WorldWideScience

Sample records for haas enn realo

  1. The ENN project. ENN exploitation plan.

    Science.gov (United States)

    Dekena, R; Rehm-Berbenni, C; Seyfried, K

    2000-01-01

    The objective of the ENN-European Neurologic Network project is to improve knowledge and treatment of sleep disorders, headache and epilepsy. The means to obtain this objective shall be certain software to be distributed to the appropriate users in the medical field and the collection of relevant cases, in order to set up a neurological database. It is intended that the distribution of the above mentioned software and access to the database, will be able to finance research projects in the neurological field. The outcome of the EU funded project have been six prototypes, which need further work in order to establish a system of compatible and linked products. A particular emphasis of this work should be put on making the products as process oriented as possible. At the time being there are already products available in the market, which would be competing with particular ENN prototypes, but there is no set of compatible and linked products, which would be comparable with the intended set of ENN neurological tools. Such set of tools therefore could be a unique selling proposition. Intellectual property rights and legal implications have to be taken into consideration for the marketing of the ENN products. It has to be made sure, that no third party can assert violation of its IPRs and that, a protection of the products can be attained by appropriate application for IPRs. In the legal field in particular the prescriptions of data protection legislation have to be observed e.g. by obtaining the written consent of patients, whose cases are reported. The marketing concept should be set up as a short-term, middle-term, long-term strategy. The short-term strategy should concentrate on carrying out a market validation study at European level and simultaneously the development from prototype to products. The middle-term strategy should be directed towards the market introduction of the ENN products in Europe. The long-term strategy should comprise marketing of the products

  2. Enn Kunila: kunst on Eestile hea visiitkaart / Enn Kunila ; intervjueerinud Ants Juske

    Index Scriptorium Estoniae

    Kunila, Enn, 1950-

    2010-01-01

    Ärimees ja kunstimetseen Enn Kunila tegevusvaldkondadest ja kunstikogu põhjal avatavast näitusest. Näitus "Kölerist Subbini. 150 aastat Eesti klassikalist maalikunsti Enn Kunila kogust" Tallinna Kunstihoones 24. veebruarist 1. aprillini. Kureerinud Harry Liivrand, kujundanud Olev Subbi

  3. The Zygosaccharomyces bailii transcription factor Haa1 is required for acetic acid and copper stress responses suggesting subfunctionalization of the ancestral bifunctional protein Haa1/Cup2.

    Science.gov (United States)

    Palma, Margarida; Dias, Paulo Jorge; Roque, Filipa de Canaveira; Luzia, Laura; Guerreiro, Joana Fernandes; Sá-Correia, Isabel

    2017-01-13

    The food spoilage yeast species Zygosaccharomyces bailii exhibits an extraordinary capacity to tolerate weak acids, in particular acetic acid. In Saccharomyces cerevisiae, the transcription factor Haa1 (ScHaa1) is considered the main player in genomic expression reprogramming in response to acetic acid stress, but the role of its homologue in Z. bailii (ZbHaa1) is unknown. In this study it is demonstrated that ZbHaa1 is a ScHaa1 functional homologue by rescuing the acetic acid susceptibility phenotype of S. cerevisiae haa1Δ. The disruption of ZbHAA1 in Z. bailii IST302 and the expression of an extra ZbHAA1 copy confirmed ZbHAA1 as a determinant of acetic acid tolerance. ZbHaa1 was found to be required for acetic acid stress-induced transcriptional activation of Z. bailii genes homologous to ScHaa1-target genes. An evolutionary analysis of the Haa1 homologues identified in 28 Saccharomycetaceae species genome sequences, including Z bailii, was carried out using phylogenetic and gene neighbourhood approaches. Consistent with previous studies, this analysis revealed a group containing pre-whole genome duplication species Haa1/Cup2 single orthologues, including ZbHaa1, and two groups containing either Haa1 or Cup2 orthologues from post-whole genome duplication species. S. cerevisiae Cup2 (alias Ace1) is a transcription factor involved in response and tolerance to copper stress. Taken together, these observations led us to hypothesize and demonstrate that ZbHaa1 is also involved in copper-induced transcriptional regulation and copper tolerance. The transcription factor ZbHaa1 is required for adaptive response and tolerance to both acetic acid and copper stresses. The subfunctionalization of the single ancestral Haa1/Cup2 orthologue that originated Haa1 and Cup2 paralogues after whole genome duplication is proposed.

  4. Kunstiarmastusest sündinud kollektsioon / Enn Kunila

    Index Scriptorium Estoniae

    Kunila, Enn, 1950-

    2010-01-01

    Vestlus kunstikollektsionääri Enn Kunilaga maalikunsti kogumisest. Tallinna Kunstihoones aasta alguses üles pandud näitusest "Kölerist Subbini. 150 aastat eesti klassikalist maalikunsti Enn Kunila kogust"

  5. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2008-01-01

    Eesti Kunstimuuseumi Kunstisõprade Seltsi eestvõttel tähistati 4. novembril 2008 Kumule Euroopa aasta muuseumi tiitli andmist. Ühel juuresolevatest fotodest president Toomas Hendrik Ilves koos Kumu kunstimuuseumi direktrissi Sirje Helme ja Eesti Kunstimuuseumi Kunstisõprade Seltsi juhatuse esimehe Enn Kunilaga

  6. Enn Tarvel 75 : psühhograafiline skits / Jaan Undusk

    Index Scriptorium Estoniae

    Undusk, Jaan, 1958-

    2007-01-01

    Enn Tarvelist kui Läti Henriku kroonika väljaandjast. Arvutikasutuse algusest eesti agraarajaloo uurimisel 1990ndatel aastatel. Tarveli "Adramaa" erilisusest. Enn Tarvel koostööst Juhan Kahkiga. Tarvelist kui Eesti lähiajaloo uurimise korraldajast

  7. Väitlus : vastuseks eelolevale / Enn Küng, Kari Tarkiainen, Ülle Tarkiainen

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2015-01-01

    Väitlus Enn Küngi ning Kari ja Ülle Tarkiaineni vahel, mille aluseks on 2015. a. Akadeemia 8. numbris ilmunud Enn Küngi arvustis Tarkiainenite raamatule "Provinsen bortom havet. Estlands svenska historia 1561-1710" (Lk. 1491-1499)

  8. Factors affecting THMs, HAAs and HNMs formation of Jin Lan Reservoir water exposed to chlorine and monochloramine.

    Science.gov (United States)

    Hong, Huachang; Xiong, Yujing; Ruan, Mengyong; Liao, Fanglei; Lin, Hongjun; Liang, Yan

    2013-02-01

    The formations of THMs, HAAs, and HNMs from chlorination and chloramination of water from Jinlan Reservoir were investigated in this study. Results showed that monochloramine rather than chlorine generally resulted in lower concentration of DBPs, and the DBPs formation varied greatly as the treatment conditions changed. Specifically, the yields of THMs, HAAs and HNMs all increased with the high bromide level and high disinfectant dose both during chlorination and chloramination. The longer reaction time had a positive effect on the formation of THMs, HAAs and HNMs during chlorination and HNMs during chloramination. However, no time effect was observed on the formation of THMs and HAAs during chloramination. An increase in pH enhanced the levels of THMs and HNMs upon chlorination but reduced levels of HNMs upon chloramination. As for the THMs in chloramination and HAAs in chlorination and chloramination, no obvious pH effect was observed. The elevated temperature significantly increased the yields of THMs during chlorination and HNMs during chloramination, but has no effect on THMs and HAAs yields during chloramination. In the same temperature range, the formation of HAAs and HNMs in chlorination showed a first increasing and then a decreasing trend. In chloramination study, addition of nitrite markedly increased the formation of HNMs but had little impact on the formation of THMs and HAAs. While in chlorination study, the presence of high nitrite levels significantly reduced the yields of THMs, HAAs and HNMs. Range analysis revealed that the bromide and disinfectant levels were the major factors affecting THMs, HAAs and HNMs formation, in both chlorination and chloramination. Finally, comparisons of the speciation of mono-halogenated, di-halogenated, tri-halogenated HAAs and HNMs between chlorination and monochloramination were also conducted, and factors influencing the speciation pattern were identified. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Vulgarismid nii ja naa / Enn Sarv

    Index Scriptorium Estoniae

    Sarv, Enn, 1921-2008

    1998-01-01

    Meenutus Aleksander Solženitsõni "Üks päev Ivan Denissovitši elus" tõlkimisest (eesti keeles 1963, tõlkijad Lennart Meri ja Enn Sarv). Peeter Sauteri poolt kirjutatud tekstist Raul Meele näituse 'Aborigeenide elu' jaoks (vt. Looming nr. 3)

  10. De Haas-Van Alphen affect and helicons in metals

    International Nuclear Information System (INIS)

    Vol'skij, E.P.

    1975-01-01

    Specific features of helicon electrodynamics associated with the de Haas-van Alphen effect are considered for an uncompensated metal with the closed Fermi surface of arbitrary shape. The consideration is carried out entirely in the local limit, when the metal may be characterized by a static tensor for the magnetic resistance and by a static tensor for the differential magnetic permeability which describes the anisotropy of the de Haas-van Alphen effect. The amplitude of the effect is assumed to be of an arbitrary value, but in the limits determined by the thermodynamical stability of a uniformly magnetized state. It has been shown that in the general case the de Haas-van Alphen effect may strongly influence not only the phase velocity, but also the damping and polarization of a helicon. A significant effect of nondiagonal components of the differential magnetic permeability tensor that sometimes arise even at very small deviations of the magnetic field from the symmetric direction, is noted. The resonance excitation of waves in a plate is considered. The question of a possible relation between periodic diamagnetic structures in metals and helicons is discussed

  11. Catalysis of copper corrosion products on chlorine decay and HAA formation in simulated distribution systems.

    Science.gov (United States)

    Zhang, Hong; Andrews, Susan A

    2012-05-15

    This study investigated the effect of copper corrosion products, including Cu(II), Cu(2)O, CuO and Cu(2)(OH)(2)CO(3), on chlorine degradation, HAA formation, and HAA speciation under controlled experimental conditions. Chlorine decay and HAA formation were significantly enhanced in the presence of copper with the extent of copper catalysis being affected by the solution pH and the concentration of copper corrosion products. Accelerated chlorine decay and increased HAA formation were observed at pH 8.6 in the presence of 1.0 mg/L Cu(II) compared with that observed at pH 6.6 and pH 7.6. Further investigation of chlorine decay in the presence of both Suwannee River NOM and Cu(II) indicated that an increased reactivity of NOM with dissolved and/or solid surface-associated Cu(II), rather than chlorine auto-decomposition, was a primary reason for the observed rapid chlorine decay. Copper corrosion solids [Cu(2)O, CuO, Cu(2)(OH)(2)CO(3)] exhibited catalytic effects on both chlorine decay and HAA formation. Contrary to the results observed when in the absence of copper corrosion products, DCAA formation was consistently predominant over other HAA species in the presence of copper corrosion products, especially at neutral and high pH. This study improves the understanding for water utilities and households regarding chlorine residuals and HAA concentrations in distribution systems, in particular once the water reaches domestic plumbing where copper is widely used. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Comparison of the effect of Haas and Hyrax rapid palatal expanders on nasal cavity dimensions

    Directory of Open Access Journals (Sweden)

    Amini F.

    2009-11-01

    Full Text Available "nBackground and Aim: In treatment of posterior crossbite awareness of the effects of Haas and Hyrax rapid maxillary expanders (RME on nasal cavity will help the clinician to select the better appliance. This study was carried out to compare the effects of Haas and Hyrax expanders on the nasal cavity of patients treated for posterior crossbite. "nMaterials and Methods: A clinical trial study was designed on posteroanterior (PA cephalograms of 30 subjects to evaluate the nasal cavity width of 14 subjects (8 female & 6 male with mean chronological age of 12± 2years who received RME with Hyrax type and 16 subjects (9 female & 7 male with mean chronological age of 11±1.6 years who received Haas type palatal expander. Paired t-test was used to analyze the outcomes of expansion in each group. Student t-test was used to compare Haas and Hyrax groups. "nResults: The mean value of screw expansion was 9±2 mm in both groups. In Hyrax group nasal cavity width"n(Nc-cN increased from 29.2 ±1.94 mm to 31.7 ±1.93mm (p= 0.001 and In Haas group it was increased from 27.75± 2.21 mm to 29.35 ± 2.26 mm(p= 0.043. When two groups were compared to each other, statistically this increase was more significant in Hyrax than in the Haas group (p=0.038. "nConclusion: In this study RME affected geometry of the nasal cavity by increasing the nasal cavity width. However In our sample, Hyrax appliance demonstrated better performance over the Haas appliance in all variables.

  13. Karakteriga kodu / Karen Jagodin ; kommenteerinud Enn Rajasaar

    Index Scriptorium Estoniae

    Jagodin, Karen, 1982-

    2009-01-01

    2008. aastal valminud 2-korruseline eramu Mähel. Arhitekt Enn Rajasaar. Sisearhitekt Aet Seire. Välisviimistluses on kombineeritud tumedat tellist ja heledat krohvi. Sisekujundust läbivad värvid punane ja must. Osa mööbliesemeid (raamatukapid, söögitoa laud) valmisid sisearhitekti erilahendusena

  14. La crise européenne. Un regard de géographe

    Directory of Open Access Journals (Sweden)

    Yann Richard

    2012-04-01

    Full Text Available L’Union européenne est durement affectée par la crise des dettes souveraines. Cette crise peut être interprétée comme la conséquence de plusieurs faits importants : une absence de leadership européen, des inégalités fortes parfois anciennes entre les performances macroéconomiques des pays membres, des faiblesses structurelles déjà observables avant la crise dans certains pays. Mais le principal facteur de fragilité de l’Union européenne réside dans sa division interne. Tant que la problématique de l’intégration européenne ne sera pas appropriée par les citoyens européens eux-mêmes et tant que certaines politiques ne seront pas davantage coordonnées, l’Union restera sur le fil du rasoir. Cette crise met en lumière l’essoufflement d’un certain modèle d’intégration. Dans cet article, on explore ces problématiques avec un regard géographique.

  15. Effects of operating conditions on THMs and HAAs formation during wastewater chlorination

    Energy Technology Data Exchange (ETDEWEB)

    Sun Yingxue; Wu Qianyuan [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Hu Hongying, E-mail: hyhu@tsinghua.edu.cn [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Tian Jie [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China)

    2009-09-15

    Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.

  16. Effects of operating conditions on THMs and HAAs formation during wastewater chlorination

    International Nuclear Information System (INIS)

    Sun Yingxue; Wu Qianyuan; Hu Hongying; Tian Jie

    2009-01-01

    Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.

  17. Quantitative assessment of S. mutans and C. albicans in patients with Haas and Hyrax expanders

    Directory of Open Access Journals (Sweden)

    Matheus Melo Pithon

    2012-06-01

    Full Text Available OBJECTIVE: To assess and compare the number of Streptococcus mutans and Candida albicans colonies in patients with Haas and Hyrax appliances before and after insertion. METHODS: The sample consisted of 84 patients requiring orthodontic treatment. For all patients a midpalatal suture expansion was indicated. Patients were randomly divided into Group HA, who used the Haas appliance (n = 42 and Group HY, who used the Hyrax appliance (n = 42. Initially and thirty days after appliance insertion all patients were submitted to saliva collections. The saliva was diluted followed by seeding in Mitis Salivarius and CHROMagar media, for growth of S. mutans and C. albicans respectively. RESULTS: Results showed statistically significant difference between groups HA and HY for Streptococcus mutans and Candida albicans (p <0.05. Haas appliance promoted greater S. mutans and C. albicans proliferation when compared to Hyrax appliance. CONCLUSION: The Haas appliance favored greater proliferation of S. mutans and C. albicans when compared with the Hyrax appliance. Insertion of the appliances resulted in greater buildup of microorganisms.

  18. Läbimurre: Enn Kunila saadab oma maalikogu Soome näitusele / Andres Eilart ; kommenteerinud Harry Liivrand

    Index Scriptorium Estoniae

    Eilart, Andres

    2010-01-01

    Helsingi Taidehallis avatakse oktoobri keskel ülevaatenäitus "Viron värit - 150 vuatta virolaista maalaustaidetta Enn Kunilan kokoelmasta" ("Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kollektsioonist"). Näituse kuraator Harry Liivrand, kujundaja Olev Subbi. Mitmekeelse kunstialbumi koostajaks on kunstiteadlane Eero Epner

  19. Mis on Eesti hariduse eesmärk? / Enn Vatter

    Index Scriptorium Estoniae

    Vatter, Enn

    2003-01-01

    Autori arvates ei suudeta valimiseelsetes vaidlustes kokku leppida eelistusis hariduselus. Autor küsib, mis kooli- ja haridustemaatikas peaeesmärk ning mis on alameesmärgid, mis enne peaeesmärgi saavutamist on vaja kätte saada

  20. Casein Kinase I Isoform Hrr25 Is a Negative Regulator of Haa1 in the Weak Acid Stress Response Pathway in Saccharomyces cerevisiae.

    Science.gov (United States)

    Collins, Morgan E; Black, Joshua J; Liu, Zhengchang

    2017-07-01

    Haa1 is a transcription factor that adapts Saccharomyces cerevisiae cells to weak organic acid stresses by activating the expression of various genes. Many of these genes encode membrane proteins, such as TPO2 and YRO2 How Haa1 is activated by weak acids is not clear. Here, we show that casein kinase I isoform Hrr25 is an important negative regulator of Haa1. Haa1 is known to be multiply phosphorylated. We found that mutations in HRR25 lead to reduced Haa1 phosphorylation and increased expression of Haa1 target genes and that Hrr25 interacts with Haa1. The other three casein kinase I isoforms, Yck1, Yck2, and Yck3, do not seem to play critical roles in Haa1 regulation. Hrr25 has a 200-residue C-terminal region, including a proline- and glutamine-rich domain. Our data suggest that the C-terminal region of Hrr25 is required for normal inhibition of expression of Haa1 target genes TPO2 and YRO2 and is important for cell growth but is not required for cell morphogenesis. We propose that Hrr25 is an important regulator of cellular adaptation to weak acid stress by inhibiting Haa1 through phosphorylation. IMPORTANCE Our study has revealed the casein kinase I protein Hrr25 to be a negative regulator of Haa1, a transcription factor mediating the cellular response to stresses caused by weak acids. Many studies have focused on the target genes of Haa1 and their roles in weak acid stress responses, but little has been reported on the regulatory mechanism of Haa1. Weak acids, such as acetic acid, have long been used for food preservation by slowing down the growth of fungal species, including S. cerevisiae In the biofuel industry, acetic acid in the lignocellulosic hydrolysates limits the production of ethanol, which is undesirable. By understanding how Haa1 is regulated, we can make advances in the field of food sciences to better preserve food and engineer acetic acid-resistant strains that will increase productivity in the biofuel industry. Copyright © 2017 American

  1. Galvano-magnetic properties and Shubnikov de Haas effect of Te-whiskers

    International Nuclear Information System (INIS)

    Berezovets, Veacheslav; Bondarchuk, Nikolai; Nikolaeva, Albina; Nijankovskii, Victor

    2009-01-01

    The work is devoted to investigation of the peculiarities of magnetoresistance, Hall effect and Shubnikov de Haas oscillations in Te-whiskers. Te-whiskers was prepared from vapor-gas phase on the substrate pure tellurium and grown naturally, of the walls of a crucible in the course of growing Te single crystals by the Czochralski method . The measurements of the galvanomagnetic properties and Shubnikov de Haas oscillation correspond to the notion of the occurrence of the effect of intraband magnetic breakdown when two different quasi-classical cyclotron trajectories coexist simultaneously in a magnetic field. This effect is a consequence of the presence of the saddle point in the dispersion law of the tellurium valence band. (authors)

  2. La possibilité d'un encadrement juridique des lanceurs d'alerte par l'Union européenne

    OpenAIRE

    Racho, Tania

    2016-01-01

    Plusieurs raisons peuvent justifier la nécessité d’une réglementation pour protéger les lanceurs d'alerte au niveau de l'Union européenne. Les alertes médiatisées concernent des dysfonctionnements aux dimensions européennes voire internationales comme par exemple avec les affaires révélées par Snowden ou le Luxleaks. La pertinence d'une action de l'Union européenne est évidente et permettrait alors d'accorder une protection minimale identique sur le territoire des 28 États membres. Néanmoins,...

  3. Lakewoodi Eesti Majas New Jersey osariigis... / Enn Lillemets

    Index Scriptorium Estoniae

    Lillemets, Enn

    2004-01-01

    9. X tuletati meelde eesti graafikut ja maalijat Eduard Rüga (1903-1997), kelle loomingust oli välja pandud näitus Ameerika erakogudest. Õhtust võtsid osa E. Rüga abikaasa Leida Rüga, tütred Silja Melts ja Kersti Raimondo. Enn Lillemetsa ettekandest. Vaadati Andres Söödi telefilmi "Eduard Rüga" (1993)

  4. La Nuit européenne des chercheurs / European Researchers' Night

    CERN Multimedia

    CERN. Geneva

    2016-01-01

    Cliquez ici pour voir l'événement webcast (Ceci n'est pas un événement officiel financé par la Commission européenne.) Le CERN organise pour la 7ème année consécutive La Nuit européenne des chercheurs et propose de découvrir la science sous un autre angle. Cet événement ouvre au grand public des centaines de lieux de science à travers l'Europe. Le CERN propose les activités suivantes au public local : Au premier étage du Globe (entrée devant le Globe), projections de documentaires scientifiques primés et de court-métrages en VO sous-titrés en français. Voir programme du Globe. Visites guidées d...

  5. Chemie Linz AG Enns - Austria

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1978-11-01

    Full Text Available This factory building in Enns has been erected as an enlargement of the Linz facilities that had become too small. It contains an acrylonitrile processing plant and the whole range of accessory installations required for its operation, both from the technical side, such as equipment, etc., and from the personnel facilities side. Outstanding in this project is the elaborate infrastructure, such as the terracing and filling of 40 Ha of land to evercome the risks from the cyclic sweiling of the Danube, or the water supply, treatment and distribution systems for the various installations. Worth mentioning are also the planning for future expansion, which in successive enlargements and additions will cover 160 Ha and employ up to 5,000-6,000 people.

    Este edificio fabril se ha levantado en Enns con objeto de ampliar las ya pequeñas instalaciones de Linz. Consta de una planta para la producción de acrilnitrilo y de toda una serie de instalaciones secundarias necesarias para su funcionamiento, tanto de orden técnico —equipos, medios, etc. — como relativos al personal. En su realización destacan las complejas obras de infraestructura, tales como el terraplenado de las 40 Ha de terreno, a fin de evitar los peligros de las periódicas crecidas del Danubio, o el sistema de toma, depuración y distribución de agua para abastecimiento de las distintas instalaciones. Asimismo, cabe mencionar las previsiones hechas de cara al futuro, con sucesivas ampliaciones que llegarán a ocupar 160 Ha, y emplearán a 5.000 ó 6.000 personas.

  6. Normes comptables européennes du secteur public (EPSAS)

    DEFF Research Database (Denmark)

    Andernack, Isabelle; Pontoppidan, Caroline Aggestam

    2014-01-01

    Les EPSAS, adaptation des IFRS pour le secteur public, devraient fournir à terme des informations plus fiables et transparentes sur la situation et la performance financière des États de l’Union européenne - notamment sur leur niveau d’endettement et leurs engagements - sur la soutenabilité des...

  7. 75 FR 22627 - Chrysler LLC, St. Louis North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc...

    Science.gov (United States)

    2010-04-29

    ... North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services, Inc., Corrigan Company and Murphy Company, Fenton, MO... workers from HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services...

  8. Le syndicalisme, acteur de la démocratisation de l'Union Européenne?

    OpenAIRE

    Erne, Roland

    2002-01-01

    Les syndicats pourraient être des agents de la démocratisation de l'Union européenne pour deux raisons : primo, le syndicalisme a souvent joué un rôle substantiel dans les processus de démocratisation nationale. Secundo, les syndicats ont été parmi les premières organisations citoyennes à être impliquées dans le processus d'intégration européenne. Cependant, ces considérations ne signifient pas nécessairement qu'ils joueront un rôle important dans la démocratisation de l'UE....

  9. Improved ethanol production from xylose in the presence of acetic acid by the overexpression of the HAA1 gene in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sakihama, Yuri; Hasunuma, Tomohisa; Kondo, Akihiko

    2015-03-01

    The hydrolysis of lignocellulosic biomass liberates sugars, primarily glucose and xylose, which are subsequently converted to ethanol by microbial fermentation. The rapid and efficient fermentation of xylose by recombinant Saccharomyces cerevisiae strains is limited by weak acids generated during biomass pretreatment processes. In particular, acetic acid negatively affects cell growth, xylose fermentation rate, and ethanol production. The ability of S. cerevisiae to efficiently utilize xylose in the presence of acetic acid is an essential requirement for the cost-effective production of ethanol from lignocellulosic hydrolysates. Here, an acetic acid-responsive transcriptional activator, HAA1, was overexpressed in a recombinant xylose-fermenting S. cerevisiae strain to yield BY4741X/HAA1. This strain exhibited improved cell growth and ethanol production from xylose under aerobic and oxygen limited conditions, respectively, in the presence of acetic acid. The HAA1p regulon enhanced transcript levels in BY4741X/HAA1. The disruption of PHO13, a p-nitrophenylphosphatase gene, in BY4741X/HAA1 led to further improvement in both yeast growth and the ability to ferment xylose, indicating that HAA1 overexpression and PHO13 deletion act by different mechanisms to enhance ethanol production. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. US Baltic Foundation award winners from Estonia are Arvo Pärt and Enn Kunila

    Index Scriptorium Estoniae

    2010-01-01

    Washingtonis toimunud tänavusel U.S Baltic Foundationi auhinnagalal tunnustati kahte eestlast: helilooja Arvo Pärti auhinnaga Baltimaade kuvandi rikastamise eest (Baltic Image Enhancement Award) ja ettevõtjast kunstikollektsionääri Enn Kunilat Baltimaade filantroopiaauhinnaga

  11. ÉTUDE COMPARATIVE DANS LE SECTEUR DE L’AGRICULTURE DE L’UNION EUROPÉENNE

    Directory of Open Access Journals (Sweden)

    Constantin CIUTACU

    2008-12-01

    Full Text Available Le secteur agricole est un pilier central de la construction européenne et il occupe, des lors, une place prépondérante dans les politiques européennes. L’agriculture doit faire face a des défis importants, résultant de l’internationalisation et de la mondialisation des politiques et marchés agricoles. La cohésion sociale et économique tout comme la compétitivité économique donnent une nouvelle dimension européenne aux politiques agricoles communes et il y a lieu de les considérer en rapport avec les politiques en matiere de développement rural ainsi qu’avec les nécessités de développement durable. Un large éventail de problemes affecte actuellement le secteur, par exemple la surpopulation et le dépeuplement agricole, le vieillissement démographique, le niveau et la sécurité des revenus, l’ESB et la fievre aphteuse, les organismes génétiquement modifiés, la biodiversité, le changement climatique, la protection de l’environnement, l’opposition entre agriculture organique et agriculture productive, le bien-etre des animaux, l’érosion du sol et la gestion de l’eau. Les actuels problemes structurels ont des conséquences considérables, particulierement dans les nouveaux et les futurs États membres de l’UE.

  12. ENN-ICS - quality assurance and online evaluation of a multilingual learning management system for sleep medicine

    Directory of Open Access Journals (Sweden)

    Knobl, Brigitte

    2006-11-01

    Full Text Available With the development and implementation of a multilingual interactive communication system the e-health project ENN-ICS, funded by the European Union, aims at the improvement of health care in Europe. The field of application is sleep physiology and sleep medicine. ENN-ICS Centre offers direct access to medical information for multiple users, i.e. health authorities, health care professionals, patients and citizen. Using XML technologies the new web based network integrates advanced e-learning and e-publishing methods for the training of healthcare professionals. Editorial and distributive processes are supported by customized central editorial, content management and learning management systems (CMS, LMS. ENN-ICS e-health services are evaluated by selected user groups in North, Middle and Southern Europe using reliable and scientifically accepted validation instruments. The compliance with essential quality requirements and criteria is tested and verified by using adapted online questionnaires based on the DISCERN questionnaire for evaluating patient information, on the HON principles for evaluating health-related websites and on the GMDS catalogue of quality criteria for electronic publications in medicine. The system architecture and its exemplary applications can be used as a model for future e-health services dealing with neurological and other medical topics.

  13. The measurement of the amplitude of de Haas-van Alphen oscillations in indium

    International Nuclear Information System (INIS)

    Wilde, J. de; Meredith, D.J.

    1976-01-01

    A flux-gate magnetometer incorporating a superconducting flux transformer is described and its application to the measurement of de Haas-van Alphen oscillation amplitude is compared with conventional techniques. Measurements on the third zone Fermi surface of indium in magnetic fields of up to 4 T are given to show the advantages of the method. (author)

  14. Study on the TOC concentration in raw water and HAAs in Tehran's water treatment plant outlet.

    Science.gov (United States)

    Ghoochani, Mahboobeh; Rastkari, Noushin; Nabizadeh Nodehi, Ramin; Mahvi, Amir Hossein; Nasseri, Simin; Nazmara, Shahrokh

    2013-11-12

    A sampling has been undertaken to investigate the variation of haloacetic acids formation and nature organic matter through 81 samples were collected from three water treatment plant and three major rivers of Tehran Iran. Changes in the total organic matter (TOC), ultraviolet absorbance (UV254), specific ultraviolet absorbance (SUVA) were measured in raw water samples. Haloacetic acids concentrations were monitored using a new static headspace GC-ECD method without a manual pre-concentration in three water treatment plants. The average concentration of TOC and HAAs in three rivers and three water treatment plants in spring, summer and fall, were 4, 2.41 and 4.03 mg/L and 48.75, 43.79 and 51.07 μg/L respectively. Seasonal variation indicated that HAAs levels were much higher in spring and fall.

  15. HAA1 and PRS3 overexpression boosts yeast tolerance towards acetic acid improving xylose or glucose consumption: unravelling the underlying mechanisms.

    Science.gov (United States)

    Cunha, Joana T; Costa, Carlos E; Ferraz, Luís; Romaní, Aloia; Johansson, Björn; Sá-Correia, Isabel; Domingues, Lucília

    2018-04-02

    Acetic acid tolerance and xylose consumption are desirable traits for yeast strains used in industrial biotechnological processes. In this work, overexpression of a weak acid stress transcriptional activator encoded by the gene HAA1 and a phosphoribosyl pyrophosphate synthetase encoded by PRS3 in a recombinant industrial Saccharomyces cerevisiae strain containing a xylose metabolic pathway was evaluated in the presence of acetic acid in xylose- or glucose-containing media. HAA1 or PRS3 overexpression resulted in superior yeast growth and higher sugar consumption capacities in the presence of 4 g/L acetic acid, and a positive synergistic effect resulted from the simultaneous overexpression of both genes. Overexpressing these genes also improved yeast adaptation to a non-detoxified hardwood hydrolysate with a high acetic acid content. Furthermore, the overexpression of HAA1 and/or PRS3 was found to increase the robustness of yeast cell wall when challenged with acetic acid stress, suggesting the involvement of the modulation of the cell wall integrity pathway. This study clearly shows HAA1 and/or, for the first time, PRS3 overexpression to play an important role in the improvement of industrial yeast tolerance towards acetic acid. The results expand the molecular toolbox and add to the current understanding of the mechanisms involved in higher acetic acid tolerance, paving the way for the further development of more efficient industrial processes.

  16. La culture musicale caribéenne de New York - 14

    OpenAIRE

    Audebert , Cédric

    2012-01-01

    Le bassin caribéen est un espace de production musicale foisonnante (reggae, salsa, konpa, meringue, zouk, calypso, etc.) au rayonnement international. Les musiques puisent leur énergie principalement dans l'héritage de la plantation et des quartiers populaires urbains des îles d'origine, mais aussi dans le cosmopolitisme des métropoles d'immigration. La mondialisation des musiques caribéennes s'appuie sur les puissants réseaux nord-américains de production et de diffusion, dont les communaut...

  17. Electrons in a Magnetic Field: Special Spin in de Haas-van Alphen effect

    International Nuclear Information System (INIS)

    Shrivastava, Keshav N

    2012-01-01

    When the magnetic field is applied in a metal, the electrons behave like a harmonic oscillator. When the field is increased these harmonic oscillator type levels cross the Fermi energy at a particular point resulting into the discontinuities in the population of any particular level at that point. For a large orbital magnetic moment, different from L = 0 and both signs of spin in the total magnetic momentum quantum number, j = l ± s, the discontinuities in the population of the electrons in a particular level become double valued resulting into doubling of oscillations in the magnetization. There is a double valued change in the energy of the electrons when they transfer from the harmonic oscillator type level to the Fermi level. The magnetization depends on the value of j = l ± s so that there is a double valued period in the oscillations. The de Haas-van Alphen effect is usually described for the L = 0 electrons. Hence, we see that the de Haas-van Alphen effect is considerably modified in going from L = 0 to j = l ± s, with both signs in the spin.

  18. Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris

    International Nuclear Information System (INIS)

    Ge, Fei; Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin

    2011-01-01

    The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L -1 iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L -1 manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH) 3(am) or MnO 2(am) coat the algal cells , which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).

  19. Transverse effect of Haas and Hyrax appliances on the upper dental arch in patients with unilateral complete cleft lip and palate: A comparative study

    Science.gov (United States)

    Façanha, Anna Júlia de Oliveira; Lara, Tulio Silva; Garib, Daniela Gamba; da Silva Filho, Omar Gabriel

    2014-01-01

    Objective The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months); and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months). Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho AnalyzerTM 3D software. Results The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders. PMID:24945513

  20. Transverse effect of Haas and Hyrax appliances on the upper dental arch in patients with unilateral complete cleft lip and palate: A comparative study

    Directory of Open Access Journals (Sweden)

    Anna Júlia de Oliveira Façanha

    2014-04-01

    Full Text Available Objective: The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods: The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months; and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months. Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho Analyzer(tm 3D software. Results: The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion: Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders.

  1. Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Ge, Fei, E-mail: gefei@xtu.edu.cn [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China); Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China)

    2011-05-15

    The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L{sup -1} iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L{sup -1} manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH){sub 3(am)} or MnO{sub 2(am)} coat the algal cells{sub ,} which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).

  2. Raimond Valgre noorem vend - kes ta oli? : Kuno-Enn Valgre (30.05.1918-02.03.1987) / Valdur Ohmann

    Index Scriptorium Estoniae

    Ohmann, Valdur, 1958-

    2011-01-01

    Vastukäivad andmed ärgitasid uurima, kes õigupoolest oli Valgre noorem vend. Kõige ehedamalt annab Enn Valgre sõjaaegse käekäigu edasi ülekuulamisprotokoll 11. novembrist 1944. Ülekuulamisprotokolli tekst

  3. Vocabulaire du budget des Communautés européennes

    CERN Document Server

    European Communities. Luxembourg

    1992-01-01

    Sujet: Etude terminologique et phraséologique du vocabulaire du règlement financier et d'autres textes relatifs au budget des Communautés européennes. Langues: Français, anglais, allemand, italien, néerlandais, danois, espagnol, portuguais, grec. Présentation: Corpus d'un millier d'entrées en neuf langues, présentées dans l'ordre d'apparition des termes et phrases dans les textes dépouillés, avec indication des sources. Des définitions ou notes précisent certaines notions. Neuf index alphabétiques donnent accès au corpus.

  4. Mis põhjustab/soodustab vägivalda koolis? / Valter Parve, Mikko Lagerspetz, Erki Korp, Enn Toom, Kristiine Vahtramäe

    Index Scriptorium Estoniae

    2008-01-01

    Küsimusele vastavad TÜ Pärnu Kolledži lektor Valter Parve, TLÜ sotsioloogiaprofessor Mikko Lagerspetz, Tallinna laste turvakeskuse juhataja Erki Korp, usaldustelefoni projektijuht Enn Toom ja lastevanemate liidu koolitusjuht Kristiine Vahtramäe

  5. La Turquie et l’Union européenne

    Directory of Open Access Journals (Sweden)

    Benoît Montabone

    2008-03-01

    Full Text Available L’article explore les évolutions possibles des relations entre la Turquie et l’Union européenne à l’horizon 2020. Il présente quatre scénarios géopolitiques : l’ancrage européen (scénario normatif, l’intégration à risque (scénario tendanciel, la diversification des partenaires (scénario alternatif et le renversement stratégique (scénario catastrophe. Dans tous les cas, l’accès aux hydrocarbures du Caucase et de la mer Caspienne joue une place centrale.This article investigates the various possible evolutions of the relations between Turkey and the European Union on the horizon 2020. Four resulting geopolitical scenarios are introduced: European anchoring (the normative scenario, Integration at risk (the trend line scenario, Diversification of partners (the alternate scenario, and at last Strategic overthrow (the nightmare one. In every case, the access to the hydrocarbons of Caucasus and Caspian Sea plays a key role.

  6. Kjøring med mistanke om påvirkning av andre rusmidler enn alkohol

    Directory of Open Access Journals (Sweden)

    Asbjørg S. Christophersen

    2009-10-01

    Full Text Available  SAMMENDRAGStatens rettstoksikologiske institutt har i løpet av de siste år registrert en stor økning av prøver fra bilføreremistenkt for kjøring under påvirkning av andre rusmidler enn alkohol. Antall positive saker økte 42% fra1994 til 1995. De hyppigste påviste stoffer er tetrahydrocannabinol, amfetamin, benzodiazepiner og opiater(morfin/kodein. Bruk av tyngre narkotiske stoffer har blitt mer vanlig i trafikksammenheng og antall positivetilfeller har økt betydelig mer enn totalt antall saker. Fra 1994 til 1995 økte antall positive amfetaminprøvermed 75% (fra 533 til 937 og antall positive prøver som følge av heroininntak økte med 87% (fra 92 til 172.Bruk av flere stoffer samtidig er vanlig, over 60 % av sakene i 1995 var positive på mer enn ett stoff, alkoholikke medregnet. De fleste tilfeller var representert av menn i alderen 25-32 år (37%. Kvinner var representerti ca. 11% av sakene.Christophersen AS, Skurtveit S, Mørland J. Drivers suspected to drive under the influence of drugs otherthan alcohol. Nor J Epidemiol 1996; 6 (1: 45-48.ENGLISH SUMMARYThe National Institute of Forensic Toxicology has registered a large increase in the number of samples fromdrivers suspected to drive under influence of drugs other than alcohol. The number of drug positive casesincreased 42% from 1994 to 1995. The most frequent drugs detected are tetrahydrocannabinol, amphetamine,benzodiazepines and opiates (morphine/codeine. The frequency of hard narcotic drug use has increased morethan the total number of cases. From 1994 to 1995, the number of amphetamine positive samples increased75% (from 533 to 937 and the number of samples positive due to heroin use (detection of the metabolite 6-monoacetylmorphine in urine increased 87%. Multi-drug use is common and more than one drug wasdetected in more than 60% of the cases from 1995, alcohol not included. Most of the cases were representedby men 25-32 years old (37%. Women were represented in about

  7. Editorial: Alimentation méditerranéenne et santé [Mediterranean diet and health

    Directory of Open Access Journals (Sweden)

    Malika BOUCHENAK

    2016-06-01

    Full Text Available Ce numéro de Nutrition & Santé est un retour sur le 2 Congrès International de la Société Algérienne de Nutrition qui s'est tenu du 13 au 15 octobre 2015, à Alger, et dont la thématique principale portait sur l'Alimentation méditerranéenne et la santé. L'alimentation méditerranéenne représente un véritable trésor culturel et culinaire, prônant la consommation de certains aliments, comme les fruits, les légumes, les légumineuses, les grains entiers, les noix, le poisson. De plus, l'un de ses piliers repose sur la consommation de l'huile d'olive, dont les avantages sont nombreux. A cet effet, l'OMS et la FAO ont reconnu le régime méditerranéen comme un modèle d'alimentation de qualité, sain et durable. Par ailleurs, les régimes méditerranéens traditionnels sont nutritionnellement appropriés, avec des teneurs variées en graisses totales, faibles en acides gras saturés et très faibles en acides gras Trans, et riches en fibres et en vitamines et flavonoïdes antioxydants.

  8. Pavel Haas Study Day a IMR Study Day: Inter-War Avant-Garde across National and Disciplinary Borders, 30. a 31. ledna 2016, Cardiff University School of Music, Cardiff, Velká Británie

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Markéta; Zapletal, Miloš

    2016-01-01

    Roč. 53, č. 1 (2016), s. 101-102 ISSN 0018-7003. [Pavel Haas Study Day. Cardiff, 30.01.2016] R&D Projects: GA ČR(CZ) GP14-35842P Institutional support: RVO:68378076 Keywords : Pavel Haas * conference * music * inter-war * avantgarde Subject RIV: AL - Art, Architecture, Cultural Heritage

  9. Kas tasemetööd täidavad oma eesmärki? / Marge Lepik, Kristi Mere, Merike Haas...[jt.

    Index Scriptorium Estoniae

    2009-01-01

    Küsimusele vastavad Lääne-Viru maavalitsuse haridusosakonna juhataja Marge Lepik, Haridus- ja Teadusministeeriumi välishindamisosakonna peaekspert Kristi Mere, Viira kooli klassiõpetaja Merike Haas, Rääma põhikooli direktor Elmo Joa ja Tallinna Ülikooli Haapsalu kolledži õppejõud Sirje Piht

  10. De Haas-van Alphen effect of a two-dimensional ultracold atomic gas

    Science.gov (United States)

    Farias, B.; Furtado, C.

    2016-01-01

    In this paper, we show how the ultracold atom analogue of the two-dimensional de Haas-van Alphen effect in electronic condensed matter systems can be induced by optical fields in a neutral atomic system. The interaction between the suitable spatially varying laser fields and tripod-type trapped atoms generates a synthetic magnetic field which leads the particles to organize themselves in Landau levels. Initially, with the atomic gas in a regime of lowest Landau level, we display the oscillatory behaviour of the atomic energy and its derivative with respect to the effective magnetic field (B) as a function of 1/B. Furthermore, we estimate the area of the Fermi circle of the two-dimensional atomic gas.

  11. Application of ENN-1 for Fault Diagnosis of Wind Power Systems

    Directory of Open Access Journals (Sweden)

    Meng-Hui Wang

    2012-01-01

    Full Text Available Maintaining a wind turbine and ensuring secure is not easy because of long-term exposure to the environment and high installation locations. Wind turbines need fully functional condition-monitoring and fault diagnosis systems that prevent accidents and reduce maintenance costs. This paper presents a simulator design for fault diagnosis of wind power systems and further proposes some fault diagnosis technologies such as signal analysis, feature selecting, and diagnosis methods. First, this paper uses a wind power simulator to produce fault conditions and features from the monitoring sensors. Then an extension neural network type-1- (ENN-1- based method is proposed to develop the core of the fault diagnosis system. The proposed system will benefit the development of real fault diagnosis systems with testing models that demonstrate satisfactory results.

  12. ANALISA MODA DAN EFEK KEGAGALAN (FAILURE MODE AND EFFECTS ANALYSIS / FMEA PADA PRODUK KURSI LIPAT CHITOSE YAMATO HAA

    Directory of Open Access Journals (Sweden)

    Denny Nurkertamanda

    2012-02-01

    Full Text Available Chitose Indonesia Manufacturing merupakan perusahaan yang memproduksi dan menjual furniture dari logam dengan kerjasama negara Jepang. Berdasarkan data penjualan Chitose Indonesia Manufacturing pada tahun 2003, kursi lipat Chitose Yamato merupakan jenis kursi lipat yang memiliki angka penjualan sebesar 59% dari keseluruhan jenis produk yang diproduksi. Kursi lipat Chitose Yamato HAA merupakan salah satu sarana untuk duduk yang dilengkapi dengan sandaran sesuai dengan bentuk punggung manusia dan dapat dilipat untuk memudahkan penyimpanannya. Selain itu juga rangka kakinya yang berbentuk H sehingga dapat digunakan pada permukaan yang datar atau bergelombang. Material yang digunakan pada rangka kursi lipat Chitose Yamato HAA adalah berupa elemen struktur rangka yang bersifat isotropik, yakni memiliki keseragaman sifat dan bahan suatu elemen (regangan, tegangan, mekanis, dsb. Pada analisa moda kegagalan dilakukan identifikasi moda kegagalan yang potensial, keparahan yang ditimbulkan, dan frekuensi kejadian moda kegagalan. Dengan menggunakan analisa moda kegagalan, maka diharapkan kualitas produk akan meningkat dan dapat digunakan sesuai dengan fungsinya. RPN adalah indikator kekritisan untuk menentukan tindakan koreksi yang sesuai dengan moda kegagalan. RPN digunakan oleh banyak prosedur FMEA untuk menaksir resiko menggunakan tiga kriteria yaitu Keparahan efek (Severity S, Kejadian penyebab (Occurrence O, Deteksi penyebab (Detection D. Angka prioritas RPN merupakan hasil kali rating keparahan, kejadian, dan deteksi. Angka ini hanyalah menunjukkan rangking atau urutan defisiensi desain sistem. Kata kunci : Moda Kegagalan, Efek Kegagalan, Penyebab Kegagalan, Deteksi, Kejadian, Keparahan, RPN (Risk Priority Number.     Chitose Manufacturing Indonesia is a company that produce and sells furniture made from alloy in cooperation with Japan. Based on Sales data by Chitose Indonesia Manufacturing in 2003, Chitose Yamato foldable chair has a sales number

  13. La faille Nord-Pyrénéenne dans l’Ariège et la Haute-Garonne

    NARCIS (Netherlands)

    Sitter, de L.U.

    1953-01-01

    Un des plus grands phénomènes structuraux des Pyrénées est sans doute la faille Nord-Pyrénéenne qui longe la zone axiale depuis la Méditerranée jusqu'à la côte atlantique. Elle est caractérisée par plusieurs particularités exceptionelles, dont le métamorphisme des terrains jurassiques et crétacés

  14. Puente sobre el río Enns, Austria

    Directory of Open Access Journals (Sweden)

    Polensky & Zöllner, Constructora

    1965-09-01

    Full Text Available A road bridge has been recently opened over the Enns river at Steyr (Austria. The purpose is to improve traffic and avoid the bottlenecks that often took place. The bridge is supplemented by three other works of lesser importance, namely two bridges and a tunnel for pedestrians. The bridge structure supporting the decks is cellular, box type. It has three compartments, and four vertical partitions, whose thickness varies from 6 m over the intermediate piles to 2.30 m at the crown. There are three spans, of 47, 101 and 70 m length. The bridge intrados forms a smooth curve. Two overhangs extend from the central structure, and provide sidewalks for pedestrians: the deck itself having a width of 17 m. The structure was made in successive overhangs, in 3.50 m sections. Longitudinal prestressing, by means of PZ-A-100 type cables, was done by applying an initial loading of 120 t. The cables run in tubes. After the concrete had reached a suitable strength, the cables were stretched. The tubes were then filled with cement mortar, and in this operation air suction equipment was utilised to make sure that no air cavities were left.Se ha construido y puesto en servicio un puente para carretera sobre el río Enns en Steyr (Austria, con objeto de mejorar la circulación de vehículos y evitar las congestiones que se producían frecuentemente. Complementan al puente otras tres obras de menor importancia, constituidas por dos puentes y un túnel para el paso de peatones. La estructura que soporta el tablero es celular, tipo cajón, de tres células y cuatro almas y tabiques verticales, con canto variable desde 6 m sobre las pilas intermedias a 2,30 m en la clave. El puente se subdivide en tres tramos de 47, 101 y 70 m de luz, respectivamente. El intradós sigue el perfil de una curva suave. Del cuerpo de la estructura salen dos ménsulas que soportan los dos andenes para peatones, quedando el tablero con una anchura total de 17 metros. La estructura se construy

  15. Microwave radiation absorption and Shubnikov-de Haas oscillations in semimetal InAs/GaSb/AlSb composite quantum wells

    Czech Academy of Sciences Publication Activity Database

    Mikhailova, M. P.; Veinger, A.I.; Kochman, I.V.; Semenikhin, P.V.; Kalinina, K.V.; Parfeniev, R.V.; Berezovets, V.A.; Safonchik, M.O.; Hospodková, Alice; Pangrác, Jiří; Zíková, Markéta; Hulicius, Eduard

    2016-01-01

    Roč. 10, č. 4 (2016), 1-8, č. článku 046013. ISSN 1934-2608 R&D Projects: GA ČR GA13-15286S; GA MŠk LO1603 Institutional support: RVO:68378271 Keywords : Shubnikov-de Haas oscillations * microwave absorption * electron-paramagnetic resonance * composite quantum wells * InAs/GaSb/AlSb * MOVPE Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.325, year: 2016

  16. Corrosion in Haas expanders with and without use of an antimicrobial agent: an in situ study

    Science.gov (United States)

    BAGATIN, Cristhiane Ristum; ITO, Izabel Yoko; ANDRUCIOLI, Marcela Cristina Damião; NELSON-FILHO, Paulo; FERREIRA, José Tarcísio Lima

    2011-01-01

    Objectives The purpose of this study was to evaluate in situ the occurrence of corrosion in the soldering point areas between the wire, silver brazing and band in Haas expanders. Material and Methods Thirty-four 7-12-year-old patients who needed maxillary expansion with a Haas expander were randomly assigned to two groups of 17 individuals each, according to the oral hygiene protocol adopted during the orthodontic treatment: Group I (control), toothbrushing with a fluoride dentifrice and Group II (experimental), toothbrushing with the same dentifrice plus 0.12% chlorhexidine gluconate (Periogard®) mouthrinses twice a week. The appliances were removed after approximately 4 months. Fragments of the appliances containing a metallic band with a soldered wire were sectioned at random for examination by stereomicroscopy, scanning electron microscopy (SEM) and energy dispersive x-ray spectroscopy (EDS). Data were analyzed statistically by Fisher's test at 5% significance level. Results The analysis by optical microscopy revealed areas with color change suggestive of corrosion in the soldering point areas joining the band and the wire in all specimens of both groups, with no statistically significant difference between the groups (p=1). The peaks of chemical elements (Ni, Fe, Cr, O, C and P) revealed by EDS were also similar in both groups. Conclusion: Color changes and peaks of chemical elements suggestive of corrosion were observed in the soldering point areas between the wire, silver brazing and band in both control and experimental groups, which indicate that the 0.12% chlorhexidine gluconate mouthrinses did not influence the occurrence of corrosion in situ. PMID:22231004

  17. Après le Brexit, un diagnostic lucide sur l'avenir de l'Union européenne

    OpenAIRE

    Kahn, Sylvain

    2016-01-01

    Faut-il être traumatisé par le Brexit? Le cas des Britanniques est très particulier. Ils sont entrés à reculons dans l'Union européenne en 1973, et ils ont tout de suite commencé par demander des clauses d'exemption. L'UE et les Britanniques, concrètement qu'est-ce que c'est? C'est un pays qui, depuis 43 ans, ne cesse de s'opposer autant que possible à toute avancée fédérale, à davantage d'intégration, et promeut une Europe à la carte. C'est d'ailleurs le seul pays avec le Danemark qui avait ...

  18. Shubnikov-de Haas effect study of InAs after transmutation doping at low temperatures

    International Nuclear Information System (INIS)

    Gerstenberg, H.; Mueller, P.

    1990-01-01

    Degenerate InAs single crystals have been irradiated by thermal neutrons below 6 K. The Shubnikov-de Haas effect and the electrical resistivity have been measured as a function of the neutron dose and the annealing temperature. The effects of transmutation doping and simultaneous introduction of lattice defects have been analysed in terms of the conduction electron density and the scattering rates τ ρ -1 - ρne 2 /m * and τ x -1 2πkub(B)X/h/2π (where X is the Dingle temperature). The measured conduction electron density after irradiation and thermal annealing agreed well with the values calculated from the experimental and materials parameters. The effects of radiation damage may qualitatively be explained assuming neutral In vacancies to be the most common type of defect in thermal-neutron-irradiated InAs. A comparison with similar experiments on InSb is given. (author)

  19. Upper Critical Field and de Haas-van Alphen Oscillations in KOs2O6 Measured in a Hybrid Magnet

    Science.gov (United States)

    Taichi Terashima,; Nobuyuki Kurita,; Atsushi Harada,; Kota Kodama,; Jun-ichi Yamaura,; Zenji Hiroi,; Hisatomo Harima,; Shinya Uji,

    2010-08-01

    Magnetic torque measurements have been performed on a KOs2O6 single crystal in magnetic fields up to 35.3 T and at temperatures down to 0.6 K. The upper critical field is determined to be ˜30 T. De Haas-van Alphen oscillations are observed. A large mass enhancement of (1+λ) = m* / mband = 7.6 is found. It is suggested that, for the large upper critical field to be reconciled with Pauli paramagnetic limiting, the observed mass enhancement must be of electron-phonon origin, including electron-rattling-mode interactions, for the most part.

  20. Europinė semiotika šiandien | Sémiotique européenne d’aujourd’hui

    Directory of Open Access Journals (Sweden)

    Kęstutis Nastopka

    2004-01-01

    Full Text Available Dans le champ sémiotique, deux approches épistémologiques se distinguent : sémiotique européenne et sémiotique américaine. La sémiotique européenne, issue de la théorie du signe linguistique de Ferdinand de Saussure, dans les années 1960 voit se former deux écoles indépendantes : celle de Paris (de Greimas et celle de Tartou-Moscou (de Lotman.La sémiotique dite « standard » de Greimas présente une théorie du discours envisagé comme un tout de signification. En comprenant la signification comme un processus, Greimas décrit les transformations des significations d’après le modèle du discours mythique élaboré par Vladimir Propp. Le monde est traité comme discontinu et composé d’oppositions. Dans les années 1980 l’école greimassienne passe de la sémiotique de faire à celle d’état, de la discontinuité à la continuité, de l’objet au sujet, de l’énoncé à l’énonciation. Dans la sémiotique des passions au centre du programme narratif se trouve une compétence modale du sujet. Ces derniers temps, parmi les héritiers de Greimas, à côté de la sémiotique tensive qui choisit un métalangage savant et des schématisations un peu arides, apparaît une sémiotique esthésique, issue de De l’imperfection de Greimas.Le concept de systèmes modelants secondaires est devenu une sorte d’emblème de l’école de Tartou. Ce terme détermine des structures communicatives différentes, organisées d’après le modèle des signes linguistiques. A la recherche d’un métalangage scientifique, commun aux diverses disciplines humaines, on s’oriente vers la linguistique structurale et la théorie de l’information. Autour de l’année 1980, dans la sémiotique de Lotman la conception du texte commeune manifestation de la langue est changée par celle du texte qui produit sa propre langue. Le texte est considéré non plus comme un systéme autonome, synchronique mais comme un énoncé, inséparable de la m

  1. Avaliação comparativa dos efeitos maxilares da expansão rápida da maxila com os aparelhos de Haas e Hyrax Comparative evaluation of maxilar effects of rapid maxilar expansion with Haas and Hyrax appliances

    Directory of Open Access Journals (Sweden)

    Marco Antônio Scanavini

    2006-02-01

    Full Text Available OBJETIVO: avaliar cefalometricamente os efeitos da expansão rápida da sutura palatina mediana sobre o posicionamento vertical e sagital da maxila, comparando os aparelhos de Haas e Hyrax. METODOLOGIA: a amostra consistiu de 93 telerradiografias obtidas de 31 pacientes jovens, brasileiros, de ambos os gêneros, na faixa etária inicial média de 13 anos e 2 meses. As radiografias foram tomadas ao início do tratamento (pré-disjunção, imediatamente após a disjunção (pós-disjunção e ao final do nivelamento. RESULTADOS E CONCLUSÕES: constatou-se que os dois aparelhos disjuntores apresentaram resultados semelhantes, com a ocorrência de deslocamento da maxila em direção inferior, sem rotação, que se manteve ao final do nivelamento e ocorrência de um deslocamento anterior logo após a disjunção, que retornou aos valores pré-disjunção ao final do nivelamento.AIM: the purpose of this cephalometric study was to evaluate, by lateral cephalograms, the changes in maxilar positioning after rapid disjunction of the midpalatal suture, following the use of two types of maxillary disjunction appliances, checked in different phases, and the likely differences between the two appliances Haas and Hyrax. METHODS: the sample comprised of 93 lateral cephalograms, taken before treatment (pre-disjunction, immediately after disjunction and at the end of levelling, obtained from 31 brazilian youths with both genres and average age of 13 years and 2 months. RESULTS AND CONCLUSIONS: both types of appliances showed similar results, with anterior and lower displacement of maxila right after disjunction. Lower displacement was without rotation, and mainttened stable until the end of levelling. Anterior displacement, however, was not stable and cephalometric measurements like SNA and Nperp-A tended to returned to initial values at the end of levelling.

  2. Kultuur isiksuse psühholoogiat ei mõjuta / Tiit Kändler

    Index Scriptorium Estoniae

    Kändler, Tiit, 1948-

    2010-01-01

    Psühholoogia uuemate andmete kohaselt ei sõltu indiviidi seadumus kultuurist, soost, vanusest, haridusest. Eesti psühholoogide Jüri Alliku ja Ann Realo osalusel ajakirjas "Journal Personality and Social Psychology" ilmunud artiklist

  3. Kultuur isiksuse psühholoogiat ei mõjuta / Tiit Kändler

    Index Scriptorium Estoniae

    Kändler, Tiit, 1948-

    2005-01-01

    Psühholoogia uuemate andmete kohaselt ei sõltu indiviidi seadumus kultuurist, soost, vanusest, haridusest. Eesti psühholoogide Jüri Alliku ja Anu Realo osalusel ajakirjas "Journal Personality and Social Psychology" ilmunud artiklist

  4. de Haas-van Alphen effect investigations of the electronic structure of pure and aluminum-doped MgB2

    International Nuclear Information System (INIS)

    Carrington, A.; Yelland, E.A.; Fletcher, J.D.; Cooper, J.R.

    2007-01-01

    Our understanding of the superconducting properties of MgB 2 is strongly linked to our knowledge of its electronic structure. In this paper we review experimental measurements of the Fermi surface parameters of pure and Al-doped MgB 2 using the de Haas-van Alphen (dHvA) effect. In general, the measurements are in excellent agreement with the theoretical predictions of the electronic structure, including the strength of the electron-phonon coupling on each Fermi surface sheet. For the Al doped samples, we are able to measure how the band structure changes with doping. These results are in excellent agreement with calculations based on the virtual crystal approximation. We also review work on the dHvA effect in the superconducting state

  5. Topological nature of the node-arc semimetal PtSn4 probed by de Haas-van Alphen quantum oscillations

    Science.gov (United States)

    Wang, Y. J.; Liang, D. D.; Ge, M.; Yang, J.; Gong, J. X.; Luo, L.; Pi, L.; Zhu, W. K.; Zhang, C. J.; Zhang, Y. H.

    2018-04-01

    Dirac node arc semimetal state is a new topological quantum state which is proposed to exist in PtSn4 (Wu et al 2016 Dirac node arcs in PtSn4 Nat. Phys. 12 667–71). We present a systematic de Haas-van Alphen quantum oscillation study on this compound. Two intriguing oscillation branches, i.e. F 1 and F 2, are detected in the fast Fourier transformation spectra, both of which are characterized to possess tiny effective mass and ultrahigh quantum mobility. And the F 2 branch exhibits an angle-dependent nontrivial Berry phase. The features are consistent with the existence of the node arc semimetal state and shed new light on its complicated Fermi surfaces and topological nature.

  6. Milleks teatrilavale ajalugu? : Katri-Aaslav-Tepandi ja Tõnu Tepandi. "President 1939". Estonia kammersaal, esietendus 18. veebruaril 2008; Enn Vetemaa, Erki Aule ja Merle Karusoo. "Sigma Tau-S705". Eesti Draamateater, esietendus 16. märtsil 2008 /

    Index Scriptorium Estoniae

    Vseviov, David, 1949-

    2009-01-01

    Arvustus : Katri-Aaslav-Tepandi ja Tõnu Tepandi. "President 1939". Estonia kammersaal, esietendus 18. veebruaril 2008; Enn Vetemaa, Erki Aule ja Merle Karusoo. "Sigma Tau-S705". Eesti Draamateater, esietendus 16. märtsil 2008

  7. Fédérations multinationales et coordination multi-niveaux. Comparaison des mécanismes de participation régionale à la politique européenne en Allemagne et en Espagne

    Directory of Open Access Journals (Sweden)

    Emmanuelle Mathieu

    2008-06-01

    Full Text Available Comment expliquer le recours extensif au bilatéralisme dans les relations intergouvernementales (RIG au sein des États multinationaux ? En étudiant le fédéralisme multinational sous l’angle des jeux d’acteurs, cet article contribue à sa compréhension comme système d’action et enrichit l’étude des RIG par la mise en évidence de nouveaux facteurs structurants. Il montre que l’hétérogénéité caractérisant l’ensemble des entités fédérées favorise le développement de relations individualisées avec l’État fédéral. La démonstration repose sur une comparaison de l’adaptation des RIG espagnoles et allemandes à l’intégration européenne. Les négociations au Conseil de l’Union européenne exigent une position nationale claire et unique, indépendamment du nombre d’acteurs dont les compétences sont concernées dans l’ordre interne. Cette exigence oriente les acteurs nationaux vers un mécanisme multilatéral de participation des entités fédérées à la politique européenne. Alors que le recours au multilatéralisme n’a pas même été questionné en Allemagne, l’Espagne peine à l’intégrer à son système basé sur le bilatéralisme. Le recours au mode d’organisation territorial, notamment au fédéralisme asymétrique et dual, et au multinationalisme permet d’expliquer ces difficultés.

  8. La Cour européenne des droits de l’homme et la défense du mode de vie tsigane : Le choix de l’immobilisme. Observations sous Chapman c. Royaume-Uni, 18 janvier 2001

    OpenAIRE

    Ringelheim, Julie

    2001-01-01

    Cet article analyse en profondeur l'arrêt de la Cour européenne des droits de l'homme, Chapman c. Royaume-Uni du 18 janvier 2001 qui porte sur le droit des familles tsiganes à vivre en caravane selon leurs traditions.

  9. Experimental determination of Rashba and Dresselhaus parameters and g *-factor anisotropy via Shubnikov-de Haas oscillations

    Science.gov (United States)

    Herzog, F.; Hardtdegen, H.; Schäpers, Th; Grundler, D.; Wilde, M. A.

    2017-10-01

    The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin-orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI.

  10. Experimental determination of Rashba and Dresselhaus parameters and g *-factor anisotropy via Shubnikov-de Haas oscillations

    International Nuclear Information System (INIS)

    Herzog, F; Grundler, D; Wilde, M A; Hardtdegen, H; Schäpers, Th

    2017-01-01

    The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin–orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI. (paper)

  11. Zavodõ jest, biodizelja - net / Viktor Filonenko

    Index Scriptorium Estoniae

    Filonenko, Viktor, 1949-

    2008-01-01

    Eestis on viimastel aastatel loodud mitu biodiislit tootvat ettevõtet, kuid Eestis puuduva nõudluse tõttu biodiislit siin ei müüda. Vt. samas: Taimsest toorainest valmistatakse kütust Paldiskis. Kommenteerivad Kai Realo, Indrek Kaju ja Sven Mark

  12. L’indice biologique global normalisé (IBGN) : principes et évolution dans le cadre de la directive cadre européenne sur l’eau

    OpenAIRE

    Virginie Archaimbault et Bernard Dumont

    2010-01-01

    Les macro-invertébrés sont un des groupes d’organismes les plus utilisés mondialement dans de nombreuses méthodes de bio-indication en cours d’eau. Nous vous proposons à travers cet article de décrire la méthode française d’évaluation de la qualité du milieu basé sur ce groupe d’organisme (l’IBGN: indice biologique global normalisé) et son évolution dans le contexte de la directive cadre européenne sur l’eau.

  13. Une progression sans révolution dans l’appréhension européenne des persécutions religieuses

    Directory of Open Access Journals (Sweden)

    Nicolas Hervieu

    2013-06-01

    SOMMAIRE: 1. Introduction - 2. Une issue retentissante: la concrétisation d’une protection conventionnelle contre les persécutions religieuses - 3. Un raisonnement parcellaire: les apories de l’analyse européenne à l’aune de la liberté de religion - 4. Conclusion - 5. Jurisprudence liée - 6. Appendice.  ABSTRACT: By banning deporting of a coptic christian by France to Egypt, where he might suffer persecution, European court of human rights has made an important contribution to the protection of foreigners against measures involving expulsion. The European solution is important because it deals with a complex, but crucial, concept: religious persecution. Unfortunatly, the opportunity offered by this case hase not been fully exploited. Freedom of religion was at the heart of this case, but European court did’nt use it enough.

  14. Quantum oscillations without a Fermi surface. The anomalous de Haas-van Alphen effect and relation to SmB{sub 6}

    Energy Technology Data Exchange (ETDEWEB)

    Knolle, Johannes; Cooper, Nigel [T.C.M. Group, Cavendish Laboratory, J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom)

    2016-07-01

    The de Haas-van Alphen effect (dHvAE), describing oscillations of the magnetization as a function of magnetic field, is commonly assumed to be a definite sign for the presence of a Fermi surface (FS). Indeed, the effect forms the basis of a well-established experimental procedure for accurately measuring FS topology and geometry of metallic systems, with parameters commonly extracted by fitting to the Lifshitz-Kosevich (LK) theory based on Fermi liquid theory. Here we show that, in contrast to this canonical situation, there can be quantum oscillations even for band insulators of certain types. We provide simple analytic formulas describing the temperature dependence of the quantum oscillations in this setting, showing strong deviations from LK theory. We draw connections to recent experiments on the tentative topological Kondo insulator SmB{sub 6}.

  15. Lean i Norge : opplever norske bedrifter som er mer lean, større økning i kundetilfredshet enn de som er mindre lean?

    OpenAIRE

    Fagereng, Hanne Eline; Askevold, Elisabeth Cathrine

    2010-01-01

    Vi ønsker å måle i hvor stor grad norske bedrifter har implementert lean, og for å måle grad av lean har vi utviklet et rammeverk basert på lean teori. Hovedformålet med lean er å øke kundeverdi med minst mulig ressursbruk, anstrengelse, energi, utstyr, tid, plass, material og kapital (Womack, Roos and Jones 2007). Vi vil utforske om høyere grad av lean fører til mer tilfredse kunder enn de som har lavere grad av lean. Altså om hovedformålet med lean blir oppnådd hvis man implementerer lean i...

  16. Á contre-courant : les mobilités caribéennes vers l’Éthiopie

    Directory of Open Access Journals (Sweden)

    Giulia Bonacci

    2008-09-01

    Full Text Available L’article s’intéresse à la migration des Caribéens vers l’Ethiopie, et notamment celle des Rastafariens qui se définissent comme de « vrais Éthiopiens » et se disent « rapatriés » en Éthiopie. En dépit de leur nombre limité, ils n’en sont pas moins importants car ils illustrent la persistance et les transformations des imaginaires et idéologies liant les Noirs du monde à l’Éthiopie ainsi qu’un pan méconnu des mobilités caribéennes qui, se dirigeant vers l’Afrique, se découvrent complètement à contre-courant.The article deals with Caribbean migration towards Ethiopia, and especially the one of Rastafarians who define themselves as ‘true Ethiopians’ and ‘repatriates’ in Ethiopia. Despite their limited number, their experience is nonetheless important as it reveals the persistence and change in imaginaries and ideologies linking black all over the world to Ethiopia as well as unknown Caribbean mobility towards Africa, a mobility which is driven against the current.

  17. Tensile strained gray tin: Dirac semimetal for observing negative magnetoresistance with Shubnikov-de Haas oscillations

    Science.gov (United States)

    Huang, Huaqing; Liu, Feng

    2017-05-01

    The extremely stringent requirement on material quality has hindered the investigation and potential applications of exotic chiral magnetic effect in Dirac semimetals. Here, we propose that gray tin is a perfect candidate for observing the chiral anomaly effect and Shubnikov-de-Haas (SdH) oscillation at relatively low magnetic field. Based on effective k .p analysis and first-principles calculations, we discover that gray tin becomes a Dirac semimetal under tensile uniaxial strain, in contrast to a topological insulator under compressive uniaxial strain as known before. In this newly found Dirac semimetal state, two Dirac points which are tunable by tensile [001] strains lie in the kz axis and Fermi arcs appear in the (010) surface. Due to the low carrier concentration and high mobility of gray tin, a large chiral anomaly induced negative magnetoresistance and a strong SdH oscillation are anticipated in this half of the strain spectrum. Comparing to other Dirac semimetals, the proposed Dirac semimetal state in the nontoxic elemental gray tin can be more easily manipulated and accurately controlled. We envision that gray tin provides a perfect platform for strain engineering of chiral magnetic effects by sweeping through the strain spectrum from positive to negative and vice versa.

  18. Un inventaire phytosociologique des dunes à la côte méditerranéenne française entre carnon et le grau du roi (département de l’hérault)

    NARCIS (Netherlands)

    Hekking, W.H.A.

    1959-01-01

    Dans la région des dunes et des bas-fonds située à une distance de 3.6 à 5.3 kilomètres de Carnon au Grau du Roi, entre l’Etang de Mauguio et la Mer méditerranéenne et dans le département de l’Hérault on peut constater deux suites progressives des associations phytosociologiques : A) LA VÉGÉ TATION

  19. High field magnetoresistance and de Haas-van Alphen effect in antiferromagnetic PrB6 and NdB6

    International Nuclear Information System (INIS)

    Onuki, Y.; Umezawa, A.; Kwok, W.K.; Crabtree, G.W.; Nishihara, M.; Yamazaki, T.; Omi, T.; Komatsubara, T.

    1987-08-01

    The transport properties and the de Haas-van Alphen (dHvA) effect have been measured for antiferromagnetic PrB 6 and NdB 6 . The number of conduction electrons is approximately one per unit cell. The magnetoresistance shows the existence of open orbits implying a multiply connected Fermi surface. The angular dependence of the magnetoresistance is roughly similar to that of the reference material, LaB 6 . The dHvA data in PrB 6 shows both paramagnetic and antiferromagnetic Fermi surfaces. The antiferromagnetic Fermi surface arises from new magnetic Brillouin zone boundaries and antiferromagnetic gaps introduced by the magnetic order, and the paramagnetic Fermi surface from magnetic breakdown through the small antiferromagnetic gaps in high field. Hybridization between the conduction electrons and the f electrons has been observed through the cyclotron masses, which in PrB 6 are three times larger than the corresponding masses of LaB 6 . In NdB 6 only the antiferromagnetic Fermi surface, quite different from those of LaB 6 and PrB 6 , has been observed. 26 refs., 10 figs., 3 tabs

  20. Transport properties and giant Shubnikov-de Haas oscillations in the first organic conductor with metal complex anion containing selenocyanate ligand, (ET)2TlHg(SeCN)4

    International Nuclear Information System (INIS)

    Laukhin, V.N.; Audouard, A.; Rakoto, H.; Broto, J.M.; Goze, F.; Coffe, G.; Brossard, L.; Redoules, J.P.; Kartsovnik, M.V.; Kushch, N.D.; Buravov, L.I.; Khomenko, A.G.; Yagubskii, E.B.; Askenazy, S.; Pari, P.

    1995-01-01

    Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal α-(ET) 2 TlHg(SeCN) 4 have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F 0 =653±3 T and slow frequency oscillations with F s =38±5 T have been revealed. (orig.)

  1. Les sépultures chasséennes du sud de la France

    Directory of Open Access Journals (Sweden)

    Alain BEYNEIX

    2009-12-01

    Full Text Available ABSTRACT: A new exam of the «royal» sepulture of Saint-Michel-clu-Touch in Toulouse (dép. Haute- Garonne and a bibliographical study about chassean sepultures in southern France permit to present social aspects of the chassean communities in this area. This study shows on the one hand, a glaring diversity about mortuary practises and rituals, on the other hand, the beginning of a social hiérarchisation. Some sepultures present an architecture or else furnitures which illustre the presence of powerful people in the populations of first farmers in the end of the 5 the millenium and in the beginning of the 4 the millenium B.C. in southern France.RÉSUMÉ: Le réexamen de la sépulture dite «royale» de Saint-Michel-du-Touch à Toulouse (Haute- Garonne suivi d'une étude bibliographique des sépultures chasséennes du sud de la France permettent de relever quelques aspects sociaux des communautés du Néolithique moyen de cette région. Outre de flagrantes diversités de pratiques et de rites funéraires, l'étude de ces sépultures dénote tin début de hiérarchisation sociale. Certaines tombes par leur architecture ou par la qualité de leur mobilier apparaissent comme la preuve tangible d'un phénomène d'émergence du pouvoir au sein des populations de premiers agriculteurs dès la fin du Vo et du début du IV millénaire avant J.C. dans le sud de la France.

  2. Rapsist diislikütus : kallis ja tõrjutud / Heiki Raudla

    Index Scriptorium Estoniae

    Raudla, Heiki, 1975-

    2008-01-01

    Paldiski Lõunasadamas avatud Biodiesel Paldiski AS tehas loodab tulevikus täisvõimsuse juures toota 100 000 tonni biodiislikütust aastas, praegu eksporditakse kogu toodang peamiselt Lääne-Euroopasse ja Skandinaaviasse. Eesti tarbijale biodiislikütuse tootmist takistab peamiselt tooraine kõrge hind ning vähene nõudlus. Küsimusele vastavad Kai Realo ja Indrek Kaju

  3. Transport properties and giant Shubnikov-de Haas oscillations in the first organic conductor with metal complex anion containing selenocyanate ligand, (ET){sub 2}TlHg(SeCN){sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Laukhin, V.N. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France)]|[Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Audouard, A. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Rakoto, H. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Broto, J.M. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Goze, F. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Coffe, G. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Brossard, L. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Redoules, J.P. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Kartsovnik, M.V. [Institute of Solid State Physics, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Kushch, N.D. [Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Buravov, L.I.

    1995-05-01

    Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal {alpha}-(ET){sub 2}TlHg(SeCN){sub 4} have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F{sub 0}=653{+-}3 T and slow frequency oscillations with F{sub s}=38{+-}5 T have been revealed. (orig.).

  4. "Möödapääsmatust hädast sunnituna otsustanud ja nõustunud meid Poola Kuninglikule Majesteedile truualamlikuks teha" : Liivimaaseisuste alistumine Poola võimule 1561. aasta sügisel / Enn Tarvel

    Index Scriptorium Estoniae

    Tarvel, Enn, 1932-

    2011-01-01

    Poola-Leedu huvist ja tegevusest Liivimaa suhtes enne 1561. aastat, mil Rootsi aktiivne sekkumine Põhja-Eestis muutis otsustavamaks ka Poola-Leedu sekkumise Liivimaal. 1561. aasta sügisel pidas ordumeister Kettler poolakatega salaläbirääkimisi ja otsustas alistuda. 28. novembril 1561 andsid ordumeister, Riia peapiiskop, orduaadli ning Võnnu ja Volmari linna esindajad truudusvande Sigismund II Augustile. Tegelik Poola aeg algas Eestis 1582 ja kestis 1625. aastani. Dokument: Poola kuninga Sigismund Augusti ja ordumeister Gotthardi vahel sõlmitud alistumisleping. Vilniuses 28. novembril 1561("Pacta subjectionis")

  5. Allocution prononcée par M. François de Rose, Président du Conseil de l'organisation européenne pour la recherche nucléaire à l'occasion de l'inauguration du synchrotron à protons du CERN le 5 février 1960

    CERN Multimedia

    CERN Press Office. Geneva

    1960-01-01

    Allocution prononcée par M. François de Rose, Président du Conseil de l'organisation européenne pour la recherche nucléaire à l'occasion de l'inauguration du synchrotron à protons du CERN le 5 février 1960

  6. Shubnikov - de Haas oscillations, weak antilocalization effect and large linear magnetoresistance in the putative topological superconductor LuPdBi

    Science.gov (United States)

    Pavlosiuk, Orest; Kaczorowski, Dariusz; Wiśniewski, Piotr

    2015-01-01

    We present electronic transport and magnetic properties of single crystals of semimetallic half-Heusler phase LuPdBi, having theoretically predicted band inversion requisite for nontrivial topological properties. The compound exhibits superconductivity below a critical temperature Tc = 1.8 K, with a zero-temperature upper critical field Bc2 ≈ 2.3 T. Although superconducting state is clearly reflected in the electrical resistivity and magnetic susceptibility data, no corresponding anomaly can be seen in the specific heat. Temperature dependence of the electrical resistivity suggests existence of two parallel conduction channels: metallic and semiconducting, with the latter making negligible contribution at low temperatures. The magnetoresistance is huge and clearly shows a weak antilocalization effect in small magnetic fields. Above about 1.5 T, the magnetoresistance becomes linear and does not saturate in fields up to 9 T. The linear magnetoresistance is observed up to room temperature. Below 10 K, it is accompanied by Shubnikov-de Haas oscillations. Their analysis reveals charge carriers with effective mass of 0.06 me and a Berry phase very close to π, expected for Dirac-fermion surface states, thus corroborating topological nature of the material. PMID:25778789

  7. Split Fermi Surfaces of the Spin-Orbit-Coupled Metal Cd2Re2O7 Probed by de Haas-van Alphen Effect

    Science.gov (United States)

    Matsubayashi, Yasuhito; Sugii, Kaori; Hirose, Hishiro T.; Hirai, Daigorou; Sugiura, Shiori; Terashima, Taichi; Uji, Shinya; Hiroi, Zenji

    2018-05-01

    The superconducting pyrochlore oxide Cd2Re2O7 shows a structural transition with inversion symmetry breaking (ISB) at Ts1 = 200 K. A recent theory [https://doi.org/10.1103/PhysRevLett.115.026401" xlink:type="simple">L. Fu, Phys. Rev. Lett. 115, 026401 (2015)] suggests that the origin is an electronic instability that leads to a multipolar order in the spin-orbit-coupled metal. To observe the Fermi surface of the low-temperature phase of Cd2Re2O7, we perform de Haas-van Alphen effect measurements by means of magnetic torque. In reference to a calculated band structure, the spin-split Fermi surfaces with large cyclotron masses of 5-9m0 are revealed. The splitting is suggested to be due to an antisymmetric spin-orbit coupling induced by ISB, the strength of which is estimated to be approximately 67 K, which is rather smaller than those of typical non-centrosymmetric metals.

  8. Mass Enhancement of Nearly Trivalent Compound EuCo2Si2: Studied by the de Haas-van Alphen Experiments and Energy Band Calculations

    International Nuclear Information System (INIS)

    Ōnuki, Yoshichika; Hedo, Masato; Nakama, Takao; Nakamura, Ai; Aoki, Dai; Boukahil, Mounir; Haga, Yoshinori; Takeuchi, Tetsuya; Harima, Hisatomo

    2015-01-01

    We succeeded in growing single crystals of EuCo 2 Si 2 by the Bridgman method, and carried out the de Haas-van Alphen (dHvA) experiments. EuCo 2 Si 2 was previously studied from a viewpoint of the trivalent electronic state on the basis of the magnetic susceptibility and X-ray absorption experiments, whereas most of the other Eu compounds order magnetically, with the divalent electronic state. The detected dHvA branches in the present experiments are found to be explained by the results of the full potential linearized augmented plane wave energy band calculations on the basis of a local density approximation (LDA) for YCo 2 Si 2 (LDA) and EuCo 2 Si 2 (LDA + U), revealing the trivalent electronic state. The detected cyclotron effective masses are moderately large, ranging from 1.2 to 2.9 m 0

  9. Título do sítio electrónico: Fédération Européenne des Associations Nacionales Travaillant avec les Sans-Abri e European Observatory on Homelessness

    Directory of Open Access Journals (Sweden)

    João Aldeia

    2012-10-01

    Full Text Available Optou-se por apresentar conjuntamente as duas páginas pela sua estreita articulação temática e institucional. Criada em 1989, a FEANTSA – Fédération Européenne des Associations Nacionales Travaillant avec les Sans-Abri – é uma organização não-governamental (ONG dedicada a eliminar a pobreza e exclusão social de indivíduos sem-abrigo ou em risco de conhecer esta situação, que congrega mais de 100 ONGs locais e nacionais de vários Estados-membros da União Europeia, sendo financiada pela Comiss...

  10. Different effects of the two types of spatial pre-cueing: what precisely is "attention" in Di Lollo's and Enns' substitution masking theory?

    Science.gov (United States)

    Luiga, I; Bachmann, T

    2007-11-01

    Enns and Di Lollo [Psychological Science, 8 (2), 135-139, 1997] have introduced the object substitution theory of visual masking. Object substitution masking occurs when focusing attention on the target is delayed. However, Posner (Quarterly Journal of Experimental Psychology, 32, 3-25, 1980) has already shown that attention can be directed to a target at least in two ways: intentionally (endogenously) and automatically (exogenously). We conducted two experiments to explore the effects of endogenous and exogenous cues on substitution masking. The results showed that when attention was shifted to the target location automatically (using a local peripheral pre-cue), masking was attenuated. A decrease in target identification dependent on a delay of mask offset, typical to substitution masking, was not observed. However, strong substitution masking occurred when the target location was not pre-cued or when attention was directed to the target location intentionally (using a symbolic pre-cue displayed centrally). The hypothesis of two different mechanisms of attentional control in substitution masking was confirmed.

  11. The European City in the Age of Globalisation La ville européenne à l'ère de la globalisation

    Directory of Open Access Journals (Sweden)

    Robert Musil

    2012-12-01

    Full Text Available This conceptual paper identifies a gap between two meaningful fields of research in urban geography : the first, old-established and reinforced by the European integration process, asks for recent and future trends, primarily on intra-urban development of cities on the European scale. The second focuses on inter-urban relations on a global scale, inspired by global city theories established since early 1990s. As a consequence of this research gap, a research agenda has been formulated with the aim to deliver the missing links between these two fields. Therein, three methodological improvements are put forward : first, more research has to be done to prove the widely accepted thesis of an existing link between global integration and internal urban structure. Second, the role of specific national politics for the production of a global city has to be examined – such as the type of welfare-regime or the impact of historical political structures. Finally, global city research should seriously consider the territorial arrangements that impinge upon the development of global cities on a national and a European scale.Cet article conceptuel identifie un écart entre deux grands domaines de recherche en géographie urbaine : le premier, établi de longue date et renforcé par le processus d'intégration européen, se concentre principalement sur les tendances récentes ou à venir en matière de développement intra-urbain à l'échelle européenne. Le second pose la question des relations inter-urbaines à l'échelle globale, née des théories sur la Ville Globale échafaudées depuis le début des années 1990. Au vu de cette lacune, un programme de recherche a été mis en place afin de fournir les chaînons manquants entre ces deux domaines. A cet égard, trois améliorations méthodologiques sont proposées : la première est la nécessité d'accroître le volume des recherches pour prouver la thèse largement admise d'un lien entre int

  12. Mycotoxin production by Fusarium avenaceum strains isolated from Norwegian grain and the cytotoxicity of rice culture extracts to porcine kidney epithelial cells.

    Science.gov (United States)

    Morrison, Ellen; Kosiak, Barbara; Ritieni, Alberto; Aastveit, Are H; Uhlig, Silvio; Bernhoft, Aksel

    2002-05-08

    The secondary metabolites of 24 isolates of Fusarium avenaceum from Norwegian cereals and grown on rice have been characterized. Moniliformin (MON), enniatins (ENNs), and beauvericin (BEA) were analyzed by high-performance liquid chromatography. Porcine kidney epithelial cells (PK15, American Type Culture Collection) were used to study the cytotoxicity of MON in the extracts. The following metabolites were produced by all isolates, ranked by concentration in rice cultures: ENN-B, MON, ENN-B1, and ENN-A. BEA was produced by eight isolates. The productions of BEA and ENN-A were significantly correlated, as was the case with ENN-B and ENN-B1. MON production was correlated neither to any of the other toxins nor to toxicity.

  13. Enniatin A1, enniatin B1 and beauvericin on HepG2: Evaluation of toxic effects.

    Science.gov (United States)

    Juan-García, Ana; Ruiz, María-José; Font, Guillermina; Manyes, Lara

    2015-10-01

    Hepatotoxicity of three Fusarium mycotoxins, beauvericin (BEA) and two enniatins (ENNs) ENN A1 and ENN B1, in hepatocarcinoma cells (HepG2) were evaluated and compared. Concentrations used were 1.5 and 3 μM at 24, 48 and 72 h for each mycotoxin. Flow cytometry was used to examine enniatins effects on cell proliferation, to characterize the cell cycle phase where the cells blocked and to study the mitochondria role in ENNs-induced apoptosis. ENN B1 treated cells showed a time dependent G1 blockade at both concentrations used. ENN A1 and BEA decreased the apoptotic-necrotic percentage of cells comparing to control and disrupted the MMP as observed by TMRM and ToPro-3 fluorochromes signal. It is proposed a decreasing mycotoxin order by number of effects as follows: BEA > ENN B1 > ENN A1, with 47, 20 and 16%, respectively out of all situations compared. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Chronic Dietary Intake of Enniatin B in Broiler Chickens Has Low Impact on Intestinal Morphometry and Hepatic Histology, and Shows Limited Transfer to Liver Tissue

    Directory of Open Access Journals (Sweden)

    Sophie Fraeyman

    2018-01-01

    Full Text Available The Fusarium mycotoxin enniatin B (ENN B is a so-called emerging mycotoxin frequently contaminating poultry feed. To investigate the impact of chronic ENN B exposure on animal health, broiler chickens were fed either a diet naturally contaminated with ENN B (2352 µg/kg or a control diet (135 µg/kg for 2, 7, 14, or 21 days. ENN B concentrations were determined in plasma and liver using a validated ultra-high performance liquid chromatography—tandem mass spectrometry UHPLC-MS/MS method. Liver was evaluated histologically, and the villus length and crypt depth of the duodenum, jejunum, and ileum were measured. Histopathology of the livers did not reveal major abnormalities. Feeding an ENN B-contaminated diet could possibly inhibit the proliferation of enterocytes in the duodenal crypts, but did not affect villus length, crypt depth, or villus length-crypt depth ratio of the jejunum and ileum. ENN B levels in plasma and liver were significantly higher in the ENN B-fed group and ranged between <25–264 pg/mL and <0.05–0.85 ng/g, respectively. ENN B carry-over rates from feed to liver tissue were 0.005–0.014% and 0.034–0.109% in the ENN B and control group, respectively. Carry-over rates were low and indicated a limited contribution of poultry tissue-derived products to the total dietary ENN B intake for humans. The above results support the opinion of the European Food Safety Authority stating that adverse health effects from ENN B in broiler chickens are unlikely.

  15. Transport properties of Cu-doped bismuth selenide single crystals at high magnetic fields up to 60 Tesla: Shubnikov-de Haas oscillations and π-Berry phase

    Science.gov (United States)

    Romanova, Taisiia A.; Knyazev, Dmitry A.; Wang, Zhaosheng; Sadakov, Andrey V.; Prudkoglyad, Valery A.

    2018-05-01

    We report Shubnikov-de Haas (SdH) and Hall oscillations in Cu-doped high quality bismuth selenide single crystals. To increase the accuracy of Berry phase determination by means of the of the SdH oscillations phase analysis we present a study of n-type samples with bulk carrier density n ∼1019 -1020cm-3 at high magnetic field up to 60 Tesla. In particular, Landau level fan diagram starting from the value of the Landau index N = 4 was plotted. Thus, from our data we found π-Berry phase that directly indicates the Dirac nature of the carriers in three-dimensional topological insulator (3D TI) based on Cu-doped bismuth selenide. We argued that in our samples the magnetotransport is determined by a general group of carriers that exhibit quasi-two-dimensional (2D) behaviour and are characterized by topological π-Berry phase. Along with the main contribution to the conductivity the presence of a small group of bulk carriers was registered. For 3D-pocket Berry phase was identified as zero, which is a characteristic of trivial metallic states.

  16. Hygiène des denrées alimentaires d'origine animale - Synthèse I : Développement actuel du concept de l'hygiène en agro-alimentaire et des exigences des normes européennes.

    OpenAIRE

    Vindevogel, Henri; Daube, Georges; Korsak Koulagenko, Nicolas; Hans, J. C.; Denys, J.; Ghafir, Y.

    1996-01-01

    Cette synthèse fait partie d’une série de trois articles qui présentent une mise au point des concepts et normes actuels au niveau européen en industrie agro-alimentaire : - Synthèse I : « Développement actuel du concept de l’hygiène en agro-alimentaire et des exigences des normes européennes » ; - Synthèse II : « Vers une assurance qualité intégrée de la chaîne agro-alimentaire » ; - Synthèse III : « Le vétérinaire et la qualité microbiologique des denrées alimentaires d’origine ani...

  17. Multigap superconductivity and Shubnikov-de Haas oscillations in single crystals of the layered boride OsB2

    Science.gov (United States)

    Singh, Yogesh; Martin, C.; Bud'Ko, S. L.; Ellern, A.; Prozorov, R.; Johnston, D. C.

    2010-10-01

    Single crystals of superconducting OsB2 [Tc=2.10(5)K] have been grown using a Cu-B eutectic flux. We confirm that OsB2 crystallizes in the reported orthorhombic structure (space group Pmmn ) at room temperature. Both the normal and superconducting state properties of the crystals are studied using various techniques. Heat capacity versus temperature C(T) measurements yield the normal state electronic specific heat coefficient γ=1.95(1)mJ/molK2 and the Debye temperature ΘD=539(2)K . The measured frequencies of Shubnikov-de Haas oscillations are in good agreement with those predicted by band structure calculations. Magnetic susceptibility χ(T,H) , electrical resistivity ρ(T) , and C(T,H) measurements ( H is the magnetic field) demonstrate that OsB2 is a bulk low- κ [κ(Tc)=2(1)] type-II superconductor that is intermediate between the clean and dirty limits [(ξ(T=0)/ℓ=0.97)] with a small upper critical magnetic field Hc2(T=0)=186(4)Oe . The penetration depth is λ(T=0)=0.300μm . An anomalous (not single-gap BCS) T dependence of λ was fitted by a two-gap model with Δ1(T=0)/kBTc=1.9 and Δ2(T=0)/kBTc=1.25 , respectively. The discontinuity in the heat capacity at Tc , ΔC/γTc=1.32 , is smaller than the weak-coupling BCS value of 1.43, consistent with the two-gap nature of the superconductivity in OsB2 . An anomalous increase in ΔC at Tc of unknown origin is found in finite H ; e.g., ΔC/γTc≈2.5 for H≈25Oe .

  18. Improved Extension Neural Network and Its Applications

    Directory of Open Access Journals (Sweden)

    Yu Zhou

    2014-01-01

    Full Text Available Extension neural network (ENN is a new neural network that is a combination of extension theory and artificial neural network (ANN. The learning algorithm of ENN is based on supervised learning algorithm. One of important issues in the field of classification and recognition of ENN is how to achieve the best possible classifier with a small number of labeled training data. Training data selection is an effective approach to solve this issue. In this work, in order to improve the supervised learning performance and expand the engineering application range of ENN, we use a novel data selection method based on shadowed sets to refine the training data set of ENN. Firstly, we use clustering algorithm to label the data and induce shadowed sets. Then, in the framework of shadowed sets, the samples located around each cluster centers (core data and the borders between clusters (boundary data are selected as training data. Lastly, we use selected data to train ENN. Compared with traditional ENN, the proposed improved ENN (IENN has a better performance. Moreover, IENN is independent of the supervised learning algorithms and initial labeled data. Experimental results verify the effectiveness and applicability of our proposed work.

  19. Involvement of enniatins-induced cytotoxicity in human HepG2 cells.

    Science.gov (United States)

    Juan-García, Ana; Manyes, Lara; Ruiz, María-José; Font, Guillermina

    2013-04-12

    Enniatins (ENNs) are mycotoxins found in Fusarium fungi and they appear in nature as mixtures of cyclic depsipeptides. The ability to form ionophores in the cell membrane is related to their cytotoxicity. Changes in ion distribution between inner and outer phases of the mitochondria affect to their metabolism, proton gradient, and chemiosmotic coupling, so a mitochondrial toxicity analysis of enniatins is highly recommended because they host the homeostasis required for cellular survival. Two ENNs, ENN A and ENN B on hepatocarcinoma cells (HepG2) at 1.5 and 3 μM and three exposure times (24, 48 and 72 h) were studied. Flow cytometry was used to examine their effects on cell proliferation, to characterize at which phase of the cell cycle progression the cells were blocked and to study the role of the mitochondrial in ENNs-induced apoptosis. In conclusion, apoptosis induction on HepG2 cells allowed to compare cytotoxic effects caused by both ENNs, A and B. It is reported the possible mechanism observed in MMP changes, cell cycle analysis and apoptosis/necrosis, identifying ENN B more toxic than ENN A. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  20. Biotransformation of the mycotoxin enniatin B1 in pigs: A comparative in vitro and in vivo approach.

    Science.gov (United States)

    Ivanova, Lada; Uhlig, Silvio; Devreese, Mathias; Croubels, Siska; Fæste, Christiane Kruse

    2017-07-01

    Enniatins (ENNs) are hexadepsipeptidic mycotoxins produced by Fusarium species. They occur in mg/kg levels in grain from Northern climate areas. Major ENNs such as ENN B and B1 have shown considerable cytotoxicity in different in vitro test systems. To adequately assess exposure and in vivo toxicity the toxicokinetic properties need to be investigated. The present study describes the metabolism of ENN B1 both in vitro and in vivo in pigs, comparing metabolites found in vitro in experiments with liver microsomes from different pig strains to those found in the plasma of pigs after single oral or intravenous application of ENN B1. Metabolites of hepatic biotransformation were tentatively identified and characterised by high performance liquid chromatography coupled to ion trap and high-resolution mass spectrometry, as well as chemical derivatisations. Kinetic parameters of metabolite formation and elimination were determined. Metabolite formation was higher when ENN B1 was absorbed from the gut compared to intravenous administration indicating pre-systemic metabolism of ENN B1 after oral uptake. The in vitro approach resulted in the detection of ten ENN B1 metabolites, while six were detected in in vivo samples. The putative ENN B1 metabolites were products of hydroxylation, carbonylation, carboxylation and oxidative demethylation reactions. Copyright © 2017. Published by Elsevier Ltd.

  1. Enniatin B-induced cell death and inflammatory responses in RAW 267.4 murine macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Gammelsrud, A. [Norwegian Veterinary Institute, P.O. Box 750, Centrum, N-0106 Oslo (Norway); Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway); Solhaug, A. [Norwegian Veterinary Institute, P.O. Box 750, Centrum, N-0106 Oslo (Norway); Dendelé, B. [EA 4427 SeRAIC, IRSET, Université de Rennes 1, IFR 140, Rennes (France); Sandberg, W.J. [Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway); Ivanova, L. [Norwegian Veterinary Institute, P.O. Box 750, Centrum, N-0106 Oslo (Norway); Kocbach Bølling, A. [Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway); Lagadic-Gossmann, D. [EA 4427 SeRAIC, IRSET, Université de Rennes 1, IFR 140, Rennes (France); Refsnes, M.; Becher, R. [Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway); Eriksen, G. [Norwegian Veterinary Institute, P.O. Box 750, Centrum, N-0106 Oslo (Norway); Holme, J.A., E-mail: jorn.holme@fhi.no [Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway)

    2012-05-15

    The mycotoxin enniatin B (EnnB) is predominantly produced by species of the Fusarium genera, and often found in grain. The cytotoxic effect of EnnB has been suggested to be related to its ability to form ionophores in cell membranes. The present study examines the effects of EnnB on cell death, differentiation, proliferation and pro-inflammatory responses in the murine monocyte–macrophage cell line RAW 264.7. Exposure to EnnB for 24 h caused an accumulation of cells in the G0/G1-phase with a corresponding decrease in cyclin D1. This cell cycle-arrest was possibly also linked to the reduced cellular ability to capture and internalize receptors as illustrated by the lipid marker ganglioside GM1. EnnB also increased the number of apoptotic, early apoptotic and necrotic cells, as well as cells with elongated spindle-like morphology. The Neutral Red assay indicated that EnnB induced lysosomal damage; supported by transmission electron microscopy (TEM) showing accumulation of lipids inside the lysosomes forming lamellar structures/myelin bodies. Enhanced levels of activated caspase-1 were observed after EnnB exposure and the caspase-1 specific inhibitor ZYVAD-FMK reduced EnnB-induced apoptosis. Moreover, EnnB increased the release of interleukin-1beta (IL-1β) in cells primed with lipopolysaccharide (LPS), and this response was reduced by both ZYVAD-FMK and the cathepsin B inhibitor CA-074Me. In conclusion, EnnB was found to induce cell cycle arrest, cell death and inflammation. Caspase-1 appeared to be involved in the apoptosis and release of IL-1β and possibly activation of the inflammasome through lysosomal damage and leakage of cathepsin B. -- Highlights: ► The mycotoxin EnnB induced cell cycle arrest, cell death and inflammation. ► The G0/G1-arrest was linked to a reduced ability to internalize receptors. ► EnnB caused lysosomal damage, leakage of cathepsin B and caspase-1 cleavage. ► Caspase-1 was partly involved in both apoptosis and release of IL-1

  2. Enniatin B-induced cell death and inflammatory responses in RAW 267.4 murine macrophages

    International Nuclear Information System (INIS)

    Gammelsrud, A.; Solhaug, A.; Dendelé, B.; Sandberg, W.J.; Ivanova, L.; Kocbach Bølling, A.; Lagadic-Gossmann, D.; Refsnes, M.; Becher, R.; Eriksen, G.; Holme, J.A.

    2012-01-01

    The mycotoxin enniatin B (EnnB) is predominantly produced by species of the Fusarium genera, and often found in grain. The cytotoxic effect of EnnB has been suggested to be related to its ability to form ionophores in cell membranes. The present study examines the effects of EnnB on cell death, differentiation, proliferation and pro-inflammatory responses in the murine monocyte–macrophage cell line RAW 264.7. Exposure to EnnB for 24 h caused an accumulation of cells in the G0/G1-phase with a corresponding decrease in cyclin D1. This cell cycle-arrest was possibly also linked to the reduced cellular ability to capture and internalize receptors as illustrated by the lipid marker ganglioside GM1. EnnB also increased the number of apoptotic, early apoptotic and necrotic cells, as well as cells with elongated spindle-like morphology. The Neutral Red assay indicated that EnnB induced lysosomal damage; supported by transmission electron microscopy (TEM) showing accumulation of lipids inside the lysosomes forming lamellar structures/myelin bodies. Enhanced levels of activated caspase-1 were observed after EnnB exposure and the caspase-1 specific inhibitor ZYVAD-FMK reduced EnnB-induced apoptosis. Moreover, EnnB increased the release of interleukin-1beta (IL-1β) in cells primed with lipopolysaccharide (LPS), and this response was reduced by both ZYVAD-FMK and the cathepsin B inhibitor CA-074Me. In conclusion, EnnB was found to induce cell cycle arrest, cell death and inflammation. Caspase-1 appeared to be involved in the apoptosis and release of IL-1β and possibly activation of the inflammasome through lysosomal damage and leakage of cathepsin B. -- Highlights: ► The mycotoxin EnnB induced cell cycle arrest, cell death and inflammation. ► The G0/G1-arrest was linked to a reduced ability to internalize receptors. ► EnnB caused lysosomal damage, leakage of cathepsin B and caspase-1 cleavage. ► Caspase-1 was partly involved in both apoptosis and release of IL-1

  3. SUB’HAA

    Directory of Open Access Journals (Sweden)

    Harisnal Hadi

    2017-08-01

    Full Text Available The preparation of the artwork entitled "Subhaa", is inspired by the Minangkabau cultural phenomenon. This work focuses on the feelings of children who will be circumcised, the pressure and fear felt by the child who will be circumcised tilled in the form of Polymetrik art works. Circumcision or commonly called Basunaik by Minangkabau society is a Sunna that must be run boys of Islam; indirectly circumcision is also required for boys in Minangkabau. In the area of darek (mainland khitan has its own ceremony, begins with a child who will be circumcised is brought to the bako house to change his clothes, then paraded around the village, after arriving at home circumcised will be held. In the evening there will be entertainment in the form of randai and bagurau saluang. This piece of music is in the form of a new composition. The performance focuses more on the composition of sound as a contextual meaning to be conveyed to the appreciator. This work is a little contrary to the aesthetics that have been awakened in the brain and soul of the arts in the Sendratasik Department of FBS Universitas Negeri Padang. But it cannot be denied that a new works will create its own aesthetic realm. Keywords: Basunaik, Artwork Music. Abstrak Penyusunan karya seni yang berjudul “Subhaa”, ini terinspirasi dari fenomena budaya Minangkabau. Karya ini menitik beratkan garapan pada perasaan anak yang akan dikhitan, tekanan dan ketakutan yang dirasakan oleh anak yang akan dikhitan digarap dalam bentuk penggarapan Polymetrik. Khitan atau biasa disebut Basunaik oleh masyarakat Minangkabau merupakan sunah yang harus dijalankan anak laki-laki Islam, secara tidak langsung khitan juga diwajibkan bagi anak laki-laki di Minangkabau. Di daerah darek (daratan khitan memiliki upacara tersendiri, diawali dengan anak yang akan dikhitan dibawa ke rumah bako untuk mengganti baju, lalu diarak keliling kampung, setelah sampai di rumah baru diadakan khitan, malamnya diadakan hiburan berupa randai dan bagurau saluang. Karya musik ini berbentuk komposisi garapan baru. Penggarapan lebih menitik beratkan kepada penggarapan bunyi sebagai makna kontekstual yang akan disampaikan kepada apresiator. Karya ini memang sedikit bertolak belakang dengan estetika yang sudah terbangun dalam otak dan jiwa kalangan seni di jurusan pendidikan sendratasik FBS Universitas Negeri Padang. Namun tidak bisa dipungkiri sebuah karya garapan baru akan menciptakan ranah estetikanya sendiri. Kata Kunci: Basunaik, Karya seni Musik.

  4. Recovery from hospital-acquired anemia after acute myocardial infarction and effect on outcomes.

    Science.gov (United States)

    Salisbury, Adam C; Kosiborod, Mikhail; Amin, Amit P; Reid, Kimberly J; Alexander, Karen P; Spertus, John A; Masoudi, Frederick A

    2011-10-01

    New-onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. The patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center Translational Research Investigating Underlying disparities in acute myocardial infarction Patients' Health Status (TRIUMPH) registry, we identified 530 patients with AMI and HAA (defined as normal hemoglobin at admission with the development of anemia by discharge) who had a repeat, protocol-driven hemoglobin measurement at 1 month after discharge. The 1-month measures were used to define persistent (persistent anemia) and transient (anemia resolved) HAA. The patients' health status was assessed at 1, 6, and 12 months after AMI using the Short-Form 12 Physical Component Summary, and the health status of patients with persistent and transient HAA was compared using multivariate repeated measures regression analysis. Mortality was compared using the log-rank test and proportional hazards regression analysis. Overall, 165 patients (31%) developed persistent HAA. The adjusted mean Short-Form 12 Physical Component Summary scores at the follow-up visit were significantly lower in those with persistent HAA than in those with transient HAA (-2.0 points, 95% confidence interval -3.6 to -0.3; p = 0.02). During a median follow-up of 36 months, the crude mortality (13% vs 5%, p = 0.002) and multivariate-adjusted mortality (hazard ratio 2.08, 95% confidence interval 1.02 to 4.21, p = 0.04) was greater in patients with persistent HAA. In conclusion, HAA persists 1 month after discharge in nearly 1 of 3 patients and is associated with worse health status and greater mortality. Additional investigation is needed to understand whether HAA prevention, recognition, and treatment, particularly among those with persistent HAA, will improve outcomes. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Reflections on "Twenty Years of Feminist Counseling and Therapy."

    Science.gov (United States)

    Rawlings, Edna I.

    1993-01-01

    Responds to previous article by Carolyn Zerbe Enns on feminist counseling and psychotherapy. Sees Enns's article as a valuable resource and reacts to Enns's article from the perspective of a radical feminist therapist. Discusses the difficulty involved in trying to effectively integrate radical feminism with psychotherapy. (NB)

  6. Reducing and verifying haloacetic acids in treated drinking water using a biological filter system.

    Science.gov (United States)

    Lou, Jie C; Chan, Hung Y; Yang, Chih Y; Tseng, Wei B; Han, Jia Y

    2014-01-01

    This study focused on reducing the haloacetic acid (HAA) concentrations in treated drinking water. HAA has been thought to be one possible nutrient supporting heterotrophic bacteria regrowth in drinking water. In this study, experiments were conducted using a pilot-scale system to evaluate the efficiency of biological filters (BF) for reducing excess HAA concentrations in water. The BF system reduced the total HAA concentration and the concentrations of five HAA species in the water. Dichloroacetic acid (DCAA), monobromoacetic acid (MBAA) and dibromoacetic acid (DBAA) were the three main HAA5 species that were present in the treated drinking water in this investigation. Combined, these three species represent approximately 77% of the HAA5 in the finished water after BF. The verification of the empirical HAA equation for the outlet in the BF system indicated linear relationships with high correlation coefficients. The empirical equation for the HAA5 concentrations in the finished water was established by examining other nutrients (e.g., dissolved organic carbon (DOC), ultraviolet absorbance at 254 nm wavelength (UV254), and ammonia nitrogen) that can reduce pathogenic contamination. These findings may be useful for designing advanced processes for conventional water treatment plants or for managing water treatment and distribution systems for providing high-quality drinking water.

  7. Effective mass of two-dimensional electrons in InGaAsN/GaAsSb type II quantum well by Shubnikov-de Haas oscillations

    Energy Technology Data Exchange (ETDEWEB)

    Kawamata, Shuichi, E-mail: s-kawamata@riast.osakafu-u.ac.jp; Kawamura, Yuichi [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan); Research Organization for University-Community Collaborations, Osaka Prefecture University, Sakai 599-8570 (Japan); Hibino, Akira; Tanaka, Sho [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan)

    2016-10-14

    In order to develop optical devices for 2–3 μm wavelength regions, the InP-based InGaAs/GaAsSb type II multiple quantum well system has been investigated. By doping nitrogen into InGaAs layers, the system becomes effective in creating the optical devices with a longer wavelength. In this report, electrical transport properties are reported on the InGaAsN/GaAsSb type II system. The epitaxial layers with the single hetero or multiple quantum well structure on InP substrates are grown by the molecular beam epitaxy. The electrical resistance of samples with different nitrogen concentrations has been measured as a function of the magnetic field up to 9 Tesla at several temperatures between 2 and 6 K. The oscillation of the resistance due to the Shubnikov-de Haas (SdH) effect has been observed at each temperature. The effective mass is obtained from the temperature dependence of the amplitude of the SdH oscillations. The value of the effective mass increases from 0.048 for N = 0.0% to 0.062 for N = 1.2 and 1.5% as the nitrogen concentration increases. The mass enhancement occurs with corresponding to the reduction of the bandgap energy. These results are consistent with the band anticrossing model.

  8. The Third Decade of Feminist Therapy and the Personal Is Still Political.

    Science.gov (United States)

    Gilbert, Lucia Albino; Rossman, Karen M.

    1993-01-01

    Responds to earlier article by Carolyn Zerbe Enns on feminist counseling and psychotherapy. Asserts that Enns presents concise summary and overview but offers little beyond her examination of "themes of change, agreement, and disagreement." Focuses comments on two topics addressed by Enns: the importance of context and interrelationships…

  9. A Review of the Mycotoxin Enniatin B

    Directory of Open Access Journals (Sweden)

    Alessandra Prosperini

    2017-11-01

    Full Text Available Mycotoxin enniatin B (ENN B is a secondary metabolism product by Fusarium fungi. It is a well-known antibacterial, antihelmintic, antifungal, herbicidal, and insecticidal compound. It has been found as a contaminant in several food commodities, particularly in cereal grains, co-occurring also with other mycotoxins. The primary mechanism of action of ENN B is mainly due to its ionophoric characteristics, but the exact mechanism is still unclear. In the last two decades, it has been a topic of great interest since its potent mammalian cytotoxic activity was demonstrated in several mammalian cell lines. Moreover, the co-exposure in vitro with other mycotoxins enhances its toxic potential through synergic effects, depending on the concentrations tested. Despite its clear cytotoxic effect, European Food Safety Authority stated that acute exposure to ENNs, such as ENN B, does not indicate concern for human health, but a concern might be the chronic exposure. However, given the lack of relevant toxicity data, no firm conclusion could be drawn and a risk assessment was not possible. In fact, very few studies have been carried out in vivo and, in these studies, no adverse effects were observed. So, research on toxicological effects induced by ENN B is still on-going. Recently, some studies are dealing with new advances regarding ENN B. This review summarizes the information on biochemical and biological activity of ENN B, focusing on toxicological aspects and on the latest advances in research on ENN B.

  10. Note on de Haas-van Alphen diamagnetism in thin, free-electron films

    Directory of Open Access Journals (Sweden)

    J. A. Grzesik

    2012-03-01

    Full Text Available We revisit the problem of de Haas-van Alphen (dHvA diamagnetic susceptibility oscillations in a thin, free-electron film trapped in a synthetic harmonic potential well. A treatment of this phenomenon at zero temperature was announced many years ago by Childers and Pincus (designated hereafter as CP, and we traverse initially much the same ground, but from a slightly different analytic perspective. That difference hinges around our use, in calculating the Helmholtz free energy F, of an inverse Laplace transform, Bromwich-type contour integral representation for the sharp distribution cutoff at Fermi level μ. The contour integral permits closed-form summation all at once over the discrete orbital Landau energy levels transverse to the magnetic field, and the energy associated with the in-plane canonical momenta ℏ k x and ℏ k z. Following such summation/integration, pole/residue pairs appear in the plane of complex transform variable s, a fourth-order pole at origin s = 0, and an infinite ladder, both up and down, of simple poles along the imaginary axis. The residue sum from the infinite pole ladder automatically engenders a Fourier series with period one in dimensionless variable μ/ ℏ ω (with effective angular frequency ω suitably defined, series which admits closed-form summation as a cubic polynomial within any given periodicity slot. Such periodicity corresponds to Landau levels slipping sequentially beneath Fermi level μ as the ambient magnetic field H declines in strength, and is manifested by the dHvA pulsations in diamagnetic susceptibility. The coëxisting steady contribution from the pole at origin has a similar cubic structure but is opposite in sign, inducing a competition whose outcome is a net magnetization that is merely quadratic in any given periodicity slot, modulated by a slow amplitude growth. Apart from some minor notes of passing discord, these simple algebraic structures confirm most of the CP formulae, and their

  11. Cyclotron resonance and De Haas-Van Alphen effect in (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic conductor

    CERN Document Server

    Voskobojnikov, I B; Samarin, N A; Cluchanko, N E; Lyubovskaya, R N; Moshchalkov, V V

    2002-01-01

    Within 0.33-1.44 K temperature range at B <= 50 T magnetic field values one measured the De Haas-Van Alphen effect for (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic quasi-two-dimensional conductor. Analysis of quantum oscillations with regard to data on cyclotron resonance derived for 40-120 GHz frequency interval enabled to determine that a complex spectrum of quantum oscillations was formed by alpha approx 256 T and beta approx 670-610 T fundamental frequencies as well as, by combination and multiple frequencies. It is shown that nature of temperature rearrangement of oscillation spectrum may be interpreted in terms of model taking account of occurrence of magnetic phase transition at T sub c approx 0.9 K and proximity of a fundamental frequency with m* = 1.48m sub 0 efficient mass to the spin dumping condition

  12. L’indépendance d’une Autorité Régulatrice Nationale (ARN créée selon la législation européenne dans le secteur des communications électroniques – L’exemple Grec

    Directory of Open Access Journals (Sweden)

    Vassilios Theodoros Kondylis

    2017-07-01

    Full Text Available Cette étude se penche sur la question de l'indépendance dans le statut juridique d'une autorité de régulation nationale (ARN du secteur des communications électroniques. La première partie analyse le fondement juridique de l'indépendance et le contenu de ce concept en tenant compte de l'évolution récente de la jurisprudence de la Cour de justice de l’Union européenne (CJUE. La deuxième partie examine les mesures adoptées par le Législateur grec afin d'assurer l'indépendance de l’ARN, les compétences de cette dernière et les résultats de ces mesures au vu de la garantie de l'ouverture des marchés en cause à la libre concurrence.

  13. Physical activity patterns in the French 18-74-year-old population: French Nutrition and Health Survey (Etude Nationale Nutrition Santé, ENNS) 2006-2007.

    Science.gov (United States)

    Salanave, Benoit; Vernay, Michel; Szego, Emmanuelle; Malon, Aurélie; Deschamps, Valérie; Hercberg, Serge; Castetbon, Katia

    2012-11-01

    To describe detailed physical activity and sedentary behaviour in French adults across physical activity categories. The French Nutrition and Health Survey (Etude Nationale Nutrition Santé, ENNS), conducted in 2006-2007, was a national cross-sectional survey based on three-stage random sampling. The International Physical Activity Questionnaire (IPAQ) was used to classify participants into three physical activity categories. Time spent in a sitting position and time spent in front of a screen were used as markers of sedentary behaviour. France. Adults (n 2971) aged 18 to 74 years were included. Overall, 29·5 % of men and 23·6 % of women were classified into the high-IPAQ category, while 36·1 % of men and 37·5 % of women were in the low-IPAQ category. For each intensity level of physical activity (vigorous intensity, moderate intensity or walking), the number of active days per week decreased from the high- to the low-IPAQ category and daily duration of physical activity was longer in the high-IPAQ category than in the other two categories; 6 % of adults declared neither vigorous nor moderate nor walking activities. For most adults in the low-IPAQ category, an increasing number of active days per week would be sufficient to attain the moderate-IPAQ category. This should be taken into account in public health initiatives aimed at promoting physical activity.

  14. Pressure-assisted electrokinetic injection for on-line enrichment in capillary electrophoresis-mass spectrometry: a sensitive method for measurement of ten haloacetic acids in drinking water.

    Science.gov (United States)

    Zhang, Huijuan; Zhu, Jiping; Aranda-Rodriguez, Rocio; Feng, Yong-Lai

    2011-11-07

    Haloacetic acids (HAAs) are by-products of the chlorination of drinking water containing natural organic matter and bromide. A simple and sensitive method has been developed for determination of ten HAAs in drinking water. The pressure-assisted electrokinetic injection (PAEKI), an on-line enrichment technique, was employed to introduce the sample into a capillary electrophoresis (CE)-electrospray ionization-tandem mass spectrometry system (ESI-MS/MS). HAAs were monitored in selected reaction monitoring mode. With 3 min of PAEKI time, the ten major HAAs (HAA10) in drinking water were enriched up to 20,000-fold into the capillary without compromising resolution. A simple solid phase clean-up method has been developed to eliminate the influence of ionic matrices from drinking water on PAEKI. Under conditions optimized for mass spectrometry, PAEKI and capillary electrophoresis, detection limits defined as three times ratio of signal to noise have been achieved in a range of 0.013-0.12 μg L(-1) for ten HAAs in water sample. The overall recoveries for all ten HAAs in drinking water samples were between 76 and 125%. Six HAAs including monochloro- (MCAA), dichloro- (DCAA), trichloro- (TCAA), monobromo- (MBAA), bromochloro- (BCAA), and bromodichloroacetic acids (BDCAA) were found in tap water samples collected. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  15. Human Factors Interface with Systems Engineering for NASA Human Spaceflights

    Science.gov (United States)

    Wong, Douglas T.

    2009-01-01

    This paper summarizes the past and present successes of the Habitability and Human Factors Branch (HHFB) at NASA Johnson Space Center s Space Life Sciences Directorate (SLSD) in including the Human-As-A-System (HAAS) model in many NASA programs and what steps to be taken to integrate the Human-Centered Design Philosophy (HCDP) into NASA s Systems Engineering (SE) process. The HAAS model stresses systems are ultimately designed for the humans; the humans should therefore be considered as a system within the systems. Therefore, the model places strong emphasis on human factors engineering. Since 1987, the HHFB has been engaging with many major NASA programs with much success. The HHFB helped create the NASA Standard 3000 (a human factors engineering practice guide) and the Human Systems Integration Requirements document. These efforts resulted in the HAAS model being included in many NASA programs. As an example, the HAAS model has been successfully introduced into the programmatic and systems engineering structures of the International Space Station Program (ISSP). Success in the ISSP caused other NASA programs to recognize the importance of the HAAS concept. Also due to this success, the HHFB helped update NASA s Systems Engineering Handbook in December 2007 to include HAAS as a recommended practice. Nonetheless, the HAAS model has yet to become an integral part of the NASA SE process. Besides continuing in integrating HAAS into current and future NASA programs, the HHFB will investigate incorporating the Human-Centered Design Philosophy (HCDP) into the NASA SE Handbook. The HCDP goes further than the HAAS model by emphasizing a holistic and iterative human-centered systems design concept.

  16. Haloacetic acids in the aquatic environment. Part I: macrophyte toxicity

    International Nuclear Information System (INIS)

    Hanson, Mark L.; Solomon, Keith R.

    2004-01-01

    Haloacetic acids (HAAs) are contaminants of aquatic ecosystems with numerous sources, both anthropogenic and natural. The toxicity of HAAs to aquatic plants is generally uncharacterized. Laboratory tests were conducted with three macrophytes (Lemna gibba, Myriophyllum sibiricum and Myriophyllum spicatum) to assess the toxicity of five HAAs. Myriophyllum spp. has been proposed as required test species for pesticide registration in North America, but few studies have been conducted under standard test conditions. The HAAs in the present experiments were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). MCA was the most toxic to Myriophyllum spp. with EC 50 values ranging from 8 to 12.4 mg/l depending on the endpoint, followed by DCA (EC 50 range 62-722.5 mg/l), TCA (EC 50 range 49.5-1702.6 mg/l), CDFA (EC 50 range 105.3 to >10,000 mg/l) and with TFA (EC 50 range 222.1 to 10,000 mg/l) the least toxic. Generally, L. gibba was less sensitive to HAA toxicity than Myriophyllum spp., with the difference in toxicity between them approximately threefold. The range of toxicity within Myriophyllum spp. was normally less than twofold. Statistically, plant length and node number were the most sensitive endpoints as they had the lowest observed coefficients of variation, but they were not the most sensitive to HAA toxicity. Toxicological sensitivity of endpoints varied depending on the measure of effect chosen and the HAA, with morphological endpoints usually an order of magnitude more sensitive than pigments for all plant species. Overall, mass and root measures tended to be the most sensitive indicators of HAA toxicity. The data from this paper were subsequently used in an ecological risk assessment for HAAs and aquatic plants. The assessment found HAAs to be of low risk to aquatic macrophytes and the results are described in the second manuscript of this series

  17. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2007-01-01

    Turundusagentuur PNG (loovjuhiks Jüri Peetson) ühendas tänuõhtu oma klientidele ja koostööpartneritele hispaania laulja Enrique Iglesiase esinemisega 1. dets. Tallinnas Saku Suurhalli restoranis Platoo

  18. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2007-01-01

    21. veebruaril 2007 tähistas Tiigrihüppe SA Tallinnas Olümpia hotelli konverentsikeskuses konverentsiga "Kogu tõde Tiigrihüppest" Tiigrihüppe programmi 10. aastapäeva. Kohal viibis ka programmi üks algatajaid Toomas Hendrik Ilves

  19. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2009-01-01

    Eesti Posti peakontori hoovis esitleti Indrek Kaingi kujundatud rahvusmustriga tenniseid. Esimesed eksklusiivsed kaks paari MULK-kirjaga papusid kingiti president Toomas Hendrik Ilvesele ning ettevõtte Skype presidendile Josh Silvermanile

  20. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2006-01-01

    Tallinna Ülikoolis toimunud ameerika kultuurantropoloogi Clifford Geertzi mälestusõhtust, kus esinesid rektor Rein Raud, Eesti Humanitaarinstituudi dotsent Lorenzo Cañás Bottos ja kultuuriteooria lektor Marek Tamm

  1. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2008-01-01

    8. aug. Tallinnas kinos Sõprus ja klubis Juuksur tähistati 30 aasta möödumist ansambli Joy Divison sünnist ja Anton Corbijni debüütfilmi "Control" jõudmist Eesti kinodesse (näidati dokumentaalfilmi "Joy Divison")

  2. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2006-01-01

    Inglise rocklaulja Gordon Matthew Sumneri raamatu "Sting. Murtud muusika" esitlusest Tallinnas Viru Keskuse Rahva Raamatu kaupluses ja kontserdist Saku Suurhallis Broken Musicu nimelise tuuri raames 28. juulil

  3. Metabolism and Biomarkers of Heterocyclic Aromatic Amines in Molecular Epidemiology Studies: Lessons Learned from Aromatic Amines

    Science.gov (United States)

    2011-01-01

    Aromatic amines and heterocyclic aromatic amines (HAAs) are structurally related classes of carcinogens that are formed during the combustion of tobacco or during the high-temperature cooking of meats. Both classes of procarcinogens undergo metabolic activation by N-hydroxylation of the exocyclic amine group, to produce a common proposed intermediate, the arylnitrenium ion, which is the critical metabolite implicated in toxicity and DNA damage. However, the biochemistry and chemical properties of these compounds are distinct and different biomarkers of aromatic amines and HAAs have been developed for human biomonitoring studies. Hemoglobin adducts have been extensively used as biomarkers to monitor occupational and environmental exposures to a number of aromatic amines; however, HAAs do not form hemoglobin adducts at appreciable levels and other biomarkers have been sought. A number of epidemiologic studies that have investigated dietary consumption of well-done meat in relation to various tumor sites reported a positive association between cancer risk and well-done meat consumption, although some studies have shown no associations between well-done meat and cancer risk. A major limiting factor in most epidemiological studies is the uncertainty in quantitative estimates of chronic exposure to HAAs and, thus, the association of HAAs formed in cooked meat and cancer risk has been difficult to establish. There is a critical need to establish long-term biomarkers of HAAs that can be implemented in molecular epidemioIogy studies. In this review article, we highlight and contrast the biochemistry of several prototypical carcinogenic aromatic amines and HAAs to which humans are chronically exposed. The biochemical properties and the impact of polymorphisms of the major xenobiotic-metabolizing enzymes on the biological effects of these chemicals are examined. Lastly, the analytical approaches that have been successfully employed to biomonitor aromatic amines and HAAs, and

  4. Evaluation of thirteen haloacetic acids and ten trihalomethanes formation by peracetic acid and chlorine drinking water disinfection.

    Science.gov (United States)

    Xue, Runmiao; Shi, Honglan; Ma, Yinfa; Yang, John; Hua, Bin; Inniss, Enos C; Adams, Craig D; Eichholz, Todd

    2017-12-01

    Free chlorine is a commonly used disinfectant in drinking water treatment. However, disinfection by-products (DBPs) are formed during water disinfection. Haloacetic acids (HAAs) and trihalomethanes (THMs) are two major groups of DBPs. Iodo-HAAs and iodo-THMs (I-HAAs and I-THMs) are formed during the disinfection of the water containing high levels of iodide and are much more toxic than their chlorinated and brominated analogs. Peracetic acid (PAA) is a strong antimicrobial disinfectant that is expected to reduce the formation of HAAs and THMs during disinfection. In this study, the formations of thirteen HAAs and ten THMs, including the iodinated forms, have been investigated during PAA disinfection and chlorination as the comparison. The DBP formations under different iodide concentrations, pHs, and contact times were systematically investigated. Two types of commercial PAAs containing different concentrations of PAA and hydrogen peroxide (H 2 O 2 ) were studied. A solid-phase microextraction gas chromatography-mass spectrometry method was upgraded for THM analysis including I-THMs. HAAs were analyzed by following a recently developed high performance ion chromatography-tandem mass spectrometry method. Results show that the ratio of PAA and H 2 O 2 concentration significantly affect the formation of I-THMs and I-HAAs. During PAA disinfection with lower PAA than H 2 O 2 , no detectable levels of THMs and HAAs were observed. During PAA disinfection with higher PAA than H 2 O 2 , low levels of monoiodoacetic acid, diiodoacetic acid, and iodoform were formed, and these levels were enhanced with the increase of iodide concentration. No significant quantities of chloro- or bromo-THMs and HAAs were formed during PAA disinfection treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. From Bad to Worse: Anemia on Admission and Hospital-Acquired Anemia.

    Science.gov (United States)

    Koch, Colleen G; Li, Liang; Sun, Zhiyuan; Hixson, Eric D; Tang, Anne S; Phillips, Shannon C; Blackstone, Eugene H; Henderson, J Michael

    2017-12-01

    Anemia at hospitalization is often treated as an accompaniment to an underlying illness, without active investigation, despite its association with morbidity. Development of hospital-acquired anemia (HAA) has also been associated with increased risk for poor outcomes. Together, they may further heighten morbidity risk from bad to worse. The aims of this study were to (1) examine mortality, length of stay, and total charges in patients with present-on-admission (POA) anemia and (2) determine whether these are exacerbated by development of HAA. In this cohort investigation, from January 1, 2009, to August 31, 2011, a total of 44,483 patients with POA anemia were admitted to a single health system compared with a reference group of 48,640 without POA anemia or HAA. Data sources included the University HealthSystem Consortium database and electronic medical records. Risk-adjustment methods included logistic and linear regression models for mortality, length of stay, and total charges. Present-on-admission anemia was defined by administrative coding. Hospital-acquired anemia was determined by changes in hemoglobin values from the electronic medical record. Approximately one-half of the patients experienced worsening of anemia with development of HAA. Risk for death and resource use increased with increasing severity of HAA. Those who developed severe HAA had 2-fold greater odds for death; that is, mild POA anemia with development of severe HAA resulted in greater mortality (odds ratio, 2.57; 95% confidence interval, 2.08-3.18; P < 0.001), increased length of stay (2.23; 2.16-2.31; P < 0.001), and higher charges (2.09; 2.03-2.15; P < 0.001). Present-on-admission anemia is associated with increased mortality and resource use. This risk is further increased from bad to worse when patients develop HAA. Efforts to address POA anemia and HAA deserve attention.

  6. A New Approach to Eliminate High Amplitude Artifacts in EEG Signals

    Directory of Open Access Journals (Sweden)

    Ana Rita Teixeira

    2016-09-01

    Full Text Available High amplitude artifacts represent a problem during EEG recordings in neuroscience research. Taking this into account, this paper proposes a method to identify high amplitude artifacts with no requirement for visual inspection, electrooscillogram (EOG reference channel or user assigned parameters. A potential solution to the high amplitude artifacts (HAA elimination is presented based on blind source separation methods. The assumption underlying the selection of components is that HAA are independent of the EEG signal and different HAA can be generated during the EEG recordings. Therefore, the number of components related to HAA is variable and depends on the processed signal, which means that the method is adaptable to the input signal. The results show, when removing the HAA artifacts, the delta band is distorted but all the other frequency bands are preserved. A case study with EEG signals recorded while participants performed on the Halstead Category Test (HCT is presented. After HAA removal, data analysis revealed, as expected, an error-related frontal ERP wave: the feedback-related negativity (FRN in response to feedback stimuli.

  7. Anodic dissolution of samarium in acetonitrile solution of acetylacetone

    International Nuclear Information System (INIS)

    Kostyuk, N.N.; Dik, T.A.; Trebnikov, A.G.; Shirokij, V.L.

    2003-01-01

    Electrochemical dissolution of metal samarium in acetonitrile medium in the presence of 0.1 M tetraethylammoniumbromide and 0.9 M acetylacetone (HAA) in argon atmosphere under a voltage of 3 V was considered for studying feasibility of electrochemical synthesis of samarium β-diketonates. Using IR and mass spectrometry, thermal and elementary analyses it was ascertained that, depending on cathode and anode areas ratio, anodic dissolution of samarium can give rise to formation of complexes of bi- and trivalent samarium featuring the composition Sm 4 (AA) 8 · 3HAA, Sm(AA) 3 · HAA and Sm(AA) 3 · 4HAA [ru

  8. Eesti ajalugu Vene-Liivimaa sõjast Põhjasõjani / Lea Kõiv

    Index Scriptorium Estoniae

    Kõiv, Lea, 1961-

    2014-01-01

    Arvustus: Enn Küng, Margus Laidre, Ivar Leimus, Aivar Põldvee, Anti Selart, Marten Seppel, Kai Tafenau, Ülle Tarkiainen, Enn Tarvel. Eesti ajalugu III: Vene-Liivimaa sõjast Põhjasõjani. Tartu, 2013

  9. Pyruvate remediation of cell stress and genotoxicity induced by haloacetic acid drinking water disinfection by-products.

    Science.gov (United States)

    Dad, Azra; Jeong, Clara H; Pals, Justin A; Wagner, Elizabeth D; Plewa, Michael J

    2013-10-01

    Monohaloacetic acids (monoHAAs) are a major class of drinking water disinfection by-products (DBPs) and are cytotoxic, genotoxic, mutagenic, and teratogenic. We propose a model of toxic action based on monoHAA-mediated inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a target cytosolic enzyme. This model predicts that GAPDH inhibition by the monoHAAs will lead to a severe reduction of cellular ATP levels and repress the generation of pyruvate. A loss of pyruvate will lead to mitochondrial stress and genomic DNA damage. We found a concentration-dependent reduction of ATP in Chinese hamster ovary cells after monoHAA treatment. ATP reduction per pmol monoHAA followed the pattern of iodoacetic acid (IAA) > bromoacetic acid (BAA) > chloroacetic acid (CAA), which is the pattern of potency observed with many toxicological endpoints. Exogenous supplementation with pyruvate enhanced ATP levels and attenuated monoHAA-induced genomic DNA damage as measured with single cell gel electrophoresis. These data were highly correlated with the SN 2 alkylating potentials of the monoHAAs and with the induction of toxicity. The results from this study strongly support the hypothesis that GAPDH inhibition and the possible subsequent generation of reactive oxygen species is linked with the cytotoxicity, genotoxicity, teratogenicity, and neurotoxicity of these DBPs. Copyright © 2013 Wiley Periodicals, Inc.

  10. smport nt rust l growth in the h nerozoi X ssotopi eviden e of gr ...

    Indian Academy of Sciences (India)

    smport nt rust l growth in the h nerozoi X ssotopi eviden e of gr nitoids from e stE entr l esi fy Ewsxq terx. ID p ex. IDP nd he is ryxqQ. Iq eos ien es ennesD niversit e de ennes ID QSHRP ennes gedexD pr n e em ilX j hndunivErennesIFfr. Phep rtment of qeologyD gh ng hun niversity of ien e nd e hnologyD gh ng hun IQH ...

  11. Avoiding pitfalls in the determination of halocarboxylic acids: the photochemistry of methylation.

    Science.gov (United States)

    Rubio, F J; Urbansky, E T; Magnuson, M L

    2000-06-01

    Haloethanoic (haloacetic) acids are formed during chlorination of drinking water and are regulated by the Environmental Protection Agency (EPA). These compounds are normally quantified by gas chromatography with electron capture detection (GC-ECD) as the methyl esters. EPA Method 552 uses diazomethane (CH2N2) for this purpose, but has only been validated by EPA for HAA6: chloro-, dichloro-, bromo-, dibromo-, bromochloro- and trichloroacetic acids. EPA Method 552.2 was developed and validated for all nine analytes (HAA9 = HAA6 + dibromochloro-, bromodichloro- and tribromoethanoic acids). Since the promulgation of Method 552.2, which uses acidic methanol, a debate has ensued over discrepancies observed by various laboratories when using diazomethane instead. In an effort to identify and eliminate potential sources for these discrepancies, a comparative study was undertaken for HAA9. Better accuracy and precision were observed for all HAA9 species by Method 552.2; recoveries were satisfactory in de-ionized and tap water. Method 552 remains satisfactory for HAA6. Systematic differences in instrumental response are observed for the two methods, but these are precise and may be accounted for using similarly treated standards and analyte-fortified (spiked) samples. That notwithstanding, Method 552 (CH2N2) was shown to be unsuitable for dibromochloro-, bromodichloro- and tribromoethanoic acids (HAA9-6). The primary problem appears to be a photoactivated reaction between diazomethane and the HAA9-6 analytes; however, side reactions were found to occur even in the dark. Analyte loss is most pronounced under typical laboratory lighting (white F40 fluorescent lamps + sunlight), but it is also observed under Philips gold F40 lamps (lambda > or = 520 nm), and in the dark.

  12. Identification and evaluation of resistance to powdery mildew and yellow rust in a wheat mapping population.

    Directory of Open Access Journals (Sweden)

    Lijun Yang

    Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.

  13. Disrupted lymphocyte homeostasis in hepatitis‐associated acquired aplastic anemia is associated with short telomeres

    Science.gov (United States)

    Babushok, Daria V.; Grignon, Anne‐Laure; Li, Yimei; Atienza, Jamie; Xie, Hongbo M.; Lam, Ho‐Sun; Hartung, Helge; Bessler, Monica

    2016-01-01

    Hepatitis‐associated aplastic anemia (HAA) is a variant of acquired aplastic anemia (AA) in which immune‐mediated bone marrow failure (BMF) develops following an acute episode of seronegative hepatitis. Dyskeratosis congenita (DC) is an inherited BMF syndrome characterized by the presence of short telomeres, mucocutaneous abnormalities, and cancer predisposition. While both conditions may cause BMF and hepatic impairment, therapeutic approaches are distinct, making it imperative to establish the correct diagnosis. In clinical practice, lymphocyte telomere lengths (TL) are used as a first‐line screen to rule out inherited telomeropathies before initiating treatment for AA. To evaluate the reliability of TL in the HAA population, we performed a retrospective analysis of TL in 10 consecutively enrolled HAA patients compared to 19 patients with idiopathic AA (IAA). HAA patients had significantly shorter telomeres than IAA patients (P = 0.009), including four patients with TL at or below the 1st percentile for age‐matched controls. HAA patients had no clinical features of DC and did not carry disease‐causing mutations in known genes associated with inherited telomere disorders. Instead, short TLs were significantly correlated with severe lymphopenia and skewed lymphocyte subsets, features characteristic of HAA. Our results indicate the importance of caution in the interpretation of TL measurements in HAA, because, in this patient population, short telomeres have limited specificity. Am. J. Hematol. 91:243–247, 2016. © 2015 The Authors. American Journal of Hematology Published by Wiley Periodicals, Inc. PMID:26615915

  14. Effect of drinking water disinfection by-products in human peripheral blood lymphocytes and sperm.

    Science.gov (United States)

    Ali, Aftab; Kurzawa-Zegota, Malgorzata; Najafzadeh, Mojgan; Gopalan, Rajendran C; Plewa, Michael J; Anderson, Diana

    2014-12-01

    Drinking water disinfection by-products (DBPs) are generated by the chemical disinfection of water and may pose hazards to public health. Two major classes of DBPs are found in finished drinking water: haloacetic acids (HAAs) and trihalomethanes (THMs). HAAs are formed following disinfection with chlorine, which reacts with iodide and bromide in the water. Previously the HAAs were shown to be cytotoxic, genotoxic, mutagenic, teratogenic and carcinogenic. To determine the effect of HAAs in human somatic and germ cells and whether oxidative stress is involved in genotoxic action. In the present study both somatic and germ cells have been examined as peripheral blood lymphocytes and sperm. The effects of three HAA compounds: iodoacetic acid (IAA), bromoacetic acid (BAA) and chloroacetic acid (CAA) were investigated. After determining appropriate concentration responses, oxygen radical involvement with the antioxidants, butylated hydroxanisole (BHA) and the enzyme catalase, were investigated in the single cell gel electrophoresis (Comet) assay under alkaline conditions, >pH 13 and the micronucleus assay. In the Comet assay, BHA and catalase were able to reduce DNA damage in each cell type compared to HAA alone. In the micronucleus assay, micronuclei (MNi) were found in peripheral lymphocytes exposed to all three HAAs and catalase and BHA were in general, able to reduce MNi induction, suggesting oxygen radicals play a role in both assays. These observations are of concern to public health since both human somatic and germ cells show similar genotoxic responses. Copyright © 2014. Published by Elsevier B.V.

  15. Mycotoxin occurrence on baled and pit silages collected in Co. Meath

    Directory of Open Access Journals (Sweden)

    McElhinney C.

    2015-12-01

    Full Text Available Recent studies of baled silages produced in Ireland have identified considerable filamentous fungal contamination. Many of these fungi are toxigenic, capable of producing secondary metabolites, namely mycotoxins. Mycotoxins are potentially detrimental to livestock health and some can pose a risk to consumers of animal products. Baled (n=20 and pit (n=18 silages from a sample of farms (n=38 in Co. Meath were examined to assess the occurrence of mycotoxins and ascertain whether sampling position within the pit silos (feed face vs. 3 m behind the feed face has an effect on mycotoxin content or other chemical compositional variables. Of the 20 mycotoxins assayed, baled silages contained [mean of positive values (no. of values in mean] mycotoxin concentrations (μg/kg dry matter of beauvericin 36 (2, enniatin (enn. A 9.3 (3, enn. A1 54 (8, enn. B 351 (9, enn. B1 136 (10, mycophenolic acid (MPA 11,157 (8 and roquefortine C (Roq. C 1037 (8 and pit silages contained beauvericin 25 (2 enn. A1 18 (2, enn. B 194 (9, enn. B1 57 (3, MPA 287 (6, Roq. C 3649 (6 and zearalenone 76 (1. There was no difference (P>0.05 observed in the mycotoxin concentrations between baled and pit silages, and 11 of the 20 mycotoxins assayed were below the limits of detection. The position of sampling had no effect on the mycotoxin concentration detected in pit silages. It is concluded that mycotoxin concentrations detected in these pit and baled silages in Co. Meath did not exceed EU regulation or guidance limits, and that similar chemical composition and mycotoxin concentration values occurred at the pit silage feed face and 3 m behind this feed face.

  16. Biodiesel : la réglementation européenne et le débat sur son évolution

    Directory of Open Access Journals (Sweden)

    Dusser Philippe

    2013-09-01

    Full Text Available La réglementation communautaire sur les biocarburants a été mise en place à partir de 2003 pour répondre à un triple objectif : réduction des émissions de gaz à effet de serre, réduction de la dépendance énergétique, et soutien à la production agricole dans un contexte où 10 % des terres étaient obligatoirement gelées. Cette réglementation a été renforcée en 2009 dans le cadre du « paquet énergie » par l’introduction par la directive energie renouvelable d’un objectif obligatoire d’incorporation de 10 % d’énergie renouvelable dans les carburants à l’horizon 2020. Cette législation est complétée par une directive qualité des carburants qui impose une réduction de 6 % d’ici 2020 de l’empreinte carbone des carburants. La forte diésélisation du parc de véhicule en Europe a conduit à une rapide progression de la consommation de biodiesel (11 millions de tonnes dont 9 produites dans l’UE. L’huile de colza est la principale matière première du biodiesel. L’augmentation de la production de colza a permis de répondre à cette demande, tout en fournissant un coproduit protéique permettant de réduire significativement le déficit en protéines européen. Le débat sur l’impact du CASI (changement indirect d’affectation des sols des biocarburants, ainsi que celui sur l’équilibre alimentaire, a conduit la Commission européenne, 3 ans après avoir défini sa politique, à proposer de plafonner les carburants issus des cultures (1ere génération à 5 % et à introduire des « facteurs CASI » dans l’évaluation des effets de réduction des gaz à effets de serre. Cette proposition qui pourrait fortement remettre en cause le développement du biodiesel...et de la culture de colza fait à la date de rédaction de cet article (juillet 2013 l’objet de difficiles négociations à Bruxelles, dont l’issue est difficile à prédire.

  17. [Eesti ajalugu III: Vene-Liivimaa sõjast Põhjasõjani] / Kalle Kroon

    Index Scriptorium Estoniae

    Kroon, Kalle, 1966-

    2014-01-01

    Arvustus. Enn Küng, Margus Laidre, Ivar Leimus, Aivar Põldvee, Anti Selart, Marten Sepepl, Kai Tafenau, Ülle Tarkiainen, Enn Tarvel. Eesti ajalugu III: Vene-Liivimaa sõjast Põhjasõjani. Tartu: Tartu Ülikooli Ajaloo ja Arheoloogia Instituut, 2013

  18. Põhjalik koguteos Rootsi võidust / Kaarel Vanamölder

    Index Scriptorium Estoniae

    Vanamölder, Kaarel, 1981-

    2015-01-01

    Arvustus: Enn Küng, Margus Laidre, Ivar Leimus, Aivar Põldvee, Anti Selart, Marten Seppel, Kai Tafenau, Ülle Tarkiainen, Enn Tarvel. Eesti ajalugu III: Vene-Liivimaa sõjast Põhjasõjani. Tartu : Tartu Ülikooli Ajaloo ja arheoloogia instituut, 2013

  19. Kehalise väärkohtlemise ja avaliku korra raske rikkumise eristamine : magistritöö / Reelika Ratassepp ; juhendaja Jaan Ginter ; Tartu Ülikool, sotsiaalteaduste valdkond, õigusteaduskond, karistusõiguse osakond

    Index Scriptorium Estoniae

    Ratassepp, Reelika, 1992-

    2018-01-01

    Kehalise väärkohtlemise koosseisust enne karistusõiguse revisjoni 1. jaanuaril 2015. Avaliku korra mõistest, avalikus kohas käitumise üldnõudetest ning avaliku korra raskest rikkumisest enne korrakaitseseaduse jõustumis ja pärast jõustumist

  20. Recovery from Hospital-Acquired Anemia after Acute Myocardial Infarction and Effect on Outcomes

    OpenAIRE

    Salisbury, Adam C.; Kosiborod, Mikhail; Amin, Amit P.; Reid, Kimberly J.; Alexander, Karen P.; Spertus, John A.; Masoudi, Frederick A.

    2011-01-01

    New onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. Patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center TRIUMPH registry, we identified 530 AMI patients with HAA (defined as normal hemoglobin at admission with development of anemia by discharge) who had repeat, protocol-driven hemoglobin measurement 1 month after discharge. The 1-m...

  1. Effect of cooking methods on the formation of heterocyclic aromatic amines in chicken and duck breast.

    Science.gov (United States)

    Liao, G Z; Wang, G Y; Xu, X L; Zhou, G H

    2010-05-01

    Heterocyclic aromatic amines (HAAs), potent mutagens/carcinogens, are pyrolysis formed during the cooking of meat and fish. In the present study, the effects of various cooking methods, pan-frying, deep-frying, charcoal grilling and roasting on the formation of HAAs in chicken breast and duck breast were studied. The various HAAs formed during cooking were isolated by solid-phase extraction and analyzed by high-performance liquid chromatography (HPLC). Results showed that chicken breast cooked by charcoal grilling contained the highest content of total HAAs, as high as 112 ng/g, followed by pan-fried duck breast (53.3 ng/g), charcoal grilled duck breast (32 ng/g), pan-fried chicken breast (27.4 ng/g), deep-fried chicken breast (21.3 ng/g), deep-fried duck breast (14 ng/g), roasted duck breast (7 ng/g) and roasted chicken breast (4 ng/g). For individual HAA, the most abundant HAA was 9H-pyrido-[4,3-b]indole (Norharman), which was detected in charcoal grilled chicken breast at content as high as 32.2 ng/g, followed by 1-methyl-9H-pyrido[4,3-b] indole (Harman) and 2-amino-1-methyl-6-phenylimidazo[4,5-f]pyridine(PhIP) at 32 and 31.1 ng/g in charcoal grilled chicken breast, respectively. The content of PhIP in pan-fried duck and chicken breast were 22 and 18.3 ng/g, respectively. Generally, the type and content of HAAs in cooked poultry meat varies with cooking method and cooking conditions. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  2. Evaluation of immunologic effect of Enniatin A and quantitative determination in feces, urine and serum on treated Wistar rats.

    Science.gov (United States)

    Juan, Cristina; Manyes, Lara; Font, Guillermina; Juan-García, Ana

    2014-09-01

    Study of dietary supplementation with ENN A mycotoxin during 28 days of exposure time on Wistar rats to determinate its levels in serum, urine and feces and, to evaluate the immunologic effect in peripheral blood lymphocytes (PBL) is presented. The first method for ENN A extraction, determination and detection by LC-MS/MS in serum, urine and feces samples is reported. ENN A food dose administrated was detected in serum samples and influenced lymphocyte phenotyping. Levels in serum were founded from the second week of the experiment; reaching values of 4.76 μg/ml on the fourth week, which corresponds to 3.24 μg/ml in blood. PBL as T helper (CD4(+)) were presented in greater percentages compared to control (p ≤ 0.001), while T cytotoxic (CD8(+)) decreased significantly compared to control (p ≤ 0.001). ENN A treatment significantly increased CD4(+)/CD3(+) and CD4(+)/CD8(+) ratios but significantly decreased CD8(+)/CD3(+) ratio. CD4(+)/CD8(+) ratio was 2.94:1, indicating that PBL surface antigen expression and immune status in Wistar rats treated were impaired by the ENN A mycotoxin. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Bromine incorporation into five DBP classes upon chlorination of water with extremely low SUVA values.

    Science.gov (United States)

    Hong, Huachang; Yan, Xiaoqing; Song, Xuhui; Qin, Yanyan; Sun, Hongjie; Lin, Hongjun; Chen, Jianrong; Liang, Yan

    2017-07-15

    The main objective of this study was to assess the effects of disinfection conditions on bromine incorporation into disinfection by-products (DBPs) during chlorination of water with low specific UV absorbance (SUVA). Five classes of DBPs were included: trihalomethanes (THMs), dihaloacetic acids (di-HAAs), trihaloacetic acids (tri-HAAs), dihaloacetonitriles (DHANs) and trihalonitromethanes (THNMs). Results showed that the bromine utilization in DBPs formation was positive related with reaction time, pH and temperature. On the other hand, the bromine substitution factors (BSFs) of DBPs were generally increased with pH (except tri-HAAs) and bromide concentration, but decreased with the reaction time, temperature and chlorine dose. Moreover, the BSFs values varied with DBP classes with the ranking being as following: THNMs≫DHANs≫tri-HAAs>THM≈di-HAAs. These results were mostly similar with the references, yet the pH effect on BSFs as well as the rank of BSFs for different DBP classes may differ with the specific UV absorbance of organic matter. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. The Clerical Establishment in Iran

    Science.gov (United States)

    1989-06-01

    Political Action and Legitimate Domi- nation in Shi’ite Iran: Fourteenth to Eighteenth Centuries, A.D.," Archives Europ~ennes de Sociologie , Vol. 20, No...139 Archives Europ6ennes de Sociologie Bours, (moderate centrist) weekly in Persian, Tehran Conflict Studies, quarterly in English, London Enghelab

  5. Formation of heterocyclic amines in Chinese marinated meat: effects of animal species and ingredients (rock candy, soy sauce and rice wine).

    Science.gov (United States)

    Wang, Pan; Hong, Yanting; Ke, Weixin; Hu, Xiaosong; Chen, Fang

    2017-09-01

    Heterocyclic aromatic amines (HAAs) are one type of neo-formed contaminants in protein-rich foods during heat processing. Recently, accumulative studies have focused on the formation of HAs in Western foods. However, there is little knowledge about the occurrence of HAAs in traditional Chinese foods. The objective of this study was to determinate the contents of main HAs in traditional marinated meat products by UPLC-MS/MS, and to investigate the effects of animal species and the ingredients (soy sauce, rock candy, and rice wine) on the formation of HAAs in marinated meats. Five HAs - 2-amino-3-methylimidazo[4,5-f]-quinolone (IQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3,4-dimethylimidazo[4,5-f]quinoxaline (MeIQ), 9H-pyrido[3,4-b]indole (Norharman) and l-methyl-9H-pyrido[3,4-b]indole (Harman) - were detected in 12 marinated meats, but 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) was only found in three chicken marinates. The animal species and ingredients (soy sauce, rock candy and rice wine) have significant influence on the formation of HAAs in meat marinates. Beef had the highest content of total HAAs compared with pork, mutton and chicken. Meanwhile, soy sauce contributed to the formation of HAAs more greatly than rock candy, soy sauce, and rice wine. Choice of raw materials and optimisation of ingredients recipe should be become a critical point to control the HAAs formation in marinated meats. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  6. Pregnancy loss and eye malformations in offspring of F344 rats following gestational exposure to mixtures of regulated trihalomethanes and haloacetic acids

    Science.gov (United States)

    Chlorination of drinking water results in the formation of hundreds of disinfection byproducts (DBPs), the most prevalent are trihalomethanes (THMs) and haloacetic acids (HAAs). Four THMs (chloroform, bromodichloromethane, chlorodibromomethane, bromoform) and five HAAs (chloroac...

  7. Hepatic artery aneurysms (HAAs)

    International Nuclear Information System (INIS)

    Nosratini, H.

    2004-01-01

    The hepatic artery aneurysms are rare, especially in interahepatic branches, The frequency consists of 75-80% extrahepatic and 20-25% intrahepatic. Catheterization is achieved usually from common femoral artery, other methods implemented in the case of unsuccessful catheterization from femoral artery, are translumbar and brachial catheterization. The study consist of 565 patients that were referred to the angiography ward, During seven years of assessment, five cases of hepatic artery aneurysm were found; this is a rare condition reported in the English literature. In the literature as well as in this case report the hepatic artery aneurysms are rare. In reported series the extrahepatic artery aneurysms are found more often than in the intrahepatic artery aneurysm but in this case report intrahepatic artery aneurysms are more than extrahepatic one. (author)

  8. В Хельсинки открылась выставка эстонской живописи

    Index Scriptorium Estoniae

    2010-01-01

    Helsingi kunstihoones (Helsingin Taidehalli) avati 15. oktoobril Eesti maalikunsti ülevaatenäitus "Viron värit - 150 vuotta virolaista maalaustaideta Enn Kunilan kokoelamasta" ("Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kogust"). Kuraator Harry Liivrand, kujundaja Olev Subbi. Helsingis on "Viron värit" avatud 24. novembrini

  9. Feminist Therapy: Not for or by White Women Only.

    Science.gov (United States)

    Espin, Olivia M.

    1993-01-01

    Responds to earlier article by Carolyn Zerbe Enns on feminist counseling and psychotherapy, noting that Enns could have elaborated on what the challenge of multiculturalism meant for the future of feminist therapy and counseling. Asserts that tendency to overgeneralize from data and information gathered from experience of white women continues for…

  10. Feminist Counseling/Therapy for the 21st Century.

    Science.gov (United States)

    Worell, Judith; Robinson, Damon

    1993-01-01

    Responds to earlier article by Carolyn Zerbe Enns on feminist counseling and psychotherapy. Acknowledges productive impact of Enns's review, but raises some concerns related to the conception of history and some of the conclusions that are reached. Discusses two important parameters that merit more attention, focusing on the future of feminist…

  11. Ilushow enne teatrit

    Index Scriptorium Estoniae

    2009-01-01

    29. mail juhatab Rakvere Teater pangamajas toimuva moe- ja ilushowga sisse oma esimese suvelavastuse - Jean Genet' "Toatüdrukud", lavastaja Hendrik Toompere, kunstnik Ervin Õunapuu. Esietendus 5. juunil pangamajas

  12. Preparation and characterization of inorganic and organic coatings on AZ91D magnesium alloy with electroless plating pretreatment

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, S.Y.; Li, Q.; Zhang, H.X.; Wang, S.Y.; Liu, F. [School of Chemistry and Chemical Engineering, Southwest University Chongqing, 400715 (China); Yang, X.K. [School of Materials Science and Engineering, Southwest University Chongqing, 400715 (China)

    2011-09-15

    In this paper, a protective coating scheme was applied for the corrosion protection of AZ91D magnesium alloy. Electroless Ni coating (EN coating) as bottom layer, electrodeposited Ni coating (ENN coating), and silane-based coating (ENS coating) as top layer, respectively, were successfully prepared on AZ91D magnesium alloy by combination techniques. Scanning electron microscopy and X-ray diffraction were employed to investigate the surface and phase structure of coatings, respectively. The electrochemical corrosion behaviors of coatings in neutral 3.5 wt% NaCl solution were evaluated by electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization techniques. The corrosion testing showed that the three kinds of coatings all could provide corrosion protection for AZ91D magnesium alloy to a certain extent, and the corrosion resistance of ENN and ENS was superior to EN. In order to further study the corrosion protection properties of ENN and ENS, a comparative investigation on the evolution of EIS of ENN and ENS was carried out by dint of immersion test in neutral 3.5 wt% NaCl solution. The results indicated that, compared with ENN, the ENS could provide longer corrosion protection for AZ91D magnesium alloy. It is significant to determine the barrier effect of each coating, which could provide reference for industry applications. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. Preferential induction of the AhR gene battery in HepaRG cells after a single or repeated exposure to heterocyclic aromatic amines

    International Nuclear Information System (INIS)

    Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Laurent, Veronique; Loyer, Pascal; Robin, Marie-Anne; Guillouzo, Andre

    2010-01-01

    2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) are two of the most common heterocyclic aromatic amines (HAA) produced during cooking of meat, fish and poultry. Both HAA produce different tumor profiles in rodents and are suspected to be carcinogenic in humans. In order to better understand the molecular basis of HAA toxicity, we have analyzed gene expression profiles in the metabolically competent human HepaRG cells using pangenomic oligonucleotide microarrays, after either a single (24-h) or a repeated (28-day) exposure to 10 μM PhIP or MeIQx. The most responsive genes to both HAA were downstream targets of the arylhydrocarbon receptor (AhR): CYP1A1 and CYP1A2 after both time points and CYP1B1 and ALDH3A1 after 28 days. Accordingly, CYP1A1/1A2 induction in HAA-treated HepaRG cells was prevented by chemical inhibition or small interference RNA-mediated down-regulation of the AhR. Consistently, HAA induced activity of the CYP1A1 promoter, which contains a consensus AhR-related xenobiotic-responsive element (XRE). In addition, several other genes exhibited both time-dependent and compound-specific expression changes with, however, a smaller magnitude than previously reported for the prototypical AhR target genes. These changes concerned genes mainly related to cell growth and proliferation, apoptosis, and cancer. In conclusion, these results identify the AhR gene battery as the preferential target of PhIP and MeIQx in HepaRG cells and further support the hypothesis that intake of HAA in diet might increase human cancer risk.

  14. Trace Analysis of Mutagenic Heterocyclic Aromatic Amines in Cigarette Smoke Condensate and its Base Fractions via Silylation-GC-MS

    Directory of Open Access Journals (Sweden)

    Liu S

    2014-12-01

    Full Text Available Among the more than 5000 chemicals reported in cigarette smoke condensate (CSC, heterocyclic aromatic amines (HAAs are considered to be a contributor to observed biological activity. HAAs are non-volatile and are reported at ppb levels in CSC. A new method for HAA analysis at the trace level is reported here. N, O-Bis(trimethylsilyl trifluoroacetamide (BSTFA containing 1% trimethylchlorosilane was employed to derivatize amino groups by heating the reagent containing a sample of CSC at 80 °C for 30 min followed by analysis employing gas chromatography-mass spectroscopy (GC-MS in the selected-ion-monitoring (SIM mode. This derivatization method afforded symmetrical peak shapes on a ZB-50 stationary phase and achieved instrumental limits of quantification (LOQ at 10:1 S/N from -1 ng/mL for AαC to120 ng/mL for Glu-P-1. The chemical identity of each derivative was confirmed by comparison of retention time and mass spectra of standards. The latter were characterized by the following ions: M·+ or [M-1]+, [M-15]+, and m/z 73 (i.e., trimethylsilyl. CSC and its base sub-fractions were studied using the GC-MS method. Ten HAAs were screened and five were quantified in cigarette smoke condensate, while 2-5 HAAs were quantified in each of three base sub-fractions. Values obtained with the new procedure agree well with values reported in the literature and with results obtained from a commercial laboratory via a different analytical method. The potential contribution of each HAA to the overall mutagenic activity observed for CSC and its base fractions is discussed. When considered together, HAAs account for only a small portion (-7.8% of the observed mutagenicity of the CSC.

  15. Reducing effect of artichoke extract on heterocyclic aromatic amine formation in beef and chicken breast meat.

    Science.gov (United States)

    Tengilimoglu-Metin, Mercan Merve; Kizil, Mevlude

    2017-12-01

    The aim of this study was to investigate the inhibitory effect of different levels of artichoke extract (0, 0.5, and 1.0%) on the formation of heterocyclic aromatic amines (HAAs) in beef and chicken breast meat cooked by either pan-frying or oven-roasting. All meat samples were cooked at three different temperatures (150, 200, and 250°C) and the levels of 12 HAAs (IQ, IQx, MeIQ, MeIQx, 4,8-DiMeIQx, 7,8-DiMeIQx, PhIP, harman, norharman, AαC, MeAαC, and Trp-P-2) were assessed. The total HAA content in beef and chicken breast ranged from not detectable to 49.26ng/g, and not detectable to 83.06ng/g, respectively. The inhibitory effects of 0.5 and 1.0% artichoke extracts on total HAAs levels were found to be 6-46% and 25-98% in beef, and 5-97% and 14-95% in chicken breast, respectively. The present study showed that artichoke extracts could mitigate HAA formation especially in oven-roasted beef and chicken breast meat. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Effect of the chlorinated washing of minimally processed vegetables on the generation of haloacetic acids.

    Science.gov (United States)

    Cardador, Maria Jose; Gallego, Mercedes

    2012-07-25

    Chlorine solutions are usually used to sanitize fruit and vegetables in the fresh-cut industry due to their efficacy, low cost, and simple use. However, disinfection byproducts such as haloacetic acids (HAAs) can be formed during this process, which can remain on minimally processed vegetables (MPVs). These compounds are toxic and/or carcinogenic and have been associated with human health risks; therefore, the U.S. Environmental Protection Agency has set a maximum contaminant level for five HAAs at 60 μg/L in drinking water. This paper describes the first method to determine the nine HAAs that can be present in MPV samples, with static headspace coupled with gas chromatography-mass spectrometry where the leaching and derivatization of the HAAs are carried out in a single step. The proposed method is sensitive, with limits of detection between 0.1 and 2.4 μg/kg and an average relative standard deviation of ∼8%. From the samples analyzed, we can conclude that about 23% of them contain at least two HAAs (<0.4-24 μg/kg), which showed that these compounds are formed during washing and then remain on the final product.

  17. Synthesis of high-quality diesel with furfural and 2-methylfuran from hemicellulose.

    Science.gov (United States)

    Li, Guangyi; Li, Ning; Wang, Zhiqiang; Li, Changzhi; Wang, Aiqin; Wang, Xiaodong; Cong, Yu; Zhang, Tao

    2012-10-01

    Hydroxyalkylation-alkylation (HAA) coupled with hydrodeoxygenation is a promising route for the synthesis of renewable high-quality diesel or jet fuel. In this work, a series of solid-acid catalysts were firstly used for HAA between lignocellulose-derived furan and carbonyl compounds. Among the investigated catalysts, Nafion-212 resin demonstrated the highest activity and stability. Owing to the high activity of the reactants and the advantage in industrial integration, the HAA of 2-methylfuran (2-MF) and furfural can be considered as a prospective route in future applications. Catalyst loading, reaction temperature, and time had evident effects on the HAA of 2-MF and furfural over Nafion-212 resin. Finally, the HAA product of 2-MF and furfural was hydrogenated over a Pd/C catalyst and hydrodeoxygenated over Pt-loaded solid-acid catalysts. Pt/zirconium phosphate (Pt/ZrP) was found to be the best catalyst for hydrodeoxygenation. Over the 4 % Pt/ZrP catalyst, a 94 % carbon yield of diesel and 75 % carbon yield of C15 hydrocarbons (with 6-butylundecane as the major component) was achieved. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Eesti kunstiaarded rändasid üle mere: "Ma poleks õiglane, kui hoiaksin maalid vaid endale" / Oliver Õunmaa

    Index Scriptorium Estoniae

    Õunmaa, Oliver

    2010-01-01

    Eesti maalikunsti ülevaatenäitus "Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kogust" Helsingi Taidehallis 24. novembrini 2010. Enn Kunila, näituse kuraatori Harry Liivranna, Helsingi kunstihoone juhataja kohusetäitja Taru Tappola kommentaarid. Näituse kujundas Olev Subbi, soomekeelse raamatu näituse kohta koostas Eero Epner

  19. Cooking does not decrease hydrophilic antioxidant capacity of wild blueberries.

    Science.gov (United States)

    Murphy, Rebecca Ree; Renfroe, Michael H; Brevard, Patricia Bowling; Lee, Robert E; Gloeckner, Janet W

    2009-01-01

    The present study examined the effects of domestic cooking methods on the hydrophilic antioxidant activity (HAA) of wild blueberries. Baked, microwaved, simmered, and pan-fried frozen wild blueberries, and a thawed uncooked control, were analyzed for HAA using an ABTS/H(2)O(2)/HRP decoloration method. All cooking treatments were derived from recipes using wild blueberries, and were performed in triplicate. A randomized block design was used to determine whether there were statistical differences in antioxidant content after cooking and between each of the trials. There were no statistically significant decreases after cooking the thawed berries. On both a fresh weight and a dry weight basis, pan-fried blueberries had significantly higher HAA than baked, simmered, and control blueberries (Pcooked berries retained significant HAA. Cooked wild blueberries can be recommended as a good source of dietary antioxidants.

  20. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    (TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

  1. L’Union européenne: un champion en trompe l’œil de l’aide publique au développement

    Directory of Open Access Journals (Sweden)

    Yann Richard

    2008-06-01

    Full Text Available L’Union européenne est le premier bailleur de fonds de l’aide publique au développement dans le monde. Elle y consacre des sommes plus importantes que les États-Unis et le Japon et elle domine dans l’aide au développement perçue par la quasi-totalité des pays bénéficiaires (pays en développement et pays en transition. Elle est le premier donateur aussi bien pour l’importance de sommes dépensées que pour l’effort consenti (l’aide rapportée au revenu national brut ou bien au nombre des habitants des pays donateurs. Mais ce statut de premier donateur est en partie illusoire. Cette domination vient de l’addition artificielle de l’aide versée par la Commission européenne et de l’aide versée par les pays membres de l’UE 15. Or, l’analyse des statistiques de l’aide au développement montre que ces deux types de donateurs ne suivent pas les mêmes logiques pour l’allocation géographique de leur aide. L’aide au développement versée par l’Union, comparativement à celle versée par le Japon et les États-Unis, semble avoir un caractère universel. Cette apparente générosité ne cache-t-elle pas une faiblesse ? On peut se demander si l’aide européenne ne souffre pas en réalité d’une trop grande dispersion. Par ailleurs, la géographie de l’aide versée par l’UE ne semble pas correspondre au discours européen qui met au sommet de l’agenda politique de l’Union le développement des relations avec ses voisins géographiques. Ce manque de cohérence transparaît dans l’évolution inverse des aides versées par la Commission (en augmentation et par les pays membres de l’UE (en baisse. L’Union s’est bel et bien engagée dans une réforme de la gouvernance de son aide au développement (déclaration de Paris, Objectifs du Millénaire pour le développement. Néanmoins, les tendances que nous soulignons dans cet article montrent que les résultats sont encore à venir. La faible lisibilit

  2. ENSEIGNER LES DISPARITÉS SOCIO-SPATIALES AVEC HYPERATLAS: LE CAS DE L’UNION EUROPÉENNE

    Directory of Open Access Journals (Sweden)

    María Pigaki

    2014-12-01

    -spatiales qui existent au niveau régional dans l’Union européenne. HyperAtlas est non seulement un outil pour développer la pensée spatiale par l’analyse spatiale. Ce est aussi une ressource éducative à travers laquelle les élèves apprennent à exercer la citoyenneté, à comprendre les problèmes sociaux de caractère territorial et à proposer des solutions. Le texte décrit les objectifs, la méthodologie et les conditions d’expérimentation de HyperAtlas dans la classe de géographie à deux lycées différentes, l’un en Grèce, l’autre en France. Les similitudes et les différences entre ces deux expérimentations, mais les conclusions sur l’utilisation de HyperAtlas montrent comment HyperAtlas est un outil pour la recherche de l’espace à l’école. Mots-clés: HyperAtlas, analyse spatiale, disparités territoriales, éducation pour la citoyenneté.   

  3. Reproductive toxicity of a mixture of regulated drinking-water disinfection by-products in a multigenerational rat bioassay

    Science.gov (United States)

    BACKGROUND:Trihalomethanes (THMs) and haloaretic acids (HAAs) are regulated disinfection by-products (DBPs); their joint reproductive toxicity in drinking water is unknown.OBJECTIVE: We aimed to evaluate a drinking water mixture of the four regulated THMs and five regulated HAAs ...

  4. An integrated sample preparation to determine coccidiostats and emerging Fusarium-mycotoxins in various poultry tissues with LC-MS/MS.

    Science.gov (United States)

    Jestoi, Marika; Rokka, Mervi; Peltonen, Kimmo

    2007-05-01

    The usefulness of an existing sample preparation technique used for ionophoric coccidiostats (lasalocid, monensin, salinomycin and narasin) was applied in the analysis of emerging Fusarium-mycotoxins beauvericin (BEA) and enniatins (ENNs) in poultry tissues (liver and meat). Also, maduramicin and liver as a new sample matrix was introduced. The developed methods were validated and applied for the determination of coccidiostats and BEA/ENNs in Finnish poultry tissues in 2004-2005. The validation parameters demonstrated that the integrated sample preparation technique is applicable to the parallel determination of these contaminants in poultry tissues. Of the samples analysed (276 meat and 43 liver), only trace levels of LAS, MON, SAL, NAR and MAD were detected in 7, 3, 5, 6 and 4% of the samples, respectively. Interestingly, for the first time, traces of BEA and ENNs could also be detected in animal tissues. BEA and ENNs A, A1, B and B1 were found in 2, 0.3, 0.6, 4 and 3% of the samples, respectively. The simultaneous presence of coccidiostats and mycotoxins was detected in three turkey samples in 2004.

  5. Nouvelles données sur la paléobiogéographie des genres Septimaniceras Fauré, 2002 et Crassiceras Merla, 1932 (Ammonitina) du Toarcien moyen

    OpenAIRE

    Jattiot, Romain; Rulleau, Louis; Latutrie, Benjamin

    2017-01-01

    Depuis sa première description, le genre Septimaniceras Fauré, 2002 a été systématiquement considéré comme un genre endémique, avec une répartition géographique limitée à la région des Causses et du Languedoc (France, province nord-ouest européenne). De même, l’espèce Crassiceras bayani (Dumortier, 1874), d’affinités méditerranéennes, était interprétée comme une forme spécifiquement nord-ouest européenne cantonnée au sud-est de la France, et ne dépassant pas la région lyonnaise en latitude no...

  6. Helsingis avatakse suur Eesti maalinäitus

    Index Scriptorium Estoniae

    2010-01-01

    Eesti maalikunsti ülevaatenäitus "Viron värit - 150 vuotta virolaista maalaustaideta Enn Kunilan kokoelamasta" ("Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kogust") Helsingi kunstihoones (Helsingin Taidehalli) 16. oktoobrist 24. novembrini 2010. Näituse kuraator Harry Liivrand, kujundaja Olev Subbi. Väljapanekut saatva raamatu on koostanud Eero Epner, kujundanud Tiit Jürna

  7. Chlorination and chloramination of aminophenols in aqueous solution: oxidant demand and by-product formation.

    Science.gov (United States)

    Mehrez, O Abou; Dossier-Berne, F; Legube, B

    2015-01-01

    Chlorination and monochloramination of aminophenols (AP) were carried out in aqueous solution at 25°C and at pH 8.5. Oxidant demand and disinfection by-product formation were determined in excess of oxidant. Experiments have shown that chlorine consumption of AP was 40-60% higher than monochloramine consumption. Compared with monochloramination, chlorination of AP formed more chloroform and haloacetic acids (HAA). Dichloroacetic acid was the major species of HAA. Chloroform and HAA represented, respectively, only 1-8% and 14-15% of adsorbable organic halides (AOX) by monochloramination but up to 29% and 39% of AOX by chlorination.

  8. Hazard assessment of three haloacetic acids, as byproducts of water disinfection, in human urothelial cells.

    Science.gov (United States)

    Marsà, Alicia; Cortés, Constanza; Hernández, Alba; Marcos, Ricard

    2018-04-07

    Disinfection by-products (DBPs) are compounds produced in the raw water disinfection processes. Although increased cancer incidence has been associated with exposure to this complex mixture, the carcinogenic potential of individual DBPs remains not well known; thus, further studies are required. Haloacetic acids (HAAs) constitute an important group among DBPs. In this study, we have assessed the in vitro carcinogenic potential of three HAAs namely chloro-, bromo-, and iodoacetic acids. Using a long-term (8 weeks) and sub-toxic doses exposure scenario, different in vitro transformation markers were evaluated using a human urothelial cell line (T24). Our results indicate that long-term exposure to low doses of HAAs did not reproduce the genotoxic effects observed in acute treatments, where oxidative DNA damage was induced. No changes in the transformation endpoints analyzed were observed, as implied by the absence of significant morphological, cell growth rate and anchorage-independent cell growth pattern modifications. Interestingly, HAA-long-term exposed cells developed resistance to oxidative stress damage, what would explain the observed differences between acute and long-term exposure conditions. Accordingly, data obtained under long-term exposure to sub-toxic doses of HAAs could be more accurate, in terms of risk assessment, than under acute exposure scenarios. Copyright © 2018. Published by Elsevier Inc.

  9. Leishmaniose canine dans le Rif (côte méditerranéenne marocaine : enquête séro-épidémiologique

    Directory of Open Access Journals (Sweden)

    Rami M.

    2003-03-01

    Full Text Available Dans le but d'évaluer la situation de la leishmaniose canine dans le foyer situé dans le versant Nord-Est de la chaîne montagneuse du Rif, une enquête séro-épidémiologique a été menée dans différentes localités de la province de Nador (côte méditerranéenne marocaine. Des échantillons de sérum collectés sur 257 chiens ont été analysés par les techniques d'immunofluorescence indirecte (IFI et d'enzyme-linked immunosorbent assay (ELISA pour détecter les anticorps anti-Leishmania infantum. Les résultats montrent que 48 (18,7 % des chiens examinés sont positifs en IFI et 54 (21,0 % le sont en ELISA ; la concordance des deux méthodes étant de 96,1 %. D'autre part, le taux d'infection est significativemenl plus élevé chez les chiens âgés de plus de quatre ans et ne dépend pas du sexe de l'animal. Les symptômes les plus fréquemment relevés sur les chiens séropositifs sont la polyadénite (57,4 %, l'amyotrophie (51,9 % et les lésions cutanéo-muqueuses ( 25,9 %. Cependant, 38,9 % de ces mêmes chiens ne présentent pas de symptômes pouvant évoquer la leishmaniose. Des Leishmania isolées sur trois des chiens examinés ont toutes été identifiées comme étant L. infantum MON-1. Ces résultats montrent que le versant Nord-Est des montagnes du Rif est l'un des foyers les plus actifs de leishmaniose viscérale dans le pourtour méditerranéen et confirment le rôle que joue le chien comme principal réservoir de L. infantum.

  10. Les débouchés énergétiques de l'agriculture de la Communauté Economique Européenne Energy Outlets for Agriculture in the European Economic Community

    Directory of Open Access Journals (Sweden)

    Becker J. J.

    2006-11-01

    Full Text Available L'agriculture de la Communauté Economique Européenne (CEE connaît une crise profonde au niveau de ses débouchés. Ainsi, même dans un contexte où l'indépendance énergétique n'est plus une préoccupation majeure, une production massive d'énergie par l'agriculture reste un projet à priori digne d'intérêt. Cette étude précise les modalités d'application concrètes d'une telle politique et tente une évaluation économique permettant d'apprécier la viabilité d'un tel schéma. Elle présente, en particulier, un positionnement par rapport aux solutions agricoles plus classiques actuellement mises en oeuvre et qui pourtant ne sont guère satisfaisantes. Agriculture in the EEC is in the midst of a deep crisis concerning its outlets. Even in a context where energy independence is no longer a major preoccupation, massive energy production by agriculture is still a problem worthy of interest, a priori. This article specifies concrete procedures for applying such a policy and tries to make an economic evaluation to assess the viability of such a scheme. In particular, it describes a position in relation to the most conventional agricultural solutions now being implemented and that are proving not to be very satisfactory.

  11. Memento ettepanek president Ilvesele ja välisminister Paetile

    Index Scriptorium Estoniae

    2010-01-01

    Eesti Memento Liidu juhatuse esimehe Enn Tarto kirjast president Toomas Hendrik Ilvesele ja välisminister Urmas Paetile seoses nende sõiduga Moskvasse Suure Isamaasõja võidu aastapäeva tähistamise pidustustele. Ilmunud ka: Vaba Eesti Sõna 6. mai 2010, lk. 3, pealk.: Enn Tarto annab Moskvasse sõitvale presidendile nõu. Töövisiit Moskvasse 8.-9.05.2010

  12. Associations Between Disinfection By-Product Exposures and Craniofacial Birth Defects.

    Science.gov (United States)

    Kaufman, John A; Wright, J Michael; Evans, Amanda; Rivera-Núñez, Zorimar; Meyer, Amy; Narotsky, Michael G

    2018-02-01

    The aim of this study was to examine associations between craniofacial birth defects (CFDs) and disinfection by-product (DBP) exposures, including the sum of four trihalomethanes (THM4) and five haloacetic acids (HAA5) (ie, DBP9). We calculated first trimester adjusted odds ratios (aORs) for different DBPs in a matched case-control study of 366 CFD cases in Massachusetts towns with complete 1999 to 2004 THM and HAA data. We detected elevated aORs for cleft palate with DBP9 (highest quintile aOR = 3.52; 95% CI: 1.07, 11.60), HAA5, trichloroacetic acid (TCAA), and dichloroacetic acid. We detected elevated aORs for eye defects with TCAA and chloroform. This is the first epidemiological study of DBPs to examine eye and ear defects, as well as HAAs and CFDs. The associations for cleft palate and eye defects highlight the importance of examining specific defects and DBPs beyond THM4.

  13. Effect of Pre-ozonation on Haloacetic Acids Formation in Ganga River Water at Kanpur, India

    Science.gov (United States)

    Naladala, Nagasrinivasa Rao; Singh, Rambabu; Katiyar, Kumud Lata Devi; Bose, Purnendu; Dutta, Venkatesh

    2017-11-01

    Almost all natural water bodies which are considered to be sustainable sources of drinking water contain organic matter in dissolved form and pathogens. This dissolved organic matter and pathogens cannot be removed effectively through traditional filtering processes in drinking water treatment plants. Chlorination of such water for disinfection results in large amounts of disinfection by-products (DBPs), mainly trihalomethanes and haloacetic acids (HAAs), which showed many health effects like cancer and reproductive problems in lab animals and in human beings as well. Complete removal of dissolved organic carbon (DOC), which is a precursor compound for HAAs formation, is impossible from a practical point of view; hence, it will be better if DOC activity towards DBPs formation can be reduced via some process. The present article describes the process of pre-ozonating post-coagulated Ganga River water at Kanpur in a continuous flow mode and its effect on HAAs formation. Nearly 58% reduction in HAAs formation was observed during this study at higher doses of ozone.

  14. Serum levels of organochlorine pesticides in the French adult population: the French National Nutrition and Health Study (ENNS), 2006-2007.

    Science.gov (United States)

    Saoudi, Abdessattar; Fréry, Nadine; Zeghnoun, Abdelkrim; Bidondo, Marie-Laure; Deschamps, Valérie; Göen, Thomas; Garnier, Robert; Guldner, Laurence

    2014-02-15

    Although most organochlorine (OC) pesticides were banned in France in the 1970s and 1980s, they remain a source of public concern. Because of their high persistence in the environment, they are still detected in foodstuffs, leading to continued human exposure. The purpose of this study was to assess the distribution of serum organochlorine (OC) pesticides in the French adult population and to identify the main risk factors for p,p'-dichlorodiphenyl dichlorethylene (DDE), β-hexachlorocyclohexane (β-HCH) and hexachlorobenzene (HCB). The selected OC pesticides (HCB, DDE, DDT, α-HCH, β-HCB and γ-HCH) were measured in serum samples collected in 2006-2007 from 386 persons (aged 18-74 years) randomly selected among the participants in the clinical and biological component of the French Nutrition and Health Survey (Etude Nationale Nutrition Santé [ENNS]), a cross-sectional survey carried out in the general population. Collected data included biological samples, socio-demographic characteristics, and data about environmental and occupational exposure factors. Of the six OC pesticides investigated, the highest concentrations were observed for HCB, β-HCH and DDE. Median serum concentrations were as follows: 22.8 ng/g lipid for HCB, 0.74 and 27.0 ng/g lipid, respectively, for α- and ß-HCH, and 3.8 and 104.6 ng/g lipid, respectively, for DDT and DDE. Lindane (γ-HCH) was detected in approximately 10% of the sample. OC pesticide levels in serum in French adults were higher (except for DDT and DDE) than those observed in American, Canadian and German populations and generally lower than or in the same range as those observed in other European countries. The low serum DDT/DDE ratio in the present study (3.7%) would suggest that the concentrations observed for these two OC pesticides were mainly the result of past exposure. The most important predictors of serum DDE, HCB and β-HCH concentrations among the French adult population included individual factors (age, gender

  15. Haloacetic acids in the aquatic environment. Part II: ecological risk assessment

    International Nuclear Information System (INIS)

    Hanson, Mark L.; Solomon, Keith R.

    2004-01-01

    Haloacetic acids (HAAs) are environmental contaminants found in aquatic ecosystems throughout the world as a result of both anthropogenic and natural production. The ecological risk posed by these compounds to organisms in freshwater environments, with a specific focus on aquatic macrophytes, was characterized. The plants evaluated were Lemna gibba, Myriophyllum spicatum and M. sibiricum and the HAAs screened were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). Laboratory toxicity data formed the basis of the risk assessment, but field studies were also utilized. The estimated risk was calculated using hazard quotients (HQ), as well as effect measure distributions (EMD) in a modified probabilistic ecological risk assessment. EMDs were used to estimate HAA thresholds of toxicity for use in HQ assessments. This threshold was found to be a more sensitive measure of low toxicity than the no observed effect concentrations (NOEC) or the effective concentration (EC 10 ). Using both deterministic and probabilistic methods, it was found that HAAs do not pose a significant risk to freshwater macrophytes at current environmental concentrations in Canada, Europe or Africa for both single compound and mixture exposures. Still, HAAs are generally found as mixtures and their potential interactions are not fully understood, rendering this phase of the assessment uncertain and justifying further effects characterization. TCA in some environments poses a slight risk to phytoplankton and future concentrations of TFA and CDFA are likely to increase due to their recalcitrant nature, warranting continued environmental surveillance of HAAs. - Current environmental concentrations of haloacetic acids do not pose a risk to aquatic macrophytes, but could impact plankton

  16. Simultaneous determination of 9 heterocyclic aromatic amines in pork products by liquid chromatography coupled with triple quadrupole tandem mass spectrometry

    Science.gov (United States)

    Shen, X. C.; Zhang, Y. L.; Cui, Y. Q.; Xu, L. Y.; Li, X.; Qi, J. H.

    2017-07-01

    Heterocyclic aromatic amines (HAAs) are potent mutagens that formed at high temperature in cooked, protein-rich food. Owing to their frequent intake, an accurate method is essential to access human health risk of HAAs exposure through detecting these compounds in various heat-treated meat products. In this study, a liquid chromatography-electrospray tandem mass spectrometry (LC--ESI-MS/MS) method was developed to perform the determination of 9 mutagenic heterocyclic amines (HAAs) in meat samples with multiple reaction monitoring (MRM) mode. Ultrasound assisted extraction and diatomaceous earth was employed to extract HAAs from food samples, and the analytes were purified and enriched using tandem solid phase extraction, with propyl sulfonic acid coupled to a C18 cartridge. Two parameters, extraction time and eluent, were carefully optimized to improve the extraction and purification efficiency. The LC separation was carried out using a Zorbax SB-C18 (3.5 μm particle size, 2.1 × 150 mm i.d.) column and optimized some parameters, such as pH, concentration and volume. Under the optimal experimental conditions, recoveries ranged from 52.97% to 97.11% with good quality parameters: limit of detection values between 0.02 and 0.24 ng mL-1, linearity (R2>0.998), and run-to-run and day-to-day precisions lower than 9.81% achieved. To evaluate the performance of the method in high throughput analysis of complex meat samples, the LC-MS/MS method was applied to the analysis of HAAs in three food samples, and the results demonstrated that the method can be used for the trace determination of HAAs in pork samples.

  17. Emploi et croissance | Page 17 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Le documentaire Forward Home, qui a été produit dans le cadre du projetAvantages découlant de la circulation des cerveaux des pays de la CARICOM ainsi que du tourisme et des investissements de la part de la diaspora caribéenne du CRDI, révèle la puissance économique de la diaspora caribéenne. Read more about ...

  18. Première de Forward Home, un documentaire sur la puissance ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    26 avr. 2016 ... Le documentaire Forward Home, qui a été produit dans le cadre du projetAvantages découlant de la circulation des cerveaux des pays de la CARICOM ainsi que du tourisme et des investissements de la part de la diaspora caribéenne du CRDI, révèle la puissance économique de la diaspora caribéenne.

  19. "Дева Маали" пожизненно обручена с Вейко Ыунпуу / Борис Тух

    Index Scriptorium Estoniae

    Тух, Борис, 1946-

    2010-01-01

    Eesti Filmiajakirjanike Ühingu poolt kinos "Sõprus" väljaantud auhindadest: parimaks filmiks tunnistati ja anti üle Neitsi Maali auhind ning rahaline preemia Veiko Õunpuu mängufilmile "Püha Tõnu kiusamine". Parima filmiajakirjaniku preemia sai Enn Säde ja eripreemia Ilmar Raag blogi "Ilmari jäljed liival enne vihmasadu" eest. Parimaks välisfilmiks valiti Laurent Cantet' film "Seinte vahel" (Prantsusmaa 2008)

  20. Targeting 2.5 versus 4 g/kg/day of amino acids for extremely low birth weight infants: a randomized clinical trial.

    Science.gov (United States)

    Burattini, Ilaria; Bellagamba, Maria Paola; Spagnoli, Cristina; D'Ascenzo, Rita; Mazzoni, Nadia; Peretti, Anna; Cogo, Paola E; Carnielli, Virgilio P

    2013-11-01

    To compare the effect of 2.5 vs 4 g/kg/d of amino acid (AA) in parenteral nutrition of extremely low birth weight infants on metabolic tolerance, short-term growth, and neurodevelopment. One hundred thirty-one infants with birth weight between 500 and 1249 g were randomized to 2.5 (standard AA [SAA] group) or 4 (high AA [HAA] group) g/kg/d AA intake, with equal nonprotein energy. The primary outcome was body size at 36 weeks. One hundred thirty-one patients were randomized and 114 analyzed (58 SAA group and 56 HAA group). Study groups had similar demographics and clinical characteristics. Elevated blood urea (BU >70 mg/dL = BU nitrogen >32.6 mg/dL) occurred in 24% vs 59% (P = .000) and hyperglycemia (>175 mg/dL) in 34% vs 11% (P = .003) of the SAA and HAA patients, respectively. Body weight, length, and head circumference at 36 weeks and 2 years were similar between groups. Bayley Scales of Infant and Toddler Development, Third Edition score was 94 ± 13 in the SAA group and 97 ± 15 in the HAA group (P = .35). The HAA group had higher BU levels and better glucose control. An extra 8 g/kg of AA over the first 10 days of life did not improve growth and neurodevelopment. Copyright © 2013 Mosby, Inc. All rights reserved.

  1. Konsum CAPM og CAPM anomalier: en empirisk studie av det amerikanske aksjemarkedet

    OpenAIRE

    Tennebeck, Kristoffer; Torgrimsen, Stian

    2015-01-01

    Er konsumbeta et bedre mål på systematisk risiko enn markedsbeta? I denne oppgaven sammenligner vi den konsumbaserte kapitalverdimodellen (CCAPM) med kapitalverdimodellen (CAPM) for å vurdere deres evne til å forklare forskjellige systematiske faktorer i aksjemarkedet, ved å sette måleperioden fra et kvartal til tilsvarende kvartal påfølgende år. Vi finner mer støtte for CCAPM enn for den tradisjonelle CAPM. nhhmas

  2. Publications | Page 19 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Le documentaire Forward Home, qui a été produit dans le cadre du projet Avantages découlant de la circulation des cerveaux des pays de la CARICOM ainsi que du tourisme et des investissements de la part de la diaspora caribéenne du CRDI, révèle la puissance économique de la diaspora caribéenne. De la ferme à la ...

  3. Genotoxicity and induction of DNA damage responsive genes by food-borne heterocyclic aromatic amines in human hepatoma HepG2 cells.

    Science.gov (United States)

    Pezdirc, Marko; Žegura, Bojana; Filipič, Metka

    2013-09-01

    Heterocyclic aromatic amines (HAAs) are potential human carcinogens formed in well-done meats and fish. The most abundant are 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-Amino-3,4,8-trimethyl-3H-imidazo[4,5-f]quinoxaline (4,8-DiMeIQx) and 2-Amino-3-methyl-3H-imidazo[4,5-f]quinoline (IQ). HAAs exert genotoxic activity after metabolic transformation by CYP1A enzymes, that is well characterized, however the genomic and intervening responses are not well explored. We have examined cellular and genomic responses of human hepatoma HepG2 cells after 24h exposure to HAAs. Comet assay revealed increase in formation of DNA strand breaks by PhIP, MeIQx and IQ but not 4,8-DiMeIQx, whereas increased formation of micronuclei was not observed. The four HAAs up-regulated expression of genes encoding metabolic enzymes CYP1A1, CYP1A2 and UGT1A1 and expression of TP53 and its downstream regulated genes CDKN1A, GADD45α and BAX. Consistent with the up-regulation of CDKN1A and GADD45α the cell-cycle analysis showed arrest in S-phase by PhIP and IQ, and in G1-phase by 4,8-DiMeIQx and MeIQx. The results indicate that upon exposure to HAAs the cells respond with the cell-cycle arrest, which enables cells to repair the damage or eliminate them by apoptosis. However, elevated expression of BCL2 and down-regulation of BAX may indicate that HAAs could suppress apoptosis meaning higher probability of damaged cells to survive and mutate. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Quantitative evaluation of interstitial pneumonia using 3D-curved high-resolution CT imaging parallel to the chest wall: A pilot study.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Umakoshi

    Full Text Available To quantify the imaging findings of patients with interstitial pneumonia (IP and emphysema using three-dimensional curved high-resolution computed tomography (3D-cHRCT at a constant depth from the chest wall, and compare the results to visual assessment of IP and each patient's diffusing capacity of the lungs for carbon monoxide (DLco.We retrospectively reviewed the axial CT findings and pulmonary function test results of 95 patients with lung cancer (72 men and 23 women, aged 45-84 years with or without IP, as follows: non-IP (n = 47, mild IP (n = 31, and moderate IP (n = 17. The 3D-cHRCT images of the lung at a 1-cm depth from the chest wall were reconstructed automatically using original software; total area (TA, high-attenuation area (HAA >-500 HU, and low-attenuation area (LAA <-950 HU were calculated on a workstation. The %HAA and %LAA were calculated as follows: [Formula: see text], and [Formula: see text].The %HAA and %LAA respective values were 3.2±0.9 and 27.7±8.2, 3.9±1.2 and 27.6±5.9, and 6.9±2.2 and 25.4±8.7 in non-IP, mild IP, and moderate IP patients, respectively. There were significant differences in %HAA between the 3 groups of patients (P<0.001, but no differences in %LAA (P = 0.558. Multiple linear regression analysis revealed that %HAA and %LAA were negatively correlated with predicted DLco (standard partial regression coefficient [b*] = -0.453, P<0.001; b* = -0.447, P<0.001, respectively.The %HAA and %LAA values computed using 3D-cHRCT were significantly correlated with DLco and may be important quantitative parameters for both IP and emphysema.

  5. Antioxidant Properties of Kynurenines: Density Functional Theory Calculations

    Science.gov (United States)

    2016-01-01

    Kynurenines, the main products of tryptophan catabolism, possess both prooxidant and anioxidant effects. Having multiple neuroactive properties, kynurenines are implicated in the development of neurological and cognitive disorders, such as Alzheimer's, Parkinson's, and Huntington's diseases. Autoxidation of 3-hydroxykynurenine (3HOK) and its derivatives, 3-hydroxyanthranilic acid (3HAA) and xanthommatin (XAN), leads to the hyperproduction of reactive oxygen species (ROS) which damage cell structures. At the same time, 3HOK and 3HAA have been shown to be powerful ROS scavengers. Their ability to quench free radicals is believed to result from the presence of the aromatic hydroxyl group which is able to easily abstract an electron and H-atom. In this study, the redox properties for kynurenines and several natural and synthetic antioxidants have been calculated at different levels of density functional theory in the gas phase and water solution. Hydroxyl bond dissociation enthalpy (BDE) and ionization potential (IP) for 3HOK and 3HAA appear to be lower than for xanthurenic acid (XAA), several phenolic antioxidants, and ascorbic acid. BDE and IP for the compounds with aromatic hydroxyl group are lower than for their precursors without hydroxyl group. The reaction rate for H donation to *O-atom of phenoxyl radical (Ph-O*) and methyl peroxy radical (Met-OO*) decreases in the following rankings: 3HOK ~ 3HAA > XAAOXO > XAAENOL. The enthalpy absolute value for Met-OO* addition to the aromatic ring of the antioxidant radical increases in the following rankings: 3HAA* < 3HOK* < XAAOXO* < XAAENOL*. Thus, the high free radical scavenging activity of 3HAA and 3HOK can be explained by the easiness of H-atom abstraction and transfer to O-atom of the free radical, rather than by Met-OO* addition to the kynurenine radical. PMID:27861556

  6. Potentially bioavailable natural organic carbon and hydrolyzable amino acids in aquifer sediments

    Science.gov (United States)

    Thomas, Lashun K.; Widdowson, Mark A.; Novak, John T.; Chapelle, Francis H.; Benner, Ronald; Kaiser, Karl

    2012-01-01

    This study evaluated the relationship between concentrations of operationally defined potentially bioavailable organic -carbon (PBOC) and hydrolyzable amino acids (HAAs) in sediments collected from a diverse range of chloroethene--contaminated sites. Concentrations of PBOC and HAA were measured using aquifer sediment samples collected at six selected study sites. Average concentrations of total HAA and PBOC ranged from 1.96 ± 1.53 to 20.1 ± 25.6 mg/kg and 4.72 ± 0.72 to 443 ± 65.4 mg/kg, respectively. Results demonstrated a statistically significant positive relationship between concentrations of PBOC and total HAA present in the aquifer sediment (p amino acids are known to be readily biodegradable carbon compounds, this relationship suggests that the sequential chemical extraction procedure used to measure PBOC is a useful indicator of bioavailable carbon in aquifer sediments. This, in turn, is consistent with the interpretation that PBOC measurements can be used for estimating the amount of natural organic carbon available for driving the reductive dechlorination of chloroethenes in groundwater systems.

  7. Genotoxicity of drinking water treated with different disinfectants and effects of disinfection conditions detected by umu-test.

    Science.gov (United States)

    Nie, Xuebiao; Liu, Wenjun; Zhang, Liping; Liu, Qing

    2017-06-01

    The genotoxicity of drinking water treated with 6 disinfection methods and the effects of disinfection conditions were investigated using the umu-test. The pretreatment procedure of samples for the umu-test was optimized for drinking water analysis. The results of the umu-test were in good correlation with those of the Ames-test. The genotoxicity and production of haloacetic acids (HAAs) were the highest for chlorinated samples. UV+chloramination is the safest disinfection method from the aspects of genotoxicity, HAA production and inactivation effects. For chloramination, the effects of the mass ratio of Cl 2 to N of chloramine on genotoxicity were also studied. The changes of genotoxicity were different from those of HAA production, which implied that HAA production cannot represent the genotoxic potential of water. The genotoxicity per chlorine decay of chlorination and chloramination had similar trends, indicating that the reaction of organic matters and chlorine made a great contribution to the genotoxicity. The results of this study are of engineering significance for optimizing the operation of waterworks. Copyright © 2016. Published by Elsevier B.V.

  8. Meie esimesed naisfotograafid / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika, 1974-

    2016-01-01

    Tallinna fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kuraatorid Betty Ester-Väljaots, Merili Reinpalu, kunstnik Lilian Juhkam. Eesti naisfotograafide Anna Kuke ja Evi Lembergi eluloolisi andmeid, nende looming

  9. Meie esimesed naisfotograafid / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika, 1974-

    2015-01-01

    Eesti naisfotograafid Hilja Riet ja Lydia Tarem. Fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kus tutvustatakse Hilja Rieti, Lydia Taremi, Anna Kuke ja Evi Lembergi loomingut. Näituse kuraatorid Betty Ester-Väljaots, Merili Reinpalu

  10. Breast cancer, heterocyclic aromatic amines from meat and N-acetyltransferase 2 genotype.

    Science.gov (United States)

    Delfino, R J; Sinha, R; Smith, C; West, J; White, E; Lin, H J; Liao, S Y; Gim, J S; Ma, H L; Butler, J; Anton-Culver, H

    2000-04-01

    Breast cancer risk has been hypothesized to increase with exposure to heterocyclic aromatic amines (HAAs) formed from cooking meat at high temperature. HAAs require enzymatic activation to bind to DNA and initiate carcinogenesis. N-acetyltransferase 2 (NAT2) enzyme activity may play a role, its rate determined by a polymorphic gene. We examined the effect of NAT2 genetic polymorphisms on breast cancer risk from exposure to meat by cooking method, doneness and estimated HAA [2-amino-1-methyl-6-phenylimidazole[4,5-b]pyridine (PhIP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) and 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline (DiMeIQx)] intake. Women were recruited with suspicious breast masses and questionnaire data were collected prior to biopsy to blind subjects and interviewers to diagnoses. For 114 cases with breast cancer and 280 controls with benign breast disease, NAT2 genotype was determined using allele-specific PCR amplification to detect slow acetylator mutations. HAAs were estimated from interview data on meat type, cooking method and doneness, combined with a quantitative HAA database. Logistic regression models controlled for known risk factors, first including all controls, then 108 with no or low risk (normal breast or no hyperplasia) and finally 149 with high risk (hyperplasia, atypical hyperplasia, complex fibroadenomas). Meat effects were examined within NAT2 strata to assess interactions. We found no association between NAT2 and breast cancer. These Californian women ate more white than red meat (control median 46 versus 8 g/day). There were no significant associations of breast cancer with red meat for any doneness. White meat was significantly protective (>67 versus chicken, including well done, pan fried and barbecued chicken. MeIQx and DiMeIQx were not associated with breast cancer. A protective effect of PhIP was confounded after controlling for well done chicken. Results were unchanged using low or high risk controls or dropping

  11. LA NOTION DE TORTURE, DE TRAITEMENTS INHUMAINS ET DEGRADANTS DANS LA JURISPRUDENCE DE LA COUR EUROPEENNE DES DROITS DE L’HOMME

    Directory of Open Access Journals (Sweden)

    Jean-Paul Céré

    2017-03-01

    Full Text Available En vertu de l'article 3 de la Convention européenne de sauvegarde des droits de l'homme, les Etats ne peuvent ni pratiquer la torture ni infliger des traitements inhumains ou dégradants. Le particularisme de cette convention par rapport aux autres textes internationaux ou régionaux relatifs aux droits de l’homme réside indéniablement dans le système de protection existant qu’elle a organisé. Un organe juridictionnel, la cour européenne des droits de l’homme, est en charge de sanctionner les Etats qui ne respectent la Convention. Au terme d’une jurisprudence novatrice et évolutive, la cour européenne des droits de l’homme impose de plus en plus efficacement de lutter contre la torture, les traitements inhumains et dégradants.

  12. Rakendav rahulolematus / Enn Soosaar

    Index Scriptorium Estoniae

    Soosaar, Enn, 1937-2010

    2007-01-01

    Autor arutleb parteide valijate üle Riigikogu valimistel ja leiab, et Riigikogu koosseis oleneb suurel määral sellest, kuivõrd suudavad erakonnad võita Res Publicas pettunud ja muidu rahulolematute valijate poolehoidu

  13. Kes volitas? / Enn Vatter

    Index Scriptorium Estoniae

    Vatter, Enn

    2009-01-01

    Autor tõstatab küsimuse, kes volitas 20% töötajaskonnast hõlmava Tööandjate keskliidu ja 5-7% kaasava Ametiühingute keskliidu töölepinguseaduse küsimustes neisse institutsioonidesse mittekuuluva töötajaskonna, st. ligi 80% Eestis tööga hõivatuid esindama, tingimusi seadma, kokkuleppeid sõnastama ja sõlmima

  14. Koolitaja kogemus / Enn Siim

    Index Scriptorium Estoniae

    Siim, Enn

    2002-01-01

    Vene koolide õpetajate täienduskoolitusprobleeme, integratsiooniprobleemide lahendamisest Kanada hariduses, humanistliku pedagoogika rakendamisest Tallinna Ümera Põhikoolis ja Venemaal Peterburi koolides. Eestis on loodud Humanistliku Pedagoogika Selts, humanistliku pedagoogika asjatundja Venemaal on pedagoogikadoktor professor Šalva Amonašvili

  15. Pahaendeline pragmatism / Enn Soosaar

    Index Scriptorium Estoniae

    Soosaar, Enn, 1937-2010

    2008-01-01

    Vana Maailma kõlbeline kollaps oli see, mis lasi Euroopas tekkida ja võimust võtta XX sajandi totalitaarsetel režiimidel. Ohtu peame tajuma siis, kui huvide taha peidetakse riigi imperialistlikud ambitsioonid või merkantiilne saamahimu. Ilmunud ka Lääne Elu 18. okt. lk. 2

  16. Põud : [luuletused] / Enn Tuuling

    Index Scriptorium Estoniae

    Tuuling, Enn

    2002-01-01

    Sisu: Põud ; Aian ; Inne pikset ; Süküsõdang tarõn ; Üü tulek ; Rebäse külä vana sann ; Vana maja ; "Kes oll̀ tuu miis, kes sinno ehit ..." ; Pööningul ; Talv 1960/61. Eluloolisi andmeid autori kohta lk. 358-359

  17. [Formation and changes of regulated trihalomethanes and haloacetic acids in raw water of Yangtze River, Huangpu River and different treatment processes and pipelines network].

    Science.gov (United States)

    Chen, Xin; Zhang, Dong; Lu, Yin-hao; Zheng, Wei-wei; Wu, Yu-xin; Wei, Xiao; Tian, Da-jun; Wang, Xia; Zhang, Hao; Guo, Shuai; Jiang, Song-hui; Qu, Wei-dong

    2010-10-01

    To investigate the pollutant levels of regulated disinfection by-products trihalomethanes (THMs) and haloacetic acids (HAAs) in raw water from the Huangpu River, the Yangtze River and different treatment processes and finished water, and to explore the changes tendency in transmission and distribution pipeline network. A total of 65 ml water samples with two replicates were collected from different raw water, corresponding treatment processes, finished water and six national surveillance points in main network of transmission and distribution, water source for A water plant and B, C water plant was the Huangpu River and the Yangtze River, respectively. Regulated THMs and HAAs above water samples were detected by gas chromatography. The total trihalomethanes (THM(4)) concentration in different treatment processes of A water plant was ND-9.64 µg/L, dichlorobromomethane was the highest (6.43 µg/L). The THM(4) concentration in B and C water plant was ND to 38.06 µg/L, dibromochloromethane (12.24 µg/L) and bromoform (14.07 µg/L) were the highest in the B and the C water plant respectively. In addition to trichloroacetic acid in A water plant from the raw water, the other HAAs came from different treatment processes. The total haloacetic acids (HAA(6)) concentration of different treated processes in A water plant was 3.21 - 22.97 µg/L, mobromoacetic acid (10.40 µg/L) was the highest. Dibromoacetic acid was the highest both in B (8.25 µg/L) and C (8.84 µg/L) water plant, HAA(6) concentration was ND to 27.18 µg/L. The highest and the lowest concentration of THM(4) were found from the main distribution network of C and A water plant respectively, but the concentration of HAA(6) in the main water pipes network of A water plant was the highest, and the lowest in C water plant. The THMs concentration was 21.11 - 31.18 µg/L in C water plant and 6.72 - 8.51 µg/L in A water plant. The concentration of HAA(6) was 25.02 - 37.31 µg/L in A water plant and 18.69 - 23

  18. Purification and Characterization of Hemagglutinating Proteins from Poker-Chip Venus (Meretrix lusoria and Corbicula Clam (Corbicula fluminea

    Directory of Open Access Journals (Sweden)

    Chin-Fu Cheng

    2012-01-01

    Full Text Available Hemagglutinating proteins (HAPs were purified from Poker-chip Venus (Meretrix lusoria and Corbicula clam (Corbicula fluminea using gel-filtration chromatography on a Sephacryl S-300 column. The molecular weights of the HAPs obtained from Poker-chip Venus and Corbicula clam were 358 kDa and 380 kDa, respectively. Purified HAP from Poker-chip Venus yielded two subunits with molecular weights of 26 kDa and 29 kDa. However, only one HAP subunit was purified from Corbicula clam, and its molecular weight was 32 kDa. The two Poker-chip Venus HAPs possessed hemagglutinating ability (HAA for erythrocytes of some vertebrate animal species, especially tilapia. Moreover, HAA of the HAP purified from Poker-chip Venus was higher than that of the HAP of Corbicula clam. Furthermore, Poker-chip Venus HAPs possessed better HAA at a pH higher than 7.0. When the temperature was at 4°C–10°C or the salinity was less than 0.5‰, the two Poker-chip Venus HAPs possessed better HAA compared with that of Corbicula clam.

  19. Halogenating reaction activity of aromatic organic compounds during disinfection of drinking water

    International Nuclear Information System (INIS)

    Guo Gaimei; Chen Xiaodong

    2009-01-01

    The halogenating reactions of five aromatic organic compounds (AOCs) with aqueous chlorine (HOCl/OCl - ) and aqueous bromine (HOBr/OBr - ) were studied with an aim to compare the formation properties of haloacetic acids (HAAs) for the corresponding chlorination or bromination reactions of AOCs, respectively. The experiment results indicated that the HAAs substitution efficiency for the bromination reactions of AOCs was greater than that for the chlorination reactions, and the formation of HAAs had a strong dependence on the chemical structure of AOCs. The chlorination or bromination reaction activities for the AOCs with electron donating functional groups were higher than that for them with electron withdrawing functional groups. The kinetic experiments indicated that the reactions of aqueous bromine with phenol were faster than those of aqueous chlorine with phenol and the halogen consumption exhibited rapid initial and slower consumption stages for the reactions of phenol with aqueous chlorine and bromine, respectively. In addition, the HAAs production for the chlorination reaction of phenol decreased with the increase of pH. These conclusions could provide the valuable information for the effective control of the disinfection by-products during drinking water treatment operation

  20. Family Reintegration Following Guard Deployment

    Science.gov (United States)

    2010-09-20

    Somalia Peacekeepers. Journal of Consulting and Clinical Psychology, 72(5), 909-913. Haas DM . Pazdernik LA. Olsen CH. A cross-sectional survey of the...relationship between partner deployment and stress in pregnancy during wartime. Haas DM . Pazdernik LA. Partner deployment and stress in pregnant...Identify 3-5 key words relating to the proposal. (Required) I used MESH Headings instead of the CRISP Thesaurus for key

  1. Separation of beryllium and mercury from lithium chloride solution by gaseous extraction

    International Nuclear Information System (INIS)

    Sevast'yanov, A.I.; Chepovol, V.I.

    1989-01-01

    The possibility is shown of extracting beryllium and mercury by acetylacetone (HAA) from lithium chloride solution by passing argon through the solution and the optimum conditions have been determined. The dependence of the degree of extraction and the distribution coefficients on various parameters of the liquid phase are presented, viz. the initial pH value, the lithium chloride concentration, and the initial HAA content

  2. Improving methodological aspects of the analysis of five regulated haloacetic acids in water samples by solid-phase extraction, ion-pair liquid chromatography and electrospray tandem mass spectrometry.

    Science.gov (United States)

    Prieto-Blanco, M C; Alpendurada, M F; López-Mahía, P; Muniategui-Lorenzo, S; Prada-Rodríguez, D; Machado, S; Gonçalves, C

    2012-05-30

    Haloacetic acids (HAAs) are organic pollutants originated from the drinking water disinfection process, which ought to be controlled and minimized. In this work a method for monitoring haloacetic acids (HAAs) in water samples is proposed, which can be used in quality control laboratories using the techniques most frequently available. Among its main advantages we may highlight its automated character, including minimal steps of sample preparation, and above all, its improved selectivity and sensitivity in the analysis of real samples. Five haloacetic acids (HAA5) were analyzed using solid-phase extraction (SPE) combined with ion-pair liquid chromatography and tandem mass spectrometry. For the optimization of the chromatographic separation, two amines (triethylamine, TEA and dibutylamine, DBA) as ion pair reagents were compared, and a better selectivity and sensitivity was obtained using DBA, especially for monohaloacetic acids. SPE conditions were optimized using different polymeric adsorbents. The electrospray source parameters were studied for maximum precursor ion accumulation, while the collision cell energy of the triple quadrupole mass spectrometer was adjusted for optimum fragmentation. Precursor ions detected were deprotonated, dimeric and decarboxylated ions. The major product ions formed were: ionized halogen atom (chloride and bromide) and decarboxylated ions. After enrichment of the HAAs in Lichrolut EN adsorbent, the limits of detection obtained by LC-MS/MS analysis (between 0.04 and 0.3 ng mL(-1)) were comparable to those obtained by GC-MS after derivatization. Linearity with good correlation coefficients was obtained over two orders of magnitude irrespective of the compound. Adequate recoveries were achieved (60-102%), and the repeatability and intermediate precision were in the range of 2.4-6.6% and 3.8-14.8%, respectively. In order to demonstrate the usefulness of the method for routine HAAs monitoring, different types of water samples were

  3. Embolization of Isolated Hypogastric Artery Aneurysm: A Case Report and a Review of the Literature

    International Nuclear Information System (INIS)

    Medici, Lorenzo de; Bucci, Federico; Nesi, Fabrizio; Rabitti, Giorgio

    2006-01-01

    A 75-year-old man with arterial hypertension, coronary artery disease, and myocardial infarction was referred to our service because of an asymptomatic hypogastric artery aneurysm (HAA) detected by a routine compued tomography (CT) scan. As shown on the angio-CT the maximum transverse diameter (m.t.d.) of the HAA was 47 mm. There were no symptoms of distal embolization or compression on the pelvic structures. We performed the successful complete thrombosis of the aneurysm using vascular plugs via a controlateral femoral approach. The control angiogram was satisfactory and there were no intraoperative complications. A CT-angiography done 4 months after the procedure showed no signs of refilling of the aneurysm sac. This case illustrates some possible advantages of vascular plugs in the treatment of isolated HAA

  4. Search of new scintillation materials for nuclear medicine application

    CERN Document Server

    Korzhik, M

    2001-01-01

    Oxide crystals have a great potential to develop new advanced scintillation materials which are dense, fast, and bright. This combination of parameters, when combined to affordable price, gives a prospect for materials to be applied in nuclear medicine devices. Some of them have been developed for the last two decades along the line of rear-earth (RE) garnet (RE//3Al//5O//1//2) oxiorthosilicate (RE//2SiO//5) and perovskite (REAlO//3) crystals doped with Ce ions. Among recently developed oxide materials the lead tungstate scintillator (PWO) becomes the most used scintillation materials in high energy physics experiments due to its application in CMS and ALICE experiments at LHC. In this paper we discuss scintillation properties of some new heavy compounds doped with Ce as well as light yield improvement of PWO crystals to apply them in low energy physics and nuclear medicine. 18 Refs.

  5. GRAPHICAL DETERMINATION OF DISSOCIATION CONSTANT ...

    African Journals Online (AJOL)

    DR. AMINU

    conform to the general equation of straight – line graph; y = mx + c, where y = pH, m = slope, x = log. [HA]/[A] and C = intercept = pKa. Thus the pKa is obtained as the intercept of the graph of pH versus – log [HA]/[A] as shown in Figures 1,2 and 3 for glycine, alanine and valine respectively. The values obtained were 9.87 ...

  6. Gutters lesing på nett : lesing og motivasjon

    OpenAIRE

    Sætersmoen, Margrethe

    2010-01-01

    Mastergradsoppgave i språk, kultur og digital kommunikasjon, Avdeling for lærerutdanning og naturvitenskap, Høgskolen i Hedmark, 2010 Norsk: Det overordnede temaet for min avhandling er ungdomsskolegutters motivasjon for lesing av digitale tekster. Mye av guttenes lesing på fritiden, foregår på skjerm. Hver dag leser de ut fra mange forskjellige motiv, likevel viser store leseundersøkelser som PISA og PIRLS at unge gutter leser mindre enn jenter, de leser dårligere enn jenter, og er mindre...

  7. Occupational Exposures and Subclinical Interstitial Lung Disease. The MESA (Multi-Ethnic Study of Atherosclerosis) Air and Lung Studies.

    Science.gov (United States)

    Sack, Coralynn S; Doney, Brent C; Podolanczuk, Anna J; Hooper, Laura G; Seixas, Noah S; Hoffman, Eric A; Kawut, Steven M; Vedal, Sverre; Raghu, Ganesh; Barr, R Graham; Lederer, David J; Kaufman, Joel D

    2017-10-15

    The impact of a broad range of occupational exposures on subclinical interstitial lung disease (ILD) has not been studied. To determine whether occupational exposures to vapors, gas, dust, and fumes (VGDF) are associated with high-attenuation areas (HAA) and interstitial lung abnormalities (ILA), which are quantitative and qualitative computed tomography (CT)-based measurements of subclinical ILD, respectively. We performed analyses of participants enrolled in MESA (Multi-Ethnic Study of Atherosclerosis), a population-based cohort aged 45-84 years at recruitment. HAA was measured at baseline and on serial cardiac CT scans in 5,702 participants. ILA was ascertained in a subset of 2,312 participants who underwent full-lung CT scanning at 10-year follow-up. Occupational exposures were assessed by self-reported VGDF exposure and by job-exposure matrix (JEM). Linear mixed models and logistic regression were used to determine whether occupational exposures were associated with log-transformed HAA and ILA. Models were adjusted for age, sex, race/ethnicity, education, employment status, tobacco use, and scanner technology. Each JEM score increment in VGDF exposure was associated with 2.64% greater HAA (95% confidence interval [CI], 1.23-4.19%). Self-reported vapors/gas exposure was associated with an increased odds of ILA among those currently employed (1.76-fold; 95% CI, 1.09-2.84) and those less than 65 years old (1.97-fold; 95% CI, 1.16-3.35). There was no consistent evidence that occupational exposures were associated with progression of HAA over the follow-up period. JEM-assigned and self-reported exposures to VGDF were associated with measurements of subclinical ILD in community-dwelling adults.

  8. Technical expertise on the safety of the proposed geological repository sites. Planning for geological deep repositories, step 1; Sicherheitstechnisches Gutachten zum Vorschlag geologischer Standortgebiete. Sachplan geologische Tiefenlager, Etappe 1

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2010-01-15

    On October 17, 2010, on request of those Swiss government institutions responsible for the disposal of radioactive wastes, the National Co-operative for the Disposal of Radioactive Waste (NAGRA) presented its project concerning geological sites for the foreseen disposal of radioactive wastes to the Federal Authorities. According to the present disposal concept, two types of repository are foreseen: one for highly radioactive wastes (HAA) and the other for low radioactive and intermediate-level radioactive wastes (SMA). If a site fulfils the necessary conditions for both HAA as well as for SMA, a combined site for both types of waste may be chosen. As a qualified control authority in Switzerland, the Federal Nuclear Safety Inspectorate (ENSI) has to examine the quality of the NAGRA proposals from the point of view of the nuclear safety of the sites. The project for deep underground waste disposal first defines the process and the criteria according to which sites for the geological storage of all types of radioactive wastes in Switzerland have to be chosen. The choice is based on the actual knowledge of Swiss geology. After dividing the wastes into SMA and HAA, some large-scale areas are to be identified according to their suitability from the geological and tectonic points of view. NAGRA's division of waste into SMA and HAA is based on calculations of the long-term safety for a broad range of different rock types and geological situations and takes the different properties of all waste types into account. As a conclusion, a small portion of SMA has to be stored with {alpha}-toxic wastes in the HAA repository. The estimation of the total volume of wastes to be stored is based on 60 years of operation of the actual nuclear power plants, augmented with the wastes from possible replacement plants with a total power of 5 GW{sub e} during a further 60 years. The safety concept of the repository is based on passive systems using technical and natural barriers. The

  9. Seasonal evaluation of the presence of 46 disinfection by-products throughout a drinking water treatment plant

    Energy Technology Data Exchange (ETDEWEB)

    Serrano, Maria; Montesinos, Isabel; Cardador, M.J.; Silva, Manuel; Gallego, Mercedes, E-mail: mercedes.gallego@uco.es

    2015-06-01

    In this work, we studied a total of 46 regulated and non-regulated disinfection by-products (DBPs) including 10 trihalomethanes (THMs), 13 haloacetic acids (HAAs), 6 halonitromethanes (HNMs), 6 haloacetonitriles (HANs) and 11 aldehydes at different points in a drinking water treatment plant (DWTP) and its distribution network. Determining an increased number of compounds and using accurate, sensitive analytical methodologies for new DBPs can be useful to overcome some challenges encountered in the comprehensive assessment of the quality and safety of drinking water. This paper provides a detailed picture of the spatial and seasonal variability of DBP concentrations from raw water to distribution network. Samples were collected on a monthly basis at seven different points in the four seasons of a year to acquire robust data for DBPs and supplementary quality-related water parameters. Only 5 aldehydes and 2 HAAs were found in raw water. Chlorine dioxide caused the formation of 3 new aldehydes (benzaldehyde included), 5 HAAs and chloroform. The concentrations of DBPs present in raw water were up to 6 times higher in the warmer seasons (spring and summer). The sedimentation process further increased their concentrations and caused the formation of three new ones. Sand filtration substantially removed aldehydes and HAAs (15–50%), but increased the levels of THMs, HNMs and HANs by up to 70%. Chloramination raised the levels of 8 aldehydes and 7 HAAs; also, it caused the formation of monoiodoacetic acid, dibromochloromethane, dichloroiodomethane and bromochloroacetonitrile. Therefore, this treatment increases the levels of existing DBPs and leads to the formation of new ones to a greater extent than does chlorine dioxide. Except for 5 aldehydes, the 23 DBPs encountered at the DWTP exit were found at increased concentrations in the warmer seasons (HAAs by about 50% and THMs by 350%). - Highlights: • Occurrence of 46 regulated and non-regulated DBPs through a DWTP was

  10. Seasonal evaluation of the presence of 46 disinfection by-products throughout a drinking water treatment plant

    International Nuclear Information System (INIS)

    Serrano, Maria; Montesinos, Isabel; Cardador, M.J.; Silva, Manuel; Gallego, Mercedes

    2015-01-01

    In this work, we studied a total of 46 regulated and non-regulated disinfection by-products (DBPs) including 10 trihalomethanes (THMs), 13 haloacetic acids (HAAs), 6 halonitromethanes (HNMs), 6 haloacetonitriles (HANs) and 11 aldehydes at different points in a drinking water treatment plant (DWTP) and its distribution network. Determining an increased number of compounds and using accurate, sensitive analytical methodologies for new DBPs can be useful to overcome some challenges encountered in the comprehensive assessment of the quality and safety of drinking water. This paper provides a detailed picture of the spatial and seasonal variability of DBP concentrations from raw water to distribution network. Samples were collected on a monthly basis at seven different points in the four seasons of a year to acquire robust data for DBPs and supplementary quality-related water parameters. Only 5 aldehydes and 2 HAAs were found in raw water. Chlorine dioxide caused the formation of 3 new aldehydes (benzaldehyde included), 5 HAAs and chloroform. The concentrations of DBPs present in raw water were up to 6 times higher in the warmer seasons (spring and summer). The sedimentation process further increased their concentrations and caused the formation of three new ones. Sand filtration substantially removed aldehydes and HAAs (15–50%), but increased the levels of THMs, HNMs and HANs by up to 70%. Chloramination raised the levels of 8 aldehydes and 7 HAAs; also, it caused the formation of monoiodoacetic acid, dibromochloromethane, dichloroiodomethane and bromochloroacetonitrile. Therefore, this treatment increases the levels of existing DBPs and leads to the formation of new ones to a greater extent than does chlorine dioxide. Except for 5 aldehydes, the 23 DBPs encountered at the DWTP exit were found at increased concentrations in the warmer seasons (HAAs by about 50% and THMs by 350%). - Highlights: • Occurrence of 46 regulated and non-regulated DBPs through a DWTP was

  11. Developing the Navy’s NC Flying Boats: Transforming Aeronautical Engineering for the First Transatlantic Flight

    Science.gov (United States)

    2011-12-01

    Silberg , David J. Haas w ^m^e^ä^ Approved for Public Release; distribution is unlimited. f REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188...PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Eric Silberg , David Haas 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 99-2-5300-010-12 17...THIS PAGE UNCLASSIFIED 17. LIMITATION OF ABSTRACT UL 18. NUMBER OF PAGES 2 7 19a. NAME OF RESPONSIBLE PERSON Eric Silberg 19b. TELEPHONE

  12. Glutamate signalling and secretory phospholipase A2 modulate the release of arachidonic acid from neuronal membranes

    DEFF Research Database (Denmark)

    Rodriguez De Turco, Elena B; Jackson, Fannie R; DeCoster, Mark A

    2002-01-01

    The lipid mediators generated by phospholipases A(2) (PLA(2)), free arachidonic acid (AA), eicosanoids, and platelet-activating factor, modulate neuronal activity; when overproduced, some of them become potent neurotoxins. We have shown, using primary cortical neuron cultures, that glutamate...... and secretory PLA(2) (sPLA(2)) from bee venom (bv sPLA(2)) and Taipan snake venom (OS2) elicit synergy in inducing neuronal cell death. Low concentrations of sPLA(2) are selective ligands of cell-surface sPLA(2) receptors. We investigated which neuronal arachidonoyl phospholipids are targeted by glutamate......) and in minor changes in other phospholipids. A similar profile, although of greater magnitude, was observed 20 hr posttreatment. Glutamate (80 microM) induced much less mobilization of (3)H-AA than did sPLA(2) and resulted in a threefold greater degradation of (3)H-AA PE than of (3)H-AA PC by 20 hr...

  13. Dietary exposure to heterocyclic amines in a Chinese population.

    Science.gov (United States)

    Wong, Kin-Yoke; Su, Jin; Knize, Mark G; Koh, Woon-Puay; Seow, Adeline

    2005-01-01

    Heterocyclic aromatic amines (HAAs) formed in meat during high-temperature cooking have been associated with risk of colorectal and breast cancer. Incidence of these cancers is increasing in Singapore, a country with 77% ethnic Chinese. The purpose of this study was to estimate HAA levels in the Chinese diet and individual levels of exposure to these compounds because little is known. Twenty-five samples (each pooled from three sources) of meat and fish, cooked as commonly consumed, were analyzed by high-performance liquid chromatography for concentrations (ng/g) of 2-amino-3-methylimidazo[4,5-f]quinoline, 2-amino-3, 4-dimethylimidazo[4,5-f]quinoline (MeIQ), 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3, 4,8-trimethylimidazo[4,5-f]quinoxaline (4,8-DiMeIQx), 2- amino-3,7,8-trimethylimidazo[4,5-f]quinoxaline, 2-amino -1,6-dimethylfuro[3,2-e]imidazo[4,5-b]pyridine, and 2- amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). Dietary meat consumption data (g/day), including meat type and cooking method, were gathered from food-frequency questionnaires completed by 497 randomly sampled Chinese men and women aged 20-59 yr. PhIP, MeIQx, and 4,8-DiMeIQx were the most abundant HAAs detected. Total HAA concentrations ranged from roasted pork had the highest levels. The estimated mean daily exposure to HAA was 49.95 ng/day (P10 14.0 ng/day, P90 95.8 ng/day); this was 50% higher among younger (20-39 yr) compared with older individuals. Seven specific meat-cooking method combinations contributed 90.1% of this intake, namely, pan-fried fish, pork, and chicken, deep-fried chicken as well as fish, roasted/barbecued pork, and grilled minced beef.

  14. Entre conservation et développement : les évolutions récentes de la politique européenne des pêches dans les régions ultrapériphériques de la Caraïbe Between conservation and development: recent developments in European fisheries policy in the outermost regions of the Caribbean

    Directory of Open Access Journals (Sweden)

    Pierre Angelelli

    2012-05-01

    Full Text Available L’Union Européenne opère actuellement la seconde révision de sa politique de la pêche depuis la création de celle-ci, en 1970. Instituée pour développer la pêche maritime et garantir un revenu aux pêcheurs, la politique commune de la pêche (PCP s’est orientée progressivement vers la protection des espèces et de l’environnement marin. Pour cela, elle a sacrifié une part importante du secteur productif, mais a échoué et, avec le déclin de la pêche en Europe, les régions ultrapériphériques de la Caraïbe (RUP-C ont gagné en importance relative dans ce domaine. Elles représentent aujourd’hui près de 30% de la flotte nationale et les fondements malthusiens de la PCP ne sont plus adaptés à leurs caractéristiques : ressources halieutiques, développement économique, emplois, sécurité des approvisionnements alimentaires, etc. La réforme actuellement en cours, qui devrait aboutir avant 2012, offre peut-être une alternative aux RUP-C permettant la mise en œuvre des mesures spécifiques en application de l’article 349 du Traité sur le Fonctionnement de l’Union Européenne.The European Union currently operates the second reform of its Common Fisheries Policy since its creation in 1970. Established to develop the fisheries and provide incomes for fishermen, the Common Fisheries Policy (CFP was directed gradually towards the protection of the species and the marine environment.To do this, it sacrificed a large part of the productive sector, but failed, and with the decline of fisheries in Europe, the outermost regions of the Caribbean gained relative importance in this field. They now account for nearly 30% of the national fleet and the Malthusians bases of the CFP are not suited any more to their characteristics: fisheries resources, economic development, jobs, security of food supply, etc. The ongoing reform, which should be in force before 2012, may offer an alternative to the outermost regions of the Caribbean

  15. Evaluation of Drinking Water Disinfectant Byproducts Compliance Data as an Indirect Measure for Short-Term Exposure in Humans.

    Science.gov (United States)

    Parvez, Shahid; Frost, Kali; Sundararajan, Madhura

    2017-05-20

    In the absence of shorter term disinfectant byproducts (DBPs) data on regulated Trihalomethanes (THMs) and Haloacetic acids (HAAs), epidemiologists and risk assessors have used long-term annual compliance (LRAA) or quarterly (QA) data to evaluate the association between DBP exposure and adverse birth outcomes, which resulted in inconclusive findings. Therefore, we evaluated the reliability of using long-term LRAA and QA data as an indirect measure for short-term exposure. Short-term residential tap water samples were collected in peak DBP months (May-August) in a community water system with five separate treatment stations and were sourced from surface or groundwater. Samples were analyzed for THMs and HAAs per the EPA (U.S. Environmental Protection Agency) standard methods (524.2 and 552.2). The measured levels of total THMs and HAAs were compared temporally and spatially with LRAA and QA data, which showed significant differences ( p water stations showed higher levels than LRAA or QA. Significant numbers of samples in surface water stations exceeded regulatory permissible limits: 27% had excessive THMs and 35% had excessive HAAs. Trichloromethane, trichloroacetic acid, and dichloroacetic acid were the major drivers of variability. This study suggests that LRAA and QA data are not good proxies of short-term exposure. Further investigation is needed to determine if other drinking water systems show consistent findings for improved regulation.

  16. Conformational and mechanical changes of DNA upon transcription factor binding detected by a QCM and transmission line model.

    Science.gov (United States)

    de-Carvalho, Jorge; Rodrigues, Rogério M M; Tomé, Brigitte; Henriques, Sílvia F; Mira, Nuno P; Sá-Correia, Isabel; Ferreira, Guilherme N M

    2014-04-21

    A novel quartz crystal microbalance (QCM) analytical method is developed based on the transmission line model (TLM) algorithm to analyze the binding of transcription factors (TFs) to immobilized DNA oligoduplexes. The method is used to characterize the mechanical properties of biological films through the estimation of the film dynamic shear moduli, G and G, and the film thickness. Using the Saccharomyces cerevisiae transcription factor Haa1 (Haa1DBD) as a biological model two sensors were prepared by immobilizing DNA oligoduplexes, one containing the Haa1 recognition element (HRE(wt)) and another with a random sequence (HRE(neg)) used as a negative control. The immobilization of DNA oligoduplexes was followed in real time and we show that DNA strands initially adsorb with low or non-tilting, laying flat close to the surface, which then lift-off the surface leading to final film tilting angles of 62.9° and 46.7° for HRE(wt) and HRE(neg), respectively. Furthermore we show that the binding of Haa1DBD to HRE(wt) leads to a more ordered and compact film, and forces a 31.7° bending of the immobilized HRE(wt) oligoduplex. This work demonstrates the suitability of the QCM to monitor the specific binding of TFs to immobilized DNA sequences and provides an analytical methodology to study protein-DNA biophysics and kinetics.

  17. Inhibitory effect of cellulose fibers on the formation of heterocyclic aromatic amines in grilled beef patties.

    Science.gov (United States)

    Gibis, Monika; Weiss, Jochen

    2017-08-15

    Microcrystalline cellulose (MCC) or carboxymethyl cellulose (CMC) can be used as fat replacers; both are nondigestible fibers. As water-holding compounds, the impact of added CMC or MCC was studied concerning the formation of heterocyclic amines (HAAs). Low-fat patties with 0.5-3% MCC/CMC were prepared using 90% of beef and 10% of an aqueous fiber dispersion and were determined for HAA-levels after grilling. The HAAs in patties containing CMC(MCC) were found in the following concentrations; MeIQx (2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline) 0.6-2.7 (0.9-3.3)ng/g, 4,8-DiMeIQx (2-Amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline) n.d.-1.5 (n.d.-2.2)ng/g and PhIP (2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine) 0.03-0.3 (0.06-0.2)ng/g. The patties clearly contained lower HAA-levels with increasing addition of CMC or MCC. A continuous increase of the concentrations of comutagenic harman was observed (CMC: 1.2-13.2; MCC: 5.2-11.4ng/g) for increasing levels of fibers and a slight decrease of the content of norharman for MCC (0.5-1.6ng/g). No clear tendency was found for norharman using CMC (0.3-1.1ng/g). Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. 60 aastat tagasi / Enn Sarv

    Index Scriptorium Estoniae

    Sarv, Enn, 1921-2008

    2004-01-01

    Eesti Vabariigi Rahvuskomitee tegevusest Teise maailmasõja lõpuperioodil, 1944. aasta sõjategevusest Eestis ja suurest põgenemisest Läände ning metsavendlusest. Lisad: prof. J. Uluotsa kõne 19. augustil 1944 : kokkuvõte ; Eesti Vabariigi Rahvuskomitee pöördumine : Talllinnas, 1. augustil 1944. a. ; Eesti Vabariigi Rahvuskomitee : korraldus nr.1 ; Eesti Vabariigi Rahvuskomitee : korraldus nr. 2

  19. Aleksei Nõu eluloost / Enn Nõu

    Index Scriptorium Estoniae

    Nõu, Enn, 1933-

    2006-01-01

    Sisaldab ka kahte luuletust: A. Nõu, A. Anton, K. Rakmann,¡ H. Rothberg. Tervitus Eestimaale Siberist. (Ilmunud: Siberi Asunik (Tomsk), 1919, nr. 32) ;¡ A. Nõu. Vaikne sadam. Kirjutatud Omskis, 1919

  20. Post enne modernismi / Mari Laaniste

    Index Scriptorium Estoniae

    Laaniste, Mari, 1977-

    2007-01-01

    Laurence Sterne'i romaani ainetel loodud komöödiafilm "Tristram Shandy - härrasmehe paljastused" ("A Cock and Bull Story") : stsenarist Frank Cottrell Boyce : režissöör Michael Winterbottom : peaosas Steve Coogan : Suurbritannia 2005. Lühiandmed ka Steve Coogani kohta

  1. Kõik algaski Otsal / Enn Nõu

    Index Scriptorium Estoniae

    Nõu, Enn, 1933-

    2012-01-01

    Arvustus: Aksel, Anu. Landkänning : brevväxling mellan Anu och Aksel Mark under deras första år som flyktingar från Estland 1944-1945. Stockholm : Bokverksta, 2008 ; Mark, Aksel. Allt började på Otsa : minnen från min barndom och skolåren. Stockholm : Beijer bok & skog, 2011

  2. Unistused muudavad maailma / Enn Tammearu

    Index Scriptorium Estoniae

    Tammearu, Enn

    2000-01-01

    Rocca al Mare koolimaja ehitamisest, AS KGM Ehitus meeskonnast ja juhatuse esimehest Tiit Nurklikust. Projekti autor: AB Urbel & Peil. Arhitektid Emil Urbel, Indrek Erm, sisearhitekt Taso Mähar, projektijuht Ivar Aus. Konstruktiivne osa: E-Inseneribüroo. Kooli direktori Rein Rebase, I. Ausi, I. Ermi ja T. Nurkliku kommentaarid. Nr. 11, lk. 4-6: Rocca al Mare koolile 2000. a. parima betoonehitise tiitel. Akustik Linda Madalik. Monoliitbetoonitööd: AS Roxor Ehitus. Arvamust avaldavad: T. Nurklik, I. Erm, OÜ Roxoe Ehituse tehniline juht Kalev Ramjalg, žürii esimees Aadu Kana

  3. Fontesel uued omanikud / Enn Salu

    Index Scriptorium Estoniae

    Salu, Enn

    2005-01-01

    Konsultatsiooni- ja personaliotsingufirma Fontese viis juhtivkonsultanti ja pearaamatupidaja ostsid Fontes PMP selle asutajalt Tõnis Arrolt, kes jääb edasi firma nõukokku. Diagramm: Fontes kasvab kiirelt

  4. Kremlisse ja Kremlis / Enn Tõugu

    Index Scriptorium Estoniae

    Tõugu, Enn, 1935-

    2016-01-01

    Tallinna Inseneride Majast. Autor jutustab oma teest Kremlisse ehk kuidas ta saadikuks sai, Andrei Sahharovist, MRP materjalide levitamisest. Nõukogude Liidu Ülemnõukogu transpordi, Side ja informaatika komisjonist. Ševardnadze kõnest 1990. aasta detsembris

  5. Prospects for Closer Israeli-NATO Cooperation

    Science.gov (United States)

    2015-09-01

    Actions and Arab Perceptions.” In The Middle East and the United States, 5th ed., edited by David W. Lesch and Mark L. Haas, 177–96. Boulder, CO...Ibid. 110 David W. Lesch, Mark L. Haas, eds., The Middle East and the United States, 5th ed. (Boulder, CO, Westview Press, 2014), 2 21 beginning...to Israel in 2005, NATO Secretary General Jaap de Hoop Scheffer stated, “the interplay of Middle Eastern and transatlantic security is becoming

  6. Migrations et fuite des cerveaux dans les économies insulaires caribéennes : éléments de réflexion Reflections on Migration and Brain Drain in the Caribbean Island Economies

    Directory of Open Access Journals (Sweden)

    Fanny-Aude Bellemare

    2012-05-01

    Full Text Available Loin d’être un phénomène nouveau, les mobilités internationales se sont fortement accrues depuis les années 1960. Aujourd’hui, le contexte de mondialisation tend à accélérer les dynamiques migratoires alors que dans le même temps s’observe une élévation des niveaux d’éducation. Ainsi, la soutenabilité de l’augmentation de la fuite des cerveaux dans le monde soulève interrogations et réflexions.Le poids des flux de migrants qualifiés allié à la fragilité relative des données, pose la nécessité d’aborder en profondeur le problème de la fuite des cerveaux. Une analyse au cas par cas s’impose. A partir de données se rapportant à la diaspora caribéenne sur la base statistique de Docquier et Marfouk, cet article propose une réflexion sur les facteurs explicatifs de la fuite des cerveaux dans les territoires insulaires caribéens.Far from being a new phenomenon, the international motilities have increased since the 60’s. Today, the context of globalization tends to accelerate the migratory dynamics while at the same time observed a rise of the educational levels. The increase of the brain drain has respite to many questions.Nevertheless, image, nature of flows of skilled migrants combined with relative data’s fragility and the necessity to approach the problem and presenting appropriate policies, impose an analysis case by case. Using data relating to the Caribbean diaspora on the statistical basis of Docquier and Marfouk, this article purpose a reflection on the factors that explain the brain drain in the Caribbean islands.

  7. Tungmetaller i korn Undersøkelser av prøver dyrket før 1945 sammenlignet med prøver fra 197 6

    OpenAIRE

    Selmer-Olsen, A. R.

    1986-01-01

    Hvete, havre og bygg fra 1930, 1931 og 1943 er analysert på en del tungmetaller og resultatene er sammenlignet med korn dyrket i 1976. Materialet er altfor spinkelt til å trekke noen konklusjon, men antydningsvis kan det se ut som om tungmetallnivået i hvete og bygg ikke er høyere nå enn det var før 1945. Innholdet i havre derimot kan se ut som om det har øket litt. Generelt kan det se ut som om havre har et litt høyere nivå enn de andre.

  8. Short outlines of books by Estonian authors / Janika Kronberg, Rutt Hinrikus

    Index Scriptorium Estoniae

    Kronberg, Janika, 1963-

    2006-01-01

    Arvustus: Runnel, Hando. Sinamu. Tartu : Ilmamaa, 2005 ; Talvet, Jüri. Tõrjumatu äär. Tartu : Ilmamaa, 2005 ; Nõu, Enn. Mõtusekuke viimne kogupauk. Tallinn : Eesti Keele Sihtasutus, 2005 ; Merca. Hele häärber. Tartu : Vilep & Vallik, 2005 ; Õnnepalu, Tõnu. Enne heinaaega ja hiljem : luulet ja luuletõlkeid 1983-2005. Tallinn : Eesti Keele Sihtasutus, 2005 ; Kaplinski, Jaan. Kõik on ime. Tartu : Ilmamaa, 2004 ; Unt, Mati. Vend Antigone, ema Oidipus. Tallinn : Kultuurileht, 2006 ; Laretei, Käbi. Otsekui tõlkes : teema variatsioonidega. Tallinn : Tänapäev, 2005 ; Jõerüüt, Jaak. Sõber : valik novelle 1979-2005. Tallinn : Tuum, 2005

  9. Nathalie Dompnier, Les élections en Europe

    OpenAIRE

    Bouillaud, Christophe

    2012-01-01

    Dans ce petit ouvrage de synthèse, N. Dompnier se propose d’hybrider sur l’objet électoral deux littératures qui se croisaient peu jusqu’ici : celle de la politique comparée et celle des études européennes. La voie avait été ouverte en la matière par le Dictionnaire des élections européennes, paru en 2005 sous la direction d’Yves Déloye (Paris : Economica). Cette entreprise collective, à laquelle N. Dompnier avait d’ailleurs prêté son concours à travers les articles Caution électorale, Fraude...

  10. A nanocomposite disk prepared from reduced graphene oxide and gold nanoparticles for the preconcentration of heterocyclic aromatic amines prior to their determination by HPLC

    International Nuclear Information System (INIS)

    Tan, Connieal; Wang, Yiru; Deng, Zhuo; Xu, Na; Song, Xinhong; Liu, Haihong; Rong, Mingcong; Chen, Xi

    2014-01-01

    We report on a preconcentration disk for the determination of trace amounts of heterocyclic aromatic amines (HAAs) in the groups of quinoline and quinoxaline congeners as possible human carcinogens. The disk is based on nanocomposite (NC) prepared from graphene oxide as the precursor and from gold nanoparticles that act as building blocks to form a three-dimensional NC. If deposited in the sampling valve of a HPLC system, the material displays excellent extraction capability for HAAs owing to its large surface and π-π stacking interaction. Following an optimization of the extraction parameters, the method was successfully applied to the simultaneous determination of polar HAAs in meat samples with detection limit of 0.09 to 0.16 ng g −1 and recoveries of 69.5 to 122.7 %. The disk was used in more than 150 subsequent preconcentration cycles without obvious loss of the absorption capability. The results reveal that this new NC represents an excellent sorbent for purposes of preconcentration. (author)

  11. Evidence of arsenic release promoted by disinfection by-products within drinking-water distribution systems.

    Science.gov (United States)

    Andra, Syam S; Makris, Konstantinos C; Botsaris, George; Charisiadis, Pantelis; Kalyvas, Harris; Costa, Costas N

    2014-02-15

    Changes in disinfectant type could trigger a cascade of reactions releasing pipe-anchored metals/metalloids into finished water. However, the effect of pre-formed disinfection by-products on the release of sorbed contaminants (arsenic-As in particular) from drinking water distribution system pipe scales remains unexplored. A bench-scale study using a factorial experimental design was performed to evaluate the independent and interaction effects of trihalomethanes (TTHM) and haloacetic acids (HAA) on arsenic (As) release from either scales-only or scale-biofilm conglomerates (SBC) both anchored on asbestos/cement pipe coupons. A model biofilm (Pseudomonas aeruginosa) was allowed to grow on select pipe coupons prior experimentation. Either TTHM or HAA individual dosing did not promote As release from either scales only or SBC, detecting water. In the case of scales-only coupons, the combination of the highest spike level of TTHM and HAA significantly (pwater in pipe networks remains to be investigated in the field. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Effect of structural disorder on quantum oscillations in graphite

    Energy Technology Data Exchange (ETDEWEB)

    Camargo, B. C., E-mail: b.c-camargo@yahoo.com.br; Kopelevich, Y. [Instituto de Fisica Gleb Wataghin, Universidade Estadual de Campinas, Unicamp 13083-970, Campinas, São Paulo (Brazil); Usher, A.; Hubbard, S. B. [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)

    2016-01-18

    We have studied the effect of structural disorder on the de Haas van Alphen and Shubnikov de Haas quantum oscillations measured in natural, Kish, and highly oriented pyrolytic graphite samples at temperatures down to 30 mK and at magnetic fields up to 14 T. The measurements were performed on different samples characterized by means of x-ray diffractometry, transmission electron microscopy, and atomic-force microscopy techniques. Our results reveal a correlation between the amplitude of quantum oscillations and the sample surface roughness.

  13. Aerosol behaviour modeling and measurements

    Energy Technology Data Exchange (ETDEWEB)

    Gieseke, J A; Reed, L D [Batelle Memorial Institute, Columbus, OH (United States)

    1977-01-01

    Aerosol behavior within Liquid Metal Fast Breeder Reactor (LMFBR) containments is of critical importance since most of the radioactive species are expected to be associated with particulate forms and the mass of radiologically significant material leaked to the ambient atmosphere is directly related to the aerosol concentration airborne within the containment. Mathematical models describing the behavior of aerosols in closed environments, besides providing a direct means of assessing the importance of specific assumptions regarding accident sequences, will also serve as the basic tool with which to predict the consequences of various postulated accident situations. Consequently, considerable efforts have been recently directed toward the development of accurate and physically realistic theoretical aerosol behavior models. These models have accounted for various mechanisms affecting agglomeration rates of airborne particulate matter as well as particle removal rates from closed systems. In all cases, spatial variations within containments have been neglected and a well-mixed control volume has been assumed. Examples of existing computer codes formulated from the mathematical aerosol behavior models are the Brookhaven National Laboratory TRAP code, the PARDISEKO-II and PARDISEKO-III codes developed at Karlsruhe Nuclear Research Center, and the HAA-2, HAA-3, and HAA-3B codes developed by Atomics International. Because of their attractive short computation times, the HAA-3 and HAA-3B codes have been used extensively for safety analyses and are attractive candidates with which to demonstrate order of magnitude estimates of the effects of various physical assumptions. Therefore, the HAA-3B code was used as the nucleus upon which changes have been made to account for various physical mechanisms which are expected to be present in postulated accident situations and the latest of the resulting codes has been termed the HAARM-2 code. It is the primary purpose of the HAARM

  14. Features of Hepatitis in Hepatitis-associated Aplastic Anemia: Clinical and Histopathologic Study.

    Science.gov (United States)

    Patel, Kalyani R; Bertuch, Alison; Sasa, Ghadir S; Himes, Ryan W; Wu, Hao

    2017-01-01

    Hepatitis-associated aplastic anemia (HAA) is a rare variant of aplastic anemia in which patients present with severe pancytopenia after an episode of acute hepatitis. The marrow failure is often rapid, severe, and usually fatal if untreated. The preceding hepatitis is largely under-studied. Retrospective study of the clinical and histopathologic features of hepatitis in pediatric patients who subsequently developed aplastic anemia and comparison with consecutive cases of acute liver failure and random cases of autoimmune hepatitis during the same time frame. All 7 patients of HAA had significant elevations in aminotransferases and conjugated hyperbilirubinemia at initial presentation. Echoing liver function indices, cholestatic hepatitis with sinusoidal obstruction-type endothelial injury was seen histomorphologically. Autoimmune hepatitis serology such as anti-F-actin, anti-liver/kidney microsome, and hypergammaglobulinemia was negative in all patients. Five of 7 patients (71.4%) had, however, elevated antinuclear antibody, all with a speckled pattern. Hepatitis virus serology was negative in all patients. By immunohistochemical staining, the lobular CD8/CD4 lymphocyte ratio was markedly elevated in all of the initial samples with significant reduction in this ratio (P = 0.03) in 3 patients post treatment (ursodiol, antibiotics, and/or immunosuppressive therapy). Hepatitis preceding HAA is characterized by marked elevation of aminotransferases, conjugated hyperbilirubinemia, elevated antinuclear antibody with a speckled pattern, cholestatic hepatitis with sinusoidal obstruction morphology, and CD8 dominant lobular infiltrates. The present study suggests HAA may result from cytotoxic T-cell-mediated sinusoidal endothelial and hepatocytic injury.

  15. The isolation of beryllium and mercury from lithium chloride solution by means of gas extraction

    International Nuclear Information System (INIS)

    Sevast'yanov, A.I.; Chepovoj, V.I.

    1988-01-01

    The possibility and optimal conditions of beryllium and mercury extraction using acetylacetone (HAA) from lithium chloride solution by argon blowing through the solution are determined. Dependences of extraction degrees and distribution coefficients on different parameters of liquid phase: initial pH value, lithium chloride concentration and initial content of HAA, are presented. The degree of beryllium extraction reaches the maximum at liquid phase pH of 4.4-5.25 and concentration of lithium chloride of 8.5 mol/l. Distribution coefficient changes in inverse proportion to the extraction degree

  16. Garip Turunç, La Turquie aux marches de l’Europe, Paris : l’Harmatan, 2001, 162 p., tableaux, annexes, bibliographie, préface de Maurice Catin.

    Directory of Open Access Journals (Sweden)

    Gérard Groc

    2004-12-01

    Full Text Available Les relations entre la Turquie et l'Europe, de la Communauté Économique Européenne du Traité de Rome (1957 à l'Union Européenne du Traité de Maastricht (1993 sont à la fois longues et embrouillées. En effet, premier pays, avec la Grèce, à avoir signé, en 1963, un accord d'association avec le Marché Commun, la Turquie est tout à la fois un ancien partenaire de l'Europe occidentale et un vieux prétendant à l'adhésion, jamais satisfait et toujours éconduit. Et la complexité de ces relations vi...

  17. Endla teater 2006 : aasta omadramaturgiat / Luule Epner

    Index Scriptorium Estoniae

    Epner, Luule, 1953-

    2007-01-01

    Andrus Kivirähki "Rehepapp" (lav. Priit Pedajas), Liisu Krassi/ Sandra Sillaotsa "Sõbrapäev" (juh. Enn Keerd), August Kitzbergi "Kauka jumal" (lav. Andres Noormets), Silvi Väljali/Kiti Põllu "Jussikese seitse sõpra" (lav. Piret Rauk), A. H. Tammsaare /Urmas Lennuki "Vargamäe kuningriik" (lav. Jaanus Rohumaa), Jim Ashilevi "Nagu poisid vihma käes" (lav. Andres Noormets), Jaan Kruusvalli "Võikõllane üü" (lav. Enn Keerd), Friedebert Tuglase/Tiit Palu "Väike Illimar" (lav. Tiit Palu), Asrtid Reinla "Koduabiline" (lav. Tiit Palu), Jaan Kaplinski "Liblikas ja peegel" (lav. Madis Kalmet), Eva Koffi "Sabaga täht" (lav. Andres Noormets). Kasut. kirjandus lk. 39

  18. E-tervise portaalis on turvaauk / Kadri Ibrus

    Index Scriptorium Estoniae

    Ibrus, Kadri

    2010-01-01

    Patsient teatas andmekaitse inspektsioonile, et tervise infosüsteemi patsiendiportaali ID-kaardiga sisse logides avanesid talle enne teda portaali kasutanud isiku terviseandmed. Sotsiaalministeeriumi vastusest

  19. Putin ja Bush pakuvad peaministreid / Toomas Alatalu

    Index Scriptorium Estoniae

    Alatalu, Toomas, 1942-

    2004-01-01

    Venemaa presidendi Vladimir Putini otsusest enne presidendivalimisi tagandada valitsus. USA presidendi George W. Bushi probleemist Haiti presidendi ja peaministri ametikohaga seoses riigis valitseva kriisiga

  20. Removal of haloacetic acids from swimming pool water by reverse osmosis and nanofiltration.

    Science.gov (United States)

    Yang, Linyan; She, Qianhong; Wan, Man Pun; Wang, Rong; Chang, Victor W-C; Tang, Chuyang Y

    2017-06-01

    Recent studies report high concentrations of haloacetic acids (HAAs), a prevalent class of toxic disinfection by-products, in swimming pool water (SPW). We investigated the removal of 9 HAAs by four commercial reverse osmosis (RO) and nanofiltration (NF) membranes. Under typical SPW conditions (pH 7.5 and 50 mM ionic strength), HAA rejections were >60% for NF270 with molecular weight cut-off (MWCO) equal to 266 Da and equal or higher than 90% for XLE, NF90 and SB50 with MWCOs of 96, 118 and 152 Da, respectively, as a result of the combined effects of size exclusion and charge repulsion. We further included 7 neutral hydrophilic surrogates as molecular probes to resolve the rejection mechanisms. In the absence of strong electrostatic interaction (e.g., pH 3.5), the rejection data of HAAs and surrogates by various membranes fall onto an identical size-exclusion (SE) curve when plotted against the relative-size parameter, i.e., the ratio of molecular radius over membrane pore radius. The independence of this SE curve on molecular structures and membrane properties reveals that the relative-size parameter is a more fundamental SE descriptor compared to molecular weight. An effective molecular size with the Stokes radius accounting for size exclusion and the Debye length accounting for electrostatic interaction was further used to evaluate the rejection. The current study provides valuable insights on the rejection of trace contaminants by RO/NF membranes. Copyright © 2017. Published by Elsevier Ltd.

  1. Analysis of haloacetic acids, bromate, and dalapon in natural waters by ion chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Wu, Shimin; Anumol, Tarun; Gandhi, Jay; Snyder, Shane A

    2017-03-03

    The addition of oxidants for disinfecting water can lead to the formation of potentially carcinogenic compounds referred to as disinfection byproducts (DBPs). Haloacetic acids (HAAs) are one of the most widely detected DBPs in US water utilities and some of them are regulated by the US Environmental Protection Agency (USEPA). The present study developed a method to analyze all the compounds in the USEPA method 557 (nine HAAs, bromate and dalapon) plus four potentially more toxic iodinated HAAs in water by coupling ion chromatography with tandem mass spectrometry (IC-MS/MS). This aqueous direct injection method has significant advantages over traditional GC methods, which require a derivatization and sample extraction that are laborious, time-consuming, and can negatively impact reproducibility. The method developed in this study requires half the time of the current USEPA method 557 on IC-MS/MS while including more compounds and achieving sub-μg/L level method detection limits (MDLs) for all 15 target analytes. The single laboratory lowest concentration minimum reporting level (LCMRL) has also been determined in reagent water, which ranged from 0.011 to 0.62μg/L for the analytes. The mean recoveries of the analytes during matrix spike recovery tests were 77-125% in finished drinking water and 81-112% in surface water. This method was then applied to untreated, chlorinated, and chloraminated groundwater and surface water samples. Bromate and 9 HAAs were detected at different levels in some of these samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Flexible Airspace Management (FAM) Research 2010 Human-in-the-Loop Simulation

    Science.gov (United States)

    Lee, Paul U.; Brasil, Connie; Homola, Jeffrey; Kessell, Angela; Prevot, Thomas; Smith, Nancy

    2011-01-01

    A human-in-the-Ioop (HITL) simulation was conducted to assess potential user and system benefits of Flexible Airspace Management (FAM) concept, as well as designing role definitions, procedures, and tools to support the FAM operations in the mid-term High Altitude Airspace (HAA) environment. The study evaluated the benefits and feasibility of flexible airspace reconfiguration in response to traffic overload caused by weather deviations, and compared them to those in a baseline condition without the airspace reconfiguration. The test airspace consisted of either four sectors in one Area of Specialization or seven sectors across two Areas. The test airspace was assumed to be at or above FL340 and fully equipped Vvith data communications (Data Comm). Other assumptions were consistent with those of the HAA concept. Overall, results showed that FAM operations with multiple Traffic Management Coordinators, Area Supervisors, and controllers worked remarkably well. The results showed both user and system benefits, some of which include the increased throughput, decreased flight distance, more manageable sector loads, and better utilized airspace. Also, the roles, procedures, airspace designs, and tools were all very well received. Airspace configuration options that resulted from a combination of algorithm-generated airspace configurations with manual modifications were well acceptec and posed little difficuIty and/or workload during airspace reconfiguration process. The results suggest a positive impact of FAM operations in HAA. Further investigation would be needed to evaluate if the benefits and feasibility would extend in either non-HAA or mixed equipage environment.

  3. Saaremaa taotleb LIFE programmist 50 miljonit krooni / Ain Lember

    Index Scriptorium Estoniae

    Lember, Ain

    2001-01-01

    Vilsandi Rahvuspark ja Pärandkoosluste Kaitse Ühing esitasid EL Komisjonile LIFE programmi raames projektitaotlused. Ajalehe küsimustele vastab Vilsandi rahvuspargi kaitsekorralduskava spetsialist Enn Kaljo

  4. Käsuõigusest tulenev vastutus : [bakalaureusetöö] / Hannes Sammalpärg ; Tartu Ülikool, õigusteaduskond ; juhendajad: Andres Parmas, Tõnu Põder

    Index Scriptorium Estoniae

    Sammalpärg, Hannes

    2012-01-01

    Siseriiklikest arengutest enne I Maailmasõda Suurbritannias, USA-s, Venemaal, suundadest rahvusvahelises õiguses, II Maailmasõja mõjudest, Rahvusvahelisest Kriminaalkohtust ja Rooma statuudist, kaasustest (Hinzman, Watada)

  5. Seltskond : [fotod] / tekst ja fotod Annika Haas

    Index Scriptorium Estoniae

    2008-01-01

    8. dets. esitles Helle Michelson Eesti Lastekirjanduse Keskuses mälestusteraamatut "Lehitsetud leheküljed: Meenutusi elust ja lastekirjandusest" (Tallinn : Tänapäev, 2008) Kohal viibisid lastekirjanikud Ellen Niit, Jaak Urmet jt.

  6. USA kiidetud noise-rock Eestis / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2008-01-01

    Müra-rock'i viljelevast USA duost Magik Markers (ansambel osaleb režissöör Veiko Õunapuu uue mängufilmi "Püha Tõnu kiusamine" võtetel ja annab kaks kontserti - 13. nov. Tallinnas klubis Tapper ja 15. nov. Tartus klubis Trehv)

  7. Seltskond : [fotod] / tekst ja fotod Annika Haas

    Index Scriptorium Estoniae

    2008-01-01

    29. mail tutvustasid autorid oma lasteraamatuid Eesti Lastekirjanduse Keskuses: Kass, Kristiina. Petra lood. [Tallinn] : Tänapäev, 2008 ; Vainola, Kätlin. Mia, Konrad ja avanevad uksed : [jutustus] / pildid joonistanud Toomas Pääsuke. [Tallinn] : Tänapäev, 2008 ; Saarna, Meelike. Mattias ja mamma. [Tallinn] : Tänapäev, 2008

  8. Magneto-transporte em sistemas semicondutores com gas de eletrons bidimensional

    OpenAIRE

    Alvaro Guedes Soares

    1994-01-01

    Resumo: O objetivo básico deste trabalho foi a implantação de técnicas de magneto-transporte em heteroestruturas semicondutoras que apresentam gás de elétron bidimensional (2-DEG), particularmente, o Efeito Shubnikov-de Haas (SdH) e Efeito Hall Quântico (QHE). Neste sentido foi realizada a recuperação de uma bobina supercondutora (criostato e sistema de controle) que permite medidas em campo magnético de até 14 Tesla. Medidas de oscilações Shubnikov-de Haas e Efeito Hall Quântico foram fei...

  9. Le community manager ou animateur de communauté Web : quel nouvel acteur de la formation à distance ?

    OpenAIRE

    Savarieau, Béatrice; Guégan, Julie

    2017-01-01

    La recherche présentée s’est déroulée au sein de la Commission européenne (organe exécutif de l’Union européenne employant 33 000 agents) au cours de l’année 2016. Elle questionne le rôle du community manager, ou animateur de communautés, dans la médiation des savoirs. L’objectif est de définir les contours de ses interventions et de ses apports dans la formation (dispositifs pédagogiques qui visent notamment à renforcer l’efficacité de l’apprentissage et son lien avec le poste de travail), p...

  10. Google : innovatrice jalousée ou monopoliste hors-la-loi ? Le droit de la concurrence de l’UE à la croisée des chemins ?

    OpenAIRE

    von Moltke, Amédée

    2015-01-01

    Grande et arrogante, l’entreprise Google gêne l’Europe. Depuis près de cinq ans, des voix s’élèvent à Bruxelles pour réclamer sa tête, et le 15 avril 2015 la Commission européenne a réalisé un premier pas en ce sens en lui adressant une communication des griefs, relative au traitement préférentiel qu’elle accorde à son propre comparateur de prix dans ses pages de résultats de recherche générale. Néanmoins, Google mérite-t-elle l’opprobre de l’autorité européenne de la concurrence ? À la suite...

  11. Finantshierarhia teooria ja finantseerimisotsused Eesti ettevõtetes / Priit Sander

    Index Scriptorium Estoniae

    Sander, Priit, 1973-

    2003-01-01

    Finantshierarhia (pecking order) kujutab endast sisuliselt finantseerimisallikate paremusjärjestust. Ettevõte kasutab enne ära soodsamad finantseerimisallikad ja siis võtab tarvitusele vähemsoodsad. Tabelid

  12. EU applicants to reform justice, border systems / Janet McEvoy

    Index Scriptorium Estoniae

    McEvoy, Janet

    1998-01-01

    Euroopa Liidu siseministrite kohtumisel 30. jaanuaril 1998. a. leiti, et Ida-Euroopa riigid peavad tõhustama organiseeritud kuritegevuse ja illegaalse immigratsiooni vastaseid meetmeid enne liitumist Euroopa Liiduga

  13. SDE seisab uute põlevkivikaevanduste vastu / Piret Pert

    Index Scriptorium Estoniae

    Pert, Piret

    2006-01-01

    SDE tutvustas pressikonverentsil oma keskkonnapoliitilisi seisukohti. Sotsiaaldemokraadid on vastu uute põlevkivikaevanduste avamisele enne olemasolevate ammendumist, SDE eelnõu kohaselt tuleks uute kaevanduste avamiste kava kinnitamisele Riigikogus

  14. Development of intelligent MPPT (maximum power point tracking) control for a grid-connected hybrid power generation system

    International Nuclear Information System (INIS)

    Hong, Chih-Ming; Ou, Ting-Chia; Lu, Kai-Hung

    2013-01-01

    A hybrid power control system is proposed in the paper, consisting of solar power, wind power, and a diesel-engine. To achieve a fast and stable response for the real power control, an intelligent controller was proposed, which consists of the Wilcoxon (radial basis function network) RBFN and the improved (Elman neural network) ENN for (maximum power point tracking) MPPT. The pitch angle control of wind power uses improved ENN controller, and the output is fed to the wind turbine to achieve the MPPT. The solar array is integrated with an RBFN control algorithm to track the maximum power. MATLAB (MATrix LABoratory)/Simulink was used to build the dynamic model and simulate the solar and diesel-wind hybrid power system. - Highlights: ► To achieve a fast and stable response for the real power control. ► The pitch control of wind power uses improved ENN (Elman neural network) controller to achieve the MPPT (maximum power point tracking). ► The RBFN (radial basis function network) can quickly and accurately track the maximum power output for PV (photovoltaic) array. ► MATLAB was used to build the dynamic model and simulate the hybrid power system. ► This method can reach the desired performance even under different load conditions

  15. See oli masendav otsustamatus / Enn Tarto

    Index Scriptorium Estoniae

    Tarto, Enn, 1938-

    2001-01-01

    Hinnang kommunistlikule režiimile jäi Riigikogus andmata. Autor: Rahvaerakond Mõõdukad. Parlamendisaadik. Ilmunud ka: Tartu : Postimees, 18. juuni 2001, lk. 2; Koit, 16. juuni 2001, lk. 6; Hiiumaa, 16. juuni 2001, lk. 2; Vooremaa, 19. juuni 2001, lk. 2; Nädaline, 19. juuni 2001, lk. 5; Valgamaalane, 19. juuni 2001, lk. 2

  16. Tulevik Electroluxi disainivõistluselt / Enn Heinsoo

    Index Scriptorium Estoniae

    Heinsoo, Enn

    2009-01-01

    Võistluse "Design Lab" tööde näitus tuleviku kodumasinatest Arhitektuuri- ja Disainigaleriis 21. märtsini. 2007. aastal võitis konkursi ungarlase Levente Szabo ökopesumasin E-wash, 2008. aastal austerlase Stefan Buchbergeri moodulkülmik Flatshare

  17. Mõttesügav ajalooteos / Enn Tarvel

    Index Scriptorium Estoniae

    Tarvel, Enn, 1932-

    2012-01-01

    Arvustus: Crusading and chronicle writing on the medieval Baltic frontier : a companion to the Chronicle of Henry of Livonia / edited by Marek Tamm, Linda Kaljundi, Carsten Selch Jensen. Farnham ; Burlington : Ashgate, 2011

  18. Amanda Jasmiin, habras sidepidaja / Enn Lillemets

    Index Scriptorium Estoniae

    Lillemets, Enn

    2002-01-01

    Rootsis elava, 30. märtsil 100-aastaseks saanud Amanda Jasmiini elust, õpingutest, skulptuuriloomingust, arvustustest. Lõpetas 1937. a. Pallase skulptorina, on töötanud joonistusõpetaja, moekunstniku ja illustraatorina, kavandanud teatrikostüüme, 1997. aastast kunstiühingu Pallas auliige

  19. Seitsme venna koolitee / Enn Anupõld

    Index Scriptorium Estoniae

    Anupõld, Enn, 1937-

    2008-01-01

    Soome lähiajaloost ja kaasajast, samuti poliitikast. Järgneb: 16. juuli, lk. 7 (sisaldab vestlust Soome poliitiku Max Jakobsoniga) ; 23. juuli, lk. 5 (sisaldab vestlust Soome kauaaegse poliitiku ja ühiskonnategelase Pekka Silvolaga) ; 6. aug., lk. 7 ; 13. aug., lk. 7 ; 20. aug., lk. 7 ; 3. sept., lk. 7 ; 10. sept. ; 17. sept. ; 24. sept. ; 1. okt. ; 8. okt. ; 15. okt. ; 22. okt. ; 29. okt.

  20. Ennäe homo / Feliks Krapp

    Index Scriptorium Estoniae

    Krapp, Feliks

    1999-01-01

    Elisabeth Ohlsoni fotonäitus "Ecce homo" Pärnu Uue Kunsti Muuseumis 14. VII-22. VIII. E. Ohlsoni sõnum: Kristus armastab kõiki ning on olemas ka seksuaalvähemuste jaoks, vaid ühiskond pole seda alati.

  1. Ajaloo suurim baaslaager Haitil / Enn Eberg

    Index Scriptorium Estoniae

    Eberg, Enn

    2010-01-01

    2010. a. jaanuaris Haitil toimunud maavärina tagajärgede likvideerimisel käisid Eesti Päästemeeskonna liikmed püstitamas ajaloo suurimat baaslaagrit, mis on mõeldud ÜRO organisatsioonide töötajatele. Lisa: Eesti Päästemeskonna liikmed Haiti katastroofipiirkonnas (nimestik)

  2. BLRT : laevaehituses on pidu / Enn Tosso

    Index Scriptorium Estoniae

    Tosso, Enn, 1976-

    2008-01-01

    Ilmunud ka: Delovõje Vedomosti 13. aug. lk. 5. BLRT Grupi esimese poolaasta käive oli 2,9 miljardit krooni, mis on 38,4% enam kui mullu samal perioodil. Ettevõtte kommunikatsioonidirektori Anu Halliku kinnitusel on laevaremondi ja -ehituse maailmaturul praegu väga soodne seis. Lisa: Tulemused

  3. Taba trende enne teisi / Harli Uljas

    Index Scriptorium Estoniae

    Uljas, Harli

    2005-01-01

    Autor tutvustab maailmakuulsa innovatsiooniteoreetiku Clayton M. Christenseni innovatsiooniteooriat ning selle kasutamist võimalike turumuutuste ennustamisel. Kommenteerib konsultatsioonifirma Ajutrust konsultant Tiit Jürimäe. Vt. samas: Kopp ees; Zara tabab trende klubidest; Kui suureks peab kasvama lennujaam?; Kuidas jaotab kliente maailmakuulus trendipüüdja Anne-Lise Kjaer

  4. Religious conversion and the problem of commitment in Livland province, 1850s-1860s / Daniel C. Ryan

    Index Scriptorium Estoniae

    Ryan, Daniel C. 1972-

    2007-01-01

    Vene õigeusust taganemisest Liivimaal 1850.-1860. aastail. Preestrite raportid kõrgemalseisvatele organitele kujundasid võimude teadmised õigeusu kiriku positsioonist ja Balti provintside talurahva olukorrast vahetult enne venestusperioodi algust

  5. Arabella, küberröövli tütar / Märt Milter

    Index Scriptorium Estoniae

    Milter, Märt

    2005-01-01

    Filmipiraatlus internetis : filmid enne esilinastust saadaval. Kuidas see toimib USA-s ja meil, mis ette võtta? Lisatud kommentaarid Business Software Alliance'i Eesti tegevuse koordinaatorilt Erik Mandrelt

  6. Abuses of sugar market in Latvia, Estonia under spotlight

    Index Scriptorium Estoniae

    2004-01-01

    Läti konkurentsiamet sulges hindade mõjutamise tõttu riigi suuruselt teise suhkruvabriku. Eestit trahvitakse suhkru varumise eest enne Euroopa Liitu astumist. Leedus on aga suhkru tarbimine langenud

  7. Russki teatr gotovit letnije projektõ / Ksenia Repson

    Index Scriptorium Estoniae

    Repson, Ksenia

    2007-01-01

    Enne Vene Teatri 59. hooaja ametlikku algust mängitakse augustis mitmeid teatri lavastusi ning 14. aug. esietendub Quentin Tarantino filmistsenaariumil "Marukoerad" ("Reservoir Dogs") põhinev Anna Trifonova lavastus

  8. Noortenäidend kulgeb teismeliste tempos / Sandra Sillaots

    Index Scriptorium Estoniae

    Sillaots, Sandra

    2009-01-01

    Pärnu Endla teatris etendunud lavastusest "Oma elu superstaarid". Autorid Triinu ja Laura-Marie Ojalo, lavastaja Enn Keerd, kunstnik Tuulikki Ojalo. Ka peategelase Eliis Vaiksaare (Lenna) osatäitmisest

  9. Disinfection By-Product Exposures and the Risk of Specific Cardiac Birth Defects

    Science.gov (United States)

    Wright, J. Michael; Evans, Amanda; Kaufman, John A.; Rivera-Núñez, Zorimar; Narotsky, Michael G.

    2016-01-01

    Background: Epidemiological studies suggest that women exposed to disinfection by-products (DBPs) have an increased risk of delivering babies with cardiovascular defects (CVDs). Objective: We examined nine CVDs in relation to categorical DBP exposures including bromoform, chloroform, dibromochloromethane (DBCM), bromodichloromethane (BDCM), monobromoacetic acid (MBAA), dichloroacetic acid (DCAA), trichloroacetic acid (TCAA), and summary DBP measures (HAA5, THMBr, THM4, and DBP9). Methods: We calculated adjusted odds ratios (aORs) in a case–control study of birth defects in Massachusetts with complete quarterly 1999–2004 trihalomethane (THM) and haloacetic acid (HAA) data. We randomly matched 10 controls each to 904 CVD cases based on week of conception. Weight-averaged aggregate first-trimester DBP exposures were assigned to individuals based on residence at birth. Results: We detected associations for tetralogy of Fallot and the upper exposure categories for TCAA, DCAA, and HAA5 (aOR range, 3.34–6.51) including positive exposure–response relationships for DCAA and HAA5. aORs consistent in magnitude were detected between atrial septal defects and bromoform (aOR = 1.56; 95% CI: 1.01, 2.43), as well as DBCM, chloroform, and THM4 (aOR range, 1.26–1.67). Ventricular septal defects (VSDs) were associated with the highest bromoform (aOR = 1.85; 95% CI: 1.20, 2.83), MBAA (aOR = 1.81; 95% CI: 0.85, 3.84), and DBCM (aOR = 1.54; 95% CI: 1.00, 2.37) exposure categories. Conclusions: To our knowledge, this is the first birth defect study to develop multi-DBP adjusted regression models as well as the first CVD study to evaluate HAA exposures and the second to evaluate bromoform exposures. Our findings, therefore, inform exposure specificity for the consistent associations previously reported between THM4 and CVDs including VSDs. Citation: Wright JM, Evans A, Kaufman JA, Rivera-Núñez Z, Narotsky MG. 2017. Disinfection by-product exposures and the risk of specific

  10. In vitro bioacessibility and transport across Caco-2 monolayers of haloacetic acids in drinking water.

    Science.gov (United States)

    Melo, A; Faria, M A; Pinto, E; Mansilha, C; Ferreira, I M P L V O

    2016-10-01

    Water disinfection plays a crucial role in water safety but it is also a matter of concern as the use of disinfectants promotes the formation of disinfection by-products (DBPs). Haloacetic acids (HAAs) are one of the major classes of DBPs since they are frequently found in treated water, are ubiquitous, pervasive and have high water solubility, so a great concern emerged about their formation, occurrence and toxicity. Exposure to HAAs is influenced by consumption patterns and diet of individuals thus their bioavailability is an important parameter to the overall toxicity. In the current study the bioacessibility of the most representative HAAs (chloroacetic acid - MCAA, bromoacetic acid - MBAA, dichloroacetic acid - DCAA, dibromoacetic acid - DBAA, and trichloroacetic acid - TCAA) after simulated in vitro digestion (SIVD) in tap water and transport across Caco-2 monolayers was evaluated. Compounds were monitored in 8 points throughout the digestion phases by an optimized LC-MS/MS methodology. MCAA and MBAA were not bioaccessible after SIVD whereas DCAA, DBAA and TCAA are highly bioaccessible (85 ± 4%, 97 ± 4% and 106 ± 7% respectively). Concerning transport assays, DCAA and DBAA were highly permeable throughout the Caco-2 monolayer (apparent permeability and calculated fraction absorbed of 13.62 × 10(-6) cm/s and 90% for DCAA; and 8.82 × 10(-6) cm/s and 84% for DBAA), whereas TCAA showed no relevant permeability. The present results may contribute to efficient risk analysis studies concerning HAAs oral exposure from tap water taking into account the different biological behaviour of these chemically similar substances. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Antioxidant activity of rice plants sprayed with herbicides

    Directory of Open Access Journals (Sweden)

    Marcos André Nohatto

    2016-03-01

    Full Text Available Understanding the physiological defense behavior of plants subjected to herbicide application may help to identify products with higher or lower capacity to cause oxidative stress in crops. This study aimed at evaluating the effect of herbicides in the antioxidant activity of rice plants. The experimental design was completely randomized, with six replications. Treatments consisted of the herbicides bentazon (photosystem II inhibitor; 960 g ha-1, penoxsulam (acetolactate synthase inhibitor; 60 g ha-1, cyhalofop-butyl (acetyl coenzyme-A carboxylase inhibitor; 315 g ha-1 and a control. After the herbicides application, samples of rice shoots were collected at 12, 24, 48 and 96 hours after application (HAA. The components evaluated were hydrogen peroxide (H2O2, lipid peroxidation and activity of the antioxidant enzymes superoxide dismutase (SOD and catalase (CAT. Bentazon (up to 24 HAA and penoxsulam (48 and 96 HAA reduced the CAT activity. Moreover, these herbicides increased the levels of H2O2, lipid peroxidation and SOD activity, indicating a condition of oxidative stress in rice plants. The cyhalofop-butyl herbicide did not alter the antioxidant activity, showing that it causes less stress to the crop.

  12. Advanced oxidation processes of decomposing dichloroacetic acid and trichloroacetic acid in water

    Institute of Scientific and Technical Information of China (English)

    WANG Kun-ping; GUO Jin-song; YANG Min; JUNJI Hirotsuji; DENG Rong-sen; LIU Wei

    2008-01-01

    We studied the decomposition of two haloacetic acids (HAAs), dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA), in water by single oxidants ozone (O3) and ultraviolet radiation (UV) and the advanced oxidation processes (AOPs) constituted by the combinations of O3/UV, H2O2/UV, O3 /H2O2, and O3/H2O2/UV. The concentrations of HAAs were analyzed at specified time intervals to track their decomposition. Except for O3 and UV, the four combined oxidation processes remarkably enhance the decomposition of DCAA and TCAA owing to the generated very reactive hydroxyl radicals. The fastest decomposition process is O3/H2O2/UV, closely followed by O3/UV. DCAA is much easier to decompose than TCAA. The kinetics of HAA decomposition by O3/UV can be described well by a pseudo first-order reaction model under a constant initial dissolved O3 concentration and fixed UV radiation. Humic acids and HCO3- in the reaction system both decrease the decomposition rate constants for DCAA and TCAA. The amount of H2O2 accumulates in the presence of humic acids in the O3/UV process.

  13. RNA aptamers targeted for human αA-crystallin do not bind αB-crystallin, and spare the α-crystallin domain.

    Science.gov (United States)

    Mallik, Prabhat K; Shi, Hua; Pande, Jayanti

    2017-09-16

    The molecular chaperones, α-crystallins, belong to the small heat shock protein (sHSP) family and prevent the aggregation and insolubilization of client proteins. Studies in vivo have shown that the chaperone activity of the α-crystallins is raised or lowered in various disease states. Therefore, the development of tools to control chaperone activity may provide avenues for therapeutic intervention, as well as enable a molecular understanding of chaperone function. The major human lens α-crystallins, αA- (HAA) and αB- (HAB), share 57% sequence identity and show similar activity towards some clients, but differing activities towards others. Notably, both crystallins contain the "α-crystallin domain" (ACD, the primary client binding site), like all other members of the sHSP family. Here we show that RNA aptamers selected for HAA, in vitro, exhibit specific affinity to HAA but do not bind HAB. Significantly, these aptamers also exclude the ACD. This study thus demonstrates that RNA aptamers against sHSPs can be designed that show high affinity and specificity - yet exclude the primary client binding region - thereby facilitating the development of RNA aptamer-based therapeutic intervention strategies. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Reductive dehalogenation of haloacetic acids by hemoglobin-loaded carbon nanotube electrode.

    Science.gov (United States)

    Li, Yu-Ping; Cao, Hong-Bin; Zhang, Yi

    2007-01-01

    Hemoglobin (Hb) was immobilized on carbon nanotube (CNT) electrode to catalyze the dehalogenation of haloacetic acids (HAAs). FTIR and UV measurements were performed to investigate the activity-keep of Hb after immobilization on CNT. The electrocatalytic behaviors of the Hb-loaded electrode for the dehalogenation of HAAs were studied by cyclic voltammmetry and constant-potential electrolysis technique. An Hb-loaded packed-bed flow reactor was also constructed for bioelectrocatalytic dehalogenation of HAAs. The results showed that Hb retained its nature, the essential features of its native secondary structure, and its biocatalytic activity after immobilization on CNT. Chloroacetic acids and bromoacetic acids could be dehalogenated completely with Hb catalysis through a stepwise dehalogenation process at -0.400V (vs. saturated calomel electrode (SCE)) and -0.200V (vs. SCE), respectively. The removal of 10.5mM trichloroacetic acid and dichloroacetic acid is ca. 97% and 63%, respectively, with electrolysis for 300min at -0.400V (vs. SCE) using the Hb-loaded packed-bed flow reactor, and almost 100% of tribromoacetic acid and dibromoacetic acid was removed with electrolysis for 40min at -0.200V (vs. SCE). The average current efficiency of Hb-catalytic dehalogenation almost reaches 100%.

  15. Spontaneous correction of anterior crossbite by RPE anchored on deciduous teeth in the early mixed dentition.

    Science.gov (United States)

    Rosa, M; Lucchi, P; Mariani, L; Caprioglio, A

    2012-09-01

    The purpose of this study was to evaluate the effectiveness of Haas RPE anchored on deciduous teeth in the early mixed dentition, for inducing the spontaneous correction of permanent incisor's crossbite, without compliance, without post bite-plane and no involvement of the permanent teeth. The sample group comprised 50 consecutive patients (mean age 8y 5m, SD 2y 1m), 31 males, 19 females. They showed a cross-bite affecting one or more permanent incisors, for a total of 70 teeth. The patients were treated with Haas RPE appliance anchored on second deciduous molars and bonded on deciduous canines. No direct forces were applied on the permanent teeth. Anterior crossbite self-corrected 'spontaneously' in 84% of the cases. Lateral incisors had a higher rate of self-correction than central incisors. All hyper-divergent subjects showed a spontaneous crossbite self-correction. The early maxillary expansion by Haas RPE anchored on deciduous teeth is an efficient and effective procedure to induce the anterior crossbite self-correction in the early mixed dentition without the need of a bite-plane, no involvement of the permanent teeth and without compliance.

  16. Ajaleheturul on 70% allahindlus igapäevane / Eda-Liis Kann

    Index Scriptorium Estoniae

    Kann, Eda-Liis, 1979-

    2004-01-01

    Selle asemel, et ametlikult reklaamihinda langetada pakuvad ajalehed reklaamiandjatele ülisuuri soodustusi. Kommenteerivad Enn Parel, Aavo Kokk, Andrus Vaher, Priit Leito, Erik Roose, Ruta Kallaspoolik, Toomas Tiivel, Lauri-Hillar Talve

  17. Piranesi ja teiste veduutide kogud Roomas = Collections of vedutes by Piranesi and others in Rome / Serenita Papaldo

    Index Scriptorium Estoniae

    Papaldo, Serenita

    2004-01-01

    Rooma Rahvusliku Graafikainstituudi kollektsioonist ja antiikarhitektuuri mälestusmärkide jäädvustamisest enne Piranesit, tema loomingu erinevatest momentidest ja võrdlustest teiste graafikute töödega

  18. Tavasti stipendium = Tavast scholarship

    Index Scriptorium Estoniae

    2014-01-01

    Ennesõjaaegse Eesti tuntuima juveelitöösturi Roman Tavasti poja Raul-Roman Tavasti 1998. aastal asutatud stipendium professionaalse ehtekunsti järelkasvu toetamiseks EKA ehtekunsti eriala üliõpilastele

  19. En rask eller lang og kronglete vei til topps? Næringslivslederes karriereforløp

    Directory of Open Access Journals (Sweden)

    Trygve Gulbrandsen

    2018-01-01

    Full Text Available Det er mange studier av den sosiale bakgrunnen til toppledere i næringslivet. Et tema som har fått mindre oppmerksomhet, er hvor lang tid det tok for lederne å nå til topps. En skulle forvente at ledere med bakgrunn fra alminnelige kår brukte lenger tid opp til sine topposisjoner enn kolleger fra de øverste sosiale lag. Analysene i denne artikkelen viser imidlertid at dette ikke stemmer. Toppledere i norsk næringsliv med fedre hjemmehørende i arbeiderklassen trengte ikke flere år på å bli toppledere enn ledere med fedre som tilhørte overklassen. Derimot viser det seg at jo høyere utdanning mor hadde, desto raskere karriere hadde topplederne.

  20. Gestalt grouping and common onset masking.

    Science.gov (United States)

    Kahan, Todd A; Mathis, Katherine M

    2002-11-01

    A four-dot mask that surrounds and is presented simultaneously with a briefly presented target will reduce a person's ability to identity that target if the mask persists beyond target offset and attention is divided (Enns & Di Lollo, 1997, 2000). This masking effect, referred to as common onset masking, reflects reentrant processing in the visual system and can best be explained with a theory of object substitution (Di Lollo, Enns, & Rensink, 2000). In the present experiments, we investigated whether Gestalt grouping variables would influence the strength of common onset masking. The results indicated that (1) masking was impervious to grouping by form, similarity of color, position, luminance polarity, and common region and (2) masking increased with the number of elements in the masking display.

  1. Литература как способ самопознания в "другом" / Ирина Белобровцева

    Index Scriptorium Estoniae

    Белобровцева, Ирина, 1946-

    2001-01-01

    Eesti ja vene kogukondade vahelise dialoogi olulisest aspektist : dialoogi toimumise teoreetilisest võimalusest ja nende praktilisest realiseerumisest kirjanduses. Vene teemast Enn Vetemaa, Rein Saluri, Jaan Unduski ja Ülo Tuuliku loomingus

  2. Lithuania 1940 / Herbert Foster Anderson

    Index Scriptorium Estoniae

    Foster Anderson, Herbert

    2004-01-01

    Stseenid Leedu ennesõjaaegsest pealinnast Kaunasest briti ärimehe H. Foster Andersoni silme läbi 1940. aastal. Lühikokkuvõte raamatust: Foster Anderson, Herbert. Borderline Russia. London : Cresset press, 1942

  3. Kas sul on see film juba nähtud? / Jaanus Noormets

    Index Scriptorium Estoniae

    Noormets, Jaanus

    2009-01-01

    Gavin Hoodi lavastatud uusim film "X-meeste" sarjast, "X-meeste algus : Wolverine", on enne esilinastust lekkinud internetti. Lühidalt ka teistest aegsalt internetti lekkinud filmidest ja kuidas see neile mõjus

  4. Teheran teatas edukast tuumakütuse rikastamisest / Krister Paris

    Index Scriptorium Estoniae

    Paris, Krister, 1977-

    2006-01-01

    Iraani president Mahmoud Ahmadinejad teatas oma teleesinemises edukast uraanirikastamisest, teade edastati enne Rahvusvahelise Aatomienergia Agentuuri esimehe Mohammad ElBaradei visiiti Teherani. Iraani kritiseeris teiste hulgas ka Venemaa. Lisa: Relvaga tuumaprogrammi vastu

  5. Rahvusvahelise Tööorganisatsiooni konventsioonide ratifitseerimisest Eestis : [bakalaureusetöö] / Merle Muda ; Tartu Ülikool, õigusteaduskond ; juhendaja: Inge-Maret Orgo

    Index Scriptorium Estoniae

    Muda, Merle, 1972-

    1994-01-01

    Rahvusvahelise Tööorganisatsiooni (ILO) ajalooline areng, struktuur, aktid; ülevaade Eesti Vabariigi poolt enne 1940. a. ratifitseeritud ILO konventsioonidest; EV seadusandluse vastavusest pärast ILO-ga taasühinemist

  6. Toetusi saab küsida ka LEADER-programmi raames / Raavo Raadik

    Index Scriptorium Estoniae

    Raadik, Raavo

    2011-01-01

    Eesti Hobusekasvatajate Seltsi raskeveohobuse kasvatajate haruseltsi juht Enn Rand on LEADER-programmi abil oluliselt arendanud Pärnumaal Tõstamaa vallas asuvat Maria talu, mis on praeguseks muutunud maakonnas arvestatavaks puhke- ja spordikeskuseks

  7. Sotsialistlik realist Keskküla

    Index Scriptorium Estoniae

    1998-01-01

    Londonis 1998. a. ilmunud inglise kunstikriitiku Matthew Cullerne Bowni monograafias "Socialist Realist Painting" on eesti kunstnikest Enn Põldroos, Nikolai Kormashov, Ando Keskküla, Kormashovi ja Keskküla maalide reproduktsioonid

  8. Loodusõpetuse õppekirjanduse hindamise ja valiku põhimõtetest 1. klassi õpiku-tööraamatu näitel / Inge Timoštšuk

    Index Scriptorium Estoniae

    Timoštšuk, Inge

    2001-01-01

    Hinnang loodusõpetuse õppekirjanduse õppesisule ja metoodilisele esitatusele. Analüüsitud on õpikut : Leuhin, Illar ; Pärtel, Enn. Loodusõpetus : õpik-tööraamat 1. klassile. - Tallinn : Avita, 1999.

  9. Raamatututvustus / Oskar Tanner

    Index Scriptorium Estoniae

    Tanner, Oskar, pseud., 1939-

    1996-01-01

    Eliade, Mircea. Jaaniöö; Kippel, Enn. Kui Raudpea tuli; Beecher Stowe, Harriet. Onu Tomi onnike; Wallace, Edgar. Valge mask; Buchan, John. Kolm pantvangi; Rendell, Ruth. Hunditapp; Jurin, Artur. Näpsu

  10. Baltic minds debate the May-9th-in-Moscow dilemma

    Index Scriptorium Estoniae

    2005-01-01

    Katkendeid osalejate sõnavõttudest videokonverentsil, kus arutati Balti riikide presidentide osavõttu Teise maailmasõja aastapäeva pidustustest Moskvas 9. mail. Osalejate seas oli ka Riigikogu liige Enn Eesmaa

  11. Ohud korteri ümberehitamisel / Harri Treial

    Index Scriptorium Estoniae

    Treial, Harri

    2000-01-01

    Korteriplaani parandamisest, lodzhade kinniehitamisest, soojapidavuse suurendamisest. Enne paneelmaja toa vaheseina uue avause lõikamist tuleb tellida projekt AS-st Eesti Projekt. Kommentaarid AS Eesti Projekt konstruktorite büroo juhatajalt Anne Laurilt

  12. Merkel nõuab lõppu vangilaagrile / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2006-01-01

    Enne oma USA-visiiti antud intervjuus ajakirjale Spiegel taunis Saksa kantsler Angela Merkel Guantanamo vangilaagri olemasolu. Kantslerivahetus Saksamaal ei ole kaasa toonud Saksa-USA suhete olulist paranemist. Lisa: USA okupeeritud osa Kuubast

  13. Kaks nostalgiatrippi / Margit Tõnson

    Index Scriptorium Estoniae

    Tõnson, Margit, 1978-

    2006-01-01

    Tantsulavastusest "Once upon" Kanuti Gildi saalis. Idee ja esitus Krõõt Juurak. Jaan Kruusvalli "Võikõllane üü", lavastaja Enn Keerd, muusikalise kujunduse autor Renate Valme, esietendus 14. okt. Endla teatris

  14. Tshto nesjot nam mirnõi atom / Julia Zalutskaja

    Index Scriptorium Estoniae

    Zalutskaja, Julia

    2008-01-01

    Kui Eestisse otsustatakse rajada tuumaelektrijaam, ei lähe see ekspluatatsiooni enne 2025. aastat. Eesti Energia juhi Sandor Liive hinnangul ei asendaks tuumaelektrijaam ei põlevkivienergeetikat, vaid need täiendaksid teineteist

  15. USA-s tõsteti terroriohtu kolm aastat vana info peale

    Index Scriptorium Estoniae

    2004-01-01

    Al-Qaida arvutieksperdilt Muhammad Naeem Noor Khaanilt, kes tabati Pakistanis, saadi kätte mitmeid dokumente, luureinfot ja skeeme. Enamik infot oli kogutud enne 11. septembril 2001. aastal toimunud terrorirünnakuid

  16. Eesti saab kaasaegse veiste kogumise keskuse / Lii Sammler ; kommenteerinud Aldo Vaan

    Index Scriptorium Estoniae

    Sammler, Lii, 1963-

    2016-01-01

    Oktoobris avab Eesti Tõuloomakasvatajate Ühistu Harjumaal Kaunissaares loomade kogumiskeskuse. See annab võimaluse loomad enne eksporti kokku koondada ja vajalikud uuringud teha. Vestlusest Eesti Tõuloomakasvatajate Ühistu juhatuse esimehe Tanel Bulitkoga

  17. Põhuteater ehk Salto arhitektide must monoliit = Straw Theatre or the Black Monolith by the Salto Architects / Risto Kozer

    Index Scriptorium Estoniae

    Kozer, Risto

    2011-01-01

    Tallinnas 2011. a. valminud NO99 Põhuteatrist. Arhitektid: Maarja Kask, Karli Luik, Ralf Lõoke, Pelle-Sten Viiburg (Salto AB). Projekt: 2010. Loodud ajaperioodiks 30.04.-01.10.2011. Skoone bastionist enne Põhuteatrit

  18. Pallas näitab teed Tartu skulptuurile / Ahti Seppet

    Index Scriptorium Estoniae

    Seppet, Ahti, 1953-

    2006-01-01

    Näitus "Pallase skulptuur" Tartu Kunstimuuseumis. Eksponeeritakse Ferdi Sannamehe, Eduard Wiiralti, Johannes Hirve, August Vommi, Martin Saksa, Roman Timotheuse, Herman Halliste, Lydia Laasi, Alfred Leiuse, Enn Roosi jt. kunstnike töid

  19. Tiigri seljas ratsutav Naan ei naase mitte ainult õhtuti / Rein Ruutsoo

    Index Scriptorium Estoniae

    Ruutsoo, Rein, 1947-

    2008-01-01

    Eesti Draamateatris 16. märtsil esietendunud Enn Vetemaa, Erki Aule ja Merle Karusoo dokumentaallavastusest "Sigma Tau-C705", lavastaja Merle Karusoo. Lavastuse kohta avaldavad arvamust ka Arvo Valton ja Teet Kallas

  20. Harald Velner - insener üle poole sajandi / Harald-Adam Velner

    Index Scriptorium Estoniae

    Velner, Harald-Adam, 1923-2012

    2008-01-01

    Harald-Adam Velner on Eesti Inseneride Liidu esimene taasiseseisvumisjärgne president. Lisaks Liis Seili lühiartikkel Harald-Adam Velneri isast August Velnerist: Teedeinsenerist isa juhtis inseneride ühendust enne sõda

  1. PÖFF on poolel teel / Margit Adorf

    Index Scriptorium Estoniae

    Adorf, Margit, 1974-

    2003-01-01

    Pimedate Ööde Filmifestivali avalöögiks enne põhifestivali ametlikku algust olid tudengifilmide festival "Sleepwalkers" ja laste- ja noortefilmide festival Just Film. Lähemalt viimasel nähtud kuuest filmist

  2. Swedbank lõi Kruuda toimkonnast välja / Anne Oja

    Index Scriptorium Estoniae

    Oja, Anne, 1970-

    2010-01-01

    Vahetult enne Alta Foodsi nõuete kaitsmise koosolekut arvasid Swedbank ja Alta Foodsi omanikke esindanud äriühingud suurettevõtja Oliver Kruuda Alta Foodsi pankrotitoimkonnast välja. Pankrotihaldur Andres Tootsmani kommentaare

  3. Eesti Kunstnikkude Rühm / Reet Mark

    Index Scriptorium Estoniae

    Mark, Reet, 1965-

    2010-01-01

    Kubism enne rühma. Valga-Pensa taustaga sõbrad. Rakvere-Tallinna taustaga sõbrad. EKR kõrgaeg 1924-25. Lahkumised. Tallinlaste kõrghetked. Vaated kunstile. Tegevuse vaibumine pärast 1928. aastat

  4. Res Publica andis kolmele poliitikule fiktiivse elukoha / Kärt Karpa

    Index Scriptorium Estoniae

    Karpa, Kärt, 1973-

    2002-01-01

    Väidetavalt lasi Res Publica enne kohalikke valimisi ühte Pirita eramajja sisse registreerida Jaanus Rahumäe ja veel kaks Res Publica liiget, et nad saaksid kandideerida Tallinna volikogusse ja Pirita halduskogusse

  5. Pohlak : keegi tahab staadioni valmisehitamise nurjata / Tarmo Michelson

    Index Scriptorium Estoniae

    Michelson, Tarmo, 1975-

    2004-01-01

    Maksu- ja tolliamet avalikustas Lilleküla staadionit haldava MTÜ jalgpalliklubi FC Flora võla - 18,8 miljonit krooni - enne valitsusepoolset otsust 70 miljoni krooni suurusest rahasüstist, millega staadion valmis ehitada

  6. Must Luik tõuseb varjusurmast / Urmas Tooming

    Index Scriptorium Estoniae

    Tooming, Urmas, 1954-

    2010-01-01

    Tallinnasse Kadriorgu endise Musta Luige kohviku kinnistule ehitatakse Enn Rajasaare (JVR Arhitektuuribüroo) projekteeritud elu- ja ärihoone, mis valmib 2011. aasta suveks. Restaureerimisfirma Kuukaar taastab kõrvalkrundil asuva villa Mon Repos

  7. Quantitation of 13 heterocyclic aromatic amines in cooked beef, pork, and chicken by liquid chromatography-electrospray ionization/tandem mass spectrometry.

    Science.gov (United States)

    Ni, Weijuan; McNaughton, Lynn; LeMaster, David M; Sinha, Rashmi; Turesky, Robert J

    2008-01-09

    The concentrations of heterocyclic aromatic amines (HAAs) were determined, by liquid chromatography-electrospray ionization/tandem mass spectrometry (LC-ESI-MS/MS), in 26 samples of beef, pork, and chicken cooked to various levels of doneness. The HAAs identified were 2-amino-3-methylimidazo[4,5- f]quinoline, 2-amino-1-methylimidazo[4,5- b]quinoline, 2-amino-1-methylimidazo[4,5- g]quinoxaline (I gQx), 2-amino-3-methylimidazo[4,5- f]quinoxaline, 2-amino-1,7-dimethylimidazo[4,5- g]quinoxaline (7-MeI gQx), 2-amino-3,8-dimethylimidazo[4,5- f]quinoxaline, 2-amino-1,6-dimethyl-furo[3,2- e]imidazo[4,5- b]pyridine, 2-amino-1,6,7-trimethylimidazo[4,5- g]quinoxaline, 2-amino-3,4,8-trimethylimidazo[4,5- f]quinoxaline, 2-amino-1,7,9-trimethylimidazo[4,5- g]quinoxaline, 2-amino-1-methyl-6-phenylimidazo[4,5- b]pyridine (PhIP), 2-amino-9 H-pyrido[2,3- b]indole, and 2-amino-3-methyl-9 H-pyrido[2,3- b]indole. The concentrations of these compounds ranged from chicken (up to 305 microg/kg), broiled bacon (16 microg/kg), and pan-fried bacon (4.9 microg/kg). 7-MeI gQx was the most abundant HAA formed in very well done pan-fried beef and steak, and in beef gravy, at concentrations up to 30 microg/kg. Several other linear tricyclic ring HAAs containing the I gQx skeleton are formed at concentrations in cooked meats that are relatively high in comparison to the concentrations of their angular tricyclic ring isomers, the latter of which are known experimental animal carcinogens and potential human carcinogens. The toxicological properties of these recently discovered I gQx derivatives warrant further investigation and assessment.

  8. Preoperative Planning and Intraoperative Technique for Accurate Translation of a Distal First Metatarsal Osteotomy.

    Science.gov (United States)

    Wynes, Jacob; Lamm, Bradley M; Andrade, Bijan J; Malay, D Scot

    2016-01-01

    We used preoperative radiographic and intraoperative anatomic measurements to predict and achieve, respectively, the precise amount of capital fragment lateral translation required to restore anatomic balance to the first metatarsophalangeal joint. Correlation was used to relate the amount of capital fragment translation and operative reduction of the first intermetatarsal angle (IMA), hallux abductus angle (HAA), tibial sesamoid position (TSP), metatarsus adductus angle, and first metatarsal length. The mean capital fragment lateral translation was 5.54 ± 1.64 mm, and the mean radiographic reductions included a first IMA of 5.04° ± 2.85°, an HAA of 9.39° ± 8.38°, and a TSP of 1.38 ± 0.9. These changes were statistically (p < .001) and clinically (≥32.55%) significant. The mean reduction of the metatarsus adductus angle was 0.66° ± 4.44° and that for the first metatarsal length was 0.33 ± 7.27 mm, and neither of these were statistically (p = .5876 and 0.1247, respectively) or clinically (≤3.5%) significant. Pairwise correlations between the amount of lateral translation of the capital fragment and the first IMA, HAA, and TSP values were moderately positive and statistically significant (r = 0.4412, p = .0166; r = 0.5391, p = .0025; and r = 0.3729, p = .0463; respectively). In contrast, the correlation with metatarsus adductus and the first metatarsal shortening were weak and not statistically significant (r = 0.2296, p = .2308 and r = -0.2394, p = .2109, respectively). The results of our study indicate that predicted preoperative and executed intraoperative lateral translation of the capital fragment correlates with statistically and clinically significant reductions in the first IMA, HAA, and TSP. Copyright © 2016 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  9. Effects of multi-frequency ultrasound pretreatment under low power density on the enzymolysis and the structure characterization of defatted wheat germ protein.

    Science.gov (United States)

    Yang, Xue; Li, Yunliang; Li, Suyun; Oladejo, Ayobami Olayemi; Wang, Yucheng; Huang, Shanfen; Zhou, Cunshan; Wang, Yang; Mao, Li; Zhang, Yanyan; Ma, Haile; Ye, Xiaofei

    2017-09-01

    The effects of ultrasonic frequency mode, power density, pretreatment time and other parameters under low power density on the degree of hydrolysis (DH) of defatted wheat germ protein (DWGP) and angiotensin-I-converting enzyme (ACE) inhibitory activity of DWGP hydrolysate were studied in this research. Ultraviolet-visible (UV-Vis) spectra, free sulfhydryl (SH), disulfide bond (SS), surface hydrophobicity and hydrophobic protein content of ultrasound-pretreated protein and hydrophobic amino acid (HAA) content of alcalase-hydrolysate of DWGP were measured under optimized ultrasonic condition. The ultrasonic frequency mode with dual-fixed frequency combination of 28/40kHz showed higher ACE inhibitory activity of DWGP hydrolysate compared with that of other ultrasound frequency modes and all the ultrasonic frequency combinations involving in 28kHz showed higher ACE inhibitory activity. Under the dual-fixed frequency ultrasound mode of 28/40kHz, ultrasonic power density of 60W/L, pretreatment time of 70min, temperature of 60°C and substrate concentration of 60g/L, the ACE inhibitory activity of DWGP hydrolysate was the highest with its value of 74.75% (increased by 62.30% compared to control). However, all the ultrasonic pretreatment did not increase the DH of DWGP significantly (p>0.05). The changes in UV-Vis spectra, SH and SS groups, surface hydrophobicity and hydrophobic protein content indicated that the structure of DWGP unfolded after ultrasound pretreatment. The HAA content of hydrolysate from the pretreated DWGP increased significantly (p<0.05). The results proved that ultrasound pretreatment loosed the protein structure and exposed more HAA residues of protein to be attacked easily by alcalase. This resulted in the increase in the HAA content which related to the ACE inhibitory activity. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Production of volatiles in fresh-cut apple: effect of applying alginate coatings containing linoleic acid or isoleucine.

    Science.gov (United States)

    Maya-Meraz, Irma O; Espino-Díaz, Miguel; Molina-Corral, Francisco J; González-Aguilar, Gustavo A; Jacobo-Cuellar, Juan L; Sepulveda, David R; Olivas, Guadalupe I

    2014-11-01

    One of the main quality parameters in apples is aroma, its main precursors are fatty acids (FA) and amino acids (AA). In this study, alginate edible coatings were used as carriers of linoleic acid or isoleucine to serve as precursors for the production of aroma in cut apples. Apple wedges were immersed in a CaCl2 solution and coated with one of the following formulations: alginate solution (Alg-Ca), Alg-Ca-low-level linoleic acid (0.61 g/Lt), (LFA), Alg-Ca-high-level linoleic acid (2.44 g/L; HFA), Alg-Ca-low-level isoleucine (0.61 g/L; LAA), and Alg-Ca-high-level isoleucine (2.44 g/L; HAA). Apple wedges were stored at 3 °C and 85% relative humidity for 21 d and key volatiles were studied during storage. Addition of precursors, mainly isoleucine, showed to increase the production of some key volatiles on coated fresh-cut apples during storage. The concentration of 2-methyl-1-butanol was 4 times higher from day 12 to day 21 in HAA, while 2-methyl butyl acetate increased from day 12 to day 21 in HAA. After 21 d, HAA-apples presented a 40-fold value of 2-methyl-butyl acetate, compared to Alg-Ca cut apples. Values of hexanal increased during cut apple storage when the coating carried linoleic acid, mainly on HFA, from 3 to 12 d. The ability of apples to metabolize AA and FA depends on the concentration of precursors, but also depends on key enzymes, previous apple storage, among others. Further studies should be done to better clarify the behavior of fresh-cut apples as living tissue to metabolize precursors contained in edible coatings for the production of volatiles. © 2014 Institute of Food Technologists®

  11. Differential toxicity of heterocyclic aromatic amines and their mixture in metabolically competent HepaRG cells

    International Nuclear Information System (INIS)

    Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Le Hegarat, Ludovic; Aninat, Caroline; Robin, Marie-Anne; Guguen-Guillouzo, Christiane

    2010-01-01

    Human exposure to heterocyclic aromatic amines (HAA) usually occurs through mixtures rather than individual compounds. However, the toxic effects and related mechanisms of co-exposure to HAA in humans remain unknown. We compared the effects of two of the most common HAA, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), individually or in combination, in the metabolically competent human hepatoma HepaRG cells. Various endpoints were measured including cytotoxicity, apoptosis, oxidative stress and DNA damage by the comet assay. Moreover, the effects of PhIP and/or MeIQx on mRNA expression and activities of enzymes involved in their activation and detoxification pathways were evaluated. After a 24 h treatment, PhIP and MeIQx, individually and in combination, exerted differential effects on apoptosis, oxidative stress, DNA damage and cytochrome P450 (CYP) activities. Only PhIP induced DNA damage. It was also a stronger inducer of CYP1A1 and CYP1B1 expression and activity than MeIQx. In contrast, only MeIQx exposure resulted in a significant induction of CYP1A2 activity. The combination of PhIP with MeIQx induced an oxidative stress and showed synergistic effects on apoptosis. However, PhIP-induced genotoxicity was abolished by a co-exposure with MeIQx. Such an inhibitory effect could be explained by a significant decrease in CYP1A2 activity which is responsible for PhIP genotoxicity. Our findings highlight the need to investigate interactions between HAA when assessing risks for human health and provide new insights in the mechanisms of interaction between PhIP and MeIQx.

  12. Occurrence of 26 Mycotoxins in the Grain of Cereals Cultivated in Poland

    Directory of Open Access Journals (Sweden)

    Marcin Bryła

    2016-05-01

    Full Text Available The levels of 26 mycotoxins were determined in 147 samples of the grain of cereals cultivated in five regions of Poland during the 2014 growing season. The HPLC-HRMS (time-of-flight analytical technique was used. An analytical procedure to simultaneously determine 26 mycotoxins in grain was developed, tested and verified. Samples from eastern and southern Poland were more contaminated with mycotoxins than the samples from northern and western Poland. Toxins produced by Fusarium fungi were the main contaminants found. Some deoxynivalenol (DON was found in 100% of the tested samples of wheat (Osiny, Borusowa, Werbkowice, triticale, winter barley and oats, while the maximum permissible DON level (as defined in the EU Commission Regulation No. 1881/2006 was exceeded in 10 samples. Zearalenone (ZEN, DON metabolites and enniatins were also commonly found. The presence of mycotoxins in grain reflected the prevailing weather conditions during the plant flowering/earing stages, which were favorable for the development of blight. Among all investigated wheat genotypes, cv. Fidelius was the least contaminated, while Bamberka, Forkida and Kampana were the most contaminated. However, the single-factor ANOVA analysis of variance did not reveal (at a statistical significance level α = 0.05 any differences between levels of mycotoxins in individual genotypes. Triticale was the most contaminated grain among all of the tested varieties. ZEN, DON and the sum of 3-acetyldexynivalenol and 15-acetyldeoxynivalenol (3- and 15-ADON were found in 100% of the tested triticale samples at concentrations within the 4–86, 196–1326 and 36–374 µg·kg−1 range, respectively. Of particular concern was the fact that some “emerging mycotoxins” (enniatins (in addition to commonly-known and legally-regulated mycotoxins were also found in the tested triticale samples (enniatin B (Enn-B, enniatin B1 (Enn-B1, enniatin A-1 (Enn-A1, 100% of samples, and enniatin A (Enn-A, 70

  13. Occurrence of 26 Mycotoxins in the Grain of Cereals Cultivated in Poland

    Science.gov (United States)

    Bryła, Marcin; Waśkiewicz, Agnieszka; Podolska, Grażyna; Szymczyk, Krystyna; Jędrzejczak, Renata; Damaziak, Krzysztof; Sułek, Alicja

    2016-01-01

    The levels of 26 mycotoxins were determined in 147 samples of the grain of cereals cultivated in five regions of Poland during the 2014 growing season. The HPLC-HRMS (time-of-flight) analytical technique was used. An analytical procedure to simultaneously determine 26 mycotoxins in grain was developed, tested and verified. Samples from eastern and southern Poland were more contaminated with mycotoxins than the samples from northern and western Poland. Toxins produced by Fusarium fungi were the main contaminants found. Some deoxynivalenol (DON) was found in 100% of the tested samples of wheat (Osiny, Borusowa, Werbkowice), triticale, winter barley and oats, while the maximum permissible DON level (as defined in the EU Commission Regulation No. 1881/2006) was exceeded in 10 samples. Zearalenone (ZEN), DON metabolites and enniatins were also commonly found. The presence of mycotoxins in grain reflected the prevailing weather conditions during the plant flowering/earing stages, which were favorable for the development of blight. Among all investigated wheat genotypes, cv. Fidelius was the least contaminated, while Bamberka, Forkida and Kampana were the most contaminated. However, the single-factor ANOVA analysis of variance did not reveal (at a statistical significance level α = 0.05) any differences between levels of mycotoxins in individual genotypes. Triticale was the most contaminated grain among all of the tested varieties. ZEN, DON and the sum of 3-acetyldexynivalenol and 15-acetyldeoxynivalenol (3- and 15-ADON) were found in 100% of the tested triticale samples at concentrations within the 4–86, 196–1326 and 36–374 µg·kg−1 range, respectively. Of particular concern was the fact that some “emerging mycotoxins” (enniatins) (in addition to commonly-known and legally-regulated mycotoxins) were also found in the tested triticale samples (enniatin B (Enn-B), enniatin B1 (Enn-B1), enniatin A-1 (Enn-A1), 100% of samples, and enniatin A (Enn-A), 70% of

  14. Sõprussuhted toovad raamatukogu ellu vunki ja värve / Reet Tomband

    Index Scriptorium Estoniae

    Tomband, Reet

    2014-01-01

    Lääne-Virumaa Keskraamatukogu sõprussuhetest Lappeenranta ja Lapua raamatukogudega, Tapa linnaraamatukogu koostööst Soome sõpruslinna Akaa (enne Toijala) raamatukoguga ning üritustest, mida on koos läbi viidud

  15. Laevahüpoteegi arengust Eesti õiguskorras : [bakalaureusetöö] / Kristiina Saul ; Õigusinstituut ; juhendaja: Priidu Pärna

    Index Scriptorium Estoniae

    Saul, Kristiina

    2002-01-01

    Laevahüpoteegi võrdlus enne 1940. a. kehtinud regulatsiooniga, laevahüpoteegi ja hüpoteegi võrdlev analüüs, laevahüpoteegi õigusliku regulatsiooni rahvusvaheline võrdlus (Eesti, Skandinaavia, Saksamaa)

  16. Tallinki laeva ehib kuue jalaga lehm / Toivo Tänavsuu

    Index Scriptorium Estoniae

    Tänavsuu, Toivo

    2006-01-01

    Valmimas on suurim Läänemerel seilav reisilaev Galaxy, mis hakkab sõitma alates suvest Tallinna ja Helsingi vahet. Lisad: Enn Pandi idee: loomad laevale; Alustatud on veel ühe laeva tegemist; Fakte Galaxyst

  17. Centrist speaks out for bilingualism / Ksenia Repson

    Index Scriptorium Estoniae

    Repson, Ksenia

    2005-01-01

    Tallinna linnavolikogu liige Dimitri Klenski soovib, et volikogu istungitel võetaks kasutusele ka vene keel. Volikogu liikme Igor Sedashevi arvates püüab Klenski endale enne kohalikke valimisi tähelepanu tõmmata

  18. Kontoris kolme kitsega / Silvia Pärmann

    Index Scriptorium Estoniae

    Pärmann, Silvia

    2014-01-01

    Tallinnas Hobujaama tänaval asuva firma NG Investeeringud kontori interjöör, sisearhitekt Kaire Kemp-Tišler (ArtAku Sisearhitektuuribüroo). Ruumides eksponeeritakse Enn Kunila kunstikogusse kuuluvaid töid

  19. Swedbank hüvitab tekitatud kahju ka fondi vahetajatele

    Index Scriptorium Estoniae

    2009-01-01

    Swedbank hüvitab veel enne 2009. aasta lõppu Private Debt Fondi osaku puhasväärtuse alanemise kolmandas kvartalis ning kompensatsiooni saavad ka need kliendid, kes on andnud sisse pensionifondi vahetamise taotluse

  20. Фабрику Kalev продают норвежской фирме / Андрус Карнау, Райго Неудорф

    Index Scriptorium Estoniae

    Карнау, Андрус

    2010-01-01

    AS-i Kalev Chocolate Factory osta sooviv Orkla kontrerni esindajate kinnitusel hakatakse edaspidi toodangut eksportima nii Balti- kui Põhjamaadesse. Enne varade üleminekut uuele omanikule tuleb ära oodata Kalevi aktsiate aresti alt vabanemine

  1. Greenpeace peatas Blairi kiidukõne tuumaenergiale / Maris Lillak

    Index Scriptorium Estoniae

    Lillak, Maris, 1970-

    2005-01-01

    Ilmunud ka: Postimees : na russkom jazõke 30. nov., lk 7. Kaks Greenpeace'i keskkonnaaktivisti korraldasid Londoni konverentsisaalis enne Briti peaministri Tony Blairi tuumaenergeetikakõnet meeleavalduse, visates saali lendlehti üleskutsega "Tuumaenergia: vale otsus"

  2. Tõnu Virve: filmi aines puudutas mu enda mälestusi / Tõnu Virve ; intervjueerinud Andres Laasik

    Index Scriptorium Estoniae

    Virve, Tõnu, 1946-

    2009-01-01

    Intervjuu 22. septembril Kumu auditooriumis esilinastunud dokumentaalfilmi "Monument" (Freyja Film, 2009) režissööri Tõnu Virvega. Kesksel kohal on filmis Tallinna Tõnismäe monument (skulptor Enn Roos, arhitekt Arnold Alas)

  3. Gustav Naanist etendub näidend

    Index Scriptorium Estoniae

    2008-01-01

    Merle Karusoo lavastab Draamateatris näidendi "Sigma Tau-C705". Näidendi aluseks on dokumentaalmaterjalid ja Enn Vetemaa - Erki Aule näidend "Gustav Naani hiilgus ja viletsus". Esietendub 16. märtsil

  4. Observation of Rashba zero-field spin splitting in a strained germanium 2D hole gas

    International Nuclear Information System (INIS)

    Morrison, C.; Rhead, S. D.; Foronda, J.; Leadley, D. R.; Myronov, M.; Wiśniewski, P.

    2014-01-01

    We report the observation, through Shubnikov-de Haas oscillations in the magnetoresistance, of spin splitting caused by the Rashba spin-orbit interaction in a strained Ge quantum well epitaxially grown on a standard Si(001) substrate. The Shubnikov-de Haas oscillations display a beating pattern due to the spin split Landau levels. The spin-orbit parameter and Rashba spin-splitting energy are found to be 1.0 × 10 −28   eVm 3 and 1.4 meV, respectively. This energy is comparable to 2D electron gases in III-V semiconductors, but substantially larger than in Si, and illustrates the suitability of Ge for modulated hole spin transport devices.

  5. Loodame luua pingevaba ja konstruktiivse õhkkonna / Jevgeni Ossinovski ; intervjueerinud Raivo Juurak

    Index Scriptorium Estoniae

    Ossinovski, Jevgeni, 1986-

    2014-01-01

    Intervjuu haridusminister Jevgeni Ossinovskiga eelseisvatest ülesannetest hariduse vallas. Küsimusele koalitsioonileppe kohta vastavad Audentese erakooli õpetaja Enn Kirsman, Rocca al Mare kooli aktsiaseltsi juhataja Rein Rebane ja Sakala eragümnaasiumi direktor Jekaterina Gridneva

  6. Kalevi uus omanik tahab ettevõtte eksportima panna / Raigo Neudorf ; kommenteerinud Kuldar Leis, Kati Kusmin, Vjatšeslav Leedo

    Index Scriptorium Estoniae

    Neudorf, Raigo

    2010-01-01

    AS-i Kalev Chocolate Factory osta sooviv Orkla kontrerni esindajate kinnitusel hakatakse edaspidi toodangut eksportima nii Balti- kui Põhjamaadesse. Enne varade üleminekut uuele omanikule tuleb ära oodata Kalevi aktsiate aresti alt vabanemine. Diagramm

  7. Chaos returns as new Latvian Saiema convenes / Philip Birzulis

    Index Scriptorium Estoniae

    Birzulis, Philip

    2011-01-01

    Enne Läti uue seimi esimest istungit astusid 6 parlamendiliiget Valdis Zatlersi parteist välja, kuna ei olnud rahul koalitsiooni poolt esitatud ministrikandidaatidega. Seimi spiikriks valiti taas Solvita Aboltina. Statistikat praeguse seimi koosseisu kohta

  8. Genetics Home Reference: genitopatellar syndrome

    Science.gov (United States)

    ... hypoplasia, renal anomalies, facial dysmorphism, and mental retardation GPS Related Information How are genetic conditions and genes ... Kwan A, Schlaubitz S, Barsh GS, Enns GM, Hudgins L. Genitopatellar syndrome: expanding the phenotype and excluding mutations ...

  9. Bangladeshis madistab kaks naist / Allan Espenberg

    Index Scriptorium Estoniae

    Espenberg, Allan

    2006-01-01

    Sisepoliitilised pinged Bangladeshis, kus kehtib maailmas küllaltki ainulaadne süsteem, mis näeb ette mõni kuu enne üldvalimisi valitud valitsuse lahkumist ning võimu üleandmist ajutisele üleminekukabinetile

  10. Muudatused sisemajanduse koguprodukti arvestustes = Changes in the methodology of macroeconomic statistics / Ene Kaldma

    Index Scriptorium Estoniae

    Kaldma, Ene

    2004-01-01

    2004. aastal tehtud muudatused makromajandusstatistika metoodikas tõid kaasa 1993.-2003. aasta sisemajanduse koguprodukti (SKP) ja selle komponentide suuruse korrigeerimise. Tabel: Sisemajanduse koguprodukt turuhindades kvartalite kaupa enne ja pärast metoodika muutumist, 1993-2003

  11. Sürrealism kunstigurmaanidele / Raivo Kelomees

    Index Scriptorium Estoniae

    Kelomees, Raivo, 1960-

    2008-01-01

    PARA näitus "Paranorm" Jõhvi kontserdimajas kuni 31. VIII. Osalejad: Ilmar Malin, Jüri Palm, Elo Järv, Vello Vinn, Leonhard Lapin, Enn Tegova, Ahti Seppet, Raivo Kelomees ja Kristina Viin. Kuraator Jaan Malin

  12. Foreign Minister urges EU unity on Russia / Matt Withers

    Index Scriptorium Estoniae

    Withers, Matt

    2008-01-01

    Välisminister Urmas Paet rõhutas Euroopa Liidu Üldasjade ja Välissuhete Nõukogu liikmete kohtumisel, et Euroopa Liit peab enne EL-i ja Venemaa vahelist tippkohtumist kujundama ühise arvamuse Venemaa-Gruusia konflikti suhtes

  13. На стройке "Черного лебедя" затишье

    Index Scriptorium Estoniae

    2009-01-01

    Tallinnas Kadriorus asuv 19. sajandist pärinev arhitektuurimälestis puitvilla Mon Repos laguneb. Hoone peab taastama firma NG Eesti. Lammutatud restoranihoone "Must Luik" kohale kavandatud Enn Rajasaare projekteeritud hoonet pole veel ehitama hakatud

  14. Kunsti tõmbavad vaatama p-tähed : uus näitus lastekunstikooli galeriis / Raimu Hanson

    Index Scriptorium Estoniae

    Hanson, Raimu, 1957-

    2008-01-01

    Näitus "P... ja p... kunst" Tartu Lastekunstikooli galeriis, kuraator Margus Kiis. Oma töid eksponeerivad Rauno Thomas Moss, Enn Tegova, Maris Palgi, Jane Remm, Kristiina Viin, Martin Vaher, Kaspar Jassa, Mariliin Kindsiko jt.

  15. 1er mars 2017 - Signature du livre d'or, visite du tunnel du LHC au Point 5 et de la caverne expériementale de CMS par le Secrétaire d’Etat français aux Affaires européennes auprès du ministre des Affaires étrangères et du Développement international H. Désir.

    CERN Multimedia

    Bennett, Sophia Elizabeth

    2017-01-01

    Entourent le Secrétaire d'Etat pendant la signature du livre d'or: Le Préfet de l’Ain A. Cochet; le Directeur des accélérateurs et de la technologie F. Bordry; Ambassadeur, Représentant permanent de la France auprès de l’Office des Nations Unies à Genève et des Organisations internationales en Suisse E. Laurin; la Directrice générale du CERN F. Gianotti et la Directrice des relations internationales C. Warakaulle. Sont également présents: H. Bertrand, Maire de Saint-Genis-Pouilly; C. Bouvier, Maire de Cessy; G. Rousseau, Secrétaire Général de la sous-préfecture de Gex; Y. Mecibah, Directrice de Cabinet du Maire de Saint-Genis-Pouilly; F. Croquette, Ambassadeur pour les droits de l’homme, chargé de la dimension internationale de la Shoah, des spoliations et du devoir de mémoire; S. Bonbayl, Conseillère technique, Cabinet du Secrétaire d’Etat chargé des Affaires Européennes au MAEDI; F. Cormon-Veyssière, Sous-Directrice des droits de l’Homme et des Affaires humanitaires au MAEDI...

  16. Disinfection byproduct formation in drinking water sources: A case study of Yuqiao reservoir.

    Science.gov (United States)

    Zhai, Hongyan; He, Xizhen; Zhang, Yan; Du, Tingting; Adeleye, Adeyemi S; Li, Yao

    2017-08-01

    This study investigated the potential formation of disinfection byproducts (DBPs) during chlorination and chloramination of 20 water samples collected from different points of Yuqiao reservoir in Tianjin, China. The concentrations of dissolved organic matter and ammonia decreased downstream the reservoir, while the specific UV absorbance (SUVA: the ratio of UV 254 to dissolved organic carbon) increased [from 0.67 L/(mg*m) upstream to 3.58 L/(mg*m) downstream]. The raw water quality played an important role in the formation of DBPs. During chlorination, haloacetic acids (HAAs) were the major DBPs formed in most of the water samples, followed by trihalomethanes (THMs). CHCl 3 and CHCl 2 Br were the major THM species, while trichloroacetic acid (TCAA) and dichloroacetic acid (DCAA) were the major HAA species. Chloramination, on the other hand, generally resulted in lower concentrations of THMs (CHCl 3 ), HAAs (TCAA and DCAA), and haloacetonitriles (HANs). All the species of DBPs formed had positive correlations with the SUVA values, and HANs had the highest one (R 2  = 0.8). The correlation coefficients between the analogous DBP yields and the SUVA values in chlorinated samples were close to those in chloraminated samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Validation and application of a GC-MS method for the determination of haloacetic acids in drinking water

    Directory of Open Access Journals (Sweden)

    Chiavelli Lucas U.R.

    2016-01-01

    Full Text Available Usually, water treatment plants employ chlorine or sodium hypochlorite during the disinfection process, ensuring that there are not any pathogenic microorganisms in water. However, chlorine might react with natural organic matter and lead to formation of potentially carcinogenic by-products regarding human health, such as haloacetic acids (HAAs. Several countries regulate the levels of these acids in drinking water. Therefore, their concentrations must be monitored with the greatest accuracy as possible. In order to achieve this goal, a method through gas chromatography coupled with mass spectrometry (GC-MS was validated and applied to the determination of HAAs in samples of water destined to the public water service provision from the city of Maringá, Paraná State, Brazil. Measurements between two periods have close recovery values, indicating that the method has good accuracy during the same day. The limits of detection (LOD and quantification (LOQ were satisfactory, with LOD 0.42 μg L-1 and LOQ 1.40 μg L-1 for dichloro-acetic acid (DCAA analysis. Recovery values obtained for the nine haloace-tics acids (HAA9 corresponded to 69.9-107.3 % for samples. The repeatability performed for two periods presented close relative standard deviation (RSD values, indicating that the method has good accuracy during the same day.

  18. Monte-Carlo and multi-exposure assessment for the derivation of criteria for disinfection byproducts and volatile organic compounds in drinking water: Allocation factors and liter-equivalents per day.

    Science.gov (United States)

    Akiyama, Megumi; Matsui, Yoshihiko; Kido, Junki; Matsushita, Taku; Shirasaki, Nobutaka

    2018-06-01

    The probability distributions of total potential doses of disinfection byproducts and volatile organic compounds via ingestion, inhalation, and dermal exposure were estimated with Monte Carlo simulations, after conducting physiologically based pharmacokinetic model simulations to takes into account the differences in availability between the three exposures. If the criterion that the 95th percentile estimate equals the TDI (tolerable daily intake) is regarded as protecting the majority of a population, the drinking water criteria would be 140 (trichloromethane), 66 (bromodichloromethane), 157 (dibromochloromethane), 203 (tribromomethane), 140 (dichloroacetic acid), 78 (trichloroacetic acid), 6.55 (trichloroethylene, TCE), and 22 μg/L (perchloroethylene). The TCE criterion was lower than the Japanese Drinking Water Quality Standard (10 μg/L). The latter would allow the intake of 20% of the population to exceed the TDI. Indirect inhalation via evaporation from water, especially in bathrooms, was the major route of exposure to compounds other than haloacetic acids (HAAs) and accounted for 1.2-9 liter-equivalents/day for the median-exposure subpopulation. The ingestion of food was a major indirect route of exposure to HAAs. Contributions of direct water intake were not very different for trihalomethanes (30-45% of TDIs) and HAAs (45-52% of TDIs). Copyright © 2018 Elsevier Inc. All rights reserved.

  19. High altitude dermatology

    Directory of Open Access Journals (Sweden)

    G K Singh

    2017-01-01

    Full Text Available Approximately, 140 million people worldwide live permanently at high altitudes (HAs and approximately another 40 million people travel to HA area (HAA every year for reasons of occupation, sports or recreation. In India, whole of Ladakh region, part of Northwest Kashmir, Northern part of Sikkim and Tenga valley of Arunachal are considered inhabited areas of HAA. The low quantity of oxygen, high exposure of ultraviolet (UV light, very low humidity, extreme subzero temperature in winter, high wind velocity, make this region difficult for lowlanders as well as for tourists. Acute mountain sickness, HA pulmonary edema, HA cerebral edema, and thromboembolic conditions are known to occur in HA. However, enough knowledge has not been shared on dermatoses peculiar to this region. Xerosis, UV-related skin disorders (tanning, photomelanosis, acute and chronic sunburn, polymorphic light eruption, chronic actinic dermatitis, actinic cheilitis, etc., cold injuries (frostbite, chilblains, acrocyanosis, erythrocyanosis, etc. nail changes (koilonychias, airborne contact dermatitis, insect bite reaction, and skin carcinoma (basal cell carcinomas, squamous cell carcinomas, and also rarely malignant melanoma are the dermatoses seen in HAAs. Early diagnosis and knowledge of HA dermatoses may prevent serious consequences of disease and improve the quality of life for the visitors as well as for native of the place.

  20. The influence of different matrices on the nature and content of haloacetic acids precursors in ozonized water

    Directory of Open Access Journals (Sweden)

    Molnar Jelena J.

    2012-01-01

    Full Text Available This paper investigates the influence of different matrices (groundwater a realistic natural matrix and commercial humic acid solution a synthetic matrix on the nature and content of haloacetic acid (HAA precursors in ozonized water (0.4 to 3.0 mg O3/mg DOC; pH 6. Natural organic matter (NOM characterization of the natural matrix showed it was largely of hydrophobic character (65% fulvic and 14% humic acids, with the hydrophilic fractions HPIA and HPI-NA at 12% and 9%, respectively. At approximately the same dissolved organic carbon (DOC content of the investigated matrices (~10 mg /L, a greater degree of hydrophobicity was seen in the humic acid solution than in the natural matrix, resulting in a higher content of HAA precursors (559 ± 21 μg/L in the synthetic matrix compared to 309 ± 15 μg/L in the natural matrix. By applying different ozone doses (0.4 to 3.0 mg O3/mg DOC, the DOC content of the studied matrices was reduced by 6-22%, with a maximum process efficacy being achieved with 3.0 mg O3/mg DOC. Ozonation also lead to changes in the NOM structure, i.e. complete oxidation of the humic acid fractions in both investigated matrices. After oxidation, hydrophilic structures dominate the natural water matrix (65%, whereas the synthetic matrix has an equal distribution of hydrophobic and hydrophilic fractions (~50%. Changes in the content and structure of NOM during ozonation resulted in the reduction of the total HAA precursors content (63-85%, using 3.0 mg O3/mg DOC. Detailed analysis of the reactivity of the residual HAA precursor materials shows that ozonation using 3.0 mg O3/mg DOC reduced the reactivity of the NOM fractions in comparison to the raw water. By contrast, HAA precursor material present in the commercial HA solution was transformed after ozonation into other reactive compounds, i.e. precursors which originated from the fulvic acid and hydrophilic fractions. The results of the laboratory testing indicate that the

  1. Methemoglobin Formation and Characterization of Hemoglobin Adducts of Carcinogenic Aromatic Amines and Heterocyclic Aromatic Amines.

    Science.gov (United States)

    Pathak, Khyatiben V; Chiu, Ting-Lan; Amin, Elizabeth Ambrose; Turesky, Robert J

    2016-03-21

    Arylamines (AAs) and heterocyclic aromatic amines (HAAs) are structurally related carcinogens formed during the combustion of tobacco or cooking of meat. They undergo cytochrome P450 mediated N-hydroxylation to form metabolites which bind to DNA and lead to mutations. The N-hydroxylated metabolites of many AAs also can undergo a co-oxidation reaction with oxy-hemolgobin (HbO2) to form methemoglobin (met-Hb) and the arylnitroso intermediates, which react with the β-Cys(93) chain of Hb to form Hb-arylsulfinamide adducts. The biochemistry of arylamine metabolism has been exploited to biomonitor certain AAs through their Hb arylsulfinamide adducts in humans. We examined the reactivity of HbO2 with the N-hydroxylated metabolites of 4-aminobiphenyl (ABP, HONH-ABP), aniline (ANL, HONH-ANL), and the HAAs 2-amino-9H-pyrido[2,3-b]indole (AαC, HONH-AαC), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP, HONH-PhIP), and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx, HONH-MeIQx). HONH-ABP, HO-ANL, and HONH-AαC induced methemoglobinemia and formed Hb sulfinamide adducts. However, HONH-MeIQx and HONH-PhIP did not react with the oxy-heme complex, and met-Hb formation and chemical modification of the β-Cys(93) residue were negligible. Molecular modeling studies showed that the distances between the H-ON-AA or H-ON-HAA substrates and the oxy-heme complex of HbO2 were too far away to induce methemoglobinemia. Different conformational changes in flexible helical and loop regions around the heme pocket induced by the H-ON-AA or H-ON-HAAs may explain the different proclivities of these chemicals to induce methemoglobinemia. Hb-Cys(93β) sulfinamide and sulfonamide adducts of ABP, ANL, and AαC were identified, by Orbitrap MS, following the proteolysis of Hb with trypsin, Glu-C, or Lys-C. Hb sulfinamide and sulfonamide adducts of ABP were identified in the blood of mice exposed to ABP, by Orbitrap MS. This is the first report of the identification of intact Hb

  2. Osa kultuuripealinna jälle vastu taevast, aidaa linnahalli remondile! / Raimo Poom

    Index Scriptorium Estoniae

    Poom, Raimo

    2010-01-01

    Autor selgitab Tallinna ja linnahalli investeerida soovivaid USA ettevõtjaid koondava firma Tallinn Entertainment LLC vahel sõlmitud eellepingut ning leiab, et tõenäoliselt on välistatud linnahalli renoveerimise algus enne 2011. aastat

  3. Väliseestlane kinkis haruldased filmilõigud / Priit Rajalo

    Index Scriptorium Estoniae

    Rajalo, Priit, 1975-

    2005-01-01

    Kanada eestlane, 83-aastane Valdek Raiend kinkis Eesti Spordimuuseumile enda tehtud amatöörfilmid Montreali olümpiamängudest 1976.a., kus Enn Selliku 5000 m jooksu ajal lehvisid pealtvaatajate seas ka Eesti trikoloorid

  4. Unistused Pärnu 33 tooli asjus / Toomas Sildam

    Index Scriptorium Estoniae

    Sildam, Toomas, 1961-

    2005-01-01

    Pärnu maavanem Toomas Kivimägi iseloomustab olukorda Pärnumaal kolm nädalat enne valimisi. Erakondade ja valimisliitude valimislubadustest Pärnus. Kaart: Pärnumaa. Lisa: 21 omavalitsust. Vt. samas: Üks asfalttee Talile, palun!

  5. Eesti rehepapid läksid Bauhausi nime kallale / Sten-Aleks Pihlak

    Index Scriptorium Estoniae

    Pihlak, Sten-Aleks

    2008-01-01

    Enne Saksa keti Bauhaus Eestisse tulekut üritasid eestlastest konkurendid tema kaubamärki endale võtta. Vt. samas: Kaubamärkide üle vaieldakse sageli ja pikalt. Kommenteerivad Merle Rihma ja Margus Tähepõld

  6. Võõrvõimu tekitatud kahju heastamise kriteeriumid : Euroopa Inimõiguste Kohtu praktika / Maris Kuurberg

    Index Scriptorium Estoniae

    Kuurberg, Maris

    2010-01-01

    Euroopa Inimõiguste Kohtu praktikast kohtuasjades, mis puudutavad Euroopa inimõiguste ja põhivabaduste kaitse konventsiooni osalisriigi kohustusi kahju heastamisel, mille on tekitanud enne konventsiooni jõustumist selles riigis riiki okupeerinud või annekteerinud teine riik

  7. Eesti lastefilmi ja lasteraamatu uutmoodi suhted / Mari Niitra

    Index Scriptorium Estoniae

    Niitra, Mari, 1979-

    Viimaste aastate lastefilmi ja lasteraamatu omavaheliste suhete uuest suundumusest, kus filmid linastuvad enne raamatu sündi või paralleelselt raamatu väljaandmisega ("Lepatriinude jõulud", "Leiutajateküla Lotte" ja "Ruudi" näidetel)

  8. Standardi juhid maksid 37, 5 miljonit krooni / Aivar Hundimägi

    Index Scriptorium Estoniae

    Hundimägi, Aivar, 1975-

    2004-01-01

    Standardi juhatuse esimees Enn Veskimägi ning juhatuse liikmed Priit Tamm ja Mati Peekma omandasid 58% Standardi aktsiatest, makstes Indoor Group'ile ja riskikapitaliinvestorile BaltCap tehingu eest väidetavalt 37, 5 miljonit krooni

  9. Papas Kino ist tot? / Lauri Kärk

    Index Scriptorium Estoniae

    Kärk, Lauri, 1954-

    2009-01-01

    Saksamaa sõjajärgsest filmisituatsioonist ja suhestumisest minevikuga ning Paps Kino'st seoses 2.-7. juunini kinos Sõprus toimunud saksa filmide festivaliga "Pärast sõda, enne müüri: saksa film 1945-60"

  10. Purpurmust Org : Urmo Mets, Allar Lepa, Martin Vabat, Marje Ingel, Carolina Pihelgas, Siim Kera, Hanna Kangro, Kaarel B Väljamäe

    Index Scriptorium Estoniae

    2008-01-01

    Sisu: Kultuurinartsiss; "lugesin enne roostet..." ; Eravaldus ; "riik nagu..." ; "Novembri lõpu õunapuud..." ; Mis siin ikka ; "su selgroog..." ; "hommikuti jääb pori kingatalla alla..." "lauale seisma jäänud sibul haiseb nagu venelase higi..."

  11. Kas piiratud natsionalism või identiteedi kinnitus?! / Imbi Paju

    Index Scriptorium Estoniae

    Paju, Imbi, 1959-

    2010-01-01

    Näitus "Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kollektsioonist" Helsingi Taidehallis 24. novembrini 2010, kuraator Harry Liivrand. Näituse kohta 28. oktoobril 2010 ajalehes "Sirp" ilmunud Otso Kantokorpi ja Reet Varblase artiklitest

  12. Eestit külastab 17 USA kindralit

    Index Scriptorium Estoniae

    2016-01-01

    Kaitseväe juhataja kindralleitnant Riho Terras tutvustas eile mereväebaasis 17 Eestis viibivale Ameerika Ühendriikide kõrgemale ohvitserile meie riigikaitsesüsteemi. Enne Eestit käisid õppereisil viibivad ohvitserid Ukrainas ja Moldovas

  13. "Kadriorg" dozhivajet poslednije dni / Urmas Tooming

    Index Scriptorium Estoniae

    Tooming, Urmas

    2008-01-01

    Voldemar Herkeli projekteeritud Kadrioru kohvik Tallinnas lammutatakse. Asemele ehitatakse Enn Rajasaare (arhitektuuribüroo JVR) projekteeritud külaliskorteritega ärimaja. Kohvikuhoone taga asuv ajalooline villa Mon Repos tuleb arendajal säilitada. Robert Nermani kommentaar

  14. Olmerti lahkumine külvab segadust / Karin Volmer

    Index Scriptorium Estoniae

    Volmer, Karin

    2008-01-01

    Iisraeli valitsusjuhi Ehud Olmerti tagasiastumisteade külvas kahtlusi Palestiinaga rahukõneluste jätkumise üle, kuid Jerusalem Posti andmeil üritab Olmert jõuda Palestiina liidri Mahmoud Abbasiga kokkuleppele veel enne uusi erakonnasiseseid valimisi

  15. Homoseksualism ja selle õiguslik regulatsioon : [bakalaureusetöö] / Mai Ärmand ; Tartu Ülikool, õigusteaduskond ; juhendaja: Edgar Salumaa

    Index Scriptorium Estoniae

    Ärmand, Mai

    1996-01-01

    Homoseksualismist ajaloos (Kreeka, Rooma, keskaeg - kirikuõigus, ilmalik õigus, uusaeg), homoseksualismist Eestis (enne Eesti Vabariiki, Vabariigi ajal, ENSV ajal); homoseksualism ja tänapäeva Eesti. Vt. ka: Juridica (1996) nr. 6, lk. 301-303

  16. Pallaslitaania : ka traditsioonilist skulptuuri tuleb aktiivselt eksponeerida / Eero Kangor

    Index Scriptorium Estoniae

    Kangor, Eero, 1982-

    2006-01-01

    Näitus "Pallase skulptuur" Tartu Kivisilla galeriis kuni 24. IX, kuraator Ahti Seppet. Enn Roosi, Maire-Helve Männiku, Ernst Jõesaare, Irmgard Luha, Eduard Wiiralti, Ferdi Sannamehe, Johannes Hirve ja August Vommi töödest

  17. Kadrioru kuulus Must Luik elab oma viimaseid päevi / Urmas Tooming

    Index Scriptorium Estoniae

    Tooming, Urmas

    2008-01-01

    Voldemar Herkeli projekteeritud Kadrioru kohvik Tallinnas lammutatakse. Asemele ehitatakse Enn Rajasaare (arhitektuuribüroo JVR) projekteeritud külaliskorteritega ärimaja. Kohvikuhoone taga asuv ajalooline villa Mon Repos tuleb arendajal säilitada. Robert Nermani kommentaar

  18. Latvia faces another hoarding fine from EC

    Index Scriptorium Estoniae

    2005-01-01

    Euroopa Komisjon võib Lätile määrata trahve ka juustu, või ja kooritud piima ladustamise eest enne Euroopa Liiduga liitumist. Põllumajandusminister Martins Roze sõul ei ole Läti neid toiduaineid ladustanud

  19. Aasta pressifotod žürii perspektiivist / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika, 1974-

    2015-01-01

    Konkursist "Aasta pressifoto", pressifotograafide igapäevatööst. "Aasta pressifoto 2014" peapreemia pälvis Dmitri Kotjuhi "Noored suusatajad", portreefoto kategooria võitis Renee Altrovi "Eesti Vabariigi president", uudisfoto kategooria Margus Ansu "Klassijuhataja tunnid", olemusfoto kategooria Priit Simsoni "Kaotatud sõda"

  20. Kiigutab kuuski ja porgandeid / Marko Mägi

    Index Scriptorium Estoniae

    Mägi, Marko

    2000-01-01

    Andrus Kõressaare ja Raivo Kotovi EXPO 2000 Eesti paviljoni projektist. R. Kotovist, tema tulevikuplaanidest, saavutustest enne EXPO-konkursi võitu (väljapanek näitusel 'Biotoopia',1998. a. ühistöö Marko Laimrega 'Egoistically Correct').

  1. [Communication in the early modern Baltic Sea region = Kommunikatsioon varauusaegses Läänemereruumis] / Ulrike Plath

    Index Scriptorium Estoniae

    Plath, Ulrike, 1972-

    2011-01-01

    Arvustus: Communication in the early modern Baltic Sea region = Kommunikatsioon varauusaegses Läänemereruumis. Hrsg. von Enn Küng, Mati Laur, Kersti Lust. Ajalooline Ajakiri. The Estonian Historical Journal 2009. Nr. 3/4 (129/130). (Tartu 2010)

  2. Teatrisügise macho-pähklid / Margit Tõnson

    Index Scriptorium Estoniae

    Tõnson, Margit, 1978-

    2008-01-01

    Andrzej Saramonowiczi näidend "Testosteroon" Endla teatris, lavastaja Enn Keerd. Ott Aardami noortetükist "Poks", lavastaja autor Ugala teatris. Kristjan Sarve debüütlavastus "Rambo" David Morrelli romaani "Esimene veri" ainetel NO99 teatris

  3. Spordipreemiad leidsid omaniku / Anne Põder

    Index Scriptorium Estoniae

    Põder, Anne, 1973-

    2007-01-01

    Järvamaa omavalitsuste liit ja spordiliit tunnustasid maakonna parimaid sportlasi, kelleks osutusid Ain-Alar Juhanson, Mikko Vanaisak, Viktoria Leks ja Grit Shadeiko. Spordiedendaja preemia sai Tiit Kavak, spordi elutöö preemia pälvis Enn Sõmeri

  4. Kirjandusteosed läbisid esimese sõelumise / Inna Grünfeldt

    Index Scriptorium Estoniae

    Grünfeldt, Inna, 1961-

    2006-01-01

    Virumaa selle aasta kirjandusauhinnale kandideerivad Ave Alavainu "Minekulaulud", Toomas Haugi "Troojamäe tõotus", Enn Nõu "Mõtusekuke viimne kogupauk", Olavi Ruitlase "Kroonu", Olivia Saare "Humalapuu", Indrek Hargla "French ja Koulu" ja Eevi Taeli "Lapse silmadega Narvast"

  5. Stiilne avarus / Aita Kivi

    Index Scriptorium Estoniae

    Kivi, Aita, 1954-

    2004-01-01

    Angelika ja Meelis Maalmanni perekonna korter (93 mø) Rannamõisa teel asuvas ridaelamus. Uue plaanilahenduse ja sisekujunduse autor Aet Piel. Ill.: 8 vaadet, korteri plaan enne ja nüüd. A. ja M. Maalmanni kommentaarid

  6. L'Europe prête 300 millions d'euros au CERN

    CERN Multimedia

    2003-01-01

    The BEI (Banque Européenne d'Investissement) will lent to CERN 300 millions of Euros, not only to build the new accelerator, but also to help to set up and european programm of research (1 paragraph)

  7. International banks' CSR disclosures after the 2008 crisis / Laivi Laidroo, Maia Sokolova

    Index Scriptorium Estoniae

    Laidroo, Laivi

    2014-01-01

    Artiklis käsitletakse rahvusvaheliste pankade sotsiaalset vastutust oma tegevuse avalikustamise aspektist enne ja pärast viimast majanduskriisi. Kontentanalüüsi meetodil analüüsitakse 35 panga veebilehti ja ettevõtete sotsiaalse vastutuse raporteid.

  8. Vana platelsitsija juhtum: kapo töö kogemustepagas / Arvi Tap-Tapver

    Index Scriptorium Estoniae

    Tap-Tapver, Arvi

    2009-01-01

    Eesti Kaitsepolitsei uuris 1990-ndatel tollase Koonderakonna juhi ja Riigikogu riigikaitsekomisjoni esimehe Peeter Lorentsi seotust Soomest relvade salakaubana sissetoomisega mässulisele Läänemaa Vabatahtlike Jäägrikompaniile 1993. a., vahetult enne Pullapää kriisi

  9. Gromkaja ataka v Tihhom okeane / Ruslan Kadrmatov

    Index Scriptorium Estoniae

    Kadrmatov, Ruslan

    2006-01-01

    Hiina allveelaev lähenes 26. oktoobril Vaikses ookeanis USA lennukikandjale Kitty Hawk ja tõusis enne avastamist oma rakettide ja torpeedode tegevusraadiuses pinnale. Eksperdid usuvad, et aastaks 2025 hakkab Vaikse ookeani regioonis oma allveelaevastikuga domineerima Hiina

  10. Eesti tippteadlaste panus maailma : päästvad bakterid ja täiustatud elektroonika / koost. Jüri Allik

    Index Scriptorium Estoniae

    2007-01-01

    Jüri Allik lappas maailma suurimat teaduskirjanduse andmebaasi ISI Web of Science. Enimviidatud Eesti teadlased on: Jaan Aarik, Jaak Jürimäe, Mati Karelson, Marco Kirm, Eero Vasar, Mihkel Zilmer, Ülo Niinemets, Kaupo Kukli, Enn Lust

  11. Easyhome - ebatavaliselt hõrgud tüüpmajad / Urmas Oja

    Index Scriptorium Estoniae

    Oja, Urmas, 1981-2012

    2009-01-01

    Easyhome poolt pakutavatest suvilatest ja väikemajadest, mille on projekteerinud arhitekt Sten Ader. Moodulmajad toodetakse liimpuitkonstruktsioonis valmis Põlvamaal Ihamarus. Maja plaane, seinu ja viimistlusmaterjale on enne kokkupanekut hõlbus muuta. Mudeli saab tellida lame- või kaldkatusega

  12. "August 1991" - film ajaloost ja teletöötajaist / Sergo Selder

    Index Scriptorium Estoniae

    Selder, Sergo

    2005-01-01

    Eesti Televisiooni fiktiivne dokumentaaldraama "August 1991" : stsenarist ja režissöör Ilmar Raag : produtsent Gerda Kordemets : operaator Janno-Hans Arro. "Prototüübid" Enn Eesmaa ja Andres Raid kommenteerivad endi ja kolleegide kujutamist filmis

  13. Эстонская коллекция едет в Финландию / Валнер Вальме

    Index Scriptorium Estoniae

    Вальме, Валнер, 1970-

    2010-01-01

    15. oktoobril avatakse Helsingi kunstihoones (Helsingin Taidehalli) eesti klassikalise maalikunsti näitus "Eesti värvid – 150 aastat eesti maalikunsti Enn Kunila kollektsioonist". Kuraator Harry Liivrand, kujundaja Olev Subbi. Kollektsiooni tutvustava raamatu autor on Eero Epner

  14. Von Systemkritik zur Anpassung : Wie ein Buch in der Übersetzung die Farbe wechselt / Marianne Vogel

    Index Scriptorium Estoniae

    Vogel, Marianne

    2002-01-01

    Arvustus: Vetemaa, Enn. Die Nixen von Estland : ein Bestimmungsbuch / frei nach E. Vetemaa ; bearbeitet und illustriert von Kat Menschik ; nach dem russischen Übersetzungsmanuskript ins Deutsche übertragen von Günter Jäniche. Frankfurt/M : Eichborn Verlag, 2002.

  15. Must kalamari kallineb / Aleksei Günter

    Index Scriptorium Estoniae

    Günter, Aleksei, 1979-

    2006-01-01

    3. jaanuaril teatas ohustatud liikidega kauplemist reguleeriv rahvusvaheline keskkonnaorganisatsioon CITES, et ei kinnita kaaviari ekspordikvoote 2006. aastaks enne, kui tootjariigid esitavad piisavalt tõendeid, et tuuraliste püük ei ohusta seda hinnalist liiki. Lisa: Kas teate?

  16. Ehitusmaavarad ümber puhkes poliitiline kemplemine. Ettevõtjad loodavad kindlust tuleviku ees / Ain Alvela ; kommenteerinud Veljo Haube ja Enno Reinsalu

    Index Scriptorium Estoniae

    Alvela, Ain, 1967-

    2011-01-01

    Valitsus on kinnitanud ehitusmaavarade arengukava aastani 2020 ja sinna on sisse kirjutatud ka Nabala karstiala lubjakivivarud, kuigi enne 6. märtsil toimunud parlamendivalimisi oli lubatud, et need jäetakse arengukavast välja. Tõstetakse ka ressursitasusid

  17. Merinvestis on kõige tähtsam kvaliteet / Jaanus Kõrv

    Index Scriptorium Estoniae

    Kõrv, Jaanus

    2008-01-01

    Euroopa autotööstusele kummidetaile tarniva Merinvesti aastakäive on 150 miljonit krooni. Firmast 80% kuulub ettevõtte omanikule Enn Merile, ülejäänud 20% Freudenberg Dichtungs- und Schwingungstechnik GmbH & Co. KG-le

  18. USA eitab Afganistani valimiste promomõju / Neeme Raud

    Index Scriptorium Estoniae

    Raud, Neeme, 1969-

    2004-01-01

    USA suursaadiku Afganistanis Zalmay Khalilzadi väitel ei ole 9. oktoobril toimuvad valimised katse näidata enne Ameerika Ühendriikide valimisi, et valitsuse Afganistanis ja Iraagis võetud kurss on õige ja edukas. Lisa: Afganistani presidendivalimised

  19. Toward a culture-by-context perspective on negotiation: negotiating teams in the United States and Taiwan.

    Science.gov (United States)

    Gelfand, Michele J; Brett, Jeanne; Gunia, Brian C; Imai, Lynn; Huang, Tsai-Jung; Hsu, Bi-Fen

    2013-05-01

    Within the United States, teams outperform solos in negotiation (Thompson, Peterson, & Brodt, 1996). The current research examined whether this team advantage generalizes to negotiators from a collectivist culture (Taiwan). Because different cultures have different social norms, and because the team context may amplify the norms that are salient in a particular culture (Gelfand & Realo, 1999), we predicted that the effect of teams on negotiation would differ across cultures. Specifically, we predicted that since harmony norms predominate in collectivist cultures like Taiwan, the team context would amplify a concern with harmony, leading Taiwanese teams to negotiate especially suboptimal outcomes. In support, 2 studies showed that Taiwanese teams negotiated less-optimal outcomes than Taiwanese solos. We also used a moderated-mediation analysis to investigate the mechanism (Hayes, 2012), documenting that the interactive effect of culture and context on outcomes was mediated by harmony norms. By showing that the same situational conditions (team negotiations) can have divergent effects on negotiation outcomes across cultures, our results point toward a nuanced, sociocontextual view that moves beyond the culture-as-main-effect approach to studying culture and negotiations. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  20. Estimating the temporal evolution of Alzheimer's disease pathology with autopsy data.

    Science.gov (United States)

    Royall, Donald R; Palmer, Raymond F

    2012-01-01

    The temporal growth of Alzheimer's disease (AD) neuropathology cannot be easily determined because autopsy data are available only after death. We combined autopsy data from 471 participants in the Honolulu-Asia Aging Study (HAAS) into latent factor measures of neurofibrillary tangle and neuritic plaque counts. These were associated with intercept and slope parameters from a latent growth curve (LGC) model of 9-year change in cognitive test performance in 3244 autopsied and non-autopsied HAAS participants. Change in cognition fully mediated the association between baseline cognitive performance and AD lesions counts. The mediation effect of cognitive change on both AD lesion models effectively dates them within the period of cognitive surveillance. Additional analyses could lead to an improved understanding of lesion propagation in AD.

  1. Tallinna kaubandusbilanss 17. sajandil / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2015-01-01

    Mida kujutas endast portooriumitoll. Artikkel on katse uurida kaubandusbilanssi, tuginedes ainult ühele konkreetsele allikaliigile - peaaegu kogu 17. sajandi ulatuses säilinud portooriumitolliraamatutele

  2. Taastuvenergeetika stiimulid ja tõkked / Enn Kareda

    Index Scriptorium Estoniae

    Kareda, Enn, 1939-

    2005-01-01

    Energiaturu iseregulatsiooni eelistest käsumajandusliku administreerimise ees, Euroopa Liidu taastuvenergeetika ülevaatest FORRES 2020, Eesti taastuvenergeetika probleemidest ning Euroopa Liidu projektist CEERES uute liikmesriikide kaasamiseks taastuvenergia uurimisprogrammidesse

  3. Kas ikka elame XXI sajandil? / Enn Uusen

    Index Scriptorium Estoniae

    Uusen, Enn, 1941-

    2009-01-01

    Aegunud ideoloogiate eksporti arenenud riikidesse peab kõigi diplomaatiliste vahenditega piirama, autori sõnul puudutab Eestit eelkõige Venemaa toetumine XIX sajandi vallutajamaade imperiaalsele ideoloogiale

  4. Eesti Post haarab õlekõrrest? / Enn Vatter

    Index Scriptorium Estoniae

    Vatter, Enn

    2007-01-01

    AS Eesti Post 2006. aasta majandusaruandest ja ettevõtte majandusraskustest. Autor soovitab abi otsida riigikontrollist, kes suunaks AS Eesti Posti õigetele majandamisrööbastele. Diagrammid: Eesti Posti palgatõus

  5. Võidusammas tehakse korda enne valimisi / Raimo Poom

    Index Scriptorium Estoniae

    Poom, Raimo

    2010-01-01

    Kaitseministeerium allkirjastas Vabadussõja võidusamba uue valgustuse rajamiseks lepingu ettevõttega KH Energia-Konsult. Valgustus- ja ventilatsioonisüsteem peaks valmima jaanuaris 2011. Tööde järele valvavad Tehnokontrollikeskus OÜ ja Tallinna Tehnikaülikooli spetsialistid. Garantiitööd peab tegema Tšehhi firma Sans Souci

  6. Meie oma Aarete saar : [arvustus] / Enn Nõu

    Index Scriptorium Estoniae

    Nõu, Enn, 1933-

    2012-01-01

    Arvustus: Mats Burström. Minnesgömmor: berättelser om föremål gömda i jorden i Estland under andra världskriget. Lund: Nordic Academic Press, 2012 ; Burström, Mats. Treasured Memories: Tales of Buried Belonings in Wartime Estonia. Lund: Nordic Academic Press, 2012

  7. Veneetsia Kuldlõvi iraanlasele

    Index Scriptorium Estoniae

    2000-01-01

    Kuldlõvi sai Jafar Panahi mängufilm "Ring" ("Dayereh"), žürii suure preemia USA režissööri Julian Schnabeli "Enne kui öö saabub" ("Before Night Falls"), parima meesnäitleja preemia Javier Bardem

  8. JeS zhdjot ot Rossii podtverzhdenija / Marko Saaret

    Index Scriptorium Estoniae

    Saaret, Marko

    2004-01-01

    Euroopa Komisjoni president Romano Prodi, välisasjade komissar Chris Patten ja kaubandusvolinik Pascal Lamy alustavad visiiti Moskvasse. Venemaalt oodatakse lõplikku kinnitust kirjutamaks alla partnerluse ja koostöö lepingu laienemisele uute EL-i riikidega enne 1. maid

  9. Bank of Georgia jäi sõja jalgu / Romet Kreek

    Index Scriptorium Estoniae

    Kreek, Romet, 1972-

    2008-01-01

    Pinev olukord Gruusias ei ole Bank of Georgia tööd veel halvanud, kuid pikemas perspektiivis sõltub panga saatus sellest, kuidas läheb edasi Gruusia majandusel. Graafik: Aktsia oli langustrendis ammu enne Venemaa kallaletungi Gruusiale. Lisad

  10. Pühendunud oma kirele / Kristjan Smeds ; intervjueerinud Kairi Prints

    Index Scriptorium Estoniae

    Smeds, Kristian, 1970-

    2011-01-01

    Von Krahli Teatris esietendus 1. oktoobril lavastus "12 Karamazovit", lavastaja Kristian Smeds. Intervjuu lavastajaga päev enne esietendust. Von Krahli Teatri ja Smeds Ensemble'i ühisprojekti mängitakse oktoobris ja novembris Euroopa kultuuripealinnades Tallinnas ja Turus

  11. Kunstnik kavatseb maalidest jaanitule teha / Erika Prave

    Index Scriptorium Estoniae

    Prave, Erika, 1970-

    2005-01-01

    Andrus Older teeb jaanitule oma piltidest, mis jäävad ostmata oksjonil, mille ta korraldab päev enne Sillamäe lähedal Orava talus. Harrastuskunstnik paneb müüki umbes 50 maali. Kunstniku kommentaarid

  12. Väikeste sammudega saab jõudsamalt edasi liikuda / Liisi Seil

    Index Scriptorium Estoniae

    Seil, Liisi, 1971-

    2009-01-01

    Täiskasvanud õppija nädala raames tunnustati Viljandimaa aasta parimaid. Aasta õppija tiitli pälvis OÜ Sveba-Dahlen tootmistehnik Raul Järve, aasta koolitaja on vabakutseline õpetaja Enn Onni ning aasta koolitussõbralikemaks omavalitsuseks tunnistati Tarvastu Vallavalitsus

  13. 2763-IJBCS-Article-Tandji Olivier Amoussou

    African Journals Online (AJOL)

    hp

    Olivier AMOUSSOU exprime également sa gratitude à l'endroit de l'Union Européenne ... West African estuaries and lagoons, is also a good candidate for promoting tilapia farming. ...... Cichlidae) from coastal areas in West ... Rio de Janeiro;.

  14. Putin calls for diaspora Russians to return home / Joel Alas

    Index Scriptorium Estoniae

    Alas, Joel

    2006-01-01

    Venemaa president Vladimir Putin kutsus väljaspool Venemaad elavaid venelasi naasma kodumaale. Poliitik Enn Eesmaa sõnul on Venemaad juba pikemat aega probleemiks rahvastiku vähenemine, kuid vaatamata kutsele ei ole siiski oodata paljude inimeste lahkumist kodumaale

  15. Sõja ja kaose vahele surutud tšetšeenid valisid parlamenti / Kaarel Kaas

    Index Scriptorium Estoniae

    Kaas, Kaarel, 1978-

    2005-01-01

    Ilmunud ka: Postimees : na russkom jazõke 29. nov. lk. 8. 27. novembril toimunud parlamendivalimistest Tšetšeenias. Kaks ja pool tundi enne valimiste lõppu oli hääletamas käinud 57,4 protsenti valijatest

  16. Kas alternatiivid mainstreamil või alternatiivne mainstream? / Reet Varblane

    Index Scriptorium Estoniae

    Varblane, Reet, 1952-

    1998-01-01

    Missugune on praeguste eesti noorte sub- ja kontrakultuur? Samasuguseid laineid on enne olnud, näiteks Lapin-Okas-Keskküla, Eve ja Peeter Linnap & jüngrid. Hanno Soansi kutse väljuda galeriidest ja mõjutama olmet.

  17. "Paranormalnaja" võstavka v galereje

    Index Scriptorium Estoniae

    2008-01-01

    PARA näitus أParanormؤ Narva Muuseumi kunstigaleriis. Osalevad Ilmar Malin, Jüri Palm, Elo Järv, Vello Vinn, Leonhard Lapin, Enn Tegova, Ahti Seppet, Raivo Kelomees ja Kristina Viin. Parasürrealistide rühmitusest PARA

  18. Presidential Green Chemistry Challenge: 1996 Designing Greener Chemicals Award

    Science.gov (United States)

    Presidential Green Chemistry Challenge 1996 award winner, Rohm and Haas, developed Sea-Nine, a marine antifoulant to control plants and animals on ship hulls. Sea-Nine replaces persistent, toxic organotin antifoulants.

  19. Audrey Tautouga Coco jälgedes / Audrey Tautou ; intervjueerinud Lee Hanael

    Index Scriptorium Estoniae

    Tautou, Audrey, 1976-

    2009-01-01

    Näitlejanna mängib peaosa äsja esilinastunud eluloofilmis "Coco enne Chaneli" ("Coco avant Chanel", režissöör Anne Fontaine, Prantsusmaa 2009) ja on Chaneli moemaja parfüümi Chanel №5 reklaaminägu

  20. Arvo Pärt: Kui kannatab üks inimene, siis kannatab kogu maailm! / Arvo Pärt, Nora Pärt ; intervjueerinud Yana Toom, Maarja-Liis Arujärv, Aleksandr Zukerman ; kommenteerinud Edgar Savisaar

    Index Scriptorium Estoniae

    Pärt, Arvo, 1935-

    2010-01-01

    Arvo Pärt ja tema abikaasa Nora Pärt andsid Türgis enne Pärdi uudisteose "Aadama itk" esiettekannet intervjuu, kus rääkisid nii nende raskustest Läände elama asumisel kui uudisteose sügavamast mõttest

  1. Milline on Saare maakonna ettevõtjate koostöö / Vilma Rauniste

    Index Scriptorium Estoniae

    Rauniste, Vilma

    2007-01-01

    Saaremaa ettevõtete, omavalitsuste, koolitusasutuste ja riigi esindajad arutasid maakonna tulevikku. Vt. samas: Kohalviibinute arvamusi organisatsiooni loomise kohta. Arvamust avaldavad: Aadu Keskpaik, Marek Lepamets, Tullio Liblik, Villu Vatsfeld, Jüri Aus, Enn Meri, Riivo Asuja, Tarmo Sink, Robert Pajussaar, Kalle Koov

  2. Nasdaq loobub Londoni börsist OMX-i ostmiseks / Eric Katskowski

    Index Scriptorium Estoniae

    Katskowski, Eric

    2007-01-01

    USA tehnoloogiabörs Nasdaq konkureerib Dubai börsiga Skandinaavia ja Balti väärtpaberiturge juhtiva OMX-i ostmise pärast. Enn Metsari hinnangul on Tallinna börsi jaoks head mõlemad OMX-ile tehtud pakkumised

  3. BBC ja Kroonika teevad koostööd

    Index Scriptorium Estoniae

    2002-01-01

    Kroonika poole pöördus Inglise produtsent Lara McClure, sest Briti telekanali BBC tarvis valmib film "Estonia Dreams of Eurovision" ("Eesti unistab Eurovisioonist"), mis läheb eetrisse vahetult enne Eurovisiooni finaalvõistlust. Fotol T. Padar ja D. Benton

  4. Filmimaailma aplaus realismile : kolmas festivalikiri Cannes'ist, kus filmiprogramm on ületanud ekvaatori / Jaak Lõhmus

    Index Scriptorium Estoniae

    Lõhmus, Jaak

    2002-01-01

    Kolmest seni huvitavamast filmist : inglase Mike Leigh' "Kõik või ei midagi", Michiganist pärit dokumentalisti Michael Moore'i ameeriklaste vägivaldsust uuriv "Keeglimäng enne Columbine'i", iraanlase Abbas Kiarostami "10" ja Kanada armeenlase Atom Egoyani "Ararat"

  5. African Journal June 2011.cdr

    African Journals Online (AJOL)

    SEGUN ADENIJI

    reproductive health services. ... Cet article se sert des données tirées des Enquêtes Démographiques Ghanéennes de 2003 et 2008 ... family planning services and negative attitudes of ..... The vigorous social marketing campaigns carried out.

  6. Karikatura i meditatsija / Anna Litvinjuk

    Index Scriptorium Estoniae

    Litvinjuk, Anna

    2003-01-01

    Aserbaidžaani kunstniku Rashid Sherifi tööde näitus Tallinnas Kodulinna Majas. Enne seda eksponeeriti Sherifi töid Ugala teatris, kus ta oli näidendi "Dekameron" külaliskunstnikuks. Kunstnik oma töödest

  7. Charms - Kudu - Heinsaar kui sibul - kala - munaroog / Jüri Ehlvest

    Index Scriptorium Estoniae

    Ehlvest, Jüri, 1967-2006

    2005-01-01

    K. Kudust ja tema kolmest lavastusest Tartu Üliõpilasteatri esituses : M. Heinsaar-D. Charms-L. Carroll "Artur ja Paul ehk veidi enne maailma loomist", M. Heinsaar-D. Charms "Joogem äädikat, härrased!" ja D. Charmsi "Jelizaveta Bam"

  8. Muusikamaailm : Berliini Filharmoonikud Beethoveniga. Kurtagi festival Gütersloh's. Uus soome ooper. Glyndebourne Opera New Yorgis / Priit Kuusk

    Index Scriptorium Estoniae

    Kuusk, Priit, 1938-

    2001-01-01

    Berliini Filharmoonikute Beethoveni festivalist Roomas, Viinis ja Berliinis. Kurtagi festivalist Gütersloh's Saksamaal 16.-18. veebr.Helsingis esietendus 8. veebr. K.Aho kammerooper "Enne kui me kõik oleme hukkunud". Glyndebourne'i Touring Opera tutvustab kuulsa ooperifestivali lavastusi New Yorgis

  9. Uue Musta Luige ehitus Kadriorus ähvardab teadmata ajaks seiskuda / Urmas Tooming

    Index Scriptorium Estoniae

    Tooming, Urmas, 1954-

    2009-01-01

    Tallinnas Kadriorus asuv arhitektuurimälestis villa Mon Repos laguneb. 19. sajandist päit puithoone peab taastama firma NG Eesti. Arhitekt Voldemar Herkeli projekteeritud restoran Must Luik on lammutatud. Samale kohale kavandatud Enn Rajasaare projekteeritud hoonet pole veel hakatud ehitama

  10. Gustav Naan ja Sigma Tau / Arvo Pesti, Madli Pesti

    Index Scriptorium Estoniae

    Pesti, Arvo, 1956-2010

    2009-01-01

    Füüsik, kosmoloog ja ühiskonnategelane Gustav Naanist. Merle Karusoo dokumentaallavastusest "Sigma Tau-C705", mis põhineb Enn Vetemaa ja Erki Aule näidendil "Gustav Naani hiilgus ja viletsus". Esietendus 16. märtsil 2008 Eesti Draamateatris

  11. Vozmozhno, võ jeshtshjo ne znajete, tshto...

    Index Scriptorium Estoniae

    2003-01-01

    J. Lennoni kujundatud margid müüdi oksjonil, M. Carey otsib meest, R.E.M.-il ilmub hittide kogumik, Coldplay oli edukas Q Awards-2003, B. Streisand esineb vähe kontsertidel, Korn esineb enne poksimatshi, Eminemi loomingulistest plaanidest

  12. Kas Euroopa saab Euroopaks? / Timothy Garton Ash ; tõlk. Aet Varik

    Index Scriptorium Estoniae

    Garton Ash, Timothy, 1955-

    2002-01-01

    3. aprillil 1996 peetud Sanford S. Elbergi nim. loeng California Ülikooli (Berkeley) Rahvusvaheliste Uuringute Instituudis. Euroopa määratlus enne 1945. aastat, 1945-1989, külma sõja järgsel perioodil ja tänapäeval

  13. Essai de reconstitution de l'histoire géologique et structurale de la Méditerranée centrale Attempt to Reconstruct the Geological Tectonics and Intraplate Deformations

    Directory of Open Access Journals (Sweden)

    Schuster J. -M.

    2006-11-01

    Full Text Available La Méditerranée centrale (mer Ionienne occupe une position charnière entre le craton africain au sud et les chaînes de l'arc alpin au nord. La zone étudiée s'étend globalement de l'escarpement maltais à l'ouest, à l'extrémité orientale de la Crête à l'est. Elle se localise à l'aplomb du secteur profond de la Méditerranée centrale. On y distingue cinq unités structurales majeures : le bassin de Syrte, la plaine abyssale ionienne, le cône de Messine, la ride méditerranéenne et le fossé hellénique. La synthèse des éléments géophysiques et géologiques et des mouvements supposés des plaques africaine et eurasienne permet d'esquisser une reconstitution de l'histoire géologique et structurale de la Méditerranée centrale que l'on peut diviser en trois périodes: Trias-Paléocène, Éocène-Miocène, Plio-Quaternaire. Deux tectoniques y prennent place. L'une, protoméditerranéenne (téthysienne, mésogéenne, créatrice des chaînes périméditerranéennes s'étend tout au long des deux premières périodes (Trias à Miocène. L'autre, méditerranéenne, édificatrice de la Mer Méditerranée couvre la deuxième et la troisième période (Éocène à Quaternaire. The central Mediterranean (lonian Sea forms the uncture between the African croton in the S and the ranges of the Alpine arc in the . The zone examined stretches from the Maltese escarpment in the W ta the eastern M of Crete in the E. It is situated directly on top of the deep sector of the central editerranean. Five major structural units can be distinguished there, i.e. the Syrtis Basin, the lonian abyssal plain, the Messina cone, the Mediterranean ridge and the Hellenic trough. A synthesis of the geophysical and geological elements and of the assumed move-mentsoftheAfrican and Eurasion plates has been used ta sketch out a reconstruction of the geological and structural history of the central Mediterranean which can be divided into three periods : Trias

  14. Urine and plasma metabonomics coupled with UHPLC-QTOF/MS and multivariate data analysis on potential biomarkers in anemia and hematinic effects of herb pair Gui-Hong.

    Science.gov (United States)

    Li, Shujiao; Lin, Hang; Qu, Cheng; Tang, Yuping; Shen, Juan; Li, Weixia; Yue, Shijun; Kai, Jun; Shang, Guanxiong; Zhu, Zhenhua; Zhang, Changbin; Liu, Pei; Yan, Hui; Zhang, Li; Qian, Li; Qian, Dawei; Duan, Jin-ao

    2015-07-21

    The compatibility of Angelicae Sinensis Radix (Danggui) and Carthami Flos (Honghua), a famous herb pair Gui-Hong, can produce synergistic and complementary hematinic effects. Our previous studies have indicated that Gui-Hong has therapeutic potential treatment in hemolytic and aplastic anemia (HAA). The present study aimed to investigate the hematinic effects of Danggui, Honghua and Gui-Hong on HAA rats induced by acetyl phenylhydrazine (APH) and cyclophosphamide (CP) and to explore the underlying hematinic regulation mechanisms. Rats were divided into 5 groups, and drugs were administered by oral gavage one time each day for continuous 7 days from the experiment began. Urine and plasma were analyzed by ultra-high-performance liquid chromatography coupled to quadrupole time-of-flight mass spectrometry (UHPLC-QTOF/MS). Partial least-squares discriminate analysis (PLS-DA) models were built to evaluate the therapeutic effects of Danggui, Honghua and Gui-Hong. Pearson correlation matrix analysis method was used to discover the correlations between potential biomarkers and biochemical indicators of HAA rats. Seven potential biomarkers contribute to the separation of model group and control group were tentatively identified. The levels of l-kynurenine, phenylalanine, nicotinic acid and sphingosine increased significantly (Pmetabonomics method is a promising tool in the efficacy and mechanism research of traditional Chinese medicines. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Preliminary assessment report for Army Aviation Support Facility No. 3, Installation 13307, Hunter Army Airfield, Savannah, Georgia

    International Nuclear Information System (INIS)

    Kolpa, R.; Smith, K.

    1993-07-01

    This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA

  16. Preliminary assessment report for Army Aviation Support Facility No. 3, Installation 13307, Hunter Army Airfield, Savannah, Georgia. Installation Restoration Program

    Energy Technology Data Exchange (ETDEWEB)

    Kolpa, R.; Smith, K.

    1993-07-01

    This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA.

  17. Chloramination of nitrogenous contaminants (pharmaceuticals and pesticides): NDMA and halogenated DBPs formation

    KAUST Repository

    Le Roux, Julien; Gallard, Hervé ; Croue, Jean-Philippe

    2011-01-01

    Disinfection with chloramines is often used to reduce the production of regulated disinfection by-products (DBPs) such as trihalomethanes (THMs) and haloacetic acids (HAAs). However, chloramination can lead to the formation of N

  18. de Fusarium isolé du fruit de tomate (Solanum lycopersicum L ...

    African Journals Online (AJOL)

    Dina

    A phytopathogenic fungus Fusarium F-02 is isolated from rotten tomato fruit. ..... between Trichoderma harzianum and Pythium ultimum”. .... [31] - HAAS, and C. KEEL, “Regulation of antibiotic production in root-colonizing Pseudomonas spp.

  19. Carla del Ponte : Serbia koostöö ei saa piirduda vaid ühe inimesega / Carla Del Ponte ; interv. Krister Paris

    Index Scriptorium Estoniae

    Del Ponte, Carla

    2006-01-01

    ÜRO sõjakuritegude tribunali peasüüdistaja Carla del Ponte ei anna Serbia ühinemisele EL-iga oma heakskiitu enne, kui Belgrad hakkab täielikku koostööd tegema. Vt. samas: Del Ponte seisab Serbia teel EL-i

  20. Veneetsias lööb laineid kuuba kirjaniku eluloofilm / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2000-01-01

    57. Veneetsia filmifestivalil tõusis üheks favoriidiks Julian Schnabeli mängufilm "Enne õhtu saabumist" ("Before Night Falls") : Ameerika Ühendriigid 2000. Riho Undi nukufilmi "Samueli Internet" näidati edukalt ühes alaprogrammis, mis läheb edasi Milanosse ja Rooma

  1. Amber Trust on ostmas Tallinna Külmhoone emafirmat / Liis Kängsepp

    Index Scriptorium Estoniae

    Kängsepp, Liis, 1981-

    2005-01-01

    Skandinaavia-USA investeerimisfond Amber Trust loodab enne aasta lõppu allkirjastada Tallinna Külmhoone emafirma Kauno Pieno Centras ostulepingu. Diagramm: Tallinna Külmhoone majandusnäitajad. Vt. samas: Amber Trust tahab investeerida üle 2 miljardi krooni; Amber laiendas tegevust Vetteli kaudu Soome

  2. Sõjavägi võis salaja Estoniale sukelduda / Vahur Koorits

    Index Scriptorium Estoniae

    Koorits, Vahur, 1981-

    2006-01-01

    Rootsi parlamendisaadik Lars Angström väidab, et tuukrid käisid salaja Estonia vraki juures enne 2. okt. 1994, ja usub, et hukkumisööl veeti Estonial relvi, samuti soovib ta uut uurimist. Riigiprokurör Margus Kurmi seisukohad

  3. Filmifestival ootab dokfilme uudistama / Berit Toodo

    Index Scriptorium Estoniae

    Toodo, Berit

    2008-01-01

    Pärnu 22. dokumentaal- ja antropoloogiafilmide festivali kulgemisest, probleemidest filmide näitamise paikade ja tehnikaga, näidatavate filmide tutvustusi - ameeriklase Robert Harding Pittmani "Tamm nr. 419", Doris Tromballa ja Florian Guthknechti "Elu tulvavees", hollandlase Jos de Putteri "Enne üleujutust"

  4. Eduka ettevõtte aluseks saab olla vaid looming / Ave Schmidt

    Index Scriptorium Estoniae

    Schmidt, Ave

    2010-01-01

    Tänapäeva ettevõttele tagavad konkurentsieelise inspiratsioon ja originaalsed ideed. Arvamust avaldavad Tallinna kohviku Nop asutaja Margit Aasmäe, Estonian Airi arendusdirektor Gunnar Mägi, Tallinna Kaubamaja müügi- ja turundusdirektor Enn Parel ja Balteco disainijuht Aivar Habakukk

  5. Kaubanduse tagasihoidlik valitseja / Väinu Rozental

    Index Scriptorium Estoniae

    Rozental, Väinu, 1957-

    2007-01-01

    Tallinna Kaubamaja juht Raul Puusepp on äärmiselt järjekindel ja töökas. CV. Vt. samas: Kaubamaja eduloo taga on õiged otsused ja investeeringud. Diagramm; Kutse Lumumba ülikooli. Kommenteerivad: Enn Parel, Tarmo Punger, Tenno Tiits ja Jaan Kallas

  6. Arhitektuursed interjööridetailid

    Index Scriptorium Estoniae

    2003-01-01

    Front Arhitektide kujundatud trepp Tallinna vanalinna korteris. Martin Aunini projekteeritud trepp Kiuru t. ridaelamus Tallinnas. Sisekujunduse autor ja trepi konstruktor Enn Kivi. Klaasuksega kamin, alumiiniumraamis mattklaasist vaheuksed, dushiruum ja keerdtrepp Taso Mähari kujundatud korteris Tallinnas. Sisustuselementide konstruktor-teostaja Anti Kalk. 8 ill

  7. Eesti Kirjanike Liit praegu : ankeedivastused

    Index Scriptorium Estoniae

    1997-01-01

    Aut.: Ain Kaalep, Juhan Habicht, Valeria Ränik, Karl Muru, Mart Velsker, Janika Kronberg, Maie Kalda, Hannes Varblane, Toomas Raudam, Priidu Beier, Kati Murutar, Dagmar Normet, Enn Vetemaa, Henn-Kaarel Hellat, Vello Lattik, Kajar Pruul, Kauksi Ülle, Ene Mihkelson, Jüri Ehlvest

  8. Kuulatades pimedust / Krister Kivi

    Index Scriptorium Estoniae

    Kivi, Krister, 1975-

    2011-01-01

    Scotland Yardi kriisiläbirääkijana töötanud Richard Mullenderi sõnul on nt. Colombia inimröövide puhul paarikuuline vaikus enne nõudmiste esitamist tavaline. Varasematest Liibanonis toimunud lääne kodanike röövidest

  9. Lääs püüab maandada pingeid Venemaaga / Arko Olesk

    Index Scriptorium Estoniae

    Olesk, Arko, 1981-

    2007-01-01

    Ilmunud ka: Postimees : na russkom jazõke, 15. mai 2007, lk. 8. USA välisminister Condoleezza Rice ja Saksamaa välisminister Frank-Walter Steinmeier teevad visiidi Moskvasse, et siluda halvenevaid suhteid Venemaaga enne Samaras toimuvat EL-i ja Venemaa tippkohtumist

  10. "Ironiju sudbõ-2" Rjazanov jeshtsho ne videl

    Index Scriptorium Estoniae

    2007-01-01

    Eldar Rjazanovi igihaljale komöödiafilmile on Timur Bekmambetovi käe all loodud järg "Ironija sudbõ-2" (stsenarist Aleksei Slapovski), mille ümber juba enne esilinastust on loodud salapära hkkond ja ette võetud protestiaktsioone

  11. Filmitudengite lõputööde huumor : leebe, absurdne, must / Kaarel Kressa

    Index Scriptorium Estoniae

    Kressa, Kaarel, 1983-

    2006-01-01

    Homsel kinoseansil näidatakse nelja uut TLÜ filmi ja video õppetooli tudengite filmi : "Kaks enne ühte" (Laur Tõnurist), "Tulnukas ehk Valdise pääsemine 11 osas" (Rasmus Merivoo), "Konkurss" (Margus Paju), "Roosa kleit ja nahksed püksid" (Birgit Demidova)

  12. Kuu sündmus: Saksa filmide nädal / Maria Ulfsak-Šeripova

    Index Scriptorium Estoniae

    Ulfsak-Šeripova, Maria, 1981-

    2009-01-01

    1.-6. juunini toimub Vanalinnapäevade raames kinos Sõprus saksa filmide festival "Pärast sõda, enne müüri". Filmisoovitused: "Kadunud mees", režissöör, peaosatäitja Peter Lorre (1951) ja Ernst Marischka "Sissi" (1955)

  13. Kolmekesi ühest Peipsi-äärsest asjast / Tiit Lepp

    Index Scriptorium Estoniae

    Lepp, Tiit

    2007-01-01

    Annika Haasi, Birgit Püve ja Age Petersoni fotonäitus "Prichudie, Revisited" Peipsiääre valla inimestest ja elust-olust kunstikeskuses AmbulARToorium Tartumaaal. Kommenteerinud Annika Haas, Birgit Püve, Age Peterson

  14. Requirements on the provisional safety analyses and technical comparison of safety measures

    International Nuclear Information System (INIS)

    2010-04-01

    The concept of a Geological Underground Repository (SGT) was adopted by the Swiss Federal Council on April 2 nd , 2008. It fixes the goals and the safety technical criteria as well as the procedures for the choice of the site for an underground repository. Those responsible for waste management evaluate possible site regions according to the present status of geological knowledge and based on the safety criteria defined in SGT as well as on technical feasibility. In a first step, they propose geological repository sites for high level (HAA) and for low and intermediate level (SMA) radioactive wastes and justify their choice in a report delivered to the Swiss Federal Office of Energy. The Swiss Federal Council reviews the choices presented and, in the case of positive evaluation, approves them and considers them as an initial orientation. In a second step, based on the possible sites according to step 1, the waste management institution responsible has to reduce the repositories chosen for HAA and SMA by taking into account safety aspects, technical feasibility as well as space planning and socio-economical aspects. In making this choice, safety aspects have the highest priority. The criteria used for the evaluation in the first step have to be defined using provisional quantitative safety analyses. On the basis of the whole appraisal, including space planning and socio-economical aspects, those responsible for waste management propose at least two repository sites for HAA- and SMA-waste. Their selection is then reviewed by the authorities and, in the case of a positive assesment, the selection is taken as an intermediate result. The remaining sites are further studied to examine site choice and the delivery of a request for a design license. If necessary, the requested geological knowledge has to be confirmed by new investigations. Based on the results of the choosing process and a positive evaluation by the safety authorities, the Swiss Federal Council has to

  15. Quantum magnetotransport for the surface states of three-dimensional topological insulators in the presence of a Zeeman field

    KAUST Repository

    Tahir, Muhammad; Schwingenschlö gl, Udo

    2013-01-01

    We show that the surface states of magnetic topological insulators realize an activated behavior and Shubnikov de Haas oscillations. Applying an external magnetic field perpendicular to the surface of the topological insulator in the presence

  16. Veneetsia filmifestival lõppes Iraani võiduga / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2000-01-01

    Kuldlõvi sai Jafar Panahi mängufilm "Ring" ("Dayereh"), žürii suure preemia USA režissööri Julian Schnabeli "Enne kui öö saabub" ("Before Night Falls"), parima stsenaariumi preemia itaallase Marco Tullio Giordana "Sada sammu" ("I cento passi")

  17. Piip ja Tuut ootavad Amarillosse ja Coca-Cola Plazasse perepäevale

    Index Scriptorium Estoniae

    2004-01-01

    Kord kuus, septembrist 2004 kuni 2005.a. maini korraldatavatest perepäevadest. C-C Plazas on perepäevade ajal kavas eriprogramm ja enne või pärast filmi on pered oodatud Viru hotelli restorani Amarillo, kus kavas spetsiaalne lasteprogramm klounidelt Piip ja Tuut

  18. Haridustee = Education / Tiiu-Liisa Rummo-Laes

    Index Scriptorium Estoniae

    Rummo-Laes, Tiiu-Liisa

    2006-01-01

    Põhihariduses soolist eristumist ei ole märgata, murettekitavalt suur on poiste väljalangemine enne põhihariduse omandamist. Tütarlapsed ja noormehed üld- ja kutsehariduses, kesk- ja kõrghariduses. Noorte õppimine ja töötamine leibkonnatüübiti. Tabel, graafik, diagrammid

  19. Tuulelohe lend 2008 : Juhan Parts kutsus tööstureid arutelule

    Index Scriptorium Estoniae

    2008-01-01

    Kokkuvõte majandusfoorumist, kus arutati Eesti majanduspoliitika ja tööstuse tulevikku. Arutlevad majandus- ja kommunikatsiooniminister Juhan Parts, teadlane Endel Lippmaa, Eesti Telekomi juhatuse esimees Valdo Kalm, Eesti Arengufondi nõukogu esimees Indrek Neivelt ja AS-i Standard juhatuse esimees Enn Veskimägi

  20. Õnnetute ugrilaste lõputu õnn, ääri-veeri / Art Leete

    Index Scriptorium Estoniae

    Leete, Art, 1969-

    1996-01-01

    Arvustus: Enne koitu : Soome-ugri tõlkeklassikat / Koost. ja tlk. Arvo Valton; Saatesõnad kirjutanud: Eva Vingiano de Pina Martins. - Tln. : Virgela, 1996. nEesti-mari, eesti-komi ja eesti-udmurdi paralleeltekstidega tõlkekogumik. Ka Eva Vingiano de Pina Martinsi (Toulouze'i) saatesõnadest

  1. Punane süda mustal lipul / Lauri Kaare

    Index Scriptorium Estoniae

    Kaare, Lauri

    2004-01-01

    Helsingis 17. korda toimuva festivali "Armastus ja Anarhia" kavas olnud filmidest - korealase Park Chan-Wooki "Vanapoiss" ("Old Boy"), Richard Linklateri "Enne päikeseloojangut" ("Before Sunset"), india film "Homne võib jööda tulemata" ("Tomorrow May Never Come"), mehhiko "Nikotiin" ("Nicotina") jt

  2. Résultats de recherche | Page 427 | CRDI - Centre de recherches ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Fatal Indifference : The G8, Africa, and Global Health. Le G8 (Allemagne, Angleterre, Canada, États-Unis, France, Italie, Japon, Russie et Union européenne) est aujourd'hui le principal vecteur politique de la mondialisation. Publication Date. 31 août 2004. Livres.

  3. Weimari vari / Kalle Muuli

    Index Scriptorium Estoniae

    Muuli, Kalle, 1958-

    2008-01-01

    Enne Venemaa presidendivalimisi võrdles Eesti president Toomas Hendrik Ilves praegust Venemaad kunagise Weimari vabariigiga Saksamaal, jättes mainimata, et Weimari vabariik lõppes valimistega, mis tõid võimule natsionaalsotsialistliku partei eesotsas Adolf Hitleriga. Demokraatlike valimistega seotud ohtudest vähese demokraatiakogemusega maades

  4. Edgar Savisaar : poliitilistel kolleegidel läheb tarvis rohkem paksu nahka / Edgar Savisaar ; interv. Tuuli Koch

    Index Scriptorium Estoniae

    Savisaar, Edgar, 1950-

    2007-01-01

    Keskerakonna esimees vastab enne Riigikogu valimisi küsimustele, mis puudutavad valimisvõitlust, valitsuse moodustamist, peaministriks olemist, hinnangut peaminister Andrus Ansipile, koostööd Reformierakonna ja Rahvaliiduga, Keskerakonna valimislubadusi ja -programmi ning uusliikmeid, teiste parteide poliitikat. Lisa: Keskerakonna valimislubadusi; 3 küsimust

  5. Toomas Annus. Elu koos kapoga / Kadri Jakobson

    Index Scriptorium Estoniae

    Jakobson, Kadri, 1970-

    2007-01-01

    Merko suuromanik Toomas Annus räägib hirmuõhustikust ja kahtlustustest tema ümber, sõpradest ja toetajatest, süüdistusest ja prokuratuuri käitumisest. Vt. samas: Skandaal hakks kaks aastat tagasi. Kommenteerivad: Enn Veskimägi, Juhan Parts, Indrek Neivelt

  6. Rein Veidemanni romaan vene keeles

    Index Scriptorium Estoniae

    2015-01-01

    Kirjastus KPD on välja andnud vene keeles Rein Veidemanni 2012. aastal ilmunud romaani "Tund enne igavikku". Marina Tervoneni tõlkes ilmunud teos kannab vene keeles pealkirja "Вечный университет"

  7. Millennium breakthrough : North goes west / Ivar Leimus

    Index Scriptorium Estoniae

    Leimus, Ivar, 1953-

    2009-01-01

    Kaubandusest Kasaari ja Volga-Bulgari riigi keskustes. Saksa idamisjonist ja Põhjala misjonist. Ebaõnnestunud misjonist Kiievi-Venes. Inglise misjonist Rootsis ja Taanis. Seosest misjonitegevuse ja mündiekspordi lähtealade vahel. Euroopa orientatsioonile üleminekust paar sajandit enne Eesti vägivaldset hõivamist

  8. Hea disaineri kätte võib usaldada nii büroo kui kodu / Tiina Salumäe

    Index Scriptorium Estoniae

    Salumäe, Tiina

    1998-01-01

    Näiteid eestoi sisearhitektide ja firmade heast koostööst: Ene Eharanna ja Enn Lüüsi (ITC MCM) koostööst ERE Pangaga, Pille Lausmäe kujundustest Estconde-E'le, Maile Grünbergi tööst Linda Liinidele

  9. Theodor Schiemann - Tallinna esimene linnaarhivaar (1883-1887) / Jüri Kivimäe

    Index Scriptorium Estoniae

    Kivimäe, Jüri, 1947-

    2008-01-01

    Tallinna Linnaarhiivi asutamise vaimuloolisest taustast. Haruldaste ürikute "ülesleidmisest" Tallinna raekojas 1875. ja 1882. aastal. Põhjalik ülevaade Theodor Schiemanni elust enne Tallinna asumist ja Tallinna linnaarhivaari ametis. Lisad : Instruktisoonid linnaarhivaarile. Tallinna linna arhiivi kasutamise eeskirjad. (Theodor Schiemanni koostatud tekstid ja nende tõlge)

  10. Diskussioon : põlvkondadevaheline konflikt - kas ka Eestis?

    Index Scriptorium Estoniae

    2006-01-01

    Järelkaja Director, 2006/Jun, nr. 5, lk. 14-21 ilmunud artiklile põlvkondade vahelistest konfliktidest ettevõtetes. Küsimusele vastavad MicroLinki juhatuse esimees Enn Saar, rahandusministeeriumi personaliosakonna juhataja Ele-Mall Vainomäe, rahandusministeeriumi koolitusjuht Ly Pihlak ning EMT personalijuht Terje Kuusik

  11. Saalomonidel tõi peaminister vägivallalaine / Allan Espenberg

    Index Scriptorium Estoniae

    Espenberg, Allan

    2006-01-01

    Snyder Rini valimine peaministriks tõi Saalomoni saartel kaasa vägivalla. Rinit on süüdistatud korruptsioonis ja parlamendiliikmete äraostmises. Enne parlamendis toimuma pidanud umbusaldushääletust teatas Rini oma tagasiastumisest. Lisad: Meeleavaldajate viha tabas hiinlasi; Kodusõda kestab sisuliselt siiani

  12. Suhtesõlmed kire vastu / Aita Kivi

    Index Scriptorium Estoniae

    Kivi, Aita, 1954-

    2002-01-01

    Sisu : Linn Ullmann. Enne kui sa uinud; Josie Lloyd, Emlyn Rees. Saame kokku; Deborah Moggach. Tulbipalavik; Victoria Clayton. Armastusest loobuja; Rosamunde Pilcher: Kaksikute tähtkujus; Hailey North. Kallis Armastuse Doktor; August Gailit. Muinasmaa; Aidi Vallik. Mis teha, Ann?; A. E. Hotchner. Papa Hemingway

  13. Beckett elab edasi / Richard Brooks

    Index Scriptorium Estoniae

    Brooks, Richard

    2001-01-01

    Dublini Gate Theatre, Blue Angel Films, RTE ja Channel 4 on jäädvustanud üheks telesarjaks kõik 19 Samuel Becketi näidendit. Mõnest filmist pikemalt, näiteks John Gielgudi kuu aega enne surma tehtud rollist David Mameti lavastatud "Katastroofis"

  14. Promõshlennõje zonõ ohvatil "mjortvõi sezon" / Ain Alvela

    Index Scriptorium Estoniae

    Alvela, Ain, 1967-

    2008-01-01

    Arendajad on tehnoparkide rajamise ooterežiimile pannud - ostjaid jaguks, kuid võimalusi napib. Diagramm: Za pjat let stoimost zemli promõshlennogo naznatshenija võrosla v pjat raz; Tabel: Naiboleje dorogaja zemlja - v promparke Lasnamäe. Kommenteerivad Enn Tosso, Nikolai Pitshugov ja Urmas Ahven

  15. August. Sajab / Urmas Petti

    Index Scriptorium Estoniae

    Petti, Urmas, 1965-2016

    2013-01-01

    Mõtisklus enne uut kooliaastat; autor kommenteerib ja tsiteerib Šveitsi kirjanikku Pascal Mercier'd (romaan "Öine rong Lissaboni", orig. " Nachtzug nach Lissabon") ja briti-ameerika poeeti W. H. Auden'it ("39 luuletust ja 5 esseed") ning kommenteerib Marju Lepajõed ja Vello Salo

  16. Rio de Janeirost Tallinna, 75 kraadi Celsiuse järgi / Antonio Claudio Carvalho ; tõlk. Reet Varblane

    Index Scriptorium Estoniae

    Carvalho, Antonio Claudio

    2006-01-01

    Juhendaja Antonio Claudio Carvalho Eesti Kunstiakadeemia üliõpilastele toimunud maalimeistriklassist "Ava oma silmad" ja lõpunäitusest Eesti Kunstiakadeemia galeriis. Enne näitust näitasid üliõpilased tööd, mida nad ise pidasid parimaks, kunstikriitik Heie Treierile

  17. Eesti fotograafiast 1900-1940 / Peeter Linnap

    Index Scriptorium Estoniae

    Linnap, Peeter, 1960-

    2010-01-01

    Allikatest ja hitoriograafiast. Eesti fotoajaloo historiograafilised lätted. Fotokunstnike sõnastatud taotlustest 1920.-1930.aastatel. Fotokunsti staatusest de facto - kunstikriitika seisukohti. "Uue" kunstiliigi evolutsioonimehhaanikast. Isiksusi Eesti fotograafias 20. sajandi 1. poolel. Fotograafide organisatsioonid. Fotode pildiline keskkond. Ajakirjandusfotost enne II maailmasõda. Montaaž.

  18. Eesti mehed Iraagis - kuniks veel? / Paul A. Goble

    Index Scriptorium Estoniae

    Goble, Paul Alan, 1949-

    2005-01-01

    Tartu Ülikooli Euroopa Kolledzhi õppejõud, toetudes Briti ajaloolase Robert Conquesti esseele, on arvamusel, et demokraatlikes maades peaks otsuste langetamisele eelnema arutelu. Eesti riigijuhid langetasid otsuse saata sõdurid konfliktipiirkondadesse võitlema enne avalikku arutelu, mis algas alles peale Eesti sõdurite traagilist hukkumist

  19. Nemad, kes laulsid koos / Tanja Muravskaja ; interv. Ahto Külvet

    Index Scriptorium Estoniae

    Muravskaja, Tanja, 1978-

    2008-01-01

    Tanja Muravskaja fotonäitusest "Nemad, kes laulsid koos" Vaal galeriis, kus esitatud 12 portreed Eesti poliitikutest ja vabadusvõitlejatest. Illustratsioonidena Enn Tarto, Tunne Kelami, Ülo Nugise, Jüri Adamsi ja Heinz Valgu portreed. Lk. 30 Rael Arteli kommentaar näituse kohta

  20. Creation of a Dynamical Stratospheric Turbulence Forecasting and Nowcasting Tool for High Altitude Airships and Other Aircraft

    National Research Council Canada - National Science Library

    Fritts, David C

    2008-01-01

    ... for which significant wave and turbulence activity may pose an operational or functional risk. The specific goal for MDA purposes was to create a forecasting methodology for turbulence activity at the expected High Altitude Airship (HAA...

  1. Ere täht Britta / Britta Vahur ; interv. Jüri Muttika

    Index Scriptorium Estoniae

    Vahur, Britta, 1984-

    2006-01-01

    Rubriigis "elu ühes päevas" TV 3 uues telesarjas "Helena" peaosalist kehastav Britta Vahur endast. Lisaks sarja stsenaristi Marko Lillemägi kirjutatud "Seriaalikangelanna Helena Haas (23)", mis kirjeldab seriaali Helena päeva

  2. Tallinn soovib linnahalli Ameerika investoritega ikka edasi minna / Raimo Poom

    Index Scriptorium Estoniae

    Poom, Raimo

    2010-01-01

    Tallinna linnavalitsus ootab enne otsustamist, kas pikendada Tallinna linnahalli arendamiseks sõlmitud eellepingut Ameerika ettevõttega Tallinn Entertainment LLC, Ameerika investorite delegatsiooni visiiti Tallinna. Rahandusminister Jürgen Ligi vastusest Tallinna abilinnapea Taavi Aasa kirjale, milles oli ettepanek kaaluda võimalust anda riigi garantii linnahalli arendamise projektile

  3. Helmese raport: valimiskomisjon pidanuks süsteemi sajaprotsendilise mahuga testima / Urmas Jaagant

    Index Scriptorium Estoniae

    Jaagant, Urmas

    2011-01-01

    IT-firma Helmes raportist, milles selgitatakse Riigikogu valimiste tulemuste edastamisel tekkinud seisaku põhjusi. Raporti kohaselt oleks juhtunut saanud vältida enne valimisi suurema mahuga teste tehes. Valimiskomisjoni esimehe Heiki Sibula sõnul oli lepingu järgi süsteemi testimine kogu mahus Helmese kohustus

  4. Piraadid paljastasid riiklike relvaärikate varjatud kanali / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2008-01-01

    Somaalia piraatide kaaperdatud laeval oli 33 Nõukogude päritolu tanki, laadungi sihtpunktiks väidetavalt Kenya. Piraatide väitel aga ei kuulu relvad Kenya valitsusele, vaid Lõuna-Sudaanile. Autor märgib, et enne 2011. a. toimuvat referendumit Lõuna-Sudaanis toimub pingeline võidurelvastumine

  5. 7. XII avati rahvusraamatukogu VI korruse näitusesaalis...

    Index Scriptorium Estoniae

    2005-01-01

    Hispaania Graafiliste Kunstide Akadeemia (Calcografia Nacional) koostatud ja Hispaania Suursaatkonna vahendatud näitus "Goya : portreteeritud südametunnistus". Väljas on 20 suureformaadilist digitaalpilti Francisco de Goya gravüüridest. Enne näituse avamist pidas Ramon de Villanueva loengu "Selgitusi Goya loomingu mõistmiseks"

  6. Genetics Home Reference: 22q13.3 deletion syndrome

    Science.gov (United States)

    ... 5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and Rehabilitation Related Information How are genetic ... Veltman JA, de Vries BB. Molecular characterisation of patients with subtelomeric 22q ... L, Enns GM, Hoyme HE. Terminal 22q deletion syndrome: a newly recognized cause of ...

  7. Talendid, kes tulid tagasi koju / Laura Mallene

    Index Scriptorium Estoniae

    Mallene, Laura

    2010-01-01

    IsePankuri asutajast Pärtel Tombergist, start-up firmaga Cutefund tegelevast Enn Metsarist, riigikantselei EL-i sekretariaadi konsultandist Katrin Juhandist, Küberkaitse Kompetentsikeskuse töötajast Anna-Maria Talihärmist, LHV Turunduse töötajast Ellen Murulast, Elioni finantsanalüütikust Artur Elmest

  8. Aet Piel : oluline sisekujunduselement on viltune sein / Gitte Hint

    Index Scriptorium Estoniae

    Hint, Gitte

    2003-01-01

    Poolkaares ehitatud korterelamus on Aet Pieli kujundatud korteris üks sein viltu. Esmapilgul häirivana mõjunud sein sai oluliseks sisekujunduselemendiks. Eritellimusel valmistatud mööbel on tammepuidust. A. Pieli kommentaarid. Ill.: plaan enne ja nüüd, 9 värv. vaadet

  9. Ostetud saab vaid parim / Silvia Viidik

    Index Scriptorium Estoniae

    Viidik, Silvia, 1972-

    2010-01-01

    Maailma kaks suuremat kiibitootjat - Advanced Micro Devices ja Intel - alandasid oma kvartaliprognoose. Autor analüüsib, mis sellel turul toimub, ning ütleb, et enne tulemuste hooaega võiks infotehnoloogiasektorist huvitatud investor kaaluda pigem ettevõtteid, kes toodavad ka väga valivale kliendile sobivaid tooteid

  10. Kaebeõiguse probleemid Tartu Ringkonnakohtu halduskolleegiumi praktika näitel / Triinu Rauk, Kadri Rohtla, Mariliis Timmermann

    Index Scriptorium Estoniae

    Rauk, Triinu, 1988-

    2016-01-01

    Isiku kaebeõigusest halduskohtumenetluse seadustiku § 44 lg 1 mõttes, isiku võimalustest vaidlustada teise isiku kohta antud haldusakte ja enne kohtusse pöördumist kehtivuse kaotanud haldusaktide vaidlustamisest. Tuvastamiskaebuse esitamise lubatavusest ning probleemidest halduskohtumenetluse § 121 lg 2 p-de 1 ja 2 eristamisel

  11. L'autriche quittera le CERN d'ici à fin 2010

    CERN Multimedia

    2009-01-01

    L'autriche se retire du CERN. Le gouvernement juge les 20 millions d'euros (30 millions de francs) à débourser par année trop cher. L'Organisation européenne pour la recherche nucléaire regrette cette défection. (1 page)

  12. Tantsuteater ütleb oma ruumidele hüvasti / Andres Laasik

    Index Scriptorium Estoniae

    Laasik, Andres, 1960-2016

    2011-01-01

    Tantsuteatri Fine 5 uuest tantsulavastusest "Enne kui minna, ma ütlen", mis tähistab teatri sunnitud lahkumist Tallinnas Lai t. 9 asuvatest ruumidest. Tantsuteatri Fine 5 eestvedajad Tiina Ollesk ja René Nõmmik Lai t. 9 asuva hoone seisukorrast, sinna kolimisest, teatrist, uute ruumide otsingust

  13. Parental lack of care and overprotection

    NARCIS (Netherlands)

    Overbeek, G.J.; Have, M.L. ten; Vollebergh, W.A.M.; Graaf, R. de

    2007-01-01

    This study served to replicate and extend the findings from the National Comorbidity Survey [Enns MW, Cox BJ, Clara I (2002) Psychol Med 32:997-1008], in examining associations between recalled parental bonding and the prevalence and incidence of mental disorders in adulthood. Data were used from

  14. Changements climatiques et santé humaine à Accra, Ghana | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    existence et le bien-être de la population ghanéenne. La détérioration du milieu rural contribue sensiblement au flux de migrants qui arrivent chaque jour dans les villes. Ces nouveaux arrivants regroupés dans des bidonvilles dépourvus ...

  15. Estonija razozlila Jevropu

    Index Scriptorium Estoniae

    2005-01-01

    Eesti-Venemaa piirilepingu tüli Euroopa Liidu põhiseaduse ratifitseerimise, edasise laienemise ja eelarve probleemide taustal. Artiklis viidatakse Euroopa Liidu eesistujamaa Suurbritannia Moskva suursaadiku arvamusavaldusele, et Eesti-Venemaa piiritüli on kahe riigi omavaheline asi. Riigikogu välispoliitika komisjoni esimehe Enn Eesmaa arvamus

  16. Repše: välislaenuabi katkedes on aasta lõpuks raha läbi / Mikk Salu

    Index Scriptorium Estoniae

    Salu, Mikk, 1975-

    2009-01-01

    Läti rahandusminister Einars Repše hoiatas, et kui Lätil ei õnnestu täita oma kohustusi rahvusvaheliste kreeditoride ees ja vähendada 2010. a. eelarvedefitsiiti poole miljardi lati võrra, võib riigikassa rahast tühjaks joosta juba enne aasta lõppu

  17. Sekhon: see ei ole terrorismi lõpp / Harinder Sekhon ; intervjueerinud Külli-Riin Tigasson

    Index Scriptorium Estoniae

    Sekhon, Harinder

    2011-01-01

    Intervjuu New Delhis asuva mõttekoja Observer Foundation vanemteaduriga Osama bin Ladeni tapmisest, selle mõjust Afganistani sõjale, al-Qaidast ja Talibanist. Tema sõnul tuleks anda al-Qaidale löök enne, kui nad uuesti grupeeruvad, löök tuleb anda infrastruktuurile, rahastamisele

  18. Kes tegelikult lõid Res Publica? / Valeri Kalabugin

    Index Scriptorium Estoniae

    Kalabugin, Valeri

    2005-01-01

    Enne erakonnaks kuulutamist oli Res Publica Eesti iseseisvust ja demokraatiat taotlev ühendus, kuhu on kuulunud mitmed poliitika- ning ühiskonnategelased. Vt. samas: Ühendus Res Publica avaldus. Küsimustele vastavad Res Publica avalike suhete juht Riina Vändre, Riigikogu liige Mart Nutt, ajakirjanik Toomas Kümmel

  19. Case report

    African Journals Online (AJOL)

    abp

    7 août 2013 ... 1. Myélome multiple survenant au cours d'une Fièvre Méditerranéenne Familiale ... évidence de mutations du gène «MEFV» dont il existe plus d'une vingtaine. .... Mediterranean Fever (FMF): from diagnosis to treatment.

  20. Mick Jagger ihaldas peaosa "Kellavärgiga apelsinis"

    Index Scriptorium Estoniae

    2008-01-01

    Avalikkuse ette tulnud produtsent Si Litvinoffi kirjast režissöör John Schlesingerile selgus tema soov filmida A. Burgessi romaani "Kellavärgiga apelsin" juba enne S. Kubricku kuulsat filmi. Filmis soovis Alexit mängida Mick Jagger. J. Schlesinger keeldus selle filmi lavastamisest

  1. Jõhvis tuleb parasürrealistide näitus

    Index Scriptorium Estoniae

    2008-01-01

    Jõhvi kontserdimajas avatakse parasürrealistide rühmituse PARA näitus "Panoraam". Osalevad Ilmar Malin (maalid), Jüri Palm (maalid), Elo Järv (nahkskulptuurid), Vello Vinn (graafika), Leonhard Lapin (akvarellid), Enn Tegova (maalid), Ahti Seppet (puuskulptuurid), Raivo Kelomees (maalid), Kristiina Viin (joonistused ja maalid)

  2. Herman Simmi sõbrad ründavad peaministrit / Risto Berendson

    Index Scriptorium Estoniae

    Berendson, Risto, 1975-

    2008-01-01

    Šveitsi-Balti Kaubanduskoja president Jürg Würtenberg ja rahvusvaheliste suhete õppejõud Juhan Värk ei pea õigeks, et peaminister Andrus Ansip on Hermann Simmi juba enne kohtuotsust süüdi mõistnud. Vt. samas: Ansip: see võis olla vääratus

  3. Parkovi talu Parkhofi mõisas / Jana Rand

    Index Scriptorium Estoniae

    Rand, Jana, 1963-

    2009-01-01

    Perekond Villandi taastatud Parkovi talust Jalase külas Raplamaal, mis rajatud kunagise Parkhofi mõisa asukohale. Mõis kuulus enne hävitamist 1905. a. Viktor von Kotzebue'le. Madis ja Mihkel Villandi loodud firma Gildemann Dolomite Designs jätkab talus kiviraiumise traditsioone kaasaegses tootmisviisis

  4. Inimese mõõde II. Kuue- ja seitsmekümnendad : kirjanduslooline fragmentaarium 1960.-1970. aastail tegutsenud kirjanikest / Jaak Urmet

    Index Scriptorium Estoniae

    Urmet, Jaak, 1979-

    2015-01-01

    Katkendid intervjuudest ja vestlustest Leo Metsariga, Valda Rauaga, Mihkel Rauaga, Enn Vetemaaga, Andres Ehiniga, Väino Ilusaga, Ülo Tuulikuga, Villem Grossiga, Heljo Männiga, Maie Kaldaga, Jaan Isotammega, Vaapo Vaheriga, Jaan Kaplinskiga, Mati Undiga, Vaino Vahinguga, Lea Tormisega, Ralf Parvega, Oskar Kruusiga ja Toomas Vindiga

  5. Inimese mõõde II. Kuue- ja seitsmekümnendad : kirjanduslooline fragmentaarium 1960.-1970. aastail tegutsenud kirjanikest / Jaak Urmet

    Index Scriptorium Estoniae

    Urmet, Jaak, 1979-

    2011-01-01

    Katkendid intervjuudest ja vestlustest Leo Metsariga, Valda Rauaga, Mihkel Rauaga, Enn Vetemaaga, Andres Ehiniga, Väino Ilusaga, Ülo Tuulikuga, Villem Grossiga, Heljo Männiga, Maie Kaldaga, Jaan Isotammega, Vaapo Vaheriga, Jaan Kaplinskiga, Mati Undiga, Vaino Vahinguga, Lea Tormisega, Ralf Parvega, Oskar Kruusiga ja Toomas Vindiga

  6. Milleks teatrilavale ajalugu? / David Vseviov

    Index Scriptorium Estoniae

    Vseviov, David, 1949-

    2008-01-01

    Lavastused Konstantin Pätsist ja Gustav Naanist ajaloolisest taustast lähtudes: Rahvusooperis Estonia etendunud Katri Aaslav-Tepandi ja Tõnu Tepandi dokumentaaldraama "President 1939" Katri Aaslav-Tepandi lavastuses ja Eesti Draamateatris etendunud Enn Vetemaa, Erki Aule ja Merle Karusoo dokumentaallavastus "Sigma Tau-C705" Merle Karusoo lavastuses

  7. Töölepingu ülesütlemine majanduslikel põhjustel : töötaja tagatised / Vahur-Peeter Liin

    Index Scriptorium Estoniae

    Liin, Vahur-Peeter, 1983-

    2009-01-01

    Töötajate valiku kriteeriumitest, töölepingu ülesütlemise piirangutest ja teise töö pakkumise kohustusest enne töölepingu ülesütlemist. Etteteatamistähtajast ja rahalisest hüvitisest töölepingu ülesütlemisel

  8. Euroopa paindumatus Eestile eurot ei luba / Hindrek Riikoja

    Index Scriptorium Estoniae

    Riikoja, Hindrek

    2006-01-01

    Vt. ka Postimees : na russkom jazõke 17. juuli lk. 9. 14. juulil Eesti rahandusministri Aivar Sõerdi ja peaminister Andrus Ansipiga kohtunud Euroopa Komisjoni rahandusvolinik Joaquin Almunia kinnitas, et Eestil ei maksa loota eurokriteeriumide muutmisele, rahandusvoliniku hinnangul Eesti krooni devalveerimine enne eurole üleminekut ei ole vajalik

  9. Sõjakurjategijad ja pooleli reformid tõkstamas Balkanil teed euroliitu / Krister Paris

    Index Scriptorium Estoniae

    Paris, Krister, 1977-

    2005-01-01

    Sõjakuritegude tribunali peasüüdistaja Carla del Ponte avaldab EL-ile survet, et see ei astuks samme Horvaatia ega Serbia ja Montenegroga ühinemise suunas enne, kui nimetatud riigid pole välja andnud kõige tagaotsitumaid sõjakurjategijaid. Lisa: Reformide jaoks aeg otsa saamas

  10. High concentrations of the carcinogen 2-amino-1-methyl-6-phenylimidazo- [4,5-b]pyridine (PhIP) occur in chicken but are dependent on the cooking method.

    Science.gov (United States)

    Sinha, R; Rothman, N; Brown, E D; Salmon, C P; Knize, M G; Swanson, C A; Rossi, S C; Mark, S D; Levander, O A; Felton, J S

    1995-10-15

    Heterocyclic aromatic amines (HAAs) are mutagenic and carcinogenic compounds found in meats cooked at high temperatures. Although chicken is consumed in large quantities in the United States, there is little information on its HAA content. The objective of this study was to measure the five predominant HAAs (IQ, MeIQ, MeIQx, DiMeIQx, and PhIP) in chicken cooked by various methods to different degrees of doneness. Chicken breasts were panfried, oven-broiled, or grilled/barbecued. Whole chickens were roasted or stewed. Skinless, boneless chicken breasts were cooked to three degrees of doneness: just until done, well done, or very well done. High levels of PhIP (ranging from 12 to 480 ng/g cooked meat) were found in chicken breasts when panfried, oven-broiled, and grilled/barbecued but not in while roasted or stewed chicken. PhIP concentration increased in skinless, boneless chicken breast with longer cooking time, higher internal temperature, and greater degree of surface browning. PhIP concentration was also high in chicken breasts cooked with skin and bones. MeIQx and DiMeIQx levels increased with the degree of doneness, whereas IQ and MeIQ were not detectable in any of these chicken samples. Certain cooking methods produce PhIP, a known colon and breast carcinogen in rodents and possibly a human carcinogen, at substantially higher levels in chicken than has been reported previously in red meat.

  11. In situ derivatization and hollow fiber membrane microextraction for gas chromatographic determination of haloacetic acids in water

    Energy Technology Data Exchange (ETDEWEB)

    Varanusupakul, Pakorn [Chromatography and Separation Research Unit, Department of Chemistry, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330 (Thailand)], E-mail: pakorn.v@chula.ac.th; Vora-adisak, Narongchai; Pulpoka, Bancha [Chromatography and Separation Research Unit, Department of Chemistry, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330 (Thailand)

    2007-08-15

    An alternative method for gas chromatographic determination of haloacetic acids (HAAs) in water using direct derivatization followed by hollow fiber membrane liquid-phase microextraction (HF-LPME) has been developed. The method has improved the sample preparation step according to the conventional US EPA Method 552.2 by combining the derivatization and the extraction into one step prior to determination by gas chromatography electron captured detector (GC-ECD). The HAAs were derivatized with acidic methanol into their methyl esters and simultaneously extracted with supported liquid hollow fiber membrane in headspace mode. The derivatization was attempted directly in water sample without sample evaporation. The HF-LPME was performed using 1-octanol as the extracting solvent at 55 deg. C for 60 min with 20% Na{sub 2}SO{sub 4}. The linear calibration curves were observed for the concentrations ranging from 1 to 300 {mu}g L{sup -1} with the correlation coefficients (R{sup 2}) being greater than 0.99. The method detection limits of most analytes were below 1 {mu}g L{sup -1} except DCAA and MCAA that were 2 and 18 {mu}g L{sup -1}, respectively. The recoveries from spiked concentration ranged from 97 to 109% with %R.S.D. less than 12%. The method was applied for determination of HAAs in drinking water and tap water samples. The method offers an easy one step high sample throughput sample preparation for gas chromatographic determination of haloacetic acids as well as other contaminants in water.

  12. Use of ozone-biofiltration for bulk organic removal and disinfection byproduct mitigation in potable reuse applications.

    Science.gov (United States)

    Arnold, Mayara; Batista, Jacimaria; Dickenson, Eric; Gerrity, Daniel

    2018-07-01

    The purpose of this research was to investigate the impacts of ozone dose and empty bed contact time (EBCT) in ozone-biofiltration systems on disinfection byproduct (DBP) formation potential. The data were used to evaluate the possibility of using DBP formation potential as an alternative guideline for total organic carbon (TOC) removal in potable reuse applications. A pilot-scale ozone-biofiltration system was operated with O 3 /TOC ratios ranging from 0.1 to 2.25 and EBCTs ranging from 2 to 20 min. The biofiltration columns contained anthracite or biological activated carbon (BAC). Bench-scale chlorination was performed using the uniform formation conditions (UFC) approach, and quenched samples were analyzed for total trihalomethanes (TTHMs) and regulated haloacetic acids (HAA5s). The data demonstrated that ozone-biofiltration achieved TOC removals ranging from ∼10 to 30%, depending on operational conditions, but biofiltration without ozone generally achieved <10% TOC removal. UFC testing demonstrated that ozone alone was efficient in transforming bulk organic matter and reducing DBP formation potential by 10-30%. The synergistic combination of ozone and biofiltration achieved average overall reductions in TTHM and HAA5 formation potential of 26% and 51%, respectively. Finally, a maximum TOC concentration of 2.0 mg/L was identified as a recommended treatment target for reliable compliance with TTHM and HAA5 regulations for potable reuse systems in the United States. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. In situ derivatization and hollow fiber membrane microextraction for gas chromatographic determination of haloacetic acids in water

    International Nuclear Information System (INIS)

    Varanusupakul, Pakorn; Vora-adisak, Narongchai; Pulpoka, Bancha

    2007-01-01

    An alternative method for gas chromatographic determination of haloacetic acids (HAAs) in water using direct derivatization followed by hollow fiber membrane liquid-phase microextraction (HF-LPME) has been developed. The method has improved the sample preparation step according to the conventional US EPA Method 552.2 by combining the derivatization and the extraction into one step prior to determination by gas chromatography electron captured detector (GC-ECD). The HAAs were derivatized with acidic methanol into their methyl esters and simultaneously extracted with supported liquid hollow fiber membrane in headspace mode. The derivatization was attempted directly in water sample without sample evaporation. The HF-LPME was performed using 1-octanol as the extracting solvent at 55 deg. C for 60 min with 20% Na 2 SO 4 . The linear calibration curves were observed for the concentrations ranging from 1 to 300 μg L -1 with the correlation coefficients (R 2 ) being greater than 0.99. The method detection limits of most analytes were below 1 μg L -1 except DCAA and MCAA that were 2 and 18 μg L -1 , respectively. The recoveries from spiked concentration ranged from 97 to 109% with %R.S.D. less than 12%. The method was applied for determination of HAAs in drinking water and tap water samples. The method offers an easy one step high sample throughput sample preparation for gas chromatographic determination of haloacetic acids as well as other contaminants in water

  14. Bilateral cross-bite treated by repeated rapid maxillary expansions: a 17-year follow-up case.

    Science.gov (United States)

    Cozzani, M; Mazzotta, L; Caprioglio, A

    2014-07-01

    The objective of this paper is to show the clinical results after the repeated application of a Haas expander for rapid maxillary expansion (RME) anchored onto deciduous teeth in a 7-year-old patient that presented bilateral cross-bite, superior crowding and no space for permanent lateral incisors eruption. A first Haas expander was applied to the patient. She was told to activate it once a day, each activation was equal to 0.20 mm. After the first RME, the bilateral cross-bite was solved but still there was not enough space for lateral incisor eruption. A second and then a third Haas expander were applied, with the same activation protocol as the first one, in order to gain space in the anterior region and to achieve proper eruption of the lateral incisors. The patient was then treated with fixed appliances. At debonding the patient presented well aligned arch-forms: space for lateral incisor eruption was gained and superior crowding was solved. Bilateral cross-bite was also corrected. She was seen again 10 years and 17 years after expansions: she showed no relapse and presented a good functional occlusion that had remained stable, and an aesthetically pleasant smile, however she exhibited gingival recessions. Repeated rapid maxillary expansion, anchored onto deciduous teeth, performed in early mixed dentition represents a safe and successful treatment to correct severe bilateral cross- bites and to create space for maxillary incisor eruption.

  15. Role of codeposited impurities during growth. II. Dependence of morphology on binding and barrier energies

    Science.gov (United States)

    Sathiyanarayanan, Rajesh; Hamouda, Ajmi Bh.; Pimpinelli, A.; Einstein, T. L.

    2011-01-01

    In an accompanying article we showed that surface morphologies obtained through codeposition of a small quantity (2%) of impurities with Cu during growth (step-flow mode, θ = 40 ML) significantly depends on the lateral nearest-neighbor binding energy (ENN) to Cu adatom and the diffusion barrier (Ed) of the impurity atom on Cu(0 0 1). Based on these two energy parameters, ENN and Ed, we classify impurity atoms into four sets. We study island nucleation and growth in the presence of codeposited impurities from different sets in the submonolayer (θ⩽ 0.7 ML) regime. Similar to growth in the step-flow mode, we find different nucleation and growth behavior for impurities from different sets. We characterize these differences through variations of the number of islands (Ni) and the average island size with coverage (θ). Further, we compute the critical nucleus size (i) for all of these cases from the distribution of capture-zone areas using the generalized Wigner distribution.

  16. Ungdom med innvandringsbakgrunn etter overgangen til videregående opplæring – tapte nettverk og svekket skoletrivsel?

    Directory of Open Access Journals (Sweden)

    Kristinn Hegna

    2014-10-01

    Full Text Available Nylig publisert forskning har vist at de sosioøkonomiske forskjellene i ungdomsskolekarakterer har økt noe etter at Kunnskapsløftet ble innført i 2006/2007. Denne artikkelen undersøker om det samme har skjedd i Oslo – landets eneste virkelige storby med betydelig sosial ulikhet og en særskilt stor andel innvandrere. På tross av slike trekk får Oslos ungdomsskoleelever litt bedre gjennomsnittskarakterer enn landsgjennomsnittet, og «Oslo-forspranget» har økt de siste årene. På midten av 2000-tallet var karakterforskjellene mellom «høy» og «lav» sosioøkonomisk familiebakgrunn mindre i Oslo enn i resten av landet, men etter at Kunnskapsløftet ble innført, er det ikke lenger slik. I 2010/2011 var den sosiale ulikheten i eksamenskarakterer den samme i Oslo som i resten av landet. I artikkelen diskuterer vi forskjellige årsaker til at ulikhetene i skolen øker.

  17. Kuidas sünnib pealkiri? / Pärt Lias

    Index Scriptorium Estoniae

    Lias, Pärt

    2002-01-01

    Pealkiri, pühendus, moto, joonealune märge, ees- ja järelsõna on teose teksti manused, mis ei kuulu otse teksti, kuid selgitavad, täiendavad ja täpsustavad seda. Gerard Genette on need teksti lisandid koondanud üldnimetuse paratekstid alla. Eesti kirjanikud vastavad Pärt Liase küsimusele oma teoste pealkirjade saamisloo kohta: Aimee Beekman, Henn-Kaarel Hellat, Joel Sang ja Arvo Mägi (4); Lennart Meri, Heino Kiik ja Fanny de Sivers (5); Helga Nõu, Ülle Kauksi, Maie Kalda ja Cornelius Hasselblatt (6); Debora Vaarandi, Vaino Vahing, Arved Viirlaid ja Wimberg (7); Vahur Afanasjev, Matt Barker, Andrus Kivirähk, Jürgen Rooste ja Contra (8); Elin Toona, Jaak Rähesoo, Enn Soosaar, Juhan Peegel ja Toomas Kall (9); Kerttu Rakke, Aare Pilv, Aarne Ruben, Indrek Hargla, Jan Kaus ja Karen Orlau (10); Ene Mihkelson, Mats Traat ja Boriss Baljasnõi (11); Maimu Berg, Ain Kaalep, Enn Nõu ja Madis Kõiv (12)

  18. (Radio)active participation

    CERN Multimedia

    Anaïs Schaeffer

    2014-01-01

    This year, for the first time, CERN hosted the Rencontres internationales lycéennes de la radioprotection: a three-day event in which some 200 students from 16 schools in France and elsewhere came together to discuss the topic of radiation protection and to deepen their understanding of the field.   Participants of the Rencontres internationales lycéennes de la radioprotection 2014. Each year since 2008, the Centre d’étude sur l’évaluation de la protection dans le domaine nucléaire français (CEPN, the French centre for studies of the evaluation of nuclear protection) and the Institut de radioprotection et de sûreté nucléaire français (IRSN, the French institute for radiation protection and nuclear safety), in partnership with various other bodies*, have been organising radiation protection workshops. Aimed at students between the ages of 15 and 18 from France and beyo...

  19. Short outlines of books by Estonian authors / Janika Kronberg, Rutt Hinrikus

    Index Scriptorium Estoniae

    Kronberg, Janika, 1963-

    2003-01-01

    Sinijärv, Karl- Martin. Artutart & 39. Tallinn : Tuum, 2002 ; Beier, Priidu. Monaco. Tartu : P. Beier, 2002 ; Malin, Jaan. Sulle. Tartu : J. Malin, 2003 ; Liiv, Toomas. Luuletused 1968-2002. Tallinn : Tuum, 2003 ; Mägi, Arvo. Katk ja koolera. Tartu : Ilmamaa ; Kross, Jaan. Omaeluloolisus ja alltekst. Tallinn : Eesti Keele Sihtasutus, 2003 ; Kaplinski, Jaan ; Salminen, Johannes. Ööd valged ja mustad. Tallinn : Loomingu Raamatukogu, 2003 ; Kauksi Ülle. Käänüpäiv. Tartu : Kauksi Ülle Mänedsment', 2003 ; Luik, Tõnu. Filosoofiast kõnelda. Tartu : Ilmamaa, 2002 ; Teder, Tarmo. Pööningujutud. Tallinn : Eesti Keele Sihtasutus, 2002 ; Vetemaa, Enn. Minu väga magus elu ehk martsipanimeister. Tallinn : Tänapäev, 2002 ; Põldroos, Enn. Joonik kivi. Tallinn : Eesti Keele Sihtasutus, 2003 ; Suburg, Lilli. Kogutud kirjatööd. Tallinn : Eesti Raamat, 2002 ; Mikelsaar, Henn. Müüritud. Tartu : Ilmamaa, 2003 ; Kaus, Jan. Õndsate tund. Tallinn : Tuum, c2003

  20. [Presidendipaar Ingrid ja Arnold Rüütel] / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2007-01-01

    President Arnold Rüütel ja Ingrid Rüütel Briti suursaadiku Nigel Haywoodi lahkumispeol Tallinna Teaduste Akadeemia peasaalis. Foto allkiri: Presidendipaar Ingrid ja Arnold Rüütel kuulavad Briti suursaadiku Nigel Haywoodi kiidulaulu Eesti kiire arengu aadressil