WorldWideScience

Sample records for haas enn realo

  1. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2008-01-01

    Eesti Kunstimuuseumi Kunstisõprade Seltsi eestvõttel tähistati 4. novembril 2008 Kumule Euroopa aasta muuseumi tiitli andmist. Ühel juuresolevatest fotodest president Toomas Hendrik Ilves koos Kumu kunstimuuseumi direktrissi Sirje Helme ja Eesti Kunstimuuseumi Kunstisõprade Seltsi juhatuse esimehe Enn Kunilaga

  2. The ENN project. ENN exploitation plan.

    Science.gov (United States)

    Dekena, R; Rehm-Berbenni, C; Seyfried, K

    2000-01-01

    The objective of the ENN-European Neurologic Network project is to improve knowledge and treatment of sleep disorders, headache and epilepsy. The means to obtain this objective shall be certain software to be distributed to the appropriate users in the medical field and the collection of relevant cases, in order to set up a neurological database. It is intended that the distribution of the above mentioned software and access to the database, will be able to finance research projects in the neurological field. The outcome of the EU funded project have been six prototypes, which need further work in order to establish a system of compatible and linked products. A particular emphasis of this work should be put on making the products as process oriented as possible. At the time being there are already products available in the market, which would be competing with particular ENN prototypes, but there is no set of compatible and linked products, which would be comparable with the intended set of ENN neurological tools. Such set of tools therefore could be a unique selling proposition. Intellectual property rights and legal implications have to be taken into consideration for the marketing of the ENN products. It has to be made sure, that no third party can assert violation of its IPRs and that, a protection of the products can be attained by appropriate application for IPRs. In the legal field in particular the prescriptions of data protection legislation have to be observed e.g. by obtaining the written consent of patients, whose cases are reported. The marketing concept should be set up as a short-term, middle-term, long-term strategy. The short-term strategy should concentrate on carrying out a market validation study at European level and simultaneously the development from prototype to products. The middle-term strategy should be directed towards the market introduction of the ENN products in Europe. The long-term strategy should comprise marketing of the products

  3. Chemie Linz AG Enns - Austria

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1978-11-01

    Full Text Available This factory building in Enns has been erected as an enlargement of the Linz facilities that had become too small. It contains an acrylonitrile processing plant and the whole range of accessory installations required for its operation, both from the technical side, such as equipment, etc., and from the personnel facilities side. Outstanding in this project is the elaborate infrastructure, such as the terracing and filling of 40 Ha of land to evercome the risks from the cyclic sweiling of the Danube, or the water supply, treatment and distribution systems for the various installations. Worth mentioning are also the planning for future expansion, which in successive enlargements and additions will cover 160 Ha and employ up to 5,000-6,000 people.

    Este edificio fabril se ha levantado en Enns con objeto de ampliar las ya pequeñas instalaciones de Linz. Consta de una planta para la producción de acrilnitrilo y de toda una serie de instalaciones secundarias necesarias para su funcionamiento, tanto de orden técnico —equipos, medios, etc. — como relativos al personal. En su realización destacan las complejas obras de infraestructura, tales como el terraplenado de las 40 Ha de terreno, a fin de evitar los peligros de las periódicas crecidas del Danubio, o el sistema de toma, depuración y distribución de agua para abastecimiento de las distintas instalaciones. Asimismo, cabe mencionar las previsiones hechas de cara al futuro, con sucesivas ampliaciones que llegarán a ocupar 160 Ha, y emplearán a 5.000 ó 6.000 personas.

  4. Enn Kunila: kunst on Eestile hea visiitkaart / Enn Kunila ; intervjueerinud Ants Juske

    Index Scriptorium Estoniae

    Kunila, Enn, 1950-

    2010-01-01

    Ärimees ja kunstimetseen Enn Kunila tegevusvaldkondadest ja kunstikogu põhjal avatavast näitusest. Näitus "Kölerist Subbini. 150 aastat Eesti klassikalist maalikunsti Enn Kunila kogust" Tallinna Kunstihoones 24. veebruarist 1. aprillini. Kureerinud Harry Liivrand, kujundanud Olev Subbi

  5. Kunstiarmastusest sündinud kollektsioon / Enn Kunila

    Index Scriptorium Estoniae

    Kunila, Enn, 1950-

    2010-01-01

    Vestlus kunstikollektsionääri Enn Kunilaga maalikunsti kogumisest. Tallinna Kunstihoones aasta alguses üles pandud näitusest "Kölerist Subbini. 150 aastat eesti klassikalist maalikunsti Enn Kunila kogust"

  6. Karakteriga kodu / Karen Jagodin ; kommenteerinud Enn Rajasaar

    Index Scriptorium Estoniae

    Jagodin, Karen, 1982-

    2009-01-01

    2008. aastal valminud 2-korruseline eramu Mähel. Arhitekt Enn Rajasaar. Sisearhitekt Aet Seire. Välisviimistluses on kombineeritud tumedat tellist ja heledat krohvi. Sisekujundust läbivad värvid punane ja must. Osa mööbliesemeid (raamatukapid, söögitoa laud) valmisid sisearhitekti erilahendusena

  7. Vulgarismid nii ja naa / Enn Sarv

    Index Scriptorium Estoniae

    Sarv, Enn, 1921-2008

    1998-01-01

    Meenutus Aleksander Solženitsõni "Üks päev Ivan Denissovitši elus" tõlkimisest (eesti keeles 1963, tõlkijad Lennart Meri ja Enn Sarv). Peeter Sauteri poolt kirjutatud tekstist Raul Meele näituse 'Aborigeenide elu' jaoks (vt. Looming nr. 3)

  8. The Zygosaccharomyces bailii transcription factor Haa1 is required for acetic acid and copper stress responses suggesting subfunctionalization of the ancestral bifunctional protein Haa1/Cup2.

    Science.gov (United States)

    Palma, Margarida; Dias, Paulo Jorge; Roque, Filipa de Canaveira; Luzia, Laura; Guerreiro, Joana Fernandes; Sá-Correia, Isabel

    2017-01-13

    The food spoilage yeast species Zygosaccharomyces bailii exhibits an extraordinary capacity to tolerate weak acids, in particular acetic acid. In Saccharomyces cerevisiae, the transcription factor Haa1 (ScHaa1) is considered the main player in genomic expression reprogramming in response to acetic acid stress, but the role of its homologue in Z. bailii (ZbHaa1) is unknown. In this study it is demonstrated that ZbHaa1 is a ScHaa1 functional homologue by rescuing the acetic acid susceptibility phenotype of S. cerevisiae haa1Δ. The disruption of ZbHAA1 in Z. bailii IST302 and the expression of an extra ZbHAA1 copy confirmed ZbHAA1 as a determinant of acetic acid tolerance. ZbHaa1 was found to be required for acetic acid stress-induced transcriptional activation of Z. bailii genes homologous to ScHaa1-target genes. An evolutionary analysis of the Haa1 homologues identified in 28 Saccharomycetaceae species genome sequences, including Z bailii, was carried out using phylogenetic and gene neighbourhood approaches. Consistent with previous studies, this analysis revealed a group containing pre-whole genome duplication species Haa1/Cup2 single orthologues, including ZbHaa1, and two groups containing either Haa1 or Cup2 orthologues from post-whole genome duplication species. S. cerevisiae Cup2 (alias Ace1) is a transcription factor involved in response and tolerance to copper stress. Taken together, these observations led us to hypothesize and demonstrate that ZbHaa1 is also involved in copper-induced transcriptional regulation and copper tolerance. The transcription factor ZbHaa1 is required for adaptive response and tolerance to both acetic acid and copper stresses. The subfunctionalization of the single ancestral Haa1/Cup2 orthologue that originated Haa1 and Cup2 paralogues after whole genome duplication is proposed.

  9. Enn Tarvel 75 : psühhograafiline skits / Jaan Undusk

    Index Scriptorium Estoniae

    Undusk, Jaan, 1958-

    2007-01-01

    Enn Tarvelist kui Läti Henriku kroonika väljaandjast. Arvutikasutuse algusest eesti agraarajaloo uurimisel 1990ndatel aastatel. Tarveli "Adramaa" erilisusest. Enn Tarvel koostööst Juhan Kahkiga. Tarvelist kui Eesti lähiajaloo uurimise korraldajast

  10. De Haas-Van Alphen affect and helicons in metals

    International Nuclear Information System (INIS)

    Vol'skij, E.P.

    1975-01-01

    Specific features of helicon electrodynamics associated with the de Haas-van Alphen effect are considered for an uncompensated metal with the closed Fermi surface of arbitrary shape. The consideration is carried out entirely in the local limit, when the metal may be characterized by a static tensor for the magnetic resistance and by a static tensor for the differential magnetic permeability which describes the anisotropy of the de Haas-van Alphen effect. The amplitude of the effect is assumed to be of an arbitrary value, but in the limits determined by the thermodynamical stability of a uniformly magnetized state. It has been shown that in the general case the de Haas-van Alphen effect may strongly influence not only the phase velocity, but also the damping and polarization of a helicon. A significant effect of nondiagonal components of the differential magnetic permeability tensor that sometimes arise even at very small deviations of the magnetic field from the symmetric direction, is noted. The resonance excitation of waves in a plate is considered. The question of a possible relation between periodic diamagnetic structures in metals and helicons is discussed

  11. Normes comptables européennes du secteur public (EPSAS)

    DEFF Research Database (Denmark)

    Andernack, Isabelle; Pontoppidan, Caroline Aggestam

    2014-01-01

    Les EPSAS, adaptation des IFRS pour le secteur public, devraient fournir à terme des informations plus fiables et transparentes sur la situation et la performance financière des États de l’Union européenne - notamment sur leur niveau d’endettement et leurs engagements - sur la soutenabilité des...

  12. Mis on Eesti hariduse eesmärk? / Enn Vatter

    Index Scriptorium Estoniae

    Vatter, Enn

    2003-01-01

    Autori arvates ei suudeta valimiseelsetes vaidlustes kokku leppida eelistusis hariduselus. Autor küsib, mis kooli- ja haridustemaatikas peaeesmärk ning mis on alameesmärgid, mis enne peaeesmärgi saavutamist on vaja kätte saada

  13. Lakewoodi Eesti Majas New Jersey osariigis... / Enn Lillemets

    Index Scriptorium Estoniae

    Lillemets, Enn

    2004-01-01

    9. X tuletati meelde eesti graafikut ja maalijat Eduard Rüga (1903-1997), kelle loomingust oli välja pandud näitus Ameerika erakogudest. Õhtust võtsid osa E. Rüga abikaasa Leida Rüga, tütred Silja Melts ja Kersti Raimondo. Enn Lillemetsa ettekandest. Vaadati Andres Söödi telefilmi "Eduard Rüga" (1993)

  14. Väitlus : vastuseks eelolevale / Enn Küng, Kari Tarkiainen, Ülle Tarkiainen

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2015-01-01

    Väitlus Enn Küngi ning Kari ja Ülle Tarkiaineni vahel, mille aluseks on 2015. a. Akadeemia 8. numbris ilmunud Enn Küngi arvustis Tarkiainenite raamatule "Provinsen bortom havet. Estlands svenska historia 1561-1710" (Lk. 1491-1499)

  15. Comparison of the effect of Haas and Hyrax rapid palatal expanders on nasal cavity dimensions

    Directory of Open Access Journals (Sweden)

    Amini F.

    2009-11-01

    Full Text Available "nBackground and Aim: In treatment of posterior crossbite awareness of the effects of Haas and Hyrax rapid maxillary expanders (RME on nasal cavity will help the clinician to select the better appliance. This study was carried out to compare the effects of Haas and Hyrax expanders on the nasal cavity of patients treated for posterior crossbite. "nMaterials and Methods: A clinical trial study was designed on posteroanterior (PA cephalograms of 30 subjects to evaluate the nasal cavity width of 14 subjects (8 female & 6 male with mean chronological age of 12± 2years who received RME with Hyrax type and 16 subjects (9 female & 7 male with mean chronological age of 11±1.6 years who received Haas type palatal expander. Paired t-test was used to analyze the outcomes of expansion in each group. Student t-test was used to compare Haas and Hyrax groups. "nResults: The mean value of screw expansion was 9±2 mm in both groups. In Hyrax group nasal cavity width"n(Nc-cN increased from 29.2 ±1.94 mm to 31.7 ±1.93mm (p= 0.001 and In Haas group it was increased from 27.75± 2.21 mm to 29.35 ± 2.26 mm(p= 0.043. When two groups were compared to each other, statistically this increase was more significant in Hyrax than in the Haas group (p=0.038. "nConclusion: In this study RME affected geometry of the nasal cavity by increasing the nasal cavity width. However In our sample, Hyrax appliance demonstrated better performance over the Haas appliance in all variables.

  16. Catalysis of copper corrosion products on chlorine decay and HAA formation in simulated distribution systems.

    Science.gov (United States)

    Zhang, Hong; Andrews, Susan A

    2012-05-15

    This study investigated the effect of copper corrosion products, including Cu(II), Cu(2)O, CuO and Cu(2)(OH)(2)CO(3), on chlorine degradation, HAA formation, and HAA speciation under controlled experimental conditions. Chlorine decay and HAA formation were significantly enhanced in the presence of copper with the extent of copper catalysis being affected by the solution pH and the concentration of copper corrosion products. Accelerated chlorine decay and increased HAA formation were observed at pH 8.6 in the presence of 1.0 mg/L Cu(II) compared with that observed at pH 6.6 and pH 7.6. Further investigation of chlorine decay in the presence of both Suwannee River NOM and Cu(II) indicated that an increased reactivity of NOM with dissolved and/or solid surface-associated Cu(II), rather than chlorine auto-decomposition, was a primary reason for the observed rapid chlorine decay. Copper corrosion solids [Cu(2)O, CuO, Cu(2)(OH)(2)CO(3)] exhibited catalytic effects on both chlorine decay and HAA formation. Contrary to the results observed when in the absence of copper corrosion products, DCAA formation was consistently predominant over other HAA species in the presence of copper corrosion products, especially at neutral and high pH. This study improves the understanding for water utilities and households regarding chlorine residuals and HAA concentrations in distribution systems, in particular once the water reaches domestic plumbing where copper is widely used. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Factors affecting THMs, HAAs and HNMs formation of Jin Lan Reservoir water exposed to chlorine and monochloramine.

    Science.gov (United States)

    Hong, Huachang; Xiong, Yujing; Ruan, Mengyong; Liao, Fanglei; Lin, Hongjun; Liang, Yan

    2013-02-01

    The formations of THMs, HAAs, and HNMs from chlorination and chloramination of water from Jinlan Reservoir were investigated in this study. Results showed that monochloramine rather than chlorine generally resulted in lower concentration of DBPs, and the DBPs formation varied greatly as the treatment conditions changed. Specifically, the yields of THMs, HAAs and HNMs all increased with the high bromide level and high disinfectant dose both during chlorination and chloramination. The longer reaction time had a positive effect on the formation of THMs, HAAs and HNMs during chlorination and HNMs during chloramination. However, no time effect was observed on the formation of THMs and HAAs during chloramination. An increase in pH enhanced the levels of THMs and HNMs upon chlorination but reduced levels of HNMs upon chloramination. As for the THMs in chloramination and HAAs in chlorination and chloramination, no obvious pH effect was observed. The elevated temperature significantly increased the yields of THMs during chlorination and HNMs during chloramination, but has no effect on THMs and HAAs yields during chloramination. In the same temperature range, the formation of HAAs and HNMs in chlorination showed a first increasing and then a decreasing trend. In chloramination study, addition of nitrite markedly increased the formation of HNMs but had little impact on the formation of THMs and HAAs. While in chlorination study, the presence of high nitrite levels significantly reduced the yields of THMs, HAAs and HNMs. Range analysis revealed that the bromide and disinfectant levels were the major factors affecting THMs, HAAs and HNMs formation, in both chlorination and chloramination. Finally, comparisons of the speciation of mono-halogenated, di-halogenated, tri-halogenated HAAs and HNMs between chlorination and monochloramination were also conducted, and factors influencing the speciation pattern were identified. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. 75 FR 22627 - Chrysler LLC, St. Louis North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc...

    Science.gov (United States)

    2010-04-29

    ... North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services, Inc., Corrigan Company and Murphy Company, Fenton, MO... workers from HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services...

  19. Effects of operating conditions on THMs and HAAs formation during wastewater chlorination

    Energy Technology Data Exchange (ETDEWEB)

    Sun Yingxue; Wu Qianyuan [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Hu Hongying, E-mail: hyhu@tsinghua.edu.cn [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Tian Jie [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China)

    2009-09-15

    Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.

  20. The measurement of the amplitude of de Haas-van Alphen oscillations in indium

    International Nuclear Information System (INIS)

    Wilde, J. de; Meredith, D.J.

    1976-01-01

    A flux-gate magnetometer incorporating a superconducting flux transformer is described and its application to the measurement of de Haas-van Alphen oscillation amplitude is compared with conventional techniques. Measurements on the third zone Fermi surface of indium in magnetic fields of up to 4 T are given to show the advantages of the method. (author)

  1. Quantitative assessment of S. mutans and C. albicans in patients with Haas and Hyrax expanders

    Directory of Open Access Journals (Sweden)

    Matheus Melo Pithon

    2012-06-01

    Full Text Available OBJECTIVE: To assess and compare the number of Streptococcus mutans and Candida albicans colonies in patients with Haas and Hyrax appliances before and after insertion. METHODS: The sample consisted of 84 patients requiring orthodontic treatment. For all patients a midpalatal suture expansion was indicated. Patients were randomly divided into Group HA, who used the Haas appliance (n = 42 and Group HY, who used the Hyrax appliance (n = 42. Initially and thirty days after appliance insertion all patients were submitted to saliva collections. The saliva was diluted followed by seeding in Mitis Salivarius and CHROMagar media, for growth of S. mutans and C. albicans respectively. RESULTS: Results showed statistically significant difference between groups HA and HY for Streptococcus mutans and Candida albicans (p <0.05. Haas appliance promoted greater S. mutans and C. albicans proliferation when compared to Hyrax appliance. CONCLUSION: The Haas appliance favored greater proliferation of S. mutans and C. albicans when compared with the Hyrax appliance. Insertion of the appliances resulted in greater buildup of microorganisms.

  2. Effects of operating conditions on THMs and HAAs formation during wastewater chlorination

    International Nuclear Information System (INIS)

    Sun Yingxue; Wu Qianyuan; Hu Hongying; Tian Jie

    2009-01-01

    Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.

  3. La Turquie et l’Union européenne

    Directory of Open Access Journals (Sweden)

    Benoît Montabone

    2008-03-01

    Full Text Available L’article explore les évolutions possibles des relations entre la Turquie et l’Union européenne à l’horizon 2020. Il présente quatre scénarios géopolitiques : l’ancrage européen (scénario normatif, l’intégration à risque (scénario tendanciel, la diversification des partenaires (scénario alternatif et le renversement stratégique (scénario catastrophe. Dans tous les cas, l’accès aux hydrocarbures du Caucase et de la mer Caspienne joue une place centrale.This article investigates the various possible evolutions of the relations between Turkey and the European Union on the horizon 2020. Four resulting geopolitical scenarios are introduced: European anchoring (the normative scenario, Integration at risk (the trend line scenario, Diversification of partners (the alternate scenario, and at last Strategic overthrow (the nightmare one. In every case, the access to the hydrocarbons of Caucasus and Caspian Sea plays a key role.

  4. Puente sobre el río Enns, Austria

    Directory of Open Access Journals (Sweden)

    Polensky & Zöllner, Constructora

    1965-09-01

    Full Text Available A road bridge has been recently opened over the Enns river at Steyr (Austria. The purpose is to improve traffic and avoid the bottlenecks that often took place. The bridge is supplemented by three other works of lesser importance, namely two bridges and a tunnel for pedestrians. The bridge structure supporting the decks is cellular, box type. It has three compartments, and four vertical partitions, whose thickness varies from 6 m over the intermediate piles to 2.30 m at the crown. There are three spans, of 47, 101 and 70 m length. The bridge intrados forms a smooth curve. Two overhangs extend from the central structure, and provide sidewalks for pedestrians: the deck itself having a width of 17 m. The structure was made in successive overhangs, in 3.50 m sections. Longitudinal prestressing, by means of PZ-A-100 type cables, was done by applying an initial loading of 120 t. The cables run in tubes. After the concrete had reached a suitable strength, the cables were stretched. The tubes were then filled with cement mortar, and in this operation air suction equipment was utilised to make sure that no air cavities were left.Se ha construido y puesto en servicio un puente para carretera sobre el río Enns en Steyr (Austria, con objeto de mejorar la circulación de vehículos y evitar las congestiones que se producían frecuentemente. Complementan al puente otras tres obras de menor importancia, constituidas por dos puentes y un túnel para el paso de peatones. La estructura que soporta el tablero es celular, tipo cajón, de tres células y cuatro almas y tabiques verticales, con canto variable desde 6 m sobre las pilas intermedias a 2,30 m en la clave. El puente se subdivide en tres tramos de 47, 101 y 70 m de luz, respectivamente. El intradós sigue el perfil de una curva suave. Del cuerpo de la estructura salen dos ménsulas que soportan los dos andenes para peatones, quedando el tablero con una anchura total de 17 metros. La estructura se construy

  5. Läbimurre: Enn Kunila saadab oma maalikogu Soome näitusele / Andres Eilart ; kommenteerinud Harry Liivrand

    Index Scriptorium Estoniae

    Eilart, Andres

    2010-01-01

    Helsingi Taidehallis avatakse oktoobri keskel ülevaatenäitus "Viron värit - 150 vuatta virolaista maalaustaidetta Enn Kunilan kokoelmasta" ("Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kollektsioonist"). Näituse kuraator Harry Liivrand, kujundaja Olev Subbi. Mitmekeelse kunstialbumi koostajaks on kunstiteadlane Eero Epner

  6. Study on the TOC concentration in raw water and HAAs in Tehran's water treatment plant outlet.

    Science.gov (United States)

    Ghoochani, Mahboobeh; Rastkari, Noushin; Nabizadeh Nodehi, Ramin; Mahvi, Amir Hossein; Nasseri, Simin; Nazmara, Shahrokh

    2013-11-12

    A sampling has been undertaken to investigate the variation of haloacetic acids formation and nature organic matter through 81 samples were collected from three water treatment plant and three major rivers of Tehran Iran. Changes in the total organic matter (TOC), ultraviolet absorbance (UV254), specific ultraviolet absorbance (SUVA) were measured in raw water samples. Haloacetic acids concentrations were monitored using a new static headspace GC-ECD method without a manual pre-concentration in three water treatment plants. The average concentration of TOC and HAAs in three rivers and three water treatment plants in spring, summer and fall, were 4, 2.41 and 4.03 mg/L and 48.75, 43.79 and 51.07 μg/L respectively. Seasonal variation indicated that HAAs levels were much higher in spring and fall.

  7. Galvano-magnetic properties and Shubnikov de Haas effect of Te-whiskers

    International Nuclear Information System (INIS)

    Berezovets, Veacheslav; Bondarchuk, Nikolai; Nikolaeva, Albina; Nijankovskii, Victor

    2009-01-01

    The work is devoted to investigation of the peculiarities of magnetoresistance, Hall effect and Shubnikov de Haas oscillations in Te-whiskers. Te-whiskers was prepared from vapor-gas phase on the substrate pure tellurium and grown naturally, of the walls of a crucible in the course of growing Te single crystals by the Czochralski method . The measurements of the galvanomagnetic properties and Shubnikov de Haas oscillation correspond to the notion of the occurrence of the effect of intraband magnetic breakdown when two different quasi-classical cyclotron trajectories coexist simultaneously in a magnetic field. This effect is a consequence of the presence of the saddle point in the dispersion law of the tellurium valence band. (authors)

  8. US Baltic Foundation award winners from Estonia are Arvo Pärt and Enn Kunila

    Index Scriptorium Estoniae

    2010-01-01

    Washingtonis toimunud tänavusel U.S Baltic Foundationi auhinnagalal tunnustati kahte eestlast: helilooja Arvo Pärti auhinnaga Baltimaade kuvandi rikastamise eest (Baltic Image Enhancement Award) ja ettevõtjast kunstikollektsionääri Enn Kunilat Baltimaade filantroopiaauhinnaga

  9. Raimond Valgre noorem vend - kes ta oli? : Kuno-Enn Valgre (30.05.1918-02.03.1987) / Valdur Ohmann

    Index Scriptorium Estoniae

    Ohmann, Valdur, 1958-

    2011-01-01

    Vastukäivad andmed ärgitasid uurima, kes õigupoolest oli Valgre noorem vend. Kõige ehedamalt annab Enn Valgre sõjaaegse käekäigu edasi ülekuulamisprotokoll 11. novembrist 1944. Ülekuulamisprotokolli tekst

  10. Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris

    International Nuclear Information System (INIS)

    Ge, Fei; Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin

    2011-01-01

    The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L -1 iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L -1 manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH) 3(am) or MnO 2(am) coat the algal cells , which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).

  11. Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Ge, Fei, E-mail: gefei@xtu.edu.cn [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China); Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China)

    2011-05-15

    The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L{sup -1} iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L{sup -1} manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH){sub 3(am)} or MnO{sub 2(am)} coat the algal cells{sub ,} which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).

  12. Electrons in a Magnetic Field: Special Spin in de Haas-van Alphen effect

    International Nuclear Information System (INIS)

    Shrivastava, Keshav N

    2012-01-01

    When the magnetic field is applied in a metal, the electrons behave like a harmonic oscillator. When the field is increased these harmonic oscillator type levels cross the Fermi energy at a particular point resulting into the discontinuities in the population of any particular level at that point. For a large orbital magnetic moment, different from L = 0 and both signs of spin in the total magnetic momentum quantum number, j = l ± s, the discontinuities in the population of the electrons in a particular level become double valued resulting into doubling of oscillations in the magnetization. There is a double valued change in the energy of the electrons when they transfer from the harmonic oscillator type level to the Fermi level. The magnetization depends on the value of j = l ± s so that there is a double valued period in the oscillations. The de Haas-van Alphen effect is usually described for the L = 0 electrons. Hence, we see that the de Haas-van Alphen effect is considerably modified in going from L = 0 to j = l ± s, with both signs in the spin.

  13. La Nuit européenne des chercheurs / European Researchers' Night

    CERN Multimedia

    CERN. Geneva

    2016-01-01

    Cliquez ici pour voir l'événement webcast (Ceci n'est pas un événement officiel financé par la Commission européenne.) Le CERN organise pour la 7ème année consécutive La Nuit européenne des chercheurs et propose de découvrir la science sous un autre angle. Cet événement ouvre au grand public des centaines de lieux de science à travers l'Europe. Le CERN propose les activités suivantes au public local : Au premier étage du Globe (entrée devant le Globe), projections de documentaires scientifiques primés et de court-métrages en VO sous-titrés en français. Voir programme du Globe. Visites guidées d...

  14. La crise européenne. Un regard de géographe

    Directory of Open Access Journals (Sweden)

    Yann Richard

    2012-04-01

    Full Text Available L’Union européenne est durement affectée par la crise des dettes souveraines. Cette crise peut être interprétée comme la conséquence de plusieurs faits importants : une absence de leadership européen, des inégalités fortes parfois anciennes entre les performances macroéconomiques des pays membres, des faiblesses structurelles déjà observables avant la crise dans certains pays. Mais le principal facteur de fragilité de l’Union européenne réside dans sa division interne. Tant que la problématique de l’intégration européenne ne sera pas appropriée par les citoyens européens eux-mêmes et tant que certaines politiques ne seront pas davantage coordonnées, l’Union restera sur le fil du rasoir. Cette crise met en lumière l’essoufflement d’un certain modèle d’intégration. Dans cet article, on explore ces problématiques avec un regard géographique.

  15. Casein Kinase I Isoform Hrr25 Is a Negative Regulator of Haa1 in the Weak Acid Stress Response Pathway in Saccharomyces cerevisiae.

    Science.gov (United States)

    Collins, Morgan E; Black, Joshua J; Liu, Zhengchang

    2017-07-01

    Haa1 is a transcription factor that adapts Saccharomyces cerevisiae cells to weak organic acid stresses by activating the expression of various genes. Many of these genes encode membrane proteins, such as TPO2 and YRO2 How Haa1 is activated by weak acids is not clear. Here, we show that casein kinase I isoform Hrr25 is an important negative regulator of Haa1. Haa1 is known to be multiply phosphorylated. We found that mutations in HRR25 lead to reduced Haa1 phosphorylation and increased expression of Haa1 target genes and that Hrr25 interacts with Haa1. The other three casein kinase I isoforms, Yck1, Yck2, and Yck3, do not seem to play critical roles in Haa1 regulation. Hrr25 has a 200-residue C-terminal region, including a proline- and glutamine-rich domain. Our data suggest that the C-terminal region of Hrr25 is required for normal inhibition of expression of Haa1 target genes TPO2 and YRO2 and is important for cell growth but is not required for cell morphogenesis. We propose that Hrr25 is an important regulator of cellular adaptation to weak acid stress by inhibiting Haa1 through phosphorylation. IMPORTANCE Our study has revealed the casein kinase I protein Hrr25 to be a negative regulator of Haa1, a transcription factor mediating the cellular response to stresses caused by weak acids. Many studies have focused on the target genes of Haa1 and their roles in weak acid stress responses, but little has been reported on the regulatory mechanism of Haa1. Weak acids, such as acetic acid, have long been used for food preservation by slowing down the growth of fungal species, including S. cerevisiae In the biofuel industry, acetic acid in the lignocellulosic hydrolysates limits the production of ethanol, which is undesirable. By understanding how Haa1 is regulated, we can make advances in the field of food sciences to better preserve food and engineer acetic acid-resistant strains that will increase productivity in the biofuel industry. Copyright © 2017 American

  16. Shubnikov-de Haas effect study of InAs after transmutation doping at low temperatures

    International Nuclear Information System (INIS)

    Gerstenberg, H.; Mueller, P.

    1990-01-01

    Degenerate InAs single crystals have been irradiated by thermal neutrons below 6 K. The Shubnikov-de Haas effect and the electrical resistivity have been measured as a function of the neutron dose and the annealing temperature. The effects of transmutation doping and simultaneous introduction of lattice defects have been analysed in terms of the conduction electron density and the scattering rates τ ρ -1 - ρne 2 /m * and τ x -1 2πkub(B)X/h/2π (where X is the Dingle temperature). The measured conduction electron density after irradiation and thermal annealing agreed well with the values calculated from the experimental and materials parameters. The effects of radiation damage may qualitatively be explained assuming neutral In vacancies to be the most common type of defect in thermal-neutron-irradiated InAs. A comparison with similar experiments on InSb is given. (author)

  17. De Haas-van Alphen effect of a two-dimensional ultracold atomic gas

    Science.gov (United States)

    Farias, B.; Furtado, C.

    2016-01-01

    In this paper, we show how the ultracold atom analogue of the two-dimensional de Haas-van Alphen effect in electronic condensed matter systems can be induced by optical fields in a neutral atomic system. The interaction between the suitable spatially varying laser fields and tripod-type trapped atoms generates a synthetic magnetic field which leads the particles to organize themselves in Landau levels. Initially, with the atomic gas in a regime of lowest Landau level, we display the oscillatory behaviour of the atomic energy and its derivative with respect to the effective magnetic field (B) as a function of 1/B. Furthermore, we estimate the area of the Fermi circle of the two-dimensional atomic gas.

  18. Corrosion in Haas expanders with and without use of an antimicrobial agent: an in situ study

    Science.gov (United States)

    BAGATIN, Cristhiane Ristum; ITO, Izabel Yoko; ANDRUCIOLI, Marcela Cristina Damião; NELSON-FILHO, Paulo; FERREIRA, José Tarcísio Lima

    2011-01-01

    Objectives The purpose of this study was to evaluate in situ the occurrence of corrosion in the soldering point areas between the wire, silver brazing and band in Haas expanders. Material and Methods Thirty-four 7-12-year-old patients who needed maxillary expansion with a Haas expander were randomly assigned to two groups of 17 individuals each, according to the oral hygiene protocol adopted during the orthodontic treatment: Group I (control), toothbrushing with a fluoride dentifrice and Group II (experimental), toothbrushing with the same dentifrice plus 0.12% chlorhexidine gluconate (Periogard®) mouthrinses twice a week. The appliances were removed after approximately 4 months. Fragments of the appliances containing a metallic band with a soldered wire were sectioned at random for examination by stereomicroscopy, scanning electron microscopy (SEM) and energy dispersive x-ray spectroscopy (EDS). Data were analyzed statistically by Fisher's test at 5% significance level. Results The analysis by optical microscopy revealed areas with color change suggestive of corrosion in the soldering point areas joining the band and the wire in all specimens of both groups, with no statistically significant difference between the groups (p=1). The peaks of chemical elements (Ni, Fe, Cr, O, C and P) revealed by EDS were also similar in both groups. Conclusion: Color changes and peaks of chemical elements suggestive of corrosion were observed in the soldering point areas between the wire, silver brazing and band in both control and experimental groups, which indicate that the 0.12% chlorhexidine gluconate mouthrinses did not influence the occurrence of corrosion in situ. PMID:22231004

  19. La culture musicale caribéenne de New York - 14

    OpenAIRE

    Audebert , Cédric

    2012-01-01

    Le bassin caribéen est un espace de production musicale foisonnante (reggae, salsa, konpa, meringue, zouk, calypso, etc.) au rayonnement international. Les musiques puisent leur énergie principalement dans l'héritage de la plantation et des quartiers populaires urbains des îles d'origine, mais aussi dans le cosmopolitisme des métropoles d'immigration. La mondialisation des musiques caribéennes s'appuie sur les puissants réseaux nord-américains de production et de diffusion, dont les communaut...

  20. Le syndicalisme, acteur de la démocratisation de l'Union Européenne?

    OpenAIRE

    Erne, Roland

    2002-01-01

    Les syndicats pourraient être des agents de la démocratisation de l'Union européenne pour deux raisons : primo, le syndicalisme a souvent joué un rôle substantiel dans les processus de démocratisation nationale. Secundo, les syndicats ont été parmi les premières organisations citoyennes à être impliquées dans le processus d'intégration européenne. Cependant, ces considérations ne signifient pas nécessairement qu'ils joueront un rôle important dans la démocratisation de l'UE....

  1. Editorial: Alimentation méditerranéenne et santé [Mediterranean diet and health

    Directory of Open Access Journals (Sweden)

    Malika BOUCHENAK

    2016-06-01

    Full Text Available Ce numéro de Nutrition & Santé est un retour sur le 2 Congrès International de la Société Algérienne de Nutrition qui s'est tenu du 13 au 15 octobre 2015, à Alger, et dont la thématique principale portait sur l'Alimentation méditerranéenne et la santé. L'alimentation méditerranéenne représente un véritable trésor culturel et culinaire, prônant la consommation de certains aliments, comme les fruits, les légumes, les légumineuses, les grains entiers, les noix, le poisson. De plus, l'un de ses piliers repose sur la consommation de l'huile d'olive, dont les avantages sont nombreux. A cet effet, l'OMS et la FAO ont reconnu le régime méditerranéen comme un modèle d'alimentation de qualité, sain et durable. Par ailleurs, les régimes méditerranéens traditionnels sont nutritionnellement appropriés, avec des teneurs variées en graisses totales, faibles en acides gras saturés et très faibles en acides gras Trans, et riches en fibres et en vitamines et flavonoïdes antioxydants.

  2. Tensile strained gray tin: Dirac semimetal for observing negative magnetoresistance with Shubnikov-de Haas oscillations

    Science.gov (United States)

    Huang, Huaqing; Liu, Feng

    2017-05-01

    The extremely stringent requirement on material quality has hindered the investigation and potential applications of exotic chiral magnetic effect in Dirac semimetals. Here, we propose that gray tin is a perfect candidate for observing the chiral anomaly effect and Shubnikov-de-Haas (SdH) oscillation at relatively low magnetic field. Based on effective k .p analysis and first-principles calculations, we discover that gray tin becomes a Dirac semimetal under tensile uniaxial strain, in contrast to a topological insulator under compressive uniaxial strain as known before. In this newly found Dirac semimetal state, two Dirac points which are tunable by tensile [001] strains lie in the kz axis and Fermi arcs appear in the (010) surface. Due to the low carrier concentration and high mobility of gray tin, a large chiral anomaly induced negative magnetoresistance and a strong SdH oscillation are anticipated in this half of the strain spectrum. Comparing to other Dirac semimetals, the proposed Dirac semimetal state in the nontoxic elemental gray tin can be more easily manipulated and accurately controlled. We envision that gray tin provides a perfect platform for strain engineering of chiral magnetic effects by sweeping through the strain spectrum from positive to negative and vice versa.

  3. Improved ethanol production from xylose in the presence of acetic acid by the overexpression of the HAA1 gene in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sakihama, Yuri; Hasunuma, Tomohisa; Kondo, Akihiko

    2015-03-01

    The hydrolysis of lignocellulosic biomass liberates sugars, primarily glucose and xylose, which are subsequently converted to ethanol by microbial fermentation. The rapid and efficient fermentation of xylose by recombinant Saccharomyces cerevisiae strains is limited by weak acids generated during biomass pretreatment processes. In particular, acetic acid negatively affects cell growth, xylose fermentation rate, and ethanol production. The ability of S. cerevisiae to efficiently utilize xylose in the presence of acetic acid is an essential requirement for the cost-effective production of ethanol from lignocellulosic hydrolysates. Here, an acetic acid-responsive transcriptional activator, HAA1, was overexpressed in a recombinant xylose-fermenting S. cerevisiae strain to yield BY4741X/HAA1. This strain exhibited improved cell growth and ethanol production from xylose under aerobic and oxygen limited conditions, respectively, in the presence of acetic acid. The HAA1p regulon enhanced transcript levels in BY4741X/HAA1. The disruption of PHO13, a p-nitrophenylphosphatase gene, in BY4741X/HAA1 led to further improvement in both yeast growth and the ability to ferment xylose, indicating that HAA1 overexpression and PHO13 deletion act by different mechanisms to enhance ethanol production. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Kjøring med mistanke om påvirkning av andre rusmidler enn alkohol

    Directory of Open Access Journals (Sweden)

    Asbjørg S. Christophersen

    2009-10-01

    Full Text Available  SAMMENDRAGStatens rettstoksikologiske institutt har i løpet av de siste år registrert en stor økning av prøver fra bilføreremistenkt for kjøring under påvirkning av andre rusmidler enn alkohol. Antall positive saker økte 42% fra1994 til 1995. De hyppigste påviste stoffer er tetrahydrocannabinol, amfetamin, benzodiazepiner og opiater(morfin/kodein. Bruk av tyngre narkotiske stoffer har blitt mer vanlig i trafikksammenheng og antall positivetilfeller har økt betydelig mer enn totalt antall saker. Fra 1994 til 1995 økte antall positive amfetaminprøvermed 75% (fra 533 til 937 og antall positive prøver som følge av heroininntak økte med 87% (fra 92 til 172.Bruk av flere stoffer samtidig er vanlig, over 60 % av sakene i 1995 var positive på mer enn ett stoff, alkoholikke medregnet. De fleste tilfeller var representert av menn i alderen 25-32 år (37%. Kvinner var representerti ca. 11% av sakene.Christophersen AS, Skurtveit S, Mørland J. Drivers suspected to drive under the influence of drugs otherthan alcohol. Nor J Epidemiol 1996; 6 (1: 45-48.ENGLISH SUMMARYThe National Institute of Forensic Toxicology has registered a large increase in the number of samples fromdrivers suspected to drive under influence of drugs other than alcohol. The number of drug positive casesincreased 42% from 1994 to 1995. The most frequent drugs detected are tetrahydrocannabinol, amphetamine,benzodiazepines and opiates (morphine/codeine. The frequency of hard narcotic drug use has increased morethan the total number of cases. From 1994 to 1995, the number of amphetamine positive samples increased75% (from 533 to 937 and the number of samples positive due to heroin use (detection of the metabolite 6-monoacetylmorphine in urine increased 87%. Multi-drug use is common and more than one drug wasdetected in more than 60% of the cases from 1995, alcohol not included. Most of the cases were representedby men 25-32 years old (37%. Women were represented in about

  5. Vocabulaire du budget des Communautés européennes

    CERN Document Server

    European Communities. Luxembourg

    1992-01-01

    Sujet: Etude terminologique et phraséologique du vocabulaire du règlement financier et d'autres textes relatifs au budget des Communautés européennes. Langues: Français, anglais, allemand, italien, néerlandais, danois, espagnol, portuguais, grec. Présentation: Corpus d'un millier d'entrées en neuf langues, présentées dans l'ordre d'apparition des termes et phrases dans les textes dépouillés, avec indication des sources. Des définitions ou notes précisent certaines notions. Neuf index alphabétiques donnent accès au corpus.

  6. Application of ENN-1 for Fault Diagnosis of Wind Power Systems

    Directory of Open Access Journals (Sweden)

    Meng-Hui Wang

    2012-01-01

    Full Text Available Maintaining a wind turbine and ensuring secure is not easy because of long-term exposure to the environment and high installation locations. Wind turbines need fully functional condition-monitoring and fault diagnosis systems that prevent accidents and reduce maintenance costs. This paper presents a simulator design for fault diagnosis of wind power systems and further proposes some fault diagnosis technologies such as signal analysis, feature selecting, and diagnosis methods. First, this paper uses a wind power simulator to produce fault conditions and features from the monitoring sensors. Then an extension neural network type-1- (ENN-1- based method is proposed to develop the core of the fault diagnosis system. The proposed system will benefit the development of real fault diagnosis systems with testing models that demonstrate satisfactory results.

  7. Mis põhjustab/soodustab vägivalda koolis? / Valter Parve, Mikko Lagerspetz, Erki Korp, Enn Toom, Kristiine Vahtramäe

    Index Scriptorium Estoniae

    2008-01-01

    Küsimusele vastavad TÜ Pärnu Kolledži lektor Valter Parve, TLÜ sotsioloogiaprofessor Mikko Lagerspetz, Tallinna laste turvakeskuse juhataja Erki Korp, usaldustelefoni projektijuht Enn Toom ja lastevanemate liidu koolitusjuht Kristiine Vahtramäe

  8. Upper Critical Field and de Haas-van Alphen Oscillations in KOs2O6 Measured in a Hybrid Magnet

    Science.gov (United States)

    Taichi Terashima,; Nobuyuki Kurita,; Atsushi Harada,; Kota Kodama,; Jun-ichi Yamaura,; Zenji Hiroi,; Hisatomo Harima,; Shinya Uji,

    2010-08-01

    Magnetic torque measurements have been performed on a KOs2O6 single crystal in magnetic fields up to 35.3 T and at temperatures down to 0.6 K. The upper critical field is determined to be ˜30 T. De Haas-van Alphen oscillations are observed. A large mass enhancement of (1+λ) = m* / mband = 7.6 is found. It is suggested that, for the large upper critical field to be reconciled with Pauli paramagnetic limiting, the observed mass enhancement must be of electron-phonon origin, including electron-rattling-mode interactions, for the most part.

  9. La faille Nord-Pyrénéenne dans l’Ariège et la Haute-Garonne

    NARCIS (Netherlands)

    Sitter, de L.U.

    1953-01-01

    Un des plus grands phénomènes structuraux des Pyrénées est sans doute la faille Nord-Pyrénéenne qui longe la zone axiale depuis la Méditerranée jusqu'à la côte atlantique. Elle est caractérisée par plusieurs particularités exceptionelles, dont le métamorphisme des terrains jurassiques et crétacés

  10. ENN-ICS - quality assurance and online evaluation of a multilingual learning management system for sleep medicine

    Directory of Open Access Journals (Sweden)

    Knobl, Brigitte

    2006-11-01

    Full Text Available With the development and implementation of a multilingual interactive communication system the e-health project ENN-ICS, funded by the European Union, aims at the improvement of health care in Europe. The field of application is sleep physiology and sleep medicine. ENN-ICS Centre offers direct access to medical information for multiple users, i.e. health authorities, health care professionals, patients and citizen. Using XML technologies the new web based network integrates advanced e-learning and e-publishing methods for the training of healthcare professionals. Editorial and distributive processes are supported by customized central editorial, content management and learning management systems (CMS, LMS. ENN-ICS e-health services are evaluated by selected user groups in North, Middle and Southern Europe using reliable and scientifically accepted validation instruments. The compliance with essential quality requirements and criteria is tested and verified by using adapted online questionnaires based on the DISCERN questionnaire for evaluating patient information, on the HON principles for evaluating health-related websites and on the GMDS catalogue of quality criteria for electronic publications in medicine. The system architecture and its exemplary applications can be used as a model for future e-health services dealing with neurological and other medical topics.

  11. Note on de Haas-van Alphen diamagnetism in thin, free-electron films

    Directory of Open Access Journals (Sweden)

    J. A. Grzesik

    2012-03-01

    Full Text Available We revisit the problem of de Haas-van Alphen (dHvA diamagnetic susceptibility oscillations in a thin, free-electron film trapped in a synthetic harmonic potential well. A treatment of this phenomenon at zero temperature was announced many years ago by Childers and Pincus (designated hereafter as CP, and we traverse initially much the same ground, but from a slightly different analytic perspective. That difference hinges around our use, in calculating the Helmholtz free energy F, of an inverse Laplace transform, Bromwich-type contour integral representation for the sharp distribution cutoff at Fermi level μ. The contour integral permits closed-form summation all at once over the discrete orbital Landau energy levels transverse to the magnetic field, and the energy associated with the in-plane canonical momenta ℏ k x and ℏ k z. Following such summation/integration, pole/residue pairs appear in the plane of complex transform variable s, a fourth-order pole at origin s = 0, and an infinite ladder, both up and down, of simple poles along the imaginary axis. The residue sum from the infinite pole ladder automatically engenders a Fourier series with period one in dimensionless variable μ/ ℏ ω (with effective angular frequency ω suitably defined, series which admits closed-form summation as a cubic polynomial within any given periodicity slot. Such periodicity corresponds to Landau levels slipping sequentially beneath Fermi level μ as the ambient magnetic field H declines in strength, and is manifested by the dHvA pulsations in diamagnetic susceptibility. The coëxisting steady contribution from the pole at origin has a similar cubic structure but is opposite in sign, inducing a competition whose outcome is a net magnetization that is merely quadratic in any given periodicity slot, modulated by a slow amplitude growth. Apart from some minor notes of passing discord, these simple algebraic structures confirm most of the CP formulae, and their

  12. Pavel Haas Study Day a IMR Study Day: Inter-War Avant-Garde across National and Disciplinary Borders, 30. a 31. ledna 2016, Cardiff University School of Music, Cardiff, Velká Británie

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Markéta; Zapletal, Miloš

    2016-01-01

    Roč. 53, č. 1 (2016), s. 101-102 ISSN 0018-7003. [Pavel Haas Study Day. Cardiff, 30.01.2016] R&D Projects: GA ČR(CZ) GP14-35842P Institutional support: RVO:68378076 Keywords : Pavel Haas * conference * music * inter-war * avantgarde Subject RIV: AL - Art, Architecture, Cultural Heritage

  13. ANALISA MODA DAN EFEK KEGAGALAN (FAILURE MODE AND EFFECTS ANALYSIS / FMEA PADA PRODUK KURSI LIPAT CHITOSE YAMATO HAA

    Directory of Open Access Journals (Sweden)

    Denny Nurkertamanda

    2012-02-01

    Full Text Available Chitose Indonesia Manufacturing merupakan perusahaan yang memproduksi dan menjual furniture dari logam dengan kerjasama negara Jepang. Berdasarkan data penjualan Chitose Indonesia Manufacturing pada tahun 2003, kursi lipat Chitose Yamato merupakan jenis kursi lipat yang memiliki angka penjualan sebesar 59% dari keseluruhan jenis produk yang diproduksi. Kursi lipat Chitose Yamato HAA merupakan salah satu sarana untuk duduk yang dilengkapi dengan sandaran sesuai dengan bentuk punggung manusia dan dapat dilipat untuk memudahkan penyimpanannya. Selain itu juga rangka kakinya yang berbentuk H sehingga dapat digunakan pada permukaan yang datar atau bergelombang. Material yang digunakan pada rangka kursi lipat Chitose Yamato HAA adalah berupa elemen struktur rangka yang bersifat isotropik, yakni memiliki keseragaman sifat dan bahan suatu elemen (regangan, tegangan, mekanis, dsb. Pada analisa moda kegagalan dilakukan identifikasi moda kegagalan yang potensial, keparahan yang ditimbulkan, dan frekuensi kejadian moda kegagalan. Dengan menggunakan analisa moda kegagalan, maka diharapkan kualitas produk akan meningkat dan dapat digunakan sesuai dengan fungsinya. RPN adalah indikator kekritisan untuk menentukan tindakan koreksi yang sesuai dengan moda kegagalan. RPN digunakan oleh banyak prosedur FMEA untuk menaksir resiko menggunakan tiga kriteria yaitu Keparahan efek (Severity S, Kejadian penyebab (Occurrence O, Deteksi penyebab (Detection D. Angka prioritas RPN merupakan hasil kali rating keparahan, kejadian, dan deteksi. Angka ini hanyalah menunjukkan rangking atau urutan defisiensi desain sistem. Kata kunci : Moda Kegagalan, Efek Kegagalan, Penyebab Kegagalan, Deteksi, Kejadian, Keparahan, RPN (Risk Priority Number.     Chitose Manufacturing Indonesia is a company that produce and sells furniture made from alloy in cooperation with Japan. Based on Sales data by Chitose Indonesia Manufacturing in 2003, Chitose Yamato foldable chair has a sales number

  14. HAA1 and PRS3 overexpression boosts yeast tolerance towards acetic acid improving xylose or glucose consumption: unravelling the underlying mechanisms.

    Science.gov (United States)

    Cunha, Joana T; Costa, Carlos E; Ferraz, Luís; Romaní, Aloia; Johansson, Björn; Sá-Correia, Isabel; Domingues, Lucília

    2018-04-02

    Acetic acid tolerance and xylose consumption are desirable traits for yeast strains used in industrial biotechnological processes. In this work, overexpression of a weak acid stress transcriptional activator encoded by the gene HAA1 and a phosphoribosyl pyrophosphate synthetase encoded by PRS3 in a recombinant industrial Saccharomyces cerevisiae strain containing a xylose metabolic pathway was evaluated in the presence of acetic acid in xylose- or glucose-containing media. HAA1 or PRS3 overexpression resulted in superior yeast growth and higher sugar consumption capacities in the presence of 4 g/L acetic acid, and a positive synergistic effect resulted from the simultaneous overexpression of both genes. Overexpressing these genes also improved yeast adaptation to a non-detoxified hardwood hydrolysate with a high acetic acid content. Furthermore, the overexpression of HAA1 and/or PRS3 was found to increase the robustness of yeast cell wall when challenged with acetic acid stress, suggesting the involvement of the modulation of the cell wall integrity pathway. This study clearly shows HAA1 and/or, for the first time, PRS3 overexpression to play an important role in the improvement of industrial yeast tolerance towards acetic acid. The results expand the molecular toolbox and add to the current understanding of the mechanisms involved in higher acetic acid tolerance, paving the way for the further development of more efficient industrial processes.

  15. Kas tasemetööd täidavad oma eesmärki? / Marge Lepik, Kristi Mere, Merike Haas...[jt.

    Index Scriptorium Estoniae

    2009-01-01

    Küsimusele vastavad Lääne-Viru maavalitsuse haridusosakonna juhataja Marge Lepik, Haridus- ja Teadusministeeriumi välishindamisosakonna peaekspert Kristi Mere, Viira kooli klassiõpetaja Merike Haas, Rääma põhikooli direktor Elmo Joa ja Tallinna Ülikooli Haapsalu kolledži õppejõud Sirje Piht

  16. Les sépultures chasséennes du sud de la France

    Directory of Open Access Journals (Sweden)

    Alain BEYNEIX

    2009-12-01

    Full Text Available ABSTRACT: A new exam of the «royal» sepulture of Saint-Michel-clu-Touch in Toulouse (dép. Haute- Garonne and a bibliographical study about chassean sepultures in southern France permit to present social aspects of the chassean communities in this area. This study shows on the one hand, a glaring diversity about mortuary practises and rituals, on the other hand, the beginning of a social hiérarchisation. Some sepultures present an architecture or else furnitures which illustre the presence of powerful people in the populations of first farmers in the end of the 5 the millenium and in the beginning of the 4 the millenium B.C. in southern France.RÉSUMÉ: Le réexamen de la sépulture dite «royale» de Saint-Michel-du-Touch à Toulouse (Haute- Garonne suivi d'une étude bibliographique des sépultures chasséennes du sud de la France permettent de relever quelques aspects sociaux des communautés du Néolithique moyen de cette région. Outre de flagrantes diversités de pratiques et de rites funéraires, l'étude de ces sépultures dénote tin début de hiérarchisation sociale. Certaines tombes par leur architecture ou par la qualité de leur mobilier apparaissent comme la preuve tangible d'un phénomène d'émergence du pouvoir au sein des populations de premiers agriculteurs dès la fin du Vo et du début du IV millénaire avant J.C. dans le sud de la France.

  17. Transverse effect of Haas and Hyrax appliances on the upper dental arch in patients with unilateral complete cleft lip and palate: A comparative study

    Science.gov (United States)

    Façanha, Anna Júlia de Oliveira; Lara, Tulio Silva; Garib, Daniela Gamba; da Silva Filho, Omar Gabriel

    2014-01-01

    Objective The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months); and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months). Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho AnalyzerTM 3D software. Results The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders. PMID:24945513

  18. Transverse effect of Haas and Hyrax appliances on the upper dental arch in patients with unilateral complete cleft lip and palate: A comparative study

    Directory of Open Access Journals (Sweden)

    Anna Júlia de Oliveira Façanha

    2014-04-01

    Full Text Available Objective: The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods: The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months; and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months. Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho Analyzer(tm 3D software. Results: The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion: Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders.

  19. ÉTUDE COMPARATIVE DANS LE SECTEUR DE L’AGRICULTURE DE L’UNION EUROPÉENNE

    Directory of Open Access Journals (Sweden)

    Constantin CIUTACU

    2008-12-01

    Full Text Available Le secteur agricole est un pilier central de la construction européenne et il occupe, des lors, une place prépondérante dans les politiques européennes. L’agriculture doit faire face a des défis importants, résultant de l’internationalisation et de la mondialisation des politiques et marchés agricoles. La cohésion sociale et économique tout comme la compétitivité économique donnent une nouvelle dimension européenne aux politiques agricoles communes et il y a lieu de les considérer en rapport avec les politiques en matiere de développement rural ainsi qu’avec les nécessités de développement durable. Un large éventail de problemes affecte actuellement le secteur, par exemple la surpopulation et le dépeuplement agricole, le vieillissement démographique, le niveau et la sécurité des revenus, l’ESB et la fievre aphteuse, les organismes génétiquement modifiés, la biodiversité, le changement climatique, la protection de l’environnement, l’opposition entre agriculture organique et agriculture productive, le bien-etre des animaux, l’érosion du sol et la gestion de l’eau. Les actuels problemes structurels ont des conséquences considérables, particulierement dans les nouveaux et les futurs États membres de l’UE.

  20. La possibilité d'un encadrement juridique des lanceurs d'alerte par l'Union européenne

    OpenAIRE

    Racho, Tania

    2016-01-01

    Plusieurs raisons peuvent justifier la nécessité d’une réglementation pour protéger les lanceurs d'alerte au niveau de l'Union européenne. Les alertes médiatisées concernent des dysfonctionnements aux dimensions européennes voire internationales comme par exemple avec les affaires révélées par Snowden ou le Luxleaks. La pertinence d'une action de l'Union européenne est évidente et permettrait alors d'accorder une protection minimale identique sur le territoire des 28 États membres. Néanmoins,...

  1. Experimental determination of Rashba and Dresselhaus parameters and g *-factor anisotropy via Shubnikov-de Haas oscillations

    Science.gov (United States)

    Herzog, F.; Hardtdegen, H.; Schäpers, Th; Grundler, D.; Wilde, M. A.

    2017-10-01

    The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin-orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI.

  2. Experimental determination of Rashba and Dresselhaus parameters and g *-factor anisotropy via Shubnikov-de Haas oscillations

    International Nuclear Information System (INIS)

    Herzog, F; Grundler, D; Wilde, M A; Hardtdegen, H; Schäpers, Th

    2017-01-01

    The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin–orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI. (paper)

  3. Shubnikov - de Haas oscillations, weak antilocalization effect and large linear magnetoresistance in the putative topological superconductor LuPdBi

    Science.gov (United States)

    Pavlosiuk, Orest; Kaczorowski, Dariusz; Wiśniewski, Piotr

    2015-01-01

    We present electronic transport and magnetic properties of single crystals of semimetallic half-Heusler phase LuPdBi, having theoretically predicted band inversion requisite for nontrivial topological properties. The compound exhibits superconductivity below a critical temperature Tc = 1.8 K, with a zero-temperature upper critical field Bc2 ≈ 2.3 T. Although superconducting state is clearly reflected in the electrical resistivity and magnetic susceptibility data, no corresponding anomaly can be seen in the specific heat. Temperature dependence of the electrical resistivity suggests existence of two parallel conduction channels: metallic and semiconducting, with the latter making negligible contribution at low temperatures. The magnetoresistance is huge and clearly shows a weak antilocalization effect in small magnetic fields. Above about 1.5 T, the magnetoresistance becomes linear and does not saturate in fields up to 9 T. The linear magnetoresistance is observed up to room temperature. Below 10 K, it is accompanied by Shubnikov-de Haas oscillations. Their analysis reveals charge carriers with effective mass of 0.06 me and a Berry phase very close to π, expected for Dirac-fermion surface states, thus corroborating topological nature of the material. PMID:25778789

  4. Microwave radiation absorption and Shubnikov-de Haas oscillations in semimetal InAs/GaSb/AlSb composite quantum wells

    Czech Academy of Sciences Publication Activity Database

    Mikhailova, M. P.; Veinger, A.I.; Kochman, I.V.; Semenikhin, P.V.; Kalinina, K.V.; Parfeniev, R.V.; Berezovets, V.A.; Safonchik, M.O.; Hospodková, Alice; Pangrác, Jiří; Zíková, Markéta; Hulicius, Eduard

    2016-01-01

    Roč. 10, č. 4 (2016), 1-8, č. článku 046013. ISSN 1934-2608 R&D Projects: GA ČR GA13-15286S; GA MŠk LO1603 Institutional support: RVO:68378271 Keywords : Shubnikov-de Haas oscillations * microwave absorption * electron-paramagnetic resonance * composite quantum wells * InAs/GaSb/AlSb * MOVPE Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.325, year: 2016

  5. Multigap superconductivity and Shubnikov-de Haas oscillations in single crystals of the layered boride OsB2

    Science.gov (United States)

    Singh, Yogesh; Martin, C.; Bud'Ko, S. L.; Ellern, A.; Prozorov, R.; Johnston, D. C.

    2010-10-01

    Single crystals of superconducting OsB2 [Tc=2.10(5)K] have been grown using a Cu-B eutectic flux. We confirm that OsB2 crystallizes in the reported orthorhombic structure (space group Pmmn ) at room temperature. Both the normal and superconducting state properties of the crystals are studied using various techniques. Heat capacity versus temperature C(T) measurements yield the normal state electronic specific heat coefficient γ=1.95(1)mJ/molK2 and the Debye temperature ΘD=539(2)K . The measured frequencies of Shubnikov-de Haas oscillations are in good agreement with those predicted by band structure calculations. Magnetic susceptibility χ(T,H) , electrical resistivity ρ(T) , and C(T,H) measurements ( H is the magnetic field) demonstrate that OsB2 is a bulk low- κ [κ(Tc)=2(1)] type-II superconductor that is intermediate between the clean and dirty limits [(ξ(T=0)/ℓ=0.97)] with a small upper critical magnetic field Hc2(T=0)=186(4)Oe . The penetration depth is λ(T=0)=0.300μm . An anomalous (not single-gap BCS) T dependence of λ was fitted by a two-gap model with Δ1(T=0)/kBTc=1.9 and Δ2(T=0)/kBTc=1.25 , respectively. The discontinuity in the heat capacity at Tc , ΔC/γTc=1.32 , is smaller than the weak-coupling BCS value of 1.43, consistent with the two-gap nature of the superconductivity in OsB2 . An anomalous increase in ΔC at Tc of unknown origin is found in finite H ; e.g., ΔC/γTc≈2.5 for H≈25Oe .

  6. Milleks teatrilavale ajalugu? : Katri-Aaslav-Tepandi ja Tõnu Tepandi. "President 1939". Estonia kammersaal, esietendus 18. veebruaril 2008; Enn Vetemaa, Erki Aule ja Merle Karusoo. "Sigma Tau-S705". Eesti Draamateater, esietendus 16. märtsil 2008 /

    Index Scriptorium Estoniae

    Vseviov, David, 1949-

    2009-01-01

    Arvustus : Katri-Aaslav-Tepandi ja Tõnu Tepandi. "President 1939". Estonia kammersaal, esietendus 18. veebruaril 2008; Enn Vetemaa, Erki Aule ja Merle Karusoo. "Sigma Tau-S705". Eesti Draamateater, esietendus 16. märtsil 2008

  7. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2007-01-01

    Turundusagentuur PNG (loovjuhiks Jüri Peetson) ühendas tänuõhtu oma klientidele ja koostööpartneritele hispaania laulja Enrique Iglesiase esinemisega 1. dets. Tallinnas Saku Suurhalli restoranis Platoo

  8. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2007-01-01

    21. veebruaril 2007 tähistas Tiigrihüppe SA Tallinnas Olümpia hotelli konverentsikeskuses konverentsiga "Kogu tõde Tiigrihüppest" Tiigrihüppe programmi 10. aastapäeva. Kohal viibis ka programmi üks algatajaid Toomas Hendrik Ilves

  9. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2009-01-01

    Eesti Posti peakontori hoovis esitleti Indrek Kaingi kujundatud rahvusmustriga tenniseid. Esimesed eksklusiivsed kaks paari MULK-kirjaga papusid kingiti president Toomas Hendrik Ilvesele ning ettevõtte Skype presidendile Josh Silvermanile

  10. Hepatic artery aneurysms (HAAs)

    International Nuclear Information System (INIS)

    Nosratini, H.

    2004-01-01

    The hepatic artery aneurysms are rare, especially in interahepatic branches, The frequency consists of 75-80% extrahepatic and 20-25% intrahepatic. Catheterization is achieved usually from common femoral artery, other methods implemented in the case of unsuccessful catheterization from femoral artery, are translumbar and brachial catheterization. The study consist of 565 patients that were referred to the angiography ward, During seven years of assessment, five cases of hepatic artery aneurysm were found; this is a rare condition reported in the English literature. In the literature as well as in this case report the hepatic artery aneurysms are rare. In reported series the extrahepatic artery aneurysms are found more often than in the intrahepatic artery aneurysm but in this case report intrahepatic artery aneurysms are more than extrahepatic one. (author)

  11. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2008-01-01

    8. aug. Tallinnas kinos Sõprus ja klubis Juuksur tähistati 30 aasta möödumist ansambli Joy Divison sünnist ja Anton Corbijni debüütfilmi "Control" jõudmist Eesti kinodesse (näidati dokumentaalfilmi "Joy Divison")

  12. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2006-01-01

    Tallinna Ülikoolis toimunud ameerika kultuurantropoloogi Clifford Geertzi mälestusõhtust, kus esinesid rektor Rein Raud, Eesti Humanitaarinstituudi dotsent Lorenzo Cañás Bottos ja kultuuriteooria lektor Marek Tamm

  13. Seltskond / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2006-01-01

    Inglise rocklaulja Gordon Matthew Sumneri raamatu "Sting. Murtud muusika" esitlusest Tallinnas Viru Keskuse Rahva Raamatu kaupluses ja kontserdist Saku Suurhallis Broken Musicu nimelise tuuri raames 28. juulil

  14. SUB’HAA

    Directory of Open Access Journals (Sweden)

    Harisnal Hadi

    2017-08-01

    Full Text Available The preparation of the artwork entitled "Subhaa", is inspired by the Minangkabau cultural phenomenon. This work focuses on the feelings of children who will be circumcised, the pressure and fear felt by the child who will be circumcised tilled in the form of Polymetrik art works. Circumcision or commonly called Basunaik by Minangkabau society is a Sunna that must be run boys of Islam; indirectly circumcision is also required for boys in Minangkabau. In the area of darek (mainland khitan has its own ceremony, begins with a child who will be circumcised is brought to the bako house to change his clothes, then paraded around the village, after arriving at home circumcised will be held. In the evening there will be entertainment in the form of randai and bagurau saluang. This piece of music is in the form of a new composition. The performance focuses more on the composition of sound as a contextual meaning to be conveyed to the appreciator. This work is a little contrary to the aesthetics that have been awakened in the brain and soul of the arts in the Sendratasik Department of FBS Universitas Negeri Padang. But it cannot be denied that a new works will create its own aesthetic realm. Keywords: Basunaik, Artwork Music. Abstrak Penyusunan karya seni yang berjudul “Subhaa”, ini terinspirasi dari fenomena budaya Minangkabau. Karya ini menitik beratkan garapan pada perasaan anak yang akan dikhitan, tekanan dan ketakutan yang dirasakan oleh anak yang akan dikhitan digarap dalam bentuk penggarapan Polymetrik. Khitan atau biasa disebut Basunaik oleh masyarakat Minangkabau merupakan sunah yang harus dijalankan anak laki-laki Islam, secara tidak langsung khitan juga diwajibkan bagi anak laki-laki di Minangkabau. Di daerah darek (daratan khitan memiliki upacara tersendiri, diawali dengan anak yang akan dikhitan dibawa ke rumah bako untuk mengganti baju, lalu diarak keliling kampung, setelah sampai di rumah baru diadakan khitan, malamnya diadakan hiburan berupa randai dan bagurau saluang. Karya musik ini berbentuk komposisi garapan baru. Penggarapan lebih menitik beratkan kepada penggarapan bunyi sebagai makna kontekstual yang akan disampaikan kepada apresiator. Karya ini memang sedikit bertolak belakang dengan estetika yang sudah terbangun dalam otak dan jiwa kalangan seni di jurusan pendidikan sendratasik FBS Universitas Negeri Padang. Namun tidak bisa dipungkiri sebuah karya garapan baru akan menciptakan ranah estetikanya sendiri. Kata Kunci: Basunaik, Karya seni Musik.

  15. Á contre-courant : les mobilités caribéennes vers l’Éthiopie

    Directory of Open Access Journals (Sweden)

    Giulia Bonacci

    2008-09-01

    Full Text Available L’article s’intéresse à la migration des Caribéens vers l’Ethiopie, et notamment celle des Rastafariens qui se définissent comme de « vrais Éthiopiens » et se disent « rapatriés » en Éthiopie. En dépit de leur nombre limité, ils n’en sont pas moins importants car ils illustrent la persistance et les transformations des imaginaires et idéologies liant les Noirs du monde à l’Éthiopie ainsi qu’un pan méconnu des mobilités caribéennes qui, se dirigeant vers l’Afrique, se découvrent complètement à contre-courant.The article deals with Caribbean migration towards Ethiopia, and especially the one of Rastafarians who define themselves as ‘true Ethiopians’ and ‘repatriates’ in Ethiopia. Despite their limited number, their experience is nonetheless important as it reveals the persistence and change in imaginaries and ideologies linking black all over the world to Ethiopia as well as unknown Caribbean mobility towards Africa, a mobility which is driven against the current.

  16. Europinė semiotika šiandien | Sémiotique européenne d’aujourd’hui

    Directory of Open Access Journals (Sweden)

    Kęstutis Nastopka

    2004-01-01

    Full Text Available Dans le champ sémiotique, deux approches épistémologiques se distinguent : sémiotique européenne et sémiotique américaine. La sémiotique européenne, issue de la théorie du signe linguistique de Ferdinand de Saussure, dans les années 1960 voit se former deux écoles indépendantes : celle de Paris (de Greimas et celle de Tartou-Moscou (de Lotman.La sémiotique dite « standard » de Greimas présente une théorie du discours envisagé comme un tout de signification. En comprenant la signification comme un processus, Greimas décrit les transformations des significations d’après le modèle du discours mythique élaboré par Vladimir Propp. Le monde est traité comme discontinu et composé d’oppositions. Dans les années 1980 l’école greimassienne passe de la sémiotique de faire à celle d’état, de la discontinuité à la continuité, de l’objet au sujet, de l’énoncé à l’énonciation. Dans la sémiotique des passions au centre du programme narratif se trouve une compétence modale du sujet. Ces derniers temps, parmi les héritiers de Greimas, à côté de la sémiotique tensive qui choisit un métalangage savant et des schématisations un peu arides, apparaît une sémiotique esthésique, issue de De l’imperfection de Greimas.Le concept de systèmes modelants secondaires est devenu une sorte d’emblème de l’école de Tartou. Ce terme détermine des structures communicatives différentes, organisées d’après le modèle des signes linguistiques. A la recherche d’un métalangage scientifique, commun aux diverses disciplines humaines, on s’oriente vers la linguistique structurale et la théorie de l’information. Autour de l’année 1980, dans la sémiotique de Lotman la conception du texte commeune manifestation de la langue est changée par celle du texte qui produit sa propre langue. Le texte est considéré non plus comme un systéme autonome, synchronique mais comme un énoncé, inséparable de la m

  17. Mass Enhancement of Nearly Trivalent Compound EuCo2Si2: Studied by the de Haas-van Alphen Experiments and Energy Band Calculations

    International Nuclear Information System (INIS)

    Ōnuki, Yoshichika; Hedo, Masato; Nakama, Takao; Nakamura, Ai; Aoki, Dai; Boukahil, Mounir; Haga, Yoshinori; Takeuchi, Tetsuya; Harima, Hisatomo

    2015-01-01

    We succeeded in growing single crystals of EuCo 2 Si 2 by the Bridgman method, and carried out the de Haas-van Alphen (dHvA) experiments. EuCo 2 Si 2 was previously studied from a viewpoint of the trivalent electronic state on the basis of the magnetic susceptibility and X-ray absorption experiments, whereas most of the other Eu compounds order magnetically, with the divalent electronic state. The detected dHvA branches in the present experiments are found to be explained by the results of the full potential linearized augmented plane wave energy band calculations on the basis of a local density approximation (LDA) for YCo 2 Si 2 (LDA) and EuCo 2 Si 2 (LDA + U), revealing the trivalent electronic state. The detected cyclotron effective masses are moderately large, ranging from 1.2 to 2.9 m 0

  18. Quantum oscillations without a Fermi surface. The anomalous de Haas-van Alphen effect and relation to SmB{sub 6}

    Energy Technology Data Exchange (ETDEWEB)

    Knolle, Johannes; Cooper, Nigel [T.C.M. Group, Cavendish Laboratory, J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom)

    2016-07-01

    The de Haas-van Alphen effect (dHvAE), describing oscillations of the magnetization as a function of magnetic field, is commonly assumed to be a definite sign for the presence of a Fermi surface (FS). Indeed, the effect forms the basis of a well-established experimental procedure for accurately measuring FS topology and geometry of metallic systems, with parameters commonly extracted by fitting to the Lifshitz-Kosevich (LK) theory based on Fermi liquid theory. Here we show that, in contrast to this canonical situation, there can be quantum oscillations even for band insulators of certain types. We provide simple analytic formulas describing the temperature dependence of the quantum oscillations in this setting, showing strong deviations from LK theory. We draw connections to recent experiments on the tentative topological Kondo insulator SmB{sub 6}.

  19. de Haas-van Alphen effect investigations of the electronic structure of pure and aluminum-doped MgB2

    International Nuclear Information System (INIS)

    Carrington, A.; Yelland, E.A.; Fletcher, J.D.; Cooper, J.R.

    2007-01-01

    Our understanding of the superconducting properties of MgB 2 is strongly linked to our knowledge of its electronic structure. In this paper we review experimental measurements of the Fermi surface parameters of pure and Al-doped MgB 2 using the de Haas-van Alphen (dHvA) effect. In general, the measurements are in excellent agreement with the theoretical predictions of the electronic structure, including the strength of the electron-phonon coupling on each Fermi surface sheet. For the Al doped samples, we are able to measure how the band structure changes with doping. These results are in excellent agreement with calculations based on the virtual crystal approximation. We also review work on the dHvA effect in the superconducting state

  20. Topological nature of the node-arc semimetal PtSn4 probed by de Haas-van Alphen quantum oscillations

    Science.gov (United States)

    Wang, Y. J.; Liang, D. D.; Ge, M.; Yang, J.; Gong, J. X.; Luo, L.; Pi, L.; Zhu, W. K.; Zhang, C. J.; Zhang, Y. H.

    2018-04-01

    Dirac node arc semimetal state is a new topological quantum state which is proposed to exist in PtSn4 (Wu et al 2016 Dirac node arcs in PtSn4 Nat. Phys. 12 667–71). We present a systematic de Haas-van Alphen quantum oscillation study on this compound. Two intriguing oscillation branches, i.e. F 1 and F 2, are detected in the fast Fourier transformation spectra, both of which are characterized to possess tiny effective mass and ultrahigh quantum mobility. And the F 2 branch exhibits an angle-dependent nontrivial Berry phase. The features are consistent with the existence of the node arc semimetal state and shed new light on its complicated Fermi surfaces and topological nature.

  1. La Cour européenne des droits de l’homme et la défense du mode de vie tsigane : Le choix de l’immobilisme. Observations sous Chapman c. Royaume-Uni, 18 janvier 2001

    OpenAIRE

    Ringelheim, Julie

    2001-01-01

    Cet article analyse en profondeur l'arrêt de la Cour européenne des droits de l'homme, Chapman c. Royaume-Uni du 18 janvier 2001 qui porte sur le droit des familles tsiganes à vivre en caravane selon leurs traditions.

  2. Koolitaja kogemus / Enn Siim

    Index Scriptorium Estoniae

    Siim, Enn

    2002-01-01

    Vene koolide õpetajate täienduskoolitusprobleeme, integratsiooniprobleemide lahendamisest Kanada hariduses, humanistliku pedagoogika rakendamisest Tallinna Ümera Põhikoolis ja Venemaal Peterburi koolides. Eestis on loodud Humanistliku Pedagoogika Selts, humanistliku pedagoogika asjatundja Venemaal on pedagoogikadoktor professor Šalva Amonašvili

  3. Kes volitas? / Enn Vatter

    Index Scriptorium Estoniae

    Vatter, Enn

    2009-01-01

    Autor tõstatab küsimuse, kes volitas 20% töötajaskonnast hõlmava Tööandjate keskliidu ja 5-7% kaasava Ametiühingute keskliidu töölepinguseaduse küsimustes neisse institutsioonidesse mittekuuluva töötajaskonna, st. ligi 80% Eestis tööga hõivatuid esindama, tingimusi seadma, kokkuleppeid sõnastama ja sõlmima

  4. Rakendav rahulolematus / Enn Soosaar

    Index Scriptorium Estoniae

    Soosaar, Enn, 1937-2010

    2007-01-01

    Autor arutleb parteide valijate üle Riigikogu valimistel ja leiab, et Riigikogu koosseis oleneb suurel määral sellest, kuivõrd suudavad erakonnad võita Res Publicas pettunud ja muidu rahulolematute valijate poolehoidu

  5. Pahaendeline pragmatism / Enn Soosaar

    Index Scriptorium Estoniae

    Soosaar, Enn, 1937-2010

    2008-01-01

    Vana Maailma kõlbeline kollaps oli see, mis lasi Euroopas tekkida ja võimust võtta XX sajandi totalitaarsetel režiimidel. Ohtu peame tajuma siis, kui huvide taha peidetakse riigi imperialistlikud ambitsioonid või merkantiilne saamahimu. Ilmunud ka Lääne Elu 18. okt. lk. 2

  6. Põud : [luuletused] / Enn Tuuling

    Index Scriptorium Estoniae

    Tuuling, Enn

    2002-01-01

    Sisu: Põud ; Aian ; Inne pikset ; Süküsõdang tarõn ; Üü tulek ; Rebäse külä vana sann ; Vana maja ; "Kes oll̀ tuu miis, kes sinno ehit ..." ; Pööningul ; Talv 1960/61. Eluloolisi andmeid autori kohta lk. 358-359

  7. Ilushow enne teatrit

    Index Scriptorium Estoniae

    2009-01-01

    29. mail juhatab Rakvere Teater pangamajas toimuva moe- ja ilushowga sisse oma esimese suvelavastuse - Jean Genet' "Toatüdrukud", lavastaja Hendrik Toompere, kunstnik Ervin Õunapuu. Esietendus 5. juunil pangamajas

  8. ENSEIGNER LES DISPARITÉS SOCIO-SPATIALES AVEC HYPERATLAS: LE CAS DE L’UNION EUROPÉENNE

    Directory of Open Access Journals (Sweden)

    María Pigaki

    2014-12-01

    -spatiales qui existent au niveau régional dans l’Union européenne. HyperAtlas est non seulement un outil pour développer la pensée spatiale par l’analyse spatiale. Ce est aussi une ressource éducative à travers laquelle les élèves apprennent à exercer la citoyenneté, à comprendre les problèmes sociaux de caractère territorial et à proposer des solutions. Le texte décrit les objectifs, la méthodologie et les conditions d’expérimentation de HyperAtlas dans la classe de géographie à deux lycées différentes, l’un en Grèce, l’autre en France. Les similitudes et les différences entre ces deux expérimentations, mais les conclusions sur l’utilisation de HyperAtlas montrent comment HyperAtlas est un outil pour la recherche de l’espace à l’école. Mots-clés: HyperAtlas, analyse spatiale, disparités territoriales, éducation pour la citoyenneté.   

  9. High field magnetoresistance and de Haas-van Alphen effect in antiferromagnetic PrB6 and NdB6

    International Nuclear Information System (INIS)

    Onuki, Y.; Umezawa, A.; Kwok, W.K.; Crabtree, G.W.; Nishihara, M.; Yamazaki, T.; Omi, T.; Komatsubara, T.

    1987-08-01

    The transport properties and the de Haas-van Alphen (dHvA) effect have been measured for antiferromagnetic PrB 6 and NdB 6 . The number of conduction electrons is approximately one per unit cell. The magnetoresistance shows the existence of open orbits implying a multiply connected Fermi surface. The angular dependence of the magnetoresistance is roughly similar to that of the reference material, LaB 6 . The dHvA data in PrB 6 shows both paramagnetic and antiferromagnetic Fermi surfaces. The antiferromagnetic Fermi surface arises from new magnetic Brillouin zone boundaries and antiferromagnetic gaps introduced by the magnetic order, and the paramagnetic Fermi surface from magnetic breakdown through the small antiferromagnetic gaps in high field. Hybridization between the conduction electrons and the f electrons has been observed through the cyclotron masses, which in PrB 6 are three times larger than the corresponding masses of LaB 6 . In NdB 6 only the antiferromagnetic Fermi surface, quite different from those of LaB 6 and PrB 6 , has been observed. 26 refs., 10 figs., 3 tabs

  10. Split Fermi Surfaces of the Spin-Orbit-Coupled Metal Cd2Re2O7 Probed by de Haas-van Alphen Effect

    Science.gov (United States)

    Matsubayashi, Yasuhito; Sugii, Kaori; Hirose, Hishiro T.; Hirai, Daigorou; Sugiura, Shiori; Terashima, Taichi; Uji, Shinya; Hiroi, Zenji

    2018-05-01

    The superconducting pyrochlore oxide Cd2Re2O7 shows a structural transition with inversion symmetry breaking (ISB) at Ts1 = 200 K. A recent theory [https://doi.org/10.1103/PhysRevLett.115.026401" xlink:type="simple">L. Fu, Phys. Rev. Lett. 115, 026401 (2015)] suggests that the origin is an electronic instability that leads to a multipolar order in the spin-orbit-coupled metal. To observe the Fermi surface of the low-temperature phase of Cd2Re2O7, we perform de Haas-van Alphen effect measurements by means of magnetic torque. In reference to a calculated band structure, the spin-split Fermi surfaces with large cyclotron masses of 5-9m0 are revealed. The splitting is suggested to be due to an antisymmetric spin-orbit coupling induced by ISB, the strength of which is estimated to be approximately 67 K, which is rather smaller than those of typical non-centrosymmetric metals.

  11. Transport properties of Cu-doped bismuth selenide single crystals at high magnetic fields up to 60 Tesla: Shubnikov-de Haas oscillations and π-Berry phase

    Science.gov (United States)

    Romanova, Taisiia A.; Knyazev, Dmitry A.; Wang, Zhaosheng; Sadakov, Andrey V.; Prudkoglyad, Valery A.

    2018-05-01

    We report Shubnikov-de Haas (SdH) and Hall oscillations in Cu-doped high quality bismuth selenide single crystals. To increase the accuracy of Berry phase determination by means of the of the SdH oscillations phase analysis we present a study of n-type samples with bulk carrier density n ∼1019 -1020cm-3 at high magnetic field up to 60 Tesla. In particular, Landau level fan diagram starting from the value of the Landau index N = 4 was plotted. Thus, from our data we found π-Berry phase that directly indicates the Dirac nature of the carriers in three-dimensional topological insulator (3D TI) based on Cu-doped bismuth selenide. We argued that in our samples the magnetotransport is determined by a general group of carriers that exhibit quasi-two-dimensional (2D) behaviour and are characterized by topological π-Berry phase. Along with the main contribution to the conductivity the presence of a small group of bulk carriers was registered. For 3D-pocket Berry phase was identified as zero, which is a characteristic of trivial metallic states.

  12. Effective mass of two-dimensional electrons in InGaAsN/GaAsSb type II quantum well by Shubnikov-de Haas oscillations

    Energy Technology Data Exchange (ETDEWEB)

    Kawamata, Shuichi, E-mail: s-kawamata@riast.osakafu-u.ac.jp; Kawamura, Yuichi [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan); Research Organization for University-Community Collaborations, Osaka Prefecture University, Sakai 599-8570 (Japan); Hibino, Akira; Tanaka, Sho [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan)

    2016-10-14

    In order to develop optical devices for 2–3 μm wavelength regions, the InP-based InGaAs/GaAsSb type II multiple quantum well system has been investigated. By doping nitrogen into InGaAs layers, the system becomes effective in creating the optical devices with a longer wavelength. In this report, electrical transport properties are reported on the InGaAsN/GaAsSb type II system. The epitaxial layers with the single hetero or multiple quantum well structure on InP substrates are grown by the molecular beam epitaxy. The electrical resistance of samples with different nitrogen concentrations has been measured as a function of the magnetic field up to 9 Tesla at several temperatures between 2 and 6 K. The oscillation of the resistance due to the Shubnikov-de Haas (SdH) effect has been observed at each temperature. The effective mass is obtained from the temperature dependence of the amplitude of the SdH oscillations. The value of the effective mass increases from 0.048 for N = 0.0% to 0.062 for N = 1.2 and 1.5% as the nitrogen concentration increases. The mass enhancement occurs with corresponding to the reduction of the bandgap energy. These results are consistent with the band anticrossing model.

  13. Une progression sans révolution dans l’appréhension européenne des persécutions religieuses

    Directory of Open Access Journals (Sweden)

    Nicolas Hervieu

    2013-06-01

    SOMMAIRE: 1. Introduction - 2. Une issue retentissante: la concrétisation d’une protection conventionnelle contre les persécutions religieuses - 3. Un raisonnement parcellaire: les apories de l’analyse européenne à l’aune de la liberté de religion - 4. Conclusion - 5. Jurisprudence liée - 6. Appendice.  ABSTRACT: By banning deporting of a coptic christian by France to Egypt, where he might suffer persecution, European court of human rights has made an important contribution to the protection of foreigners against measures involving expulsion. The European solution is important because it deals with a complex, but crucial, concept: religious persecution. Unfortunatly, the opportunity offered by this case hase not been fully exploited. Freedom of religion was at the heart of this case, but European court did’nt use it enough.

  14. Lean i Norge : opplever norske bedrifter som er mer lean, større økning i kundetilfredshet enn de som er mindre lean?

    OpenAIRE

    Fagereng, Hanne Eline; Askevold, Elisabeth Cathrine

    2010-01-01

    Vi ønsker å måle i hvor stor grad norske bedrifter har implementert lean, og for å måle grad av lean har vi utviklet et rammeverk basert på lean teori. Hovedformålet med lean er å øke kundeverdi med minst mulig ressursbruk, anstrengelse, energi, utstyr, tid, plass, material og kapital (Womack, Roos and Jones 2007). Vi vil utforske om høyere grad av lean fører til mer tilfredse kunder enn de som har lavere grad av lean. Altså om hovedformålet med lean blir oppnådd hvis man implementerer lean i...

  15. Après le Brexit, un diagnostic lucide sur l'avenir de l'Union européenne

    OpenAIRE

    Kahn, Sylvain

    2016-01-01

    Faut-il être traumatisé par le Brexit? Le cas des Britanniques est très particulier. Ils sont entrés à reculons dans l'Union européenne en 1973, et ils ont tout de suite commencé par demander des clauses d'exemption. L'UE et les Britanniques, concrètement qu'est-ce que c'est? C'est un pays qui, depuis 43 ans, ne cesse de s'opposer autant que possible à toute avancée fédérale, à davantage d'intégration, et promeut une Europe à la carte. C'est d'ailleurs le seul pays avec le Danemark qui avait ...

  16. Avaliação comparativa dos efeitos maxilares da expansão rápida da maxila com os aparelhos de Haas e Hyrax Comparative evaluation of maxilar effects of rapid maxilar expansion with Haas and Hyrax appliances

    Directory of Open Access Journals (Sweden)

    Marco Antônio Scanavini

    2006-02-01

    Full Text Available OBJETIVO: avaliar cefalometricamente os efeitos da expansão rápida da sutura palatina mediana sobre o posicionamento vertical e sagital da maxila, comparando os aparelhos de Haas e Hyrax. METODOLOGIA: a amostra consistiu de 93 telerradiografias obtidas de 31 pacientes jovens, brasileiros, de ambos os gêneros, na faixa etária inicial média de 13 anos e 2 meses. As radiografias foram tomadas ao início do tratamento (pré-disjunção, imediatamente após a disjunção (pós-disjunção e ao final do nivelamento. RESULTADOS E CONCLUSÕES: constatou-se que os dois aparelhos disjuntores apresentaram resultados semelhantes, com a ocorrência de deslocamento da maxila em direção inferior, sem rotação, que se manteve ao final do nivelamento e ocorrência de um deslocamento anterior logo após a disjunção, que retornou aos valores pré-disjunção ao final do nivelamento.AIM: the purpose of this cephalometric study was to evaluate, by lateral cephalograms, the changes in maxilar positioning after rapid disjunction of the midpalatal suture, following the use of two types of maxillary disjunction appliances, checked in different phases, and the likely differences between the two appliances Haas and Hyrax. METHODS: the sample comprised of 93 lateral cephalograms, taken before treatment (pre-disjunction, immediately after disjunction and at the end of levelling, obtained from 31 brazilian youths with both genres and average age of 13 years and 2 months. RESULTS AND CONCLUSIONS: both types of appliances showed similar results, with anterior and lower displacement of maxila right after disjunction. Lower displacement was without rotation, and mainttened stable until the end of levelling. Anterior displacement, however, was not stable and cephalometric measurements like SNA and Nperp-A tended to returned to initial values at the end of levelling.

  17. Un inventaire phytosociologique des dunes à la côte méditerranéenne française entre carnon et le grau du roi (département de l’hérault)

    NARCIS (Netherlands)

    Hekking, W.H.A.

    1959-01-01

    Dans la région des dunes et des bas-fonds située à une distance de 3.6 à 5.3 kilomètres de Carnon au Grau du Roi, entre l’Etang de Mauguio et la Mer méditerranéenne et dans le département de l’Hérault on peut constater deux suites progressives des associations phytosociologiques : A) LA VÉGÉ TATION

  18. Meie esimesed naisfotograafid / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika, 1974-

    2016-01-01

    Tallinna fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kuraatorid Betty Ester-Väljaots, Merili Reinpalu, kunstnik Lilian Juhkam. Eesti naisfotograafide Anna Kuke ja Evi Lembergi eluloolisi andmeid, nende looming

  19. Meie esimesed naisfotograafid / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika, 1974-

    2015-01-01

    Eesti naisfotograafid Hilja Riet ja Lydia Tarem. Fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kus tutvustatakse Hilja Rieti, Lydia Taremi, Anna Kuke ja Evi Lembergi loomingut. Näituse kuraatorid Betty Ester-Väljaots, Merili Reinpalu

  20. Transport properties and giant Shubnikov-de Haas oscillations in the first organic conductor with metal complex anion containing selenocyanate ligand, (ET)2TlHg(SeCN)4

    International Nuclear Information System (INIS)

    Laukhin, V.N.; Audouard, A.; Rakoto, H.; Broto, J.M.; Goze, F.; Coffe, G.; Brossard, L.; Redoules, J.P.; Kartsovnik, M.V.; Kushch, N.D.; Buravov, L.I.; Khomenko, A.G.; Yagubskii, E.B.; Askenazy, S.; Pari, P.

    1995-01-01

    Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal α-(ET) 2 TlHg(SeCN) 4 have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F 0 =653±3 T and slow frequency oscillations with F s =38±5 T have been revealed. (orig.)

  1. Transport properties and giant Shubnikov-de Haas oscillations in the first organic conductor with metal complex anion containing selenocyanate ligand, (ET){sub 2}TlHg(SeCN){sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Laukhin, V.N. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France)]|[Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Audouard, A. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Rakoto, H. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Broto, J.M. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Goze, F. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Coffe, G. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Brossard, L. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Redoules, J.P. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Kartsovnik, M.V. [Institute of Solid State Physics, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Kushch, N.D. [Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Buravov, L.I.

    1995-05-01

    Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal {alpha}-(ET){sub 2}TlHg(SeCN){sub 4} have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F{sub 0}=653{+-}3 T and slow frequency oscillations with F{sub s}=38{+-}5 T have been revealed. (orig.).

  2. Different effects of the two types of spatial pre-cueing: what precisely is "attention" in Di Lollo's and Enns' substitution masking theory?

    Science.gov (United States)

    Luiga, I; Bachmann, T

    2007-11-01

    Enns and Di Lollo [Psychological Science, 8 (2), 135-139, 1997] have introduced the object substitution theory of visual masking. Object substitution masking occurs when focusing attention on the target is delayed. However, Posner (Quarterly Journal of Experimental Psychology, 32, 3-25, 1980) has already shown that attention can be directed to a target at least in two ways: intentionally (endogenously) and automatically (exogenously). We conducted two experiments to explore the effects of endogenous and exogenous cues on substitution masking. The results showed that when attention was shifted to the target location automatically (using a local peripheral pre-cue), masking was attenuated. A decrease in target identification dependent on a delay of mask offset, typical to substitution masking, was not observed. However, strong substitution masking occurred when the target location was not pre-cued or when attention was directed to the target location intentionally (using a symbolic pre-cue displayed centrally). The hypothesis of two different mechanisms of attentional control in substitution masking was confirmed.

  3. Physical activity patterns in the French 18-74-year-old population: French Nutrition and Health Survey (Etude Nationale Nutrition Santé, ENNS) 2006-2007.

    Science.gov (United States)

    Salanave, Benoit; Vernay, Michel; Szego, Emmanuelle; Malon, Aurélie; Deschamps, Valérie; Hercberg, Serge; Castetbon, Katia

    2012-11-01

    To describe detailed physical activity and sedentary behaviour in French adults across physical activity categories. The French Nutrition and Health Survey (Etude Nationale Nutrition Santé, ENNS), conducted in 2006-2007, was a national cross-sectional survey based on three-stage random sampling. The International Physical Activity Questionnaire (IPAQ) was used to classify participants into three physical activity categories. Time spent in a sitting position and time spent in front of a screen were used as markers of sedentary behaviour. France. Adults (n 2971) aged 18 to 74 years were included. Overall, 29·5 % of men and 23·6 % of women were classified into the high-IPAQ category, while 36·1 % of men and 37·5 % of women were in the low-IPAQ category. For each intensity level of physical activity (vigorous intensity, moderate intensity or walking), the number of active days per week decreased from the high- to the low-IPAQ category and daily duration of physical activity was longer in the high-IPAQ category than in the other two categories; 6 % of adults declared neither vigorous nor moderate nor walking activities. For most adults in the low-IPAQ category, an increasing number of active days per week would be sufficient to attain the moderate-IPAQ category. This should be taken into account in public health initiatives aimed at promoting physical activity.

  4. The European City in the Age of Globalisation La ville européenne à l'ère de la globalisation

    Directory of Open Access Journals (Sweden)

    Robert Musil

    2012-12-01

    Full Text Available This conceptual paper identifies a gap between two meaningful fields of research in urban geography : the first, old-established and reinforced by the European integration process, asks for recent and future trends, primarily on intra-urban development of cities on the European scale. The second focuses on inter-urban relations on a global scale, inspired by global city theories established since early 1990s. As a consequence of this research gap, a research agenda has been formulated with the aim to deliver the missing links between these two fields. Therein, three methodological improvements are put forward : first, more research has to be done to prove the widely accepted thesis of an existing link between global integration and internal urban structure. Second, the role of specific national politics for the production of a global city has to be examined – such as the type of welfare-regime or the impact of historical political structures. Finally, global city research should seriously consider the territorial arrangements that impinge upon the development of global cities on a national and a European scale.Cet article conceptuel identifie un écart entre deux grands domaines de recherche en géographie urbaine : le premier, établi de longue date et renforcé par le processus d'intégration européen, se concentre principalement sur les tendances récentes ou à venir en matière de développement intra-urbain à l'échelle européenne. Le second pose la question des relations inter-urbaines à l'échelle globale, née des théories sur la Ville Globale échafaudées depuis le début des années 1990. Au vu de cette lacune, un programme de recherche a été mis en place afin de fournir les chaînons manquants entre ces deux domaines. A cet égard, trois améliorations méthodologiques sont proposées : la première est la nécessité d'accroître le volume des recherches pour prouver la thèse largement admise d'un lien entre int

  5. L’indice biologique global normalisé (IBGN) : principes et évolution dans le cadre de la directive cadre européenne sur l’eau

    OpenAIRE

    Virginie Archaimbault et Bernard Dumont

    2010-01-01

    Les macro-invertébrés sont un des groupes d’organismes les plus utilisés mondialement dans de nombreuses méthodes de bio-indication en cours d’eau. Nous vous proposons à travers cet article de décrire la méthode française d’évaluation de la qualité du milieu basé sur ce groupe d’organisme (l’IBGN: indice biologique global normalisé) et son évolution dans le contexte de la directive cadre européenne sur l’eau.

  6. "Möödapääsmatust hädast sunnituna otsustanud ja nõustunud meid Poola Kuninglikule Majesteedile truualamlikuks teha" : Liivimaaseisuste alistumine Poola võimule 1561. aasta sügisel / Enn Tarvel

    Index Scriptorium Estoniae

    Tarvel, Enn, 1932-

    2011-01-01

    Poola-Leedu huvist ja tegevusest Liivimaa suhtes enne 1561. aastat, mil Rootsi aktiivne sekkumine Põhja-Eestis muutis otsustavamaks ka Poola-Leedu sekkumise Liivimaal. 1561. aasta sügisel pidas ordumeister Kettler poolakatega salaläbirääkimisi ja otsustas alistuda. 28. novembril 1561 andsid ordumeister, Riia peapiiskop, orduaadli ning Võnnu ja Volmari linna esindajad truudusvande Sigismund II Augustile. Tegelik Poola aeg algas Eestis 1582 ja kestis 1625. aastani. Dokument: Poola kuninga Sigismund Augusti ja ordumeister Gotthardi vahel sõlmitud alistumisleping. Vilniuses 28. novembril 1561("Pacta subjectionis")

  7. Cyclotron resonance and De Haas-Van Alphen effect in (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic conductor

    CERN Document Server

    Voskobojnikov, I B; Samarin, N A; Cluchanko, N E; Lyubovskaya, R N; Moshchalkov, V V

    2002-01-01

    Within 0.33-1.44 K temperature range at B <= 50 T magnetic field values one measured the De Haas-Van Alphen effect for (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic quasi-two-dimensional conductor. Analysis of quantum oscillations with regard to data on cyclotron resonance derived for 40-120 GHz frequency interval enabled to determine that a complex spectrum of quantum oscillations was formed by alpha approx 256 T and beta approx 670-610 T fundamental frequencies as well as, by combination and multiple frequencies. It is shown that nature of temperature rearrangement of oscillation spectrum may be interpreted in terms of model taking account of occurrence of magnetic phase transition at T sub c approx 0.9 K and proximity of a fundamental frequency with m* = 1.48m sub 0 efficient mass to the spin dumping condition

  8. L’Union européenne: un champion en trompe l’œil de l’aide publique au développement

    Directory of Open Access Journals (Sweden)

    Yann Richard

    2008-06-01

    Full Text Available L’Union européenne est le premier bailleur de fonds de l’aide publique au développement dans le monde. Elle y consacre des sommes plus importantes que les États-Unis et le Japon et elle domine dans l’aide au développement perçue par la quasi-totalité des pays bénéficiaires (pays en développement et pays en transition. Elle est le premier donateur aussi bien pour l’importance de sommes dépensées que pour l’effort consenti (l’aide rapportée au revenu national brut ou bien au nombre des habitants des pays donateurs. Mais ce statut de premier donateur est en partie illusoire. Cette domination vient de l’addition artificielle de l’aide versée par la Commission européenne et de l’aide versée par les pays membres de l’UE 15. Or, l’analyse des statistiques de l’aide au développement montre que ces deux types de donateurs ne suivent pas les mêmes logiques pour l’allocation géographique de leur aide. L’aide au développement versée par l’Union, comparativement à celle versée par le Japon et les États-Unis, semble avoir un caractère universel. Cette apparente générosité ne cache-t-elle pas une faiblesse ? On peut se demander si l’aide européenne ne souffre pas en réalité d’une trop grande dispersion. Par ailleurs, la géographie de l’aide versée par l’UE ne semble pas correspondre au discours européen qui met au sommet de l’agenda politique de l’Union le développement des relations avec ses voisins géographiques. Ce manque de cohérence transparaît dans l’évolution inverse des aides versées par la Commission (en augmentation et par les pays membres de l’UE (en baisse. L’Union s’est bel et bien engagée dans une réforme de la gouvernance de son aide au développement (déclaration de Paris, Objectifs du Millénaire pour le développement. Néanmoins, les tendances que nous soulignons dans cet article montrent que les résultats sont encore à venir. La faible lisibilit

  9. Biodiesel : la réglementation européenne et le débat sur son évolution

    Directory of Open Access Journals (Sweden)

    Dusser Philippe

    2013-09-01

    Full Text Available La réglementation communautaire sur les biocarburants a été mise en place à partir de 2003 pour répondre à un triple objectif : réduction des émissions de gaz à effet de serre, réduction de la dépendance énergétique, et soutien à la production agricole dans un contexte où 10 % des terres étaient obligatoirement gelées. Cette réglementation a été renforcée en 2009 dans le cadre du « paquet énergie » par l’introduction par la directive energie renouvelable d’un objectif obligatoire d’incorporation de 10 % d’énergie renouvelable dans les carburants à l’horizon 2020. Cette législation est complétée par une directive qualité des carburants qui impose une réduction de 6 % d’ici 2020 de l’empreinte carbone des carburants. La forte diésélisation du parc de véhicule en Europe a conduit à une rapide progression de la consommation de biodiesel (11 millions de tonnes dont 9 produites dans l’UE. L’huile de colza est la principale matière première du biodiesel. L’augmentation de la production de colza a permis de répondre à cette demande, tout en fournissant un coproduit protéique permettant de réduire significativement le déficit en protéines européen. Le débat sur l’impact du CASI (changement indirect d’affectation des sols des biocarburants, ainsi que celui sur l’équilibre alimentaire, a conduit la Commission européenne, 3 ans après avoir défini sa politique, à proposer de plafonner les carburants issus des cultures (1ere génération à 5 % et à introduire des « facteurs CASI » dans l’évaluation des effets de réduction des gaz à effets de serre. Cette proposition qui pourrait fortement remettre en cause le développement du biodiesel...et de la culture de colza fait à la date de rédaction de cet article (juillet 2013 l’objet de difficiles négociations à Bruxelles, dont l’issue est difficile à prédire.

  10. Serum levels of organochlorine pesticides in the French adult population: the French National Nutrition and Health Study (ENNS), 2006-2007.

    Science.gov (United States)

    Saoudi, Abdessattar; Fréry, Nadine; Zeghnoun, Abdelkrim; Bidondo, Marie-Laure; Deschamps, Valérie; Göen, Thomas; Garnier, Robert; Guldner, Laurence

    2014-02-15

    Although most organochlorine (OC) pesticides were banned in France in the 1970s and 1980s, they remain a source of public concern. Because of their high persistence in the environment, they are still detected in foodstuffs, leading to continued human exposure. The purpose of this study was to assess the distribution of serum organochlorine (OC) pesticides in the French adult population and to identify the main risk factors for p,p'-dichlorodiphenyl dichlorethylene (DDE), β-hexachlorocyclohexane (β-HCH) and hexachlorobenzene (HCB). The selected OC pesticides (HCB, DDE, DDT, α-HCH, β-HCB and γ-HCH) were measured in serum samples collected in 2006-2007 from 386 persons (aged 18-74 years) randomly selected among the participants in the clinical and biological component of the French Nutrition and Health Survey (Etude Nationale Nutrition Santé [ENNS]), a cross-sectional survey carried out in the general population. Collected data included biological samples, socio-demographic characteristics, and data about environmental and occupational exposure factors. Of the six OC pesticides investigated, the highest concentrations were observed for HCB, β-HCH and DDE. Median serum concentrations were as follows: 22.8 ng/g lipid for HCB, 0.74 and 27.0 ng/g lipid, respectively, for α- and ß-HCH, and 3.8 and 104.6 ng/g lipid, respectively, for DDT and DDE. Lindane (γ-HCH) was detected in approximately 10% of the sample. OC pesticide levels in serum in French adults were higher (except for DDT and DDE) than those observed in American, Canadian and German populations and generally lower than or in the same range as those observed in other European countries. The low serum DDT/DDE ratio in the present study (3.7%) would suggest that the concentrations observed for these two OC pesticides were mainly the result of past exposure. The most important predictors of serum DDE, HCB and β-HCH concentrations among the French adult population included individual factors (age, gender

  11. Leishmaniose canine dans le Rif (côte méditerranéenne marocaine : enquête séro-épidémiologique

    Directory of Open Access Journals (Sweden)

    Rami M.

    2003-03-01

    Full Text Available Dans le but d'évaluer la situation de la leishmaniose canine dans le foyer situé dans le versant Nord-Est de la chaîne montagneuse du Rif, une enquête séro-épidémiologique a été menée dans différentes localités de la province de Nador (côte méditerranéenne marocaine. Des échantillons de sérum collectés sur 257 chiens ont été analysés par les techniques d'immunofluorescence indirecte (IFI et d'enzyme-linked immunosorbent assay (ELISA pour détecter les anticorps anti-Leishmania infantum. Les résultats montrent que 48 (18,7 % des chiens examinés sont positifs en IFI et 54 (21,0 % le sont en ELISA ; la concordance des deux méthodes étant de 96,1 %. D'autre part, le taux d'infection est significativemenl plus élevé chez les chiens âgés de plus de quatre ans et ne dépend pas du sexe de l'animal. Les symptômes les plus fréquemment relevés sur les chiens séropositifs sont la polyadénite (57,4 %, l'amyotrophie (51,9 % et les lésions cutanéo-muqueuses ( 25,9 %. Cependant, 38,9 % de ces mêmes chiens ne présentent pas de symptômes pouvant évoquer la leishmaniose. Des Leishmania isolées sur trois des chiens examinés ont toutes été identifiées comme étant L. infantum MON-1. Ces résultats montrent que le versant Nord-Est des montagnes du Rif est l'un des foyers les plus actifs de leishmaniose viscérale dans le pourtour méditerranéen et confirment le rôle que joue le chien comme principal réservoir de L. infantum.

  12. Allocution prononcée par M. François de Rose, Président du Conseil de l'organisation européenne pour la recherche nucléaire à l'occasion de l'inauguration du synchrotron à protons du CERN le 5 février 1960

    CERN Multimedia

    CERN Press Office. Geneva

    1960-01-01

    Allocution prononcée par M. François de Rose, Président du Conseil de l'organisation européenne pour la recherche nucléaire à l'occasion de l'inauguration du synchrotron à protons du CERN le 5 février 1960

  13. Aleksei Nõu eluloost / Enn Nõu

    Index Scriptorium Estoniae

    Nõu, Enn, 1933-

    2006-01-01

    Sisaldab ka kahte luuletust: A. Nõu, A. Anton, K. Rakmann,¡ H. Rothberg. Tervitus Eestimaale Siberist. (Ilmunud: Siberi Asunik (Tomsk), 1919, nr. 32) ;¡ A. Nõu. Vaikne sadam. Kirjutatud Omskis, 1919

  14. 60 aastat tagasi / Enn Sarv

    Index Scriptorium Estoniae

    Sarv, Enn, 1921-2008

    2004-01-01

    Eesti Vabariigi Rahvuskomitee tegevusest Teise maailmasõja lõpuperioodil, 1944. aasta sõjategevusest Eestis ja suurest põgenemisest Läände ning metsavendlusest. Lisad: prof. J. Uluotsa kõne 19. augustil 1944 : kokkuvõte ; Eesti Vabariigi Rahvuskomitee pöördumine : Talllinnas, 1. augustil 1944. a. ; Eesti Vabariigi Rahvuskomitee : korraldus nr.1 ; Eesti Vabariigi Rahvuskomitee : korraldus nr. 2

  15. Kõik algaski Otsal / Enn Nõu

    Index Scriptorium Estoniae

    Nõu, Enn, 1933-

    2012-01-01

    Arvustus: Aksel, Anu. Landkänning : brevväxling mellan Anu och Aksel Mark under deras första år som flyktingar från Estland 1944-1945. Stockholm : Bokverksta, 2008 ; Mark, Aksel. Allt började på Otsa : minnen från min barndom och skolåren. Stockholm : Beijer bok & skog, 2011

  16. Unistused muudavad maailma / Enn Tammearu

    Index Scriptorium Estoniae

    Tammearu, Enn

    2000-01-01

    Rocca al Mare koolimaja ehitamisest, AS KGM Ehitus meeskonnast ja juhatuse esimehest Tiit Nurklikust. Projekti autor: AB Urbel & Peil. Arhitektid Emil Urbel, Indrek Erm, sisearhitekt Taso Mähar, projektijuht Ivar Aus. Konstruktiivne osa: E-Inseneribüroo. Kooli direktori Rein Rebase, I. Ausi, I. Ermi ja T. Nurkliku kommentaarid. Nr. 11, lk. 4-6: Rocca al Mare koolile 2000. a. parima betoonehitise tiitel. Akustik Linda Madalik. Monoliitbetoonitööd: AS Roxor Ehitus. Arvamust avaldavad: T. Nurklik, I. Erm, OÜ Roxoe Ehituse tehniline juht Kalev Ramjalg, žürii esimees Aadu Kana

  17. Post enne modernismi / Mari Laaniste

    Index Scriptorium Estoniae

    Laaniste, Mari, 1977-

    2007-01-01

    Laurence Sterne'i romaani ainetel loodud komöödiafilm "Tristram Shandy - härrasmehe paljastused" ("A Cock and Bull Story") : stsenarist Frank Cottrell Boyce : režissöör Michael Winterbottom : peaosas Steve Coogan : Suurbritannia 2005. Lühiandmed ka Steve Coogani kohta

  18. Fontesel uued omanikud / Enn Salu

    Index Scriptorium Estoniae

    Salu, Enn

    2005-01-01

    Konsultatsiooni- ja personaliotsingufirma Fontese viis juhtivkonsultanti ja pearaamatupidaja ostsid Fontes PMP selle asutajalt Tõnis Arrolt, kes jääb edasi firma nõukokku. Diagramm: Fontes kasvab kiirelt

  19. Kremlisse ja Kremlis / Enn Tõugu

    Index Scriptorium Estoniae

    Tõugu, Enn, 1935-

    2016-01-01

    Tallinna Inseneride Majast. Autor jutustab oma teest Kremlisse ehk kuidas ta saadikuks sai, Andrei Sahharovist, MRP materjalide levitamisest. Nõukogude Liidu Ülemnõukogu transpordi, Side ja informaatika komisjonist. Ševardnadze kõnest 1990. aasta detsembris

  20. Fédérations multinationales et coordination multi-niveaux. Comparaison des mécanismes de participation régionale à la politique européenne en Allemagne et en Espagne

    Directory of Open Access Journals (Sweden)

    Emmanuelle Mathieu

    2008-06-01

    Full Text Available Comment expliquer le recours extensif au bilatéralisme dans les relations intergouvernementales (RIG au sein des États multinationaux ? En étudiant le fédéralisme multinational sous l’angle des jeux d’acteurs, cet article contribue à sa compréhension comme système d’action et enrichit l’étude des RIG par la mise en évidence de nouveaux facteurs structurants. Il montre que l’hétérogénéité caractérisant l’ensemble des entités fédérées favorise le développement de relations individualisées avec l’État fédéral. La démonstration repose sur une comparaison de l’adaptation des RIG espagnoles et allemandes à l’intégration européenne. Les négociations au Conseil de l’Union européenne exigent une position nationale claire et unique, indépendamment du nombre d’acteurs dont les compétences sont concernées dans l’ordre interne. Cette exigence oriente les acteurs nationaux vers un mécanisme multilatéral de participation des entités fédérées à la politique européenne. Alors que le recours au multilatéralisme n’a pas même été questionné en Allemagne, l’Espagne peine à l’intégrer à son système basé sur le bilatéralisme. Le recours au mode d’organisation territorial, notamment au fédéralisme asymétrique et dual, et au multinationalisme permet d’expliquer ces difficultés.

  1. Título do sítio electrónico: Fédération Européenne des Associations Nacionales Travaillant avec les Sans-Abri e European Observatory on Homelessness

    Directory of Open Access Journals (Sweden)

    João Aldeia

    2012-10-01

    Full Text Available Optou-se por apresentar conjuntamente as duas páginas pela sua estreita articulação temática e institucional. Criada em 1989, a FEANTSA – Fédération Européenne des Associations Nacionales Travaillant avec les Sans-Abri – é uma organização não-governamental (ONG dedicada a eliminar a pobreza e exclusão social de indivíduos sem-abrigo ou em risco de conhecer esta situação, que congrega mais de 100 ONGs locais e nacionais de vários Estados-membros da União Europeia, sendo financiada pela Comiss...

  2. Seltskond : [fotod] / tekst ja fotod Annika Haas

    Index Scriptorium Estoniae

    2008-01-01

    8. dets. esitles Helle Michelson Eesti Lastekirjanduse Keskuses mälestusteraamatut "Lehitsetud leheküljed: Meenutusi elust ja lastekirjandusest" (Tallinn : Tänapäev, 2008) Kohal viibisid lastekirjanikud Ellen Niit, Jaak Urmet jt.

  3. Seltskond : [fotod] / tekst ja fotod Annika Haas

    Index Scriptorium Estoniae

    2008-01-01

    29. mail tutvustasid autorid oma lasteraamatuid Eesti Lastekirjanduse Keskuses: Kass, Kristiina. Petra lood. [Tallinn] : Tänapäev, 2008 ; Vainola, Kätlin. Mia, Konrad ja avanevad uksed : [jutustus] / pildid joonistanud Toomas Pääsuke. [Tallinn] : Tänapäev, 2008 ; Saarna, Meelike. Mattias ja mamma. [Tallinn] : Tänapäev, 2008

  4. Migrations et fuite des cerveaux dans les économies insulaires caribéennes : éléments de réflexion Reflections on Migration and Brain Drain in the Caribbean Island Economies

    Directory of Open Access Journals (Sweden)

    Fanny-Aude Bellemare

    2012-05-01

    Full Text Available Loin d’être un phénomène nouveau, les mobilités internationales se sont fortement accrues depuis les années 1960. Aujourd’hui, le contexte de mondialisation tend à accélérer les dynamiques migratoires alors que dans le même temps s’observe une élévation des niveaux d’éducation. Ainsi, la soutenabilité de l’augmentation de la fuite des cerveaux dans le monde soulève interrogations et réflexions.Le poids des flux de migrants qualifiés allié à la fragilité relative des données, pose la nécessité d’aborder en profondeur le problème de la fuite des cerveaux. Une analyse au cas par cas s’impose. A partir de données se rapportant à la diaspora caribéenne sur la base statistique de Docquier et Marfouk, cet article propose une réflexion sur les facteurs explicatifs de la fuite des cerveaux dans les territoires insulaires caribéens.Far from being a new phenomenon, the international motilities have increased since the 60’s. Today, the context of globalization tends to accelerate the migratory dynamics while at the same time observed a rise of the educational levels. The increase of the brain drain has respite to many questions.Nevertheless, image, nature of flows of skilled migrants combined with relative data’s fragility and the necessity to approach the problem and presenting appropriate policies, impose an analysis case by case. Using data relating to the Caribbean diaspora on the statistical basis of Docquier and Marfouk, this article purpose a reflection on the factors that explain the brain drain in the Caribbean islands.

  5. Les débouchés énergétiques de l'agriculture de la Communauté Economique Européenne Energy Outlets for Agriculture in the European Economic Community

    Directory of Open Access Journals (Sweden)

    Becker J. J.

    2006-11-01

    Full Text Available L'agriculture de la Communauté Economique Européenne (CEE connaît une crise profonde au niveau de ses débouchés. Ainsi, même dans un contexte où l'indépendance énergétique n'est plus une préoccupation majeure, une production massive d'énergie par l'agriculture reste un projet à priori digne d'intérêt. Cette étude précise les modalités d'application concrètes d'une telle politique et tente une évaluation économique permettant d'apprécier la viabilité d'un tel schéma. Elle présente, en particulier, un positionnement par rapport aux solutions agricoles plus classiques actuellement mises en oeuvre et qui pourtant ne sont guère satisfaisantes. Agriculture in the EEC is in the midst of a deep crisis concerning its outlets. Even in a context where energy independence is no longer a major preoccupation, massive energy production by agriculture is still a problem worthy of interest, a priori. This article specifies concrete procedures for applying such a policy and tries to make an economic evaluation to assess the viability of such a scheme. In particular, it describes a position in relation to the most conventional agricultural solutions now being implemented and that are proving not to be very satisfactory.

  6. Tulevik Electroluxi disainivõistluselt / Enn Heinsoo

    Index Scriptorium Estoniae

    Heinsoo, Enn

    2009-01-01

    Võistluse "Design Lab" tööde näitus tuleviku kodumasinatest Arhitektuuri- ja Disainigaleriis 21. märtsini. 2007. aastal võitis konkursi ungarlase Levente Szabo ökopesumasin E-wash, 2008. aastal austerlase Stefan Buchbergeri moodulkülmik Flatshare

  7. See oli masendav otsustamatus / Enn Tarto

    Index Scriptorium Estoniae

    Tarto, Enn, 1938-

    2001-01-01

    Hinnang kommunistlikule režiimile jäi Riigikogus andmata. Autor: Rahvaerakond Mõõdukad. Parlamendisaadik. Ilmunud ka: Tartu : Postimees, 18. juuni 2001, lk. 2; Koit, 16. juuni 2001, lk. 6; Hiiumaa, 16. juuni 2001, lk. 2; Vooremaa, 19. juuni 2001, lk. 2; Nädaline, 19. juuni 2001, lk. 5; Valgamaalane, 19. juuni 2001, lk. 2

  8. Amanda Jasmiin, habras sidepidaja / Enn Lillemets

    Index Scriptorium Estoniae

    Lillemets, Enn

    2002-01-01

    Rootsis elava, 30. märtsil 100-aastaseks saanud Amanda Jasmiini elust, õpingutest, skulptuuriloomingust, arvustustest. Lõpetas 1937. a. Pallase skulptorina, on töötanud joonistusõpetaja, moekunstniku ja illustraatorina, kavandanud teatrikostüüme, 1997. aastast kunstiühingu Pallas auliige

  9. Seitsme venna koolitee / Enn Anupõld

    Index Scriptorium Estoniae

    Anupõld, Enn, 1937-

    2008-01-01

    Soome lähiajaloost ja kaasajast, samuti poliitikast. Järgneb: 16. juuli, lk. 7 (sisaldab vestlust Soome poliitiku Max Jakobsoniga) ; 23. juuli, lk. 5 (sisaldab vestlust Soome kauaaegse poliitiku ja ühiskonnategelase Pekka Silvolaga) ; 6. aug., lk. 7 ; 13. aug., lk. 7 ; 20. aug., lk. 7 ; 3. sept., lk. 7 ; 10. sept. ; 17. sept. ; 24. sept. ; 1. okt. ; 8. okt. ; 15. okt. ; 22. okt. ; 29. okt.

  10. Ennäe homo / Feliks Krapp

    Index Scriptorium Estoniae

    Krapp, Feliks

    1999-01-01

    Elisabeth Ohlsoni fotonäitus "Ecce homo" Pärnu Uue Kunsti Muuseumis 14. VII-22. VIII. E. Ohlsoni sõnum: Kristus armastab kõiki ning on olemas ka seksuaalvähemuste jaoks, vaid ühiskond pole seda alati.

  11. Võidusammas tehakse korda enne valimisi / Raimo Poom

    Index Scriptorium Estoniae

    Poom, Raimo

    2010-01-01

    Kaitseministeerium allkirjastas Vabadussõja võidusamba uue valgustuse rajamiseks lepingu ettevõttega KH Energia-Konsult. Valgustus- ja ventilatsioonisüsteem peaks valmima jaanuaris 2011. Tööde järele valvavad Tehnokontrollikeskus OÜ ja Tallinna Tehnikaülikooli spetsialistid. Garantiitööd peab tegema Tšehhi firma Sans Souci

  12. Mõttesügav ajalooteos / Enn Tarvel

    Index Scriptorium Estoniae

    Tarvel, Enn, 1932-

    2012-01-01

    Arvustus: Crusading and chronicle writing on the medieval Baltic frontier : a companion to the Chronicle of Henry of Livonia / edited by Marek Tamm, Linda Kaljundi, Carsten Selch Jensen. Farnham ; Burlington : Ashgate, 2011

  13. Ajaloo suurim baaslaager Haitil / Enn Eberg

    Index Scriptorium Estoniae

    Eberg, Enn

    2010-01-01

    2010. a. jaanuaris Haitil toimunud maavärina tagajärgede likvideerimisel käisid Eesti Päästemeeskonna liikmed püstitamas ajaloo suurimat baaslaagrit, mis on mõeldud ÜRO organisatsioonide töötajatele. Lisa: Eesti Päästemeskonna liikmed Haiti katastroofipiirkonnas (nimestik)

  14. Kas ikka elame XXI sajandil? / Enn Uusen

    Index Scriptorium Estoniae

    Uusen, Enn, 1941-

    2009-01-01

    Aegunud ideoloogiate eksporti arenenud riikidesse peab kõigi diplomaatiliste vahenditega piirama, autori sõnul puudutab Eestit eelkõige Venemaa toetumine XIX sajandi vallutajamaade imperiaalsele ideoloogiale

  15. BLRT : laevaehituses on pidu / Enn Tosso

    Index Scriptorium Estoniae

    Tosso, Enn, 1976-

    2008-01-01

    Ilmunud ka: Delovõje Vedomosti 13. aug. lk. 5. BLRT Grupi esimese poolaasta käive oli 2,9 miljardit krooni, mis on 38,4% enam kui mullu samal perioodil. Ettevõtte kommunikatsioonidirektori Anu Halliku kinnitusel on laevaremondi ja -ehituse maailmaturul praegu väga soodne seis. Lisa: Tulemused

  16. Meie oma Aarete saar : [arvustus] / Enn Nõu

    Index Scriptorium Estoniae

    Nõu, Enn, 1933-

    2012-01-01

    Arvustus: Mats Burström. Minnesgömmor: berättelser om föremål gömda i jorden i Estland under andra världskriget. Lund: Nordic Academic Press, 2012 ; Burström, Mats. Treasured Memories: Tales of Buried Belonings in Wartime Estonia. Lund: Nordic Academic Press, 2012

  17. Taba trende enne teisi / Harli Uljas

    Index Scriptorium Estoniae

    Uljas, Harli

    2005-01-01

    Autor tutvustab maailmakuulsa innovatsiooniteoreetiku Clayton M. Christenseni innovatsiooniteooriat ning selle kasutamist võimalike turumuutuste ennustamisel. Kommenteerib konsultatsioonifirma Ajutrust konsultant Tiit Jürimäe. Vt. samas: Kopp ees; Zara tabab trende klubidest; Kui suureks peab kasvama lennujaam?; Kuidas jaotab kliente maailmakuulus trendipüüdja Anne-Lise Kjaer

  18. Hygiène des denrées alimentaires d'origine animale - Synthèse I : Développement actuel du concept de l'hygiène en agro-alimentaire et des exigences des normes européennes.

    OpenAIRE

    Vindevogel, Henri; Daube, Georges; Korsak Koulagenko, Nicolas; Hans, J. C.; Denys, J.; Ghafir, Y.

    1996-01-01

    Cette synthèse fait partie d’une série de trois articles qui présentent une mise au point des concepts et normes actuels au niveau européen en industrie agro-alimentaire : - Synthèse I : « Développement actuel du concept de l’hygiène en agro-alimentaire et des exigences des normes européennes » ; - Synthèse II : « Vers une assurance qualité intégrée de la chaîne agro-alimentaire » ; - Synthèse III : « Le vétérinaire et la qualité microbiologique des denrées alimentaires d’origine ani...

  19. L'idéal de l'immigration européenne dans la Colombie du XIXe siècle: du rêve civilisateur à la peur de la subversion

    Directory of Open Access Journals (Sweden)

    1996-01-01

    Full Text Available Parmi les multiples outils de “civilisation” à la portée des dirigeants latino-américains du siècle dernier, l’immigration européenne s’imposa évidemment comme un des plus attirants, de par son caractère concret : au lieu d’importer des normes, il s’agissait d’importer des hommes “civilisés”, en chair et en os. Dans la course à l’immigration, qui caractérise la culture politique du XIXe siècle latino-américain, la Colombie se distingue par son incapacité à réaliser ce rêve. Malgré les échecs répétés des tentatives officielles, les groupes dirigeants débattent, tout au long du siècle des bienfaits et des dangers de l’immigration les plans d’immigration mis en oeuvre par les différentes tendances politiques qui se succèdent au pouvoir cristallisent leurs projets idéologiques. Les projets immigrationnistes, tout autant qu’ils révèlent les fluctuations de la perception de l’Europe, reflètent à merveille les différentes versions de l’idéal “civilisateur” des élites colombiennes. Mais l’absence de dynamique interne, l’inexistence d’un réel besoin de main-d’oeuvre, la fragilité des circuits étatiques, qui s’ajoutent aux obstacles évidents du pays - faible niveau d’activité économique, insuffisante intégration au marché international, difficulté de lutter contre la concurrence de pays plus prometteurs comme les États-Unis ou l’Argentine - achèveront d’enterrer l’idéal d’une immigration “civilisatrice”. EL IDEAL DE LA INMIGRACIÓN EUROPEA EN EL SIGLO XIX COLOMBIANO: DEL SUEÑO CIVILIZADOR AL MIEDO A LA SUBVERSIÓN. Entre las distintas herramientas de “civilización” al alcance de los dirigentes latinoamericanos del siglo XIX, la inmigración europea apareció evidentemente como una de las más deseables, por ser la más concreta: en vez de importar normas, se importarían hombres “civilizados”, de carne y hueso. En la carrera a la inmigración europea, que caracteriza la

  20. Entre conservation et développement : les évolutions récentes de la politique européenne des pêches dans les régions ultrapériphériques de la Caraïbe Between conservation and development: recent developments in European fisheries policy in the outermost regions of the Caribbean

    Directory of Open Access Journals (Sweden)

    Pierre Angelelli

    2012-05-01

    Full Text Available L’Union Européenne opère actuellement la seconde révision de sa politique de la pêche depuis la création de celle-ci, en 1970. Instituée pour développer la pêche maritime et garantir un revenu aux pêcheurs, la politique commune de la pêche (PCP s’est orientée progressivement vers la protection des espèces et de l’environnement marin. Pour cela, elle a sacrifié une part importante du secteur productif, mais a échoué et, avec le déclin de la pêche en Europe, les régions ultrapériphériques de la Caraïbe (RUP-C ont gagné en importance relative dans ce domaine. Elles représentent aujourd’hui près de 30% de la flotte nationale et les fondements malthusiens de la PCP ne sont plus adaptés à leurs caractéristiques : ressources halieutiques, développement économique, emplois, sécurité des approvisionnements alimentaires, etc. La réforme actuellement en cours, qui devrait aboutir avant 2012, offre peut-être une alternative aux RUP-C permettant la mise en œuvre des mesures spécifiques en application de l’article 349 du Traité sur le Fonctionnement de l’Union Européenne.The European Union currently operates the second reform of its Common Fisheries Policy since its creation in 1970. Established to develop the fisheries and provide incomes for fishermen, the Common Fisheries Policy (CFP was directed gradually towards the protection of the species and the marine environment.To do this, it sacrificed a large part of the productive sector, but failed, and with the decline of fisheries in Europe, the outermost regions of the Caribbean gained relative importance in this field. They now account for nearly 30% of the national fleet and the Malthusians bases of the CFP are not suited any more to their characteristics: fisheries resources, economic development, jobs, security of food supply, etc. The ongoing reform, which should be in force before 2012, may offer an alternative to the outermost regions of the Caribbean

  1. L’indépendance d’une Autorité Régulatrice Nationale (ARN créée selon la législation européenne dans le secteur des communications électroniques – L’exemple Grec

    Directory of Open Access Journals (Sweden)

    Vassilios Theodoros Kondylis

    2017-07-01

    Full Text Available Cette étude se penche sur la question de l'indépendance dans le statut juridique d'une autorité de régulation nationale (ARN du secteur des communications électroniques. La première partie analyse le fondement juridique de l'indépendance et le contenu de ce concept en tenant compte de l'évolution récente de la jurisprudence de la Cour de justice de l’Union européenne (CJUE. La deuxième partie examine les mesures adoptées par le Législateur grec afin d'assurer l'indépendance de l’ARN, les compétences de cette dernière et les résultats de ces mesures au vu de la garantie de l'ouverture des marchés en cause à la libre concurrence.

  2. Aasta pressifotod žürii perspektiivist / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika, 1974-

    2015-01-01

    Konkursist "Aasta pressifoto", pressifotograafide igapäevatööst. "Aasta pressifoto 2014" peapreemia pälvis Dmitri Kotjuhi "Noored suusatajad", portreefoto kategooria võitis Renee Altrovi "Eesti Vabariigi president", uudisfoto kategooria Margus Ansu "Klassijuhataja tunnid", olemusfoto kategooria Priit Simsoni "Kaotatud sõda"

  3. [Presidendipaar Ingrid ja Arnold Rüütel] / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2007-01-01

    President Arnold Rüütel ja Ingrid Rüütel Briti suursaadiku Nigel Haywoodi lahkumispeol Tallinna Teaduste Akadeemia peasaalis. Foto allkiri: Presidendipaar Ingrid ja Arnold Rüütel kuulavad Briti suursaadiku Nigel Haywoodi kiidulaulu Eesti kiire arengu aadressil

  4. USA kiidetud noise-rock Eestis / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2008-01-01

    Müra-rock'i viljelevast USA duost Magik Markers (ansambel osaleb režissöör Veiko Õunapuu uue mängufilmi "Püha Tõnu kiusamine" võtetel ja annab kaks kontserti - 13. nov. Tallinnas klubis Tapper ja 15. nov. Tartus klubis Trehv)

  5. Recherches de la Communauté Européenne en matière d'énergie géothermique. 3e Colloque International, Munich, 29 novembre- 1er décembre 1983 Research on Geothermal Energy by the European Community. 3rd International Symposium, Munich, 29 November-1 December 1983

    Directory of Open Access Journals (Sweden)

    Bertrand A. R. V.

    2006-11-01

    Full Text Available Ce colloque, tenu sous le thème Mise à jour de la géothermie européenne, avait pour objectif principal de passer en revue les résultats du deuxième programme de R&D, qui vient de s'achever, et de faire le point sur les opérations de démonstration en cours ou terminées. On en retiendra : - les progrès de la géothermie basse enthalpie (eau de chauffage dont la faisabilité technique et les conditions de rentabïlité économique sont maintenant établies ; - les difficultés de la géothermie haute enthalpie et surtout de la géothermie en roche sèche dont les développements sont loin d'atteindre le stade de l'industrialisation ; - l'apport modeste de la géothermie commerciable qui n'atteindra en 2000 que l'équivalent de 4 % de la production pétrolière actuelle (2,5 Mtep pour la France très bien placée en géothermie basse enthalpie, soit environ 1 % de sa consommation énergétique. Le prochain programme communautaire devrait être axé sur les géothermies à haute enthalpie et à roche sèche. This symposium, on the topic of European Geothermal Update, had the main goal of reviewing the results of the second R&D program which bas just been completed, and to ascertain the state-of-the art of ongoing or completed demonstration operations. Emphasis was placed on the following three aspects: Progress in low-enthalpy geothermal energy (heating water, for which the technical feasibility and the economic profitability criteria have now been established. Difficulties in high-enthalpy geothermal energy and in particular in that from dry rocks, where developments are far from having reached the stage of industrialization. The modest contribution of marketable geothermal energy which, in the year 2000, will account for the equivalent of only 4% of current petroleum production (2. 5 MtOE for France which is in a very good position for low-enthalpy geothermal energy which provides about 1% of its energy consumption. The next EC R

  6. 1er mars 2017 - Signature du livre d'or, visite du tunnel du LHC au Point 5 et de la caverne expériementale de CMS par le Secrétaire d’Etat français aux Affaires européennes auprès du ministre des Affaires étrangères et du Développement international H. Désir.

    CERN Multimedia

    Bennett, Sophia Elizabeth

    2017-01-01

    Entourent le Secrétaire d'Etat pendant la signature du livre d'or: Le Préfet de l’Ain A. Cochet; le Directeur des accélérateurs et de la technologie F. Bordry; Ambassadeur, Représentant permanent de la France auprès de l’Office des Nations Unies à Genève et des Organisations internationales en Suisse E. Laurin; la Directrice générale du CERN F. Gianotti et la Directrice des relations internationales C. Warakaulle. Sont également présents: H. Bertrand, Maire de Saint-Genis-Pouilly; C. Bouvier, Maire de Cessy; G. Rousseau, Secrétaire Général de la sous-préfecture de Gex; Y. Mecibah, Directrice de Cabinet du Maire de Saint-Genis-Pouilly; F. Croquette, Ambassadeur pour les droits de l’homme, chargé de la dimension internationale de la Shoah, des spoliations et du devoir de mémoire; S. Bonbayl, Conseillère technique, Cabinet du Secrétaire d’Etat chargé des Affaires Européennes au MAEDI; F. Cormon-Veyssière, Sous-Directrice des droits de l’Homme et des Affaires humanitaires au MAEDI...

  7. Baltikumi aktsiaturud tõusevad enne kui reaalmajandus / Paul Lukka

    Index Scriptorium Estoniae

    Lukka, Paul

    2008-01-01

    Autori hinnangul on jahtuvas Balti majanduses märgata positiivseid tendentse ning kuna inflatsioon on jõudnud oma kõrgpunkti, võib juba oodata selle langemist. Enamike börsiettevõtete ühtlasest langemisest võivad enim võita pikaajalised investorid. Tabel: Positiivsed näited Leedu börsi ettevõtete tulemustest. Graafik: OMX Baltic Benchmark GI Indeks

  8. Kolmikpointi reklaam häirib vaimulikke / Enn Uus

    Index Scriptorium Estoniae

    Uus, Enn

    2001-01-01

    Radiolinja Kolmikpointi mobiiltelefoni sooduspaketi reklaam vannist vastu vaatava neiu ja kahe noormehega häirib kirikuringkondi vaimuliku ametiriietuse kasutamise ja perekonnaväärtuste labastamise tõttu. Kampaania autor on reklaamibüroo Zoom. Reklaamibüroo töötaja Kaur Hansoni kommentaar

  9. Valve Janov ja Margus Meinart Oslos / Enn Lillemets

    Index Scriptorium Estoniae

    Lillemets, Enn

    1999-01-01

    Tartu kunstnike Valve Janovi ja Margus Meinarti ühisnäitus 12. V-18. VI Oslo galeriis Rusticana. Eksponeeritud V. Janovi 19 õlimaali, kollaazhi ja monotüüpiat aastaist 1958-1994, M. Meinarti 24 õlimaali.

  10. Post 15 jaroj reaperis "Interlinguistica Tartuensis" / Enn Ernits

    Index Scriptorium Estoniae

    Ernits, Enn, 1945-

    2006-01-01

    Väljaande "Interlinguistica Tartuensis" 8. osast "Interlinguistica et Eurolinguistica", mis annab ülevaate 4. veebr. 2005 Tartus Paul Ariste 100. sünniaastapäevale pühendatud rahvusvahelisest konverentsist

  11. Võit tuli enne võidupüha / Ivari Padar

    Index Scriptorium Estoniae

    Padar, Ivari, 1965-

    2001-01-01

    SAPARD-i programmi käivitumine. Autor: Rahvaerakond Mõõdukad. Ilmunud ka: Järva Teataja, 22. juuni 2001, lk. 2; Põhjarannik, 21. juuni 2001, lk. 2; Severnoje Poberezhje, 21. juuni 2001, lk. 2; Võrumaa Teataja, 26. juuni 2001, lk. 2; Lääne Elu, 26. juni 2001, lk. 4; Hiiu Leht, 29. juni 2001, lk. 2; Sakala, 5. juuli 2001, lk. 5

  12. Aksel Mark: kõik algaski Otsal / Enn Nõu

    Index Scriptorium Estoniae

    Nõu, Enn, 1933-

    2012-01-01

    Arvustus: Mark Beijer, Mai. Landkänning : Brevväxling mellan Anu och Aksel Mark under deras första år som flyktingar från Estland 1944-45. Stockholm : Bokverksta´n Förlag, 2008; Allt började på Otsa : minnen från min barndom och skoláren. Stockholm : Beijer Bok & Skog, 2011

  13. Nõiajahiga FIEdele riigikassat ei täida / Enn Vatter

    Index Scriptorium Estoniae

    Vatter, Enn

    2005-01-01

    Kriitika 3. veebr. Äripäevas ilmunud Tarmo Kriisi artiklile, kus viidatakse tööandjate keskliidu ja maksuameti koostöös valminud analüüsile, millest järeldub, et osa FIE-sid tegeleb ettevõtluse asemel maksudest kõrvalehiilimisega

  14. Eesti Post haarab õlekõrrest? / Enn Vatter

    Index Scriptorium Estoniae

    Vatter, Enn

    2007-01-01

    AS Eesti Post 2006. aasta majandusaruandest ja ettevõtte majandusraskustest. Autor soovitab abi otsida riigikontrollist, kes suunaks AS Eesti Posti õigetele majandamisrööbastele. Diagrammid: Eesti Posti palgatõus

  15. Tallinna kaubandusbilanss 17. sajandil / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2015-01-01

    Mida kujutas endast portooriumitoll. Artikkel on katse uurida kaubandusbilanssi, tuginedes ainult ühele konkreetsele allikaliigile - peaaegu kogu 17. sajandi ulatuses säilinud portooriumitolliraamatutele

  16. Audit aitab piraatlust vältida / Enn Heinsoo

    Index Scriptorium Estoniae

    Heinsoo, Enn

    2007-01-01

    Ilmunud ka: Delovõje Vedomosti 6. juuni lk. 14. Tarkvaraaudit annab ülevaate piraatluse probleemidest ettevõttes. Kommenteerib Andreas Simsel. Vt. samas: Tarkvaraauditiks tasub eeltööd teha; Tarkvaraauditit pakuvad paljud firmad

  17. Eesti keele grammatika ja sõnaraamat jaapanlastele / Enn Veldi

    Index Scriptorium Estoniae

    Veldi, Enn

    1994-01-01

    Arvustus: Matsumura, Kazuto. Eesti keele grammatika jaapanlastele. Tokyo : Institute for the Study of Languages and Cultures of Asia and Africa, 1991 ; Matsumura, Kazuto. Väike eesti-jaapani õppesõnaraamat. Tokyo : Institute for the Study of Languages and Cultures of Asia and Africa, 1991

  18. Taastuvenergeetika stiimulid ja tõkked / Enn Kareda

    Index Scriptorium Estoniae

    Kareda, Enn, 1939-

    2005-01-01

    Energiaturu iseregulatsiooni eelistest käsumajandusliku administreerimise ees, Euroopa Liidu taastuvenergeetika ülevaatest FORRES 2020, Eesti taastuvenergeetika probleemidest ning Euroopa Liidu projektist CEERES uute liikmesriikide kaasamiseks taastuvenergia uurimisprogrammidesse

  19. Hetk enne plahvatust : arhitektuuri tulevik / Alberto Campo Baeza

    Index Scriptorium Estoniae

    Campo Baeza, Alberto

    1997-01-01

    Teemad: Arhitektuuri tulevik on ideedes. Valgus ja gravitatsioon : küsimuse olemus. Inimene ja tabatud ilu. Aeg ja arhitektuur. Projektiliialdused ja tehnoloogia ebaadekvaatne rakendamine. Ühiskond ja kunstnik.

  20. Viiv enne kojuminekut / Leo Kunnas ; interv. Helen Arak

    Index Scriptorium Estoniae

    Kunnas, Leo, 1967-

    2006-01-01

    Kaitsejõudude Peastaabi operatiivosakonna ülem kolonelleitnant Leo Kunnas oma perekonnast, lapsepõlvekodust Põlvamaal ja praegusest elamisest Tallinnas, missioonil viibivate sõjaväelaste probleemidest ning eluolust Iraagis. Lisa: Katkend Leo Kunnase raamatust "Viiv pikas sõjas"

  1. Rogozin : Topelttollid kaovad enne WTOd / Dmitri Rogozin ; interv. Toomas Sildam

    Index Scriptorium Estoniae

    Rogozin, Dmitri

    2002-01-01

    Venemaa Riigiduuma väliskomitee esimehe sõnul on Eestil ja Venemaal palju rohkem kokkupuutepunkte kui vastuolusid. D. Rogozin Venemaa välispoliitikast, NATO laienemisest itta, topelttollidest, õigeusu kiriku tülist

  2. Inimeste teadlikkus arendab ravimiturgu / Rauno Pukonen ; ref. Enn Tosso

    Index Scriptorium Estoniae

    Pukonen, Rauno

    2003-01-01

    Ilmunud ka: Delovõje Vedomosti 15. okt. lk. 14. Eli Lilly juhatuse esimehe Rauno Pukoneni ettekandest Äripäeva konverentsil Äriplaan 2004. Ettekandja sõnul on Eesti ravimiturg ebaatraktiivne ja ettearvamatu, kompenseeritavate ravimite valik on kesine, Eesti tarbija jääb väga paljudest ravimitest ilma. Kommenteerib AS-i Magnum Medical juhatuse liige Tarmo Laanetu. Vt. samas: Ravimiturg riigi lõa otsas. Diagramm

  3. "Lavakad" laval - kaheksa kuud enne diplomit / Andres Keil

    Index Scriptorium Estoniae

    Keil, Andres, 1974-

    2007-01-01

    Eesti Muusika ja Teatriakadeemia Lavakunstikooli 23. lennu lavastustest : kaksiklavastus "Pink" VAT Teatris, Mart Kase "Perekond" Eesti Nuku- ja Noorsooteatris ja William Shakespeare'i "Eksituste komöödia" Stephen Harperi ja Elmo Nüganeni lavastuses Hobuveskis

  4. Enne kui Rakvere teatrisse saabub vananaistesuvi / Pille-Riin Purje

    Index Scriptorium Estoniae

    Purje, Pille-Riin, 1963-

    2007-01-01

    Rakvere teatri suvest, valmistumisest suurejoonelise "Cyrano de Bergerac'i" väljatoomiseks septembris. Imaveres etendati William Shakespeare'i "MacBethi", Tallinnas Pirita kloostris avas 10. ja 11. augustil Birgitta Festivali Arthur Honeggeri-Paul Claudeli dramaatiline oratoorium "Jeanne d'Arc tuleriidal". Mõlemad lavastas Üllar Saaremäe

  5. Les circulants entre métropoles européennes à l’épreuve de leurs mobilités. Une lecture temporelle, spatiale et sociale de la pénibilité Circulating between European cities: A temporal, spatial and social reading of arduous mobility

    Directory of Open Access Journals (Sweden)

    Matthieu Giroud

    2011-09-01

    Full Text Available Cet article interroge les circulations d’individus entre Lisbonne et quatre autres métropoles européennes (Berlin, Bruxelles, Londres, Paris sous l’angle de la pénibilité. L’approche proposée articule trois dimensions, à savoir la construction des pratiques de circulation entre métropoles à l’échelle biographique, le fonctionnement familial induit par la circulation et l’expérience des lieux fréquentés au quotidien dans chacune des métropoles. La prise en compte de ces trois dimensions permet de caractériser les circulants en termes de situations de mobilité à travers lesquelles est envisagée la pénibilité. Les situations de mobilité bien vécues semblent traduire un relatif équilibre dans les modes de vie associés aux circulations. L’article met cependant en évidence une série de facteurs qui peuvent contribuer à fragiliser, ou à nuancer ces situations : la lassitude, l’absence d’espace d’identification et de projet, la gestion de l’absence du circulant au sein de la famille, la modification du rapport à des lieux de ressourcement, la limitation des pratiques dans les lieux de la circulation. Au total, il n’existe pas de segmentation claire entre ces situations de mobilité du point de vue de la pénibilité. Des situations de mobilité très diverses peuvent être vécues de manière différente. La pénibilité dépend finalement d’une combinaison de facteurs qui, pris isolément, n’ont pas d’effet mécanique.This article examines the circulation of people between Lisbon and four other European cities (Berlin, Brussels, London, Paris in terms of the difficulties that it can cause. The proposed approach articulates three dimensions, namely the construction of practices of circulation between cities at a biographical scale, the way families deal with the circulation of one or more of its members, and the daily experience of places frequented in each of the cities. Taking into account these

  6. A new method for measuring the amplitude of de Haas-van Alphen oscillations

    International Nuclear Information System (INIS)

    Wilde, J. de; Meredith, D.J.

    1975-01-01

    Quantum (dHvA) oscillations in the diamagnetic susceptibility of a metal at low temperatures are usually studied by a torque balance or by the field modulation technique of Shoenberg and Stiles. A new method of measuring dHvA amplitudes in indium using a superconducting flux transformer and a ferrite core flux gate magnetometer is reported. The magnitude of the magnetization is typically 10 -6 T at 1K which is considerably greater than the minimum detectable signal of the magnetometer, and shielding the sensor from the magnetizing field of up to 4T is the main experimental problem. (Auth.)

  7. Portreefotograafia Oscarid. Kuidas neid küll jagada? / Annika Haas ; kommenteerinud Birgit Püve

    Index Scriptorium Estoniae

    Haas, Annika, 1974-

    2016-01-01

    Londoni rahvusliku portreegalerii (National Portrait Gallery) poolt 2003. aastal algatatud portreefotokonkursist Taylor Wessing Photographic Portrait Prize (TWPPP). 2015. aasta võidutöö: David Stewart "Viis tüdrukut"

  8. Oma ninast kaugemal: Aasia ja Euroopa fotokunsti võrdlusi / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika, 1974-

    2016-01-01

    Rahvusvahelisest portreefotovõistlusest "Kuala Lumpur International Photo Awards 2016" (KLPA 2016). Saksa fotokunstnikest Kathrin Tschirnerist ja Heiko Tiemannist, Jaapani fotokunstnikust Mayumi Suzukist, Jeemeni-Bosnia-Ameerika päritolu fotokunstnikust Alia Alist, Malaisia fotokunstnikest Eiffel Chongist ja Nadirah Zakariyast

  9. Paris Photo 2015 / Kristel Schwede, Annika Haas, Laura Põld, Piret Frey

    Index Scriptorium Estoniae

    2015-01-01

    Rahvusvaheline fotomess "Paris Photo 2015" 12. kuni 15. novembrini Pariisi messihallis Grand Palais. Eestit esindasid messil oma loominguga Jaanus Samma, Sigrid Viir, Krista Mölder (Temnikova & Kasela galerii)

  10. Putin's security policy in the past, present and future / Marcel de Haas

    Index Scriptorium Estoniae

    Haas, Marcel de

    2004-01-01

    Venemaa julgeolekupoliitika analüüs. Analüüsi aluseks on 2000. aastal välja töötatud Venemaa riiklik julgeolekukontseptsioon, sõjaline doktriin ja Vene föderatsiooni välispoliitiline kontseptsioon ning 2003. a. avaldatud Venemaa Föderatsiooni sõjalise kaitsevõime arendamise peamised prioriteedid. Tabel

  11. Muutuvintressi arvestamine krediidilepingutes, kui baasintressimäär on muutunud negatiivseks / Anni Haas

    Index Scriptorium Estoniae

    Haas, Anni

    2016-01-01

    Krediidilepingutest, milles intressimäär moodustub baasintressimäära ja intressimarginaali summast. Intressimakse negatiivse väärtuse tähendusest laenuandja ja laenusaaja suhte jaoks. Intressiarvestusest lepingu tõlgendamisel

  12. Un rideau de fer entre la Russie et l’Union Européenne ?

    Directory of Open Access Journals (Sweden)

    Sophie Ollivier

    2010-06-01

    Full Text Available Il conviendra dans un premier temps de présenter l’historique du Mur de Berlin et de déterminer les raisons de sa chute. À un monde bipolaire succède un monde dominé par les États-Unis. Les anciens membres du Pacte de Varsovie adhèrent à l’OTAN et l’UE. Un ensemble d’accords régit peu à peu les relations entre l’UE et les anciennes républiques de l’URSS, l’UE et la Russie. Avec l’élargissement de l’UE et de l’OTAN la question de l’identité de l’Europe est à l’ordre du jour. Les dissensions et les conflits entre la Russie et les pays anciennement communistes ainsi qu’avec des membres de la CEI, les interventions de l’OTAN et de l’UE dans des pays que la Russie considère comme sa zone d’influence, les rivalités entre Russes et Occidentaux dans des zones stratégiques comme le Caucase créent un climat qui rappelle celui de la guerre froide et les termes de « mur », « rideau  de fer » reviennent souvent dans la bouche des hommes d’État et des commentateurs. Toutefois, malgré de grandes divergences, un processus important de rapprochement a eu lieu. En conclusion, nous poserons la question de la nature eurasienne de la Russie.First we shall give a chronological account of the history of the Berlin Wall and define the reasons for its fall. A bipolar world was succeeded by a world dominated by the United States. The former members of the Warsaw Agreement entered NATO and the EU. A series of agreements progressively fixed the relations between the UE and the former republics of the USSR, the UE and Russia. With the enlargement of the UE, the question of the identity of Europe is on the agenda. The dissensions and the conflicts in countries which Russia considers as belonging to its area of influence, the competition between Russians and Westerners in strategic areas such as the Caucasus, create a climate which reminds onlookers of the climate of the Cold War and the terms « wall » « iron curtain » are frequently used by statesmen and commentators. However, in spite of wide differences, an important rapprochement process is taking place. In conclusion we shall raise the question of the Eurasian nature of Russia.

  13. Pikk mees ja lühike mees kohtuvad Kremlis / Enn Soosaar

    Index Scriptorium Estoniae

    Soosaar, Enn, 1937-2010

    2009-01-01

    USA presidendi Barack Obama eelseisvast kohtumisest Venemaa presidendi Dmitri Medvedeviga. Juttu on ka 15. juunil 2009 Washingtonis toimunud USA presidendi B. Obama ja Eesti presidendi Toomas Hendrik Ilvese plaanivälisest kohtumisest, viidates artiklile: Summertime blues. The Economist, 18. juuni 2009

  14. De grandes organisations scientifiques européennes organisent une "webdiffusion" en direct

    CERN Multimedia

    CERN Press Office. Geneva

    2001-01-01

    Is there life elsewhere in the Universe? Are we alone? These questions have always fascinated humanity and for more than 30 years, physicists, biologists, chemists, cosmologists and astronomers have worked tirelessly to answer these questions. And now this November via webcast, all the world will have the opportunity to see the latest on extraterrestrial life from the most prestigious research centers and how for the past three months, European students have had the chance to jump into the scientists' shoes and explore these questions for themselves.

  15. Küsimus pole MRP-s, vaid agressioonis / Enn Soovik

    Index Scriptorium Estoniae

    Soovik, Enn, 1933-2010

    2005-01-01

    Autor leiab, et on vajalik esitada Venemaale pretensioon Nõukogude Liidu poolt Eesti vastu 1939/40 toime pandud agressiooni ja selle järelmite suhtes ning mitte laskuda MRP-ga seotud viljatusse vaidlusse

  16. Die Entwicklung der Stadt Nyen im zweiten Viertel des 17. Jahrhunderts / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2006-01-01

    Ülevaade kirjandusest. Sõjalisest tugipunktist Neeva suudmealal. Nyeni linnaõiguslikust seisundist 1632-1638. 1642. aasta privileegidest ja Nyeni avamisest väliskaubandusele. Linna kindlustamisest ja elanikkonnast

  17. Ground Zero mošee jagab rahva kahte leeri juba enne valmimist / Hendrik Vosman

    Index Scriptorium Estoniae

    Vosman, Hendrik

    2010-01-01

    Ameerikas on tekitanud üleriigilise debati plaan püstitada paarisaja meetri kaugusele Maailma Kaubanduskeskuse kaksiktornidest mošee Ground Zero märgiks ameeriklaste sallivusest ja usulisest leppimisest

  18. Kõik on nii nagu enne, aga miski pole enam endine / Martin Rünk

    Index Scriptorium Estoniae

    Rünk, Martin

    2010-01-01

    Anders Härmi kuraatoriprojekt "Next to Nothing" ("Eimillestki edasi") Eesti Kaasaegse Kunsti Muuseumis 22. augustini 2010. Pikemalt Martin Creedi (Suurbritannia), Laura Tootsi, Triin Tamme, Dénes Farkasi, Neeme Külma ja Kaido Ole töödest

  19. L'effet pro-concurrentiel de l'intégration européenne:

    DEFF Research Database (Denmark)

    Bellone, Flora; Musso, Patrick; Nesta, Lionel

    En situation de concurrence pure et parfaite, les décisions par les entreprises de quantité produites et d'utilisation des facteurs s'effectuent en égalisant le prix du marché de bien final avec le coût marginal. En situation de concurrence imparfaite, cette égalisation n'est plus respectée, les...... firmes ayant intérêt d'utiliser leur pouvoir de marché pour fixer un prix au-delà de leur coût marginal. Dans cet article, nous mesurons les taux de marge, définis comme l'écart en pourcentage entre le prix de vente et le coût marginal, à partir de données d'entreprises pour 14 industries manufacturières...... françaises de 1986 à 2004. Nous observons que le taux de marge moyen, sur l'ensemble de la période et sur l'ensemble des industries, est de 13,8%, ce qui est légèrement supérieur au Royaume-Uni.  Nous trouvons que la mise en place du marché commun a conduit à une diminution de 4 à 5% des marges, alors que l...

  20. Lüganuse vallavolikogu loobib maardla rajajale kaikaid kodaratesse / Enn Tosso

    Index Scriptorium Estoniae

    Tosso, Enn, 1976-

    2008-01-01

    Ida-Virumaal Lüganuse vallas ehituslubjakivi kaevandamist kavandav ettevõte Transurban pole saanud vallavolikogult kaevandamisluba ka pärast nelja-aastast asjaajamist ning kõikide lubade ja kooskõlastuste saamist. Vallavanem Arno Rossman toob põhjendusena 141 vallaelaniku allkirjaga kirja, milles väidetakse, et kaevandamine võtab kohalikelt joogivee ning rikub randa. Lisa: Kronoloogia

  1. Des initiatives locales européennes pour atteindre le facteur 4 ?

    Directory of Open Access Journals (Sweden)

    Elsa Mor

    2011-03-01

    Full Text Available Dans un contexte d’urgence climatique et de pics énergétiques, la dimension locale s’avère être une échelle stratégique pour relever le défi du facteur 4. C’est ce que nous tenterons de questionner au cœur de cet article. Nous examinerons les freins et les leviers que rencontrent les initiatives locales en Europe, en matière de politiques sectorielles, énergétiques et climatiques, ainsi que de gouvernance, en nous appuyant d’exemples précurseurs.In a climate emergency and peak oil context, the local dimension proves to be a strategical scale to take up the challenge of factor 4. It is what we will try to question in this article. We will examine brakes and levers which meet the local initiatives in Europe, in sectoral, energy-climate policies and governance, by leaning of forerunners examples.

  2. Riia on Liivimaa akadeemia jaoks kohaseim ja sobivaim paik / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2010-01-01

    Esitatud on kaks dokumenti, kus Liivimaa kindralkuberner Jakob Johann Hastfer ja Liivimaa ülemkonsistooriumi juht Johann Fischer esitavad oma seisukohad ja nägemuse, kus peaks Tartu ülikool (Academia Gustaviana) pärast Vene-Rootsi sõda (1659-1661) taas tegutsemist alustama. Hastfer eelistas Riiat ja Fischer Pärnut. Lisatud autori kommentaar

  3. Punase koolimaja saamisloost ning ajast enne ja pärast seda / Aavo Soopa

    Index Scriptorium Estoniae

    Soopa, Aavo

    1998-01-01

    Viljandi Maagümnaasiumi 120. aastapäeval meenutatakse G.M. Schmidti eraõppeasutust ja selle järglase Liivimaa Maagümnaasiumi sündi ja tegevust : ka Riia arhitekti R. Häuseri projekteeritud kahekorruselisest punasest tellismajast, mis valmis 1877.a.

  4. Les eaux guérisseuses dans l'Aquitaine augustéenne

    Directory of Open Access Journals (Sweden)

    Bénedicte Grangé

    1992-01-01

    Full Text Available La antigüedad de la investigación arqueológica y literaria sobre las aguas curativas de la Aquitania augustea, a lo largo de período comprendido entre el siglo i a. C. y el siglo vi de nuestra era, hace necesaria la reactivación de su estudio, que se presenta rico y complejo. El interés de esta investigación reside en la diversidad de los temas abordados, principalmente los relativos a la medicina antigua (¿existia el termalismo como especialidad médica? y, en tal caso, ¿cómo se practicaba?, a las creencias religiosas vinculadas al trato frecuente con las aguas (¿qué dioses evocaban?, ¿qué formas adquirían las esperas de los fieles?, a la arquitectura de los establecimientos termales y de los sistemas de recogida de agua, la asiduidad a las estaciones termales (clientela, alojamiento, distracciones, etc.. Pero también en la multiplicidad de los yacimientos descubiertos: alrededor de 150 han sido catalogados en la actualidad, entre la región del Loira y los Pirineos.También están incluidas las villas termales, los santuarios de las aguas o las simples fuentes veneradas por la piedad popular.Because of the out-of-date literary and archaeological research into curing waters in Aquitania between the first century B. C. and the sixth century A. D, it is necessary to start again its study, which appears to be rich and c'omplex. The interest of this enquiry lies in the various tackied subjects, especially those dealing with antigüe medicine (Did thermalism exist as a medical specialization? And if it did, then how was it practised?, religious beliefs connected with waters'frequentation (Which were the invoked gods? What did the devouts'expectations look like?, the architecture of thermae and water-pumping system, the spas'frequentation (diéntele, accomodatlon, entertainment,.... The multiplicity of identified sites is also worth studying: until now, about 150 of them had been registered in the área between Loire river and Pyrénées mountains. They are both spas and water-sanctuaries or simple springs venerated by popular devotion.

  5. Uusi treenimisharjumusi : 500 krooli enne tööd / Risto Tankler

    Index Scriptorium Estoniae

    Tankler, Risto

    2006-01-01

    Ajakirja Sport+ toimetaja Lauri Tankleri ja Di peatoimetaja Kristjan Kaljundi muljeid ujumistreeningust. Vt. samas ka intervjuud Eesti Ujumisliidu presidendi ja viimase aja Eesti edukaima meesujuja Indrek Seiga. Lisaks Indrek Sei 8 nõuannet

  6. Kristjan Lepik : Olympic puhul on käive olulisem kui kasum / Enn Tosso

    Index Scriptorium Estoniae

    Tosso, Enn, 1976-

    2008-01-01

    Kasiinoketi Olympic Entertainment Group esimese poolaasta kasum oli 97,4 miljonit krooni, mis on 48,4 protsenti vähem kui mullu samal perioodil. Käive kasvas aastaga rohkem kui kolmandiku. Lisa: Tulemused

  7. Ülevaateid okupatsiooniajast / Kistler-Ritso Eesti Sihtasutus ; [koostanud Heiki Ahonen ; toimetaja Enn Tarvel

    Index Scriptorium Estoniae

    Eesti riigi (valitsusliikmete saatus, omavalitsuse likvideerimine, kaitseväe ning kohtunike saatus, kohtusüsteemi likvideerimine) ja rahva (arreteerimised 1940-41, küüditamine, repressioonid, kolhooside moodustamine) hävitamisest, vastupanust

  8. Estonia's occupations revisited. Accounts of an era / comp. by Heiki Ahonen ; ed. by Enn Tarvel

    Index Scriptorium Estoniae

    2005-01-01

    Eesti riigi (valitsusliikmete saatus, omavalitsuse likvideerimine, kaitseväe ning kohtunike saatus, kohtusüsteemi likvideerimine) ja rahva (arreteerimised 1940-41, küüditamine, repressioonid, kolhooside moodustamine) hävitamisest, vastupanust

  9. Le retour des hommes sur la scène méditerranéenne

    Directory of Open Access Journals (Sweden)

    Jean-Robert Henry

    2012-03-01

    Full Text Available Absent for a long time from the institutions which try to give shape to the relationship between Europe and its south, the human dimension of Mediterranean relations returned to agenda thanks to the determination of the “illegal” migrants. Coming from Maghreb or sub-Saharan region, they established themselves as new actors of the regional game and showed to the European and national decision-makers the illusion of a closing of human borders of Europe. The necessity to go back to a free circulation of the persons and to take Mediterranean sea as a common human space, on the European model, is a claim formulated by more and more significant representatives of the society, as manifests the very clear advice of the euro-Mediterranean civil Forum of Marrakech in November 2006.This question is now reaching the European authorities, which put on agenda for 2007 a reflexion on the new migratory policy of Europe. In reality, the question jostles European plan itself and its relation to the outside world by making it necessary to chose between a model of the European fortress and the universalist utopia of a « Europe without shores ».

  10. Migrations européennes, économie touristique et impasses

    African Journals Online (AJOL)

    et politiques induites par des flux sud-nord – principalement sous l'angle des migrations de travail, des transferts d'argent, des stratégies de passage vers le « Nord »1, des enjeux d'ethnicité et ... entreprises et institutions nord-américaines. De plus ...... Il est localement apprécié pour recruter du personnel sénégalais issu.

  11. Ain Kivisaar : äärelinn pole kvaliteetne investeering / Ain Kivisaar ; interv. Enn Tosso

    Index Scriptorium Estoniae

    Kivisaar, Ain, 1978-

    2007-01-01

    Ilmunud ka: Delovõje Vedomosti : Nedvizhimost 24. okt. lk. 2-3. Küsimustele kinnisvaraturu olukorra ja investeeringute kohta vastab Metro Capital Managementi finantsjuht Ain Kivisaar. CV: Ain Kivisaar

  12. L'ÉDUCATION Musicale pour la Formation D'une IDENTITÉ EUROPÉENNE Pluraliste

    Science.gov (United States)

    Albarea, Roberto

    1997-01-01

    This paper presents some of the elements which have been typical of music in different contexts and cultures, and describes an approach to musical phenomena which relates them to the intercultural and interdisciplinary dimension of lifelong education (music considered as a cultural good, an expression form, a field of creativity, an artistic production and an aesthetic experience). From the educational point of view, the aim is to form "multi-musical" individuals. In this framework are set the problem of musical identity and the need to spell out that identity in relation to stereotypes (popular music, classical music, folk music, etc.) and the differing shades of diversity. Particular attention needs to be given to the question of the universals seen in the psychology of music and the configuration of musical phenomena as structures which are organized hierarchically in several dimensions. In short, music in all its forms can help to form a dynamic, pluralist identity in the European context.

  13. Eurohindu tuleb näidata enne kursi selgumist / Väinu Rozental

    Index Scriptorium Estoniae

    Rozental, Väinu, 1957-

    2010-01-01

    1. juulist tuleb avaldada kaupade ja teenuste hinnad nii kroonides kui ka eurodes. Arvamust avaldavad Eesti Kaupmeeste Liidu tegevdirektor Marika Merilai, ASi Rimi Eesti Food turundusjuht Evelin Mägioja ja OÜ Maxima Eesti brändi ja kommunikatsiooni osakonna direktor Ty Lehtmäe

  14. Põhiväärtuste kriisist Eestis / Jüri Lina ; foto: Enn Kalve

    Index Scriptorium Estoniae

    Lina, Jüri, 1949-

    1991-01-01

    nõukogude korra valeliku propaganda hüvanguks töötamisest, ebamoraalsest äritegevusest, põhiväärtuste normaalstaatuse taastamise hädavalikkusest kommunistliku impeeriumi mõjuvõimu alt pääsemiseks

  15. Tööandjate Keskliidu pöördumine / Enn Veskimägi

    Index Scriptorium Estoniae

    Veskimägi, Enn, 1947-

    2008-01-01

    Ilmunud ka: Eesti Eest = Za Estoniju : Izdanije objedinenija "Sojuz Otetshestva i Res Publica" 15. mai 2008, lk. 3. Eesti Tööandjate Keskliidu Volikogu esimehe pöördumine, milles tehakse ettepanekuid vajalike muutuste tekkeks tänases majandusühiskonnas

  16. Otsekui Kaval-Ants ja Vanapagan klassiku näidendis / Enn Siimer

    Index Scriptorium Estoniae

    Siimer, Enn, 1946-

    2009-01-01

    Ugala suvelavastus, Kalju Komissarovi lavastatud Bertolt Brechti "Härra Punttila ja tema sulane Matti". Mängitake Ugala tiigi kõrvale ehitatud laval. Osades: härra Punttila - Peeter Tammearu, sulane Matti - Indrek Sammul

  17. Preatoni müüs aktsiaid enne uurimist / Inno Tähismaa

    Index Scriptorium Estoniae

    Tähismaa, Inno, 1970-

    2001-01-01

    ASi Pro Kapital Grupp nõukogu esimehe Ernesto Preatoni kontrolli all olevad Šveitsi firmad Peak Mount Corporation AG ja Telom AG müüsid juuni lõpust kuni juuli lõpuni üle 2 mln Pro Kapitali aktsia ligi 120 mln krooni väärtuses Pro Kapitaliga seotud isikute ja firmade nn. keelatud tehingud

  18. Nyen (Nevanlinna) transiitkaubanduse keskusena Neeva jõe suudmealal 1632-1703 / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn

    2003-01-01

    Neeva jõe suudmealal asunud Nevanlinna (Nyen) ajaloost ja kujunemisest kaubanduskeskuseks, linna rollist Vene transiitkaubanduse vahendajana 17. saj. teisel poolel. Tabelid: "Nyenist lahkunud ja saabunud laevad 1687-1696", "Üle Öresundi läände sõitnud Madalmaade ja Inglismaa laevad 1661-1700", "Vene ja mitte-vene laevadel välja veetud kaupade hind" lk. 22-23

  19. Kan elevene mindre enn før? Naturfagkompetanse i Norden i perioden 1995 – 2003

    Directory of Open Access Journals (Sweden)

    Marit Kjærnsli

    2005-11-01

    Full Text Available This article presents and discusses changes in science competency in the period from 1995 to 2003 in the Nordic countries based on analyses of data from PISA and TIMSS. One central feature of the PISA and TIMSS surveys is to study changes in students’ competency over time in absolute terms. Some items are kept secure from cycle to cycle, and based on these items it is possible to create trend data, i.e. to place students who have taken tests at different times on the same cognitive scale. This is done by the use of modern psychometrical methods. The results show a decline in Norway and Sweden, while a positive development is found in Finland.

  20. ennäismarkkinoiden tehokkuuden rajoitteet ja mahdollisuudet paikallishallinnon palveluissa

    OpenAIRE

    Kähkönen, Liisa

    2007-01-01

    Väitöksen aihe käsittelee kuntasektorilla jo pitkään toteutettuja erilaisia markkinasuuntautuneita palvelujen ohjausmuotoja. Ajankohtaisen aiheesta tekee käynnissä oleva kunta- ja palvelurakenneuudistus, jossa teema on nostettu esille toiseen kertaan maamme kuntasektorin historiassa. Paljon huomiota ovat saaneet erilaiset tilaaja-tuottajamallit. Niiden lisäksi palvelusetelit ovat alkaneet yleistyä joissakin kunnallisissa palveluissa. Tutkimus käsittelee näiden mallien teoreettista pohjaa, näe...

  1. Genotsiid ja apartheid okupeeritud Eestis. [1.-3. osa] / Enn Sarv

    Index Scriptorium Estoniae

    Sarv, Enn, 1921-2008

    1997-01-01

    Peatükk raamatust "Õigluse vastu ei saa ükski". NSVLi poolt eestlaste kallal toimepandud inimsusevastased kuriteod. Inimkaotused, raamatute hävitamine. Sõjakuriteod ja nende eest karistamise võimalused

  2. Moskva ja Lääs enne Peterburi G-8 tippkohtumist / Urmas Kiil

    Index Scriptorium Estoniae

    Kiil, Urmas

    2006-01-01

    Hiljuti avalikustatud ettekannet Engaging with Russia - the Next Phase (Koostöö Venemaaga - järgmine etapp) võib pidada Venemaa ja lääneriikide suhete külmenemise mastaapseks kroonikaks ja see teeb problemaatiliseks Venemaa edaspidise osalemise G-8 seltskonnas

  3. Eesti suurim tuulepark Pakri poolsaarel / Tiit Kallaste, Enn Kareda, Anton Laur, Koidu Tenno

    Index Scriptorium Estoniae

    2004-01-01

    Pakri tuulepark on Eesti esimene suur rahvusvaheline tuuleenergia ühisrakenduse projekt, mille tasuvusuuring ja tuulepargi esimese järgu ehitus on täielikult finantseeritud väliskapitali poolt. Tabelid

  4. Elulähedus enne ja nüüd / Marin Roose

    Index Scriptorium Estoniae

    Roose, Marin

    1991-01-01

    Kirjandusmuuseumi kevadsessioon 24. ja 25. mail Nüplis. Ülevaade ettekannetest: Piret Noorhani "Tagasi maailma lõpust", Mihkel Volt "Romantiline kunstnikumüüt ja orbiitlus", Marin Laak "Eesti kirjanikud eluläheduse kaevikuis", Pekka Erelt "Sõda A. Kivikase loomingus", Toomas Muru "Marginaale arbujate elulähedasest vaimulähedusest", Arne Merilai "Lähemale elulähedusele", Peeter Olesk "Vaimulähedus 1960. aastatel. Aga elu?", Piret Viires "Haiguste ravi, kontrollitud, Eesti noor proosa ja elulähedus"

  5. Alimentation méditerranéenne et cancers [Mediterranean diet and cancers

    Directory of Open Access Journals (Sweden)

    Mariette GERBER

    2016-06-01

    Full Text Available Cancer prevention through food habits is an important matter of public health, given that everybody is exposed to food. The Mediterranean diet model is briefly reported, together with the way to evaluate the adherence to this diet. However, the original score, made for Mediterranean populations, had to be adapted to Western populations. These modifications pinpoint the peculiar aspects of the Mediterranean diet related to health. The studies reporting on the relationship between Mediterranean diet and cancer mortality, colorectal, breast, prostate and other cancers incidence are described. A risk reduction is generally evoked for these outcomes in Mediterranean countries, but it is more difficult to show in US or North-European country. Enough subjects with sane food habits, capable to reveal an inverse association of a Mediterranean-style diet and cancers, might only be found in large cohorts. In addition, the group of “negative” foods in the score needs to include “junk food”, known to be deleterious, and often part of the habits in these occidental countries. In conclusion, it can be said that a high and diverse consumption of fruits, vegetables, legumes, whole grain cereals is a must, be underlined the importance of olive oil, be mentioned the advantage of eating sea-food at least twice-a-week. Consumption of red and processed meat, dairy foods, and alcohol should be kept low and it is important to avoid sugars, saturated fats, all junk-foods, providing empty calories.

  6. Kuidas Adolf Hitler vahetult enne valimisi Püssirohukeldrisse jõuab / Agni Lass

    Index Scriptorium Estoniae

    Lass, Agni

    2005-01-01

    10. sept. esietendub Tartu Püssirohukeldris P. Uttoni "Adolf", mille M. Unt pidi lavastama. Kuid proovideni ta ei jõudnud. See etendub E. Õunapuu käe all, kes tegi M. Undi lavavariandi ümber. Heli- ja lavakujundus ning kostüümid on samuti E. Õunapuult

  7. Serveri rentimine päästab suurest investeeringust / Enn Heinsoo

    Index Scriptorium Estoniae

    Heinsoo, Enn

    2006-01-01

    Ilmunud ka: Delovõje Vedomosti 2. aug. lk. 13. IT-outsourcing ehk IT-teenuse sisse ostmine annab ettevõttele võimaluse saada läbi oma serveriruumita ning IT-spetsialistideta, kasutades samas kõiki serveriga kaasnevaid mugavusi. Tabel: Serverit rentides võib hinnas võita kolmandiku. Vt. samas: Vladimiras Silkovas. Ühtne süsteem tagab töökindluse

  8. Tallinna hotelliturg : vaikus enne tormi = Hotel market in Tallinn : the calm before the storm / Marit Sillavee

    Index Scriptorium Estoniae

    Sillavee, Marit

    2006-01-01

    2008. aastaks suureneb Tallinna hotelliturul konkurents 4 uue hotelli võrra, nõudlust on konverentsiturismile, kuid panustatakse luksushotellidele. Vt. samas: Pealinna hotellitubade hinnad. Tabel: Majutatuid Tallinna hotellides 2000-2006

  9. Les Implications Géopolitiques de la Réunification Européenne

    Directory of Open Access Journals (Sweden)

    N. N. Bobica

    2009-06-01

    Full Text Available The creation of European Union has changed the relationship of the existing force all over theworld, causing a redistribution of the power and influence. During the Cold War, the European Communitywill be the main ally of the United States of America in its confrontation with the USSR. After the fall of theBerlin Wall and of the Soviet Union, the European Union ceased to be the disciplined follower of the U.S. inthe international politics, assuming its own role in this direction. It will reasonably claim to have a major rolein determining the European policy and to follow its own path in solving vital issues of the contemporaryworld. It will offer many times, the optimal alternative to solutions forwarded by the main representatives ofthe international political life; when they will undoubtedly follow their own particular interests, it will be animportant counterweight to the hegemonic tendencies of the United States. It currently works as a balancefactor in confronting various geopolitical tendencies and in imposing law and morality principles in theinternational political life.

  10. Les Implications Géopolitiques de la Réunification Européenne

    OpenAIRE

    N. N. Bobica

    2009-01-01

    The creation of European Union has changed the relationship of the existing force all over theworld, causing a redistribution of the power and influence. During the Cold War, the European Communitywill be the main ally of the United States of America in its confrontation with the USSR. After the fall of theBerlin Wall and of the Soviet Union, the European Union ceased to be the disciplined follower of the U.S. inthe international politics, assuming its own role in this direction. It will reas...

  11. La politique européenne en Méditerranée

    Directory of Open Access Journals (Sweden)

    Azzedine Rakkah

    2009-11-01

    Full Text Available A raíz de la iniciativa francesa de creación de una Unión Euro -Mediterránea, el tema de las reformas políticas de los países del sur del Mediterráneo, tema tradicionalmente relegado a un segundo plano dentro de las temáticas de discusión y de cooperación entre los países europeos y los países del mar Mediterráneo, ha vuelto sobre la mesa. Durante muchos años, la cuestión de la democracia había sido relegada a un segundo plano para no molestar a los regímenes autoritarios, miembros de la asociación. Desde hace poco, sin embargo, la estrategia europea ha ido evolucionando. El nuevo enfoque se articula alrededor de dos niveles: uno estratégico, para responder a las preocupaciones de seguridad y energéticas, y un segundo, político, que busca no tanto cambiar a los regímenes sino a favorecer la exportación de normas y valores de la UE. Aunque este nuevo enfoque más incremental (paso a paso trae problemas éticos, la UE, que también ha venido (junto con los EE.UU. impulsando una mayor integración de los países del Magreb, no debe temer abordar la cuestión de la democratización

  12. Pallas kuuvalgel ehk Lõpetamata peatükk eesti kunstis / Enn Lillemets

    Index Scriptorium Estoniae

    Lillemets, Enn, 1958-

    2009-01-01

    Pallase kunstikooli 90. aastapäeva tähistav näitus "Lõpetamata Pallas" Tartu Linnamuuseumis 31. oktoobrini. Loetletud 19 osalejat. Väljapaneku autoritel jäi Pallase kool lõpetamata, näituse aines on valitud peamiselt Teise maailmasõja aastaist 1940-1945. Pikemalt Varmo Pirgi ja Herman Aunapuu töödest

  13. L´avenir urbain de la démocratie européenne.

    Directory of Open Access Journals (Sweden)

    Xavier Carpentier-Tanguy

    2007-11-01

    Full Text Available Vue de l’étranger, du Japon ou des Etats-Unis, l’Europe constitue déjà un ensemble cohérent ; pour certains auteurs, tels que Jeremy Rifkins, l´Europe constitue même un modèle à suivre ― selon l´idée qu´il développe à travers son livre The European dream (how Europe´s vision of Futur is quietly eclipsing the american dream . Pourtant, les refus hollandais et français de ratification du traité Constitutionnel à l´occasion de référendums nationaux, les récentes et ...

  14. Tarneprogramm lihtsustab logistiku tööd / Jaana Pikalev, Enn Tosso

    Index Scriptorium Estoniae

    Pikalev, Jaana

    2007-01-01

    Ilmunud ka: Delovõje Vedomosti 19. sept. lk. 19. Transpordi tarneahela haldamiseks on kasulik kasutada spetsiaalset tarneprogrammi, mis aitab otsuste tegemisel. Vt. samas: SCM - nõudluspõhine tarnevõrgustik

  15. Towards Behavior Control for Evolutionary Robot Based on RL with ENN

    Directory of Open Access Journals (Sweden)

    Jingan Yang

    2012-03-01

    Full Text Available This paper proposes a behavior-switching control strategy of anevolutionary robotics based on Artificial NeuralNetwork (ANN and Genetic Algorithms (GA. This method is able not only to construct thereinforcement learning models for autonomous robots and evolutionary robot modules thatcontrol behaviors and reinforcement learning environments, and but also to perform thebehavior-switching control and obstacle avoidance of an evolutionary robotics (ER intime-varying environments with static and moving obstacles by combining ANN and GA.The experimental results on thebasic behaviors and behavior-switching control have demonstrated that ourmethod can perform the decision-making strategy and parameters set opimization ofFNN and GA by learning and can escape successfully from the trap of a localminima and avoid \\emph{"motion deadlock" status} of humanoid soccer robotics agents,and reduce the oscillation of the planned trajectory betweenthe multiple obstacles by crossover and mutation. Some results of the proposed algorithmhave been successfully applied to our simulation humanoid robotics soccer team CIT3Dwhich won \\emph{the 1st prize} of RoboCup Championship and ChinaOpen2010 (July 2010 and \\emph{the $2^{nd}$ place}of the official RoboCup World Championship on 5-11 July, 2011 in Istanbul, Turkey.As compared with the conventional behavior network and the adaptive behavior method,the genetic encoding complexity of our algorithm is simplified, and the networkperformance and the {\\em convergence rate $\\rho$} have been greatlyimproved.

  16. Principaux indices de l'intensité du feu dans une savane Guinéenne ...

    African Journals Online (AJOL)

    DELL

    Since direct measurements of fire intensity are not always possible, post-fire indices are often used to substitute this measure to better understand fire behaviour and its impact on vegetation. This study was ... fire management in West Africa.

  17. Kas emakas või söögitoru? : [keelekommentaar] / Enn Ernits

    Index Scriptorium Estoniae

    Ernits, Enn, 1945-

    2014-01-01

    Eesti murretes on emakas või sellele lähedased sõnakujud tähendanud nii sugu- kui ka seedeelundit. Mitmed nimetatud mõisted esinevad nii eesti kui ka lähedastes sugulaskeeltes, kuigi mõnevõrra muundunult

  18. Inimesed lahinguväljal ehk Karmid pildid tegelikkusest / Enn Mälgand

    Index Scriptorium Estoniae

    Mälgand, Enn

    2005-01-01

    M. Karusoo Afganistani sõja teemaline lavastus "Misjonärid", mis põhineb Dee Browni indiaanisõdade raamatul "Mata mu süda Wounded Knees" ja Afganistanis sõdinud meestega tehtud intervjuudel. Esietendus Rakvere Teatris 24. märtsil 2005

  19. Kultuur isiksuse psühholoogiat ei mõjuta / Tiit Kändler

    Index Scriptorium Estoniae

    Kändler, Tiit, 1948-

    2010-01-01

    Psühholoogia uuemate andmete kohaselt ei sõltu indiviidi seadumus kultuurist, soost, vanusest, haridusest. Eesti psühholoogide Jüri Alliku ja Ann Realo osalusel ajakirjas "Journal Personality and Social Psychology" ilmunud artiklist

  20. Kultuur isiksuse psühholoogiat ei mõjuta / Tiit Kändler

    Index Scriptorium Estoniae

    Kändler, Tiit, 1948-

    2005-01-01

    Psühholoogia uuemate andmete kohaselt ei sõltu indiviidi seadumus kultuurist, soost, vanusest, haridusest. Eesti psühholoogide Jüri Alliku ja Anu Realo osalusel ajakirjas "Journal Personality and Social Psychology" ilmunud artiklist

  1. Marcel de Haas, Russia’s Foreign Security Policy in the 21st Century – Putin, Medvedev and Beyond.

    Directory of Open Access Journals (Sweden)

    Isabelle Facon

    2011-03-01

    Full Text Available Specialists of Russian military and defense policy are familiar with Marcel De Haas’s prolific and in-depth publications on sometimes fairly technical issues. This book, with its broader outlook aimed at providing an overall understanding of Russian security policy in the 2000s, is the product of Dr. De Haas’s years as a Senior Research Fellow at the Clingendael Institute (The Hague. In many ways, it constitutes a follow-on to the author’s previous book– Russian Security Policy and Air Power...

  2. Seltskond : Tallinna Linnateatri 42. hooaja avasündmus ja kohtumine teatrilegendi Adolf Šapiroga / Annika Haas

    Index Scriptorium Estoniae

    Haas, Annika

    2006-01-01

    5. sept. toimus Tallinna Linnateatri 42. hooaja avamine, sai ülevaate teatri plaanidest ja toimus kohtumine Adolf Šapiroga. Uue hooaja plaanidesse kuulub ka töölepingu sõlmimine Tallinna Ülikooliga

  3. Microduplications encompassing the Sonic Hedgehog Limb Enhancer ZRS are Associated with Haas Type Polysyndactyly and Laurin-Sandrow Syndrome

    DEFF Research Database (Denmark)

    Lohan, Silke; Spielmann, Malte; Doelken, Sandra C

    2014-01-01

    Laurin-Sandrow syndrome (LSS) is a rare autosomal dominant disorder characterized by polysyndactyly of hands and/or feet, mirror image duplication of the feet, nasal defects, and loss of identity between fibula and tibia. The genetic basis of LSS is currently unknown. LSS shows phenotypic overlap...

  4. Shubnikov-de Haas oscillations in bulk ZrT e5 single crystals: Evidence for a weak topological insulator

    Science.gov (United States)

    Lv, Yang-Yang; Zhang, Bin-Bin; Li, Xiao; Zhang, Kai-Wen; Li, Xiang-Bing; Yao, Shu-Hua; Chen, Y. B.; Zhou, Jian; Zhang, Shan-Tao; Lu, Ming-Hui; Li, Shao-Chun; Chen, Yan-Feng

    2018-03-01

    The study of ZrT e5 crystals is revived because of the recent theoretical prediction of topological phase in bulk ZrT e5 . However, the current conclusions for the topological character of bulk ZrT e5 are quite contradictory. To resolve this puzzle, we here identify the Berry phase on both b - and c planes of high-quality ZrT e5 crystals by the Shubnikov-de-Hass (SdH) oscillation under tilted magnetic field at 2 K. The angle-dependent SdH oscillation frequency, both on b - and c planes of ZrT e5 , demonstrates the two-dimensional feature. However, phase analysis of SdH verifies that a nontrivial π-Berry phase is observed in the c -plane SdH oscillation, but not in the b -plane one. Compared to bulk Fermi surface predicted by the first-principle calculation, the two-dimensional-like behavior of SdH oscillation measured at b plane comes from the bulk electron. Based on these analyses, it is suggested that bulk ZrT e5 at low temperature (˜2 K) belongs to a weak topological insulator, rather than Dirac semimetal or strong topological insulator as reported previously.

  5. Investigation of the scattering of conduction electrons in copper from interstitial hydrogen using the de Haas-van Alphen effect

    International Nuclear Information System (INIS)

    Wampler, W.

    1976-05-01

    The physics of the dHvA effect is discussed and it is shown how it can be used to determine the Fermi surface geometry, the Fermi velocities and the local scattering rates. Dingle temperature measurements are discribed and discussed. Furthermore the way in which the samples were prepared is described. Also discussed are some aspects of the metallurgical behavior of hydrogen in copper which are relevant to the sample preparation such as solubility, diffusion, precipitation, and trapping at impurities. The experimental results are presented, and the local scattering rates are determined from the results. These are then compared with lifetimes from previously reported measurements on substitutional impurities in noble metals. The experimental results are found to be in excellent agreement with a recent calculation of the scattering rates for hydrogen in copper by Huisman and Weiss. The data is also analysed in terms of phase shifts using the Greens function theory of Holtzworth and Lee for scattering from interstitials. (HPOE) [de

  6. 75 FR 20382 - Chrysler LLC, St. Louis North Assembly Plant, Including On-Site Leased Workers From HAAS TCM, Inc...

    Science.gov (United States)

    2010-04-19

    ...., Diversified Contract Service, Inc. 639, and Logistics Management Services, Inc., Fenton, MO; Amended... Logistics Management Services, Inc. worked on-site at the Chrysler LLC, Fenton, Missouri plant (Logistics... Department is amending this certification to include workers leased from Logistics Management Services, Inc...

  7. 75 FR 20384 - Chrysler LLC, St. Louis North Assembly Plant, Including On-Site Leased Workers From Haas TCM, Inc...

    Science.gov (United States)

    2010-04-19

    .... Diversified Contract Service, Inc. 639, and Logistics Management Services, Inc. Fenton, MO; Amended... Logistics Management Services, Inc. worked on-site at the Chrysler LLC, Fenton, Missouri plant (Logistics... Department is amending this certification to include workers leased from Logistics Management Services, Inc...

  8. Valimiskomisjonide otsuste ja toimingute vaidlustamine : [bakalaureusetöö] / Ene Soop ; Õigusinstituut ; juhendaja: Enn Markvart

    Index Scriptorium Estoniae

    Soop, Ene, 1974-

    1998-01-01

    Avalduste ja kaebuste esitamine, tähtajad, valimiskaebused konstitutsioonikohtus, kaebuste lahendamise erinevad viisid ja tähtajad, võimalikud parandused ja muudatused, keelenõudega seonduvad protestid.Vt. ka Õigusinstituudi toimetised (1998) nr. 1, lk. 10-11

  9. Manufaktuuriettevõtlusest ja veskitest Narva jõel 17. saj. II poolel / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2009-01-01

    Manufaktuuride sisseseadmisest Rootsis. Esimestest saeveskitest Narvas. 1660-1670. aastatel rajatud saeveskitest. Narva manufaktuuriettevõtluse laiendamisest 1680. aastatel. J. Tunderfeldti ettevõtetest. Narva manufaktuuriettevõtetest kaasaegsete kirjeldustes

  10. Le Græculus et la Chananéenne : Salammbô, le roman des traductions

    Directory of Open Access Journals (Sweden)

    Agnès Bouvier

    2012-03-01

    Full Text Available Tout commence dans Salammbô par une traduction, c’est-à-dire une trahison. Le Grec Spendius, quand Hannon vient haranguer les mercenaires cantonnés à Sicca, déforme les propos du général carthaginois et déclenche la guerre. Ainsi, il s’impose d’emblée comme le maître de toutes les nations de l’armée qu’il est seul à comprendre et donc à dominer. Durant tout le roman, il use de son pouvoir linguistique pour engendrer la violence. La translatio, dans Salammbô, c’est la captatio : la civilisation mise au service de la barbarie. L’autre figure traductrice du roman, l’héroïne elle-même, pratique la traduction comme un art de séduction – jusqu’à ce que Flaubert, dans un geste d’écriture que l’analyse génétique des brouillons permet d’observer, fasse tomber sur son roman et sur son personnage la malédiction de Babel, autrement plus grave que celle de Tanit. Salammbô est l’histoire d’un sens qui cesse de circuler, coupé, étranglé, gelé dans la bouche des interprètes morts.Salammbô starts with a translation, that is, a treason. When Hannon comes to harangue the mercenaries billeted in Sicca, Spendius the Greek twists the General’s words and causes the war to unleash. Thus he establishes himself as the master of all the nations of the army that he alone can understand and dominate. Throughout the novel he uses his linguistic ability to generate violence. The translatio in Salammbô is the captatio: civilization working for barbarity. The other translating character in the novel, the heroine herself, practices translation like the art of seduction, until Flaubert, in a writing act that genetic analysis of the drafts can trace, casts on this novel and on its character Babel’s curse, more severe than Tanit’s. Salammbô is the story of a meaning that ceases to circulate, as it is cut, strangled, frozen in the dead interpreters’ mouths.

  11. Noorte olukord tööturul enne kriisi, kriisi ajal ning pärast kriisi / Siim Krusell

    Index Scriptorium Estoniae

    Krusell, Siim

    2015-01-01

    Noorte hõive, töötuse ja ametialase struktuuri analüüsi fookuses on haridust kolmandal tasemel omandavate noorte töötamine ning selle lõpetanute puhul hariduse ja tööl seatavate ülesannete kooskõla puudumine

  12. LE DÉTOURNEMENT DE FONDS OU DE BIENS DES BUDGETS DE L’UNION EUROPÉENNE

    Directory of Open Access Journals (Sweden)

    Alexandru BOROI

    2007-09-01

    Full Text Available The embezzling of European communities funds is an important problem included in all criminal legislations from the European countries. This approach has been developed both trough the embezzling of the obtained funds, and also through the embezzling of a specific legal interest. As to the financial communitarian interests in the expenses domain changing the destination of the obtained funds means to use these previously legally obtained funds for other purposes than those originally meant. In Greece and Ireland this fraud of illegal redirection of funds is one of the potential expressions of fraudulent behavior that is provided in specific laws or specific provisions in the criminal code through frauds related to aids and incentives. In these countries changing the destination for funds that cannot be regarded as aids or incentives is not subjected to the provisions of the criminal law unless it has the elements of the breach of trust. In criminal codes from Austria, Denmark, Germany, Italy, Luxembourg, Spain and Sweden this fraudulent behavior related to the change of destination for funds is provided in specific stipulations different from those related to the fraud committed either by presenting false, inaccurate or incomplete documents or statements, or by avoiding to present information. The French criminal law stipulates this change of destination for funds as a crime related to the breach of trust. Unlike the other member states, none of the Great Britain jurisdictions stipulates a specific crime related to this fraud of changing the destination for funds. As for the communitarian financial interests related to incomes, frauds in the field of changing the destination for a legally obtained interest has to be followed by the unlawful assignment of some funds or the unlawful retaining of these funds. At the same time the resources of the European communities budgets are diminished. In Denmark, Greece, Spain, Ireland and Luxembourg changing the destination for a legally obtained interest is one of the potential types of fraudulent behavior provided in the criminal law in respect of the communitarian incomes.In Germany, Italy, France, Netherlands, Austria, Portugal and Finland tax fraud, regardless of the unique regulation in one or more specific laws, related to the customs regulations and the VAT, is defined in such a way as the fraudulent behavior is defined by any avoidance to indicate any change in the circumstances that can lead either to the illegally obtained funds, or to the unlawful retaining of these funds. This will result in the illegal decrease of the communitarian resources. In Romania the criminal provisions related to the embezzling of funds or interests are included in the art.18, par. 1,2, 3, Law no.78/2000. This fraud is directed at the social relations correlated with the financial discipline within the EU. Compliance with this discipline means to use the funds and the legally obtained interests in compliance with the legal provisions in force. This crime consists of affecting the money or the legally obtained interests by changing the destination for these funds. The crime of embezzling funds consists of changing the destination of the money, hence using it for other purposes than intended. Unlike the embezzlement of legally obtained interests, the crime of embezzling funds does not necessarily imply that the money is legally obtained.

  13. [Jarmo T. Kotilainen. Russia's foreign and economic expansion in the seventeenth century. Windows on the World ] / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn

    2009-01-01

    Arvustus: Jarmo T. Kotilainen, Jarmo T.. Russia's foreign and economic expansion in the seventeenth century. Windows on the World. XVIII. Leiden : Brill Academic Publishers, 2005. Oma töös vaatleb autor ka Rootsi Läänemere-provintside linnade Riia, Tallinna, Narva ja Nyeni tähtsust Venemaa väliskaubanduses.

  14. Riia-Moskva postitüli Põhjasõja eelõhtul / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn

    2006-01-01

    Haagi saadiku Andrei Matvejev'i poolt 1701. a. propagandateose sissejuhatuses esitatud Põhjasõja algatamise ettekäänetest. Rootsi ja Venemaa vahelisest postiühendusest, postmeistrite omavahelisest vastuolust ning selle kasutamisest Venemaa poolt ühe Põhjasõja alustamise võimaliku põhjendusena

  15. Le principe de coopération loyale comme fondement identitaire de l’Union européenne

    OpenAIRE

    Neframi, Eleftheria

    2012-01-01

    The principle of loyal cooperation affects the balance between Member State autonomy and obligation to ensure the attainment of the objectives of the Union. Unity in the external representation is regulated by the principle of loyal cooperation. In the internal field, the principle has an autonomous identification function despite the interference with structural and conflict of norms related principles.

  16. Enne võõrandamist uppunud auriku eest saab ka hüvitust / Hille Tänavsuu

    Index Scriptorium Estoniae

    Tänavsuu, Hille, 1941-2014

    2006-01-01

    Tallinna linnavalitsuse otsusest kompenseerida kuue, 1940. aasta oktoobris õigusvastaselt võõrandatud, aurulaeva mõttelisi osi. Laevadega seotud probleemist ka laiemalt ning laevade saatusest. Lisatud: mis on õigusvastaselt võõrandatud vara

  17. L’action française: une matrice européenne et transatlantique des droites radicales?

    Directory of Open Access Journals (Sweden)

    Olivier DARD

    2013-05-01

    Full Text Available L’action française et le maurrassisme sont indissociables de la figure de maurras. En même temps, ils la dépassent. L’action française renvoie à une réalité polymorphe articulée autour de trois piliers: une doctrine, un quotidien et une ligue. Cet ensemble a eu une influence incontestable non seulement en France mais aussi à l’étranger. Une étude sur ce dernier point permet de mettre en lumière une chronologie sensiblement différente de celle qui a été proposée pour la France. En même temps, l’examen des vecteurs de pénétration et des transferts politiques et culturels à l’œuvre font découvrir les différentes façons d’être maurrassien de l’Europe aux Amériques.

  18. Julgeolekuanalüütik : maailm on ohtlikum kui enne Iraagi sõda / Ronald D. Asmus ; interv. Erkki Bahovski

    Index Scriptorium Estoniae

    Asmus, Ronald D., 1957-2011

    2005-01-01

    Saksa Marshalli Fondi tegevdirektor Ameerika ja Euroopa suhetest, Euroopa Liidu poliitikast Venemaa suhtes, Eesti panusest Euroopa Liidu poliitika kujundamisesse, NATO 2006. aasta tippkohtumisest ja Ukraina võimalikust liitumisest NATO-ga. Lisa: Dr Ronald D. Asmus

  19. Estimation des taux de marge dans l'industrie manufacturière européenne

    DEFF Research Database (Denmark)

    Warzynski, Frederic

    2009-01-01

    This brief note presents estimates of price cost margins (PCMs) obtained following the Roeger (1995) methodology using Amadeus as microeconomic dataset. We discuss the advantages and disadvantages of the dataset, and propose alternative datasets when longer times series or more representative sam...

  20. Zwischen Mars und Merkur : Narvaer und Revaler Kaufleute im Handel mit den Niederlanden um 1675 / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2005-01-01

    Ülevaade Euroopa poliitilistest suhetest 1660ndatel ja 1670ndatel aastatel. Rootsi kuninga poolt kehtestatud kaubanduskeelust (kehtis 1675-1676) Madalmaadega ja selleteemalisest kirjavahetusest Tallinna ja Narva võimuesindajatega

  1. Kohaliku omavalitsuse roll Eesti Vabariigis : [bakalaureusetöö] / Anu Peterson ; Õigusinstituut ; juhendaja: Enn Markvart

    Index Scriptorium Estoniae

    Peterson, Anu

    1998-01-01

    Kohalike omavalitsuste areng Eestis, kohaliku omavalitsuse mõiste ja Euroopa Kohaliku Omavalitsuse Harta, kohaliku omavalitsuse suhe riigiga, riigikeskne või kogukondlik kohaliku omavalitsuse teooria

  2. Christian Lara: Reconciling Vision and Execution in Sucre Amer and 1802 l’Epopée Guadeloupéenne

    Directory of Open Access Journals (Sweden)

    Meredith Robinson

    2015-11-01

    Full Text Available Invoking the past in film is a political gesture because it suggests new interpretations of historical events. French Caribbean director Christian Lara portrays the Guadeloupean rebellion of 1803 in two of his films. In his own words, he builds “a historical fresco” of the events, abounding with frequent changes of scenery, elaborate period costumes, and a wide range of minor and major characters through which he exposes France’s colonial wrongdoings. He further questions present French involvement in Guadeloupe. My aim in this paper is to demonstrate that his cinematic efforts, though criticized for their theatricality, underscore an urgency to correct and confirm the islands’ distinctive and inspiring local history.

  3. Kaks kanget: Forgotten Sunrise ning Tharaphitha enne ja nüüd / Anders Melts, Ants Lill ; intervjueerinud Mart Kalvet

    Index Scriptorium Estoniae

    Melts, Anders

    2009-01-01

    Küsimustele vastavad dark-elektro-bändi Forgotten Sunrise laulja Anders Melts ja pagan-metal-bändi Tharaphita laulja-kitarrist Ants Lill. Ansamblitest ja nende esimestest heliplaatidest, mis üllitati hiljuti uuesti plaadifirma Nailboard Records poolt: Tharaphita albumi "Raev" digipack-CD, millele on lisatud 1996. aastal ilmunud neljalooline demosalvestis "Kui varjud põlevad" ja Forgotten Sunrise demo "Behind The Abysmal Sky" (1993) ja minialbumi "Forever Sleeping Greystones" (1994) lood

  4. Des organisations de recherche européennes de premier plan unissent leurs efforts dans le cadre du groupe EIROFORUM

    CERN Multimedia

    CERN Press Office. Geneva

    2001-01-01

    Since the early 1950s, a number of powerful research infrastructures and laboratories which are used by an extensive network of scientists have been developed and deployed within Europe by European Intergovernmental Research Organisations (EIRO). Together, they represent European spearheads in some of the most crucial basic and applied research fields.

  5. De Haas-Van Alphen measurements of one-electron and many-body effects in transition metals and intermetallic compounds

    International Nuclear Information System (INIS)

    Crabtree, G.W.; Johanson, W.R.; Campbell, S.A.; Dye, D.H.; Karim, D.P.; Ketterson, J.B.

    1980-01-01

    Examples are given which demonstrate the power and versatility of the dHvA effect in studying electronic behavior in metals. In transition metals the parametrization schemes give a very complete and consistent picture of the k-dependent and surface averaged electronic properties. Because the one-electron behavior is fairly well known, the many body contribution to the Fermi velocity can be isolated and its detailed anisotropy can be displayed. This kind of information is directly relevant to the calculation of electron-phonon interaction effects and cannot be derived by any other means

  6. Zavodõ jest, biodizelja - net / Viktor Filonenko

    Index Scriptorium Estoniae

    Filonenko, Viktor, 1949-

    2008-01-01

    Eestis on viimastel aastatel loodud mitu biodiislit tootvat ettevõtet, kuid Eestis puuduva nõudluse tõttu biodiislit siin ei müüda. Vt. samas: Taimsest toorainest valmistatakse kütust Paldiskis. Kommenteerivad Kai Realo, Indrek Kaju ja Sven Mark

  7. Når skolens behov blir viktigere enn formell kompetanse: Hvordan veilede nyutdannede lærere til å undervise i skolefag de ikke har?

    Directory of Open Access Journals (Sweden)

    Merete Føinum

    2016-04-01

    Full Text Available Studien undersøker veiledning av nyutdannede lærere ved en norsk ungdomsskole. Artikkelen problematiserer de ekstra krevende arbeidsbetingelsene som disse nye lærerne møtte i sitt første år, da de ble satt til å undervise i skolefag de ikke hadde studert. Forskningsspørsmålet er: Hvordan fremstiller nyutdannede ungdomsskolelærere sine opplevelser med å undervise i skolefag de ikke selv er formelt kvalifisert i, og på hvilke måter kan veiledning bidra med støtte? Artikkelen presenterer utdrag fra veiledningssamtaler som eksemplifiserer to nye læreres fremstilling av eget arbeid med elevvurdering når de mangler formell kvalifikasjon i faget. De nyutdannedes perspektiv, og mentorens, fremheves som et samspill gjennom inter­aksjonsanalyse. Artikkelens teoretiske bidrag er analysebegrepene – «psykologisk-emosjonell mentorstøtte» og «faglig-profesjonell mentorstøtte» – som brukes for å identifisere ulike varianter av mentorstøtte i veiledningssamtaler. Innenfor hovedtypen «faglig-profesjonell mentorstøtte» utdypes distinksjonen videre når det skilles analytisk mellom mentor-bidrag som vektlegger spisset drøfting av skolefag (faglig og mentor-innspill av pedagogisk eller mer generell didaktisk karakter (profesjonell. Dermed bidrar studien til å vise hvordan ulike kvaliteter i faglig-profesjonell lærerveiledning kan gjenkjennes i praksis. Funnene viser hvor avgjørende det er at mentor har kompetanse i det skolefaget det skal veiledes i, såfremt skoler ønsker å tilby nyutdannede lærere spisset veiledning i skolefag. Funnene har implikasjoner for skolelederes/-eieres tilrettelegging av arbeidsforhold og organiseringen av veilednings­støtte for nyutdannede lærere.Nøkkelord: nyutdannede (førsteårslærere, mentor(ing, veiledning, undervisningskompe­tanse, skolefag, ungdomsskolen, lærerutdanningAbstract Research on teachers’ professional development establishes the first year of teaching as a vulnerable phase for many newly qualified teachers (NQTs. While existing studies shed light on various challenges of NQTs, few studies pay attention to the strains created when NQTs are put in positions of teaching subjects they are not formally qualified for. This study problematizes implications of such work conditions, asking: How do NQTs bring up and discuss issues of teaching school subjects without formal qualifications, and how can mentors support them? Mentoring of NQTs at a lower secondary school in Norway was observed. The NQTs’ perspectives on this matter are displayed by presenting conversation excerpts from mentoring situations. The study demonstrates that while NQTs need both subject specific professional support and psychological-emotional support, the quality of the professional support depends on the mentors’ subject qualifications. Knowledge from the study bears implications for choices relating to the work conditions of NQTs and mentor-mentee matching when school leaders and administrators facilitate mentoring support for NQTs.Keywords: newly qualified teachers (NQTs, mentoring quality, teaching competence, school subjects, teacher education

  8. Diversité, priorité pastorale et de conservation des ligneux fourragers des terres de parcours en zone soudano-guinéenne du Bénin

    Directory of Open Access Journals (Sweden)

    Sèwadé, C.

    2016-01-01

    Full Text Available Diversity, pastoral and conservation priorities of fodder trees in the Sudano-Guinean pasture lands of Benin. Description of the subject. Fodder trees are important for livestock survival in dryland Africa. In view of the pressure faced by these trees, and their consequent rarity noted in rangelands, a study was conducted in the Sudano-Guinean transition zone of Benin at the level of the local population surrounding the protected forests of Monts Kouffé, Wari-Maro and Ouémé Supérieur. Objectives. This study aimed to inventory the fodder trees, analyze the local perception of factors threatening target fodder trees, according to different sociolinguistic groups and prioritize fodder trees for conservation. Method. Ethnobiological surveys and ecological data from the available literature were used to construct a database following different criteria. The citation rates of the fodder trees by the surveyed populations were used to establish pastoral priority, while their conservation priority was established using a combination of four methods and nine criteria. Results. Forty-eight fodder trees belonging to 17 families dominated by Leguminosae (27.1% and Moraceae (16.6% were reported. These species were distributed among 37 genera, with the genus Ficus being the most represented (16.6%. Palatability, species availability and the impact of tree fodder on animal productivity were the criteria used by the surveyed sociolinguistic groups in their selection of fodder trees. The prioritization methods yielded ten top ranked species: Afzelia africana, Pterocarpus erinaceus, Khaya senegalensis, Vitellaria paradoxa, Mangifera indica, Ficus platyphylla, Balanites aegyptiaca, Annona senegalensis, Ficus umbellata and Daniellia oliveri. Conclusions. With the aim of establishing the sustainable management of pasture lands, we suggest that priority be given to the aforementioned species of fodder trees as part of restoration, afforestation/reforestation and plantation activities.

  9. "Enne diskussiooni võta 100 g (40°-80°)!" : Gustav Naani kolm kirja Abe Liebmanile / Gustav Naan ; kommentaarinud Helen Lausma-Saar

    Index Scriptorium Estoniae

    Naan, Gustav, 1919-1994

    2012-01-01

    Kirjad pakuvad lisateavet selle kohta, kuidas kujunes marksistlik-leninlik-stalinlik Eesti ajaloo kontseptsioon. Annavad võimaluse heita pilgu Gustav Naani mõttemaailma ja ridade vahelt saab aimu Abe Liebmani rollist ajalooteaduse ümbermõtestamisel

  10. L’impact de la production du sucre sur les campagnes méditerranéennes à la fin du Moyen Âge

    Directory of Open Access Journals (Sweden)

    Mohamed Ouerfelli

    2012-12-01

    Full Text Available Le développement de la production du sucre en Méditerranée à la fin du Moyen Âge a engendré des répercussions tant sur le paysage urbain que sur celui des campagnes. Notre enquête se limitera à ce dernier point pour montrer comment le paysage agraire s’est remodelé. Là où la canne à sucre s’installe avec ses moyens de transformation, elle accapare l’eau et la terre. Son expansion se réalise parfois aux dépens des cultures vivrières, base de l’alimentation des paysans. Elle entame aussi les forêts environnantes. Les exemples étudiés révèlent une consommation impressionnante de bois et de formes de terre cuite pour le raffinage et le conditionnement du sucre. Les effets de cette industrie ne sont pas seulement négatifs ; cette activité a attiré une main d’œuvre nombreuse, venue parfois de loin pour chercher des salaires élevés. Elle a pu constituer le noyau d’un habitat rural. De même, elle a contribué au développement des systèmes d’irrigation, à l’amélioration de l’équipement des régions où elle s’est établie, en les intégrant dans les circuits commerciaux, les rendant ainsi plus accessibles aux moyens de transport.

  11. Enne külvi surfa netis : [internetipõhise geoinfosüsteemi loomisest] / Hugo Roostalu; kirja pannud Sirje Pärismaa

    Index Scriptorium Estoniae

    Roostalu, Hugo, 1941-

    2006-01-01

    Eesti Maaülikooli professor Hugo Roostalu sõnul plaanib EMÜ AS-i Kesko Agro toel luua internetipõhise geoinfosüsteemi, mis koondab Eesti põllumajandusteadlaste tehtud katsete tulemusi ning aitab tootjail maakasutust tõhusamalt planeerida

  12. [Stat-kyrka-samhälle : Den stormaktstida samhällsordningen i Sverige och Östersjöpinserna] / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2002-01-01

    Arvustus: Stat-kyrka-samhälle : Den stormaktstida samhällsordningen i Sverige och Östersjöpinserna. (Acta Universitatis Stockholmiensis Studia Baltica Stockholmiensa, 21). Stockholm, 2000. Stockholmi Ülikooli Balti Uuringute Keskuse teaduslik väljaanne "Riik-kirik-ühiskond" Rootsi suurriigi provintsipoliitikast Eesti- ja Liivimaal 16.-17. sajandil

  13. Le chemin des amours barbares, Genèse médiévale de la sexualité européenne

    Directory of Open Access Journals (Sweden)

    Jean-Pierre Poly

    2009-05-01

    Full Text Available A lui seul, le titre mérite l’attention, plus qu’une formule enlevée suivie d’un sous-titre explicatif, il renvoie à la double image que nous nous faisons du Moyen Age dont nous sommes les héritiers : du chemin à la genèse, des amours (féminines au pluriel, n’oublions pas ce charme de la langue française à la sexualité, des Barbares à l’Europe médiévale. Toute l’ambivalence du regard que l’on peut poser sur la question dont va traiter l’ouvrage est déjà perceptible. Amour(s ? et sexualité, ...

  14. Kan kostholdsdata fra hjerte- karundersøkelsene i Finnmark, Sogn og Fjordane og Oppland brukes i analyser av andre sykdommer enn hjerte-karsykdom?

    Directory of Open Access Journals (Sweden)

    Elin Bjørge Løken

    2009-10-01

    Full Text Available  SAMMENDRAGEt selvadministrert spørreskjema om utvalgte sider av det vanlige kostholdet er besvart av ca. 60 000 mennog kvinner i de tre første hjerte-karundersøkelsene i Finnmark, Sogn og Fjordane og Oppland (1974-1988.Sammenligning av kostdata hos et utvalg av deltakerne som både besvarte spørreskjemaet og et 24 timerskostintervju, har vist at spørreskjemaet ikke bare ga et brukbart bilde av forbruket av melk, brød,smør/margarin og kaffe, men også for beregnet inntak av energi, protein, fett og kalsium. Skjemaetinneholdt få spørsmål om friske plantematvarer og kan derfor ikke gi data for inntak av antioksidanter.Resultatene viste klare forskjeller i kostholdet mellom menn og kvinner og i forhold til bosted. Videreanalyser har vist statistisk signifikante sammenhenger mellom en eller flere kostkomponenter og risiko forulike typer kreft og lårhalsbrudd. Materialet omfatter en forholdsvis ung kohorte, og kan på sikt væreinteressant for studier av andre sykdommer eller dødsårsaker som antas å ha sammenheng med en ellerflere av de kostkomponentene som spørreskjemaet omfatter. Ved vurdering av resultatene er det viktig å tahensyn til at spørreskjemaet ikke omfattet det totale kostholdet.Løken EB, Solvoll K. Can dietary data from the cardiovascular disease studies in Finnmark,Sogn og Fjordane and Oppland be used to analyse risk for other diseases?Nor J Epidemiol ENGLISH SUMMARYA self-administered questionnaire covering selected aspects of the habitual diet was answered byapproximately 60 000 men and women who participated in the three first screenings of cardiovasculardisease risk factors in the counties of Finnmark, Sogn og Fjordane and Oppland (1974-1988. A subsampleof the subjects was in addition interviewed about their intake of foods and beverages on the day before thequestionnaire was handed out. It appeared that the questionnaire not only provided reasonable data onconsumption of milk, bread, butter/margarine and coffee, but also for calculated intake of energy, protein,fat and calcium. Since the dietary questionnaire had few questions on fresh produce it cannot provideestimates on antioxidants. The results showed clear differences in the diet of men and women and betweencounties. Further analyses have demonstrated statistically significant associations between one or more dietcomponents and risk of breast cancer, colon cancer or hip fracture. Most of the associations were dosedependent. The dietary data from the countywide screenings of cardiovascular disease risk factorscomprise a relatively young cohort and may in the future be used to analyse risk of other diseases ormortality that are associated with one or more of the dietary components included in the questionnaire.Results should be interpreted with care as the dietary questionnaire did not cover the entire diet.1997; 7 (2: 191-200.

  15. Métaux traces dans les sédiments d'une lagune méditerranéenne : l'étang de Thau

    OpenAIRE

    Pena, G; Picot, B

    1991-01-01

    Analyses of mineralogy, granulometry and chemistry - aluminium,cadmium, chromium, copper, iron, lead, manganese, mercury, nickel, zinc, organic carbon, total nitrogen and phosphorus - are carried out in a Mediterranean lagoon: Etang de Thau. Shell-fish breeding and tourism make the Thau basin an important place for studying the impact of pollution within a lagoon environment. The spatial distribution of the metallic elements is related to the fine fraction (< 63-mu-m) and to the organic matte...

  16. Faut-il en finir avec le développement durable ? Regard sur les zones humides méditerranéennes

    Directory of Open Access Journals (Sweden)

    Raphaël Mathevet

    2006-12-01

    Full Text Available Based on biodiversity conservation projects or integrated management projects of the Mediterranean wetlands, this paper shows that their sustainable development mainly depends on a political thinking about misdevelopment. The biodiversity conservation projects try with various successes to conciliate conservation and development. Amongst the problems, the decrease of the fresh water resource is added to the social disparity and the poverty. Promoting and managing institutional changes, increasing the stakeholders’social capital, learning and collectively deciding are the main keys of sustainable development. Many disparities still exist in the democratic processes atthe local,regional and national levels but a participative developmentis suggested.More centered on the needs of local communities than on economic growth, being more reflexive, and setting the science’s critic and the co-construction of projects at the heart of the process, this participative development may offer an alternative to the prevalent approaches that were used until now. The sustainable development of the Mediterranean wetlands is still promising if it increases the adaptive capacity of both social and ecological systems in order to reject any irreversibility.

  17. Après l’État-nation : application au cas de la construction européenne de 1945 à nos jours

    Directory of Open Access Journals (Sweden)

    Julien Rajaoson

    2013-08-01

    Full Text Available The advent of a global economy, which attempts to escape state regulation, requires, according to Habermas, a paradigm shift in institutional terms. The nation-state was able to objectify in a new way the “correctable” nature of social inequalities. However, a nation-state whose fundamental structure evolves into a post-national state could take the risk of exposing itself to a deficit of political legitimacy, and “democratic trust”. Thus resulting in an inability of nation-states, the only possibility is to diagnose the restriction of their freedom of maneuver, a fortiori before the establishment of a post-national structure. Within this context, the evolution of the nation-state seems to lead to a political crisis which implies powerlessness.

  18. NSV Liidu võitlus kapitalistlike riikide ideoloogilise diversiooni vastu (1987-1989) / Ritvars Jansons ; läti keelest tõlkinud Enn Tarvel

    Index Scriptorium Estoniae

    Jansons, Ritvars

    2011-01-01

    1960-ndate aastate teisel poolel moodistati Riikliku Julgeoleku Komitee juurde 5. valitsus, mille ülesandeks sai võitlus ideoloogilise diversiooniga ja ideoloogiline vastuluure. Võitlusest ideoloogilise diversiooniga Lätis

  19. Renforcement de la coopération scientifique européenne: La Commission signe un Arrangement administratif avec le CERN

    CERN Multimedia

    CERN Press Office. Geneva

    1994-01-01

    On 10 October 1994, Professor Antonio Ruberti, Commissioner for Research, Development, Education and Training, and Professor Christopher Llewellyn Smith, Director-General of CERN signed an administrative arrangement opening the way for tighter scientific and technological cooperation between the European Union and CERN.

  20. "... mugavamaid teid, kui nüüd linnade vahel tarvitatakse, on vaevalt leida..." : postirevisjon Eesti- ja Liivimaal 1687.-1688. aastal / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn

    2005-01-01

    Postikorraldusest Eesti- ja Liivimaal 17. sajandil. Lisana tabelid: Välismaalt Riiga saabunud kirjad ; Riiast saadetud maksustatavad kirjad ; Liivimaa kindralkuberneri kantselei vabakirjad ; Tallinnast saadetud maksustatavad kirjad ; Tartust saadetud maksustatavad kirjad ; Pärnust saadetud maksustatavad kirjad ; Rakverest saadetud maksustatavad kirjad

  1. Andres Puustusmaa - mees nagu jalgratas ehk Seitseteist kevadist hetke enne Moskva rongi väljumist / Andres Puustusmaa ; interv. Margus Mikomägi

    Index Scriptorium Estoniae

    Puustusmaa, Andres

    2008-01-01

    Venemaal tegutseva Eestist pärit režissööri Andres Puustusmaa mängufilm "18-14" esilinastub 10. jaanuaril Eestis. Lisaks tõlge filmi tutvustavast tekstist (www.1814.ru) : "Tsarskoje Selo Kõrilõikaja ja lütseumi kasvandikud". Artikkel rubriigis "Teatriküljed 1/25"

  2. Dégradation des hydrocarbures et dénitrification bacterienne dans les sédiments marins de la cote mediterranéenne

    OpenAIRE

    Azoulay, E.; Violet, M.; Giusti, G.; Stragier, C.

    1982-01-01

    Les populations bactériennes isolées des sédiments ou des eaux de surface de l'Etang de Berre dans des zones soumises à des pollutions permanentes par des fractions pétrolières dégradent les différentes classes d'hydrocarbures en présence de nitrate ou d'ammonium comme source d'azote. L'activité dénitrifiante des souches constituant ces populations a été déterminée par plusieurs méthodes dont les résultats conduisent en première approximation aux conclusions suivantes : - La majorité des bact...

  3. Mind häirib edukultus. Mind häirib progressikultus. Mind kohutavalt häirib laristamine ja raiskamine / Enn Soosaar ; interv. Urmo Soonvald

    Index Scriptorium Estoniae

    Soosaar, Enn, 1937-2010

    2007-01-01

    Tõlkija, esseist ja kolumnist räägib poliitikast, Eesti ühiskonnast, Eesti suhetest Venemaaga, oma kokkupuudetest presidentide Lennart Meri, Arnold Rüütli ja Toomas Hendrik Ilvesega. Vt. samas: President Ilves tsiteerib 24. veebruaril 2007 Soosaart. Vabariigi aastapäeva kõnes tsiteeris president T. H. Ilves E. Soosaare raamatut "Isa ja Aeg"

  4. Sports d’aventure et tourisme au début de la construction européenne en Pyrénées

    Directory of Open Access Journals (Sweden)

    André Suchet

    2011-12-01

    Full Text Available Organisés au printemps 1993 sur la frontière entre la France et l’Espagne, les Jeux Pyrénéens de l’Aventure, ou los Juegos Pirenaicos de la Aventura, réunirent plus de 1 000 athlètes venus de 26 pays du monde sous les yeux de 21 000 visiteurs. Olympiade des sports d’aventure et de nature patronnée par le CIO, les épreuves se déroulèrent dans la vallée d’Aure en France (département des Hautes-Pyrénées et le Sobrarbe en Espagne (province de Huesca. Cet article analyse la gouvernance de cette compétition sportive internationale. Plus précisément, cette étude de cas permet d’interroger les modalités d’organisation d’un projet transfrontalier au début des années 1990. Quels sont les différents échanges politiques, sociaux et culturels entre les vallées sur le plan du sport et du tourisme en Pyrénées ? Les résultats montrent un fonctionnement parallèle d’une organisation française et d’une organisation espagnole plutôt qu’un travail de terrain en commun. Division du travail qui permettait de contourner le problème de la langue. La dimension transfrontalière, présente dans cette olympiade de l’aventure en 1993, résulte en fait des pressions de la DATAR au tout début du projet, c’est-à-dire précisément en octobre 1989. Par cet aspect, les Jeux Pyrénéens de l’Aventure 1993 apparaissent le témoin d’une Europe politique en construction au lendemain de 1989.

  5. [Baltic connections : archival guide to the maritime relations of the countries around the Baltic Sea (including the Netherlands) 1450-1800)] / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn

    2009-01-01

    Arvustus: Baltic connections : archival guide to the maritime relations of the countries around the Baltic Sea (including the Netherlands) 1450-1800). Leiden, Boston : Brill, 2007. Lisaks raamatule on arhiivijuht kättesaadav ka elektrooniliselt http://www.balticconnections.net/

  6. Les communautés savantes européennes à la fin du siècle des Lumières

    Directory of Open Access Journals (Sweden)

    René Sigrist

    2013-08-01

    Full Text Available Le présent article traite de la localisation des savants européens à la fin du XVIIIe siècle. Une première méthode consiste à cartographier la «République des sciences» à partir de la Liste des astronomes connus actuellement vivants établie par Jean III Bernoulli entre 1776 et 1779. Une seconde méthode localise les membres et correspondants des six principales académies scientifiques de l'époque, soit celles de Paris, Londres, Berlin, St-Pétersbourg, Stockholm et Bologne. Dans le cas particulier de la France, la recherche met en évidence l'articulation spatiale entre la communauté académique de la capitale, les villes de province et les centres étrangers.

  7. Étude de la Cinétique d'adsorption des molécules anti paludéennes ...

    African Journals Online (AJOL)

    SARAH

    29 mai 2013 ... elimination of drugs from blood, and the static adsorption simulates the elimination of drugs from stomach. Chloroquine .... concentration du produit en solution. Les prélèvements pour la mesure de la concentration sont de quantité suffisamment faible pour ne pas modifier de manière significative la ...

  8. Politique nationale et coopération européenne: La méthode ouverte de coordination ouverte est-elle devenue plus contraignante? (1)

    NARCIS (Netherlands)

    Vanhercke, B.; Hamel, M.P.

    2008-01-01

    De récentes « évaluations » de différentes MOC ont décrié ces processus de coordination, les qualifiant de « purement rhétoriques et de peu de valeur », de « lointains et peu pertinents », voire pire, de « diversion à la mode ». Les auteurs rejettent ce point de vue qui considère la MOC comme de la

  9. "Paludes kristlikku päästmist ja kaitset" : Eestimaa seisuste alistumine Rootsi võimule 1561. aasta suvel / Enn Küng

    Index Scriptorium Estoniae

    Küng, Enn, 1963-

    2011-01-01

    Liivi sõja käigust. Esialgu piirdus Rootsi võimu alla läinud territoorium ainult Tallinna ja selle ümbrusega. Eestimaa seisuste privileegide laiaulatuslik kinnitamine 1561. aastal kujunes üheks oluliseks vundamendikiviks siinsete provintside eriseisundi tekkimisel

  10. Myélome multiple survenant au cours d'une Fièvre Méditerranéenne Familiale

    Science.gov (United States)

    Salem, Bouomrani; Afef, Farah; Nadia, Bouassida; Nabil, Ayadi; Zouhir, Bahloul; Maher, Béji

    2013-01-01

    L'objectif de ce travail est de rapporter une observation particulière de myélome multiple survenant au cours d'une maladie périodique. Il s'agit d'un patient tunisien de 53 ans suivi depuis le jeune âge pour maladie périodique dont le diagnostic était confirmé par l’étude génétique montrant l'homozygotie pour la mutation M694V du gène MEFV, fut admis pour exploration d'une douleur avec tuméfaction fessière droite récente. Les explorations biologiques et radiologiques ont permis de retenir le diagnostic d'un myélome multiple de type IgA à chaînes légères kappa stade III B, associé à une volumineuse localisation plasmocytaire très agressive de l'aile iliaque droite envahissant les structures musculaires avoisinantes. Notre observation, qui à notre connaissance est la deuxième signalant une telle association, se distingue par sa survenue brutale, sa progression rapide et le caractère très agressif de l'hémopathie. PMID:24255729

  11. Expulsion d’etrangers et Convention européenne des droits de l’homme Le risque de mauvais traitements dans l’Etat de destinatio

    Directory of Open Access Journals (Sweden)

    Syméon Karagiannis

    2010-12-01

    Full Text Available The right of States, for a variety of reasons, to expel aliens hasnever been disputed by the European Court of Human Rights insofar as aState party to the European Convention on Human Rights continues, quite naturally, to exercise its sovereignty over its territory. However, this right has to be reconciled with the obligation of States parties to the European Convention on Human Rights not to expose aliens and, more generally, persons under their jurisdictionto a risk of violation of the provisions of the Convention. Yet, guaranteeing that no human right recognized as such by the Convention be violated in case of expulsion is too heavy a task for States to assume. Imposing such an obligation would end up in invalidatingthe sovereign right of States to expel aliens. The Court ofStrasbourg retains primarily the risk of Article 3 of the Convention being violated in expulsion cases, a provision according to which inhuman or degrading punishments or treatments and, of course, acts of torture are strictly prohibited. The Court’s case-law, abundant aswell as rich in nuances, results in rather a thorough examination of the human rights situation in any country towards which a alien will be (or has already been expelled.

  12. Estonia's occupations revisited. Accounts of an era / The Kistler-Ritso Estonian Foundation ; comp. by Heiki Ahonen ; ed. by Enn Tarvel

    Index Scriptorium Estoniae

    2014-01-01

    Eesti riigi (valitsusliikmete saatus, omavalitsuse likvideerimine, kaitseväe ning kohtunike saatus, kohtusüsteemi likvideerimine) ja rahva (arreteerimised 1940-41, küüditamine, repressioonid, kolhooside moodustamine) hävitamisest, vastupanust

  13. L’intégration dans L’Union Européenne, une Impulsion Déterminante pour la Roumanie dans le Processus de la Globalisation

    Directory of Open Access Journals (Sweden)

    Mariana Aida Câmpeanu

    2009-06-01

    Full Text Available Without a doubt, Romania’s adherence to the European Union in January 2007 created anopening to progress at all levels; the act of adherence is also an option for globalization as a Europeanversion, without being just an act of integration. Creating a Single Market, having a European currency,creating transnational corporations, establishing a Europeanized, legislative and institutional framework tosupport the European integration were more then likely to change Romania in just a few years. Theintegration of our country into European structures created, indisputably, a greater openness towards theprocess of globalization; the European construction to which we engaged is likely to influence in asignificant way the process of globalization at European and global level.

  14. Caractéristiques polliniques des plantes mellifères de la zone soudano-guinéenne d'altitude de l'ouest Cameroun

    Directory of Open Access Journals (Sweden)

    Pinta, JY.

    2008-01-01

    Full Text Available Pollen Characteristics of Melliferous Plants of the Soudano Guinean Western Highlands of Cameroon. Between November 2000 and 2001, an inventory and pollen characteristics study of major melliferous plants of the Menoua Division in the Western highlands of Cameroon (Latitude North 5° 21.45N- 5°35.44'N and Longitude east 10°04.72- 10°26.24 were carried out. A total of 78 melliferous plants belonging to 33 families were identified. In terms of number of plants, the most-represented species were Asteraceae (12.9%; Solanaceae (8.6%; Euphorbiaceae (7.6%; Myrtaceae and Malvaceae (6.4% respectively in decreasing order. As concerns pollen characteristics inter and intra families variations were recorded. The smallest pollen size (15.7 ± 1.6 μ was found with Leucaena leucocephala while Calliandra callothyrsus had the highest (190.9 ± 7.1 μ. Subcircular pollen form was predominant (Asteraceae 39.2% of the 78 melliferous plants followed respectively by spheric (20.3%; Convovulaceae, elliptic (12.2%; Dacryodes edulis, cordia sp., and triangular (10.8%; Myrtaceae. Melliferous plants with aperturated exine pollen (Ageratum conyzoides, Psidium guayava were predominant (71.7% compared to those without aperturated exine pollen (Manihot esculenta, Croton macrostachyus; 28.2%. Pollen ornamentation also showed a trend of variation between species. Smooth pollen plants (Arachis hypogaea, Psidium guajava were more numerous (46.1%, followed respectively by spined (25.6%; Asteracea, Malvaceae and scabrous pollen species (Casuarina equisetifolia, Musa paradisiaca.

  15. Kiievi kunagise vürsti Izjaslavi oletatavad jäljed Keava linnamäel endiselt leidmata / Enn Haabsaar

    Index Scriptorium Estoniae

    Haabsaar, Enn

    2006-01-01

    Keavas toimuvatest arheoloogilistest kaevamistest, millega püütakse tõestada, et Vene vürst Izjaslav käis 1054. aastal sõjakäigul Eestis. Sisaldab kaarti: Eestlased ja nende naabrid XIII sajandi alul

  16. Actualisation 2015 des recommandations américaines et européennes pour le traitement du diabète de type 2

    OpenAIRE

    Scheen, André; Paquot, Nicolas

    2015-01-01

    The strategy for the management of type 2 diabetes, summarized by a group of experts of the American Diabetes Association (ADA) and the European Association for the Study of Diabetes (EASD), has been updated early 2015. As in the previous position statement published in 2012, a patientcentered approach is recommended and the choice of the best medication, after failure of metformin monotherapy, should be based on the efficacy and safety profile of each pharmacological class. Besides sulfonylu...

  17. Separating liquids. Oppsamlingsutstyr for fjernelse av forurensninger som flyter paa vaesker, saerlig slike som har lavere spesifikk vekt enn vaesken, fortrinnsvis til rensing av oljeholdig kloakkvann eller spillvann

    Energy Technology Data Exchange (ETDEWEB)

    Somogyi, F.; Morva, A.

    1985-04-15

    To remove a contaminating layer of a liquid of lower specific gravity (e.g.oil) floating on a liquid of higher spesific gravity (e.g.seawage), the liquids are forced to flow along a settling tank towards a collector whose open bottom is disposed well below the boundary between the liquids. The top of the collector is sealed to an inclined weir dipping just below the boundary so that the contaminating layer ascends the weir, assisted by air jets from nozzles and flows into the collector. A discharge duct is disposed in the collector with an adjustable inlet arranged in a plane higher than the liquid-liquid boundary but lower than the surface of the contaminating liquid in the collector. The collector and nozzles are supported by floats, and duct is connected to tank outlet by a flexible tube. 1 drawing.

  18. La Banque Européenne pour la Reconstruction et le Développement (BERD) et les mutations en Europe Centrale et Orientale

    CERN Document Server

    1993-01-01

    Contents :"Les pays de l'Est en transition vers l'économie de marché : 1990-1992" by Gérard Wild, "Privatisation en tant que préalable fondamental de la tranformation de l'économie tchèque en économie de marché" by Jan Vit, "Sur les problèmes monétaires" by A. Scannavino, "Le cadre juridique de l'activité économique : sociétés - investissements - privatisations" by Jerzy Rajski, " Le cadre juridique de l'activité économique : contrats et litiges" by Philippe Fouchard and Cestmir Cepelka

  19. Accaparement de terres et droits de l'homme: rôle des sociétés et des entités financières européennes dans l'accaparement de terres en dehors de l'Union européenne

    NARCIS (Netherlands)

    S.M. Borras jr. (Saturnino); P. Seufert (Philip); S. Backes (Stephan); D. Fyfe (Daniel); R. Herre (Roman); E.N. Mills (Elyse); L. Michele (Laura)

    2016-01-01

    textabstractDans les travaux de recherche antérieurs sur l'accaparement de terres, les auteurs se sont initialement intéressés aux sociétés étrangères investissant dans d'autres pays et ont mis notamment l'accent sur les sociétés implantées dans des pays tels que la Chine, les États du Golfe, la

  20. Rapsist diislikütus : kallis ja tõrjutud / Heiki Raudla

    Index Scriptorium Estoniae

    Raudla, Heiki, 1975-

    2008-01-01

    Paldiski Lõunasadamas avatud Biodiesel Paldiski AS tehas loodab tulevikus täisvõimsuse juures toota 100 000 tonni biodiislikütust aastas, praegu eksporditakse kogu toodang peamiselt Lääne-Euroopasse ja Skandinaaviasse. Eesti tarbijale biodiislikütuse tootmist takistab peamiselt tooraine kõrge hind ning vähene nõudlus. Küsimusele vastavad Kai Realo ja Indrek Kaju

  1. Eesti ajalugu Vene-Liivimaa sõjast Põhjasõjani / Lea Kõiv

    Index Scriptorium Estoniae

    Kõiv, Lea, 1961-

    2014-01-01

    Arvustus: Enn Küng, Margus Laidre, Ivar Leimus, Aivar Põldvee, Anti Selart, Marten Seppel, Kai Tafenau, Ülle Tarkiainen, Enn Tarvel. Eesti ajalugu III: Vene-Liivimaa sõjast Põhjasõjani. Tartu, 2013

  2. Reflections on "Twenty Years of Feminist Counseling and Therapy."

    Science.gov (United States)

    Rawlings, Edna I.

    1993-01-01

    Responds to previous article by Carolyn Zerbe Enns on feminist counseling and psychotherapy. Sees Enns's article as a valuable resource and reacts to Enns's article from the perspective of a radical feminist therapist. Discusses the difficulty involved in trying to effectively integrate radical feminism with psychotherapy. (NB)

  3. The Third Decade of Feminist Therapy and the Personal Is Still Political.

    Science.gov (United States)

    Gilbert, Lucia Albino; Rossman, Karen M.

    1993-01-01

    Responds to earlier article by Carolyn Zerbe Enns on feminist counseling and psychotherapy. Asserts that Enns presents concise summary and overview but offers little beyond her examination of "themes of change, agreement, and disagreement." Focuses comments on two topics addressed by Enns: the importance of context and interrelationships…

  4. Pregnancy loss and eye malformations in offspring of F344 rats following gestational exposure to mixtures of regulated trihalomethanes and haloacetic acids

    Science.gov (United States)

    Chlorination of drinking water results in the formation of hundreds of disinfection byproducts (DBPs), the most prevalent are trihalomethanes (THMs) and haloacetic acids (HAAs). Four THMs (chloroform, bromodichloromethane, chlorodibromomethane, bromoform) and five HAAs (chloroac...

  5. Mycotoxin production by Fusarium avenaceum strains isolated from Norwegian grain and the cytotoxicity of rice culture extracts to porcine kidney epithelial cells.

    Science.gov (United States)

    Morrison, Ellen; Kosiak, Barbara; Ritieni, Alberto; Aastveit, Are H; Uhlig, Silvio; Bernhoft, Aksel

    2002-05-08

    The secondary metabolites of 24 isolates of Fusarium avenaceum from Norwegian cereals and grown on rice have been characterized. Moniliformin (MON), enniatins (ENNs), and beauvericin (BEA) were analyzed by high-performance liquid chromatography. Porcine kidney epithelial cells (PK15, American Type Culture Collection) were used to study the cytotoxicity of MON in the extracts. The following metabolites were produced by all isolates, ranked by concentration in rice cultures: ENN-B, MON, ENN-B1, and ENN-A. BEA was produced by eight isolates. The productions of BEA and ENN-A were significantly correlated, as was the case with ENN-B and ENN-B1. MON production was correlated neither to any of the other toxins nor to toxicity.

  6. 8. armee ületab erikäsuga määratud päeval riigipiiri ja tungib peale... : dokumente Eesti sõjalisest okupeerimisest 1940. aasta suvel / Tõnu Tannberg, Enn Tarvel

    Index Scriptorium Estoniae

    Tannberg, Tõnu, 1961-

    2006-01-01

    Balti riikide vastu suunatud otsestest sõjalistest ettevalmistustest NSV Liidus alates 1939. a. septembrist kuni 1940. aasta okupatsioonini Venemaa arhiividest pärit dokumentide alusel. Lisa: NSV Liidu kaitse rahvakomissari direktiiv nr. 02622 9. juunist 1940. aastast Balti Laevastiku lahinguvalmidusse seadmiseks ; Lahingukäsk Punaarmee 8. armeele 13. juunist 1940 Eesti vallutamiseks ; Käsk Punaarmee 8. armee vägedele 22. juunist 1940 asuda lahinguvalmidusse Tartu linnas ; Lahingukäsk Punaarmee 8. armee laskurpolgule 14. juulil 1940 võimalike vastuhakkamiste mahasurumiseks Riigivolikogu valimiste puhul Pärnu- ja Läänemaal

  7. NICOLAS PÉLISSIER, NICOLAE PERPELEA, Du «Eux» au «Nous»: étude d'impact de la construction européenne sur la responsabilité sociale des journalistes

    Directory of Open Access Journals (Sweden)

    CAMELIA BECIU

    2009-03-01

    Full Text Available This study analyzes the media construction of the role of journalists in their relationship with institutional sources and public opinion. The main research questions refer to the influence of the European argument on the way in which journalists define their "mission" and their symbolic identity in the public space. What are the generalization strategies which journalists deploy in order to legitimize their participation in the definition of the post EU-accession period as a public issue? The study uses a constructivist paradigm applied to the European issue. By using a semiotic-discursive methodology, the analysis highlights certain media practices relevant for the Europeanization of the media discourse in Romania. It demonstrates that at the time of the imminent accession to the EU, the press begins to use certain identity themes and imageries, as well as a militant and, at the same time, statutory image of the journalist.

  8. L'évolution des valeurs de soin humain : une analyse dialectique de la proposition d'humanisation de Watson à la lumière d'une perspective nietzschéenne

    OpenAIRE

    Krol, Pawel

    2014-01-01

    La pratique du soin infirmier d’aujourd’hui hérite d’une longue et complexe évolution de valeurs. Outre les valeurs traditionnellement humaines de soigner, la pratique infirmière d’aujourd’hui intègre aussi des valeurs qui façonnent notre monde moderne. Ainsi, nous retraçons d’abord l’évolution de quelques-unes des valeurs traditionnelles rattachées au soin humain conservées dans les pratiques infirmières. Puis, nous montrons que certaines valeurs traditionnelles de soin humain sont progressi...

  9. Rahvusvaheline lõimumist ergutav seminar ehk ребята, давайте жит дружно! / Ülly Enn

    Index Scriptorium Estoniae

    Enn, Ülly

    2008-01-01

    12.-16. oktoobril korraldas Sihtasutuse Archimedes Euroopa Noored Eesti büroo Ida-Virumaal rahvusvahelise seminari "Intercultural dialogue withhout subtitles", kus osalesid Eesti, Läti, Leedu, Saksamaa ja Soome noorsootöötajad

  10. La valorisation des instruments financiers dans les banques européennes entre 2009 et 2011 : valeurs de marché ou valeurs issues de modèles ?

    OpenAIRE

    Dominique Dufour; Gregory Heem

    2013-01-01

    When financial markets are no more active, as in 2008, the question of fair value valuation techniques becomes crucial. IFRS 7 specifies a three-level hierarchy for fair value measurement disclosures: market value, model using significant observable market data and models not using significant observable market data. The aim of this work is to study the evolution of fair value measurement techniques in European Banks since the beginning of the crisis. Our results show that banks ? and more sp...

  11. Étude hydrobiologique d’und rivière de région méditerranéenne, l’Argens (Var, France). Habtats, hydrochimie, distribution de la faune benthique

    NARCIS (Netherlands)

    Giudicelli, Jean; Dia, Aref; Legier, Pierre

    1980-01-01

    This is the first almost complete hydrobiological monograph of a water-course in a low altitude Mediterranean coastal drainage basin. Through knowledge of the hydrological and physicochemical peculiarities as well as an analysis of the biocoenoses, an ecological zonation of the river is established.

  12. Isikuandmete kaitse nõuete rikkumise sanktsioneerimine enne ja pärast Euroopa Liidu andmekaitsereformi valguses : magistritöö / Piret Muinast ; juhendaja: Julia Antonova, kaasjuhendaja: Jaan Sootak ; Tartu Ülikool, õigusteaduskond, karistusõi

    Index Scriptorium Estoniae

    Muinast, Piret

    2018-01-01

    Isikuandmete kaitse õiguslikust regulatsioonist tulenevalt Euroopa Liidu ja Eesti õiguskorrast, vastutusest isikuandmete nõuete rikkumisel Eestis, andmekaitse üldmäärusest tulenevatest sanktsioonidest ja jõustamismeetmetest

  13. La consolidation des co-entreprises en IFRS : étude de l'impact du changement de méthodes pour les sociétés européennes

    OpenAIRE

    David Alexander; Pascale Delvaille; Frédéric Demerens; Anne Le Manh-Béna; Chiara Saccon

    2012-01-01

    This paper explores the conceptual and regulatory arguments concerning financial reporting for joint ventures under IFRS. The new IFRS 11 requires the equity method for joint ventures, this latter being against the preferences of IAS 31 and against recent practice in many entities. After a theoretical exploration of the issues and a summary of the history of the various regulations, we present a content analysis of comment letters on the 2007 Exposure Draft, and an investigation of the IASB E...

  14. Veel enne kui ehitatakse konkreetseid ruume : arhitektuuri ja kunsti suhtest Tallinna kooli arhitektide praktikas = Before the spaces are constructed : concerning the relationship between architecture and art in the practice of the Tallinn school arc

    Index Scriptorium Estoniae

    Laanemets, Mari, 1975-

    2008-01-01

    Kunsti kaasamisest arhitektuuripraktikasse ja -projektidesse. Keskkonna kujundamisest: värvimisest tehismaastikeni. Kui uuslinnadest saavad varemed. Kunstnik-arhitekt: kunstniku-müüdi kultiveerimine arhitektuuris. "Ka mina olen maalija". Näitus kui vahend ja manifest. Bibliograafia lk. 82-85

  15. Variations géographiques de la mortalité due à des maladies justiciables d'une intervention médicale en Europe-Commission des Communautés Européennes

    DEFF Research Database (Denmark)

    Paul, E A; Evans, J; Barry, J

    1989-01-01

    that death within specified age groups should be either wholly or substantially avoidable when appropriate medical care is sought and provided in good time. Mortality from these causes was compared across 360 health-service administrative areas in the participating countries. For all diseases...

  16. Equilibrium constant and nitrogen activity and the parameters of interaction eN(N), rN(N,Cr), rN(N,Mn) in high nitrogen steels of Fe-Cr-Mn-N type

    International Nuclear Information System (INIS)

    Svyazhin, A.G.; Siwka, J.; Rashev, T.

    1999-01-01

    In the paper a description of a thermodynamic of liquid solutions of Fe-Cr-Mn-N type with using a concept of parameters of an interaction has been presented. A temperature relationship of the equilibrium constant K N(Fe) and values of self interaction parameters e N (N) , r N (N,Cr) , r N (N,Mn) and t N (N,Cr,Cr) has been determined for mean values of temperatures of liquid metal equal 1990 K and 2090 K. By application of a theory of regular solutions those values were recalculated for a temperature 1873 K. (orig.)

  17. Le Hodna occidental entre régions méditerranéennes et plaines désertiques : organisation des terroirs, communautés rurales et productions agricoles au Moyen Âge

    Directory of Open Access Journals (Sweden)

    Mohamed Meouak

    2012-12-01

    Full Text Available Les objectifs de notre contribution reposent sur deux axes méthodologiques précis : proposer une lecture critique des sources arabes et offrir un tableau précis des terroirs du Hodna occidental, région située entre la Kabylie maritime et les zones désertiques du Maghreb central à l'époque médiévale. Dans un premier temps, nous concentrerons nos efforts sur les lieux d'activités des communautés rurales afin d'établir un inventaire des diverses structures de peuplement. Dans une deuxième partie, il sera question des principaux aspects de l'organisation tribale comme moteur du peuplement rural dans le Hodna occidental avec la présence fondamentale de groupes arabes, tribus berbères et autres « étrangers ». Enfin dans une troisième et dernière étape, nous essaierons de dresser un tableau des paysages agraires et des productions agricoles en mettant l'accent notamment sur la gestion des espaces agricoles.

  18. Les services de paiement sur le marché de l’Union Européenne et de L’Espace Économique Européen, pendant la crise économique actuelle

    Directory of Open Access Journals (Sweden)

    Alexandru BULEARCĂ

    2011-12-01

    Full Text Available From 1 November 2009 came into force Emergency Ordinance No. 113/2009, which introduced into Romanian legislation the Directive on Payment Services (PSD "Payment Services Directive" applicable in the European Union (EU and European Economic Space (EES. These regulations are intended transparency of banking information for payment services to create a single legal framework at the European Union and European Economic Space in the field of payment services and the protection of consumers of these services. The regulations of the Directive on payment services are applied to all payment transactions in the currency of each Member State of the European Union and European Economic Space, provided that the two banks - the payer's bank and the beneficiary's bank – are located in a Member State. Payment services coming under the impact of new legislation are: payment by bill of exchange, electronic payments, payments by credit card, payments made by direct debit, cash transactions, provided the payment and transfer of funds (the giving of money under conditions of transparency and information to users and to comply with a set of laws and obligations on the part of all those involved in this operation.

  19. Systèmes maraîchers en milieux urbain et périurbain des zones Soudano-sahélienne et Soudano-guinéenne du Cameroun: cas de Garoua et Ngaoundéré

    Directory of Open Access Journals (Sweden)

    Nchoutnji, I.

    2009-01-01

    Full Text Available Horticultural Production Systems in the Soudano-sahelian and Soudano-guinean Agro Ecological Zones of Cameroon: Cases of Garoua and Ngaoundéré. A study was carried out in Garoua (Soudano-Sahelian zone and Ngaoundéré (Soudano-Guinean zone to characterize horticultural production systems. Investigations revealed that more than 500 families cultivated horticultural crops yearly. Two types of legumes are concerned: European legumes (tomato, onion, cabbage… and African legumes (oseille de Guinée, morelle noire…. In Garoua, all types are produced and African legumes are mostly (70% by women. In Ngaoundéré where mainly European legumes are produced, women are about 15.3% of all producers. Producers are not from local origin and are organized in production areas according the type of legumes. In Garoua, there are essentially from the Far North province while those in Ngaoundéré are from the West province. There are of three types: those having many other activities, those cultivating in various lands according to seasons and those exploiting just one season of the year. Chemicals are used when available and doses are not respected. Only those who have financial means easily access to flooded lands. Horticultural crops production is by hand tools. It is an important source of income associated to cotton and small trading. Tomato and onion produced are carried to other town and in neighboring countries. Other crops are locally consumed.

  20. Google (encore) encore soupçonné d'abus de position dominante : Observations sur la Communication des griefs de la Commission Européenne du 20 avril 2016

    OpenAIRE

    Mouron , Philippe

    2016-01-01

    National audience; La Commission, dans cette communication du 20 avril 2016, énonce plusieurs griefs à l'encontre de Google, ceux-ci pouvant faire état d’un abus de position dominante :- les contrats passés avec les fabricants d’appareils mobiles subordonneraient l’octroi de licences pour des applications propriétaires (telles que Playstore) à la préinstallation d’autres applications, dont les plus essentielles pour l’utilisation des smartphones et tablettes (Google Search ou Chrome) ;- ces m...

  1. Créer de nouveaux écosystèmes durables par des méthodes bio-inspirées : le cas des toits verts extensifs en région méditerranéenne

    Directory of Open Access Journals (Sweden)

    DUTOIT, Thierry

    2016-05-01

    Full Text Available Outre l’aspect esthétique, de nombreuses études ont confirmé l’intérêt des toitures végétales dans une perspective de restauration ou de protection de la biodiversité et de l'environnement en milieu urbain. Leur mise en place exige toutefois quelques recommandations quant aux matériaux et techniques utilisés, qui doivent notamment s'inspirer des habitats naturels écologiquement proches. Les objectifs des travaux présentés ici sont d'élaborer et de tester de nouvelles techniques bio-inspirées pour la création de toits verts extensifs en climat méditerranéen sans reccours à l'irrigation permanente.

  2. L’inclusion des personnes handicapées dans l’emploi : Le cas de l'Organisation européenne pour la recherche nucléaire (CERN)

    CERN Document Server

    Martínez-Cabañas Rodríguez, María

    2016-01-01

    Travail effectué dans le cadre d'un stage de recherche appliquée. Le mémoire tente de répondre aux questions suivantes: Quelles sont les différentes mesures prises au CERN pour permettre l'inclusion des personnes en situation de handicap? Quelles sont les principales barrières que les personnes en situation de handicap peuvent rencontrer au CERN au quotidien? Quelles mesures sont nécessaires pour que le CERN puisse atteindre l'inclusion des personnes en situation de handicap ? Le mémoire fait une revue de la literature sur le sujet y compris les textes internationaux. Il analyse la situation au CERN à travers une observation et des entreriens, et construit quelques pistes pour une meilleure inclusion des personnes en situation de handicap.

  3. L'indice biologique global normalisé (IBGN) : principes et évolution dans le cadre de la directive cadre européenne sur l'eau

    OpenAIRE

    Archaimbault , V.; Dumont , B.

    2010-01-01

    Benthic macro-invertebrates are one of the most famous organism groups used for rivers biomonitoring surveys. We propose to describe the French IBGN method (Indice biologique global normalisé) which is based on benthic macro-invertebrates and its evolutionary through the European Water Framework Directive context. / Les macro-invertébrés sont un des groupes d'organismes les plus utilisés mondialement dans de nombreuses méthodes de bio-indication en cours d'eau. Nous vous proposons à travers c...

  4. Optimalisation de l'extraction d'ADN génomique de la morelle jaune (Solanum elaeagnifolium Cav., une plante invasive des milieux cultivés en région méditerranéenne

    Directory of Open Access Journals (Sweden)

    Ripoll, J.

    2011-01-01

    Full Text Available Optimization of the genomic DNA extraction method of silverleaf nightshade (Solanum elaeagnifolium Cav., an invasive plant in the cultivated areas within the Mediterranean region. The geographical origin of an invasive plant in the cultivated area within the Mediterranean region, silverleaf nightshade, Solanum elaeagnifolium Cav. (Solanaceae should be identified through the analysis of genetic similarities between native and introduced populations using microsatellite markers. Beforehand, an effective and less costly method for extracting genomic DNA from dehydrated and polysaccharide-rich leaves was investigated. The original Doyle's protocol based on the use of a cationic detergent, CTAB, was successfully optimized in order to extract high quality DNA (A260/280 ratio of 1.8; A260/230 ratio of 1.7 to 2. The DNA yields obtained with this new protocol were higher than those obtained with a commercial kit, although quality of the DNA extracted was comparable. The improvement of the protocol was further proven by the amplification of several microsatellite loci first developed in eggplant, Solanum melongena L.

  5. Ühiskondlik süüdistus : EV Ülemkohtu esimehe, nõukogude teenelise juristi J. Kirikali, Ülemkohtu liikmete U. Penderi ja A. Viljardi ning EV prokuröri L. Urge vastu / Enn Sarv

    Index Scriptorium Estoniae

    Sarv, Enn, 1921-2008

    1992-01-01

    1991. a. 27. veebruari Ülemkohtu pleenumi määrusest, mis puudutas 1946. a. süüdi mõistetud koolinoori (Ageeda-Andrea Paavel, Aili Jürgenson, Eino Valdmaa, Lia Frei, Juhan Kuusk). Lisatud määruse täistekst

  6. L'effet pro-concurrentiel de l'intégration européenne: une analyse de l'évolution des taux de marge dans les industries manufacturières françaises

    DEFF Research Database (Denmark)

    Bellone, Flora; Musso, Patrick; Nesta, Lionel

    2009-01-01

    We analyse the evolution of French mark-ups and their determinants in manufacturing industries from 1986 to 2004, using an extended version of Roeger's specification. With a value of 13.8%, French mark-ups in manufacturing are found to be slightly above those found by Görg and Warzynski (2006......) in UK manufacturing. Over the period, French mark-ups have gone down by 4 to 5%. We interpret this as being the pro-competitive consequences of European integration. We also find that the implementation of the Euro in 2002 has been associated with an increase of mark-up by 2%. French mark-ups are contra...

  7. La question de l’autosuffisance protéique est-elle définitivement obsolète pour l’Union Européenne ?

    Directory of Open Access Journals (Sweden)

    Mahé Louis-Pascal

    2005-05-01

    Full Text Available Is the issue of European self-sufficiency in vegetal proteins definitely obsolete? The issue is reviewed from two standpoints: economic relevance and political feasibility in regards to international relations. Self sufficiency has a cost in terms of global welfare. Be it defined at the aggregate for food, or even for a core input of the European animal sector such as feed proteins, full self sufficiency is not seen as defensible from an economic standpoint. However food security may be a legitimate objective. It should be pursued by many tools and should first resort to the most efficient ones. Self supply is just one among several. A sensible criterion for a target degree of self sufficiency is when the marginal welfare cost of self sufficiency balances the welfare gain in terms of food security. Given the very low level of coverage of the European demand by domestic sources (20% and due to other risk factors, it seems plausible that an increase in self sufficiency would be appropriate. The political feasibility is low, due to the built-in bias of the CAP in favour of grains. The zero bound tariff in the first GATT round, the Blair House agreement in the Uruguay round have kept the EU in a straight jacket. In the Agenda 2000, the Commission has even anticipated the pressure of the US, probably excessively in view of the extension of flexibility payments to Soya in the 2002 US Farm Act. The concern for increased self sufficiency seems now to have faded away. What is left is mostly a strategy of security through a reliable rule-based trading system. The club of multifunctionnal countries should press exporters to concede the end the derogation to the GATT Article XI which allows them to restrain export in case of shortage. If a crisis on world markets would occur, followed as in the past by embargoes or other export restraints, the issue of self sufficiency would come back to the front scene.

  8. Contribution à l'étude de l'environnement industriel des systèmes de distribution: Le cas de la presse imprimée dans les pays de l'Union Européenne

    OpenAIRE

    YALLES , Ahmed

    2000-01-01

    The present thesis deals with industrialization which takes place within press distribution systems in certain countries of European Union., in particular France, Great Britain, Germany, Italy and Spain. It stresses liberalization and regulation of realization operation of titles diffusion according to mechanisms and processes borrowed from industrial logistics and marketing distributor specific to the sector of the current goods distribution. After introduction constraints and specificities ...

  9. Panga huvide kaitse ja probleemide analüüs krediiditehingutes imporditava kauba tagatisel : [bakalaureusetöö] / Enn Leet ; Tartu Ülikooli Õigusinstituut ; juhendaja: Kaupo Paal

    Index Scriptorium Estoniae

    Leet, Enn

    2004-01-01

    Kaup ja asi, tollilao mõiste ja õiguslik rezhiim, käsipant finantseerimistehingute tagatisena, registerpant, tagatisomandamine, panga positsioon krediidisaaja pankrotimenetluses, panditud asja realiseerimine

  10. Absence d'embryons ou embryons non transférables en ICSI : que dire aux patients ?: Une étude nancéenne et revue de la littérature

    OpenAIRE

    Tomaszewski , Cécile

    2009-01-01

    Non disponible / Not available; Depuis sa découverte, l'essor de la FIV avec micro-injection intra-cytoplasmique du spermatozoïde (FIV-ICSI) est incontestable. La FIV-ICSI a transformé la prise en charge des infertilités, notamment masculines. En outrepassant les échecs de fécondation en FIV classique, la FIV-ICSI a permis une meilleure compréhension des mécanismes de fécondation. Avec des taux de fécondation proches de 70% en ICSI, l'absence de replacement embryonnaire est peu habituelle et ...

  11. Wafik Raouf, L'Europe vue par l'Islam. Une perception ambivalente, L'Harmattan, coll. Histoire et Perspectives Méditerranéennes, Paris, 2000, 239 p.

    Directory of Open Access Journals (Sweden)

    Gilbert Meynier

    2005-03-01

    Full Text Available Un peu différemment de ce que promet le titre, cet ouvrage est une réflexion, ondoyante et diverse, sur les rapports entre civilisations : entre le monde musulman - en fait, surtout le Proche-Orient - et l'Occident - surtout européen. Il rend honnêtement compte de l'imaginaire, bien réel, du contentieux islam-chrétienté, des traumatismes des croi­sades, et du colonialisme. Sans cacher les obstacles et les préjugés, M. Raouf tente de se situer au-delà en composant un péan aux relations intercu...

  12. Biotransformation of the mycotoxin enniatin B1 in pigs: A comparative in vitro and in vivo approach.

    Science.gov (United States)

    Ivanova, Lada; Uhlig, Silvio; Devreese, Mathias; Croubels, Siska; Fæste, Christiane Kruse

    2017-07-01

    Enniatins (ENNs) are hexadepsipeptidic mycotoxins produced by Fusarium species. They occur in mg/kg levels in grain from Northern climate areas. Major ENNs such as ENN B and B1 have shown considerable cytotoxicity in different in vitro test systems. To adequately assess exposure and in vivo toxicity the toxicokinetic properties need to be investigated. The present study describes the metabolism of ENN B1 both in vitro and in vivo in pigs, comparing metabolites found in vitro in experiments with liver microsomes from different pig strains to those found in the plasma of pigs after single oral or intravenous application of ENN B1. Metabolites of hepatic biotransformation were tentatively identified and characterised by high performance liquid chromatography coupled to ion trap and high-resolution mass spectrometry, as well as chemical derivatisations. Kinetic parameters of metabolite formation and elimination were determined. Metabolite formation was higher when ENN B1 was absorbed from the gut compared to intravenous administration indicating pre-systemic metabolism of ENN B1 after oral uptake. The in vitro approach resulted in the detection of ten ENN B1 metabolites, while six were detected in in vivo samples. The putative ENN B1 metabolites were products of hydroxylation, carbonylation, carboxylation and oxidative demethylation reactions. Copyright © 2017. Published by Elsevier Ltd.

  13. E-tervise portaalis on turvaauk / Kadri Ibrus

    Index Scriptorium Estoniae

    Ibrus, Kadri

    2010-01-01

    Patsient teatas andmekaitse inspektsioonile, et tervise infosüsteemi patsiendiportaali ID-kaardiga sisse logides avanesid talle enne teda portaali kasutanud isiku terviseandmed. Sotsiaalministeeriumi vastusest

  14. Putin ja Bush pakuvad peaministreid / Toomas Alatalu

    Index Scriptorium Estoniae

    Alatalu, Toomas, 1942-

    2004-01-01

    Venemaa presidendi Vladimir Putini otsusest enne presidendivalimisi tagandada valitsus. USA presidendi George W. Bushi probleemist Haiti presidendi ja peaministri ametikohaga seoses riigis valitseva kriisiga

  15. Chronic Dietary Intake of Enniatin B in Broiler Chickens Has Low Impact on Intestinal Morphometry and Hepatic Histology, and Shows Limited Transfer to Liver Tissue

    Directory of Open Access Journals (Sweden)

    Sophie Fraeyman

    2018-01-01

    Full Text Available The Fusarium mycotoxin enniatin B (ENN B is a so-called emerging mycotoxin frequently contaminating poultry feed. To investigate the impact of chronic ENN B exposure on animal health, broiler chickens were fed either a diet naturally contaminated with ENN B (2352 µg/kg or a control diet (135 µg/kg for 2, 7, 14, or 21 days. ENN B concentrations were determined in plasma and liver using a validated ultra-high performance liquid chromatography—tandem mass spectrometry UHPLC-MS/MS method. Liver was evaluated histologically, and the villus length and crypt depth of the duodenum, jejunum, and ileum were measured. Histopathology of the livers did not reveal major abnormalities. Feeding an ENN B-contaminated diet could possibly inhibit the proliferation of enterocytes in the duodenal crypts, but did not affect villus length, crypt depth, or villus length-crypt depth ratio of the jejunum and ileum. ENN B levels in plasma and liver were significantly higher in the ENN B-fed group and ranged between <25–264 pg/mL and <0.05–0.85 ng/g, respectively. ENN B carry-over rates from feed to liver tissue were 0.005–0.014% and 0.034–0.109% in the ENN B and control group, respectively. Carry-over rates were low and indicated a limited contribution of poultry tissue-derived products to the total dietary ENN B intake for humans. The above results support the opinion of the European Food Safety Authority stating that adverse health effects from ENN B in broiler chickens are unlikely.

  16. Recovery from hospital-acquired anemia after acute myocardial infarction and effect on outcomes.

    Science.gov (United States)

    Salisbury, Adam C; Kosiborod, Mikhail; Amin, Amit P; Reid, Kimberly J; Alexander, Karen P; Spertus, John A; Masoudi, Frederick A

    2011-10-01

    New-onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. The patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center Translational Research Investigating Underlying disparities in acute myocardial infarction Patients' Health Status (TRIUMPH) registry, we identified 530 patients with AMI and HAA (defined as normal hemoglobin at admission with the development of anemia by discharge) who had a repeat, protocol-driven hemoglobin measurement at 1 month after discharge. The 1-month measures were used to define persistent (persistent anemia) and transient (anemia resolved) HAA. The patients' health status was assessed at 1, 6, and 12 months after AMI using the Short-Form 12 Physical Component Summary, and the health status of patients with persistent and transient HAA was compared using multivariate repeated measures regression analysis. Mortality was compared using the log-rank test and proportional hazards regression analysis. Overall, 165 patients (31%) developed persistent HAA. The adjusted mean Short-Form 12 Physical Component Summary scores at the follow-up visit were significantly lower in those with persistent HAA than in those with transient HAA (-2.0 points, 95% confidence interval -3.6 to -0.3; p = 0.02). During a median follow-up of 36 months, the crude mortality (13% vs 5%, p = 0.002) and multivariate-adjusted mortality (hazard ratio 2.08, 95% confidence interval 1.02 to 4.21, p = 0.04) was greater in patients with persistent HAA. In conclusion, HAA persists 1 month after discharge in nearly 1 of 3 patients and is associated with worse health status and greater mortality. Additional investigation is needed to understand whether HAA prevention, recognition, and treatment, particularly among those with persistent HAA, will improve outcomes. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Recovery from Hospital-Acquired Anemia after Acute Myocardial Infarction and Effect on Outcomes

    OpenAIRE

    Salisbury, Adam C.; Kosiborod, Mikhail; Amin, Amit P.; Reid, Kimberly J.; Alexander, Karen P.; Spertus, John A.; Masoudi, Frederick A.

    2011-01-01

    New onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. Patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center TRIUMPH registry, we identified 530 AMI patients with HAA (defined as normal hemoglobin at admission with development of anemia by discharge) who had repeat, protocol-driven hemoglobin measurement 1 month after discharge. The 1-m...

  18. Anodic dissolution of samarium in acetonitrile solution of acetylacetone

    International Nuclear Information System (INIS)

    Kostyuk, N.N.; Dik, T.A.; Trebnikov, A.G.; Shirokij, V.L.

    2003-01-01

    Electrochemical dissolution of metal samarium in acetonitrile medium in the presence of 0.1 M tetraethylammoniumbromide and 0.9 M acetylacetone (HAA) in argon atmosphere under a voltage of 3 V was considered for studying feasibility of electrochemical synthesis of samarium β-diketonates. Using IR and mass spectrometry, thermal and elementary analyses it was ascertained that, depending on cathode and anode areas ratio, anodic dissolution of samarium can give rise to formation of complexes of bi- and trivalent samarium featuring the composition Sm 4 (AA) 8 · 3HAA, Sm(AA) 3 · HAA and Sm(AA) 3 · 4HAA [ru

  19. Reducing and verifying haloacetic acids in treated drinking water using a biological filter system.

    Science.gov (United States)

    Lou, Jie C; Chan, Hung Y; Yang, Chih Y; Tseng, Wei B; Han, Jia Y

    2014-01-01

    This study focused on reducing the haloacetic acid (HAA) concentrations in treated drinking water. HAA has been thought to be one possible nutrient supporting heterotrophic bacteria regrowth in drinking water. In this study, experiments were conducted using a pilot-scale system to evaluate the efficiency of biological filters (BF) for reducing excess HAA concentrations in water. The BF system reduced the total HAA concentration and the concentrations of five HAA species in the water. Dichloroacetic acid (DCAA), monobromoacetic acid (MBAA) and dibromoacetic acid (DBAA) were the three main HAA5 species that were present in the treated drinking water in this investigation. Combined, these three species represent approximately 77% of the HAA5 in the finished water after BF. The verification of the empirical HAA equation for the outlet in the BF system indicated linear relationships with high correlation coefficients. The empirical equation for the HAA5 concentrations in the finished water was established by examining other nutrients (e.g., dissolved organic carbon (DOC), ultraviolet absorbance at 254 nm wavelength (UV254), and ammonia nitrogen) that can reduce pathogenic contamination. These findings may be useful for designing advanced processes for conventional water treatment plants or for managing water treatment and distribution systems for providing high-quality drinking water.

  20. Kehalise väärkohtlemise ja avaliku korra raske rikkumise eristamine : magistritöö / Reelika Ratassepp ; juhendaja Jaan Ginter ; Tartu Ülikool, sotsiaalteaduste valdkond, õigusteaduskond, karistusõiguse osakond

    Index Scriptorium Estoniae

    Ratassepp, Reelika, 1992-

    2018-01-01

    Kehalise väärkohtlemise koosseisust enne karistusõiguse revisjoni 1. jaanuaril 2015. Avaliku korra mõistest, avalikus kohas käitumise üldnõudetest ning avaliku korra raskest rikkumisest enne korrakaitseseaduse jõustumis ja pärast jõustumist

  1. Põhjalik koguteos Rootsi võidust / Kaarel Vanamölder

    Index Scriptorium Estoniae

    Vanamölder, Kaarel, 1981-

    2015-01-01

    Arvustus: Enn Küng, Margus Laidre, Ivar Leimus, Aivar Põldvee, Anti Selart, Marten Seppel, Kai Tafenau, Ülle Tarkiainen, Enn Tarvel. Eesti ajalugu III: Vene-Liivimaa sõjast Põhjasõjani. Tartu : Tartu Ülikooli Ajaloo ja arheoloogia instituut, 2013

  2. [Eesti ajalugu III: Vene-Liivimaa sõjast Põhjasõjani] / Kalle Kroon

    Index Scriptorium Estoniae

    Kroon, Kalle, 1966-

    2014-01-01

    Arvustus. Enn Küng, Margus Laidre, Ivar Leimus, Aivar Põldvee, Anti Selart, Marten Sepepl, Kai Tafenau, Ülle Tarkiainen, Enn Tarvel. Eesti ajalugu III: Vene-Liivimaa sõjast Põhjasõjani. Tartu: Tartu Ülikooli Ajaloo ja Arheoloogia Instituut, 2013

  3. The Clerical Establishment in Iran

    Science.gov (United States)

    1989-06-01

    Political Action and Legitimate Domi- nation in Shi’ite Iran: Fourteenth to Eighteenth Centuries, A.D.," Archives Europ~ennes de Sociologie , Vol. 20, No...139 Archives Europ6ennes de Sociologie Bours, (moderate centrist) weekly in Persian, Tehran Conflict Studies, quarterly in English, London Enghelab

  4. Eesti kunstiaarded rändasid üle mere: "Ma poleks õiglane, kui hoiaksin maalid vaid endale" / Oliver Õunmaa

    Index Scriptorium Estoniae

    Õunmaa, Oliver

    2010-01-01

    Eesti maalikunsti ülevaatenäitus "Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kogust" Helsingi Taidehallis 24. novembrini 2010. Enn Kunila, näituse kuraatori Harry Liivranna, Helsingi kunstihoone juhataja kohusetäitja Taru Tappola kommentaarid. Näituse kujundas Olev Subbi, soomekeelse raamatu näituse kohta koostas Eero Epner

  5. Helsingis avatakse suur Eesti maalinäitus

    Index Scriptorium Estoniae

    2010-01-01

    Eesti maalikunsti ülevaatenäitus "Viron värit - 150 vuotta virolaista maalaustaideta Enn Kunilan kokoelamasta" ("Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kogust") Helsingi kunstihoones (Helsingin Taidehalli) 16. oktoobrist 24. novembrini 2010. Näituse kuraator Harry Liivrand, kujundaja Olev Subbi. Väljapanekut saatva raamatu on koostanud Eero Epner, kujundanud Tiit Jürna

  6. В Хельсинки открылась выставка эстонской живописи

    Index Scriptorium Estoniae

    2010-01-01

    Helsingi kunstihoones (Helsingin Taidehalli) avati 15. oktoobril Eesti maalikunsti ülevaatenäitus "Viron värit - 150 vuotta virolaista maalaustaideta Enn Kunilan kokoelamasta" ("Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kogust"). Kuraator Harry Liivrand, kujundaja Olev Subbi. Helsingis on "Viron värit" avatud 24. novembrini

  7. A Review of the Mycotoxin Enniatin B

    Directory of Open Access Journals (Sweden)

    Alessandra Prosperini

    2017-11-01

    Full Text Available Mycotoxin enniatin B (ENN B is a secondary metabolism product by Fusarium fungi. It is a well-known antibacterial, antihelmintic, antifungal, herbicidal, and insecticidal compound. It has been found as a contaminant in several food commodities, particularly in cereal grains, co-occurring also with other mycotoxins. The primary mechanism of action of ENN B is mainly due to its ionophoric characteristics, but the exact mechanism is still unclear. In the last two decades, it has been a topic of great interest since its potent mammalian cytotoxic activity was demonstrated in several mammalian cell lines. Moreover, the co-exposure in vitro with other mycotoxins enhances its toxic potential through synergic effects, depending on the concentrations tested. Despite its clear cytotoxic effect, European Food Safety Authority stated that acute exposure to ENNs, such as ENN B, does not indicate concern for human health, but a concern might be the chronic exposure. However, given the lack of relevant toxicity data, no firm conclusion could be drawn and a risk assessment was not possible. In fact, very few studies have been carried out in vivo and, in these studies, no adverse effects were observed. So, research on toxicological effects induced by ENN B is still on-going. Recently, some studies are dealing with new advances regarding ENN B. This review summarizes the information on biochemical and biological activity of ENN B, focusing on toxicological aspects and on the latest advances in research on ENN B.

  8. Feminist Therapy: Not for or by White Women Only.

    Science.gov (United States)

    Espin, Olivia M.

    1993-01-01

    Responds to earlier article by Carolyn Zerbe Enns on feminist counseling and psychotherapy, noting that Enns could have elaborated on what the challenge of multiculturalism meant for the future of feminist therapy and counseling. Asserts that tendency to overgeneralize from data and information gathered from experience of white women continues for…

  9. Feminist Counseling/Therapy for the 21st Century.

    Science.gov (United States)

    Worell, Judith; Robinson, Damon

    1993-01-01

    Responds to earlier article by Carolyn Zerbe Enns on feminist counseling and psychotherapy. Acknowledges productive impact of Enns's review, but raises some concerns related to the conception of history and some of the conclusions that are reached. Discusses two important parameters that merit more attention, focusing on the future of feminist…

  10. Improved Extension Neural Network and Its Applications

    Directory of Open Access Journals (Sweden)

    Yu Zhou

    2014-01-01

    Full Text Available Extension neural network (ENN is a new neural network that is a combination of extension theory and artificial neural network (ANN. The learning algorithm of ENN is based on supervised learning algorithm. One of important issues in the field of classification and recognition of ENN is how to achieve the best possible classifier with a small number of labeled training data. Training data selection is an effective approach to solve this issue. In this work, in order to improve the supervised learning performance and expand the engineering application range of ENN, we use a novel data selection method based on shadowed sets to refine the training data set of ENN. Firstly, we use clustering algorithm to label the data and induce shadowed sets. Then, in the framework of shadowed sets, the samples located around each cluster centers (core data and the borders between clusters (boundary data are selected as training data. Lastly, we use selected data to train ENN. Compared with traditional ENN, the proposed improved ENN (IENN has a better performance. Moreover, IENN is independent of the supervised learning algorithms and initial labeled data. Experimental results verify the effectiveness and applicability of our proposed work.

  11. Enniatin A1, enniatin B1 and beauvericin on HepG2: Evaluation of toxic effects.

    Science.gov (United States)

    Juan-García, Ana; Ruiz, María-José; Font, Guillermina; Manyes, Lara

    2015-10-01

    Hepatotoxicity of three Fusarium mycotoxins, beauvericin (BEA) and two enniatins (ENNs) ENN A1 and ENN B1, in hepatocarcinoma cells (HepG2) were evaluated and compared. Concentrations used were 1.5 and 3 μM at 24, 48 and 72 h for each mycotoxin. Flow cytometry was used to examine enniatins effects on cell proliferation, to characterize the cell cycle phase where the cells blocked and to study the mitochondria role in ENNs-induced apoptosis. ENN B1 treated cells showed a time dependent G1 blockade at both concentrations used. ENN A1 and BEA decreased the apoptotic-necrotic percentage of cells comparing to control and disrupted the MMP as observed by TMRM and ToPro-3 fluorochromes signal. It is proposed a decreasing mycotoxin order by number of effects as follows: BEA > ENN B1 > ENN A1, with 47, 20 and 16%, respectively out of all situations compared. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Involvement of enniatins-induced cytotoxicity in human HepG2 cells.

    Science.gov (United States)

    Juan-García, Ana; Manyes, Lara; Ruiz, María-José; Font, Guillermina

    2013-04-12

    Enniatins (ENNs) are mycotoxins found in Fusarium fungi and they appear in nature as mixtures of cyclic depsipeptides. The ability to form ionophores in the cell membrane is related to their cytotoxicity. Changes in ion distribution between inner and outer phases of the mitochondria affect to their metabolism, proton gradient, and chemiosmotic coupling, so a mitochondrial toxicity analysis of enniatins is highly recommended because they host the homeostasis required for cellular survival. Two ENNs, ENN A and ENN B on hepatocarcinoma cells (HepG2) at 1.5 and 3 μM and three exposure times (24, 48 and 72 h) were studied. Flow cytometry was used to examine their effects on cell proliferation, to characterize at which phase of the cell cycle progression the cells were blocked and to study the role of the mitochondrial in ENNs-induced apoptosis. In conclusion, apoptosis induction on HepG2 cells allowed to compare cytotoxic effects caused by both ENNs, A and B. It is reported the possible mechanism observed in MMP changes, cell cycle analysis and apoptosis/necrosis, identifying ENN B more toxic than ENN A. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  13. Enniatin B-induced cell death and inflammatory responses in RAW 267.4 murine macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Gammelsrud, A. [Norwegian Veterinary Institute, P.O. Box 750, Centrum, N-0106 Oslo (Norway); Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway); Solhaug, A. [Norwegian Veterinary Institute, P.O. Box 750, Centrum, N-0106 Oslo (Norway); Dendelé, B. [EA 4427 SeRAIC, IRSET, Université de Rennes 1, IFR 140, Rennes (France); Sandberg, W.J. [Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway); Ivanova, L. [Norwegian Veterinary Institute, P.O. Box 750, Centrum, N-0106 Oslo (Norway); Kocbach Bølling, A. [Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway); Lagadic-Gossmann, D. [EA 4427 SeRAIC, IRSET, Université de Rennes 1, IFR 140, Rennes (France); Refsnes, M.; Becher, R. [Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway); Eriksen, G. [Norwegian Veterinary Institute, P.O. Box 750, Centrum, N-0106 Oslo (Norway); Holme, J.A., E-mail: jorn.holme@fhi.no [Department of Air Pollution and Noise, Division of Environmental Medicine, Norwegian Institute of Public Health, N-0403 Oslo (Norway)

    2012-05-15

    The mycotoxin enniatin B (EnnB) is predominantly produced by species of the Fusarium genera, and often found in grain. The cytotoxic effect of EnnB has been suggested to be related to its ability to form ionophores in cell membranes. The present study examines the effects of EnnB on cell death, differentiation, proliferation and pro-inflammatory responses in the murine monocyte–macrophage cell line RAW 264.7. Exposure to EnnB for 24 h caused an accumulation of cells in the G0/G1-phase with a corresponding decrease in cyclin D1. This cell cycle-arrest was possibly also linked to the reduced cellular ability to capture and internalize receptors as illustrated by the lipid marker ganglioside GM1. EnnB also increased the number of apoptotic, early apoptotic and necrotic cells, as well as cells with elongated spindle-like morphology. The Neutral Red assay indicated that EnnB induced lysosomal damage; supported by transmission electron microscopy (TEM) showing accumulation of lipids inside the lysosomes forming lamellar structures/myelin bodies. Enhanced levels of activated caspase-1 were observed after EnnB exposure and the caspase-1 specific inhibitor ZYVAD-FMK reduced EnnB-induced apoptosis. Moreover, EnnB increased the release of interleukin-1beta (IL-1β) in cells primed with lipopolysaccharide (LPS), and this response was reduced by both ZYVAD-FMK and the cathepsin B inhibitor CA-074Me. In conclusion, EnnB was found to induce cell cycle arrest, cell death and inflammation. Caspase-1 appeared to be involved in the apoptosis and release of IL-1β and possibly activation of the inflammasome through lysosomal damage and leakage of cathepsin B. -- Highlights: ► The mycotoxin EnnB induced cell cycle arrest, cell death and inflammation. ► The G0/G1-arrest was linked to a reduced ability to internalize receptors. ► EnnB caused lysosomal damage, leakage of cathepsin B and caspase-1 cleavage. ► Caspase-1 was partly involved in both apoptosis and release of IL-1

  14. Enniatin B-induced cell death and inflammatory responses in RAW 267.4 murine macrophages

    International Nuclear Information System (INIS)

    Gammelsrud, A.; Solhaug, A.; Dendelé, B.; Sandberg, W.J.; Ivanova, L.; Kocbach Bølling, A.; Lagadic-Gossmann, D.; Refsnes, M.; Becher, R.; Eriksen, G.; Holme, J.A.

    2012-01-01

    The mycotoxin enniatin B (EnnB) is predominantly produced by species of the Fusarium genera, and often found in grain. The cytotoxic effect of EnnB has been suggested to be related to its ability to form ionophores in cell membranes. The present study examines the effects of EnnB on cell death, differentiation, proliferation and pro-inflammatory responses in the murine monocyte–macrophage cell line RAW 264.7. Exposure to EnnB for 24 h caused an accumulation of cells in the G0/G1-phase with a corresponding decrease in cyclin D1. This cell cycle-arrest was possibly also linked to the reduced cellular ability to capture and internalize receptors as illustrated by the lipid marker ganglioside GM1. EnnB also increased the number of apoptotic, early apoptotic and necrotic cells, as well as cells with elongated spindle-like morphology. The Neutral Red assay indicated that EnnB induced lysosomal damage; supported by transmission electron microscopy (TEM) showing accumulation of lipids inside the lysosomes forming lamellar structures/myelin bodies. Enhanced levels of activated caspase-1 were observed after EnnB exposure and the caspase-1 specific inhibitor ZYVAD-FMK reduced EnnB-induced apoptosis. Moreover, EnnB increased the release of interleukin-1beta (IL-1β) in cells primed with lipopolysaccharide (LPS), and this response was reduced by both ZYVAD-FMK and the cathepsin B inhibitor CA-074Me. In conclusion, EnnB was found to induce cell cycle arrest, cell death and inflammation. Caspase-1 appeared to be involved in the apoptosis and release of IL-1β and possibly activation of the inflammasome through lysosomal damage and leakage of cathepsin B. -- Highlights: ► The mycotoxin EnnB induced cell cycle arrest, cell death and inflammation. ► The G0/G1-arrest was linked to a reduced ability to internalize receptors. ► EnnB caused lysosomal damage, leakage of cathepsin B and caspase-1 cleavage. ► Caspase-1 was partly involved in both apoptosis and release of IL-1

  15. Reproductive toxicity of a mixture of regulated drinking-water disinfection by-products in a multigenerational rat bioassay

    Science.gov (United States)

    BACKGROUND:Trihalomethanes (THMs) and haloaretic acids (HAAs) are regulated disinfection by-products (DBPs); their joint reproductive toxicity in drinking water is unknown.OBJECTIVE: We aimed to evaluate a drinking water mixture of the four regulated THMs and five regulated HAAs ...

  16. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    (TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

  17. Pressure-assisted electrokinetic injection for on-line enrichment in capillary electrophoresis-mass spectrometry: a sensitive method for measurement of ten haloacetic acids in drinking water.

    Science.gov (United States)

    Zhang, Huijuan; Zhu, Jiping; Aranda-Rodriguez, Rocio; Feng, Yong-Lai

    2011-11-07

    Haloacetic acids (HAAs) are by-products of the chlorination of drinking water containing natural organic matter and bromide. A simple and sensitive method has been developed for determination of ten HAAs in drinking water. The pressure-assisted electrokinetic injection (PAEKI), an on-line enrichment technique, was employed to introduce the sample into a capillary electrophoresis (CE)-electrospray ionization-tandem mass spectrometry system (ESI-MS/MS). HAAs were monitored in selected reaction monitoring mode. With 3 min of PAEKI time, the ten major HAAs (HAA10) in drinking water were enriched up to 20,000-fold into the capillary without compromising resolution. A simple solid phase clean-up method has been developed to eliminate the influence of ionic matrices from drinking water on PAEKI. Under conditions optimized for mass spectrometry, PAEKI and capillary electrophoresis, detection limits defined as three times ratio of signal to noise have been achieved in a range of 0.013-0.12 μg L(-1) for ten HAAs in water sample. The overall recoveries for all ten HAAs in drinking water samples were between 76 and 125%. Six HAAs including monochloro- (MCAA), dichloro- (DCAA), trichloro- (TCAA), monobromo- (MBAA), bromochloro- (BCAA), and bromodichloroacetic acids (BDCAA) were found in tap water samples collected. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  18. Algues unicellulaires marines : composition et prospectives.- Xèmes journées européennes de cosmétologie : Produits marins et plantes en thérapeutique et cosmétologie, 27, 28 et 29 janvier 1986

    OpenAIRE

    Lassus, Patrick

    1986-01-01

    Le développement croissant des cultures intensives d'algues unicellulaires marines pour l'aquaculture pose aujourd'hui le problème non seulement de la valeur nutritive de ces organismes mais également des ouvertures possibles vers un marché plus spécialisé en pharmacologie et cosmétologie. En effet, tant au niveau des propriétés étonnantes de certains produits d'excrétions (hydrates de carbone, biotoxines, antibiotiques) que des constituants de base (en particulier lipides et aminoacides) ...

  19. La circulation des déchets au sein de l’Union européenne. Etude des rapports entre le régime mis en place par le Titre II du Règlement n°1013/2006 et la circulation des marchandises.

    OpenAIRE

    Krack, Noémie

    2017-01-01

    La gestion des déchets n’a pas toujours été une priorité pour nos sociétés, et ce même si les Romains et les Grecs faisaient figure de précurseurs. Les découvertes scientifiques relatives aux épidémies de grandes ampleurs, telle la peste noire, démontrèrent l’importance d’un traitement correct des déchets. En effet, leur abandon et leur accumulation sont responsables de la prolifération de germes et microbes pathogènes. Or il faut savoir qu’à l’époque les cités occidentales étaient malsaines ...

  20. L´évaluation des systèmes éducatifs dans les pays de I´Union Européenne: d’une nécessité problématique à une pratique complexe souhaitable

    Directory of Open Access Journals (Sweden)

    Pascal Roggero

    2002-01-01

    Full Text Available After investing numerous public politics, the process of evaluation reaches the education world. This process, which does not go without any trouble, nevertheless becomes widespread in the whole countries of the European Union. By combining the analysis of the institutional forms and the procedures used on one hand, and the representations which found them on the other hand, it is possible to define three big models of evaluation: the English, French and Finnish models. If it seems justifiable that organizations and educational systems are equipped with instruments of piloting as the evaluation, there is no need to reduce the question only to the technical level. The evaluation is a political question which supposes a collective and democratic consideration on the missions of the school, which is not generally carried out. The most powerful interests groups often appear thus in measure to press on this debate. Another influence appears with the comparisons among the European educational systems, made by the international body of expertises. Thus there is a risk of seeing a technical international evaluation by transparency on the own political foundations acting in the sense of educational systems normalization. In these conditions, the auto-evaluation, a complex process, by which an educational community deliberates on its ends in contact with its local environment and gives the means to know, and this to modify its action, seems at once more mobilizing and more in agreement with the social systems variety.

  1. Normes religieuses et identité civique dans les cités de Grèce égéenne (IIe siècle av. J.-C.-IIIe siècle ap. J.-C.

    Directory of Open Access Journals (Sweden)

    Yves Lafond

    2010-04-01

    Full Text Available Un règlement athénien, daté du IIe siècle de notre ère, nous plonge dans une séance de l’assemblée des Iobacches convoquée pour ratifier les statuts (δόγματα présentés à l’occasion d’un renouvellement du prêtre et du vice-prêtre de l’association. La lecture des statuts soulève les acclamations : « Observons-les (ces statuts pour toujours », τούτοις ἀεὶ χρώμεθα,« Restitue les statuts », ἀνάκτησαι τ’ ὰ δόγματα, « Qu’on mette les statuts sur une stèle », ἐν στήλῃ τὰ δόγματα. Il est alors procé...

  2. Superposition de la tectonique éburnéenne et panafricaine dans les granitoïdes de la bordure nord du craton ouest africain, boutonniére de Zenaga, Anti-Atlas central, Maroc(Pan-african overprint on Eburnian granitoids at the northern boundary of the West African Craton, Zenaga Inlier, central Anti-Atlas, Morocco)

    Science.gov (United States)

    Ennih, N.; Laduron, D.; Greiling, R. O.; Errami, E.; de Wall, H.; Boutaleb, M.

    2001-05-01

    The Zenaga Inlier shows a comprehensive record of the Eburnian and Pan-African Orogenies. The Eburnian is characterised by high-temperature regional metamorphism and complex magmatism. The early (Azguemerzi) granodiorite has an isotopic mantle signature and was emplaced diapirically during the Eburnian Orogeny causing local thermal metamorphism. The foliation observed in this granitoid is a result of the interference between its primary syn-emplacement foliation and the regional foliation under amphibolite-facies conditions. The northern part of Zenaga has been intruded by the leucocratic granites of Tazenakht. These granites are cut by mylonites and phyllonites, corresponding to the Pan-African shear zones and accompanied with sub-greenschist-facies metamorphism during the Pan-African Orogeny. The deformation was the result of a regional sinistral transpressive event. This study in the northern part of the West African Craton shows the superposition of the Pan-African on the Eburnian Orogeny and the presence of a major fault in the Anti-Atlas.

  3. Les transformations des relations euro-méditerranéennes après le cinquième élargissement de l’UE : Portée et limites des cadres de voisinage euro-méditerranéens

    OpenAIRE

    Mourad , Ali

    2014-01-01

    With the launch of the Euro-Mediterranean Partnership (EMP) in 1995, the relation between the relationship between the EU and Mediterranean countries witnessed a significant evolution. With the establishment of a multilateral framework supplemented by the conclusion of association agreements, this Partnership represents a break with past Mediterranean policies. In the context of the fifth enlargement of the European Union on May 1st, 2004, the European Neighbourhood Policy (ENP) transforms th...

  4. Impact de l'érosion sur l'envasement des barrages, la recharge des nappes phréatiques côtières et les intrusions marines dans la zone semi-aride méditerranéenne : cas du barrage de Boukourdane (Algérie

    Directory of Open Access Journals (Sweden)

    Tadrist, N.

    2016-01-01

    Full Text Available Impact of erosion on the silting of dams, on the recharging groundwater and on coastal marine intrusion in the Mediterranean semi-arid area: Case of Boukourdane dam (Algeria. Description of the subject. Water erosion is a particularly important issue, especially in the Mediterranean and semi-arid zone. This zone is characterized by irregular rainfall patterns, which have a considerable influence on soil loss. In mountainous areas, water erosion phenomena are accentuated by steep slopes and low ground cover. The dams draining these areas undergo siltation linked to significant erosion. The silting of the dams drastically limits their capacity and thus their operating life. When used for recharging aquifers, the resuspension of fine particles may accumulate in the recharge areas and reduce infiltration capacity by clogging soil porosity. This leads to a significant reduction of groundwater levels. Additionally, groundwater situated in the coastal zone is submitted to intensive pumping. These two phenomena make groundwater particularly sensitive to marine intrusions. Objectives. This article aims, on the one hand to quantify the rate of siltation in the case of the Boukourdane dam (northern Algeria, which is used to recharge groundwater. On the other hand, the article also shows the reduction in permeability in the capturing field with the current management of releases. Method. Solid rates were set in relation to the liquid flow and sediment concentration occasionally taken from the wadi. The relation established made it possible to evaluate the solid contributions to the dam of Boukourdane. The impact of the releases on recharging the well field was evaluated by grouping wells and the well field mushrooms using heuristic k-means. Regressions were applied to the piezometric variations of each group. Results. This dam is fed by a catchment area of 156 km². Sediment transport was estimated from empirical formulas. The specific degradation rate was estimated at 366 t·km-2·year-1 during the 1993 to 2005 period. The increase in the frequency of extreme rainfall resulted in an increase in the soil erosion rate to 446 t·km-2·year-1 during the 1993 to 2013 period. The volume of sediments accumulated in the dam reached 8·104 m³·year-1 and 11·104 m³·year-1 respectively during these two periods. Conclusions. A change in the management of current releases has a positive impact on the partial restoration of the hydraulic conductivity and de facto, on the fight against marine intrusion.

  5. Search of new scintillation materials for nuclear medicine application

    CERN Document Server

    Korzhik, M

    2001-01-01

    Oxide crystals have a great potential to develop new advanced scintillation materials which are dense, fast, and bright. This combination of parameters, when combined to affordable price, gives a prospect for materials to be applied in nuclear medicine devices. Some of them have been developed for the last two decades along the line of rear-earth (RE) garnet (RE//3Al//5O//1//2) oxiorthosilicate (RE//2SiO//5) and perovskite (REAlO//3) crystals doped with Ce ions. Among recently developed oxide materials the lead tungstate scintillator (PWO) becomes the most used scintillation materials in high energy physics experiments due to its application in CMS and ALICE experiments at LHC. In this paper we discuss scintillation properties of some new heavy compounds doped with Ce as well as light yield improvement of PWO crystals to apply them in low energy physics and nuclear medicine. 18 Refs.

  6. smport nt rust l growth in the h nerozoi X ssotopi eviden e of gr ...

    Indian Academy of Sciences (India)

    smport nt rust l growth in the h nerozoi X ssotopi eviden e of gr nitoids from e stE entr l esi fy Ewsxq terx. ID p ex. IDP nd he is ryxqQ. Iq eos ien es ennesD niversit e de ennes ID QSHRP ennes gedexD pr n e em ilX j hndunivErennesIFfr. Phep rtment of qeologyD gh ng hun niversity of ien e nd e hnologyD gh ng hun IQH ...

  7. Disrupted lymphocyte homeostasis in hepatitis‐associated acquired aplastic anemia is associated with short telomeres

    Science.gov (United States)

    Babushok, Daria V.; Grignon, Anne‐Laure; Li, Yimei; Atienza, Jamie; Xie, Hongbo M.; Lam, Ho‐Sun; Hartung, Helge; Bessler, Monica

    2016-01-01

    Hepatitis‐associated aplastic anemia (HAA) is a variant of acquired aplastic anemia (AA) in which immune‐mediated bone marrow failure (BMF) develops following an acute episode of seronegative hepatitis. Dyskeratosis congenita (DC) is an inherited BMF syndrome characterized by the presence of short telomeres, mucocutaneous abnormalities, and cancer predisposition. While both conditions may cause BMF and hepatic impairment, therapeutic approaches are distinct, making it imperative to establish the correct diagnosis. In clinical practice, lymphocyte telomere lengths (TL) are used as a first‐line screen to rule out inherited telomeropathies before initiating treatment for AA. To evaluate the reliability of TL in the HAA population, we performed a retrospective analysis of TL in 10 consecutively enrolled HAA patients compared to 19 patients with idiopathic AA (IAA). HAA patients had significantly shorter telomeres than IAA patients (P = 0.009), including four patients with TL at or below the 1st percentile for age‐matched controls. HAA patients had no clinical features of DC and did not carry disease‐causing mutations in known genes associated with inherited telomere disorders. Instead, short TLs were significantly correlated with severe lymphopenia and skewed lymphocyte subsets, features characteristic of HAA. Our results indicate the importance of caution in the interpretation of TL measurements in HAA, because, in this patient population, short telomeres have limited specificity. Am. J. Hematol. 91:243–247, 2016. © 2015 The Authors. American Journal of Hematology Published by Wiley Periodicals, Inc. PMID:26615915

  8. Pyruvate remediation of cell stress and genotoxicity induced by haloacetic acid drinking water disinfection by-products.

    Science.gov (United States)

    Dad, Azra; Jeong, Clara H; Pals, Justin A; Wagner, Elizabeth D; Plewa, Michael J

    2013-10-01

    Monohaloacetic acids (monoHAAs) are a major class of drinking water disinfection by-products (DBPs) and are cytotoxic, genotoxic, mutagenic, and teratogenic. We propose a model of toxic action based on monoHAA-mediated inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a target cytosolic enzyme. This model predicts that GAPDH inhibition by the monoHAAs will lead to a severe reduction of cellular ATP levels and repress the generation of pyruvate. A loss of pyruvate will lead to mitochondrial stress and genomic DNA damage. We found a concentration-dependent reduction of ATP in Chinese hamster ovary cells after monoHAA treatment. ATP reduction per pmol monoHAA followed the pattern of iodoacetic acid (IAA) > bromoacetic acid (BAA) > chloroacetic acid (CAA), which is the pattern of potency observed with many toxicological endpoints. Exogenous supplementation with pyruvate enhanced ATP levels and attenuated monoHAA-induced genomic DNA damage as measured with single cell gel electrophoresis. These data were highly correlated with the SN 2 alkylating potentials of the monoHAAs and with the induction of toxicity. The results from this study strongly support the hypothesis that GAPDH inhibition and the possible subsequent generation of reactive oxygen species is linked with the cytotoxicity, genotoxicity, teratogenicity, and neurotoxicity of these DBPs. Copyright © 2013 Wiley Periodicals, Inc.

  9. Effect of drinking water disinfection by-products in human peripheral blood lymphocytes and sperm.

    Science.gov (United States)

    Ali, Aftab; Kurzawa-Zegota, Malgorzata; Najafzadeh, Mojgan; Gopalan, Rajendran C; Plewa, Michael J; Anderson, Diana

    2014-12-01

    Drinking water disinfection by-products (DBPs) are generated by the chemical disinfection of water and may pose hazards to public health. Two major classes of DBPs are found in finished drinking water: haloacetic acids (HAAs) and trihalomethanes (THMs). HAAs are formed following disinfection with chlorine, which reacts with iodide and bromide in the water. Previously the HAAs were shown to be cytotoxic, genotoxic, mutagenic, teratogenic and carcinogenic. To determine the effect of HAAs in human somatic and germ cells and whether oxidative stress is involved in genotoxic action. In the present study both somatic and germ cells have been examined as peripheral blood lymphocytes and sperm. The effects of three HAA compounds: iodoacetic acid (IAA), bromoacetic acid (BAA) and chloroacetic acid (CAA) were investigated. After determining appropriate concentration responses, oxygen radical involvement with the antioxidants, butylated hydroxanisole (BHA) and the enzyme catalase, were investigated in the single cell gel electrophoresis (Comet) assay under alkaline conditions, >pH 13 and the micronucleus assay. In the Comet assay, BHA and catalase were able to reduce DNA damage in each cell type compared to HAA alone. In the micronucleus assay, micronuclei (MNi) were found in peripheral lymphocytes exposed to all three HAAs and catalase and BHA were in general, able to reduce MNi induction, suggesting oxygen radicals play a role in both assays. These observations are of concern to public health since both human somatic and germ cells show similar genotoxic responses. Copyright © 2014. Published by Elsevier B.V.

  10. Sõprussuhted toovad raamatukogu ellu vunki ja värve / Reet Tomband

    Index Scriptorium Estoniae

    Tomband, Reet

    2014-01-01

    Lääne-Virumaa Keskraamatukogu sõprussuhetest Lappeenranta ja Lapua raamatukogudega, Tapa linnaraamatukogu koostööst Soome sõpruslinna Akaa (enne Toijala) raamatukoguga ning üritustest, mida on koos läbi viidud

  11. PÖFF on poolel teel / Margit Adorf

    Index Scriptorium Estoniae

    Adorf, Margit, 1974-

    2003-01-01

    Pimedate Ööde Filmifestivali avalöögiks enne põhifestivali ametlikku algust olid tudengifilmide festival "Sleepwalkers" ja laste- ja noortefilmide festival Just Film. Lähemalt viimasel nähtud kuuest filmist

  12. Loodame luua pingevaba ja konstruktiivse õhkkonna / Jevgeni Ossinovski ; intervjueerinud Raivo Juurak

    Index Scriptorium Estoniae

    Ossinovski, Jevgeni, 1986-

    2014-01-01

    Intervjuu haridusminister Jevgeni Ossinovskiga eelseisvatest ülesannetest hariduse vallas. Küsimusele koalitsioonileppe kohta vastavad Audentese erakooli õpetaja Enn Kirsman, Rocca al Mare kooli aktsiaseltsi juhataja Rein Rebane ja Sakala eragümnaasiumi direktor Jekaterina Gridneva

  13. Teheran teatas edukast tuumakütuse rikastamisest / Krister Paris

    Index Scriptorium Estoniae

    Paris, Krister, 1977-

    2006-01-01

    Iraani president Mahmoud Ahmadinejad teatas oma teleesinemises edukast uraanirikastamisest, teade edastati enne Rahvusvahelise Aatomienergia Agentuuri esimehe Mohammad ElBaradei visiiti Teherani. Iraani kritiseeris teiste hulgas ka Venemaa. Lisa: Relvaga tuumaprogrammi vastu

  14. Merkel nõuab lõppu vangilaagrile / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2006-01-01

    Enne oma USA-visiiti antud intervjuus ajakirjale Spiegel taunis Saksa kantsler Angela Merkel Guantanamo vangilaagri olemasolu. Kantslerivahetus Saksamaal ei ole kaasa toonud Saksa-USA suhete olulist paranemist. Lisa: USA okupeeritud osa Kuubast

  15. EU applicants to reform justice, border systems / Janet McEvoy

    Index Scriptorium Estoniae

    McEvoy, Janet

    1998-01-01

    Euroopa Liidu siseministrite kohtumisel 30. jaanuaril 1998. a. leiti, et Ida-Euroopa riigid peavad tõhustama organiseeritud kuritegevuse ja illegaalse immigratsiooni vastaseid meetmeid enne liitumist Euroopa Liiduga

  16. Religious conversion and the problem of commitment in Livland province, 1850s-1860s / Daniel C. Ryan

    Index Scriptorium Estoniae

    Ryan, Daniel C. 1972-

    2007-01-01

    Vene õigeusust taganemisest Liivimaal 1850.-1860. aastail. Preestrite raportid kõrgemalseisvatele organitele kujundasid võimude teadmised õigeusu kiriku positsioonist ja Balti provintside talurahva olukorrast vahetult enne venestusperioodi algust

  17. Finantshierarhia teooria ja finantseerimisotsused Eesti ettevõtetes / Priit Sander

    Index Scriptorium Estoniae

    Sander, Priit, 1973-

    2003-01-01

    Finantshierarhia (pecking order) kujutab endast sisuliselt finantseerimisallikate paremusjärjestust. Ettevõte kasutab enne ära soodsamad finantseerimisallikad ja siis võtab tarvitusele vähemsoodsad. Tabelid

  18. Res Publica andis kolmele poliitikule fiktiivse elukoha / Kärt Karpa

    Index Scriptorium Estoniae

    Karpa, Kärt, 1973-

    2002-01-01

    Väidetavalt lasi Res Publica enne kohalikke valimisi ühte Pirita eramajja sisse registreerida Jaanus Rahumäe ja veel kaks Res Publica liiget, et nad saaksid kandideerida Tallinna volikogusse ja Pirita halduskogusse

  19. Toetusi saab küsida ka LEADER-programmi raames / Raavo Raadik

    Index Scriptorium Estoniae

    Raadik, Raavo

    2011-01-01

    Eesti Hobusekasvatajate Seltsi raskeveohobuse kasvatajate haruseltsi juht Enn Rand on LEADER-programmi abil oluliselt arendanud Pärnumaal Tõstamaa vallas asuvat Maria talu, mis on praeguseks muutunud maakonnas arvestatavaks puhke- ja spordikeskuseks

  20. Arabella, küberröövli tütar / Märt Milter

    Index Scriptorium Estoniae

    Milter, Märt

    2005-01-01

    Filmipiraatlus internetis : filmid enne esilinastust saadaval. Kuidas see toimib USA-s ja meil, mis ette võtta? Lisatud kommentaarid Business Software Alliance'i Eesti tegevuse koordinaatorilt Erik Mandrelt

  1. Piranesi ja teiste veduutide kogud Roomas = Collections of vedutes by Piranesi and others in Rome / Serenita Papaldo

    Index Scriptorium Estoniae

    Papaldo, Serenita

    2004-01-01

    Rooma Rahvusliku Graafikainstituudi kollektsioonist ja antiikarhitektuuri mälestusmärkide jäädvustamisest enne Piranesit, tema loomingu erinevatest momentidest ja võrdlustest teiste graafikute töödega

  2. Ajaleheturul on 70% allahindlus igapäevane / Eda-Liis Kann

    Index Scriptorium Estoniae

    Kann, Eda-Liis, 1979-

    2004-01-01

    Selle asemel, et ametlikult reklaamihinda langetada pakuvad ajalehed reklaamiandjatele ülisuuri soodustusi. Kommenteerivad Enn Parel, Aavo Kokk, Andrus Vaher, Priit Leito, Erik Roose, Ruta Kallaspoolik, Toomas Tiivel, Lauri-Hillar Talve

  3. Lithuania 1940 / Herbert Foster Anderson

    Index Scriptorium Estoniae

    Foster Anderson, Herbert

    2004-01-01

    Stseenid Leedu ennesõjaaegsest pealinnast Kaunasest briti ärimehe H. Foster Andersoni silme läbi 1940. aastal. Lühikokkuvõte raamatust: Foster Anderson, Herbert. Borderline Russia. London : Cresset press, 1942

  4. Литература как способ самопознания в "другом" / Ирина Белобровцева

    Index Scriptorium Estoniae

    Белобровцева, Ирина, 1946-

    2001-01-01

    Eesti ja vene kogukondade vahelise dialoogi olulisest aspektist : dialoogi toimumise teoreetilisest võimalusest ja nende praktilisest realiseerumisest kirjanduses. Vene teemast Enn Vetemaa, Rein Saluri, Jaan Unduski ja Ülo Tuuliku loomingus

  5. Teatrisügise macho-pähklid / Margit Tõnson

    Index Scriptorium Estoniae

    Tõnson, Margit, 1978-

    2008-01-01

    Andrzej Saramonowiczi näidend "Testosteroon" Endla teatris, lavastaja Enn Keerd. Ott Aardami noortetükist "Poks", lavastaja autor Ugala teatris. Kristjan Sarve debüütlavastus "Rambo" David Morrelli romaani "Esimene veri" ainetel NO99 teatris

  6. Saaremaa taotleb LIFE programmist 50 miljonit krooni / Ain Lember

    Index Scriptorium Estoniae

    Lember, Ain

    2001-01-01

    Vilsandi Rahvuspark ja Pärandkoosluste Kaitse Ühing esitasid EL Komisjonile LIFE programmi raames projektitaotlused. Ajalehe küsimustele vastab Vilsandi rahvuspargi kaitsekorralduskava spetsialist Enn Kaljo

  7. Väliseestlane kinkis haruldased filmilõigud / Priit Rajalo

    Index Scriptorium Estoniae

    Rajalo, Priit, 1975-

    2005-01-01

    Kanada eestlane, 83-aastane Valdek Raiend kinkis Eesti Spordimuuseumile enda tehtud amatöörfilmid Montreali olümpiamängudest 1976.a., kus Enn Selliku 5000 m jooksu ajal lehvisid pealtvaatajate seas ka Eesti trikoloorid

  8. Swedbank lõi Kruuda toimkonnast välja / Anne Oja

    Index Scriptorium Estoniae

    Oja, Anne, 1970-

    2010-01-01

    Vahetult enne Alta Foodsi nõuete kaitsmise koosolekut arvasid Swedbank ja Alta Foodsi omanikke esindanud äriühingud suurettevõtja Oliver Kruuda Alta Foodsi pankrotitoimkonnast välja. Pankrotihaldur Andres Tootsmani kommentaare

  9. Greenpeace peatas Blairi kiidukõne tuumaenergiale / Maris Lillak

    Index Scriptorium Estoniae

    Lillak, Maris, 1970-

    2005-01-01

    Ilmunud ka: Postimees : na russkom jazõke 30. nov., lk 7. Kaks Greenpeace'i keskkonnaaktivisti korraldasid Londoni konverentsisaalis enne Briti peaministri Tony Blairi tuumaenergeetikakõnet meeleavalduse, visates saali lendlehti üleskutsega "Tuumaenergia: vale otsus"

  10. Kaks nostalgiatrippi / Margit Tõnson

    Index Scriptorium Estoniae

    Tõnson, Margit, 1978-

    2006-01-01

    Tantsulavastusest "Once upon" Kanuti Gildi saalis. Idee ja esitus Krõõt Juurak. Jaan Kruusvalli "Võikõllane üü", lavastaja Enn Keerd, muusikalise kujunduse autor Renate Valme, esietendus 14. okt. Endla teatris

  11. Tallinki laeva ehib kuue jalaga lehm / Toivo Tänavsuu

    Index Scriptorium Estoniae

    Tänavsuu, Toivo

    2006-01-01

    Valmimas on suurim Läänemerel seilav reisilaev Galaxy, mis hakkab sõitma alates suvest Tallinna ja Helsingi vahet. Lisad: Enn Pandi idee: loomad laevale; Alustatud on veel ühe laeva tegemist; Fakte Galaxyst

  12. Эстонская коллекция едет в Финландию / Валнер Вальме

    Index Scriptorium Estoniae

    Вальме, Валнер, 1970-

    2010-01-01

    15. oktoobril avatakse Helsingi kunstihoones (Helsingin Taidehalli) eesti klassikalise maalikunsti näitus "Eesti värvid – 150 aastat eesti maalikunsti Enn Kunila kollektsioonist". Kuraator Harry Liivrand, kujundaja Olev Subbi. Kollektsiooni tutvustava raamatu autor on Eero Epner

  13. Kas piiratud natsionalism või identiteedi kinnitus?! / Imbi Paju

    Index Scriptorium Estoniae

    Paju, Imbi, 1959-

    2010-01-01

    Näitus "Eesti värvid - 150 aastat eesti maalikunsti Enn Kunila kollektsioonist" Helsingi Taidehallis 24. novembrini 2010, kuraator Harry Liivrand. Näituse kohta 28. oktoobril 2010 ajalehes "Sirp" ilmunud Otso Kantokorpi ja Reet Varblase artiklitest

  14. Purpurmust Org : Urmo Mets, Allar Lepa, Martin Vabat, Marje Ingel, Carolina Pihelgas, Siim Kera, Hanna Kangro, Kaarel B Väljamäe

    Index Scriptorium Estoniae

    2008-01-01

    Sisu: Kultuurinartsiss; "lugesin enne roostet..." ; Eravaldus ; "riik nagu..." ; "Novembri lõpu õunapuud..." ; Mis siin ikka ; "su selgroog..." ; "hommikuti jääb pori kingatalla alla..." "lauale seisma jäänud sibul haiseb nagu venelase higi..."

  15. Osa kultuuripealinna jälle vastu taevast, aidaa linnahalli remondile! / Raimo Poom

    Index Scriptorium Estoniae

    Poom, Raimo

    2010-01-01

    Autor selgitab Tallinna ja linnahalli investeerida soovivaid USA ettevõtjaid koondava firma Tallinn Entertainment LLC vahel sõlmitud eellepingut ning leiab, et tõenäoliselt on välistatud linnahalli renoveerimise algus enne 2011. aastat

  16. Harald Velner - insener üle poole sajandi / Harald-Adam Velner

    Index Scriptorium Estoniae

    Velner, Harald-Adam, 1923-2012

    2008-01-01

    Harald-Adam Velner on Eesti Inseneride Liidu esimene taasiseseisvumisjärgne president. Lisaks Liis Seili lühiartikkel Harald-Adam Velneri isast August Velnerist: Teedeinsenerist isa juhtis inseneride ühendust enne sõda

  17. Muudatused sisemajanduse koguprodukti arvestustes = Changes in the methodology of macroeconomic statistics / Ene Kaldma

    Index Scriptorium Estoniae

    Kaldma, Ene

    2004-01-01

    2004. aastal tehtud muudatused makromajandusstatistika metoodikas tõid kaasa 1993.-2003. aasta sisemajanduse koguprodukti (SKP) ja selle komponentide suuruse korrigeerimise. Tabel: Sisemajanduse koguprodukt turuhindades kvartalite kaupa enne ja pärast metoodika muutumist, 1993-2003

  18. USA-s tõsteti terroriohtu kolm aastat vana info peale

    Index Scriptorium Estoniae

    2004-01-01

    Al-Qaida arvutieksperdilt Muhammad Naeem Noor Khaanilt, kes tabati Pakistanis, saadi kätte mitmeid dokumente, luureinfot ja skeeme. Enamik infot oli kogutud enne 11. septembril 2001. aastal toimunud terrorirünnakuid

  19. Kas sul on see film juba nähtud? / Jaanus Noormets

    Index Scriptorium Estoniae

    Noormets, Jaanus

    2009-01-01

    Gavin Hoodi lavastatud uusim film "X-meeste" sarjast, "X-meeste algus : Wolverine", on enne esilinastust lekkinud internetti. Lühidalt ka teistest aegsalt internetti lekkinud filmidest ja kuidas see neile mõjus

  20. Kirjandusteosed läbisid esimese sõelumise / Inna Grünfeldt

    Index Scriptorium Estoniae

    Grünfeldt, Inna, 1961-

    2006-01-01

    Virumaa selle aasta kirjandusauhinnale kandideerivad Ave Alavainu "Minekulaulud", Toomas Haugi "Troojamäe tõotus", Enn Nõu "Mõtusekuke viimne kogupauk", Olavi Ruitlase "Kroonu", Olivia Saare "Humalapuu", Indrek Hargla "French ja Koulu" ja Eevi Taeli "Lapse silmadega Narvast"

  1. Standardi juhid maksid 37, 5 miljonit krooni / Aivar Hundimägi

    Index Scriptorium Estoniae

    Hundimägi, Aivar, 1975-

    2004-01-01

    Standardi juhatuse esimees Enn Veskimägi ning juhatuse liikmed Priit Tamm ja Mati Peekma omandasid 58% Standardi aktsiatest, makstes Indoor Group'ile ja riskikapitaliinvestorile BaltCap tehingu eest väidetavalt 37, 5 miljonit krooni

  2. Ohud korteri ümberehitamisel / Harri Treial

    Index Scriptorium Estoniae

    Treial, Harri

    2000-01-01

    Korteriplaani parandamisest, lodzhade kinniehitamisest, soojapidavuse suurendamisest. Enne paneelmaja toa vaheseina uue avause lõikamist tuleb tellida projekt AS-st Eesti Projekt. Kommentaarid AS Eesti Projekt konstruktorite büroo juhatajalt Anne Laurilt

  3. Genetics Home Reference: genitopatellar syndrome

    Science.gov (United States)

    ... hypoplasia, renal anomalies, facial dysmorphism, and mental retardation GPS Related Information How are genetic conditions and genes ... Kwan A, Schlaubitz S, Barsh GS, Enns GM, Hudgins L. Genitopatellar syndrome: expanding the phenotype and excluding mutations ...

  4. Stiilne avarus / Aita Kivi

    Index Scriptorium Estoniae

    Kivi, Aita, 1954-

    2004-01-01

    Angelika ja Meelis Maalmanni perekonna korter (93 mø) Rannamõisa teel asuvas ridaelamus. Uue plaanilahenduse ja sisekujunduse autor Aet Piel. Ill.: 8 vaadet, korteri plaan enne ja nüüd. A. ja M. Maalmanni kommentaarid

  5. Фабрику Kalev продают норвежской фирме / Андрус Карнау, Райго Неудорф

    Index Scriptorium Estoniae

    Карнау, Андрус

    2010-01-01

    AS-i Kalev Chocolate Factory osta sooviv Orkla kontrerni esindajate kinnitusel hakatakse edaspidi toodangut eksportima nii Balti- kui Põhjamaadesse. Enne varade üleminekut uuele omanikule tuleb ära oodata Kalevi aktsiate aresti alt vabanemine

  6. Kalevi uus omanik tahab ettevõtte eksportima panna / Raigo Neudorf ; kommenteerinud Kuldar Leis, Kati Kusmin, Vjatšeslav Leedo

    Index Scriptorium Estoniae

    Neudorf, Raigo

    2010-01-01

    AS-i Kalev Chocolate Factory osta sooviv Orkla kontrerni esindajate kinnitusel hakatakse edaspidi toodangut eksportima nii Balti- kui Põhjamaadesse. Enne varade üleminekut uuele omanikule tuleb ära oodata Kalevi aktsiate aresti alt vabanemine. Diagramm

  7. Swedbank hüvitab tekitatud kahju ka fondi vahetajatele

    Index Scriptorium Estoniae

    2009-01-01

    Swedbank hüvitab veel enne 2009. aasta lõppu Private Debt Fondi osaku puhasväärtuse alanemise kolmandas kvartalis ning kompensatsiooni saavad ka need kliendid, kes on andnud sisse pensionifondi vahetamise taotluse

  8. Must kalamari kallineb / Aleksei Günter

    Index Scriptorium Estoniae

    Günter, Aleksei, 1979-

    2006-01-01

    3. jaanuaril teatas ohustatud liikidega kauplemist reguleeriv rahvusvaheline keskkonnaorganisatsioon CITES, et ei kinnita kaaviari ekspordikvoote 2006. aastaks enne, kui tootjariigid esitavad piisavalt tõendeid, et tuuraliste püük ei ohusta seda hinnalist liiki. Lisa: Kas teate?

  9. "Kadriorg" dozhivajet poslednije dni / Urmas Tooming

    Index Scriptorium Estoniae

    Tooming, Urmas

    2008-01-01

    Voldemar Herkeli projekteeritud Kadrioru kohvik Tallinnas lammutatakse. Asemele ehitatakse Enn Rajasaare (arhitektuuribüroo JVR) projekteeritud külaliskorteritega ärimaja. Kohvikuhoone taga asuv ajalooline villa Mon Repos tuleb arendajal säilitada. Robert Nermani kommentaar

  10. Centrist speaks out for bilingualism / Ksenia Repson

    Index Scriptorium Estoniae

    Repson, Ksenia

    2005-01-01

    Tallinna linnavolikogu liige Dimitri Klenski soovib, et volikogu istungitel võetaks kasutusele ka vene keel. Volikogu liikme Igor Sedashevi arvates püüab Klenski endale enne kohalikke valimisi tähelepanu tõmmata

  11. Kontoris kolme kitsega / Silvia Pärmann

    Index Scriptorium Estoniae

    Pärmann, Silvia

    2014-01-01

    Tallinnas Hobujaama tänaval asuva firma NG Investeeringud kontori interjöör, sisearhitekt Kaire Kemp-Tišler (ArtAku Sisearhitektuuribüroo). Ruumides eksponeeritakse Enn Kunila kunstikogusse kuuluvaid töid

  12. Russki teatr gotovit letnije projektõ / Ksenia Repson

    Index Scriptorium Estoniae

    Repson, Ksenia

    2007-01-01

    Enne Vene Teatri 59. hooaja ametlikku algust mängitakse augustis mitmeid teatri lavastusi ning 14. aug. esietendub Quentin Tarantino filmistsenaariumil "Marukoerad" ("Reservoir Dogs") põhinev Anna Trifonova lavastus

  13. Homoseksualism ja selle õiguslik regulatsioon : [bakalaureusetöö] / Mai Ärmand ; Tartu Ülikool, õigusteaduskond ; juhendaja: Edgar Salumaa

    Index Scriptorium Estoniae

    Ärmand, Mai

    1996-01-01

    Homoseksualismist ajaloos (Kreeka, Rooma, keskaeg - kirikuõigus, ilmalik õigus, uusaeg), homoseksualismist Eestis (enne Eesti Vabariiki, Vabariigi ajal, ENSV ajal); homoseksualism ja tänapäeva Eesti. Vt. ka: Juridica (1996) nr. 6, lk. 301-303

  14. Tshto nesjot nam mirnõi atom / Julia Zalutskaja

    Index Scriptorium Estoniae

    Zalutskaja, Julia

    2008-01-01

    Kui Eestisse otsustatakse rajada tuumaelektrijaam, ei lähe see ekspluatatsiooni enne 2025. aastat. Eesti Energia juhi Sandor Liive hinnangul ei asendaks tuumaelektrijaam ei põlevkivienergeetikat, vaid need täiendaksid teineteist

  15. Noortenäidend kulgeb teismeliste tempos / Sandra Sillaots

    Index Scriptorium Estoniae

    Sillaots, Sandra

    2009-01-01

    Pärnu Endla teatris etendunud lavastusest "Oma elu superstaarid". Autorid Triinu ja Laura-Marie Ojalo, lavastaja Enn Keerd, kunstnik Tuulikki Ojalo. Ka peategelase Eliis Vaiksaare (Lenna) osatäitmisest

  16. Rahvusvahelise Tööorganisatsiooni konventsioonide ratifitseerimisest Eestis : [bakalaureusetöö] / Merle Muda ; Tartu Ülikool, õigusteaduskond ; juhendaja: Inge-Maret Orgo

    Index Scriptorium Estoniae

    Muda, Merle, 1972-

    1994-01-01

    Rahvusvahelise Tööorganisatsiooni (ILO) ajalooline areng, struktuur, aktid; ülevaade Eesti Vabariigi poolt enne 1940. a. ratifitseeritud ILO konventsioonidest; EV seadusandluse vastavusest pärast ILO-ga taasühinemist

  17. L'Europe prête 300 millions d'euros au CERN

    CERN Multimedia

    2003-01-01

    The BEI (Banque Européenne d'Investissement) will lent to CERN 300 millions of Euros, not only to build the new accelerator, but also to help to set up and european programm of research (1 paragraph)

  18. Chaos returns as new Latvian Saiema convenes / Philip Birzulis

    Index Scriptorium Estoniae

    Birzulis, Philip

    2011-01-01

    Enne Läti uue seimi esimest istungit astusid 6 parlamendiliiget Valdis Zatlersi parteist välja, kuna ei olnud rahul koalitsiooni poolt esitatud ministrikandidaatidega. Seimi spiikriks valiti taas Solvita Aboltina. Statistikat praeguse seimi koosseisu kohta

  19. Loodusõpetuse õppekirjanduse hindamise ja valiku põhimõtetest 1. klassi õpiku-tööraamatu näitel / Inge Timoštšuk

    Index Scriptorium Estoniae

    Timoštšuk, Inge

    2001-01-01

    Hinnang loodusõpetuse õppekirjanduse õppesisule ja metoodilisele esitatusele. Analüüsitud on õpikut : Leuhin, Illar ; Pärtel, Enn. Loodusõpetus : õpik-tööraamat 1. klassile. - Tallinn : Avita, 1999.

  20. Pallas näitab teed Tartu skulptuurile / Ahti Seppet

    Index Scriptorium Estoniae

    Seppet, Ahti, 1953-

    2006-01-01

    Näitus "Pallase skulptuur" Tartu Kunstimuuseumis. Eksponeeritakse Ferdi Sannamehe, Eduard Wiiralti, Johannes Hirve, August Vommi, Martin Saksa, Roman Timotheuse, Herman Halliste, Lydia Laasi, Alfred Leiuse, Enn Roosi jt. kunstnike töid

  1. Pallaslitaania : ka traditsioonilist skulptuuri tuleb aktiivselt eksponeerida / Eero Kangor

    Index Scriptorium Estoniae

    Kangor, Eero, 1982-

    2006-01-01

    Näitus "Pallase skulptuur" Tartu Kivisilla galeriis kuni 24. IX, kuraator Ahti Seppet. Enn Roosi, Maire-Helve Männiku, Ernst Jõesaare, Irmgard Luha, Eduard Wiiralti, Ferdi Sannamehe, Johannes Hirve ja August Vommi töödest

  2. Põhuteater ehk Salto arhitektide must monoliit = Straw Theatre or the Black Monolith by the Salto Architects / Risto Kozer

    Index Scriptorium Estoniae

    Kozer, Risto

    2011-01-01

    Tallinnas 2011. a. valminud NO99 Põhuteatrist. Arhitektid: Maarja Kask, Karli Luik, Ralf Lõoke, Pelle-Sten Viiburg (Salto AB). Projekt: 2010. Loodud ajaperioodiks 30.04.-01.10.2011. Skoone bastionist enne Põhuteatrit

  3. SDE seisab uute põlevkivikaevanduste vastu / Piret Pert

    Index Scriptorium Estoniae

    Pert, Piret

    2006-01-01

    SDE tutvustas pressikonverentsil oma keskkonnapoliitilisi seisukohti. Sotsiaaldemokraadid on vastu uute põlevkivikaevanduste avamisele enne olemasolevate ammendumist, SDE eelnõu kohaselt tuleks uute kaevanduste avamiste kava kinnitamisele Riigikogus

  4. Sürrealism kunstigurmaanidele / Raivo Kelomees

    Index Scriptorium Estoniae

    Kelomees, Raivo, 1960-

    2008-01-01

    PARA näitus "Paranorm" Jõhvi kontserdimajas kuni 31. VIII. Osalejad: Ilmar Malin, Jüri Palm, Elo Järv, Vello Vinn, Leonhard Lapin, Enn Tegova, Ahti Seppet, Raivo Kelomees ja Kristina Viin. Kuraator Jaan Malin

  5. Pohlak : keegi tahab staadioni valmisehitamise nurjata / Tarmo Michelson

    Index Scriptorium Estoniae

    Michelson, Tarmo, 1975-

    2004-01-01

    Maksu- ja tolliamet avalikustas Lilleküla staadionit haldava MTÜ jalgpalliklubi FC Flora võla - 18,8 miljonit krooni - enne valitsusepoolset otsust 70 miljoni krooni suurusest rahasüstist, millega staadion valmis ehitada

  6. Eesti saab kaasaegse veiste kogumise keskuse / Lii Sammler ; kommenteerinud Aldo Vaan

    Index Scriptorium Estoniae

    Sammler, Lii, 1963-

    2016-01-01

    Oktoobris avab Eesti Tõuloomakasvatajate Ühistu Harjumaal Kaunissaares loomade kogumiskeskuse. See annab võimaluse loomad enne eksporti kokku koondada ja vajalikud uuringud teha. Vestlusest Eesti Tõuloomakasvatajate Ühistu juhatuse esimehe Tanel Bulitkoga

  7. Sotsialistlik realist Keskküla

    Index Scriptorium Estoniae

    1998-01-01

    Londonis 1998. a. ilmunud inglise kunstikriitiku Matthew Cullerne Bowni monograafias "Socialist Realist Painting" on eesti kunstnikest Enn Põldroos, Nikolai Kormashov, Ando Keskküla, Kormashovi ja Keskküla maalide reproduktsioonid

  8. Tõnu Virve: filmi aines puudutas mu enda mälestusi / Tõnu Virve ; intervjueerinud Andres Laasik

    Index Scriptorium Estoniae

    Virve, Tõnu, 1946-

    2009-01-01

    Intervjuu 22. septembril Kumu auditooriumis esilinastunud dokumentaalfilmi "Monument" (Freyja Film, 2009) režissööri Tõnu Virvega. Kesksel kohal on filmis Tallinna Tõnismäe monument (skulptor Enn Roos, arhitekt Arnold Alas)

  9. Raamatututvustus / Oskar Tanner

    Index Scriptorium Estoniae

    Tanner, Oskar, pseud., 1939-

    1996-01-01

    Eliade, Mircea. Jaaniöö; Kippel, Enn. Kui Raudpea tuli; Beecher Stowe, Harriet. Onu Tomi onnike; Wallace, Edgar. Valge mask; Buchan, John. Kolm pantvangi; Rendell, Ruth. Hunditapp; Jurin, Artur. Näpsu

  10. Tiigri seljas ratsutav Naan ei naase mitte ainult õhtuti / Rein Ruutsoo

    Index Scriptorium Estoniae

    Ruutsoo, Rein, 1947-

    2008-01-01

    Eesti Draamateatris 16. märtsil esietendunud Enn Vetemaa, Erki Aule ja Merle Karusoo dokumentaallavastusest "Sigma Tau-C705", lavastaja Merle Karusoo. Lavastuse kohta avaldavad arvamust ka Arvo Valton ja Teet Kallas

  11. Gustav Naanist etendub näidend

    Index Scriptorium Estoniae

    2008-01-01

    Merle Karusoo lavastab Draamateatris näidendi "Sigma Tau-C705". Näidendi aluseks on dokumentaalmaterjalid ja Enn Vetemaa - Erki Aule näidend "Gustav Naani hiilgus ja viletsus". Esietendub 16. märtsil

  12. Abuses of sugar market in Latvia, Estonia under spotlight

    Index Scriptorium Estoniae

    2004-01-01

    Läti konkurentsiamet sulges hindade mõjutamise tõttu riigi suuruselt teise suhkruvabriku. Eestit trahvitakse suhkru varumise eest enne Euroopa Liitu astumist. Leedus on aga suhkru tarbimine langenud

  13. Käsuõigusest tulenev vastutus : [bakalaureusetöö] / Hannes Sammalpärg ; Tartu Ülikool, õigusteaduskond ; juhendajad: Andres Parmas, Tõnu Põder

    Index Scriptorium Estoniae

    Sammalpärg, Hannes

    2012-01-01

    Siseriiklikest arengutest enne I Maailmasõda Suurbritannias, USA-s, Venemaal, suundadest rahvusvahelises õiguses, II Maailmasõja mõjudest, Rahvusvahelisest Kriminaalkohtust ja Rooma statuudist, kaasustest (Hinzman, Watada)

  14. Tavasti stipendium = Tavast scholarship

    Index Scriptorium Estoniae

    2014-01-01

    Ennesõjaaegse Eesti tuntuima juveelitöösturi Roman Tavasti poja Raul-Roman Tavasti 1998. aastal asutatud stipendium professionaalse ehtekunsti järelkasvu toetamiseks EKA ehtekunsti eriala üliõpilastele

  15. Gromkaja ataka v Tihhom okeane / Ruslan Kadrmatov

    Index Scriptorium Estoniae

    Kadrmatov, Ruslan

    2006-01-01

    Hiina allveelaev lähenes 26. oktoobril Vaikses ookeanis USA lennukikandjale Kitty Hawk ja tõusis enne avastamist oma rakettide ja torpeedode tegevusraadiuses pinnale. Eksperdid usuvad, et aastaks 2025 hakkab Vaikse ookeani regioonis oma allveelaevastikuga domineerima Hiina

  16. На стройке "Черного лебедя" затишье

    Index Scriptorium Estoniae

    2009-01-01

    Tallinnas Kadriorus asuv 19. sajandist pärinev arhitektuurimälestis puitvilla Mon Repos laguneb. Hoone peab taastama firma NG Eesti. Lammutatud restoranihoone "Must Luik" kohale kavandatud Enn Rajasaare projekteeritud hoonet pole veel ehitama hakatud

  17. Must Luik tõuseb varjusurmast / Urmas Tooming

    Index Scriptorium Estoniae

    Tooming, Urmas, 1954-

    2010-01-01

    Tallinnasse Kadriorgu endise Musta Luige kohviku kinnistule ehitatakse Enn Rajasaare (JVR Arhitektuuribüroo) projekteeritud elu- ja ärihoone, mis valmib 2011. aasta suveks. Restaureerimisfirma Kuukaar taastab kõrvalkrundil asuva villa Mon Repos

  18. Kadrioru kuulus Must Luik elab oma viimaseid päevi / Urmas Tooming

    Index Scriptorium Estoniae

    Tooming, Urmas

    2008-01-01

    Voldemar Herkeli projekteeritud Kadrioru kohvik Tallinnas lammutatakse. Asemele ehitatakse Enn Rajasaare (arhitektuuribüroo JVR) projekteeritud külaliskorteritega ärimaja. Kohvikuhoone taga asuv ajalooline villa Mon Repos tuleb arendajal säilitada. Robert Nermani kommentaar

  19. Kunsti tõmbavad vaatama p-tähed : uus näitus lastekunstikooli galeriis / Raimu Hanson

    Index Scriptorium Estoniae

    Hanson, Raimu, 1957-

    2008-01-01

    Näitus "P... ja p... kunst" Tartu Lastekunstikooli galeriis, kuraator Margus Kiis. Oma töid eksponeerivad Rauno Thomas Moss, Enn Tegova, Maris Palgi, Jane Remm, Kristiina Viin, Martin Vaher, Kaspar Jassa, Mariliin Kindsiko jt.

  20. Baltic minds debate the May-9th-in-Moscow dilemma

    Index Scriptorium Estoniae

    2005-01-01

    Katkendeid osalejate sõnavõttudest videokonverentsil, kus arutati Balti riikide presidentide osavõttu Teise maailmasõja aastapäeva pidustustest Moskvas 9. mail. Osalejate seas oli ka Riigikogu liige Enn Eesmaa

  1. Evaluation of thirteen haloacetic acids and ten trihalomethanes formation by peracetic acid and chlorine drinking water disinfection.

    Science.gov (United States)

    Xue, Runmiao; Shi, Honglan; Ma, Yinfa; Yang, John; Hua, Bin; Inniss, Enos C; Adams, Craig D; Eichholz, Todd

    2017-12-01

    Free chlorine is a commonly used disinfectant in drinking water treatment. However, disinfection by-products (DBPs) are formed during water disinfection. Haloacetic acids (HAAs) and trihalomethanes (THMs) are two major groups of DBPs. Iodo-HAAs and iodo-THMs (I-HAAs and I-THMs) are formed during the disinfection of the water containing high levels of iodide and are much more toxic than their chlorinated and brominated analogs. Peracetic acid (PAA) is a strong antimicrobial disinfectant that is expected to reduce the formation of HAAs and THMs during disinfection. In this study, the formations of thirteen HAAs and ten THMs, including the iodinated forms, have been investigated during PAA disinfection and chlorination as the comparison. The DBP formations under different iodide concentrations, pHs, and contact times were systematically investigated. Two types of commercial PAAs containing different concentrations of PAA and hydrogen peroxide (H 2 O 2 ) were studied. A solid-phase microextraction gas chromatography-mass spectrometry method was upgraded for THM analysis including I-THMs. HAAs were analyzed by following a recently developed high performance ion chromatography-tandem mass spectrometry method. Results show that the ratio of PAA and H 2 O 2 concentration significantly affect the formation of I-THMs and I-HAAs. During PAA disinfection with lower PAA than H 2 O 2 , no detectable levels of THMs and HAAs were observed. During PAA disinfection with higher PAA than H 2 O 2 , low levels of monoiodoacetic acid, diiodoacetic acid, and iodoform were formed, and these levels were enhanced with the increase of iodide concentration. No significant quantities of chloro- or bromo-THMs and HAAs were formed during PAA disinfection treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Identification and evaluation of resistance to powdery mildew and yellow rust in a wheat mapping population.

    Directory of Open Access Journals (Sweden)

    Lijun Yang

    Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.

  3. Metabolism and Biomarkers of Heterocyclic Aromatic Amines in Molecular Epidemiology Studies: Lessons Learned from Aromatic Amines

    Science.gov (United States)

    2011-01-01

    Aromatic amines and heterocyclic aromatic amines (HAAs) are structurally related classes of carcinogens that are formed during the combustion of tobacco or during the high-temperature cooking of meats. Both classes of procarcinogens undergo metabolic activation by N-hydroxylation of the exocyclic amine group, to produce a common proposed intermediate, the arylnitrenium ion, which is the critical metabolite implicated in toxicity and DNA damage. However, the biochemistry and chemical properties of these compounds are distinct and different biomarkers of aromatic amines and HAAs have been developed for human biomonitoring studies. Hemoglobin adducts have been extensively used as biomarkers to monitor occupational and environmental exposures to a number of aromatic amines; however, HAAs do not form hemoglobin adducts at appreciable levels and other biomarkers have been sought. A number of epidemiologic studies that have investigated dietary consumption of well-done meat in relation to various tumor sites reported a positive association between cancer risk and well-done meat consumption, although some studies have shown no associations between well-done meat and cancer risk. A major limiting factor in most epidemiological studies is the uncertainty in quantitative estimates of chronic exposure to HAAs and, thus, the association of HAAs formed in cooked meat and cancer risk has been difficult to establish. There is a critical need to establish long-term biomarkers of HAAs that can be implemented in molecular epidemioIogy studies. In this review article, we highlight and contrast the biochemistry of several prototypical carcinogenic aromatic amines and HAAs to which humans are chronically exposed. The biochemical properties and the impact of polymorphisms of the major xenobiotic-metabolizing enzymes on the biological effects of these chemicals are examined. Lastly, the analytical approaches that have been successfully employed to biomonitor aromatic amines and HAAs, and

  4. From Bad to Worse: Anemia on Admission and Hospital-Acquired Anemia.

    Science.gov (United States)

    Koch, Colleen G; Li, Liang; Sun, Zhiyuan; Hixson, Eric D; Tang, Anne S; Phillips, Shannon C; Blackstone, Eugene H; Henderson, J Michael

    2017-12-01

    Anemia at hospitalization is often treated as an accompaniment to an underlying illness, without active investigation, despite its association with morbidity. Development of hospital-acquired anemia (HAA) has also been associated with increased risk for poor outcomes. Together, they may further heighten morbidity risk from bad to worse. The aims of this study were to (1) examine mortality, length of stay, and total charges in patients with present-on-admission (POA) anemia and (2) determine whether these are exacerbated by development of HAA. In this cohort investigation, from January 1, 2009, to August 31, 2011, a total of 44,483 patients with POA anemia were admitted to a single health system compared with a reference group of 48,640 without POA anemia or HAA. Data sources included the University HealthSystem Consortium database and electronic medical records. Risk-adjustment methods included logistic and linear regression models for mortality, length of stay, and total charges. Present-on-admission anemia was defined by administrative coding. Hospital-acquired anemia was determined by changes in hemoglobin values from the electronic medical record. Approximately one-half of the patients experienced worsening of anemia with development of HAA. Risk for death and resource use increased with increasing severity of HAA. Those who developed severe HAA had 2-fold greater odds for death; that is, mild POA anemia with development of severe HAA resulted in greater mortality (odds ratio, 2.57; 95% confidence interval, 2.08-3.18; P < 0.001), increased length of stay (2.23; 2.16-2.31; P < 0.001), and higher charges (2.09; 2.03-2.15; P < 0.001). Present-on-admission anemia is associated with increased mortality and resource use. This risk is further increased from bad to worse when patients develop HAA. Efforts to address POA anemia and HAA deserve attention.

  5. Human Factors Interface with Systems Engineering for NASA Human Spaceflights

    Science.gov (United States)

    Wong, Douglas T.

    2009-01-01

    This paper summarizes the past and present successes of the Habitability and Human Factors Branch (HHFB) at NASA Johnson Space Center s Space Life Sciences Directorate (SLSD) in including the Human-As-A-System (HAAS) model in many NASA programs and what steps to be taken to integrate the Human-Centered Design Philosophy (HCDP) into NASA s Systems Engineering (SE) process. The HAAS model stresses systems are ultimately designed for the humans; the humans should therefore be considered as a system within the systems. Therefore, the model places strong emphasis on human factors engineering. Since 1987, the HHFB has been engaging with many major NASA programs with much success. The HHFB helped create the NASA Standard 3000 (a human factors engineering practice guide) and the Human Systems Integration Requirements document. These efforts resulted in the HAAS model being included in many NASA programs. As an example, the HAAS model has been successfully introduced into the programmatic and systems engineering structures of the International Space Station Program (ISSP). Success in the ISSP caused other NASA programs to recognize the importance of the HAAS concept. Also due to this success, the HHFB helped update NASA s Systems Engineering Handbook in December 2007 to include HAAS as a recommended practice. Nonetheless, the HAAS model has yet to become an integral part of the NASA SE process. Besides continuing in integrating HAAS into current and future NASA programs, the HHFB will investigate incorporating the Human-Centered Design Philosophy (HCDP) into the NASA SE Handbook. The HCDP goes further than the HAAS model by emphasizing a holistic and iterative human-centered systems design concept.

  6. Memento ettepanek president Ilvesele ja välisminister Paetile

    Index Scriptorium Estoniae

    2010-01-01

    Eesti Memento Liidu juhatuse esimehe Enn Tarto kirjast president Toomas Hendrik Ilvesele ja välisminister Urmas Paetile seoses nende sõiduga Moskvasse Suure Isamaasõja võidu aastapäeva tähistamise pidustustele. Ilmunud ka: Vaba Eesti Sõna 6. mai 2010, lk. 3, pealk.: Enn Tarto annab Moskvasse sõitvale presidendile nõu. Töövisiit Moskvasse 8.-9.05.2010

  7. Emploi et croissance | Page 17 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Le documentaire Forward Home, qui a été produit dans le cadre du projetAvantages découlant de la circulation des cerveaux des pays de la CARICOM ainsi que du tourisme et des investissements de la part de la diaspora caribéenne du CRDI, révèle la puissance économique de la diaspora caribéenne. Read more about ...

  8. "Дева Маали" пожизненно обручена с Вейко Ыунпуу / Борис Тух

    Index Scriptorium Estoniae

    Тух, Борис, 1946-

    2010-01-01

    Eesti Filmiajakirjanike Ühingu poolt kinos "Sõprus" väljaantud auhindadest: parimaks filmiks tunnistati ja anti üle Neitsi Maali auhind ning rahaline preemia Veiko Õunpuu mängufilmile "Püha Tõnu kiusamine". Parima filmiajakirjaniku preemia sai Enn Säde ja eripreemia Ilmar Raag blogi "Ilmari jäljed liival enne vihmasadu" eest. Parimaks välisfilmiks valiti Laurent Cantet' film "Seinte vahel" (Prantsusmaa 2008)

  9. Première de Forward Home, un documentaire sur la puissance ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    26 avr. 2016 ... Le documentaire Forward Home, qui a été produit dans le cadre du projetAvantages découlant de la circulation des cerveaux des pays de la CARICOM ainsi que du tourisme et des investissements de la part de la diaspora caribéenne du CRDI, révèle la puissance économique de la diaspora caribéenne.

  10. Publications | Page 19 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Le documentaire Forward Home, qui a été produit dans le cadre du projet Avantages découlant de la circulation des cerveaux des pays de la CARICOM ainsi que du tourisme et des investissements de la part de la diaspora caribéenne du CRDI, révèle la puissance économique de la diaspora caribéenne. De la ferme à la ...

  11. Konsum CAPM og CAPM anomalier: en empirisk studie av det amerikanske aksjemarkedet

    OpenAIRE

    Tennebeck, Kristoffer; Torgrimsen, Stian

    2015-01-01

    Er konsumbeta et bedre mål på systematisk risiko enn markedsbeta? I denne oppgaven sammenligner vi den konsumbaserte kapitalverdimodellen (CCAPM) med kapitalverdimodellen (CAPM) for å vurdere deres evne til å forklare forskjellige systematiske faktorer i aksjemarkedet, ved å sette måleperioden fra et kvartal til tilsvarende kvartal påfølgende år. Vi finner mer støtte for CCAPM enn for den tradisjonelle CAPM. nhhmas

  12. Chlorination and chloramination of aminophenols in aqueous solution: oxidant demand and by-product formation.

    Science.gov (United States)

    Mehrez, O Abou; Dossier-Berne, F; Legube, B

    2015-01-01

    Chlorination and monochloramination of aminophenols (AP) were carried out in aqueous solution at 25°C and at pH 8.5. Oxidant demand and disinfection by-product formation were determined in excess of oxidant. Experiments have shown that chlorine consumption of AP was 40-60% higher than monochloramine consumption. Compared with monochloramination, chlorination of AP formed more chloroform and haloacetic acids (HAA). Dichloroacetic acid was the major species of HAA. Chloroform and HAA represented, respectively, only 1-8% and 14-15% of adsorbable organic halides (AOX) by monochloramination but up to 29% and 39% of AOX by chlorination.

  13. Cooking does not decrease hydrophilic antioxidant capacity of wild blueberries.

    Science.gov (United States)

    Murphy, Rebecca Ree; Renfroe, Michael H; Brevard, Patricia Bowling; Lee, Robert E; Gloeckner, Janet W

    2009-01-01

    The present study examined the effects of domestic cooking methods on the hydrophilic antioxidant activity (HAA) of wild blueberries. Baked, microwaved, simmered, and pan-fried frozen wild blueberries, and a thawed uncooked control, were analyzed for HAA using an ABTS/H(2)O(2)/HRP decoloration method. All cooking treatments were derived from recipes using wild blueberries, and were performed in triplicate. A randomized block design was used to determine whether there were statistical differences in antioxidant content after cooking and between each of the trials. There were no statistically significant decreases after cooking the thawed berries. On both a fresh weight and a dry weight basis, pan-fried blueberries had significantly higher HAA than baked, simmered, and control blueberries (Pcooked berries retained significant HAA. Cooked wild blueberries can be recommended as a good source of dietary antioxidants.

  14. Chloramination of nitrogenous contaminants (pharmaceuticals and pesticides): NDMA and halogenated DBPs formation

    KAUST Repository

    Le Roux, Julien; Gallard, Hervé ; Croue, Jean-Philippe

    2011-01-01

    Disinfection with chloramines is often used to reduce the production of regulated disinfection by-products (DBPs) such as trihalomethanes (THMs) and haloacetic acids (HAAs). However, chloramination can lead to the formation of N

  15. Kolmekesi ühest Peipsi-äärsest asjast / Tiit Lepp

    Index Scriptorium Estoniae

    Lepp, Tiit

    2007-01-01

    Annika Haasi, Birgit Püve ja Age Petersoni fotonäitus "Prichudie, Revisited" Peipsiääre valla inimestest ja elust-olust kunstikeskuses AmbulARToorium Tartumaaal. Kommenteerinud Annika Haas, Birgit Püve, Age Peterson

  16. Creation of a Dynamical Stratospheric Turbulence Forecasting and Nowcasting Tool for High Altitude Airships and Other Aircraft

    National Research Council Canada - National Science Library

    Fritts, David C

    2008-01-01

    ... for which significant wave and turbulence activity may pose an operational or functional risk. The specific goal for MDA purposes was to create a forecasting methodology for turbulence activity at the expected High Altitude Airship (HAA...

  17. de Fusarium isolé du fruit de tomate (Solanum lycopersicum L ...

    African Journals Online (AJOL)

    Dina

    A phytopathogenic fungus Fusarium F-02 is isolated from rotten tomato fruit. ..... between Trichoderma harzianum and Pythium ultimum”. .... [31] - HAAS, and C. KEEL, “Regulation of antibiotic production in root-colonizing Pseudomonas spp.

  18. Presidential Green Chemistry Challenge: 1996 Designing Greener Chemicals Award

    Science.gov (United States)

    Presidential Green Chemistry Challenge 1996 award winner, Rohm and Haas, developed Sea-Nine, a marine antifoulant to control plants and animals on ship hulls. Sea-Nine replaces persistent, toxic organotin antifoulants.

  19. Ere täht Britta / Britta Vahur ; interv. Jüri Muttika

    Index Scriptorium Estoniae

    Vahur, Britta, 1984-

    2006-01-01

    Rubriigis "elu ühes päevas" TV 3 uues telesarjas "Helena" peaosalist kehastav Britta Vahur endast. Lisaks sarja stsenaristi Marko Lillemägi kirjutatud "Seriaalikangelanna Helena Haas (23)", mis kirjeldab seriaali Helena päeva

  20. Quantum magnetotransport properties of topological insulators under strain

    KAUST Repository

    Tahir, M.; Schwingenschlö gl, Udo

    2012-01-01

    scattering in the first Born approximation. We also calculate the Hall conductivity using the Kubo formalism. Evidence for the beating of Shubnikov–de Haas oscillations is found from the temperature and magnetic field dependence of the collisional and Hall

  1. Quantum magnetotransport for the surface states of three-dimensional topological insulators in the presence of a Zeeman field

    KAUST Repository

    Tahir, Muhammad; Schwingenschlö gl, Udo

    2013-01-01

    We show that the surface states of magnetic topological insulators realize an activated behavior and Shubnikov de Haas oscillations. Applying an external magnetic field perpendicular to the surface of the topological insulator in the presence

  2. GRAPHICAL DETERMINATION OF DISSOCIATION CONSTANT ...

    African Journals Online (AJOL)

    DR. AMINU

    conform to the general equation of straight – line graph; y = mx + c, where y = pH, m = slope, x = log. [HA]/[A] and C = intercept = pKa. Thus the pKa is obtained as the intercept of the graph of pH versus – log [HA]/[A] as shown in Figures 1,2 and 3 for glycine, alanine and valine respectively. The values obtained were 9.87 ...

  3. Family Reintegration Following Guard Deployment

    Science.gov (United States)

    2010-09-20

    Somalia Peacekeepers. Journal of Consulting and Clinical Psychology, 72(5), 909-913. Haas DM . Pazdernik LA. Olsen CH. A cross-sectional survey of the...relationship between partner deployment and stress in pregnancy during wartime. Haas DM . Pazdernik LA. Partner deployment and stress in pregnant...Identify 3-5 key words relating to the proposal. (Required) I used MESH Headings instead of the CRISP Thesaurus for key

  4. Avoiding pitfalls in the determination of halocarboxylic acids: the photochemistry of methylation.

    Science.gov (United States)

    Rubio, F J; Urbansky, E T; Magnuson, M L

    2000-06-01

    Haloethanoic (haloacetic) acids are formed during chlorination of drinking water and are regulated by the Environmental Protection Agency (EPA). These compounds are normally quantified by gas chromatography with electron capture detection (GC-ECD) as the methyl esters. EPA Method 552 uses diazomethane (CH2N2) for this purpose, but has only been validated by EPA for HAA6: chloro-, dichloro-, bromo-, dibromo-, bromochloro- and trichloroacetic acids. EPA Method 552.2 was developed and validated for all nine analytes (HAA9 = HAA6 + dibromochloro-, bromodichloro- and tribromoethanoic acids). Since the promulgation of Method 552.2, which uses acidic methanol, a debate has ensued over discrepancies observed by various laboratories when using diazomethane instead. In an effort to identify and eliminate potential sources for these discrepancies, a comparative study was undertaken for HAA9. Better accuracy and precision were observed for all HAA9 species by Method 552.2; recoveries were satisfactory in de-ionized and tap water. Method 552 remains satisfactory for HAA6. Systematic differences in instrumental response are observed for the two methods, but these are precise and may be accounted for using similarly treated standards and analyte-fortified (spiked) samples. That notwithstanding, Method 552 (CH2N2) was shown to be unsuitable for dibromochloro-, bromodichloro- and tribromoethanoic acids (HAA9-6). The primary problem appears to be a photoactivated reaction between diazomethane and the HAA9-6 analytes; however, side reactions were found to occur even in the dark. Analyte loss is most pronounced under typical laboratory lighting (white F40 fluorescent lamps + sunlight), but it is also observed under Philips gold F40 lamps (lambda > or = 520 nm), and in the dark.

  5. Separation of beryllium and mercury from lithium chloride solution by gaseous extraction

    International Nuclear Information System (INIS)

    Sevast'yanov, A.I.; Chepovol, V.I.

    1989-01-01

    The possibility is shown of extracting beryllium and mercury by acetylacetone (HAA) from lithium chloride solution by passing argon through the solution and the optimum conditions have been determined. The dependence of the degree of extraction and the distribution coefficients on various parameters of the liquid phase are presented, viz. the initial pH value, the lithium chloride concentration, and the initial HAA content

  6. Developing the Navy’s NC Flying Boats: Transforming Aeronautical Engineering for the First Transatlantic Flight

    Science.gov (United States)

    2011-12-01

    Silberg , David J. Haas w ^m^e^ä^ Approved for Public Release; distribution is unlimited. f REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188...PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Eric Silberg , David Haas 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 99-2-5300-010-12 17...THIS PAGE UNCLASSIFIED 17. LIMITATION OF ABSTRACT UL 18. NUMBER OF PAGES 2 7 19a. NAME OF RESPONSIBLE PERSON Eric Silberg 19b. TELEPHONE

  7. A New Approach to Eliminate High Amplitude Artifacts in EEG Signals

    Directory of Open Access Journals (Sweden)

    Ana Rita Teixeira

    2016-09-01

    Full Text Available High amplitude artifacts represent a problem during EEG recordings in neuroscience research. Taking this into account, this paper proposes a method to identify high amplitude artifacts with no requirement for visual inspection, electrooscillogram (EOG reference channel or user assigned parameters. A potential solution to the high amplitude artifacts (HAA elimination is presented based on blind source separation methods. The assumption underlying the selection of components is that HAA are independent of the EEG signal and different HAA can be generated during the EEG recordings. Therefore, the number of components related to HAA is variable and depends on the processed signal, which means that the method is adaptable to the input signal. The results show, when removing the HAA artifacts, the delta band is distorted but all the other frequency bands are preserved. A case study with EEG signals recorded while participants performed on the Halstead Category Test (HCT is presented. After HAA removal, data analysis revealed, as expected, an error-related frontal ERP wave: the feedback-related negativity (FRN in response to feedback stimuli.

  8. Mycotoxin occurrence on baled and pit silages collected in Co. Meath

    Directory of Open Access Journals (Sweden)

    McElhinney C.

    2015-12-01

    Full Text Available Recent studies of baled silages produced in Ireland have identified considerable filamentous fungal contamination. Many of these fungi are toxigenic, capable of producing secondary metabolites, namely mycotoxins. Mycotoxins are potentially detrimental to livestock health and some can pose a risk to consumers of animal products. Baled (n=20 and pit (n=18 silages from a sample of farms (n=38 in Co. Meath were examined to assess the occurrence of mycotoxins and ascertain whether sampling position within the pit silos (feed face vs. 3 m behind the feed face has an effect on mycotoxin content or other chemical compositional variables. Of the 20 mycotoxins assayed, baled silages contained [mean of positive values (no. of values in mean] mycotoxin concentrations (μg/kg dry matter of beauvericin 36 (2, enniatin (enn. A 9.3 (3, enn. A1 54 (8, enn. B 351 (9, enn. B1 136 (10, mycophenolic acid (MPA 11,157 (8 and roquefortine C (Roq. C 1037 (8 and pit silages contained beauvericin 25 (2 enn. A1 18 (2, enn. B 194 (9, enn. B1 57 (3, MPA 287 (6, Roq. C 3649 (6 and zearalenone 76 (1. There was no difference (P>0.05 observed in the mycotoxin concentrations between baled and pit silages, and 11 of the 20 mycotoxins assayed were below the limits of detection. The position of sampling had no effect on the mycotoxin concentration detected in pit silages. It is concluded that mycotoxin concentrations detected in these pit and baled silages in Co. Meath did not exceed EU regulation or guidance limits, and that similar chemical composition and mycotoxin concentration values occurred at the pit silage feed face and 3 m behind this feed face.

  9. Rapport de la Deuxième Consultation technique sur l'utilisation des espèces pélagiques de petite taille dans la région méditerranéenne: Zadar, Yougoslavie, 7-10 mai 1985 = Report of the Second Technical Consultation on the Utilization of Small Pelagic Species in the Mediterranean Area : Zadar, Yugoslavia, 7-10 May 1985

    National Research Council Canada - National Science Library

    1985-01-01

    The main topics considered are; results of the regional programme of research on better utilization of small pelagic species, their handling on board, the preparation of minced fish and products made on the basis of minced fish...

  10. System safety as a starting point for education and training of engineers. Contribution to Société Européenne pour la Formation des Ingenieurs SEFI Conference 1980 `The education of the engineer in, and for, his society; Trends and future needs of engineering education in a world perspective', UNESCO Headquaters, Paris, 10-12 September 1980. Theme 2: Significance of urgent problems; Safety in construction, manufacture or in use.

    NARCIS (Netherlands)

    Asmussen, E.

    1980-01-01

    In order to control the aspects of unsafety in dwelling, working and transportation systems, adequate methods of research and decision making are necessary. These methods must be fit for dealing with comprehensive problems in which the study of interactions, such as relations between man and his

  11. How Do R&D Programs Funded by the Dg Xii (Science, Research and Development Directorate of the European Commission Impact the Upstream Oil and Gas Industry in Europe? Comment les programmes de R&D financés par la DG XII de la Commission européenne influencent-ils l'industrie pétrolière amont en Europe ?

    Directory of Open Access Journals (Sweden)

    Forbes P.

    2006-12-01

    Full Text Available This paper provides an overview of the direct and indirect impact which DG XII funding for research and development has on the oil and gas exploration and production industry in Europe. Despite the relatively low level of funding, the impact is quite significant. These impacts are presented using a bottom-up analysis, starting with the impact of technology on industry and society, the impact of research on technology, and the impact of DG XII funding on both research and technology for the exploration and production of oil and gas. The different aspects that are discussed include the direct impact, the impact on R&D organization and management, and the impact due to the Commission demonstration program for oil and gas (Thermie. Examples are provided from current and past project results. The future impact on the industry, and Commission policy toward the oil and gas sector are suggestedIn the near future, it is expected that there will be greater impact on production technologies, on the contribution of oil and gas companies to long-term R&D, and on the transfer of results to the Commission demonstration program. L'article apporte une vue d'ensemble sur la manière dont les financements de la DG XII pour la recherche et le développement (R&D ont une influence, directe ou indirecte, sur l'exploration et la production dans l'industrie du pétrole et du gaz en Europe. Le niveau de ces financements est présenté comme relativement faible de façon à mettre en évidence que, comparativement, leur répercution est très significative. L'impact de ces financements est abordé en couvrant successivement les effets sur la société, l'industrie, la technologie et finalement la recherche elle-même. Nous décrivons ici les influences de la technologie sur l'industrie et sur la société, puis les influences de la recherche sur la technologie et enfin celles des financements de la DG XII sur la recherche et la technologie en exploration-production. Différents aspects sont évoqués : les effets directs, les effets sur l'organisation et la gestion de la R&D, les effets à travers d'autres programmes de la Commission comme le programme de démonstration Thermie. Des exemples sont donnés à partir de résultats,de projets en cours ou passés, d'autre part, les conséquences futures sur les statuts de l'industrie et la politique de la Commission concernant le pétrole et le gaz sont abordées. Les effets les plus importants escomptés, dans un futur proche, concernent les technologies de production, la contribution à la R&D long terme des industries du pétrole et du gaz et le transfert des résultats vers des programmes de démonstration.

  12. Haloacetic acids in the aquatic environment. Part I: macrophyte toxicity

    International Nuclear Information System (INIS)

    Hanson, Mark L.; Solomon, Keith R.

    2004-01-01

    Haloacetic acids (HAAs) are contaminants of aquatic ecosystems with numerous sources, both anthropogenic and natural. The toxicity of HAAs to aquatic plants is generally uncharacterized. Laboratory tests were conducted with three macrophytes (Lemna gibba, Myriophyllum sibiricum and Myriophyllum spicatum) to assess the toxicity of five HAAs. Myriophyllum spp. has been proposed as required test species for pesticide registration in North America, but few studies have been conducted under standard test conditions. The HAAs in the present experiments were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). MCA was the most toxic to Myriophyllum spp. with EC 50 values ranging from 8 to 12.4 mg/l depending on the endpoint, followed by DCA (EC 50 range 62-722.5 mg/l), TCA (EC 50 range 49.5-1702.6 mg/l), CDFA (EC 50 range 105.3 to >10,000 mg/l) and with TFA (EC 50 range 222.1 to 10,000 mg/l) the least toxic. Generally, L. gibba was less sensitive to HAA toxicity than Myriophyllum spp., with the difference in toxicity between them approximately threefold. The range of toxicity within Myriophyllum spp. was normally less than twofold. Statistically, plant length and node number were the most sensitive endpoints as they had the lowest observed coefficients of variation, but they were not the most sensitive to HAA toxicity. Toxicological sensitivity of endpoints varied depending on the measure of effect chosen and the HAA, with morphological endpoints usually an order of magnitude more sensitive than pigments for all plant species. Overall, mass and root measures tended to be the most sensitive indicators of HAA toxicity. The data from this paper were subsequently used in an ecological risk assessment for HAAs and aquatic plants. The assessment found HAAs to be of low risk to aquatic macrophytes and the results are described in the second manuscript of this series

  13. Preparation and characterization of inorganic and organic coatings on AZ91D magnesium alloy with electroless plating pretreatment

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, S.Y.; Li, Q.; Zhang, H.X.; Wang, S.Y.; Liu, F. [School of Chemistry and Chemical Engineering, Southwest University Chongqing, 400715 (China); Yang, X.K. [School of Materials Science and Engineering, Southwest University Chongqing, 400715 (China)

    2011-09-15

    In this paper, a protective coating scheme was applied for the corrosion protection of AZ91D magnesium alloy. Electroless Ni coating (EN coating) as bottom layer, electrodeposited Ni coating (ENN coating), and silane-based coating (ENS coating) as top layer, respectively, were successfully prepared on AZ91D magnesium alloy by combination techniques. Scanning electron microscopy and X-ray diffraction were employed to investigate the surface and phase structure of coatings, respectively. The electrochemical corrosion behaviors of coatings in neutral 3.5 wt% NaCl solution were evaluated by electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization techniques. The corrosion testing showed that the three kinds of coatings all could provide corrosion protection for AZ91D magnesium alloy to a certain extent, and the corrosion resistance of ENN and ENS was superior to EN. In order to further study the corrosion protection properties of ENN and ENS, a comparative investigation on the evolution of EIS of ENN and ENS was carried out by dint of immersion test in neutral 3.5 wt% NaCl solution. The results indicated that, compared with ENN, the ENS could provide longer corrosion protection for AZ91D magnesium alloy. It is significant to determine the barrier effect of each coating, which could provide reference for industry applications. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  14. Evaluation of immunologic effect of Enniatin A and quantitative determination in feces, urine and serum on treated Wistar rats.

    Science.gov (United States)

    Juan, Cristina; Manyes, Lara; Font, Guillermina; Juan-García, Ana

    2014-09-01

    Study of dietary supplementation with ENN A mycotoxin during 28 days of exposure time on Wistar rats to determinate its levels in serum, urine and feces and, to evaluate the immunologic effect in peripheral blood lymphocytes (PBL) is presented. The first method for ENN A extraction, determination and detection by LC-MS/MS in serum, urine and feces samples is reported. ENN A food dose administrated was detected in serum samples and influenced lymphocyte phenotyping. Levels in serum were founded from the second week of the experiment; reaching values of 4.76 μg/ml on the fourth week, which corresponds to 3.24 μg/ml in blood. PBL as T helper (CD4(+)) were presented in greater percentages compared to control (p ≤ 0.001), while T cytotoxic (CD8(+)) decreased significantly compared to control (p ≤ 0.001). ENN A treatment significantly increased CD4(+)/CD3(+) and CD4(+)/CD8(+) ratios but significantly decreased CD8(+)/CD3(+) ratio. CD4(+)/CD8(+) ratio was 2.94:1, indicating that PBL surface antigen expression and immune status in Wistar rats treated were impaired by the ENN A mycotoxin. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Formation of heterocyclic amines in Chinese marinated meat: effects of animal species and ingredients (rock candy, soy sauce and rice wine).

    Science.gov (United States)

    Wang, Pan; Hong, Yanting; Ke, Weixin; Hu, Xiaosong; Chen, Fang

    2017-09-01

    Heterocyclic aromatic amines (HAAs) are one type of neo-formed contaminants in protein-rich foods during heat processing. Recently, accumulative studies have focused on the formation of HAs in Western foods. However, there is little knowledge about the occurrence of HAAs in traditional Chinese foods. The objective of this study was to determinate the contents of main HAs in traditional marinated meat products by UPLC-MS/MS, and to investigate the effects of animal species and the ingredients (soy sauce, rock candy, and rice wine) on the formation of HAAs in marinated meats. Five HAs - 2-amino-3-methylimidazo[4,5-f]-quinolone (IQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3,4-dimethylimidazo[4,5-f]quinoxaline (MeIQ), 9H-pyrido[3,4-b]indole (Norharman) and l-methyl-9H-pyrido[3,4-b]indole (Harman) - were detected in 12 marinated meats, but 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) was only found in three chicken marinates. The animal species and ingredients (soy sauce, rock candy and rice wine) have significant influence on the formation of HAAs in meat marinates. Beef had the highest content of total HAAs compared with pork, mutton and chicken. Meanwhile, soy sauce contributed to the formation of HAAs more greatly than rock candy, soy sauce, and rice wine. Choice of raw materials and optimisation of ingredients recipe should be become a critical point to control the HAAs formation in marinated meats. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  16. Preferential induction of the AhR gene battery in HepaRG cells after a single or repeated exposure to heterocyclic aromatic amines

    International Nuclear Information System (INIS)

    Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Laurent, Veronique; Loyer, Pascal; Robin, Marie-Anne; Guillouzo, Andre

    2010-01-01

    2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) are two of the most common heterocyclic aromatic amines (HAA) produced during cooking of meat, fish and poultry. Both HAA produce different tumor profiles in rodents and are suspected to be carcinogenic in humans. In order to better understand the molecular basis of HAA toxicity, we have analyzed gene expression profiles in the metabolically competent human HepaRG cells using pangenomic oligonucleotide microarrays, after either a single (24-h) or a repeated (28-day) exposure to 10 μM PhIP or MeIQx. The most responsive genes to both HAA were downstream targets of the arylhydrocarbon receptor (AhR): CYP1A1 and CYP1A2 after both time points and CYP1B1 and ALDH3A1 after 28 days. Accordingly, CYP1A1/1A2 induction in HAA-treated HepaRG cells was prevented by chemical inhibition or small interference RNA-mediated down-regulation of the AhR. Consistently, HAA induced activity of the CYP1A1 promoter, which contains a consensus AhR-related xenobiotic-responsive element (XRE). In addition, several other genes exhibited both time-dependent and compound-specific expression changes with, however, a smaller magnitude than previously reported for the prototypical AhR target genes. These changes concerned genes mainly related to cell growth and proliferation, apoptosis, and cancer. In conclusion, these results identify the AhR gene battery as the preferential target of PhIP and MeIQx in HepaRG cells and further support the hypothesis that intake of HAA in diet might increase human cancer risk.

  17. Trace Analysis of Mutagenic Heterocyclic Aromatic Amines in Cigarette Smoke Condensate and its Base Fractions via Silylation-GC-MS

    Directory of Open Access Journals (Sweden)

    Liu S

    2014-12-01

    Full Text Available Among the more than 5000 chemicals reported in cigarette smoke condensate (CSC, heterocyclic aromatic amines (HAAs are considered to be a contributor to observed biological activity. HAAs are non-volatile and are reported at ppb levels in CSC. A new method for HAA analysis at the trace level is reported here. N, O-Bis(trimethylsilyl trifluoroacetamide (BSTFA containing 1% trimethylchlorosilane was employed to derivatize amino groups by heating the reagent containing a sample of CSC at 80 °C for 30 min followed by analysis employing gas chromatography-mass spectroscopy (GC-MS in the selected-ion-monitoring (SIM mode. This derivatization method afforded symmetrical peak shapes on a ZB-50 stationary phase and achieved instrumental limits of quantification (LOQ at 10:1 S/N from -1 ng/mL for AαC to120 ng/mL for Glu-P-1. The chemical identity of each derivative was confirmed by comparison of retention time and mass spectra of standards. The latter were characterized by the following ions: M·+ or [M-1]+, [M-15]+, and m/z 73 (i.e., trimethylsilyl. CSC and its base sub-fractions were studied using the GC-MS method. Ten HAAs were screened and five were quantified in cigarette smoke condensate, while 2-5 HAAs were quantified in each of three base sub-fractions. Values obtained with the new procedure agree well with values reported in the literature and with results obtained from a commercial laboratory via a different analytical method. The potential contribution of each HAA to the overall mutagenic activity observed for CSC and its base fractions is discussed. When considered together, HAAs account for only a small portion (-7.8% of the observed mutagenicity of the CSC.

  18. Effect of cooking methods on the formation of heterocyclic aromatic amines in chicken and duck breast.

    Science.gov (United States)

    Liao, G Z; Wang, G Y; Xu, X L; Zhou, G H

    2010-05-01

    Heterocyclic aromatic amines (HAAs), potent mutagens/carcinogens, are pyrolysis formed during the cooking of meat and fish. In the present study, the effects of various cooking methods, pan-frying, deep-frying, charcoal grilling and roasting on the formation of HAAs in chicken breast and duck breast were studied. The various HAAs formed during cooking were isolated by solid-phase extraction and analyzed by high-performance liquid chromatography (HPLC). Results showed that chicken breast cooked by charcoal grilling contained the highest content of total HAAs, as high as 112 ng/g, followed by pan-fried duck breast (53.3 ng/g), charcoal grilled duck breast (32 ng/g), pan-fried chicken breast (27.4 ng/g), deep-fried chicken breast (21.3 ng/g), deep-fried duck breast (14 ng/g), roasted duck breast (7 ng/g) and roasted chicken breast (4 ng/g). For individual HAA, the most abundant HAA was 9H-pyrido-[4,3-b]indole (Norharman), which was detected in charcoal grilled chicken breast at content as high as 32.2 ng/g, followed by 1-methyl-9H-pyrido[4,3-b] indole (Harman) and 2-amino-1-methyl-6-phenylimidazo[4,5-f]pyridine(PhIP) at 32 and 31.1 ng/g in charcoal grilled chicken breast, respectively. The content of PhIP in pan-fried duck and chicken breast were 22 and 18.3 ng/g, respectively. Generally, the type and content of HAAs in cooked poultry meat varies with cooking method and cooking conditions. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  19. LA NOTION DE TORTURE, DE TRAITEMENTS INHUMAINS ET DEGRADANTS DANS LA JURISPRUDENCE DE LA COUR EUROPEENNE DES DROITS DE L’HOMME

    Directory of Open Access Journals (Sweden)

    Jean-Paul Céré

    2017-03-01

    Full Text Available En vertu de l'article 3 de la Convention européenne de sauvegarde des droits de l'homme, les Etats ne peuvent ni pratiquer la torture ni infliger des traitements inhumains ou dégradants. Le particularisme de cette convention par rapport aux autres textes internationaux ou régionaux relatifs aux droits de l’homme réside indéniablement dans le système de protection existant qu’elle a organisé. Un organe juridictionnel, la cour européenne des droits de l’homme, est en charge de sanctionner les Etats qui ne respectent la Convention. Au terme d’une jurisprudence novatrice et évolutive, la cour européenne des droits de l’homme impose de plus en plus efficacement de lutter contre la torture, les traitements inhumains et dégradants.

  20. Nouvelles données sur la paléobiogéographie des genres Septimaniceras Fauré, 2002 et Crassiceras Merla, 1932 (Ammonitina) du Toarcien moyen

    OpenAIRE

    Jattiot, Romain; Rulleau, Louis; Latutrie, Benjamin

    2017-01-01

    Depuis sa première description, le genre Septimaniceras Fauré, 2002 a été systématiquement considéré comme un genre endémique, avec une répartition géographique limitée à la région des Causses et du Languedoc (France, province nord-ouest européenne). De même, l’espèce Crassiceras bayani (Dumortier, 1874), d’affinités méditerranéennes, était interprétée comme une forme spécifiquement nord-ouest européenne cantonnée au sud-est de la France, et ne dépassant pas la région lyonnaise en latitude no...

  1. Hazard assessment of three haloacetic acids, as byproducts of water disinfection, in human urothelial cells.

    Science.gov (United States)

    Marsà, Alicia; Cortés, Constanza; Hernández, Alba; Marcos, Ricard

    2018-04-07

    Disinfection by-products (DBPs) are compounds produced in the raw water disinfection processes. Although increased cancer incidence has been associated with exposure to this complex mixture, the carcinogenic potential of individual DBPs remains not well known; thus, further studies are required. Haloacetic acids (HAAs) constitute an important group among DBPs. In this study, we have assessed the in vitro carcinogenic potential of three HAAs namely chloro-, bromo-, and iodoacetic acids. Using a long-term (8 weeks) and sub-toxic doses exposure scenario, different in vitro transformation markers were evaluated using a human urothelial cell line (T24). Our results indicate that long-term exposure to low doses of HAAs did not reproduce the genotoxic effects observed in acute treatments, where oxidative DNA damage was induced. No changes in the transformation endpoints analyzed were observed, as implied by the absence of significant morphological, cell growth rate and anchorage-independent cell growth pattern modifications. Interestingly, HAA-long-term exposed cells developed resistance to oxidative stress damage, what would explain the observed differences between acute and long-term exposure conditions. Accordingly, data obtained under long-term exposure to sub-toxic doses of HAAs could be more accurate, in terms of risk assessment, than under acute exposure scenarios. Copyright © 2018. Published by Elsevier Inc.

  2. Synthesis of high-quality diesel with furfural and 2-methylfuran from hemicellulose.

    Science.gov (United States)

    Li, Guangyi; Li, Ning; Wang, Zhiqiang; Li, Changzhi; Wang, Aiqin; Wang, Xiaodong; Cong, Yu; Zhang, Tao

    2012-10-01

    Hydroxyalkylation-alkylation (HAA) coupled with hydrodeoxygenation is a promising route for the synthesis of renewable high-quality diesel or jet fuel. In this work, a series of solid-acid catalysts were firstly used for HAA between lignocellulose-derived furan and carbonyl compounds. Among the investigated catalysts, Nafion-212 resin demonstrated the highest activity and stability. Owing to the high activity of the reactants and the advantage in industrial integration, the HAA of 2-methylfuran (2-MF) and furfural can be considered as a prospective route in future applications. Catalyst loading, reaction temperature, and time had evident effects on the HAA of 2-MF and furfural over Nafion-212 resin. Finally, the HAA product of 2-MF and furfural was hydrogenated over a Pd/C catalyst and hydrodeoxygenated over Pt-loaded solid-acid catalysts. Pt/zirconium phosphate (Pt/ZrP) was found to be the best catalyst for hydrodeoxygenation. Over the 4 % Pt/ZrP catalyst, a 94 % carbon yield of diesel and 75 % carbon yield of C15 hydrocarbons (with 6-butylundecane as the major component) was achieved. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Reducing effect of artichoke extract on heterocyclic aromatic amine formation in beef and chicken breast meat.

    Science.gov (United States)

    Tengilimoglu-Metin, Mercan Merve; Kizil, Mevlude

    2017-12-01

    The aim of this study was to investigate the inhibitory effect of different levels of artichoke extract (0, 0.5, and 1.0%) on the formation of heterocyclic aromatic amines (HAAs) in beef and chicken breast meat cooked by either pan-frying or oven-roasting. All meat samples were cooked at three different temperatures (150, 200, and 250°C) and the levels of 12 HAAs (IQ, IQx, MeIQ, MeIQx, 4,8-DiMeIQx, 7,8-DiMeIQx, PhIP, harman, norharman, AαC, MeAαC, and Trp-P-2) were assessed. The total HAA content in beef and chicken breast ranged from not detectable to 49.26ng/g, and not detectable to 83.06ng/g, respectively. The inhibitory effects of 0.5 and 1.0% artichoke extracts on total HAAs levels were found to be 6-46% and 25-98% in beef, and 5-97% and 14-95% in chicken breast, respectively. The present study showed that artichoke extracts could mitigate HAA formation especially in oven-roasted beef and chicken breast meat. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Bromine incorporation into five DBP classes upon chlorination of water with extremely low SUVA values.

    Science.gov (United States)

    Hong, Huachang; Yan, Xiaoqing; Song, Xuhui; Qin, Yanyan; Sun, Hongjie; Lin, Hongjun; Chen, Jianrong; Liang, Yan

    2017-07-15

    The main objective of this study was to assess the effects of disinfection conditions on bromine incorporation into disinfection by-products (DBPs) during chlorination of water with low specific UV absorbance (SUVA). Five classes of DBPs were included: trihalomethanes (THMs), dihaloacetic acids (di-HAAs), trihaloacetic acids (tri-HAAs), dihaloacetonitriles (DHANs) and trihalonitromethanes (THNMs). Results showed that the bromine utilization in DBPs formation was positive related with reaction time, pH and temperature. On the other hand, the bromine substitution factors (BSFs) of DBPs were generally increased with pH (except tri-HAAs) and bromide concentration, but decreased with the reaction time, temperature and chlorine dose. Moreover, the BSFs values varied with DBP classes with the ranking being as following: THNMs≫DHANs≫tri-HAAs>THM≈di-HAAs. These results were mostly similar with the references, yet the pH effect on BSFs as well as the rank of BSFs for different DBP classes may differ with the specific UV absorbance of organic matter. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Effect of the chlorinated washing of minimally processed vegetables on the generation of haloacetic acids.

    Science.gov (United States)

    Cardador, Maria Jose; Gallego, Mercedes

    2012-07-25

    Chlorine solutions are usually used to sanitize fruit and vegetables in the fresh-cut industry due to their efficacy, low cost, and simple use. However, disinfection byproducts such as haloacetic acids (HAAs) can be formed during this process, which can remain on minimally processed vegetables (MPVs). These compounds are toxic and/or carcinogenic and have been associated with human health risks; therefore, the U.S. Environmental Protection Agency has set a maximum contaminant level for five HAAs at 60 μg/L in drinking water. This paper describes the first method to determine the nine HAAs that can be present in MPV samples, with static headspace coupled with gas chromatography-mass spectrometry where the leaching and derivatization of the HAAs are carried out in a single step. The proposed method is sensitive, with limits of detection between 0.1 and 2.4 μg/kg and an average relative standard deviation of ∼8%. From the samples analyzed, we can conclude that about 23% of them contain at least two HAAs (<0.4-24 μg/kg), which showed that these compounds are formed during washing and then remain on the final product.

  6. Targeting 2.5 versus 4 g/kg/day of amino acids for extremely low birth weight infants: a randomized clinical trial.

    Science.gov (United States)

    Burattini, Ilaria; Bellagamba, Maria Paola; Spagnoli, Cristina; D'Ascenzo, Rita; Mazzoni, Nadia; Peretti, Anna; Cogo, Paola E; Carnielli, Virgilio P

    2013-11-01

    To compare the effect of 2.5 vs 4 g/kg/d of amino acid (AA) in parenteral nutrition of extremely low birth weight infants on metabolic tolerance, short-term growth, and neurodevelopment. One hundred thirty-one infants with birth weight between 500 and 1249 g were randomized to 2.5 (standard AA [SAA] group) or 4 (high AA [HAA] group) g/kg/d AA intake, with equal nonprotein energy. The primary outcome was body size at 36 weeks. One hundred thirty-one patients were randomized and 114 analyzed (58 SAA group and 56 HAA group). Study groups had similar demographics and clinical characteristics. Elevated blood urea (BU >70 mg/dL = BU nitrogen >32.6 mg/dL) occurred in 24% vs 59% (P = .000) and hyperglycemia (>175 mg/dL) in 34% vs 11% (P = .003) of the SAA and HAA patients, respectively. Body weight, length, and head circumference at 36 weeks and 2 years were similar between groups. Bayley Scales of Infant and Toddler Development, Third Edition score was 94 ± 13 in the SAA group and 97 ± 15 in the HAA group (P = .35). The HAA group had higher BU levels and better glucose control. An extra 8 g/kg of AA over the first 10 days of life did not improve growth and neurodevelopment. Copyright © 2013 Mosby, Inc. All rights reserved.

  7. Short outlines of books by Estonian authors / Janika Kronberg, Rutt Hinrikus

    Index Scriptorium Estoniae

    Kronberg, Janika, 1963-

    2006-01-01

    Arvustus: Runnel, Hando. Sinamu. Tartu : Ilmamaa, 2005 ; Talvet, Jüri. Tõrjumatu äär. Tartu : Ilmamaa, 2005 ; Nõu, Enn. Mõtusekuke viimne kogupauk. Tallinn : Eesti Keele Sihtasutus, 2005 ; Merca. Hele häärber. Tartu : Vilep & Vallik, 2005 ; Õnnepalu, Tõnu. Enne heinaaega ja hiljem : luulet ja luuletõlkeid 1983-2005. Tallinn : Eesti Keele Sihtasutus, 2005 ; Kaplinski, Jaan. Kõik on ime. Tartu : Ilmamaa, 2004 ; Unt, Mati. Vend Antigone, ema Oidipus. Tallinn : Kultuurileht, 2006 ; Laretei, Käbi. Otsekui tõlkes : teema variatsioonidega. Tallinn : Tänapäev, 2005 ; Jõerüüt, Jaak. Sõber : valik novelle 1979-2005. Tallinn : Tuum, 2005

  8. Tungmetaller i korn Undersøkelser av prøver dyrket før 1945 sammenlignet med prøver fra 197 6

    OpenAIRE

    Selmer-Olsen, A. R.

    1986-01-01

    Hvete, havre og bygg fra 1930, 1931 og 1943 er analysert på en del tungmetaller og resultatene er sammenlignet med korn dyrket i 1976. Materialet er altfor spinkelt til å trekke noen konklusjon, men antydningsvis kan det se ut som om tungmetallnivået i hvete og bygg ikke er høyere nå enn det var før 1945. Innholdet i havre derimot kan se ut som om det har øket litt. Generelt kan det se ut som om havre har et litt høyere nivå enn de andre.

  9. Gutters lesing på nett : lesing og motivasjon

    OpenAIRE

    Sætersmoen, Margrethe

    2010-01-01

    Mastergradsoppgave i språk, kultur og digital kommunikasjon, Avdeling for lærerutdanning og naturvitenskap, Høgskolen i Hedmark, 2010 Norsk: Det overordnede temaet for min avhandling er ungdomsskolegutters motivasjon for lesing av digitale tekster. Mye av guttenes lesing på fritiden, foregår på skjerm. Hver dag leser de ut fra mange forskjellige motiv, likevel viser store leseundersøkelser som PISA og PIRLS at unge gutter leser mindre enn jenter, de leser dårligere enn jenter, og er mindre...

  10. Toward a culture-by-context perspective on negotiation: negotiating teams in the United States and Taiwan.

    Science.gov (United States)

    Gelfand, Michele J; Brett, Jeanne; Gunia, Brian C; Imai, Lynn; Huang, Tsai-Jung; Hsu, Bi-Fen

    2013-05-01

    Within the United States, teams outperform solos in negotiation (Thompson, Peterson, & Brodt, 1996). The current research examined whether this team advantage generalizes to negotiators from a collectivist culture (Taiwan). Because different cultures have different social norms, and because the team context may amplify the norms that are salient in a particular culture (Gelfand & Realo, 1999), we predicted that the effect of teams on negotiation would differ across cultures. Specifically, we predicted that since harmony norms predominate in collectivist cultures like Taiwan, the team context would amplify a concern with harmony, leading Taiwanese teams to negotiate especially suboptimal outcomes. In support, 2 studies showed that Taiwanese teams negotiated less-optimal outcomes than Taiwanese solos. We also used a moderated-mediation analysis to investigate the mechanism (Hayes, 2012), documenting that the interactive effect of culture and context on outcomes was mediated by harmony norms. By showing that the same situational conditions (team negotiations) can have divergent effects on negotiation outcomes across cultures, our results point toward a nuanced, sociocontextual view that moves beyond the culture-as-main-effect approach to studying culture and negotiations. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  11. Effect of inclusions modified by rare earth elements (Ce, La) on localized marine corrosion in Q460NH weathering steel

    International Nuclear Information System (INIS)

    Liu, Chao; Revilla, Reynier I.; Liu, Zhiyong; Zhang, Dawei; Li, Xiaogang; Terryn, Herman

    2017-01-01

    Highlights: •The initial stages of the pitting corrosion of Q460NH steel in a marine environment was studied. •Two different types of inclusions formed in the Q460NH steel after adding rare earth. •Both types of inclusions showed a lower Volta potential than the matrix. •Pitting corrosion was induced by the dissolution of inclusions rather than the matrix. •Inclusions containing (RE)AlO 3 dissolved completely as a result of the acidic solution formed in the pits. -- Abstract: In this work the initial stages of the pitting corrosion in Q460NH weathering steel in a marine environment was studied. To elucidate the effects of inclusions modified by rare earth (RE) elements on pitting corrosion, field emission-scanning electron microscopy-energy dispersive spectrometry (FE-SEM-EDS) analyses, scanning Kelvin probe force microscopy (SKPFM) tests, and a series of immersion tests were conducted. Two main types of inclusions were formed in the steel, and different pit morphologies were observed. The pitting corrosion was initiated by the dissolution of (RE) 2 O 2 S-(RE)xSy in both types of inclusions due to the lower potential of this phase compared to the matrix, which indicated that the inclusions in the Q460NH weathering steel had a lower pitting corrosion resistance than the matrix.

  12. Glutamate signalling and secretory phospholipase A2 modulate the release of arachidonic acid from neuronal membranes

    DEFF Research Database (Denmark)

    Rodriguez De Turco, Elena B; Jackson, Fannie R; DeCoster, Mark A

    2002-01-01

    The lipid mediators generated by phospholipases A(2) (PLA(2)), free arachidonic acid (AA), eicosanoids, and platelet-activating factor, modulate neuronal activity; when overproduced, some of them become potent neurotoxins. We have shown, using primary cortical neuron cultures, that glutamate...... and secretory PLA(2) (sPLA(2)) from bee venom (bv sPLA(2)) and Taipan snake venom (OS2) elicit synergy in inducing neuronal cell death. Low concentrations of sPLA(2) are selective ligands of cell-surface sPLA(2) receptors. We investigated which neuronal arachidonoyl phospholipids are targeted by glutamate......) and in minor changes in other phospholipids. A similar profile, although of greater magnitude, was observed 20 hr posttreatment. Glutamate (80 microM) induced much less mobilization of (3)H-AA than did sPLA(2) and resulted in a threefold greater degradation of (3)H-AA PE than of (3)H-AA PC by 20 hr...

  13. Embolization of Isolated Hypogastric Artery Aneurysm: A Case Report and a Review of the Literature

    International Nuclear Information System (INIS)

    Medici, Lorenzo de; Bucci, Federico; Nesi, Fabrizio; Rabitti, Giorgio

    2006-01-01

    A 75-year-old man with arterial hypertension, coronary artery disease, and myocardial infarction was referred to our service because of an asymptomatic hypogastric artery aneurysm (HAA) detected by a routine compued tomography (CT) scan. As shown on the angio-CT the maximum transverse diameter (m.t.d.) of the HAA was 47 mm. There were no symptoms of distal embolization or compression on the pelvic structures. We performed the successful complete thrombosis of the aneurysm using vascular plugs via a controlateral femoral approach. The control angiogram was satisfactory and there were no intraoperative complications. A CT-angiography done 4 months after the procedure showed no signs of refilling of the aneurysm sac. This case illustrates some possible advantages of vascular plugs in the treatment of isolated HAA

  14. Quantitative evaluation of interstitial pneumonia using 3D-curved high-resolution CT imaging parallel to the chest wall: A pilot study.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Umakoshi

    Full Text Available To quantify the imaging findings of patients with interstitial pneumonia (IP and emphysema using three-dimensional curved high-resolution computed tomography (3D-cHRCT at a constant depth from the chest wall, and compare the results to visual assessment of IP and each patient's diffusing capacity of the lungs for carbon monoxide (DLco.We retrospectively reviewed the axial CT findings and pulmonary function test results of 95 patients with lung cancer (72 men and 23 women, aged 45-84 years with or without IP, as follows: non-IP (n = 47, mild IP (n = 31, and moderate IP (n = 17. The 3D-cHRCT images of the lung at a 1-cm depth from the chest wall were reconstructed automatically using original software; total area (TA, high-attenuation area (HAA >-500 HU, and low-attenuation area (LAA <-950 HU were calculated on a workstation. The %HAA and %LAA were calculated as follows: [Formula: see text], and [Formula: see text].The %HAA and %LAA respective values were 3.2±0.9 and 27.7±8.2, 3.9±1.2 and 27.6±5.9, and 6.9±2.2 and 25.4±8.7 in non-IP, mild IP, and moderate IP patients, respectively. There were significant differences in %HAA between the 3 groups of patients (P<0.001, but no differences in %LAA (P = 0.558. Multiple linear regression analysis revealed that %HAA and %LAA were negatively correlated with predicted DLco (standard partial regression coefficient [b*] = -0.453, P<0.001; b* = -0.447, P<0.001, respectively.The %HAA and %LAA values computed using 3D-cHRCT were significantly correlated with DLco and may be important quantitative parameters for both IP and emphysema.

  15. Simultaneous determination of 9 heterocyclic aromatic amines in pork products by liquid chromatography coupled with triple quadrupole tandem mass spectrometry

    Science.gov (United States)

    Shen, X. C.; Zhang, Y. L.; Cui, Y. Q.; Xu, L. Y.; Li, X.; Qi, J. H.

    2017-07-01

    Heterocyclic aromatic amines (HAAs) are potent mutagens that formed at high temperature in cooked, protein-rich food. Owing to their frequent intake, an accurate method is essential to access human health risk of HAAs exposure through detecting these compounds in various heat-treated meat products. In this study, a liquid chromatography-electrospray tandem mass spectrometry (LC--ESI-MS/MS) method was developed to perform the determination of 9 mutagenic heterocyclic amines (HAAs) in meat samples with multiple reaction monitoring (MRM) mode. Ultrasound assisted extraction and diatomaceous earth was employed to extract HAAs from food samples, and the analytes were purified and enriched using tandem solid phase extraction, with propyl sulfonic acid coupled to a C18 cartridge. Two parameters, extraction time and eluent, were carefully optimized to improve the extraction and purification efficiency. The LC separation was carried out using a Zorbax SB-C18 (3.5 μm particle size, 2.1 × 150 mm i.d.) column and optimized some parameters, such as pH, concentration and volume. Under the optimal experimental conditions, recoveries ranged from 52.97% to 97.11% with good quality parameters: limit of detection values between 0.02 and 0.24 ng mL-1, linearity (R2>0.998), and run-to-run and day-to-day precisions lower than 9.81% achieved. To evaluate the performance of the method in high throughput analysis of complex meat samples, the LC-MS/MS method was applied to the analysis of HAAs in three food samples, and the results demonstrated that the method can be used for the trace determination of HAAs in pork samples.

  16. Genotoxicity and induction of DNA damage responsive genes by food-borne heterocyclic aromatic amines in human hepatoma HepG2 cells.

    Science.gov (United States)

    Pezdirc, Marko; Žegura, Bojana; Filipič, Metka

    2013-09-01

    Heterocyclic aromatic amines (HAAs) are potential human carcinogens formed in well-done meats and fish. The most abundant are 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-Amino-3,4,8-trimethyl-3H-imidazo[4,5-f]quinoxaline (4,8-DiMeIQx) and 2-Amino-3-methyl-3H-imidazo[4,5-f]quinoline (IQ). HAAs exert genotoxic activity after metabolic transformation by CYP1A enzymes, that is well characterized, however the genomic and intervening responses are not well explored. We have examined cellular and genomic responses of human hepatoma HepG2 cells after 24h exposure to HAAs. Comet assay revealed increase in formation of DNA strand breaks by PhIP, MeIQx and IQ but not 4,8-DiMeIQx, whereas increased formation of micronuclei was not observed. The four HAAs up-regulated expression of genes encoding metabolic enzymes CYP1A1, CYP1A2 and UGT1A1 and expression of TP53 and its downstream regulated genes CDKN1A, GADD45α and BAX. Consistent with the up-regulation of CDKN1A and GADD45α the cell-cycle analysis showed arrest in S-phase by PhIP and IQ, and in G1-phase by 4,8-DiMeIQx and MeIQx. The results indicate that upon exposure to HAAs the cells respond with the cell-cycle arrest, which enables cells to repair the damage or eliminate them by apoptosis. However, elevated expression of BCL2 and down-regulation of BAX may indicate that HAAs could suppress apoptosis meaning higher probability of damaged cells to survive and mutate. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Haloacetic acids in the aquatic environment. Part II: ecological risk assessment

    International Nuclear Information System (INIS)

    Hanson, Mark L.; Solomon, Keith R.

    2004-01-01

    Haloacetic acids (HAAs) are environmental contaminants found in aquatic ecosystems throughout the world as a result of both anthropogenic and natural production. The ecological risk posed by these compounds to organisms in freshwater environments, with a specific focus on aquatic macrophytes, was characterized. The plants evaluated were Lemna gibba, Myriophyllum spicatum and M. sibiricum and the HAAs screened were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). Laboratory toxicity data formed the basis of the risk assessment, but field studies were also utilized. The estimated risk was calculated using hazard quotients (HQ), as well as effect measure distributions (EMD) in a modified probabilistic ecological risk assessment. EMDs were used to estimate HAA thresholds of toxicity for use in HQ assessments. This threshold was found to be a more sensitive measure of low toxicity than the no observed effect concentrations (NOEC) or the effective concentration (EC 10 ). Using both deterministic and probabilistic methods, it was found that HAAs do not pose a significant risk to freshwater macrophytes at current environmental concentrations in Canada, Europe or Africa for both single compound and mixture exposures. Still, HAAs are generally found as mixtures and their potential interactions are not fully understood, rendering this phase of the assessment uncertain and justifying further effects characterization. TCA in some environments poses a slight risk to phytoplankton and future concentrations of TFA and CDFA are likely to increase due to their recalcitrant nature, warranting continued environmental surveillance of HAAs. - Current environmental concentrations of haloacetic acids do not pose a risk to aquatic macrophytes, but could impact plankton

  18. Antioxidant Properties of Kynurenines: Density Functional Theory Calculations

    Science.gov (United States)

    2016-01-01

    Kynurenines, the main products of tryptophan catabolism, possess both prooxidant and anioxidant effects. Having multiple neuroactive properties, kynurenines are implicated in the development of neurological and cognitive disorders, such as Alzheimer's, Parkinson's, and Huntington's diseases. Autoxidation of 3-hydroxykynurenine (3HOK) and its derivatives, 3-hydroxyanthranilic acid (3HAA) and xanthommatin (XAN), leads to the hyperproduction of reactive oxygen species (ROS) which damage cell structures. At the same time, 3HOK and 3HAA have been shown to be powerful ROS scavengers. Their ability to quench free radicals is believed to result from the presence of the aromatic hydroxyl group which is able to easily abstract an electron and H-atom. In this study, the redox properties for kynurenines and several natural and synthetic antioxidants have been calculated at different levels of density functional theory in the gas phase and water solution. Hydroxyl bond dissociation enthalpy (BDE) and ionization potential (IP) for 3HOK and 3HAA appear to be lower than for xanthurenic acid (XAA), several phenolic antioxidants, and ascorbic acid. BDE and IP for the compounds with aromatic hydroxyl group are lower than for their precursors without hydroxyl group. The reaction rate for H donation to *O-atom of phenoxyl radical (Ph-O*) and methyl peroxy radical (Met-OO*) decreases in the following rankings: 3HOK ~ 3HAA > XAAOXO > XAAENOL. The enthalpy absolute value for Met-OO* addition to the aromatic ring of the antioxidant radical increases in the following rankings: 3HAA* < 3HOK* < XAAOXO* < XAAENOL*. Thus, the high free radical scavenging activity of 3HAA and 3HOK can be explained by the easiness of H-atom abstraction and transfer to O-atom of the free radical, rather than by Met-OO* addition to the kynurenine radical. PMID:27861556

  19. Effect of structural disorder on quantum oscillations in graphite

    Energy Technology Data Exchange (ETDEWEB)

    Camargo, B. C., E-mail: b.c-camargo@yahoo.com.br; Kopelevich, Y. [Instituto de Fisica Gleb Wataghin, Universidade Estadual de Campinas, Unicamp 13083-970, Campinas, São Paulo (Brazil); Usher, A.; Hubbard, S. B. [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)

    2016-01-18

    We have studied the effect of structural disorder on the de Haas van Alphen and Shubnikov de Haas quantum oscillations measured in natural, Kish, and highly oriented pyrolytic graphite samples at temperatures down to 30 mK and at magnetic fields up to 14 T. The measurements were performed on different samples characterized by means of x-ray diffractometry, transmission electron microscopy, and atomic-force microscopy techniques. Our results reveal a correlation between the amplitude of quantum oscillations and the sample surface roughness.

  20. Prospects for Closer Israeli-NATO Cooperation

    Science.gov (United States)

    2015-09-01

    Actions and Arab Perceptions.” In The Middle East and the United States, 5th ed., edited by David W. Lesch and Mark L. Haas, 177–96. Boulder, CO...Ibid. 110 David W. Lesch, Mark L. Haas, eds., The Middle East and the United States, 5th ed. (Boulder, CO, Westview Press, 2014), 2 21 beginning...to Israel in 2005, NATO Secretary General Jaap de Hoop Scheffer stated, “the interplay of Middle Eastern and transatlantic security is becoming

  1. The isolation of beryllium and mercury from lithium chloride solution by means of gas extraction

    International Nuclear Information System (INIS)

    Sevast'yanov, A.I.; Chepovoj, V.I.

    1988-01-01

    The possibility and optimal conditions of beryllium and mercury extraction using acetylacetone (HAA) from lithium chloride solution by argon blowing through the solution are determined. Dependences of extraction degrees and distribution coefficients on different parameters of liquid phase: initial pH value, lithium chloride concentration and initial content of HAA, are presented. The degree of beryllium extraction reaches the maximum at liquid phase pH of 4.4-5.25 and concentration of lithium chloride of 8.5 mol/l. Distribution coefficient changes in inverse proportion to the extraction degree

  2. Magneto-transporte em sistemas semicondutores com gas de eletrons bidimensional

    OpenAIRE

    Alvaro Guedes Soares

    1994-01-01

    Resumo: O objetivo básico deste trabalho foi a implantação de técnicas de magneto-transporte em heteroestruturas semicondutoras que apresentam gás de elétron bidimensional (2-DEG), particularmente, o Efeito Shubnikov-de Haas (SdH) e Efeito Hall Quântico (QHE). Neste sentido foi realizada a recuperação de uma bobina supercondutora (criostato e sistema de controle) que permite medidas em campo magnético de até 14 Tesla. Medidas de oscilações Shubnikov-de Haas e Efeito Hall Quântico foram fei...

  3. Amber Trust on ostmas Tallinna Külmhoone emafirmat / Liis Kängsepp

    Index Scriptorium Estoniae

    Kängsepp, Liis, 1981-

    2005-01-01

    Skandinaavia-USA investeerimisfond Amber Trust loodab enne aasta lõppu allkirjastada Tallinna Külmhoone emafirma Kauno Pieno Centras ostulepingu. Diagramm: Tallinna Külmhoone majandusnäitajad. Vt. samas: Amber Trust tahab investeerida üle 2 miljardi krooni; Amber laiendas tegevust Vetteli kaudu Soome

  4. Eesti tippteadlaste panus maailma : päästvad bakterid ja täiustatud elektroonika / koost. Jüri Allik

    Index Scriptorium Estoniae

    2007-01-01

    Jüri Allik lappas maailma suurimat teaduskirjanduse andmebaasi ISI Web of Science. Enimviidatud Eesti teadlased on: Jaan Aarik, Jaak Jürimäe, Mati Karelson, Marco Kirm, Eero Vasar, Mihkel Zilmer, Ülo Niinemets, Kaupo Kukli, Enn Lust

  5. Nasdaq loobub Londoni börsist OMX-i ostmiseks / Eric Katskowski

    Index Scriptorium Estoniae

    Katskowski, Eric

    2007-01-01

    USA tehnoloogiabörs Nasdaq konkureerib Dubai börsiga Skandinaavia ja Balti väärtpaberiturge juhtiva OMX-i ostmise pärast. Enn Metsari hinnangul on Tallinna börsi jaoks head mõlemad OMX-ile tehtud pakkumised

  6. Merko Ehituse aktsiaid müüb Eesti ehitusturu insaider

    Index Scriptorium Estoniae

    2005-01-01

    AS-i Merko Ehitus suuremad aktsionärid ja aktsiatehingud aastatel 1997-2004. Vt. samas: Enn Pant on Merko Ehitusest loobunud; Müüsime kõiki Eesti aktsiaid. Diagrammid: Enim Merko Ehituse aktsiaid on müünud ING; Merko Ehituse aktsiaid on ostnud juurde Eesti väikeaktsionärid

  7. Kaubanduse tagasihoidlik valitseja / Väinu Rozental

    Index Scriptorium Estoniae

    Rozental, Väinu, 1957-

    2007-01-01

    Tallinna Kaubamaja juht Raul Puusepp on äärmiselt järjekindel ja töökas. CV. Vt. samas: Kaubamaja eduloo taga on õiged otsused ja investeeringud. Diagramm; Kutse Lumumba ülikooli. Kommenteerivad: Enn Parel, Tarmo Punger, Tenno Tiits ja Jaan Kallas

  8. Piraadid paljastasid riiklike relvaärikate varjatud kanali / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2008-01-01

    Somaalia piraatide kaaperdatud laeval oli 33 Nõukogude päritolu tanki, laadungi sihtpunktiks väidetavalt Kenya. Piraatide väitel aga ei kuulu relvad Kenya valitsusele, vaid Lõuna-Sudaanile. Autor märgib, et enne 2011. a. toimuvat referendumit Lõuna-Sudaanis toimub pingeline võidurelvastumine

  9. Haridustee = Education / Tiiu-Liisa Rummo-Laes

    Index Scriptorium Estoniae

    Rummo-Laes, Tiiu-Liisa

    2006-01-01

    Põhihariduses soolist eristumist ei ole märgata, murettekitavalt suur on poiste väljalangemine enne põhihariduse omandamist. Tütarlapsed ja noormehed üld- ja kutsehariduses, kesk- ja kõrghariduses. Noorte õppimine ja töötamine leibkonnatüübiti. Tabel, graafik, diagrammid

  10. Tuulelohe lend 2008 : Juhan Parts kutsus tööstureid arutelule

    Index Scriptorium Estoniae

    2008-01-01

    Kokkuvõte majandusfoorumist, kus arutati Eesti majanduspoliitika ja tööstuse tulevikku. Arutlevad majandus- ja kommunikatsiooniminister Juhan Parts, teadlane Endel Lippmaa, Eesti Telekomi juhatuse esimees Valdo Kalm, Eesti Arengufondi nõukogu esimees Indrek Neivelt ja AS-i Standard juhatuse esimees Enn Veskimägi

  11. Punane süda mustal lipul / Lauri Kaare

    Index Scriptorium Estoniae

    Kaare, Lauri

    2004-01-01

    Helsingis 17. korda toimuva festivali "Armastus ja Anarhia" kavas olnud filmidest - korealase Park Chan-Wooki "Vanapoiss" ("Old Boy"), Richard Linklateri "Enne päikeseloojangut" ("Before Sunset"), india film "Homne võib jööda tulemata" ("Tomorrow May Never Come"), mehhiko "Nikotiin" ("Nicotina") jt

  12. Suur rahvusvaheline välisbalti arhiivide konverents südasuvises Tartus / Mai Raud-Pähn ; fotod Madis Laas

    Index Scriptorium Estoniae

    Raud-Pähn, Mai, 1920-

    2006-01-01

    Ettekannetega esinesid: Tiiu Kravtsev, Riina Reinvelt, Juta Kivimäe, Piret Noorhani, Merike Kiipus, Anu Korb, Anne Valmas, Mihkel Volt, Mare Rand, Inga Kuljus, Enn Mainla, Roland Weiler, Teas Tanner, Tiina Kirss, Jüri Kivimäe, Enda-Mai Michelson-Holland, Andrae, Carl Göran, Katrin Meerits ja Maie Barrow

  13. Õnnetute ugrilaste lõputu õnn, ääri-veeri / Art Leete

    Index Scriptorium Estoniae

    Leete, Art, 1969-

    1996-01-01

    Arvustus: Enne koitu : Soome-ugri tõlkeklassikat / Koost. ja tlk. Arvo Valton; Saatesõnad kirjutanud: Eva Vingiano de Pina Martins. - Tln. : Virgela, 1996. nEesti-mari, eesti-komi ja eesti-udmurdi paralleeltekstidega tõlkekogumik. Ka Eva Vingiano de Pina Martinsi (Toulouze'i) saatesõnadest

  14. Pühendunud oma kirele / Kristjan Smeds ; intervjueerinud Kairi Prints

    Index Scriptorium Estoniae

    Smeds, Kristian, 1970-

    2011-01-01

    Von Krahli Teatris esietendus 1. oktoobril lavastus "12 Karamazovit", lavastaja Kristian Smeds. Intervjuu lavastajaga päev enne esietendust. Von Krahli Teatri ja Smeds Ensemble'i ühisprojekti mängitakse oktoobris ja novembris Euroopa kultuuripealinnades Tallinnas ja Turus

  15. 7. XII avati rahvusraamatukogu VI korruse näitusesaalis...

    Index Scriptorium Estoniae

    2005-01-01

    Hispaania Graafiliste Kunstide Akadeemia (Calcografia Nacional) koostatud ja Hispaania Suursaatkonna vahendatud näitus "Goya : portreteeritud südametunnistus". Väljas on 20 suureformaadilist digitaalpilti Francisco de Goya gravüüridest. Enne näituse avamist pidas Ramon de Villanueva loengu "Selgitusi Goya loomingu mõistmiseks"

  16. Piip ja Tuut ootavad Amarillosse ja Coca-Cola Plazasse perepäevale

    Index Scriptorium Estoniae

    2004-01-01

    Kord kuus, septembrist 2004 kuni 2005.a. maini korraldatavatest perepäevadest. C-C Plazas on perepäevade ajal kavas eriprogramm ja enne või pärast filmi on pered oodatud Viru hotelli restorani Amarillo, kus kavas spetsiaalne lasteprogramm klounidelt Piip ja Tuut

  17. Rein Veidemanni romaan vene keeles

    Index Scriptorium Estoniae

    2015-01-01

    Kirjastus KPD on välja andnud vene keeles Rein Veidemanni 2012. aastal ilmunud romaani "Tund enne igavikku". Marina Tervoneni tõlkes ilmunud teos kannab vene keeles pealkirja "Вечный университет"

  18. Eduka ettevõtte aluseks saab olla vaid looming / Ave Schmidt

    Index Scriptorium Estoniae

    Schmidt, Ave

    2010-01-01

    Tänapäeva ettevõttele tagavad konkurentsieelise inspiratsioon ja originaalsed ideed. Arvamust avaldavad Tallinna kohviku Nop asutaja Margit Aasmäe, Estonian Airi arendusdirektor Gunnar Mägi, Tallinna Kaubamaja müügi- ja turundusdirektor Enn Parel ja Balteco disainijuht Aivar Habakukk

  19. Plaadid : Pop& rock. Retro. Jazz. Klassika

    Index Scriptorium Estoniae

    2002-01-01

    Uutest plaatidest. Sisqo "Return Of Dragon", Alice Cooper "Dragontown", Kim Wilde "The Very Best Of", David Sanches "Travesia", Peter White "Glow". Eesti plaadid : Vennaskond "News From Nowhere", Erinevad esitajad "Tallinn. Psühhedeelne linn", Ivo Linna "Enne ja pärast päeva", Arne Oit & Margus Kappel "Unustuste jõel", Anu Tali "Swan Flight"

  20. Filmifestival ootab dokfilme uudistama / Berit Toodo

    Index Scriptorium Estoniae

    Toodo, Berit

    2008-01-01

    Pärnu 22. dokumentaal- ja antropoloogiafilmide festivali kulgemisest, probleemidest filmide näitamise paikade ja tehnikaga, näidatavate filmide tutvustusi - ameeriklase Robert Harding Pittmani "Tamm nr. 419", Doris Tromballa ja Florian Guthknechti "Elu tulvavees", hollandlase Jos de Putteri "Enne üleujutust"