2014-01-01
Alcoholic fermentations have accompanied human civilizations throughout our history. Lager yeasts have a several-century-long tradition of providing fresh beer with clean taste. The yeast strains used for lager beer fermentation have long been recognized as hybrids between two Saccharomyces species. We summarize the initial findings on this hybrid nature, the genomics/transcriptomics of lager yeasts, and established targets of strain improvements. Next-generation sequencing has provided fast access to yeast genomes. Its use in population genomics has uncovered many more hybridization events within Saccharomyces species, so that lager yeast hybrids are no longer the exception from the rule. These findings have led us to propose network evolution within Saccharomyces species. This “web of life” recognizes the ability of closely related species to exchange DNA and thus drain from a combined gene pool rather than be limited to a gene pool restricted by speciation. Within the domesticated lager yeasts, two groups, the Saaz and Frohberg groups, can be distinguished based on fermentation characteristics. Recent evidence suggests that these groups share an evolutionary history. We thus propose to refer to the Saaz group as Saccharomyces carlsbergensis and to the Frohberg group as Saccharomyces pastorianus based on their distinct genomes. New insight into the hybrid nature of lager yeast will provide novel directions for future strain improvement. PMID:25084862
Energy Technology Data Exchange (ETDEWEB)
Lambrecht, A. [Trappe Erdoel Erdgas Consultant, Isernhagen (Germany)
1998-12-31
Geophysics and geology employ different kinds of techniques in order to preserve the underground structure. These techniques are based on different sets of data, i.e. seismic or geological data. A sensible combination of the two techniques should produce a better model of the ground structure. This study attempts to integrate geologically balanced profiles and seismic reflection data. A balanced geological profile can than be compared with seismic reflection data measured in the field. The geological model is then changed into a seismic model of the underground by means of seismic modeling. Synthetic modeling is based on the acquisition of available field data. The synthetic stack section or the synthetic migration image are then compared to the field data. Deviations between the two can be attributed to speed errors and the fact that balances will never give an unequivocal solution but always present a group of solutions. (orig. MSK). [Deutsch] In der Geophysik und der Geologie werden verschiedene Techniken verwendet, um die Untergrundstruktur zu erhalten. Diese Techniken basieren auf verschiedenen Datensaetzen, z.B. seismische und geologische Daten. Eine sinnvolle Kombination der Techniken sollte ein besseres Abbild des Untergrundes liefern. In dieser Studie wird ein Versuch unternommen geologisch bilanzierte Profile und reflexionsseismische Daten zu integrieren. Soll ein bilanziertes geologisches Profil mit im Feld gemessenen reflexionsseismischen Daten verglichen werden, dann wird das geologische Modell mit Hilfe der seismischen Modellierung in ein seismisches Abbild des Untergrundes verwandelt. Dabei wird die synthetische Modellierung entsprechend der Aquisition der vorliegenden Felddaten durchgefuehrt. Die synthetische Stapelsektion oder das synthetische Migrationsimage werden anschliessend mit den Felddaten verglichen. Abweichungen zwischen beobachteten und Felddaten haben ihre Ursachen sowohl in Geschwindigkeitsfehlern, als auch in der Tatsache, dass eine
Teilchendetektoren Grundlagen und Anwendungen
Kolanoski, Hermann
2016-01-01
In diesem Buch werden die experimentellen Grundlagen von Teilchendetektoren und ihre Anwendung in Experimenten beschrieben. Die Entwicklung von Detektoren ist ein wichtiger Bestandteil der Teilchen-, Astroteilchen- und Kernphysik und gehört daher zum Handwerk des Experimentalphysikers in diesen Gebieten. Dieses umfassende Werk beinhaltet den kompletten Stoff für entsprechende Master-Module in der experimentellen Teilchenphysik, geht aber im Inhalt auch darüber hinaus. Zielgruppe sind Studierende, die sich in die Materie vertiefen möchten, aber auch Lehrende und Wissenschaftler, die das Buch zum Einstieg in das wissenschaftliche Arbeiten an Detektorentwicklungen verwenden können. Zielrichtung des Buches ist, die physikalischen Grundlagen für die Detektoren und ihrer verschiedenen Ausführungen so klar wie möglich und so tiefgehend wie nötig darzustellen. Die Breite des für die Detektorentwicklung nötigen Wissens umfasst viele Bereiche der Physik und Technik, von den Wechselwirkun...
New lager yeast strains generated by interspecific hybridization.
Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian
2015-05-01
The interspecific hybrid Saccharomyces pastorianus is the most commonly used yeast in brewery fermentations worldwide. Here, we generated de novo lager yeast hybrids by mating a domesticated and strongly flocculent Saccharomyces cerevisiae ale strain with the Saccharomyces eubayanus type strain. The hybrids were characterized with respect to the parent strains in a wort fermentation performed at temperatures typical for lager brewing (12 °C). The resulting beers were analysed for sugar and aroma compounds, while the yeasts were tested for their flocculation ability and α-glucoside transport capability. These hybrids inherited beneficial properties from both parent strains (cryotolerance, maltotriose utilization and strong flocculation) and showed apparent hybrid vigour, fermenting faster and producing beer with higher alcohol content (5.6 vs 4.5 % ABV) than the parents. Results suggest that interspecific hybridization is suitable for production of novel non-GM lager yeast strains with unique properties and will help in elucidating the evolutionary history of industrial lager yeast.
Genome sequence of the lager brewing yeast, an interspecies hybrid.
Nakao, Yoshihiro; Kanamori, Takeshi; Itoh, Takehiko; Kodama, Yukiko; Rainieri, Sandra; Nakamura, Norihisa; Shimonaga, Tomoko; Hattori, Masahira; Ashikari, Toshihiko
2009-04-01
This work presents the genome sequencing of the lager brewing yeast (Saccharomyces pastorianus) Weihenstephan 34/70, a strain widely used in lager beer brewing. The 25 Mb genome comprises two nuclear sub-genomes originating from Saccharomyces cerevisiae and Saccharomyces bayanus and one circular mitochondrial genome originating from S. bayanus. Thirty-six different types of chromosomes were found including eight chromosomes with translocations between the two sub-genomes, whose breakpoints are within the orthologous open reading frames. Several gene loci responsible for typical lager brewing yeast characteristics such as maltotriose uptake and sulfite production have been increased in number by chromosomal rearrangements. Despite an overall high degree of conservation of the synteny with S. cerevisiae and S. bayanus, the syntenies were not well conserved in the sub-telomeric regions that contain lager brewing yeast characteristic and specific genes. Deletion of larger chromosomal regions, a massive unilateral decrease of the ribosomal DNA cluster and bilateral truncations of over 60 genes reflect a post-hybridization evolution process. Truncations and deletions of less efficient maltose and maltotriose uptake genes may indicate the result of adaptation to brewing. The genome sequence of this interspecies hybrid yeast provides a new tool for better understanding of lager brewing yeast behavior in industrial beer production.
Palma, Margarida; Dias, Paulo Jorge; Roque, Filipa de Canaveira; Luzia, Laura; Guerreiro, Joana Fernandes; Sá-Correia, Isabel
2017-01-13
The food spoilage yeast species Zygosaccharomyces bailii exhibits an extraordinary capacity to tolerate weak acids, in particular acetic acid. In Saccharomyces cerevisiae, the transcription factor Haa1 (ScHaa1) is considered the main player in genomic expression reprogramming in response to acetic acid stress, but the role of its homologue in Z. bailii (ZbHaa1) is unknown. In this study it is demonstrated that ZbHaa1 is a ScHaa1 functional homologue by rescuing the acetic acid susceptibility phenotype of S. cerevisiae haa1Δ. The disruption of ZbHAA1 in Z. bailii IST302 and the expression of an extra ZbHAA1 copy confirmed ZbHAA1 as a determinant of acetic acid tolerance. ZbHaa1 was found to be required for acetic acid stress-induced transcriptional activation of Z. bailii genes homologous to ScHaa1-target genes. An evolutionary analysis of the Haa1 homologues identified in 28 Saccharomycetaceae species genome sequences, including Z bailii, was carried out using phylogenetic and gene neighbourhood approaches. Consistent with previous studies, this analysis revealed a group containing pre-whole genome duplication species Haa1/Cup2 single orthologues, including ZbHaa1, and two groups containing either Haa1 or Cup2 orthologues from post-whole genome duplication species. S. cerevisiae Cup2 (alias Ace1) is a transcription factor involved in response and tolerance to copper stress. Taken together, these observations led us to hypothesize and demonstrate that ZbHaa1 is also involved in copper-induced transcriptional regulation and copper tolerance. The transcription factor ZbHaa1 is required for adaptive response and tolerance to both acetic acid and copper stresses. The subfunctionalization of the single ancestral Haa1/Cup2 orthologue that originated Haa1 and Cup2 paralogues after whole genome duplication is proposed.
Garcia Sanchez, Rosa; Solodovnikova, Natalia; Wendland, Jürgen
2012-08-01
Lager beer brewing relies on strains collectively known as Saccharomyces carlsbergensis, which are hybrids between S. cerevisiae and S. eubayanus-like strains. Lager yeasts are particularly adapted to low-temperature fermentations. Selection of new yeast strains for improved traits or fermentation performance is laborious, due to the allotetraploid nature of lager yeasts. Initially, we have generated new F1 hybrids by classical genetics, using spore clones of lager yeast and S. cerevisiae and complementation of auxotrophies of the single strains upon mating. These hybrids were improved on several parameters, including growth at elevated temperature and resistance against high osmolarity or high ethanol concentrations. Due to the uncertainty of chromosomal make-up of lager yeast spore clones, we introduced molecular markers to analyse mating-type composition by PCR. Based on these results, new hybrids between a lager and an ale yeast strain were isolated by micromanipulation. These hybrids were not subject to genetic modification. We generated and verified 13 hybrid strains. All of these hybrid strains showed improved stress resistance as seen in the ale parent, including improved survival at the end of fermentation. Importantly, some of the strains showed improved fermentation rates using 18° Plato at 18-25°C. Uniparental mitochondrial DNA inheritance was observed mostly from the S. cerevisiae parent. Copyright © 2012 John Wiley & Sons, Ltd.
The Genome Sequence of Saccharomyces eubayanus and the Domestication of Lager-Brewing Yeasts
Baker, EmilyClare; Wang, Bing; Bellora, Nicolas; Peris, David; Hulfachor, Amanda Beth; Koshalek, Justin A.; Adams, Marie; Libkind, Diego; Hittinger, Chris Todd
2015-01-01
The dramatic phenotypic changes that occur in organisms during domestication leave indelible imprints on their genomes. Although many domesticated plants and animals have been systematically compared with their wild genetic stocks, the molecular and genomic processes underlying fungal domestication have received less attention. Here, we present a nearly complete genome assembly for the recently described yeast species Saccharomyces eubayanus and compare it to the genomes of multiple domesticated alloploid hybrids of S. eubayanus × S. cerevisiae (S. pastorianus syn. S. carlsbergensis), which are used to brew lager-style beers. We find that the S. eubayanus subgenomes of lager-brewing yeasts have experienced increased rates of evolution since hybridization, and that certain genes involved in metabolism may have been particularly affected. Interestingly, the S. eubayanus subgenome underwent an especially strong shift in selection regimes, consistent with more extensive domestication of the S. cerevisiae parent prior to hybridization. In contrast to recent proposals that lager-brewing yeasts were domesticated following a single hybridization event, the radically different neutral site divergences between the subgenomes of the two major lager yeast lineages strongly favor at least two independent origins for the S. cerevisiae × S. eubayanus hybrids that brew lager beers. Our findings demonstrate how this industrially important hybrid has been domesticated along similar evolutionary trajectories on multiple occasions. PMID:26269586
Fachsprachensemantik. Grundlagen ihrer (kognitionslinguistischen) Beschreibung
DEFF Research Database (Denmark)
Engberg, Jan
2002-01-01
Vertikalitätsannahme von Wichter (z.B. Wichter 1994) und die Annahme der Gradualität von Fachlichkeit von Kalverkämper (1991). Diese Grundlagen bedeuten, dass davon ausgegangen wird, dass die Bedeutung von Fachwörtern, die bei Fachleuten zugeschrieben werden, sich in vielen Fällen lediglich graduell von Bedeutungen...... unterscheiden, die bei Nicht-Fachleuten existieren. Gleichzeitig bedeuten die Annahmen, dass von einer graduierten Geltung unterschiedlicher Bedeutungsregeln auszugehen ist, die bei der Konstruktion von Bedeutung in aktueller Kommunikation eingesetzt werden. Objekt des Modells sind damit individuelle...
The role of lager beer yeast in oxidative stability of model beer
DEFF Research Database (Denmark)
Berner, Torben Sune; Arneborg, Nils
2012-01-01
that the oxidative stress resistance was strain dependent. Fermentation of model wort in European Brewing Convention tubes using three yeast strains with varying oxidative stress resistances resulted in three model beers with different rates of radical formation as measured by electron spin resonance in forced......AIMS: In this study, we investigated the relationship between the ability of lager brewing yeast strains to tolerate oxidative stress and their ability to produce oxidative stable model beer. METHODS AND RESULTS: Screening of 21 lager brewing yeast strains against diamide and paraquat showed...... in the model beers. CONCLUSIONS: A more oxidative stable beer is not obtained by a more-oxidative-stress-tolerant lager brewing yeast strain, exhibiting a higher secretion of thioredoxin, but rather by a less-oxidative-stress-tolerant strain, exhibiting a higher iron uptake. SIGNIFICANCE AND IMPACT...
Mertens, Stijn; Steensels, Jan; Saels, Veerle; De Rouck, Gert; Aerts, Guido; Verstrepen, Kevin J
2015-12-01
Lager beer is the most consumed alcoholic beverage in the world. Its production process is marked by a fermentation conducted at low (8 to 15°C) temperatures and by the use of Saccharomyces pastorianus, an interspecific hybrid between Saccharomyces cerevisiae and the cold-tolerant Saccharomyces eubayanus. Recent whole-genome-sequencing efforts revealed that the currently available lager yeasts belong to one of only two archetypes, "Saaz" and "Frohberg." This limited genetic variation likely reflects that all lager yeasts descend from only two separate interspecific hybridization events, which may also explain the relatively limited aromatic diversity between the available lager beer yeasts compared to, for example, wine and ale beer yeasts. In this study, 31 novel interspecific yeast hybrids were developed, resulting from large-scale robot-assisted selection and breeding between carefully selected strains of S. cerevisiae (six strains) and S. eubayanus (two strains). Interestingly, many of the resulting hybrids showed a broader temperature tolerance than their parental strains and reference S. pastorianus yeasts. Moreover, they combined a high fermentation capacity with a desirable aroma profile in laboratory-scale lager beer fermentations, thereby successfully enriching the currently available lager yeast biodiversity. Pilot-scale trials further confirmed the industrial potential of these hybrids and identified one strain, hybrid H29, which combines a fast fermentation, high attenuation, and the production of a complex, desirable fruity aroma. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
The Genome Sequence of Saccharomyces eubayanus and the Domestication of Lager-Brewing Yeasts.
Baker, EmilyClare; Wang, Bing; Bellora, Nicolas; Peris, David; Hulfachor, Amanda Beth; Koshalek, Justin A; Adams, Marie; Libkind, Diego; Hittinger, Chris Todd
2015-11-01
The dramatic phenotypic changes that occur in organisms during domestication leave indelible imprints on their genomes. Although many domesticated plants and animals have been systematically compared with their wild genetic stocks, the molecular and genomic processes underlying fungal domestication have received less attention. Here, we present a nearly complete genome assembly for the recently described yeast species Saccharomyces eubayanus and compare it to the genomes of multiple domesticated alloploid hybrids of S. eubayanus × S. cerevisiae (S. pastorianus syn. S. carlsbergensis), which are used to brew lager-style beers. We find that the S. eubayanus subgenomes of lager-brewing yeasts have experienced increased rates of evolution since hybridization, and that certain genes involved in metabolism may have been particularly affected. Interestingly, the S. eubayanus subgenome underwent an especially strong shift in selection regimes, consistent with more extensive domestication of the S. cerevisiae parent prior to hybridization. In contrast to recent proposals that lager-brewing yeasts were domesticated following a single hybridization event, the radically different neutral site divergences between the subgenomes of the two major lager yeast lineages strongly favor at least two independent origins for the S. cerevisiae × S. eubayanus hybrids that brew lager beers. Our findings demonstrate how this industrially important hybrid has been domesticated along similar evolutionary trajectories on multiple occasions. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Ontologische und epistemologische Grundlagen qualitative Forschung
Vasilachis de Gialdino, Irene
2009-01-01
Dieser Beitrag zielt auf das Herzstück qualitativer Forschung, indem gezeigt wird, dass es – aus der Perspektive einer Epistemologie des "gewussten" Subjekts – erforderlich ist, zunächst deren ontologische und dann deren epistemologische Grundlagen neu zu überdenken. Hierzu zeichne ich in einem ersten Schritt den Weg von einer Epistemologie des "bewussten" Subjekts hin zu einer Epistemologie des "gewussten" Subjekts nach, die ich als neuen (und nicht exklusiven) Weg des Wissens vorschlage. Da...
Strategische Beschaffung: Grundlagen, Planung und Umsetzung eines integrierten Supply Management
van Weele, A.J.; Eßig, M.
2017-01-01
Dieses Buch bietet – erstmalig in deutscher Übersetzung – eine umfassende und sehr anschauliche Darstellung zu Grundlagen, Planung und Umsetzung einer modernen Beschaffungsfunktion. Beschaffung und Supply Management werden dabei als wesentliches Bindeglied innerhalb des Managementsystems eines
Energy Technology Data Exchange (ETDEWEB)
NONE
2010-01-15
On October 17, 2010, on request of those Swiss government institutions responsible for the disposal of radioactive wastes, the National Co-operative for the Disposal of Radioactive Waste (NAGRA) presented its project concerning geological sites for the foreseen disposal of radioactive wastes to the Federal Authorities. According to the present disposal concept, two types of repository are foreseen: one for highly radioactive wastes (HAA) and the other for low radioactive and intermediate-level radioactive wastes (SMA). If a site fulfils the necessary conditions for both HAA as well as for SMA, a combined site for both types of waste may be chosen. As a qualified control authority in Switzerland, the Federal Nuclear Safety Inspectorate (ENSI) has to examine the quality of the NAGRA proposals from the point of view of the nuclear safety of the sites. The project for deep underground waste disposal first defines the process and the criteria according to which sites for the geological storage of all types of radioactive wastes in Switzerland have to be chosen. The choice is based on the actual knowledge of Swiss geology. After dividing the wastes into SMA and HAA, some large-scale areas are to be identified according to their suitability from the geological and tectonic points of view. NAGRA's division of waste into SMA and HAA is based on calculations of the long-term safety for a broad range of different rock types and geological situations and takes the different properties of all waste types into account. As a conclusion, a small portion of SMA has to be stored with {alpha}-toxic wastes in the HAA repository. The estimation of the total volume of wastes to be stored is based on 60 years of operation of the actual nuclear power plants, augmented with the wastes from possible replacement plants with a total power of 5 GW{sub e} during a further 60 years. The safety concept of the repository is based on passive systems using technical and natural barriers. The
Directory of Open Access Journals (Sweden)
Ferruccio Guidi
2016-01-01
Full Text Available Landau's "Grundlagen der Analysis" formalized in the language Aut-QE, represents an early milestone in computer-checked mathematics and is the only non-trivial development finalized in the languages of the Automath family. Here we discuss an implemented procedure producing a faithful representation of the Grundlagen in the Calculus of Constructions, verified by the proof assistant Coq 8.4.3. The point at issue is distinguishing lambda-abstractions from pi-abstractions where the original text uses Automath unified binders, taking care of the cases in which a binder corresponds to both abstractions at one time. It is a fact that some binders can be disambiguated only by verifying the Grundlagen in a calculus accepting Aut-QE and the Calculus of Constructions. To this end, we rely on lambda-delta version 3, a system that the author is proposing here for the first time.
Liu, Chunfeng; Li, Qi; Niu, Chengtuo; Zheng, Feiyun; Li, Yongxian; Zhao, Yun; Yin, Xiangsheng
2017-10-26
Lager-brewing yeasts are mainly used for the production of lager beers. Illumina and PacBio-based sequence analyses revealed an approximate genome size of 22.8 Mb, with a GC content of 38.98%, for the Chinese lager-brewing yeast Saccharomyces sp. strain M14. Based on ab initio prediction, 9,970 coding genes were annotated. Copyright © 2017 Liu et al.
Peris, David; Langdon, Quinn K; Moriarty, Ryan V; Sylvester, Kayla; Bontrager, Martin; Charron, Guillaume; Leducq, Jean-Baptiste; Landry, Christian R; Libkind, Diego; Hittinger, Chris Todd
2016-07-01
Lager-style beers constitute the vast majority of the beer market, and yet, the genetic origin of the yeast strains that brew them has been shrouded in mystery and controversy. Unlike ale-style beers, which are generally brewed with Saccharomyces cerevisiae, lagers are brewed at colder temperatures with allopolyploid hybrids of Saccharomyces eubayanus x S. cerevisiae. Since the discovery of S. eubayanus in 2011, additional strains have been isolated from South America, North America, Australasia, and Asia, but only interspecies hybrids have been isolated in Europe. Here, using genome sequence data, we examine the relationships of these wild S. eubayanus strains to each other and to domesticated lager strains. Our results support the existence of a relatively low-diversity (π = 0.00197) lineage of S. eubayanus whose distribution stretches across the Holarctic ecozone and includes wild isolates from Tibet, new wild isolates from North America, and the S. eubayanus parents of lager yeasts. This Holarctic lineage is closely related to a population with higher diversity (π = 0.00275) that has been found primarily in South America but includes some widely distributed isolates. A second diverse South American population (π = 0.00354) and two early-diverging Asian subspecies are more distantly related. We further show that no single wild strain from the Holarctic lineage is the sole closest relative of lager yeasts. Instead, different parts of the genome portray different phylogenetic signals and ancestry, likely due to outcrossing and incomplete lineage sorting. Indeed, standing genetic variation within this wild Holarctic lineage of S. eubayanus is responsible for genetic variation still segregating among modern lager-brewing hybrids. We conclude that the relationships among wild strains of S. eubayanus and their domesticated hybrids reflect complex biogeographical and genetic processes.
Hong, Huachang; Xiong, Yujing; Ruan, Mengyong; Liao, Fanglei; Lin, Hongjun; Liang, Yan
2013-02-01
The formations of THMs, HAAs, and HNMs from chlorination and chloramination of water from Jinlan Reservoir were investigated in this study. Results showed that monochloramine rather than chlorine generally resulted in lower concentration of DBPs, and the DBPs formation varied greatly as the treatment conditions changed. Specifically, the yields of THMs, HAAs and HNMs all increased with the high bromide level and high disinfectant dose both during chlorination and chloramination. The longer reaction time had a positive effect on the formation of THMs, HAAs and HNMs during chlorination and HNMs during chloramination. However, no time effect was observed on the formation of THMs and HAAs during chloramination. An increase in pH enhanced the levels of THMs and HNMs upon chlorination but reduced levels of HNMs upon chloramination. As for the THMs in chloramination and HAAs in chlorination and chloramination, no obvious pH effect was observed. The elevated temperature significantly increased the yields of THMs during chlorination and HNMs during chloramination, but has no effect on THMs and HAAs yields during chloramination. In the same temperature range, the formation of HAAs and HNMs in chlorination showed a first increasing and then a decreasing trend. In chloramination study, addition of nitrite markedly increased the formation of HNMs but had little impact on the formation of THMs and HAAs. While in chlorination study, the presence of high nitrite levels significantly reduced the yields of THMs, HAAs and HNMs. Range analysis revealed that the bromide and disinfectant levels were the major factors affecting THMs, HAAs and HNMs formation, in both chlorination and chloramination. Finally, comparisons of the speciation of mono-halogenated, di-halogenated, tri-halogenated HAAs and HNMs between chlorination and monochloramination were also conducted, and factors influencing the speciation pattern were identified. Copyright © 2012 Elsevier B.V. All rights reserved.
De Haas-Van Alphen affect and helicons in metals
International Nuclear Information System (INIS)
Vol'skij, E.P.
1975-01-01
Specific features of helicon electrodynamics associated with the de Haas-van Alphen effect are considered for an uncompensated metal with the closed Fermi surface of arbitrary shape. The consideration is carried out entirely in the local limit, when the metal may be characterized by a static tensor for the magnetic resistance and by a static tensor for the differential magnetic permeability which describes the anisotropy of the de Haas-van Alphen effect. The amplitude of the effect is assumed to be of an arbitrary value, but in the limits determined by the thermodynamical stability of a uniformly magnetized state. It has been shown that in the general case the de Haas-van Alphen effect may strongly influence not only the phase velocity, but also the damping and polarization of a helicon. A significant effect of nondiagonal components of the differential magnetic permeability tensor that sometimes arise even at very small deviations of the magnetic field from the symmetric direction, is noted. The resonance excitation of waves in a plate is considered. The question of a possible relation between periodic diamagnetic structures in metals and helicons is discussed
Thermodynamik grundlagen und technische anwendungen
Baehr, Hans Dieter
2009-01-01
Für die aktualisierte 14. Auflage des bewährten Lehrbuchs der Technischen Thermodynamik wurde das Kapitel über Wärmekraftanlagen gründlich bearbeitet und durch einen Abschnitt zur Energiewandlung ergänzt: Die Energiebedarfsstruktur von Deutschland wird erläutert, und die möglichen Energiewandlungspfade werden diskutiert. Schwerpunkt des Buches ist die ausführliche und auch dem Anfänger verständliche Darstellung der Grundlagen der Thermodynamik mit der sorgfältigen Einführung der thermodynamischen Begriffe und den fundamentalen Bilanzgleichungen für Energie, Entropie und Exergie. Die thermodynamischen Eigenschaften reiner Fluide und fluider Gemische werden eingehend erläutert. Darauf aufbauend wird die Thermodynamik der Gemische und der chemischen Reaktionen entwickelt. Auch die thermodynamischen Aspekte wichtiger energie- und verfahrenstechnischer Anwendungen werden praxisnah behandelt: - Strömungs- und Arbeitsprozesse, - thermische Stofftrennverfahren, - Verbrennungsprozesse und Verbrennungsk...
Zhang, Hong; Andrews, Susan A
2012-05-15
This study investigated the effect of copper corrosion products, including Cu(II), Cu(2)O, CuO and Cu(2)(OH)(2)CO(3), on chlorine degradation, HAA formation, and HAA speciation under controlled experimental conditions. Chlorine decay and HAA formation were significantly enhanced in the presence of copper with the extent of copper catalysis being affected by the solution pH and the concentration of copper corrosion products. Accelerated chlorine decay and increased HAA formation were observed at pH 8.6 in the presence of 1.0 mg/L Cu(II) compared with that observed at pH 6.6 and pH 7.6. Further investigation of chlorine decay in the presence of both Suwannee River NOM and Cu(II) indicated that an increased reactivity of NOM with dissolved and/or solid surface-associated Cu(II), rather than chlorine auto-decomposition, was a primary reason for the observed rapid chlorine decay. Copper corrosion solids [Cu(2)O, CuO, Cu(2)(OH)(2)CO(3)] exhibited catalytic effects on both chlorine decay and HAA formation. Contrary to the results observed when in the absence of copper corrosion products, DCAA formation was consistently predominant over other HAA species in the presence of copper corrosion products, especially at neutral and high pH. This study improves the understanding for water utilities and households regarding chlorine residuals and HAA concentrations in distribution systems, in particular once the water reaches domestic plumbing where copper is widely used. Copyright © 2012 Elsevier Ltd. All rights reserved.
Comparison of the effect of Haas and Hyrax rapid palatal expanders on nasal cavity dimensions
Directory of Open Access Journals (Sweden)
Amini F.
2009-11-01
Full Text Available "nBackground and Aim: In treatment of posterior crossbite awareness of the effects of Haas and Hyrax rapid maxillary expanders (RME on nasal cavity will help the clinician to select the better appliance. This study was carried out to compare the effects of Haas and Hyrax expanders on the nasal cavity of patients treated for posterior crossbite. "nMaterials and Methods: A clinical trial study was designed on posteroanterior (PA cephalograms of 30 subjects to evaluate the nasal cavity width of 14 subjects (8 female & 6 male with mean chronological age of 12± 2years who received RME with Hyrax type and 16 subjects (9 female & 7 male with mean chronological age of 11±1.6 years who received Haas type palatal expander. Paired t-test was used to analyze the outcomes of expansion in each group. Student t-test was used to compare Haas and Hyrax groups. "nResults: The mean value of screw expansion was 9±2 mm in both groups. In Hyrax group nasal cavity width"n(Nc-cN increased from 29.2 ±1.94 mm to 31.7 ±1.93mm (p= 0.001 and In Haas group it was increased from 27.75± 2.21 mm to 29.35 ± 2.26 mm(p= 0.043. When two groups were compared to each other, statistically this increase was more significant in Hyrax than in the Haas group (p=0.038. "nConclusion: In this study RME affected geometry of the nasal cavity by increasing the nasal cavity width. However In our sample, Hyrax appliance demonstrated better performance over the Haas appliance in all variables.
New Lager Brewery Strains Obtained by Crossing Techniques Using Cachaça (Brazilian Spirit) Yeasts
Figueiredo, Bruna Inez Carvalho; Saraiva, Margarete Alice Fontes; de Souza Pimenta, Paloma Patrick; de Souza Testasicca, Miriam Conceição; Sampaio, Geraldo Magela Santos; da Cunha, Aureliano Claret; Afonso, Luis Carlos Crocco; Vieira de Queiroz, Marisa; de Miranda Castro, Ieso
2017-01-01
ABSTRACT The development of hybrids has been an effective approach to generate novel yeast strains with optimal technological profile for use in beer production. This study describes the generation of a new yeast strain for lager beer production by direct mating between two Saccharomyces cerevisiae strains isolated from cachaça distilleries: one that was strongly flocculent, and the other with higher production of acetate esters. The first step in this procedure was to analyze the sporulation ability and reproductive cycle of strains belonging to a specific collection of yeasts isolated from cachaça fermentation vats. Most strains showed high rates of sporulation, spore viability, and homothallic behavior. In order to obtain new yeast strains with desirable properties useful for lager beer production, we compare haploid-to-haploid and diploid-to-diploid mating procedures. Moreover, an assessment of parental phenotype traits showed that the segregant diploid C2-1d generated from a diploid-to-diploid mating experiment showed good fermentation performance at low temperature, high flocculation capacity, and desirable production of acetate esters that was significantly better than that of one type lager strain. Therefore, strain C2-1d might be an important candidate for the production of lager beer, with distinct fruit traces and originating using a non-genetically modified organism (GMO) approach. IMPORTANCE Recent work has suggested the utilization of hybridization techniques for the generation of novel non-genetically modified brewing yeast strains with combined properties not commonly found in a unique yeast strain. We have observed remarkable traits, especially low temperature tolerance, maltotriose utilization, flocculation ability, and production of volatile aroma compounds, among a collection of Saccharomyces cerevisiae strains isolated from cachaça distilleries, which allow their utilization in the production of beer. The significance of our research is in
Stability profile of flavour-active ester compounds in ale and lager ...
African Journals Online (AJOL)
User
2013-01-30
Jan 30, 2013 ... Currently, one of the main quality problems of beer is the change of its chemical composition during storage, which alters its sensory properties. In this study, ale and lager beers were produced and aged for three months at two storage temperatures. Concentration of volatile ester compounds (VECs) in the.
Energy Technology Data Exchange (ETDEWEB)
Czichos, Horst
2008-07-01
The book directs to college students and engineers in practice. Presentation of practical applications like e.g. CD-players, industry robots, automobile sensorics. THe actual edition was completed by medicinal engineering. The main topics are: fundamentals on data processing; technical communication; test engineering; quality management; materials engineering; mechanical systems; production of mechanical systems; fundamentals on electrical engineering; electric machines and devices; control systems; remote systems in automation engineering; mechatronic systems and their installation, commissioning and maintenance. (GL) [German] Dieses Fachbuch beschreibt mit aussagekraeftigen Abbildungen kurz und praegnant die Grundlagen und Anwendungen der Mechatronik: von der Makro- und Mikrotechnik bis hin zur Nanotechnik. Erstmalig wird durchgaengig eine ganzheitlich-systemtechnische Behandlung mechatronischer Systeme vorgenommen. Ein Schwerpunkt liegt in der Darstellung von Praxisanwendungen wie z. B. CD-Player, Industrieroboter, Automobilsensorik. Die aktuelle Auflage wurde um die Entwicklungsmethodik fuer mechatronische Systeme und ein neues Kapitel Medizintechnik ergaenzt. Ausserdem wurden die Grundlagen vertieft (z. B. Magneto- und Optoelektronik in der Mechatronik) sowie die Anzahl der Anwendungsbeispiele erweitert. Aus dem Inhalt Teil A Grundlagen: Uebersicht - Einfuehrung in die systemtechnische Methodik - Modellbildung mechatronischer Systeme - Regelung und Steuerung - Sensorik - Aktorik Teil B Anwendungen: Maschinenbau - Positionierungstechnik und Robotik - Produktionstechnik - Feinwerktechnik - Audio-Video-Technik - Computertechnik - Fahrzeugtechnik - Medizintechnik - Bauliche Anlagen. (orig.)
Effects of operating conditions on THMs and HAAs formation during wastewater chlorination
Energy Technology Data Exchange (ETDEWEB)
Sun Yingxue; Wu Qianyuan [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Hu Hongying, E-mail: hyhu@tsinghua.edu.cn [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Tian Jie [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China)
2009-09-15
Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.
Effects of operating conditions on THMs and HAAs formation during wastewater chlorination
International Nuclear Information System (INIS)
Sun Yingxue; Wu Qianyuan; Hu Hongying; Tian Jie
2009-01-01
Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.
Kodama, Yukiko; Omura, Fumihiko; Ashikari, Toshihiko
2001-01-01
We found two types of branched-chain amino acid permease gene (BAP2) in the lager brewing yeast Saccharomyces pastorianus BH-225 and cloned one type of BAP2 gene (Lg-BAP2), which is identical to that of Saccharomyces bayanus (by-BAP2-1). The other BAP2 gene of the lager brewing yeast (cer-BAP2) is very similar to the Saccharomyces cerevisiae BAP2 gene. This result substantiates the notion that lager brewing yeast is a hybrid of S. cerevisiae and S. bayanus. The amino acid sequence homology between S. cerevisiae Bap2p and Lg-Bap2p was 88%. The transcription of Lg-BAP2 was not induced by the addition of leucine to the growth medium, while that of cer-BAP2 was induced. The transcription of Lg-BAP2 was repressed by the presence of ethanol and weak organic acid, while that of cer-BAP2 was not affected by these compounds. Furthermore, Northern analysis during beer fermentation revealed that the transcription of Lg-BAP2 was repressed at the beginning of the fermentation, while cer-BAP2 was highly expressed throughout the fermentation. These results suggest that the transcription of Lg-BAP2 is regulated differently from that of cer-BAP2 in lager brewing yeasts. PMID:11472919
Quantitative assessment of S. mutans and C. albicans in patients with Haas and Hyrax expanders
Directory of Open Access Journals (Sweden)
Matheus Melo Pithon
2012-06-01
Full Text Available OBJECTIVE: To assess and compare the number of Streptococcus mutans and Candida albicans colonies in patients with Haas and Hyrax appliances before and after insertion. METHODS: The sample consisted of 84 patients requiring orthodontic treatment. For all patients a midpalatal suture expansion was indicated. Patients were randomly divided into Group HA, who used the Haas appliance (n = 42 and Group HY, who used the Hyrax appliance (n = 42. Initially and thirty days after appliance insertion all patients were submitted to saliva collections. The saliva was diluted followed by seeding in Mitis Salivarius and CHROMagar media, for growth of S. mutans and C. albicans respectively. RESULTS: Results showed statistically significant difference between groups HA and HY for Streptococcus mutans and Candida albicans (p <0.05. Haas appliance promoted greater S. mutans and C. albicans proliferation when compared to Hyrax appliance. CONCLUSION: The Haas appliance favored greater proliferation of S. mutans and C. albicans when compared with the Hyrax appliance. Insertion of the appliances resulted in greater buildup of microorganisms.
Die Grundlagen der Fernsehtechnik: Systemtheorie und Technik der Bildübertragung
Mahler, Gerhard
Umfassende Einführung in die Grundlagen der Bewegtbild-Übertragung von den Anfängen bis zum heutigen Stand des digitalen Fernsehens mit einer aus der Praxis entstandenen systemtheoretischen Analyse. Die kompakte und anschaulich bebilderte Darstellung mit elementaren mathematischen Beschreibungen macht es dem Leser leicht, sich in die Bildübertragungstechnik einzuarbeiten. Thematische Einheiten erweitern den Wissensstoff - u.a. zu den Themen visuelle Wahrnehmung, mehrdimensionale Signaldarstellung, Farbmetrik, Digitalisierung, Elektronenoptik - und zeigen deren Anwendung auf die elektronische Bildübertragung.
Collins, Morgan E; Black, Joshua J; Liu, Zhengchang
2017-07-01
Haa1 is a transcription factor that adapts Saccharomyces cerevisiae cells to weak organic acid stresses by activating the expression of various genes. Many of these genes encode membrane proteins, such as TPO2 and YRO2 How Haa1 is activated by weak acids is not clear. Here, we show that casein kinase I isoform Hrr25 is an important negative regulator of Haa1. Haa1 is known to be multiply phosphorylated. We found that mutations in HRR25 lead to reduced Haa1 phosphorylation and increased expression of Haa1 target genes and that Hrr25 interacts with Haa1. The other three casein kinase I isoforms, Yck1, Yck2, and Yck3, do not seem to play critical roles in Haa1 regulation. Hrr25 has a 200-residue C-terminal region, including a proline- and glutamine-rich domain. Our data suggest that the C-terminal region of Hrr25 is required for normal inhibition of expression of Haa1 target genes TPO2 and YRO2 and is important for cell growth but is not required for cell morphogenesis. We propose that Hrr25 is an important regulator of cellular adaptation to weak acid stress by inhibiting Haa1 through phosphorylation. IMPORTANCE Our study has revealed the casein kinase I protein Hrr25 to be a negative regulator of Haa1, a transcription factor mediating the cellular response to stresses caused by weak acids. Many studies have focused on the target genes of Haa1 and their roles in weak acid stress responses, but little has been reported on the regulatory mechanism of Haa1. Weak acids, such as acetic acid, have long been used for food preservation by slowing down the growth of fungal species, including S. cerevisiae In the biofuel industry, acetic acid in the lignocellulosic hydrolysates limits the production of ethanol, which is undesirable. By understanding how Haa1 is regulated, we can make advances in the field of food sciences to better preserve food and engineer acetic acid-resistant strains that will increase productivity in the biofuel industry. Copyright © 2017 American
Galvano-magnetic properties and Shubnikov de Haas effect of Te-whiskers
International Nuclear Information System (INIS)
Berezovets, Veacheslav; Bondarchuk, Nikolai; Nikolaeva, Albina; Nijankovskii, Victor
2009-01-01
The work is devoted to investigation of the peculiarities of magnetoresistance, Hall effect and Shubnikov de Haas oscillations in Te-whiskers. Te-whiskers was prepared from vapor-gas phase on the substrate pure tellurium and grown naturally, of the walls of a crucible in the course of growing Te single crystals by the Czochralski method . The measurements of the galvanomagnetic properties and Shubnikov de Haas oscillation correspond to the notion of the occurrence of the effect of intraband magnetic breakdown when two different quasi-classical cyclotron trajectories coexist simultaneously in a magnetic field. This effect is a consequence of the presence of the saddle point in the dispersion law of the tellurium valence band. (authors)
Filtration of lager beer with microsieves: Flux, permeate haze and in-line microscope observations
Kuiper, S.; van Rijn, C.J.M.; Nijdam, W.; Raspe, Onno; van Wolferen, Hendricus A.G.M.; Krijnen, Gijsbertus J.M.; Elwenspoek, Michael Curt
2002-01-01
Membrane fouling during filtration of lager beer with microsieves was studied through in-line microscope observations. It was observed that the main fouling was caused by micrometre-sized particles, presumably aggregated proteins. These particles formed flocks covering parts of the membrane surface.
Monerawela, Chandre; James, Tharappel C; Wolfe, Kenneth H; Bond, Ursula
2015-03-01
Lager yeasts, Saccharomyces pastorianus, are interspecies hybrids between S. cerevisiae and S. eubayanus and are classified into Group I and Group II clades. The genome of the Group II strain, Weihenstephan 34/70, contains eight so-called 'lager-specific' genes that are located in subtelomeric regions. We evaluated the origins of these genes through bioinformatic and PCR analyses of Saccharomyces genomes. We determined that four are of cerevisiae origin while four originate from S. eubayanus. The Group I yeasts contain all four S. eubayanus genes but individual strains contain only a subset of the cerevisiae genes. We identified S. cerevisiae strains that contain all four cerevisiae 'lager-specific' genes, and distinct patterns of loss of these genes in other strains. Analysis of the subtelomeric regions uncovered patterns of loss in different S. cerevisiae strains. We identify two classes of S. cerevisiae strains: ale yeasts (Foster O) and stout yeasts with patterns of 'lager-specific' genes and subtelomeric regions identical to Group I and II S. pastorianus yeasts, respectively. These findings lead us to propose that Group I and II S. pastorianus strains originate from separate hybridization events involving different S. cerevisiae lineages. Using the combined bioinformatic and PCR data, we describe a potential classification map for industrial yeasts. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.
2010-04-29
... North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services, Inc., Corrigan Company and Murphy Company, Fenton, MO... workers from HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services...
Brickwedde, A.; van den Broek, M.A.; Geertman, Jan Maarten A.; Magalhães, Frederico; Kuijpers, Niels G.A.; Gibson, Brian; Pronk, J.T.; Daran, J.G.
2017-01-01
The lager brewing yeast Saccharomyces pastorianus, an interspecies hybrid of S. eubayanus and S. cerevisiae, ferments maltotriose, maltose, sucrose, glucose and fructose in wort to ethanol and carbon dioxide. Complete and timely conversion ("attenuation") of maltotriose by industrial S.
Sakihama, Yuri; Hasunuma, Tomohisa; Kondo, Akihiko
2015-03-01
The hydrolysis of lignocellulosic biomass liberates sugars, primarily glucose and xylose, which are subsequently converted to ethanol by microbial fermentation. The rapid and efficient fermentation of xylose by recombinant Saccharomyces cerevisiae strains is limited by weak acids generated during biomass pretreatment processes. In particular, acetic acid negatively affects cell growth, xylose fermentation rate, and ethanol production. The ability of S. cerevisiae to efficiently utilize xylose in the presence of acetic acid is an essential requirement for the cost-effective production of ethanol from lignocellulosic hydrolysates. Here, an acetic acid-responsive transcriptional activator, HAA1, was overexpressed in a recombinant xylose-fermenting S. cerevisiae strain to yield BY4741X/HAA1. This strain exhibited improved cell growth and ethanol production from xylose under aerobic and oxygen limited conditions, respectively, in the presence of acetic acid. The HAA1p regulon enhanced transcript levels in BY4741X/HAA1. The disruption of PHO13, a p-nitrophenylphosphatase gene, in BY4741X/HAA1 led to further improvement in both yeast growth and the ability to ferment xylose, indicating that HAA1 overexpression and PHO13 deletion act by different mechanisms to enhance ethanol production. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Kajala, Ilkka; Bergsveinson, Jordyn; Friesen, Vanessa; Redekop, Anna; Juvonen, Riikka; Storgårds, Erna; Ziola, Barry
2018-01-01
In 2010, bottles of beer containing viable bacteria of the common beer-spoilage species Lactobacillus backii and Pediococcus damnosus were recovered from a shipwreck near the Åland Islands, Finland. The 170-year quiescent state maintained by the shipwreck bacteria presented a unique opportunity to study lactic acid bacteria (LAB) evolution vis-a-vis growth and survival in the beer environment. Three shipwreck bacteria (one L. backii strain and two P. damnosus strains) and modern-day beer-spoilage isolates of the same two species were genome sequenced, characterized for hop iso-α-acid tolerance, and growth in degassed lager and wheat beer. In addition, plasmid variants of the modern-day P. damnosus strain were analyzed for the effect of plasmid-encoded genes on growth in lager beer. Coding content on two plasmids was identified as essential for LAB growth in modern lager beer. Three chromosomal regions containing genes related to sugar transport and cell wall polysaccharides were shared by pediococci able to grow in beer. Our results show that the three shipwreck bacteria lack the necessary plasmid-located genetic content to grow in modern lager beer, but carry additional genes related to acid tolerance and biofilm formation compared to their modern counterparts. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Weigel-Ossiander, Fiona Sarah
2016-01-01
Mit EKG Basics wurde ein detailliertes multimediales Lernprogramm über die Grundlagen der Elektrokardiographie bei Hund und Katze erstellt unter besonderer Berücksichtigung von didaktischen und ergonomischen Gesichtspunkten. Da vielen Veterinärmedizinerinnen/Veterinärmedizinern das Erlernen, Verstehen und Interpretieren der Elektrokardiographie schwer fällt, war das Ziel der vorliegenden Arbeit, sowohl Studierenden der Tiermedizin als auch interessierten Tierärztinnen/Tierärzten die Thema...
van den Broek, M; Bolat, I; Nijkamp, J F; Ramos, E; Luttik, M A H; Koopman, F; Geertman, J M; de Ridder, D; Pronk, J T; Daran, J-M
2015-09-01
Lager brewing strains of Saccharomyces pastorianus are natural interspecific hybrids originating from the spontaneous hybridization of Saccharomyces cerevisiae and Saccharomyces eubayanus. Over the past 500 years, S. pastorianus has been domesticated to become one of the most important industrial microorganisms. Production of lager-type beers requires a set of essential phenotypes, including the ability to ferment maltose and maltotriose at low temperature, the production of flavors and aromas, and the ability to flocculate. Understanding of the molecular basis of complex brewing-related phenotypic traits is a prerequisite for rational strain improvement. While genome sequences have been reported, the variability and dynamics of S. pastorianus genomes have not been investigated in detail. Here, using deep sequencing and chromosome copy number analysis, we showed that S. pastorianus strain CBS1483 exhibited extensive aneuploidy. This was confirmed by quantitative PCR and by flow cytometry. As a direct consequence of this aneuploidy, a massive number of sequence variants was identified, leading to at least 1,800 additional protein variants in S. pastorianus CBS1483. Analysis of eight additional S. pastorianus strains revealed that the previously defined group I strains showed comparable karyotypes, while group II strains showed large interstrain karyotypic variability. Comparison of three strains with nearly identical genome sequences revealed substantial chromosome copy number variation, which may contribute to strain-specific phenotypic traits. The observed variability of lager yeast genomes demonstrates that systematic linking of genotype to phenotype requires a three-dimensional genome analysis encompassing physical chromosomal structures, the copy number of individual chromosomes or chromosomal regions, and the allelic variation of copies of individual genes. Copyright © 2015, van den Broek et al.
Microbe domestication and the identification of the wild genetic stock of lager-brewing yeast
Libkind, Diego; Hittinger, Chris Todd; Valério, Elisabete; Gonçalves, Carla; Dover, Jim; Johnston, Mark; Gonçalves, Paula; Sampaio, José Paulo
2011-01-01
Domestication of plants and animals promoted humanity's transition from nomadic to sedentary lifestyles, demographic expansion, and the emergence of civilizations. In contrast to the well-documented successes of crop and livestock breeding, processes of microbe domestication remain obscure, despite the importance of microbes to the production of food, beverages, and biofuels. Lager-beer, first brewed in the 15th century, employs an allotetraploid hybrid yeast, Saccharomyces pastorianus (syn. Saccharomyces carlsbergensis), a domesticated species created by the fusion of a Saccharomyces cerevisiae ale-yeast with an unknown cryotolerant Saccharomyces species. We report the isolation of that species and designate it Saccharomyces eubayanus sp. nov. because of its resemblance to Saccharomyces bayanus (a complex hybrid of S. eubayanus, Saccharomyces uvarum, and S. cerevisiae found only in the brewing environment). Individuals from populations of S. eubayanus and its sister species, S. uvarum, exist in apparent sympatry in Nothofagus (Southern beech) forests in Patagonia, but are isolated genetically through intrinsic postzygotic barriers, and ecologically through host-preference. The draft genome sequence of S. eubayanus is 99.5% identical to the non-S. cerevisiae portion of the S. pastorianus genome sequence and suggests specific changes in sugar and sulfite metabolism that were crucial for domestication in the lager-brewing environment. This study shows that combining microbial ecology with comparative genomics facilitates the discovery and preservation of wild genetic stocks of domesticated microbes to trace their history, identify genetic changes, and suggest paths to further industrial improvement. PMID:21873232
The measurement of the amplitude of de Haas-van Alphen oscillations in indium
International Nuclear Information System (INIS)
Wilde, J. de; Meredith, D.J.
1976-01-01
A flux-gate magnetometer incorporating a superconducting flux transformer is described and its application to the measurement of de Haas-van Alphen oscillation amplitude is compared with conventional techniques. Measurements on the third zone Fermi surface of indium in magnetic fields of up to 4 T are given to show the advantages of the method. (author)
Study on the TOC concentration in raw water and HAAs in Tehran's water treatment plant outlet.
Ghoochani, Mahboobeh; Rastkari, Noushin; Nabizadeh Nodehi, Ramin; Mahvi, Amir Hossein; Nasseri, Simin; Nazmara, Shahrokh
2013-11-12
A sampling has been undertaken to investigate the variation of haloacetic acids formation and nature organic matter through 81 samples were collected from three water treatment plant and three major rivers of Tehran Iran. Changes in the total organic matter (TOC), ultraviolet absorbance (UV254), specific ultraviolet absorbance (SUVA) were measured in raw water samples. Haloacetic acids concentrations were monitored using a new static headspace GC-ECD method without a manual pre-concentration in three water treatment plants. The average concentration of TOC and HAAs in three rivers and three water treatment plants in spring, summer and fall, were 4, 2.41 and 4.03 mg/L and 48.75, 43.79 and 51.07 μg/L respectively. Seasonal variation indicated that HAAs levels were much higher in spring and fall.
Cunha, Joana T; Costa, Carlos E; Ferraz, Luís; Romaní, Aloia; Johansson, Björn; Sá-Correia, Isabel; Domingues, Lucília
2018-04-02
Acetic acid tolerance and xylose consumption are desirable traits for yeast strains used in industrial biotechnological processes. In this work, overexpression of a weak acid stress transcriptional activator encoded by the gene HAA1 and a phosphoribosyl pyrophosphate synthetase encoded by PRS3 in a recombinant industrial Saccharomyces cerevisiae strain containing a xylose metabolic pathway was evaluated in the presence of acetic acid in xylose- or glucose-containing media. HAA1 or PRS3 overexpression resulted in superior yeast growth and higher sugar consumption capacities in the presence of 4 g/L acetic acid, and a positive synergistic effect resulted from the simultaneous overexpression of both genes. Overexpressing these genes also improved yeast adaptation to a non-detoxified hardwood hydrolysate with a high acetic acid content. Furthermore, the overexpression of HAA1 and/or PRS3 was found to increase the robustness of yeast cell wall when challenged with acetic acid stress, suggesting the involvement of the modulation of the cell wall integrity pathway. This study clearly shows HAA1 and/or, for the first time, PRS3 overexpression to play an important role in the improvement of industrial yeast tolerance towards acetic acid. The results expand the molecular toolbox and add to the current understanding of the mechanisms involved in higher acetic acid tolerance, paving the way for the further development of more efficient industrial processes.
Electrons in a Magnetic Field: Special Spin in de Haas-van Alphen effect
International Nuclear Information System (INIS)
Shrivastava, Keshav N
2012-01-01
When the magnetic field is applied in a metal, the electrons behave like a harmonic oscillator. When the field is increased these harmonic oscillator type levels cross the Fermi energy at a particular point resulting into the discontinuities in the population of any particular level at that point. For a large orbital magnetic moment, different from L = 0 and both signs of spin in the total magnetic momentum quantum number, j = l ± s, the discontinuities in the population of the electrons in a particular level become double valued resulting into doubling of oscillations in the magnetization. There is a double valued change in the energy of the electrons when they transfer from the harmonic oscillator type level to the Fermi level. The magnetization depends on the value of j = l ± s so that there is a double valued period in the oscillations. The de Haas-van Alphen effect is usually described for the L = 0 electrons. Hence, we see that the de Haas-van Alphen effect is considerably modified in going from L = 0 to j = l ± s, with both signs in the spin.
Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris
International Nuclear Information System (INIS)
Ge, Fei; Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin
2011-01-01
The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L -1 iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L -1 manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH) 3(am) or MnO 2(am) coat the algal cells , which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).
BOND, URSULA
2009-01-01
PUBLISHED Yeasts used in the production of lagers contain complex allopolyploid genomes, resulting from the fusion of two different yeast species closely related to Saccharomyces cerevisiae and Saccharomyces bayanus. Recombination between the homoeologous chromosomes has generated a number of hybrid chromosomes. These recombination events provide potential for adaptive evolution through the loss or gain of gene function. We have examined the genotypic and phenotypic effects of one of the c...
Façanha, Anna Júlia de Oliveira; Lara, Tulio Silva; Garib, Daniela Gamba; da Silva Filho, Omar Gabriel
2014-01-01
Objective The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months); and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months). Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho AnalyzerTM 3D software. Results The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders. PMID:24945513
Directory of Open Access Journals (Sweden)
Anna Júlia de Oliveira Façanha
2014-04-01
Full Text Available Objective: The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods: The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months; and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months. Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho Analyzer(tm 3D software. Results: The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion: Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders.
2017-01-01
Untersuchung des Funktionsumfangs und der fachlichen Grundlagen des LAMBDA -Tools (Examination of the functional scope and the technical basics of the... LAMBDA -Tools) 6. AUTHOR(S) Jan-Malte Lef3mann 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT .NUMBER UNIBW 9...planning, health care and environmental protection. Machine assi sted translation. 14. SUBJECT TERMS UNIBW, German, LAMBDA -Tools, functional scope 17
Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris
Energy Technology Data Exchange (ETDEWEB)
Ge, Fei, E-mail: gefei@xtu.edu.cn [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China); Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China)
2011-05-15
The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L{sup -1} iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L{sup -1} manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH){sub 3(am)} or MnO{sub 2(am)} coat the algal cells{sub ,} which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).
International Nuclear Information System (INIS)
Morales Monzon, J.A.
1994-01-01
The methodology of half value lager measurement based on ratio of unit output measured before and after an additional 4 mm thick aluminium filter has been installed is studied. The use of a condenser type dosemeter model FJ301G3 produced by Beijing Nuclear Instrument Factory for that purpose is studied too. The study is base on measurement of attenuation curves using high purity aluminium filter done with a dosemeter FJ301G3 and a standard ionization chamber model NE 2530/1 from Nuclear Enterprise respectively. The X ray quality generated had similar characteristic 50 high kerma dose rate series normalized by ISO. Expressions that allow estimate half value lager in aluminium with a maximum deviation of 0,25 mm is reported. The easy handling and low cost of dispositives employed are the main advantages of that methodology. According to voltage range in which study was done, the results have application in quality control of dental X ray units
Curtin, D.M.
2011-01-01
The Bavarian Lager Company challenged the Commission's refusal to grant it full access tot the minutes of a meeting in Brussels with national and European civil servants as well as representatives of the European Beer Brewing Federation, including the names of all those who attended. The Court of
Grabner, Jörg; Nothhaft, Richard
Die Faszination, die vom Auto ausgeht, ist und bleibt ungebrochen. Entsprechend interessant ist es, sich vor dem Hintergrund konventioneller Konstruktionstechniken über die virtuelle Produktentwicklung von Pkw-Karosserien an modernen CAD-Arbeitsplätzen informieren zu können. Die Autoren führen in die Grundlagen ein und zeigen anhand von Beispielen und zahlreichen Abbildungen, wie mit dem System CATIA der Rohbau sowie die Ausstattung innen und au=C3=9Fen konstruiert werden. Darüber hinaus wird das so genannte "Package" an Beispielen beschrieben, also das Management und die Harmonisierung der Anforderungen an die Bauräume (z.
Vidgren, Virve; Huuskonen, Anne; Virtanen, Hannele; Ruohonen, Laura; Londesborough, John
2009-04-01
The use of more concentrated, so-called high-gravity and very-high-gravity (VHG) brewer's worts for the manufacture of beer has economic and environmental advantages. However, many current strains of brewer's yeasts ferment VHG worts slowly and incompletely, leaving undesirably large amounts of maltose and especially maltotriose in the final beers. alpha-Glucosides are transported into Saccharomyces yeasts by several transporters, including Agt1, which is a good carrier of both maltose and maltotriose. The AGT1 genes of brewer's ale yeast strains encode functional transporters, but the AGT1 genes of the lager strains studied contain a premature stop codon and do not encode functional transporters. In the present work, one or more copies of the AGT1 gene of a lager strain were repaired with DNA sequence from an ale strain and put under the control of a constitutive promoter. Compared to the untransformed strain, the transformants with repaired AGT1 had higher maltose transport activity, especially after growth on glucose (which represses endogenous alpha-glucoside transporter genes) and higher ratios of maltotriose transport activity to maltose transport activity. They fermented VHG (24 degrees Plato) wort faster and more completely, producing beers containing more ethanol and less residual maltose and maltotriose. The growth and sedimentation behaviors of the transformants were similar to those of the untransformed strain, as were the profiles of yeast-derived volatile aroma compounds in the beers.
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Markéta; Zapletal, Miloš
2016-01-01
Roč. 53, č. 1 (2016), s. 101-102 ISSN 0018-7003. [Pavel Haas Study Day. Cardiff, 30.01.2016] R&D Projects: GA ČR(CZ) GP14-35842P Institutional support: RVO:68378076 Keywords : Pavel Haas * conference * music * inter-war * avantgarde Subject RIV: AL - Art, Architecture, Cultural Heritage
Kas tasemetööd täidavad oma eesmärki? / Marge Lepik, Kristi Mere, Merike Haas...[jt.
2009-01-01
Küsimusele vastavad Lääne-Viru maavalitsuse haridusosakonna juhataja Marge Lepik, Haridus- ja Teadusministeeriumi välishindamisosakonna peaekspert Kristi Mere, Viira kooli klassiõpetaja Merike Haas, Rääma põhikooli direktor Elmo Joa ja Tallinna Ülikooli Haapsalu kolledži õppejõud Sirje Piht
DEFF Research Database (Denmark)
Jespersen, Lene; Kühle, Alis Van der Aa; Petersen, Kamilla M.
2000-01-01
-amplified intergenic transcribed spacer (ITS) regions. Chromosome length polymorphism (CLP) was evident among the Saccharomyces brewing contaminants with chromosome profiles typical of Saccharomyces sensu stricto. Based upon cluster analysis of their chromosome profiles the majority of the brewing contaminants could...... be grouped as either S. cerevisiae or S. pastorianus/S. bayanus. Further, the technique was able to differentiate between almost all brewing contaminants and to separate them from any specific lager brewing yeast. The diversity of the Saccharomyces brewing contaminants clearly demonstrated by their CLP...... in the SaccharomYces brewing contaminants indicate their adaptation to a maltose-enriched environment....
De Haas-van Alphen effect of a two-dimensional ultracold atomic gas
Farias, B.; Furtado, C.
2016-01-01
In this paper, we show how the ultracold atom analogue of the two-dimensional de Haas-van Alphen effect in electronic condensed matter systems can be induced by optical fields in a neutral atomic system. The interaction between the suitable spatially varying laser fields and tripod-type trapped atoms generates a synthetic magnetic field which leads the particles to organize themselves in Landau levels. Initially, with the atomic gas in a regime of lowest Landau level, we display the oscillatory behaviour of the atomic energy and its derivative with respect to the effective magnetic field (B) as a function of 1/B. Furthermore, we estimate the area of the Fermi circle of the two-dimensional atomic gas.
Vidgren, Virve; Londesborough, John
2018-05-31
Plain and fluorescently tagged versions of Agt1, Mtt1 and Malx1 maltose transporters were over-expressed in two laboratory yeasts and one lager yeast. The plain and tagged versions of each transporter supported similar transport activities, indicating that they are similarly trafficked and have similar catalytic activities. When they were expressed under the control of the strong constitutive PGK1 promoter only minor proportions of the fluorescent transporters were associated with the plasma membrane, the rest being found in intracellular structures. Transport activity of each tagged transporter in each host was roughly proportional to the plasma membrane-associated fluorescence. All three transporters were subject to glucose-triggered inactivation when the medium glucose concentration was abruptly raised. Results also suggest competition between endogenous and over-expressed transporters for access to the plasma membrane. This article is protected by copyright. All rights reserved.
Directory of Open Access Journals (Sweden)
Denny Nurkertamanda
2012-02-01
Full Text Available Chitose Indonesia Manufacturing merupakan perusahaan yang memproduksi dan menjual furniture dari logam dengan kerjasama negara Jepang. Berdasarkan data penjualan Chitose Indonesia Manufacturing pada tahun 2003, kursi lipat Chitose Yamato merupakan jenis kursi lipat yang memiliki angka penjualan sebesar 59% dari keseluruhan jenis produk yang diproduksi. Kursi lipat Chitose Yamato HAA merupakan salah satu sarana untuk duduk yang dilengkapi dengan sandaran sesuai dengan bentuk punggung manusia dan dapat dilipat untuk memudahkan penyimpanannya. Selain itu juga rangka kakinya yang berbentuk H sehingga dapat digunakan pada permukaan yang datar atau bergelombang. Material yang digunakan pada rangka kursi lipat Chitose Yamato HAA adalah berupa elemen struktur rangka yang bersifat isotropik, yakni memiliki keseragaman sifat dan bahan suatu elemen (regangan, tegangan, mekanis, dsb. Pada analisa moda kegagalan dilakukan identifikasi moda kegagalan yang potensial, keparahan yang ditimbulkan, dan frekuensi kejadian moda kegagalan. Dengan menggunakan analisa moda kegagalan, maka diharapkan kualitas produk akan meningkat dan dapat digunakan sesuai dengan fungsinya. RPN adalah indikator kekritisan untuk menentukan tindakan koreksi yang sesuai dengan moda kegagalan. RPN digunakan oleh banyak prosedur FMEA untuk menaksir resiko menggunakan tiga kriteria yaitu Keparahan efek (Severity S, Kejadian penyebab (Occurrence O, Deteksi penyebab (Detection D. Angka prioritas RPN merupakan hasil kali rating keparahan, kejadian, dan deteksi. Angka ini hanyalah menunjukkan rangking atau urutan defisiensi desain sistem. Kata kunci : Moda Kegagalan, Efek Kegagalan, Penyebab Kegagalan, Deteksi, Kejadian, Keparahan, RPN (Risk Priority Number. Chitose Manufacturing Indonesia is a company that produce and sells furniture made from alloy in cooperation with Japan. Based on Sales data by Chitose Indonesia Manufacturing in 2003, Chitose Yamato foldable chair has a sales number
Energy Technology Data Exchange (ETDEWEB)
Popp, M.
1998-04-01
PROFIBUS-DP is one of the most common field buses for industrial communication. The author provides competent help in using this technology. He describes 32 of the most common errors found in certification tests and shows how they can be remedies. Fundamentals and enhancements of PROFIBUS-DP are presented. PROFIBUS-DP telegrams for data interpretation are discussed at length, as are extensive GSD files. Particular emphasis is given to the projecting and commissioning of a system and practical guides for installation. (orig.) [Deutsch] PROFIBUS-DP gehoert zu den am haeufigsten eingesetzten Feldbussen fuer die industrielle Kommunikation. Der Autor bietet in diesem umfassenden Werk kompetente Unterstuetzung bei der Anwendung dieser Feldbustechnik. Es werden 32 der haeufigsten Fehler, die bei Zertifizierungstests festgestellt wurden, beschrieben und Wege zu ihrer Behebung dargestellt. Die Grundlagen von PROFIBUS-DP werden erlaeutert und die PROFIBUS-Erweiterungen vorgestellt. PROFIBUS-DP-Telegramme zur Interpretation des Datenverkehrs werden genauso detailliert erklaert wie eine umfangreiche GSD-Datei. Ein besonderer Schwerpunkt ist die Projektierung und Inbetriebnahme einer Anlage und den praxisgerechten Aufbaurichtlinien gewidmet. (orig./GL)
Czech Academy of Sciences Publication Activity Database
Mikhailova, M. P.; Veinger, A.I.; Kochman, I.V.; Semenikhin, P.V.; Kalinina, K.V.; Parfeniev, R.V.; Berezovets, V.A.; Safonchik, M.O.; Hospodková, Alice; Pangrác, Jiří; Zíková, Markéta; Hulicius, Eduard
2016-01-01
Roč. 10, č. 4 (2016), 1-8, č. článku 046013. ISSN 1934-2608 R&D Projects: GA ČR GA13-15286S; GA MŠk LO1603 Institutional support: RVO:68378271 Keywords : Shubnikov-de Haas oscillations * microwave absorption * electron-paramagnetic resonance * composite quantum wells * InAs/GaSb/AlSb * MOVPE Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.325, year: 2016
Corrosion in Haas expanders with and without use of an antimicrobial agent: an in situ study
BAGATIN, Cristhiane Ristum; ITO, Izabel Yoko; ANDRUCIOLI, Marcela Cristina Damião; NELSON-FILHO, Paulo; FERREIRA, José Tarcísio Lima
2011-01-01
Objectives The purpose of this study was to evaluate in situ the occurrence of corrosion in the soldering point areas between the wire, silver brazing and band in Haas expanders. Material and Methods Thirty-four 7-12-year-old patients who needed maxillary expansion with a Haas expander were randomly assigned to two groups of 17 individuals each, according to the oral hygiene protocol adopted during the orthodontic treatment: Group I (control), toothbrushing with a fluoride dentifrice and Group II (experimental), toothbrushing with the same dentifrice plus 0.12% chlorhexidine gluconate (Periogard®) mouthrinses twice a week. The appliances were removed after approximately 4 months. Fragments of the appliances containing a metallic band with a soldered wire were sectioned at random for examination by stereomicroscopy, scanning electron microscopy (SEM) and energy dispersive x-ray spectroscopy (EDS). Data were analyzed statistically by Fisher's test at 5% significance level. Results The analysis by optical microscopy revealed areas with color change suggestive of corrosion in the soldering point areas joining the band and the wire in all specimens of both groups, with no statistically significant difference between the groups (p=1). The peaks of chemical elements (Ni, Fe, Cr, O, C and P) revealed by EDS were also similar in both groups. Conclusion: Color changes and peaks of chemical elements suggestive of corrosion were observed in the soldering point areas between the wire, silver brazing and band in both control and experimental groups, which indicate that the 0.12% chlorhexidine gluconate mouthrinses did not influence the occurrence of corrosion in situ. PMID:22231004
Energy Technology Data Exchange (ETDEWEB)
Zheng, Zhen-Ya; Jiang, Chunyan [CAS Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Shanghai 200030 (China); Wang, Junxian; Hu, Weida; Kong, Xu [CAS Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China, Hefei, Anhui 230026 (China); Rhoads, James; Malhotra, Sangeeta; Gonzalez, Alicia [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85287 (United States); Infante, Leopoldo; Galaz, Gaspar; Barrientos, L. Felipe [Institute of Astrophysics and Center for Astroengineering, Pontificia Universidad Catolica de Chile, Santiago 7820436 (Chile); Walker, Alistair R. [Cerro Tololo Inter-American Observatory, Casilla 603, La Serena (Chile); Jiang, Linhua [The Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Hibon, Pascale [European Southern Observatory, Alonso de Cordova 3107, Casilla 19001, Santiago (Chile); Zheng, XianZhong, E-mail: zhengzy@shao.ac.cn, E-mail: linfante@astro.puc.cl, E-mail: jxw@ustc.edu.cn, E-mail: Sangeeta.Malhotra@asu.edu, E-mail: James.Rhoads@asu.edu [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)
2017-06-20
We present the first results from the ongoing Lyman Alpha Galaxies in the Epoch of Reionization (LAGER) project, which is the largest narrowband survey for z ∼ 7 galaxies to date. Using a specially built narrowband filter NB964 for the superb large-area Dark Energy Camera (DECam) on the NOAO/CTIO 4 m Blanco telescope, LAGER has collected 34 hr NB964 narrowband imaging data in the 3 deg{sup 2} COSMOS field. We have identified 23 Ly α Emitter candidates at z = 6.9 in the central 2-deg{sup 2} region, where DECam and public COSMOS multi-band images exist. The resulting luminosity function (LF) can be described as a Schechter function modified by a significant excess at the bright end (four galaxies with L {sub Lyα∼} 10{sup 43.4±0.2} erg s{sup −1}). The number density at L {sub Ly} {sub α} ∼ 10{sup 43.4±0.2} erg s{sup −1} is little changed from z = 6.6, while at fainter L {sub Lyα} it is substantially reduced. Overall, we see a fourfold reduction in Ly α luminosity density from z = 5.7 to z = 6.9. Combined with a more modest evolution of the continuum UV luminosity density, this suggests a factor of ∼3 suppression of Ly α by radiative transfer through the z ∼ 7 intergalactic medium (IGM). It indicates an IGM neutral fraction of x {sub Hi} ∼ 0.4–0.6 (assuming Ly α velocity offsets of 100–200 km s{sup −1}). The changing shape of the Ly α LF between z ≲ 6.6 and z = 6.9 supports the hypothesis of ionized bubbles in a patchy reionization at z ∼ 7.
Directory of Open Access Journals (Sweden)
Stefan Schoppengerd
2010-07-01
Full Text Available Der Sammelband bietet einen Überblick zu Grundlagen und aktuellen Forschungsgebieten der feministischen Staatstheorie. Aufgezeigt werden wesentliche Analyseinstrumente, die sich aus der feministischen Kritik der Trennung von Öffentlichkeit und Privatheit sowie aus der Auseinandersetzung mit anderen herrschaftskritischen sozialwissenschaftlichen Theorieströmungen ergeben, und ihr Gebrauchswert für verschiedene politikwissenschaftliche Anwendungsgebiete.The collected volume offers an overview of the fundamentals of as well as the most recent research areas for feminist theory of government. It highlights the important analytical tools developed by the feminist critique of the division between public and private as well as by examinations from other social scientific theories also critical of governance. Finally, it points to their applicability to different areas within the political sciences.
Intermediale künstlerische Bildung – theoretische Grundlagen und praktische Umsetzungsperspektiven
Directory of Open Access Journals (Sweden)
Iwan Pasuchin
2006-07-01
Full Text Available Spätestens seit Mitte der 1990er Jahre ist im deutschsprachigen Raum eine zunehmende Annäherung der Medienpädagogik und der Pädagogik künstlerischer Fachbereiche erkennbar. Die konkrete Zusammenarbeit dieser Gebiete gestaltet sich jedoch zumeist recht schwierig, weil es sowohl auf der theoretischen als auch auf der praktischen Ebene an einem intensiven Erfahrungsaustausch mangelt. Es gibt mehrere begriffliche Missverständnisse, unaufgearbeitete historisch verwurzelte gegenseitige Vorurteile und Fehlinformationen bzgl. des aktuellen Standes der Diskurse des jeweils anderen Bereichs. Und auch wenn die praktischen Ergebnisse medienpädagogischer und künstlerisch-pädagogischer Arbeit sich zunehmend ähneln (so wird z. B. «kreativer Medienarbeit» hier wie da ein besonders hoher Stellenwert eingeräumt, weiss man nur wenig über die dahinter stehenden Intentionen und die Methoden der jeweils anderen Seite. Erschwerend kommt hinzu, dass es keine einheitliche Medienpädagogik sowie erst recht keine integrative «künstlerische Pädagogik» gibt und auch die Vernetzung innerhalb der jeweiligen Unterbereiche oft wenig ausgeprägt ist. Jedoch wächst in Zeiten zunehmend knapperer Bildungsbudgets und einer Bildungspolitik, die kaum auf fachdidaktische Forderungen Rücksicht nimmt, das Bewusstsein für die Notwendigkeit, Gemeinsamkeiten stärker hervorzuheben als die Unterschiede und die Bündelung von Energien einem aufreibenden Konkurrenzdenken vorzuziehen. In diesem Sinne werden im folgenden Beitrag (ohne die Differenzen zu verschweigen einige Analogien in den praktischen und theoretischen Grundlagen, historischen Entwicklungen und aktuellen Diskursen der hier angesprochenen Fachbereiche fokussiert, um davon ausgehend ein Forschungs- und Bildungsprojekt vorzustellen, das sich um eine Nutzung daraus resultierender Synergien in der Praxis bemüht.
Shubnikov-de Haas effect study of InAs after transmutation doping at low temperatures
International Nuclear Information System (INIS)
Gerstenberg, H.; Mueller, P.
1990-01-01
Degenerate InAs single crystals have been irradiated by thermal neutrons below 6 K. The Shubnikov-de Haas effect and the electrical resistivity have been measured as a function of the neutron dose and the annealing temperature. The effects of transmutation doping and simultaneous introduction of lattice defects have been analysed in terms of the conduction electron density and the scattering rates τ ρ -1 - ρne 2 /m * and τ x -1 2πkub(B)X/h/2π (where X is the Dingle temperature). The measured conduction electron density after irradiation and thermal annealing agreed well with the values calculated from the experimental and materials parameters. The effects of radiation damage may qualitatively be explained assuming neutral In vacancies to be the most common type of defect in thermal-neutron-irradiated InAs. A comparison with similar experiments on InSb is given. (author)
Rong, Lei; Peng, Li-Juan; Ho, Chi-Tang; Yan, Shou-He; Meurens, Marc; Zhang, Zheng-Zhu; Li, Da-Xiang; Wan, Xiao-Chun; Bao, Guan-Hu; Gao, Xue-Ling; Ling, Tie-Jun
2016-04-15
Green tea, oolong tea and black tea were separately introduced to brew three kinds of tea beers. A model was designed to investigate the tea beer flavour character. Comparison of the volatiles between the sample of tea beer plus water mixture (TBW) and the sample of combination of tea infusion and normal beer (CTB) was accomplished by triangular sensory test and HS-SPME GC-MS analysis. The PCA of GC-MS data not only showed a significant difference between volatile features of each TBW and CTB group, but also suggested some key compounds to distinguish TBW from CTB. The results of GC-MS showed that the relative concentrations of many typical tea volatiles were significantly changed after the brewing process. More interestingly, the behaviour of yeast fermentation was influenced by tea components. A potential interaction between tea components and lager yeast could be suggested. Copyright © 2015 Elsevier Ltd. All rights reserved.
Upper Critical Field and de Haas-van Alphen Oscillations in KOs2O6 Measured in a Hybrid Magnet
Taichi Terashima,; Nobuyuki Kurita,; Atsushi Harada,; Kota Kodama,; Jun-ichi Yamaura,; Zenji Hiroi,; Hisatomo Harima,; Shinya Uji,
2010-08-01
Magnetic torque measurements have been performed on a KOs2O6 single crystal in magnetic fields up to 35.3 T and at temperatures down to 0.6 K. The upper critical field is determined to be ˜30 T. De Haas-van Alphen oscillations are observed. A large mass enhancement of (1+λ) = m* / mband = 7.6 is found. It is suggested that, for the large upper critical field to be reconciled with Pauli paramagnetic limiting, the observed mass enhancement must be of electron-phonon origin, including electron-rattling-mode interactions, for the most part.
Energy Technology Data Exchange (ETDEWEB)
Hellebrand, K. [IF-Technology, Arnhem (Netherlands); Post, R.J. [DLV glas en energie, Naaldwijk (Netherlands); In ' t Groen, B. [KEMA, Arnhem (Netherlands)
2012-06-15
Geothermal energy is too expensive to serve as energy supply for most horticultural entrepreneurs. Therefore, research has been carried out into options to use heat from more shallow layers (shallow geothermal energy). Unlike shallow geothermal energy deep geothermal energy can be applied on a smaller scale, possibly also for individual growers. It can be applied in combination with an existing heating system, but with a more sustainable outcome. Because drilling is done in shallow layers, drilling costs and financial risks are lower. This report comprises the annexes (A) Geologic Framework, and (B) Maps of the Netherlands (depth, thickness of sand layers, temperature and shallow geothermal energy potential [Dutch] Geothermie is voor de meeste tuinbouwondernemers teduur om als energievoorziening te dienen. Daarom is onderzoek gedaan naar mogelijkheden om warmte te gebruiken uit ondiepere lagen (ondiepe geothermie). In tegenstelling tot diepe geothermie is ondiepe geothermie op kleinere schaal toepasbaar, mogelijk ook voor individuele kwekers. Het kan in combinatie met de bestaande verwarmingsinstallatie worden ingezet maar met een duurzamer resultaat. Omdat ondieper wordt geboord zijn de boorkosten en de financiele risico's lager. Dit rapport bevat de bijlagen: (A) Geologisch kader, en (B) B Kaarten Nederland (diepte, zandlaagdikte, temperatuur en ondiepe geothermie (OGT) potentie.
Tan, Jin; Li, Rong; Jiang, Zi-Tao
2015-10-01
We report an application of data fusion for chemometric classification of 135 canned samples of Chinese lager beers by manufacturer based on the combination of fluorescence, UV and visible spectroscopies. Right-angle synchronous fluorescence spectra (SFS) at three wavelength difference Δλ=30, 60 and 80 nm and visible spectra in the range 380-700 nm of undiluted beers were recorded. UV spectra in the range 240-400 nm of diluted beers were measured. A classification model was built using principal component analysis (PCA) and linear discriminant analysis (LDA). LDA with cross-validation showed that the data fusion could achieve 78.5-86.7% correct classification (sensitivity), while those rates using individual spectroscopies ranged from 42.2% to 70.4%. The results demonstrated that the fluorescence, UV and visible spectroscopies complemented each other, yielding higher synergic effect. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
W. Gross
2004-01-01
Full Text Available Die Entwicklung des Geologisch-Paläontologischen Instituts und Museums der Universität Berlin von einer Institution, die Geologie zusammen mit Paläontologie als eine Einheit vertrat, über eine Institution, die eine geotektonische Ausrichtung hatte, zu einer auf Paläontologie konzentrierten Institution wird nachvollzogen. Die beiden Institutsdirektoren am Anfang des 20sten Jahrhunderts waren Vertreter der allumfassenden Geologie des 19ten Jahrhunderts, während die beiden folgenden Direktoren eine Geologie ohne Paläontologie vertraten. Das führte zu einer Trennung der beiden Richtungen, und nach der III. Hochschulreform der DDR 1968 verblieb allein die sammlungsbezogene Paläontologie am Museum. Nach der Wiedervereinigung wurde ein Institut für Paläontologie mit biologischer Ausrichtung mit zwei Professuren, einer für Paläozoologie und einer für Paläobotanik, eingerichtet. The development of the Geologisch-Paläontologisches Institut und Museum of the Museum für Naturkunde at the Humboldt University (formerly Friedrich-Wilhelm-Universität in Berlin from a geology-paleontology institution to a pure paleontology institution is described. The first two directors of the department in the beginning of the 20th century, Prof, von Branca and Prof. Pompeckj, represented a 19th century concept of a geology, which included paleontology, even vertebrate paleontology as the crown jewel of geology. They fought sometimes vigorously against a separation of paleontology from geology. The next two directors. Prof. Stille and Prof, von Bubnoff, were the leading geologists in Germany; to be a student of Stille was a special trade mark in geology of Germany. They represented a geology centered on tectonics. The separation of paleontology as separate section was prepared. The destructions of the Second World War, the following restaurations and the division of Germany into two States influenced strongly their directorships. The education of geologists
Energy Technology Data Exchange (ETDEWEB)
NONE
2011-03-15
As a preliminary action ahead of Stage 2 in the Sectoral Plan 'Deep Geological Disposal' ('Sachplan Geologische Tiefenlager': SGT) the bodies in charge of the management of the radioactive wastes have to determine, together with the Swiss Federal Nuclear Safety Inspectorate (ENSI), which complementary investigations are needed for the provisional safety assessment of the foreseen repositories. In particular, comparisons between the different sites must be possible. If some doubts remain, new investigations have to be conducted. In SGT Stage 1 the National Cooperative for the Disposal of Radioactive Waste (NAGRA) stated that a time period of 100'000 years shall be considered for the storage of low- and intermediate-level radioactive wastes (SMA) and of 1 million years for the storage of high-level wastes (HAA). In SGT Stage 2, considerations about possible modifications of the biosphere during the considered time periods for SMA as well as for HAA have to be included. In what regards the host rock, ENSI declares that the dataset describing the Opalinus clay is sufficient for the site-specific safety analyses. What regards the Wellenberg site for a SMA repository, ENSI has earlier analysed the license request of the NAGRA. For the Mergel formations of the Helveticum, NAGRA conducted a complete safety analysis. ENSI considers the knowledge acquired for these rock types as sufficient for the technical safety comparisons in SGT Stage 2. The knowledge of the rock 'Brauner Dogger' is correct but some more information about the lithostratigraphy and the biostratigraphy is requested. The understanding of the effect of the rock density reduction on the hydraulic conductibility of Opalinus clay and Mergel formations is accurate enough for the comparisons in SGT Stage 2. For the 'Brauner Dogger', comparable data are missing, but the proposed thickness of 300 m of the host rock offers a sufficient protection against density reduction
Effects of caffeine and alcohol on mood and performance changes following consumption of lager.
Smith, Andrew P
2013-06-01
The present study examined whether caffeine would modify the behavioural effects of alcohol. The aim of the study was to determine whether caffeine modifies the effects of alcohol on mood and psychomotor performance and to identify possible dose-response and temporal relationships. A double-blind study examined the effects of three successive lager drinks (330 ml each) in the early afternoon on mood and psychomotor performance assessed at 30-min intervals over a 2-h period. Participants carried out a baseline session and were then randomly assigned to one of six conditions formed by combining three different doses of caffeine (0, 62.5 and 125 mg per drink) with either no alcohol or 4.3 % alcohol. One hundred and forty-six young adults (65 male, 81 female; age range 18-30 years) participated in the study. Mood (alertness, hedonic tone and anxiety) was assessed before and after performing simple reaction time and choice reaction time tasks. Alcohol was associated with higher hedonic tone (p Caffeine had no modifying effect on hedonic tone or anxiety. However, the highest dose of caffeine did remove the effect of alcohol on alertness (p caffeine were found on the performance tasks (all p values caffeine does not remove the negative effects of alcohol on performance although high doses counteract the drop in subjective alertness produced by alcohol.
Directory of Open Access Journals (Sweden)
Marco Antônio Scanavini
2006-02-01
Full Text Available OBJETIVO: avaliar cefalometricamente os efeitos da expansão rápida da sutura palatina mediana sobre o posicionamento vertical e sagital da maxila, comparando os aparelhos de Haas e Hyrax. METODOLOGIA: a amostra consistiu de 93 telerradiografias obtidas de 31 pacientes jovens, brasileiros, de ambos os gêneros, na faixa etária inicial média de 13 anos e 2 meses. As radiografias foram tomadas ao início do tratamento (pré-disjunção, imediatamente após a disjunção (pós-disjunção e ao final do nivelamento. RESULTADOS E CONCLUSÕES: constatou-se que os dois aparelhos disjuntores apresentaram resultados semelhantes, com a ocorrência de deslocamento da maxila em direção inferior, sem rotação, que se manteve ao final do nivelamento e ocorrência de um deslocamento anterior logo após a disjunção, que retornou aos valores pré-disjunção ao final do nivelamento.AIM: the purpose of this cephalometric study was to evaluate, by lateral cephalograms, the changes in maxilar positioning after rapid disjunction of the midpalatal suture, following the use of two types of maxillary disjunction appliances, checked in different phases, and the likely differences between the two appliances Haas and Hyrax. METHODS: the sample comprised of 93 lateral cephalograms, taken before treatment (pre-disjunction, immediately after disjunction and at the end of levelling, obtained from 31 brazilian youths with both genres and average age of 13 years and 2 months. RESULTS AND CONCLUSIONS: both types of appliances showed similar results, with anterior and lower displacement of maxila right after disjunction. Lower displacement was without rotation, and mainttened stable until the end of levelling. Anterior displacement, however, was not stable and cephalometric measurements like SNA and Nperp-A tended to returned to initial values at the end of levelling.
Directory of Open Access Journals (Sweden)
Jan vom Brocke
2007-07-01
Full Text Available Zur administrativen Unterstützung von Lehr- und Lernprozessen werden E-Learning-Plattformen eingesetzt, die auf der Grundlage des Internet Funktionen zur Distribution von Lehr- und Lernmaterialien und zur Kommunikation zwischen Lehrenden und Lernenden anbieten. Zahlreiche wissenschaftliche Beiträge und Marktstudien beschäftigen sich mit der multikriteriellen Evaluation dieser Softwareprodukte zur informatorischen Fundierung strategischer Investitionsentscheidungen. Demgegenüber werden Instrumente zum kostenorientierten Controlling von E-Learning-Plattformen allenfalls marginal thematisiert. Dieser Beitrag greift daher das Konzept der Total Cost of Ownership (TCO auf, das einen methodischen Ansatzpunkt zur Schaffung von Kostentransparenz von E-Learning-Plattformen bildet. Aufbauend auf den konzeptionellen Grundlagen werden Problembereiche und Anwendungspotenziale für das kostenorientierte Controlling von LMS identifiziert. Zur softwaregestützten Konstruktion und Analyse von TCO-Modellen wird das Open Source-Werkzeug TCO-Tool eingeführt und seine Anwendung anhand eines synthetischen Fallbeispiels erörtert. Abschließend erfolgt die Identifikation weiterführender Entwicklungsperspektiven des TCO-Konzepts im Kontext des E-Learning. Die dargestellte Thematik ist nicht nur von theoretischem Interesse, sondern adressiert auch den steigenden Bedarf von Akteuren aus der Bildungspraxis nach Instrumenten zur informatorischen Fundierung von Investitions- und Desinvestitionsentscheidungen im Umfeld des E-Learning.
Energy Technology Data Exchange (ETDEWEB)
Herbes, Carsten [HfWU Nuertingen-Geislingen, Nuertingen (Germany); Friege, Christian (ed.)
2015-07-01
How to market green electricity or biomethane? What is the right price for renewable energy and how do you design the optimal use of social media? What impact have the EEG or electromobility to the Green Power Marketing? Does direct marketing works or is online marketing the guarantee of success? Answers to these and many other basic questions provides the band with contributions from leading scientists and renowned practitioners. For the first time they describe in a structured form the basics of marketing of renewable energies, provide an introduction to the legal and market-based features and present new business models. The book is based on the latest research results, treats all questions of marketing issues important for practitioners, provides case studies and specific recommendations. [German] Wie vermarktet man Oekostrom oder Biomethan? Was ist der richtige Preis fuer Erneuerbare Energien und wie gestaltet man den optimalen Einsatz von Social Media? Welche Auswirkungen haben das EEG oder die Elektromobilitaet auf das Gruenstrom-Marketing? Funktioniert Direktvertrieb oder ist Online-Marketing der Erfolgsgarant? Antworten auf diese und viele weitere grundlegende Fragen liefert dieser Band mit Beitraegen fuehrender Wissenschaftler und renommierter Praktiker. Erstmals beschreiben sie hier in strukturierter Form die Grundlagen der Vermarktung von Erneuerbaren Energien, fuehren in die gesetzlichen und marktlichen Besonderheiten ein und stellen neue Geschaeftsmodelle vor. Das Buch fusst auf aktuellen Forschungsergebnissen, behandelt saemtliche fuer Praktiker wichtige Fragen der Vermarktung, liefert Fallbeispiele und konkrete Empfehlungen.
de Haas-van Alphen effect investigations of the electronic structure of pure and aluminum-doped MgB2
International Nuclear Information System (INIS)
Carrington, A.; Yelland, E.A.; Fletcher, J.D.; Cooper, J.R.
2007-01-01
Our understanding of the superconducting properties of MgB 2 is strongly linked to our knowledge of its electronic structure. In this paper we review experimental measurements of the Fermi surface parameters of pure and Al-doped MgB 2 using the de Haas-van Alphen (dHvA) effect. In general, the measurements are in excellent agreement with the theoretical predictions of the electronic structure, including the strength of the electron-phonon coupling on each Fermi surface sheet. For the Al doped samples, we are able to measure how the band structure changes with doping. These results are in excellent agreement with calculations based on the virtual crystal approximation. We also review work on the dHvA effect in the superconducting state
Topological nature of the node-arc semimetal PtSn4 probed by de Haas-van Alphen quantum oscillations
Wang, Y. J.; Liang, D. D.; Ge, M.; Yang, J.; Gong, J. X.; Luo, L.; Pi, L.; Zhu, W. K.; Zhang, C. J.; Zhang, Y. H.
2018-04-01
Dirac node arc semimetal state is a new topological quantum state which is proposed to exist in PtSn4 (Wu et al 2016 Dirac node arcs in PtSn4 Nat. Phys. 12 667–71). We present a systematic de Haas-van Alphen quantum oscillation study on this compound. Two intriguing oscillation branches, i.e. F 1 and F 2, are detected in the fast Fourier transformation spectra, both of which are characterized to possess tiny effective mass and ultrahigh quantum mobility. And the F 2 branch exhibits an angle-dependent nontrivial Berry phase. The features are consistent with the existence of the node arc semimetal state and shed new light on its complicated Fermi surfaces and topological nature.
Peris, David; Sylvester, Kayla; Libkind, Diego; Gonçalves, Paula; Sampaio, José Paulo; Alexander, William G; Hittinger, Chris Todd
2014-04-01
Reticulate evolution can be a major driver of diversification into new niches, especially in disturbed habitats and at the edges of ranges. Industrial fermentation strains of yeast provide a window into these processes, but progress has been hampered by a limited understanding of the natural diversity and distribution of Saccharomyces species and populations. For example, lager beer is brewed with Saccharomyces pastorianus, an alloploid hybrid of S. cerevisiae and S. eubayanus, a species only recently discovered in Patagonia, Argentina. Here, we report that genetically diverse strains of S. eubayanus are readily isolated from Patagonia, demonstrating that the species is well established there. Analyses of multilocus sequence data strongly suggest that there are two diverse and highly differentiated Patagonian populations. The low nucleotide diversity found in the S. eubayanus moiety of hybrid European brewing strains suggests that their alleles were drawn from a small subpopulation that is closely related to one of the Patagonian populations. For the first time, we also report the rare isolation of S. eubayanus outside Patagonia, in Wisconsin, USA. In contrast to the clear population differentiation in Patagonia, the North American strains represent a recent and possibly transient admixture of the two Patagonian populations. These complex and varied reticulation events are not adequately captured by conventional phylogenetic methods and required analyses of Bayesian concordance factors and phylogenetic networks to accurately summarize and interpret. These findings show how genetically diverse eukaryotic microbes can produce rare but economically important hybrids with low genetic diversity when they migrate from their natural ecological context. © 2014 John Wiley & Sons Ltd.
Microarray studies on lager brewer's yeasts reveal cell status in the process of autolysis.
Xu, Weina; Wang, Jinjing; Li, Qi
2014-08-01
In this work, we performed DNA microarray studies on lager brewer's yeast Saccharomyces pastorianus to investigate changes in gene expression in the process of autolysis. The two strains we used were Qing2 and 5-2. Strain 5-2 is a mutant of Qing2 and autolyzes much more slowly than its parent strain. Four samples of these two strains during different autolysis stages (0% and 15%) were tested using DNA microarray containing > 10,000 yeast's genes. Analysis of genes with the same transcription pattern (up- or down-regulated in both strains) showed that the same 99 genes were up-regulated (transcription levels were increased), and the same 97 genes were down-regulated (transcription levels were decreased) by fivefold or more during autolysis. Genes involved in energy production/utilization, protein anabolism, and stress response were down-regulated. Genes related to cell wall organization and biogenesis, starvation response and DNA damage response were up-regulated. Analysis of genes with opposite transcription patterns (up-regulated in one strain and down-regulated in the other one) showed that 246 genes were up-regulated in 5-2 (autolyzes slowly) and down-regulated in Qing2 (autolyzes rapidly). Another 18 genes had opposite transcription levels, indicating that the strain which autolyzes slowly had better cell vitality despite the same autolysis stage. These findings might further promote the global understanding of autolysis in yeast. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Anja Brickwedde
2017-09-01
Full Text Available The lager brewing yeast Saccharomyces pastorianus, an interspecies hybrid of S. eubayanus and S. cerevisiae, ferments maltotriose, maltose, sucrose, glucose and fructose in wort to ethanol and carbon dioxide. Complete and timely conversion (“attenuation” of maltotriose by industrial S. pastorianus strains is a key requirement for process intensification. This study explores a new evolutionary engineering strategy for improving maltotriose fermentation kinetics. Prolonged carbon-limited, anaerobic chemostat cultivation of the reference strain S. pastorianus CBS1483 on a maltotriose-enriched sugar mixture was used to select for spontaneous mutants with improved affinity for maltotriose. Evolved populations exhibited an up to 5-fold lower residual maltotriose concentration and a higher ethanol concentration than the parental strain. Uptake studies with 14C-labeled sugars revealed an up to 4.75-fold higher transport capacity for maltotriose in evolved strains. In laboratory batch cultures on wort, evolved strains showed improved attenuation and higher ethanol concentrations. These improvements were also observed in pilot fermentations at 1,000-L scale with high-gravity wort. Although the evolved strain exhibited multiple chromosomal copy number changes, analysis of beer made from pilot fermentations showed no negative effects on flavor compound profiles. These results demonstrate the potential of evolutionary engineering for strain improvement of hybrid, alloploid brewing strains.
Brickwedde, Anja; van den Broek, Marcel; Geertman, Jan-Maarten A; Magalhães, Frederico; Kuijpers, Niels G A; Gibson, Brian; Pronk, Jack T; Daran, Jean-Marc G
2017-01-01
The lager brewing yeast Saccharomyces pastorianus , an interspecies hybrid of S. eubayanus and S. cerevisiae , ferments maltotriose, maltose, sucrose, glucose and fructose in wort to ethanol and carbon dioxide. Complete and timely conversion ("attenuation") of maltotriose by industrial S. pastorianus strains is a key requirement for process intensification. This study explores a new evolutionary engineering strategy for improving maltotriose fermentation kinetics. Prolonged carbon-limited, anaerobic chemostat cultivation of the reference strain S. pastorianus CBS1483 on a maltotriose-enriched sugar mixture was used to select for spontaneous mutants with improved affinity for maltotriose. Evolved populations exhibited an up to 5-fold lower residual maltotriose concentration and a higher ethanol concentration than the parental strain. Uptake studies with 14 C-labeled sugars revealed an up to 4.75-fold higher transport capacity for maltotriose in evolved strains. In laboratory batch cultures on wort, evolved strains showed improved attenuation and higher ethanol concentrations. These improvements were also observed in pilot fermentations at 1,000-L scale with high-gravity wort. Although the evolved strain exhibited multiple chromosomal copy number changes, analysis of beer made from pilot fermentations showed no negative effects on flavor compound profiles. These results demonstrate the potential of evolutionary engineering for strain improvement of hybrid, alloploid brewing strains.
Herzog, F.; Hardtdegen, H.; Schäpers, Th; Grundler, D.; Wilde, M. A.
2017-10-01
The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin-orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI.
International Nuclear Information System (INIS)
Herzog, F; Grundler, D; Wilde, M A; Hardtdegen, H; Schäpers, Th
2017-01-01
The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin–orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI. (paper)
Energy Technology Data Exchange (ETDEWEB)
Baehr, Hans Dieter [Hannover Univ. (Germany). Inst. fuer Thermodynamik; Kabelac, Stephan [Helmut-Schmidt-Univ., Univ. der Bundeswehr Hamburg (Germany). Inst. fuer Thermodynamik
2009-07-01
The actualized 14th edition covers now a further chapter on energy conversion: the structure of energy demand in Germany is discussed and patterns of energy conversion highlighted. Furtheron practical application on combustion processes, thermal power plants, carbon dioxide and power generation, heating systems and refrigerating machinery are completed. The concepts of exergy and energy are introduced by postulates instead of being constructed on the basis of certain theorems; this is to give the students easier access to the fundamental balance equations which are the basic elements in the quantitative statements of the two basic laws of thermodynamics and are indispensable for their application. The balance equations are expressed in as general a form as possible taking account also of transient processes of open systems and of the special case of steady flow processes. (orig./GL) [German] die aktualisierte 14. Auflage des bewaehrten Lehrbuchs der Technischen Thermodynamik wurde das Kapitel ueber Waermekraftanlagen gruendlich bearbeitet und durch einen Abschnitt zur Energiewandlung ergaenzt: Die Energiebedarfsstruktur von Deutschland wird erlaeutert, und die moeglichen Energiewandlungspfade werden diskutiert. Schwerpunkt des Buches ist die ausfuehrliche und auch dem Anfaenger verstaendliche Darstellung der Grundlagen der Thermodynamik mit der sorgfaeltigen Einfuehrung der thermodynamischen Begriffe und den fundamentalen Bilanzgleichungen fuer Energie, Entropie und Exergie. Die thermodynamischen Eigenschaften reiner Fluide und fluider Gemische werden eingehend erlaeutert. Darauf aufbauend wird die Thermodynamik der Gemische und der chemischen Reaktionen entwickelt. Auch die thermodynamischen Aspekte wichtiger energie- und verfahrenstechnischer Anwendungen werden praxisnah behandelt: - Stroemungs- und Arbeitsprozesse, - thermische Stofftrennverfahren, - Verbrennungsprozesse und Verbrennungskraftanlagen, - thermische Kraftwerke, - CO2-Emissionen der Stromerzeugung
Energy Technology Data Exchange (ETDEWEB)
Hoppe, D.
2000-11-01
A two-phase medium consisting of a fluid containing gas is transported in a turbo-pump via an impeller. The interaction between the gaseous phase and the impeller is to be examined by tomography with gamma rays. Reconstruction of the image of the object is to be made by way of filtered inverse projection. The methodology of using this principle in the given system (geometry and measuring conditions) is explained. (orig./CB) [German] Ein zweiphasiges, aus einer gashaltigen Fluessigkeit bestehendes Medium wird in einer Axialpumpe von einem propellerartigen Laufrad senkrecht zur Drehachse dieses Laufrades transportiert. Die Wechselwirkung zwischen der Gasphase und dem Laufrad soll unter Verwendung von Gamma-Strahlung mittels Tomographie untersucht werden. Dabei ist fuer die Rekonstruktion des Objektbildes das Prinzip der sogenannten gefilterten Rueckprojektion vorgesehen. Die methodischen Grundlagen fuer die Nutzung dieses Prinzips unter von vorgesehenen geometrischen und messtechnischen Bedingungen sind Gegenstand dieser Arbeit. (orig.)
Blanco, Carlos A; Nimubona, Dieudonné; Caballero, Isabel
2014-08-01
Iso-α-acids and their chemically modified variants are responsible for the bitterness of beer and play a disproportionately large role in the final quality of beer. The current study was undertaken to predict the degradation of commercial lager beers related to changes in the concentration of trans-iso-α-acids during storage by using high-pressure liquid chromatography. In the analysed beers the concentration of isohumulone (average concentration 28 mg L(-1)) was greater than that of isocohumulone (20 mg L(-1)) and isoadhumulone (10 mg L(-1)). The kinetic parameters, activation energy and rate constant, of the trans-iso-α-acids were calculated. In the case of dark beers, the activation energy for the degradation of trans-isocohumulones was found to be higher than for trans-isohumulones and trans-isoadhumulones, whereas in pale and alcohol-free beers activation energies for the degradation of the three trans isomers were similar. The loss of iso-α-acids can be calculated using the activation energy of the degradation of trans-iso-α-acids and the temperature profile of the accelerated ageing. The results obtained in the investigation can be used in the beer industry to predict the alteration of the bitterness of beer during storage. © 2013 Society of Chemical Industry.
Energy Technology Data Exchange (ETDEWEB)
Knolle, Johannes; Cooper, Nigel [T.C.M. Group, Cavendish Laboratory, J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom)
2016-07-01
The de Haas-van Alphen effect (dHvAE), describing oscillations of the magnetization as a function of magnetic field, is commonly assumed to be a definite sign for the presence of a Fermi surface (FS). Indeed, the effect forms the basis of a well-established experimental procedure for accurately measuring FS topology and geometry of metallic systems, with parameters commonly extracted by fitting to the Lifshitz-Kosevich (LK) theory based on Fermi liquid theory. Here we show that, in contrast to this canonical situation, there can be quantum oscillations even for band insulators of certain types. We provide simple analytic formulas describing the temperature dependence of the quantum oscillations in this setting, showing strong deviations from LK theory. We draw connections to recent experiments on the tentative topological Kondo insulator SmB{sub 6}.
Huang, Huaqing; Liu, Feng
2017-05-01
The extremely stringent requirement on material quality has hindered the investigation and potential applications of exotic chiral magnetic effect in Dirac semimetals. Here, we propose that gray tin is a perfect candidate for observing the chiral anomaly effect and Shubnikov-de-Haas (SdH) oscillation at relatively low magnetic field. Based on effective k .p analysis and first-principles calculations, we discover that gray tin becomes a Dirac semimetal under tensile uniaxial strain, in contrast to a topological insulator under compressive uniaxial strain as known before. In this newly found Dirac semimetal state, two Dirac points which are tunable by tensile [001] strains lie in the kz axis and Fermi arcs appear in the (010) surface. Due to the low carrier concentration and high mobility of gray tin, a large chiral anomaly induced negative magnetoresistance and a strong SdH oscillation are anticipated in this half of the strain spectrum. Comparing to other Dirac semimetals, the proposed Dirac semimetal state in the nontoxic elemental gray tin can be more easily manipulated and accurately controlled. We envision that gray tin provides a perfect platform for strain engineering of chiral magnetic effects by sweeping through the strain spectrum from positive to negative and vice versa.
International Nuclear Information System (INIS)
Talbert, D.M.
1984-06-01
This report presents the results of the fourth interim meeting of the Seabed Working Group's (SWG) Engineering Studies Task Group (ESTG). This task group is charged with determining whether the engineering technology exists to emplace waste canisters in deep ocean sediments. The fourth interim meeting, held at Rijks Geologische Dienst, Haarlem, The Netherlands, 3-6 October 1983, reviewed progress made by the various national programs since the ESTG third interim meeting (July 1982) and developed a table of requirements for processing samples for a geotechnical properties data base. Other items addressed were (1) potential methods of instrumenting penetrators to obtain in situ measurements, (2) procedures for evaluating and quantifying the disturbed zone created by an emplaced penetrator, (3) review and modification of the current draft version of the SWG Five-Year Plan, (4) review and extension of the ESTG detailed plan for penetrator tests, and (5) details of the penetrator tests scheduled for March 1984 in the Nares Abyssal Plain using the research vessel M/V TYRO. The review of the national programs indicated significant progress when measured against the integrated ESTG five-year plan which results in a joint evaluation of engineering feasibility of subseabed disposal based upon (1) a demonstration of an emplacement capability, (2) an evaluation of the zone of sediment disturbance created during emplacement, (3) the existence of acceptable emplacement models, and (4) an acceptable engineering data base. A table of geotechnical sample-processing requirements is being developed to provide guidance for the other task groups that may have the opportunity to furnish suitable geotechnical samples to the ESTG as well as to provide some measure of consistency within the ESTG for the development of the engineering data base for the SWG study areas
High field magnetoresistance and de Haas-van Alphen effect in antiferromagnetic PrB6 and NdB6
International Nuclear Information System (INIS)
Onuki, Y.; Umezawa, A.; Kwok, W.K.; Crabtree, G.W.; Nishihara, M.; Yamazaki, T.; Omi, T.; Komatsubara, T.
1987-08-01
The transport properties and the de Haas-van Alphen (dHvA) effect have been measured for antiferromagnetic PrB 6 and NdB 6 . The number of conduction electrons is approximately one per unit cell. The magnetoresistance shows the existence of open orbits implying a multiply connected Fermi surface. The angular dependence of the magnetoresistance is roughly similar to that of the reference material, LaB 6 . The dHvA data in PrB 6 shows both paramagnetic and antiferromagnetic Fermi surfaces. The antiferromagnetic Fermi surface arises from new magnetic Brillouin zone boundaries and antiferromagnetic gaps introduced by the magnetic order, and the paramagnetic Fermi surface from magnetic breakdown through the small antiferromagnetic gaps in high field. Hybridization between the conduction electrons and the f electrons has been observed through the cyclotron masses, which in PrB 6 are three times larger than the corresponding masses of LaB 6 . In NdB 6 only the antiferromagnetic Fermi surface, quite different from those of LaB 6 and PrB 6 , has been observed. 26 refs., 10 figs., 3 tabs
International Nuclear Information System (INIS)
Laukhin, V.N.; Audouard, A.; Rakoto, H.; Broto, J.M.; Goze, F.; Coffe, G.; Brossard, L.; Redoules, J.P.; Kartsovnik, M.V.; Kushch, N.D.; Buravov, L.I.; Khomenko, A.G.; Yagubskii, E.B.; Askenazy, S.; Pari, P.
1995-01-01
Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal α-(ET) 2 TlHg(SeCN) 4 have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F 0 =653±3 T and slow frequency oscillations with F s =38±5 T have been revealed. (orig.)
First Spectroscopic Confirmations of z ∼ 7.0 Ly α Emitting Galaxies in the LAGER Survey
Energy Technology Data Exchange (ETDEWEB)
Hu, Weida; Wang, Junxian; Kang, Wenyong; Kong, Xu; Yang, Huan [CAS Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China, Hefei, Anhui 230026 (China); Zheng, Zhen-Ya; Jiang, Chunyan [CAS Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Shanghai 200030 (China); Malhotra, Sangeeta; Rhoads, James; Gonzalez, Alicia; Tilvi, Vithal [School of Earth and Space Exploration, Arizona State University, Tempe, AZ 85287 (United States); Infante, Leopoldo [Las Campanas Observatory, Carnegie Institution for Science, Casilla 601, La Serena (Chile); Walker, Alistair R. [Cerro Tololo Inter-American Observatory, Casilla 603, La Serena (Chile); Jiang, Linhua [The Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Hibon, Pascale [European Southern Observatory, Alonso de Cordova 3107, Casilla 19001, Santiago (Chile); Barrientos, L. Felipe; Galaz, Gaspar [Centro de Astroingeniería, Facultad de Física, Pontificia Universidad Católica de Chile, Santiago (Chile); Finkelstein, Steven [Department of Astronomy, The University of Texas at Austin, Austin, TX 78712 (United States); Zheng, XianZhong, E-mail: urverda@mail.ustc.edu.cn, E-mail: jxw@ustc.edu.cn, E-mail: zhengzy@shao.ac.cn, E-mail: Sangeeta.Malhotra@asu.edu, E-mail: James.Rhoads@asu.edu, E-mail: linfante@carnegiescience.edu [Purple Mountain Observatory, Chinese Academy of Sciences, Nanjing 210008 (China)
2017-08-20
Narrowband imaging is a highly successful approach for finding large numbers of high-redshift Ly α emitting galaxies (LAEs) up to z ∼ 6.6. However, at z ≳ 7 there are as of yet only three narrowband selected LAEs with spectroscopic confirmations (two at z ∼ 6.9–7.0, one at z ∼ 7.3), which hinders extensive studies on cosmic reionization and galaxy evolution at this key epoch. We have selected 23 candidate z ∼ 6.9 LAEs in COSMOS field with the large area narrowband survey Lyman-Alpha Galaxies at the End of Reionization (LAGER). In this work, we present spectroscopic follow-up observations of 12 candidates using the Inamori Magellan Areal Camera and Spectrograph on Magellan. For nine of these, the observations are sufficiently deep to detect the expected lines. Ly α emission lines are identified in six sources (yielding a success rate of 2/3), including three luminous LAEs with Ly α luminosities of L {sub Lyα} ∼ 10{sup 43.5} erg s{sup −1}, the highest among known spectroscopically confirmed galaxies at ≳7.0. This triples the sample size of spectroscopically confirmed narrowband selected LAEs at z ≳ 7, and confirms the bright-end bump in the Ly α luminosity function we previously derived based on the photometric sample, supporting a patchy reionization scenario. Two luminous LAEs appear physically linked with a projected distance of 1.1 pMpc and velocity difference of ∼170 km s{sup −1}. They likely sit in a common ionized bubble produced by themselves or with close neighbors, which reduces the intergalactic medium attenuation of Ly α . A tentative narrow N v λ 1240 line is seen in one source, hinting at activity of a central massive black hole with metal-rich line-emitting gas.
Energy Technology Data Exchange (ETDEWEB)
Laukhin, V.N. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France)]|[Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Audouard, A. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Rakoto, H. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Broto, J.M. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Goze, F. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Coffe, G. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Brossard, L. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Redoules, J.P. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Kartsovnik, M.V. [Institute of Solid State Physics, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Kushch, N.D. [Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Buravov, L.I.
1995-05-01
Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal {alpha}-(ET){sub 2}TlHg(SeCN){sub 4} have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F{sub 0}=653{+-}3 T and slow frequency oscillations with F{sub s}=38{+-}5 T have been revealed. (orig.).
Ekberg, Jukka; Rautio, Jari; Mattinen, Laura; Vidgren, Virve; Londesborough, John; Gibson, Brian R
2013-05-01
An adaptive evolution method to obtain stable Saccharomyces pastorianus brewing yeast variants with improved fermentation capacity is described. The procedure involved selection for rapid growth resumption at high osmotic strength. It was applied to a lager strain and to a previously isolated ethanol-tolerant strain. Fermentation performance of strains was compared at 15 °P wort strength. A selected osmotolerant variant of the ethanol-tolerant strain showed significantly shorter fermentation time than the parent strain, producing 6.45% alcohol by volume beer in 4-5 days with mostly similar organoleptic properties to the original strain. Diacetyl and pentanedione contents were 50-75% and 3-methylbutyl acetate and 2-phenylethyl acetate 50% higher than with the original strain, leading to a small flavour change. The variant contained significantly less intracellular trehalose and glycogen than the parent. Transcriptional analysis of selected genes at 24 h revealed reduced transcription of hexose transport genes and increased transcription of the MALx1 and MALx2 genes, responsible for α-glucoside uptake and metabolism. It is suggested that an attenuated stress response contributes to the improved fermentation performance. Results show that sequential selection for both ethanol tolerance and rapid growth at high osmotic strength can provide strains with enhanced fermentation speed with acceptable product quality. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Pavlosiuk, Orest; Kaczorowski, Dariusz; Wiśniewski, Piotr
2015-01-01
We present electronic transport and magnetic properties of single crystals of semimetallic half-Heusler phase LuPdBi, having theoretically predicted band inversion requisite for nontrivial topological properties. The compound exhibits superconductivity below a critical temperature Tc = 1.8 K, with a zero-temperature upper critical field Bc2 ≈ 2.3 T. Although superconducting state is clearly reflected in the electrical resistivity and magnetic susceptibility data, no corresponding anomaly can be seen in the specific heat. Temperature dependence of the electrical resistivity suggests existence of two parallel conduction channels: metallic and semiconducting, with the latter making negligible contribution at low temperatures. The magnetoresistance is huge and clearly shows a weak antilocalization effect in small magnetic fields. Above about 1.5 T, the magnetoresistance becomes linear and does not saturate in fields up to 9 T. The linear magnetoresistance is observed up to room temperature. Below 10 K, it is accompanied by Shubnikov-de Haas oscillations. Their analysis reveals charge carriers with effective mass of 0.06 me and a Berry phase very close to π, expected for Dirac-fermion surface states, thus corroborating topological nature of the material. PMID:25778789
Split Fermi Surfaces of the Spin-Orbit-Coupled Metal Cd2Re2O7 Probed by de Haas-van Alphen Effect
Matsubayashi, Yasuhito; Sugii, Kaori; Hirose, Hishiro T.; Hirai, Daigorou; Sugiura, Shiori; Terashima, Taichi; Uji, Shinya; Hiroi, Zenji
2018-05-01
The superconducting pyrochlore oxide Cd2Re2O7 shows a structural transition with inversion symmetry breaking (ISB) at Ts1 = 200 K. A recent theory [https://doi.org/10.1103/PhysRevLett.115.026401" xlink:type="simple">L. Fu, Phys. Rev. Lett. 115, 026401 (2015)] suggests that the origin is an electronic instability that leads to a multipolar order in the spin-orbit-coupled metal. To observe the Fermi surface of the low-temperature phase of Cd2Re2O7, we perform de Haas-van Alphen effect measurements by means of magnetic torque. In reference to a calculated band structure, the spin-split Fermi surfaces with large cyclotron masses of 5-9m0 are revealed. The splitting is suggested to be due to an antisymmetric spin-orbit coupling induced by ISB, the strength of which is estimated to be approximately 67 K, which is rather smaller than those of typical non-centrosymmetric metals.
International Nuclear Information System (INIS)
Ōnuki, Yoshichika; Hedo, Masato; Nakama, Takao; Nakamura, Ai; Aoki, Dai; Boukahil, Mounir; Haga, Yoshinori; Takeuchi, Tetsuya; Harima, Hisatomo
2015-01-01
We succeeded in growing single crystals of EuCo 2 Si 2 by the Bridgman method, and carried out the de Haas-van Alphen (dHvA) experiments. EuCo 2 Si 2 was previously studied from a viewpoint of the trivalent electronic state on the basis of the magnetic susceptibility and X-ray absorption experiments, whereas most of the other Eu compounds order magnetically, with the divalent electronic state. The detected dHvA branches in the present experiments are found to be explained by the results of the full potential linearized augmented plane wave energy band calculations on the basis of a local density approximation (LDA) for YCo 2 Si 2 (LDA) and EuCo 2 Si 2 (LDA + U), revealing the trivalent electronic state. The detected cyclotron effective masses are moderately large, ranging from 1.2 to 2.9 m 0
Kopecká, J; Němec, M; Matoulková, D
2016-06-01
Brewing yeasts are classified into two species-Saccharomyces pastorianus and Saccharomyces cerevisiae. Most of the brewing yeast strains are natural interspecies hybrids typically polyploids and their identification is thus often difficult giving heterogenous results according to the method used. We performed genetic characterization of a set of the brewing yeast strains coming from several yeast culture collections by combination of various DNA-based techniques. The aim of this study was to select a method for species-specific identification of yeast and discrimination of yeast strains according to their technological classification. A group of 40 yeast strains were characterized using PCR-RFLP analysis of ITS-5·8S, NTS, HIS4 and COX2 genes, multiplex PCR, RAPD-PCR of genomic DNA, mtDNA-RFLP and electrophoretic karyotyping. Reliable differentiation of yeast to the species level was achieved by PCR-RFLP of HIS4 gene. Numerical analysis of the obtained RAPD-fingerprints and karyotype revealed species-specific clustering corresponding with the technological classification of the strains. Taxonomic position and partial hybrid nature of strains were verified by multiplex PCR. Differentiation among species using the PCR-RFLP of ITS-5·8S and NTS region was shown to be unreliable. Karyotyping and RFLP of mitochondrial DNA evinced small inaccuracies in strain categorization. PCR-RFLP of HIS4 gene and RAPD-PCR of genomic DNA are reliable and suitable methods for fast identification of yeast strains. RAPD-PCR with primer 21 is a fast and reliable method applicable for differentiation of brewing yeasts with only 35% similarity of fingerprint profile between the two main technological groups (ale and lager) of brewing strains. It was proved that PCR-RFLP method of HIS4 gene enables precise discrimination among three technologically important Saccharomyces species. Differentiation of brewing yeast to the strain level can be achieved using the RAPD-PCR technique. © 2016 The
Wang, Jin-jing; Xu, Wei-na; Li, Xin'er; Li, Jia; Li, Qi
2014-06-01
The flavor stability during storage is very important to the freshness and shelf life of beer. However, beer fermented with a yeast strain which is prone to autolyze will significantly affect the flavor of product. In this study, the gene encoding β-1,3-glucan synthetase catalytic subunit (fks1) of the lager yeast was destroyed via self-clone strategy. β-1,3-glucan is the principle cell wall component, so fks1 disruption caused a decrease in β-1,3-glucan level and increase in chitin level in cell wall, resulting in the increased cell wall thickness. Comparing with wild-type strain, the mutant strain had 39.9 and 63.41 % less leakage of octanoic acid and decanoic acid which would significantly affect the flavor of beer during storage. Moreover, the results of European Brewery Convention tube fermentation test showed that the genetic manipulation to the industrial brewing yeast helped with the anti-staling ability, rather than affecting the fermentation ability. The thiobarbituric acid value reduced by 65.59 %, and the resistant staling value increased by 26.56 %. Moreover, the anti-staling index of the beer fermented with mutant strain increased by 2.64-fold than that from wild-type strain respectively. China has the most production and consumption of beer around the world, so the quality of beer has a significant impact on Chinese beer industry. The result of this study could help with the improvement of the quality of beer in China as well as around the world.
Depasquale, Roberto; Lee, Sau L; Saluja, Bhawana; Shur, Jagdeep; Price, Robert
2015-06-01
This study investigated the structural relaxation of micronized fluticasone propionate (FP) under different lagering conditions and its influence on aerodynamic particle size distribution (APSD) of binary and tertiary carrier-based dry powder inhaler (DPI) formulations. Micronized FP was lagered under low humidity (LH 25 C, 33% RH [relative humidity]), high humidity (HH 25°C, 75% RH) for 30, 60, and 90 days, respectively, and high temperature (HT 60°C, 44% RH) for 14 days. Physicochemical, surface interfacial properties via cohesive-adhesive balance (CAB) measurements and amorphous disorder levels of the FP samples were characterized. Particle size, surface area, and rugosity suggested minimal morphological changes of the lagered FP samples, with the exception of the 90-day HH (HH90) sample. HH90 FP samples appeared to undergo surface reconstruction with a reduction in surface rugosity. LH and HH lagering reduced the levels of amorphous content over 90-day exposure, which influenced the CAB measurements with lactose monohydrate and salmeterol xinafoate (SX). CAB analysis suggested that LH and HH lagering led to different interfacial interactions with lactose monohydrate but an increasing adhesive affinity with SX. HT lagering led to no detectable levels of the amorphous disorder, resulting in an increase in the adhesive interaction with lactose monohydrate. APSD analysis suggested that the fine particle mass of FP and SX was affected by the lagering of the FP. In conclusion, environmental conditions during the lagering of FP may have a profound effect on physicochemical and interfacial properties as well as product performance of binary and tertiary carrier-based DPI formulations.
S2k-Leitlinie zum Gebrauch von Präparationen zur lokalen Anwendung auf der Haut (Topika).
Wohlrab, Johannes; Staubach, Petra; Augustin, Matthias; Eisert, Lisa; Hünerbein, Andreas; Nast, Alexander; Reimann, Holger; Strömer, Klaus; Mahler, Vera
2018-03-01
Diese Leitlinie richtet sich an Assistenz- und Fachärzte der Dermatologie sowie an Kostenträger und politische Entscheidungsgremien. Die Leitlinie wurde im formellen Konsensusverfahren (S2k) von Dermatologen unter Einbindung von Apothekern erstellt. Die Leitlinie stellt allgemeine Aspekte der Pharmakokinetik sowie der regulatorischen Begrifflichkeiten dar. Es werden Empfehlungen zur Indikation von Magistralrezepturen sowie deren Qualitätssicherung gegeben. Die Bedeutung der galenischen Grundlagen und die Problematik bei einer Substitution gegeneinander verschiedener Grundlagen werden dargestellt. Die Leitlinie umfasst Kriterien zur Auswahl einer adäquaten Grundlage sowie spezifische Aspekte zur Therapieplanung. Die Leitlinie gibt Empfehlungen zum Management bei Unverträglichkeiten gegenüber Bestandteilen der Grundlagen oder Hilfsstoffe. © 2018 The Authors | Journal compilation © Blackwell Verlag GmbH, Berlin.
Energy Technology Data Exchange (ETDEWEB)
Schulte, Martin; Schroeder, Rainer (eds.) [Technische Univ. Dresden (Germany). Juristische Fakultaet
2011-07-01
On the boundaries between technology sciences, jurisprudence, social sciences and economic science the technology law proves as a cross-sectional area par excellence. The bases of the technology law are presented: individual, particularly important scopes of the technology law (appliance safety regulations, technology law and environment law, genetic engineering act, energy right, telecommunications law and media law, patent law, computer law, data security, legally binding telecooperation) are analyzed in detail. The manual contacts all lawyers who want to provide a first in-depth insight of this new field of law. [German] Im Grenzbereich von Technik-, Rechts-, Sozial- und Wirtschaftswissenschaften erweist sich das Technikrecht als Querschnittsmaterie par excellence. Die Grundlagen des Technikrechts werden dargestellt; einzelne, besonders wichtige Bereiche des Technikrechts (Geraetesicherheitsrecht, Technik und Umweltrecht, Gentechnikrecht, Energierecht, Telekommunikations- und Medienrecht, Patentrecht, Computerrecht, Datensicherheit, Rechtsverbindliche Telekooperation) werden eingehend analysiert. Das Handbuch wendet sich an alle in Wissenschaft und Praxis mit dem Technikrecht befassten Juristen, die sich einen ersten vertieften Einblick in dieses neue Rechtsgebiet verschaffen wollen. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Marschall, P.; Giger, S.
2014-12-15
This dossier is the fourth of a series of eight reports concerning the safety and technical aspects of locations for the disposal of radioactive wastes in Switzerland. This Dossier IV considers the documentation on geo-mechanical aspects that is available. Rock-stress conditions are looked at as are the methods and instrumentation used to establish them. The results of local analyses are presented and discussed, as are the magnitudes and long-term stability of such stress conditions. The geo-mechanical properties of Opalinus Clay as a host rock for a repository are discussed. Mountain-building models and coupled hydro-mechanical processes are also discussed.
Energy Technology Data Exchange (ETDEWEB)
Traber, D.; Gautschi, A.; Marschall, P.; Becker, J. [National Cooperative for the Disposal of Radioactive Waste (NAGRA), Wettingen (Switzerland); Waber, N. [Institut of Geological Sciences, University of Berne, Berne (Switzerland)
2014-12-15
This dossier is the fifth of a series of eight reports concerning the safety and technical aspects of locations for the disposal of radioactive wastes in Switzerland. Dossier V looks at hydro-geological considerations in North-Western Switzerland. Rock layers in the region and their hydrological properties are examined. Ground-water and deeper lying aquifers in the various rock formations are discussed. The specific hydrology in the proposed areas for nuclear waste depositories is looked at, including infiltration and exfiltration zones and gradients.
Apolin, Martin
2007-01-01
Physik soll verständlich sein und Spaß machen! Deshalb beginnt jedes Kapitel in Big Bang mit einem motivierenden Überblick und Fragestellungen und geht dann von den Grundlagen zu den Anwendungen, vom Einfachen zum Komplizierten. Dabei bleibt die Sprache einfach, alltagsorientiert und belletristisch. Der Band 5 RG behandelt die Grundlagen (Maßsystem, Größenordnungen) und die Mechanik (Translation, Rotation, Kraft, Erhaltungssätze).
Weiß, Hans-Jörg
2005-01-01
Die Liberalisierung der Netzindustrien hat das Interesse an den konzeptionellen Grundlagen der Kapitalkostenermittlung wiederbelebt. Im Mittelpunkt dieses Beitrags steht eine dieser Grundlagen: Das Deprival Value-Konzept. Es wird aufgezeigt, dass es sich hierbei um ein ökonomisch fundiertes Bewertungskonzept handelt, das sich sowohl in stationären als auch in nicht-stationären Bewertungskontexten konsistent als Referenzpunkt verwenden lässt. Die Kontextabhängigkeit der Deprival Value-Ermittlu...
Romanova, Taisiia A.; Knyazev, Dmitry A.; Wang, Zhaosheng; Sadakov, Andrey V.; Prudkoglyad, Valery A.
2018-05-01
We report Shubnikov-de Haas (SdH) and Hall oscillations in Cu-doped high quality bismuth selenide single crystals. To increase the accuracy of Berry phase determination by means of the of the SdH oscillations phase analysis we present a study of n-type samples with bulk carrier density n ∼1019 -1020cm-3 at high magnetic field up to 60 Tesla. In particular, Landau level fan diagram starting from the value of the Landau index N = 4 was plotted. Thus, from our data we found π-Berry phase that directly indicates the Dirac nature of the carriers in three-dimensional topological insulator (3D TI) based on Cu-doped bismuth selenide. We argued that in our samples the magnetotransport is determined by a general group of carriers that exhibit quasi-two-dimensional (2D) behaviour and are characterized by topological π-Berry phase. Along with the main contribution to the conductivity the presence of a small group of bulk carriers was registered. For 3D-pocket Berry phase was identified as zero, which is a characteristic of trivial metallic states.
Singh, Yogesh; Martin, C.; Bud'Ko, S. L.; Ellern, A.; Prozorov, R.; Johnston, D. C.
2010-10-01
Single crystals of superconducting OsB2 [Tc=2.10(5)K] have been grown using a Cu-B eutectic flux. We confirm that OsB2 crystallizes in the reported orthorhombic structure (space group Pmmn ) at room temperature. Both the normal and superconducting state properties of the crystals are studied using various techniques. Heat capacity versus temperature C(T) measurements yield the normal state electronic specific heat coefficient γ=1.95(1)mJ/molK2 and the Debye temperature ΘD=539(2)K . The measured frequencies of Shubnikov-de Haas oscillations are in good agreement with those predicted by band structure calculations. Magnetic susceptibility χ(T,H) , electrical resistivity ρ(T) , and C(T,H) measurements ( H is the magnetic field) demonstrate that OsB2 is a bulk low- κ [κ(Tc)=2(1)] type-II superconductor that is intermediate between the clean and dirty limits [(ξ(T=0)/ℓ=0.97)] with a small upper critical magnetic field Hc2(T=0)=186(4)Oe . The penetration depth is λ(T=0)=0.300μm . An anomalous (not single-gap BCS) T dependence of λ was fitted by a two-gap model with Δ1(T=0)/kBTc=1.9 and Δ2(T=0)/kBTc=1.25 , respectively. The discontinuity in the heat capacity at Tc , ΔC/γTc=1.32 , is smaller than the weak-coupling BCS value of 1.43, consistent with the two-gap nature of the superconductivity in OsB2 . An anomalous increase in ΔC at Tc of unknown origin is found in finite H ; e.g., ΔC/γTc≈2.5 for H≈25Oe .
Modelling the effects of the Saalian glaciation on the NW European geohydrological system
Weert FHA van; Leijnse A; LBG
1994-01-01
In een aantal Europese landen worden zoutkoepels beschouwd als potentiele geologische formaties voor de opslag van radio-actief afval. Subrosie (het oplossen van zout door stromend grondwater) van deze zoutkoepels vormt een mogelijke bedreiging voor de veiligheid van deze opslagplaatsen. Men
Die Entwicklung des Eigentums- und Gesellschaftsrechts in Estland / Ilmar Selge
Selge, Ilmar, 1954-
1992-01-01
Õigusaktide tõlked: ROW nr. 6, lk. 181-190 (tlk. Ilmar Selge) - Gesetz der Republik Estland über die Grundlagen der Eigentumsreform ; Beschluss des Obersten Rates der Republik Estland über die Anwendung des Gesetzes über die Grundlagen der Eigentumsreform ; Bodenreformgesetz der Republik Estland ; Beschluss des Obersten Rates der Republik Estland über das Inkrafttreten des Bodenreformgesetz der Republik Estland. ROW nr. 10, lk. 307-310 (tlk. Ilmar Selge) - Gesetz der Republik Estland über ausländische Investitionen ; Unternehmenseinkommensteuergesetz (Auszug)
Energy Technology Data Exchange (ETDEWEB)
Ballas, Ruediger G. [KARL MAYER Textilmaschinenfabrik GmbH, Obertshausen (Germany). Kompetenzbereich Piezoaktorik und Antriebstechnik; Pfeifer, Guenther [Technische Univ. Dresden (Germany). Inst. fuer Halbleiter- und Mikrosystemtechnik; Werthschuetzky, Roland [Technische Univ. Darmstadt (Germany). Inst. fuer Elektromechanische Konstruktionen
2009-07-01
Aktoren sowie von direkt gekoppelten Sensor-Aktor-Systemen. Der Anhang enthaelt anspruchsvollere Grundlagen zur Signalbeschreibung sowie eine Zusammenstellung wichtiger Materialdaten. (orig.)
A Living Landscape : Bronze Age settlement sites in the Dutch river area (c. 2000-800 BC)
Arnoldussen, Stijn
2008-01-01
"A Living Landscape. Bronze Age settlements in the Dutch river area (c. 2000-800 BC)" Academisch proefschrift over de aard en dynamiek van bronstijdnederzettingen in het rivierengebied. Het bevat een introductie op de geologische processen en de paleogeografie van de Nederlandse rivierdelta als
Novel brewing yeast hybrids: creation and application.
Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian
2017-01-01
The natural interspecies Saccharomyces cerevisiae × Saccharomyces eubayanus hybrid yeast is responsible for global lager beer production and is one of the most important industrial microorganisms. Its success in the lager brewing environment is due to a combination of traits not commonly found in pure yeast species, principally low-temperature tolerance, and maltotriose utilization. Parental transgression is typical of hybrid organisms and has been exploited previously for, e.g., the production of wine yeast with beneficial properties. The parental strain S. eubayanus has only been discovered recently and newly created lager yeast strains have not yet been applied industrially. A number of reports attest to the feasibility of this approach and artificially created hybrids are likely to have a significant impact on the future of lager brewing. De novo S. cerevisiae × S. eubayanus hybrids outperform their parent strains in a number of respects, including, but not restricted to, fermentation rate, sugar utilization, stress tolerance, and aroma formation. Hybrid genome function and stability, as well as different techniques for generating hybrids and their relative merits are discussed. Hybridization not only offers the possibility of generating novel non-GM brewing yeast strains with unique properties, but is expected to aid in unraveling the complex evolutionary history of industrial lager yeast.
Energy Technology Data Exchange (ETDEWEB)
Grandl, S.; Sztrokay-Gaul, A.; Auweter, S.D.; Hellerhoff, K. [Klinikum der Ludwig-Maximilians-Universitaet Muenchen, Campus Grosshadern, Institut fuer Klinische Radiologie, Muenchen (Germany)
2014-03-15
verbesserten Weichgewebekontrast fuer Gewebe mit geringen Absorptionsunterschieden wie die weibliche Brust. Die vorgestellten Studien deuten fuer verschiedene Techniken der Phasenkontrastbildgebung einen Zugewinn an diagnostischen Informationen sowohl im Rahmen der Phasenkontrastmammographie als auch der Phasenkontrast-CT an. Die vorliegende Arbeit gibt einen Ueberblick ueber die technischen Grundlagen der Phasenkontrastbildgebung und fasst die aktuelle Studienlage zur Ex-vivo- und In-vivo-Phasenkontrastbildgebung der weiblichen Brust zusammen. (orig.)
DEFF Research Database (Denmark)
Kirsch, Reinhard; Balling, N.; Fuchs, Sven
über die Eignung einer Lokation für die geothermische Nutzung. Sie ersetzen nicht die detaillierte geologisch/geophysikalische Untersuchung der Lokation, wie sie in den weiteren Planungsschritten erforderlich ist. Ein schneller Zugang zu den Projektergebnissen ist über die Homepage von GEUS (www...
Directory of Open Access Journals (Sweden)
Harisnal Hadi
2017-08-01
Full Text Available The preparation of the artwork entitled "Subhaa", is inspired by the Minangkabau cultural phenomenon. This work focuses on the feelings of children who will be circumcised, the pressure and fear felt by the child who will be circumcised tilled in the form of Polymetrik art works. Circumcision or commonly called Basunaik by Minangkabau society is a Sunna that must be run boys of Islam; indirectly circumcision is also required for boys in Minangkabau. In the area of darek (mainland khitan has its own ceremony, begins with a child who will be circumcised is brought to the bako house to change his clothes, then paraded around the village, after arriving at home circumcised will be held. In the evening there will be entertainment in the form of randai and bagurau saluang. This piece of music is in the form of a new composition. The performance focuses more on the composition of sound as a contextual meaning to be conveyed to the appreciator. This work is a little contrary to the aesthetics that have been awakened in the brain and soul of the arts in the Sendratasik Department of FBS Universitas Negeri Padang. But it cannot be denied that a new works will create its own aesthetic realm. Keywords: Basunaik, Artwork Music. Abstrak Penyusunan karya seni yang berjudul “Subhaa”, ini terinspirasi dari fenomena budaya Minangkabau. Karya ini menitik beratkan garapan pada perasaan anak yang akan dikhitan, tekanan dan ketakutan yang dirasakan oleh anak yang akan dikhitan digarap dalam bentuk penggarapan Polymetrik. Khitan atau biasa disebut Basunaik oleh masyarakat Minangkabau merupakan sunah yang harus dijalankan anak laki-laki Islam, secara tidak langsung khitan juga diwajibkan bagi anak laki-laki di Minangkabau. Di daerah darek (daratan khitan memiliki upacara tersendiri, diawali dengan anak yang akan dikhitan dibawa ke rumah bako untuk mengganti baju, lalu diarak keliling kampung, setelah sampai di rumah baru diadakan khitan, malamnya diadakan hiburan berupa randai dan bagurau saluang. Karya musik ini berbentuk komposisi garapan baru. Penggarapan lebih menitik beratkan kepada penggarapan bunyi sebagai makna kontekstual yang akan disampaikan kepada apresiator. Karya ini memang sedikit bertolak belakang dengan estetika yang sudah terbangun dalam otak dan jiwa kalangan seni di jurusan pendidikan sendratasik FBS Universitas Negeri Padang. Namun tidak bisa dipungkiri sebuah karya garapan baru akan menciptakan ranah estetikanya sendiri. Kata Kunci: Basunaik, Karya seni Musik.
DEFF Research Database (Denmark)
Mejlholm, Ole; Martens, M.
2006-01-01
In this study a sensory profiling and a consumer test including 10 commercially Danish beers were conducted. The 10 beer samples covered four types of beer namely; lager, strong lager, ale and wheat beer, representing both new and more established beers on the Danish market. A trained panel consi...
Gibson, Brian; Krogerus, Kristoffer; Ekberg, Jukka; Monroux, Adrien; Mattinen, Laura; Rautio, Jari; Vidgren, Virve
2015-01-01
A screen of 14 S. pastorianus lager-brewing strains showed as much as a nine-fold difference in wort total diacetyl concentration at equivalent stages of fermentation of 15°Plato brewer's wort. Two strains (A153 and W34), with relatively low and high diacetyl production, respectively, but which did not otherwise differ in fermentation performance, growth or flavour production, were selected for further investigation. Transcriptional analysis of key genes involved in valine biosynthesis showed differences between the two strains that were consistent with the differences in wort diacetyl concentration. In particular, the ILV6 gene, encoding a regulatory subunit of acetohydroxy acid synthase, showed early transcription (only 6 h after inoculation) and up to five-fold greater expression in W34 compared to A153. This earlier transcription was observed for both orthologues of ILV6 in the S. pastorianus hybrid (S. cerevisiae × S. eubayanus), although the S. cerevisiae form of ILV6 in W34 also showed a consistently higher transcript level throughout fermentation relative to the same gene in A153. Overexpression of either form of ILV6 (by placing it under the control of the PGK1 promoter) resulted in an identical two-fold increase in wort total diacetyl concentration relative to a control. The results confirm the role of the Ilv6 subunit in controlling α-acetolactate/diacetyl concentration and indicate no functional divergence between the two forms of Ilv6. The greater contribution of the S. cerevisiae ILV6 to acetolactate production in natural brewing yeast hybrids appears rather to be due to higher levels of transcription relative to the S. eubayanus form. Copyright © 2014 John Wiley & Sons, Ltd.
Energy Technology Data Exchange (ETDEWEB)
Sauer, R. [Klinik und Poliklinik fuer Strahlentherapie, Univ. Erlangen-Nuernberg, Erlangen (Germany)
2003-07-01
The toolbook is arranged in seven main parts. 1. General Part, with the chapters: - History of radiology and radiation therapy - Radiation therapy, radiotherapy, radiation oncology - Organisational aspects of radiation oncology in the hospital department and private practice - The MTRA in radiation therapy. 2. General Oncology, with the chapters: Tumor pathology - Epidemiology and aethiology - Tumor prophylaxis (prevention) - Fundamentals of tumor treatment - Tumor treatment strategies - Fundamentals of surgical tumor treatment - Fundamentals of internal medicine treatment of tumors. 3. Foundations of Radiation Therapy, with the chapters: - Radiation physics - Dose concepts and dose units - Radiobiology - Foundations of radiopathology - Special pathology - Instrumentation. 4. Radiation Treatment, with the chapters: Irradiation planning - Daily radiation treatment - Psychological patient management - Emergency management. 5. Special Oncology of Tumors, with 16 chapters discussing tumors of specific organs, and 2 chapters dealing with palliative radiation therapy and supportive treatment. 6. Radiation Therapy of Benign Neoplasms, with the chapters: Survey - Antiphlogistic radiation treatment - Radiation treatment for alleviation of irritations and pains induced by chronic inflammatory or degenerative processes - Radiation treatment of hypertropic lesions of the connective and supporting tissue, and benign tumors - Irradiation for immunosuppression - Castration by irradiation. 7. Radiation Protection. (orig./CB) [German] Das vorliegende Buch gliedert sich in die folgenden 7 Teile: 1. Allgemeiner Teil mit den Kapiteln Geschichte der Radiologie und Strahlentherapie, Strahlentherapie - Radiotherapie - Radioonkologie, Organisation der Radioonkologie in Krankenhaus und freier Praxis, und die MTAR in der Strahlentherapie; 2. allgemeine Onkologie (Tumorpathologie, Epidemiologie und Aetiologie, Tumorprophylaxe (Praevention), Grundlagen der Tumordiagnostik, Strategien der
Recovery from hospital-acquired anemia after acute myocardial infarction and effect on outcomes.
Salisbury, Adam C; Kosiborod, Mikhail; Amin, Amit P; Reid, Kimberly J; Alexander, Karen P; Spertus, John A; Masoudi, Frederick A
2011-10-01
New-onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. The patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center Translational Research Investigating Underlying disparities in acute myocardial infarction Patients' Health Status (TRIUMPH) registry, we identified 530 patients with AMI and HAA (defined as normal hemoglobin at admission with the development of anemia by discharge) who had a repeat, protocol-driven hemoglobin measurement at 1 month after discharge. The 1-month measures were used to define persistent (persistent anemia) and transient (anemia resolved) HAA. The patients' health status was assessed at 1, 6, and 12 months after AMI using the Short-Form 12 Physical Component Summary, and the health status of patients with persistent and transient HAA was compared using multivariate repeated measures regression analysis. Mortality was compared using the log-rank test and proportional hazards regression analysis. Overall, 165 patients (31%) developed persistent HAA. The adjusted mean Short-Form 12 Physical Component Summary scores at the follow-up visit were significantly lower in those with persistent HAA than in those with transient HAA (-2.0 points, 95% confidence interval -3.6 to -0.3; p = 0.02). During a median follow-up of 36 months, the crude mortality (13% vs 5%, p = 0.002) and multivariate-adjusted mortality (hazard ratio 2.08, 95% confidence interval 1.02 to 4.21, p = 0.04) was greater in patients with persistent HAA. In conclusion, HAA persists 1 month after discharge in nearly 1 of 3 patients and is associated with worse health status and greater mortality. Additional investigation is needed to understand whether HAA prevention, recognition, and treatment, particularly among those with persistent HAA, will improve outcomes. Copyright © 2011 Elsevier Inc. All rights reserved.
Neues über das Tertiär von Java und die mesozoischen Schichten von West-Borneo
Martin, K.
1888-01-01
Die Monographie, welche unter dem Titel Die Fossilien von Java herausgegeben wird ¹), ist so weit fortgeschritten, dass sich aus den in ihr beschriebenen Gastropoden bereits eine Anzahl von Schlussfolgerungen ableiten lässt, welche für die in Bearbeitung begriffene, geologische Karte von Java von
Energy Technology Data Exchange (ETDEWEB)
Madritsch, H.; Deplazes, G.
2014-12-15
This dossier is the second of a series of eight reports concerning the safety and technical aspects of locations for the disposal of radioactive wastes in Switzerland. It considers the sediments that can be used and discusses tectonic considerations. As an introduction, the geological framework is discussed with the various sediments from the Paleozoic, Mesozoic and Cenozoic periods. The various methods used to investigate the rock, such as drilling and reflection-seismic methods along with the investigation of surface formations are discussed. A detailed discussion of the stratigraphic and sedimentological characteristics of the various formations follows. Geological structures and the tectonics in the proposed areas are discussed, as are the depth and thickness of the structures.
Reducing and verifying haloacetic acids in treated drinking water using a biological filter system.
Lou, Jie C; Chan, Hung Y; Yang, Chih Y; Tseng, Wei B; Han, Jia Y
2014-01-01
This study focused on reducing the haloacetic acid (HAA) concentrations in treated drinking water. HAA has been thought to be one possible nutrient supporting heterotrophic bacteria regrowth in drinking water. In this study, experiments were conducted using a pilot-scale system to evaluate the efficiency of biological filters (BF) for reducing excess HAA concentrations in water. The BF system reduced the total HAA concentration and the concentrations of five HAA species in the water. Dichloroacetic acid (DCAA), monobromoacetic acid (MBAA) and dibromoacetic acid (DBAA) were the three main HAA5 species that were present in the treated drinking water in this investigation. Combined, these three species represent approximately 77% of the HAA5 in the finished water after BF. The verification of the empirical HAA equation for the outlet in the BF system indicated linear relationships with high correlation coefficients. The empirical equation for the HAA5 concentrations in the finished water was established by examining other nutrients (e.g., dissolved organic carbon (DOC), ultraviolet absorbance at 254 nm wavelength (UV254), and ammonia nitrogen) that can reduce pathogenic contamination. These findings may be useful for designing advanced processes for conventional water treatment plants or for managing water treatment and distribution systems for providing high-quality drinking water.
Energy Technology Data Exchange (ETDEWEB)
Brugge, J.V.M.; Vrouwe, B.J. [T and A Survey, Amsterdam (Netherlands)
2011-01-15
The Dutch government aims to store nuclear waste in the Dutch soil. Geological research organization T and A Survey mapped the areas that match with the demands of the Dutch government regarding underground storage of nuclear waste. These are areas in which the Clay layer of Boom has a minimal thickness of 100 meters and the depth of the top of the clay formation is at least 500 meters. This report contains the appendices with (geological) maps and data. [Dutch] De Nederlandse overheid wil kernafval ondergronds opslaan in de Nederlandse bodem. Geologisch onderzoeksbureau T and A Survey brengt de gebieden in kaart, die voldoen aan de door de overheid gestelde eisen voor mogelijke ondergrondse opslag van kernafval. Het gaat om gebieden waar de Boomse kleilaag een minimale dikte van 100 meter heeft en de diepte van de top van de kleiformatie minimaal 500 meter bedraagt. Dit rapport bevat de bijlagen met (geologische) kaarten en gegevens.
Energy Technology Data Exchange (ETDEWEB)
Kawamata, Shuichi, E-mail: s-kawamata@riast.osakafu-u.ac.jp; Kawamura, Yuichi [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan); Research Organization for University-Community Collaborations, Osaka Prefecture University, Sakai 599-8570 (Japan); Hibino, Akira; Tanaka, Sho [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan)
2016-10-14
In order to develop optical devices for 2–3 μm wavelength regions, the InP-based InGaAs/GaAsSb type II multiple quantum well system has been investigated. By doping nitrogen into InGaAs layers, the system becomes effective in creating the optical devices with a longer wavelength. In this report, electrical transport properties are reported on the InGaAsN/GaAsSb type II system. The epitaxial layers with the single hetero or multiple quantum well structure on InP substrates are grown by the molecular beam epitaxy. The electrical resistance of samples with different nitrogen concentrations has been measured as a function of the magnetic field up to 9 Tesla at several temperatures between 2 and 6 K. The oscillation of the resistance due to the Shubnikov-de Haas (SdH) effect has been observed at each temperature. The effective mass is obtained from the temperature dependence of the amplitude of the SdH oscillations. The value of the effective mass increases from 0.048 for N = 0.0% to 0.062 for N = 1.2 and 1.5% as the nitrogen concentration increases. The mass enhancement occurs with corresponding to the reduction of the bandgap energy. These results are consistent with the band anticrossing model.
Directory of Open Access Journals (Sweden)
Thomas Duve
2012-01-01
In den letzten Jahren sind im Zuge der Diskussion um postkoloniale Perspektiven auf die Geschichte, um Transnationale und Globalgeschichte, viele Grundlagen der traditionellen Europahistoriographie kritisiert und massiv erschüttert worden. Das wirft Fragen auch an die Europäische Rechtsgeschichte auf: Welches Europabild liegt ihr zu Grunde? Auf welchen intellektuellen und konzeptionellen Grundlagen beruht sie? Wie antwortet sie auf die Vorwürfe des Eurozentrismus, des epistemischen Kolonialismus, wie auf die Forderung, Europa zu ›provinzialisieren‹? Wie definiert sie das Verhältnis der Europäischen zur Transnationalen und Globalen Rechtsgeschichte? – Diesen und ähnlichen Fragen wenden sich die folgenden Überlegungen zu. Der Schwerpunkt liegt auf einer Auseinandersetzung mit der Tradition, ihren konzeptionellen Grundlagen und deren wissenschaftshistorischem Kontext (1. Teil, 1.–6.. Aus dieser kritischen Bestandsaufnahme und den Ergebnissen der Debatte um Globalgeschichte ergeben sich Ausgangspunkte und Aufgaben einer in Vielem auf den Leistungen der Disziplin aufbauenden, doch notwendigerweise auf einer anderen Konzeption beruhenden Rechtsgeschichte Europas in globalhistorischer Perspektive (2. Teil, 7.–11..
Note on de Haas-van Alphen diamagnetism in thin, free-electron films
Directory of Open Access Journals (Sweden)
J. A. Grzesik
2012-03-01
Full Text Available We revisit the problem of de Haas-van Alphen (dHvA diamagnetic susceptibility oscillations in a thin, free-electron film trapped in a synthetic harmonic potential well. A treatment of this phenomenon at zero temperature was announced many years ago by Childers and Pincus (designated hereafter as CP, and we traverse initially much the same ground, but from a slightly different analytic perspective. That difference hinges around our use, in calculating the Helmholtz free energy F, of an inverse Laplace transform, Bromwich-type contour integral representation for the sharp distribution cutoff at Fermi level μ. The contour integral permits closed-form summation all at once over the discrete orbital Landau energy levels transverse to the magnetic field, and the energy associated with the in-plane canonical momenta ℏ k x and ℏ k z. Following such summation/integration, pole/residue pairs appear in the plane of complex transform variable s, a fourth-order pole at origin s = 0, and an infinite ladder, both up and down, of simple poles along the imaginary axis. The residue sum from the infinite pole ladder automatically engenders a Fourier series with period one in dimensionless variable μ/ ℏ ω (with effective angular frequency ω suitably defined, series which admits closed-form summation as a cubic polynomial within any given periodicity slot. Such periodicity corresponds to Landau levels slipping sequentially beneath Fermi level μ as the ambient magnetic field H declines in strength, and is manifested by the dHvA pulsations in diamagnetic susceptibility. The coëxisting steady contribution from the pole at origin has a similar cubic structure but is opposite in sign, inducing a competition whose outcome is a net magnetization that is merely quadratic in any given periodicity slot, modulated by a slow amplitude growth. Apart from some minor notes of passing discord, these simple algebraic structures confirm most of the CP formulae, and their
History of geological mapping of the Holocene Rhine-Meuse delta, the Netherlands
Berendsen, H.J.A.
2007-01-01
A brief overview is given of the history of geological mapping of the Holocene Rhine-Meuse delta. The first accurate map of the delta, based on field observations, was made by Vink (1926). The geological map of the Netherlands, scale 1 : 50,000, made by the ‘Geologische Stichting’ (1927 - 1938)
Buffon (1707-1788) als geologischer Pionier
Seibold, Eugen; Seibold, Ilse
2009-12-01
During the eighteenth century Paris was the center of Enlightenment. By the scientific revolution at the end of the Middle Ages man lost his central position for the intellectual thoughts. Nature became increasingly the focus of research. In addition to the descriptive inventory physical-technological thinking based on mathematics also progressed. In this transition period was Georges-Louis Leclerc, comte de Buffon a typical representative (1707-1788) (Fig. 1). He was both a man of letters, a philosopher and also familiar with the mathematics, biology and geology of his time. Besides, he became also an entrepreneur. Though geology occupies a much less important place than biology in his publications, he became a pioneer in this field. He arranged the former purely descriptive Histoire naturelle in seven Periods, with a directional evolution of the earth: cooling from a molten mass to a future earth covered completely with ice. Amidst this evolution the sea had covered our globe completely. Then the sea level sunk continuously. The propagation of these two directional trends was pioneer work. Nevertheless he allowed also some transgressions. To better understand the sea bottom of former times he stressed on the importance of observations of present processes in the sea and on land. He is therefore also a pioneer of actualism, and thus must be discussed together with Füchsel and Werner, as well as with Hutton and Lyell, the former as classical representatives of a primarily historical geology, the two others as pioneers of physical geology asking for processes and their causes. Finally he tried to solve the question of the exact age of our earth experimentally. In his iron works (Fig. 2) he observed the cooling of cast iron globes with different diameters (Fig. 3). From the results he published an age of some 75,000 years, a pioneer approach and statement too. Privately he discussed even millions of years. Of course many of his ideas sharply contradicted a verbal interpretation of biblical texts. Therefore, he had repeated conflicts with the Theological Faculty of the Sorbonne.[Figure not available: see fulltext.][Figure not available: see fulltext.][Figure not available: see fulltext.
Voskobojnikov, I B; Samarin, N A; Cluchanko, N E; Lyubovskaya, R N; Moshchalkov, V V
2002-01-01
Within 0.33-1.44 K temperature range at B <= 50 T magnetic field values one measured the De Haas-Van Alphen effect for (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic quasi-two-dimensional conductor. Analysis of quantum oscillations with regard to data on cyclotron resonance derived for 40-120 GHz frequency interval enabled to determine that a complex spectrum of quantum oscillations was formed by alpha approx 256 T and beta approx 670-610 T fundamental frequencies as well as, by combination and multiple frequencies. It is shown that nature of temperature rearrangement of oscillation spectrum may be interpreted in terms of model taking account of occurrence of magnetic phase transition at T sub c approx 0.9 K and proximity of a fundamental frequency with m* = 1.48m sub 0 efficient mass to the spin dumping condition
Effect of increasing growth temperature on yeast fermentation ...
African Journals Online (AJOL)
The effect of increasing growth temperature on yeast fermentation was studied at approximately 5 oC intervals over a range of 18 – 37 oC, using one strain each of ale, lager and wine yeast. The ale and wine yeasts grew at all the temperatures tested, but lager yeast failed to grow at 37 oC. All these strains gave lower ...
Branding and Performance in the Global Beer Market
DEFF Research Database (Denmark)
Madsen, Erik Strøjer
The mass market for beers is served by a few global breweries in an oligopoly structure covering most of the world market. The homogeneity of their main lager beers are very high and produced at large scaled plants at low costs. However, the breweries spend large amounts of money to promote some...... of the lager beers as premium beers and at a high and increasing price premium. Based on a database with prices for standard and premium lager, the paper study the development in the consumption of different types of beers on the global market in recent years. We estimate the price premium on premium beers...... and relate it to the rapid change in the oligopoly structure of the market through the merger and acquisition activities....
Zhang, Huijuan; Zhu, Jiping; Aranda-Rodriguez, Rocio; Feng, Yong-Lai
2011-11-07
Haloacetic acids (HAAs) are by-products of the chlorination of drinking water containing natural organic matter and bromide. A simple and sensitive method has been developed for determination of ten HAAs in drinking water. The pressure-assisted electrokinetic injection (PAEKI), an on-line enrichment technique, was employed to introduce the sample into a capillary electrophoresis (CE)-electrospray ionization-tandem mass spectrometry system (ESI-MS/MS). HAAs were monitored in selected reaction monitoring mode. With 3 min of PAEKI time, the ten major HAAs (HAA10) in drinking water were enriched up to 20,000-fold into the capillary without compromising resolution. A simple solid phase clean-up method has been developed to eliminate the influence of ionic matrices from drinking water on PAEKI. Under conditions optimized for mass spectrometry, PAEKI and capillary electrophoresis, detection limits defined as three times ratio of signal to noise have been achieved in a range of 0.013-0.12 μg L(-1) for ten HAAs in water sample. The overall recoveries for all ten HAAs in drinking water samples were between 76 and 125%. Six HAAs including monochloro- (MCAA), dichloro- (DCAA), trichloro- (TCAA), monobromo- (MBAA), bromochloro- (BCAA), and bromodichloroacetic acids (BDCAA) were found in tap water samples collected. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Huu-Vang Nguyen
Full Text Available Saccharomyces bayanus is a yeast species described as one of the two parents of the hybrid brewing yeast S. pastorianus. Strains CBS380(T and NBRC1948 have been retained successively as pure-line representatives of S. bayanus. In the present study, sequence analyses confirmed and upgraded our previous finding: S. bayanus type strain CBS380(T harbours a mosaic genome. The genome of strain NBRC1948 was also revealed to be mosaic. Both genomes were characterized by amplification and sequencing of different markers, including genes involved in maltotriose utilization or genes detected by array-CGH mapping. Sequence comparisons with public Saccharomyces spp. nucleotide sequences revealed that the CBS380(T and NBRC1948 genomes are composed of: a predominant non-cerevisiae genetic background belonging to S. uvarum, a second unidentified species provisionally named S. lagerae, and several introgressed S. cerevisiae fragments. The largest cerevisiae-introgressed DNA common to both genomes totals 70kb in length and is distributed in three contigs, cA, cB and cC. These vary in terms of length and presence of MAL31 or MTY1 (maltotriose-transporter gene. In NBRC1948, two additional cerevisiae-contigs, cD and cE, totaling 12kb in length, as well as several smaller cerevisiae fragments were identified. All of these contigs were partially detected in the genomes of S. pastorianus lager strains CBS1503 (S. monacensis and CBS1513 (S. carlsbergensis explaining the noticeable common ability of S. bayanus and S. pastorianus to metabolize maltotriose. NBRC1948 was shown to be inter-fertile with S. uvarum CBS7001. The cross involving these two strains produced F1 segregants resembling the strains CBS380(T or NRRLY-1551. This demonstrates that these S. bayanus strains were the offspring of a cross between S. uvarum and a strain similar to NBRC1948. Phylogenies established with selected cerevisiae and non-cerevisiae genes allowed us to decipher the complex hybridisation
Human Factors Interface with Systems Engineering for NASA Human Spaceflights
Wong, Douglas T.
2009-01-01
This paper summarizes the past and present successes of the Habitability and Human Factors Branch (HHFB) at NASA Johnson Space Center s Space Life Sciences Directorate (SLSD) in including the Human-As-A-System (HAAS) model in many NASA programs and what steps to be taken to integrate the Human-Centered Design Philosophy (HCDP) into NASA s Systems Engineering (SE) process. The HAAS model stresses systems are ultimately designed for the humans; the humans should therefore be considered as a system within the systems. Therefore, the model places strong emphasis on human factors engineering. Since 1987, the HHFB has been engaging with many major NASA programs with much success. The HHFB helped create the NASA Standard 3000 (a human factors engineering practice guide) and the Human Systems Integration Requirements document. These efforts resulted in the HAAS model being included in many NASA programs. As an example, the HAAS model has been successfully introduced into the programmatic and systems engineering structures of the International Space Station Program (ISSP). Success in the ISSP caused other NASA programs to recognize the importance of the HAAS concept. Also due to this success, the HHFB helped update NASA s Systems Engineering Handbook in December 2007 to include HAAS as a recommended practice. Nonetheless, the HAAS model has yet to become an integral part of the NASA SE process. Besides continuing in integrating HAAS into current and future NASA programs, the HHFB will investigate incorporating the Human-Centered Design Philosophy (HCDP) into the NASA SE Handbook. The HCDP goes further than the HAAS model by emphasizing a holistic and iterative human-centered systems design concept.
Haloacetic acids in the aquatic environment. Part I: macrophyte toxicity
International Nuclear Information System (INIS)
Hanson, Mark L.; Solomon, Keith R.
2004-01-01
Haloacetic acids (HAAs) are contaminants of aquatic ecosystems with numerous sources, both anthropogenic and natural. The toxicity of HAAs to aquatic plants is generally uncharacterized. Laboratory tests were conducted with three macrophytes (Lemna gibba, Myriophyllum sibiricum and Myriophyllum spicatum) to assess the toxicity of five HAAs. Myriophyllum spp. has been proposed as required test species for pesticide registration in North America, but few studies have been conducted under standard test conditions. The HAAs in the present experiments were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). MCA was the most toxic to Myriophyllum spp. with EC 50 values ranging from 8 to 12.4 mg/l depending on the endpoint, followed by DCA (EC 50 range 62-722.5 mg/l), TCA (EC 50 range 49.5-1702.6 mg/l), CDFA (EC 50 range 105.3 to >10,000 mg/l) and with TFA (EC 50 range 222.1 to 10,000 mg/l) the least toxic. Generally, L. gibba was less sensitive to HAA toxicity than Myriophyllum spp., with the difference in toxicity between them approximately threefold. The range of toxicity within Myriophyllum spp. was normally less than twofold. Statistically, plant length and node number were the most sensitive endpoints as they had the lowest observed coefficients of variation, but they were not the most sensitive to HAA toxicity. Toxicological sensitivity of endpoints varied depending on the measure of effect chosen and the HAA, with morphological endpoints usually an order of magnitude more sensitive than pigments for all plant species. Overall, mass and root measures tended to be the most sensitive indicators of HAA toxicity. The data from this paper were subsequently used in an ecological risk assessment for HAAs and aquatic plants. The assessment found HAAs to be of low risk to aquatic macrophytes and the results are described in the second manuscript of this series
Haas, Annika
2007-01-01
Turundusagentuur PNG (loovjuhiks Jüri Peetson) ühendas tänuõhtu oma klientidele ja koostööpartneritele hispaania laulja Enrique Iglesiase esinemisega 1. dets. Tallinnas Saku Suurhalli restoranis Platoo
Haas, Annika
2008-01-01
Eesti Kunstimuuseumi Kunstisõprade Seltsi eestvõttel tähistati 4. novembril 2008 Kumule Euroopa aasta muuseumi tiitli andmist. Ühel juuresolevatest fotodest president Toomas Hendrik Ilves koos Kumu kunstimuuseumi direktrissi Sirje Helme ja Eesti Kunstimuuseumi Kunstisõprade Seltsi juhatuse esimehe Enn Kunilaga
Haas, Annika
2007-01-01
21. veebruaril 2007 tähistas Tiigrihüppe SA Tallinnas Olümpia hotelli konverentsikeskuses konverentsiga "Kogu tõde Tiigrihüppest" Tiigrihüppe programmi 10. aastapäeva. Kohal viibis ka programmi üks algatajaid Toomas Hendrik Ilves
Haas, Annika
2009-01-01
Eesti Posti peakontori hoovis esitleti Indrek Kaingi kujundatud rahvusmustriga tenniseid. Esimesed eksklusiivsed kaks paari MULK-kirjaga papusid kingiti president Toomas Hendrik Ilvesele ning ettevõtte Skype presidendile Josh Silvermanile
Haas, Annika
2006-01-01
Tallinna Ülikoolis toimunud ameerika kultuurantropoloogi Clifford Geertzi mälestusõhtust, kus esinesid rektor Rein Raud, Eesti Humanitaarinstituudi dotsent Lorenzo Cañás Bottos ja kultuuriteooria lektor Marek Tamm
Haas, Annika
2008-01-01
8. aug. Tallinnas kinos Sõprus ja klubis Juuksur tähistati 30 aasta möödumist ansambli Joy Divison sünnist ja Anton Corbijni debüütfilmi "Control" jõudmist Eesti kinodesse (näidati dokumentaalfilmi "Joy Divison")
Haas, Annika
2006-01-01
Inglise rocklaulja Gordon Matthew Sumneri raamatu "Sting. Murtud muusika" esitlusest Tallinnas Viru Keskuse Rahva Raamatu kaupluses ja kontserdist Saku Suurhallis Broken Musicu nimelise tuuri raames 28. juulil
2011-01-01
Aromatic amines and heterocyclic aromatic amines (HAAs) are structurally related classes of carcinogens that are formed during the combustion of tobacco or during the high-temperature cooking of meats. Both classes of procarcinogens undergo metabolic activation by N-hydroxylation of the exocyclic amine group, to produce a common proposed intermediate, the arylnitrenium ion, which is the critical metabolite implicated in toxicity and DNA damage. However, the biochemistry and chemical properties of these compounds are distinct and different biomarkers of aromatic amines and HAAs have been developed for human biomonitoring studies. Hemoglobin adducts have been extensively used as biomarkers to monitor occupational and environmental exposures to a number of aromatic amines; however, HAAs do not form hemoglobin adducts at appreciable levels and other biomarkers have been sought. A number of epidemiologic studies that have investigated dietary consumption of well-done meat in relation to various tumor sites reported a positive association between cancer risk and well-done meat consumption, although some studies have shown no associations between well-done meat and cancer risk. A major limiting factor in most epidemiological studies is the uncertainty in quantitative estimates of chronic exposure to HAAs and, thus, the association of HAAs formed in cooked meat and cancer risk has been difficult to establish. There is a critical need to establish long-term biomarkers of HAAs that can be implemented in molecular epidemioIogy studies. In this review article, we highlight and contrast the biochemistry of several prototypical carcinogenic aromatic amines and HAAs to which humans are chronically exposed. The biochemical properties and the impact of polymorphisms of the major xenobiotic-metabolizing enzymes on the biological effects of these chemicals are examined. Lastly, the analytical approaches that have been successfully employed to biomonitor aromatic amines and HAAs, and
Xue, Runmiao; Shi, Honglan; Ma, Yinfa; Yang, John; Hua, Bin; Inniss, Enos C; Adams, Craig D; Eichholz, Todd
2017-12-01
Free chlorine is a commonly used disinfectant in drinking water treatment. However, disinfection by-products (DBPs) are formed during water disinfection. Haloacetic acids (HAAs) and trihalomethanes (THMs) are two major groups of DBPs. Iodo-HAAs and iodo-THMs (I-HAAs and I-THMs) are formed during the disinfection of the water containing high levels of iodide and are much more toxic than their chlorinated and brominated analogs. Peracetic acid (PAA) is a strong antimicrobial disinfectant that is expected to reduce the formation of HAAs and THMs during disinfection. In this study, the formations of thirteen HAAs and ten THMs, including the iodinated forms, have been investigated during PAA disinfection and chlorination as the comparison. The DBP formations under different iodide concentrations, pHs, and contact times were systematically investigated. Two types of commercial PAAs containing different concentrations of PAA and hydrogen peroxide (H 2 O 2 ) were studied. A solid-phase microextraction gas chromatography-mass spectrometry method was upgraded for THM analysis including I-THMs. HAAs were analyzed by following a recently developed high performance ion chromatography-tandem mass spectrometry method. Results show that the ratio of PAA and H 2 O 2 concentration significantly affect the formation of I-THMs and I-HAAs. During PAA disinfection with lower PAA than H 2 O 2 , no detectable levels of THMs and HAAs were observed. During PAA disinfection with higher PAA than H 2 O 2 , low levels of monoiodoacetic acid, diiodoacetic acid, and iodoform were formed, and these levels were enhanced with the increase of iodide concentration. No significant quantities of chloro- or bromo-THMs and HAAs were formed during PAA disinfection treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.
From Bad to Worse: Anemia on Admission and Hospital-Acquired Anemia.
Koch, Colleen G; Li, Liang; Sun, Zhiyuan; Hixson, Eric D; Tang, Anne S; Phillips, Shannon C; Blackstone, Eugene H; Henderson, J Michael
2017-12-01
Anemia at hospitalization is often treated as an accompaniment to an underlying illness, without active investigation, despite its association with morbidity. Development of hospital-acquired anemia (HAA) has also been associated with increased risk for poor outcomes. Together, they may further heighten morbidity risk from bad to worse. The aims of this study were to (1) examine mortality, length of stay, and total charges in patients with present-on-admission (POA) anemia and (2) determine whether these are exacerbated by development of HAA. In this cohort investigation, from January 1, 2009, to August 31, 2011, a total of 44,483 patients with POA anemia were admitted to a single health system compared with a reference group of 48,640 without POA anemia or HAA. Data sources included the University HealthSystem Consortium database and electronic medical records. Risk-adjustment methods included logistic and linear regression models for mortality, length of stay, and total charges. Present-on-admission anemia was defined by administrative coding. Hospital-acquired anemia was determined by changes in hemoglobin values from the electronic medical record. Approximately one-half of the patients experienced worsening of anemia with development of HAA. Risk for death and resource use increased with increasing severity of HAA. Those who developed severe HAA had 2-fold greater odds for death; that is, mild POA anemia with development of severe HAA resulted in greater mortality (odds ratio, 2.57; 95% confidence interval, 2.08-3.18; P < 0.001), increased length of stay (2.23; 2.16-2.31; P < 0.001), and higher charges (2.09; 2.03-2.15; P < 0.001). Present-on-admission anemia is associated with increased mortality and resource use. This risk is further increased from bad to worse when patients develop HAA. Efforts to address POA anemia and HAA deserve attention.
A New Approach to Eliminate High Amplitude Artifacts in EEG Signals
Directory of Open Access Journals (Sweden)
Ana Rita Teixeira
2016-09-01
Full Text Available High amplitude artifacts represent a problem during EEG recordings in neuroscience research. Taking this into account, this paper proposes a method to identify high amplitude artifacts with no requirement for visual inspection, electrooscillogram (EOG reference channel or user assigned parameters. A potential solution to the high amplitude artifacts (HAA elimination is presented based on blind source separation methods. The assumption underlying the selection of components is that HAA are independent of the EEG signal and different HAA can be generated during the EEG recordings. Therefore, the number of components related to HAA is variable and depends on the processed signal, which means that the method is adaptable to the input signal. The results show, when removing the HAA artifacts, the delta band is distorted but all the other frequency bands are preserved. A case study with EEG signals recorded while participants performed on the Halstead Category Test (HCT is presented. After HAA removal, data analysis revealed, as expected, an error-related frontal ERP wave: the feedback-related negativity (FRN in response to feedback stimuli.
Rapid screening of aflatoxin B1 in beer by fluorescence polarization immunoassay.
Beloglazova, N V; Eremin, S A
2015-09-01
This manuscript describes the development of a sensitive, fast and easily-performed fluorescence polarization immunoassay (FPIA) for the mycotoxin aflatoxin B1 (AFB1) in various beer samples, both lager and dark. The highest sensitivity was determined for six poly- and monoclonal antibodies selective towards aflatoxins. The sample pretreatment design was emphasized since beer samples are characterized by extremely diverse matrices. Herein, the choice of sorbent for effective removal of matrix interferences prior to analysis was crucial. The samples were diluted with a borate buffer solution containing 1% PEG 6000 and passed through the clean-up column packed with NH2-derivated silica. This sample pretreatment technique was perfectly suitable for the FPIA of lager beer samples, but for dark beer and ale it did not suffice. An artificial matrix was constructed to plot a calibration curve and quantify the results of the latter samples. The developed immunoassay was characterized by a limit of detection of 1 ng mL(-1). Apparent recovery values of 89-114% for lager and 80-125% for dark beer were established. The FPIA data for AFB1 was characterized by elevated linear regression coefficients, 0.9953 for spiked lager and 0.9895 for dark beer samples respectively. Copyright © 2015 Elsevier B.V. All rights reserved.
Anodic dissolution of samarium in acetonitrile solution of acetylacetone
International Nuclear Information System (INIS)
Kostyuk, N.N.; Dik, T.A.; Trebnikov, A.G.; Shirokij, V.L.
2003-01-01
Electrochemical dissolution of metal samarium in acetonitrile medium in the presence of 0.1 M tetraethylammoniumbromide and 0.9 M acetylacetone (HAA) in argon atmosphere under a voltage of 3 V was considered for studying feasibility of electrochemical synthesis of samarium β-diketonates. Using IR and mass spectrometry, thermal and elementary analyses it was ascertained that, depending on cathode and anode areas ratio, anodic dissolution of samarium can give rise to formation of complexes of bi- and trivalent samarium featuring the composition Sm 4 (AA) 8 · 3HAA, Sm(AA) 3 · HAA and Sm(AA) 3 · 4HAA [ru
Dad, Azra; Jeong, Clara H; Pals, Justin A; Wagner, Elizabeth D; Plewa, Michael J
2013-10-01
Monohaloacetic acids (monoHAAs) are a major class of drinking water disinfection by-products (DBPs) and are cytotoxic, genotoxic, mutagenic, and teratogenic. We propose a model of toxic action based on monoHAA-mediated inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a target cytosolic enzyme. This model predicts that GAPDH inhibition by the monoHAAs will lead to a severe reduction of cellular ATP levels and repress the generation of pyruvate. A loss of pyruvate will lead to mitochondrial stress and genomic DNA damage. We found a concentration-dependent reduction of ATP in Chinese hamster ovary cells after monoHAA treatment. ATP reduction per pmol monoHAA followed the pattern of iodoacetic acid (IAA) > bromoacetic acid (BAA) > chloroacetic acid (CAA), which is the pattern of potency observed with many toxicological endpoints. Exogenous supplementation with pyruvate enhanced ATP levels and attenuated monoHAA-induced genomic DNA damage as measured with single cell gel electrophoresis. These data were highly correlated with the SN 2 alkylating potentials of the monoHAAs and with the induction of toxicity. The results from this study strongly support the hypothesis that GAPDH inhibition and the possible subsequent generation of reactive oxygen species is linked with the cytotoxicity, genotoxicity, teratogenicity, and neurotoxicity of these DBPs. Copyright © 2013 Wiley Periodicals, Inc.
Avoiding pitfalls in the determination of halocarboxylic acids: the photochemistry of methylation.
Rubio, F J; Urbansky, E T; Magnuson, M L
2000-06-01
Haloethanoic (haloacetic) acids are formed during chlorination of drinking water and are regulated by the Environmental Protection Agency (EPA). These compounds are normally quantified by gas chromatography with electron capture detection (GC-ECD) as the methyl esters. EPA Method 552 uses diazomethane (CH2N2) for this purpose, but has only been validated by EPA for HAA6: chloro-, dichloro-, bromo-, dibromo-, bromochloro- and trichloroacetic acids. EPA Method 552.2 was developed and validated for all nine analytes (HAA9 = HAA6 + dibromochloro-, bromodichloro- and tribromoethanoic acids). Since the promulgation of Method 552.2, which uses acidic methanol, a debate has ensued over discrepancies observed by various laboratories when using diazomethane instead. In an effort to identify and eliminate potential sources for these discrepancies, a comparative study was undertaken for HAA9. Better accuracy and precision were observed for all HAA9 species by Method 552.2; recoveries were satisfactory in de-ionized and tap water. Method 552 remains satisfactory for HAA6. Systematic differences in instrumental response are observed for the two methods, but these are precise and may be accounted for using similarly treated standards and analyte-fortified (spiked) samples. That notwithstanding, Method 552 (CH2N2) was shown to be unsuitable for dibromochloro-, bromodichloro- and tribromoethanoic acids (HAA9-6). The primary problem appears to be a photoactivated reaction between diazomethane and the HAA9-6 analytes; however, side reactions were found to occur even in the dark. Analyte loss is most pronounced under typical laboratory lighting (white F40 fluorescent lamps + sunlight), but it is also observed under Philips gold F40 lamps (lambda > or = 520 nm), and in the dark.
De polders van Nederland: een geologisch succesverhaal?
Cohen, K.M.
Overal in Nederland is de gesteldheid van de ondergrond het gevolg van landschapsvorming door de natuur, en van bedoelde en onbedoelde acties door de mens. Dat is nog eens extra waar in de poldergebieden van de kustvlakte en het rivierengebied. Al in de Romeinse tijd lagen daar lokaal de nodige
Energy Technology Data Exchange (ETDEWEB)
Gautschi, A.; Deplazes, G.; Traber, D.; Marschall, P. [National Cooperative for the Disposal of Radioactive Waste (NAGRA), Wettingen (Switzerland); Mazurek, M.; Gimmi, T.; Maeder, U. [Institute of Geological Sciences, University of Berne, Berne (Switzerland)
2014-12-15
This dossier is the sixth of a series of eight reports concerning the safety and technical aspects of locations for the disposal of radioactive wastes in Switzerland. It discusses the barrier properties of the proposed host rock sediments and neighbouring rock layers. The mineralogical composition of the host rocks are discussed as are their pore densities and hydrological properties. Diffusion aspects are discussed. The aquifer systems in the proposed depository areas and their classification are looked at. The barrier properties of the host rocks and those of neighbouring sediments are discussed. Finally, modelling concepts and parameters for the transport of radionuclides in the rocks are discussed.
Directory of Open Access Journals (Sweden)
Lijun Yang
Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.
Babushok, Daria V.; Grignon, Anne‐Laure; Li, Yimei; Atienza, Jamie; Xie, Hongbo M.; Lam, Ho‐Sun; Hartung, Helge; Bessler, Monica
2016-01-01
Hepatitis‐associated aplastic anemia (HAA) is a variant of acquired aplastic anemia (AA) in which immune‐mediated bone marrow failure (BMF) develops following an acute episode of seronegative hepatitis. Dyskeratosis congenita (DC) is an inherited BMF syndrome characterized by the presence of short telomeres, mucocutaneous abnormalities, and cancer predisposition. While both conditions may cause BMF and hepatic impairment, therapeutic approaches are distinct, making it imperative to establish the correct diagnosis. In clinical practice, lymphocyte telomere lengths (TL) are used as a first‐line screen to rule out inherited telomeropathies before initiating treatment for AA. To evaluate the reliability of TL in the HAA population, we performed a retrospective analysis of TL in 10 consecutively enrolled HAA patients compared to 19 patients with idiopathic AA (IAA). HAA patients had significantly shorter telomeres than IAA patients (P = 0.009), including four patients with TL at or below the 1st percentile for age‐matched controls. HAA patients had no clinical features of DC and did not carry disease‐causing mutations in known genes associated with inherited telomere disorders. Instead, short TLs were significantly correlated with severe lymphopenia and skewed lymphocyte subsets, features characteristic of HAA. Our results indicate the importance of caution in the interpretation of TL measurements in HAA, because, in this patient population, short telomeres have limited specificity. Am. J. Hematol. 91:243–247, 2016. © 2015 The Authors. American Journal of Hematology Published by Wiley Periodicals, Inc. PMID:26615915
Effect of drinking water disinfection by-products in human peripheral blood lymphocytes and sperm.
Ali, Aftab; Kurzawa-Zegota, Malgorzata; Najafzadeh, Mojgan; Gopalan, Rajendran C; Plewa, Michael J; Anderson, Diana
2014-12-01
Drinking water disinfection by-products (DBPs) are generated by the chemical disinfection of water and may pose hazards to public health. Two major classes of DBPs are found in finished drinking water: haloacetic acids (HAAs) and trihalomethanes (THMs). HAAs are formed following disinfection with chlorine, which reacts with iodide and bromide in the water. Previously the HAAs were shown to be cytotoxic, genotoxic, mutagenic, teratogenic and carcinogenic. To determine the effect of HAAs in human somatic and germ cells and whether oxidative stress is involved in genotoxic action. In the present study both somatic and germ cells have been examined as peripheral blood lymphocytes and sperm. The effects of three HAA compounds: iodoacetic acid (IAA), bromoacetic acid (BAA) and chloroacetic acid (CAA) were investigated. After determining appropriate concentration responses, oxygen radical involvement with the antioxidants, butylated hydroxanisole (BHA) and the enzyme catalase, were investigated in the single cell gel electrophoresis (Comet) assay under alkaline conditions, >pH 13 and the micronucleus assay. In the Comet assay, BHA and catalase were able to reduce DNA damage in each cell type compared to HAA alone. In the micronucleus assay, micronuclei (MNi) were found in peripheral lymphocytes exposed to all three HAAs and catalase and BHA were in general, able to reduce MNi induction, suggesting oxygen radicals play a role in both assays. These observations are of concern to public health since both human somatic and germ cells show similar genotoxic responses. Copyright © 2014. Published by Elsevier B.V.
Recovery from Hospital-Acquired Anemia after Acute Myocardial Infarction and Effect on Outcomes
Salisbury, Adam C.; Kosiborod, Mikhail; Amin, Amit P.; Reid, Kimberly J.; Alexander, Karen P.; Spertus, John A.; Masoudi, Frederick A.
2011-01-01
New onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. Patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center TRIUMPH registry, we identified 530 AMI patients with HAA (defined as normal hemoglobin at admission with development of anemia by discharge) who had repeat, protocol-driven hemoglobin measurement 1 month after discharge. The 1-m...
Liao, G Z; Wang, G Y; Xu, X L; Zhou, G H
2010-05-01
Heterocyclic aromatic amines (HAAs), potent mutagens/carcinogens, are pyrolysis formed during the cooking of meat and fish. In the present study, the effects of various cooking methods, pan-frying, deep-frying, charcoal grilling and roasting on the formation of HAAs in chicken breast and duck breast were studied. The various HAAs formed during cooking were isolated by solid-phase extraction and analyzed by high-performance liquid chromatography (HPLC). Results showed that chicken breast cooked by charcoal grilling contained the highest content of total HAAs, as high as 112 ng/g, followed by pan-fried duck breast (53.3 ng/g), charcoal grilled duck breast (32 ng/g), pan-fried chicken breast (27.4 ng/g), deep-fried chicken breast (21.3 ng/g), deep-fried duck breast (14 ng/g), roasted duck breast (7 ng/g) and roasted chicken breast (4 ng/g). For individual HAA, the most abundant HAA was 9H-pyrido-[4,3-b]indole (Norharman), which was detected in charcoal grilled chicken breast at content as high as 32.2 ng/g, followed by 1-methyl-9H-pyrido[4,3-b] indole (Harman) and 2-amino-1-methyl-6-phenylimidazo[4,5-f]pyridine(PhIP) at 32 and 31.1 ng/g in charcoal grilled chicken breast, respectively. The content of PhIP in pan-fried duck and chicken breast were 22 and 18.3 ng/g, respectively. Generally, the type and content of HAAs in cooked poultry meat varies with cooking method and cooking conditions. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
'Lager, lager shouting': the role of music and DJs in nightclub disorder control.
Forsyth, Alasdair J M
2009-01-01
This paper explores how music and music genre can govern the nightlife experience, specifically how a nightclub's music policy can impact on clientele, health behaviours, bar sales and levels of disorder. Participant observations were conducted in sample of eight city centre nightclubs in Glasgow, Scotland. Music policy was found to influence nightclubs' clientele and their behaviours, for example in relation to differences in levels of alcohol or illegal drug use, sexual activity and violence between venues. Further, within individual venues, music policy was also observed operating as a crowd control tool, with for example such entertainment being used in alcohol marketing, in 'soft policing' and in the temporal management of patrons' movements. This research acknowledges the centrality of the DJ in implementing these controls. It is clear that music is a central component of the Nighttime Economy. Despite this, to date music has tended to play 'second fiddle' to sex and drugs within Club Health research. From this research it is recommended that music policy be incorporated into responsible bar server training packages.
Hong, Huachang; Yan, Xiaoqing; Song, Xuhui; Qin, Yanyan; Sun, Hongjie; Lin, Hongjun; Chen, Jianrong; Liang, Yan
2017-07-15
The main objective of this study was to assess the effects of disinfection conditions on bromine incorporation into disinfection by-products (DBPs) during chlorination of water with low specific UV absorbance (SUVA). Five classes of DBPs were included: trihalomethanes (THMs), dihaloacetic acids (di-HAAs), trihaloacetic acids (tri-HAAs), dihaloacetonitriles (DHANs) and trihalonitromethanes (THNMs). Results showed that the bromine utilization in DBPs formation was positive related with reaction time, pH and temperature. On the other hand, the bromine substitution factors (BSFs) of DBPs were generally increased with pH (except tri-HAAs) and bromide concentration, but decreased with the reaction time, temperature and chlorine dose. Moreover, the BSFs values varied with DBP classes with the ranking being as following: THNMs≫DHANs≫tri-HAAs>THM≈di-HAAs. These results were mostly similar with the references, yet the pH effect on BSFs as well as the rank of BSFs for different DBP classes may differ with the specific UV absorbance of organic matter. Copyright © 2017 Elsevier B.V. All rights reserved.
Wang, Pan; Hong, Yanting; Ke, Weixin; Hu, Xiaosong; Chen, Fang
2017-09-01
Heterocyclic aromatic amines (HAAs) are one type of neo-formed contaminants in protein-rich foods during heat processing. Recently, accumulative studies have focused on the formation of HAs in Western foods. However, there is little knowledge about the occurrence of HAAs in traditional Chinese foods. The objective of this study was to determinate the contents of main HAs in traditional marinated meat products by UPLC-MS/MS, and to investigate the effects of animal species and the ingredients (soy sauce, rock candy, and rice wine) on the formation of HAAs in marinated meats. Five HAs - 2-amino-3-methylimidazo[4,5-f]-quinolone (IQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3,4-dimethylimidazo[4,5-f]quinoxaline (MeIQ), 9H-pyrido[3,4-b]indole (Norharman) and l-methyl-9H-pyrido[3,4-b]indole (Harman) - were detected in 12 marinated meats, but 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) was only found in three chicken marinates. The animal species and ingredients (soy sauce, rock candy and rice wine) have significant influence on the formation of HAAs in meat marinates. Beef had the highest content of total HAAs compared with pork, mutton and chicken. Meanwhile, soy sauce contributed to the formation of HAAs more greatly than rock candy, soy sauce, and rice wine. Choice of raw materials and optimisation of ingredients recipe should be become a critical point to control the HAAs formation in marinated meats. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Chlorination of drinking water results in the formation of hundreds of disinfection byproducts (DBPs), the most prevalent are trihalomethanes (THMs) and haloacetic acids (HAAs). Four THMs (chloroform, bromodichloromethane, chlorodibromomethane, bromoform) and five HAAs (chloroac...
Hepatic artery aneurysms (HAAs)
International Nuclear Information System (INIS)
Nosratini, H.
2004-01-01
The hepatic artery aneurysms are rare, especially in interahepatic branches, The frequency consists of 75-80% extrahepatic and 20-25% intrahepatic. Catheterization is achieved usually from common femoral artery, other methods implemented in the case of unsuccessful catheterization from femoral artery, are translumbar and brachial catheterization. The study consist of 565 patients that were referred to the angiography ward, During seven years of assessment, five cases of hepatic artery aneurysm were found; this is a rare condition reported in the English literature. In the literature as well as in this case report the hepatic artery aneurysms are rare. In reported series the extrahepatic artery aneurysms are found more often than in the intrahepatic artery aneurysm but in this case report intrahepatic artery aneurysms are more than extrahepatic one. (author)
Adding Flavor to Beverages with Non-Conventional Yeasts
Directory of Open Access Journals (Sweden)
Davide Ravasio
2018-02-01
Full Text Available Fungi produce a variety of volatile organic compounds (VOCs during their primary and secondary metabolism. In the beverage industry, these volatiles contribute to the the flavor and aroma profile of the final products. We evaluated the fermentation ability and aroma profiles of non-conventional yeasts that have been associated with various food sources. A total of 60 strains were analyzed with regard to their fermentation and flavor profile. Species belonging to the genera Candida, Pichia and Wickerhamomyces separated best from lager yeast strains according to a principal component analysis taking alcohol and ester production into account. The speed of fermentation and sugar utilization were analysed for these strains. Volatile aroma-compound formation was assayed via gas chromatography. Several strains produced substantially higher amounts of aroma alcohols and esters compared to the lager yeast strain Weihenstephan 34/70. Consequently, co-fermentation of this lager yeast strain with a Wickerhamomyces anomalus strain generated an increased fruity-flavour profile. This demonstrates that mixed fermentations utilizing non-Saccharomyces cerevisiae biodiversity can enhance the flavour profiles of fermented beverages.
Medien – Wissen – Bildung 2011: Kulturen und Ethiken des Teilens
Directory of Open Access Journals (Sweden)
Valentin Dander
2011-12-01
Full Text Available Die Tagung Medien – Wissen – Bildung 2011 bot Forschern, Künstlern und Interessierten verschiedener Disziplinen ein Forum, die kulturellen und ethischen Grundlagen und Bedeutungen des Teilens in digitalisierten Gesellschaften in seinen zahlreichen Dimensionen zu diskutieren.
Hemels, J.; Averbeck-Lietz, S.; Klein, P.; Meyen, M.
2009-01-01
Dieser Beitrag verfolgt zwei Ziele: Einerseits wird beabsichtigt, nicht his-torisch geschulte Kommunikationswissenschaftler mit Grundlagen und Praxis kommunikationswissenschaftlicher Forschung vertraut zu ma-chen. Andererseits wird für ein Zusammenspiel zwischen führenden For-schungsansätzen und
International Nuclear Information System (INIS)
Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Laurent, Veronique; Loyer, Pascal; Robin, Marie-Anne; Guillouzo, Andre
2010-01-01
2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) are two of the most common heterocyclic aromatic amines (HAA) produced during cooking of meat, fish and poultry. Both HAA produce different tumor profiles in rodents and are suspected to be carcinogenic in humans. In order to better understand the molecular basis of HAA toxicity, we have analyzed gene expression profiles in the metabolically competent human HepaRG cells using pangenomic oligonucleotide microarrays, after either a single (24-h) or a repeated (28-day) exposure to 10 μM PhIP or MeIQx. The most responsive genes to both HAA were downstream targets of the arylhydrocarbon receptor (AhR): CYP1A1 and CYP1A2 after both time points and CYP1B1 and ALDH3A1 after 28 days. Accordingly, CYP1A1/1A2 induction in HAA-treated HepaRG cells was prevented by chemical inhibition or small interference RNA-mediated down-regulation of the AhR. Consistently, HAA induced activity of the CYP1A1 promoter, which contains a consensus AhR-related xenobiotic-responsive element (XRE). In addition, several other genes exhibited both time-dependent and compound-specific expression changes with, however, a smaller magnitude than previously reported for the prototypical AhR target genes. These changes concerned genes mainly related to cell growth and proliferation, apoptosis, and cancer. In conclusion, these results identify the AhR gene battery as the preferential target of PhIP and MeIQx in HepaRG cells and further support the hypothesis that intake of HAA in diet might increase human cancer risk.
Directory of Open Access Journals (Sweden)
Liu S
2014-12-01
Full Text Available Among the more than 5000 chemicals reported in cigarette smoke condensate (CSC, heterocyclic aromatic amines (HAAs are considered to be a contributor to observed biological activity. HAAs are non-volatile and are reported at ppb levels in CSC. A new method for HAA analysis at the trace level is reported here. N, O-Bis(trimethylsilyl trifluoroacetamide (BSTFA containing 1% trimethylchlorosilane was employed to derivatize amino groups by heating the reagent containing a sample of CSC at 80 °C for 30 min followed by analysis employing gas chromatography-mass spectroscopy (GC-MS in the selected-ion-monitoring (SIM mode. This derivatization method afforded symmetrical peak shapes on a ZB-50 stationary phase and achieved instrumental limits of quantification (LOQ at 10:1 S/N from -1 ng/mL for AαC to120 ng/mL for Glu-P-1. The chemical identity of each derivative was confirmed by comparison of retention time and mass spectra of standards. The latter were characterized by the following ions: M·+ or [M-1]+, [M-15]+, and m/z 73 (i.e., trimethylsilyl. CSC and its base sub-fractions were studied using the GC-MS method. Ten HAAs were screened and five were quantified in cigarette smoke condensate, while 2-5 HAAs were quantified in each of three base sub-fractions. Values obtained with the new procedure agree well with values reported in the literature and with results obtained from a commercial laboratory via a different analytical method. The potential contribution of each HAA to the overall mutagenic activity observed for CSC and its base fractions is discussed. When considered together, HAAs account for only a small portion (-7.8% of the observed mutagenicity of the CSC.
Tengilimoglu-Metin, Mercan Merve; Kizil, Mevlude
2017-12-01
The aim of this study was to investigate the inhibitory effect of different levels of artichoke extract (0, 0.5, and 1.0%) on the formation of heterocyclic aromatic amines (HAAs) in beef and chicken breast meat cooked by either pan-frying or oven-roasting. All meat samples were cooked at three different temperatures (150, 200, and 250°C) and the levels of 12 HAAs (IQ, IQx, MeIQ, MeIQx, 4,8-DiMeIQx, 7,8-DiMeIQx, PhIP, harman, norharman, AαC, MeAαC, and Trp-P-2) were assessed. The total HAA content in beef and chicken breast ranged from not detectable to 49.26ng/g, and not detectable to 83.06ng/g, respectively. The inhibitory effects of 0.5 and 1.0% artichoke extracts on total HAAs levels were found to be 6-46% and 25-98% in beef, and 5-97% and 14-95% in chicken breast, respectively. The present study showed that artichoke extracts could mitigate HAA formation especially in oven-roasted beef and chicken breast meat. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cardador, Maria Jose; Gallego, Mercedes
2012-07-25
Chlorine solutions are usually used to sanitize fruit and vegetables in the fresh-cut industry due to their efficacy, low cost, and simple use. However, disinfection byproducts such as haloacetic acids (HAAs) can be formed during this process, which can remain on minimally processed vegetables (MPVs). These compounds are toxic and/or carcinogenic and have been associated with human health risks; therefore, the U.S. Environmental Protection Agency has set a maximum contaminant level for five HAAs at 60 μg/L in drinking water. This paper describes the first method to determine the nine HAAs that can be present in MPV samples, with static headspace coupled with gas chromatography-mass spectrometry where the leaching and derivatization of the HAAs are carried out in a single step. The proposed method is sensitive, with limits of detection between 0.1 and 2.4 μg/kg and an average relative standard deviation of ∼8%. From the samples analyzed, we can conclude that about 23% of them contain at least two HAAs (<0.4-24 μg/kg), which showed that these compounds are formed during washing and then remain on the final product.
Synthesis of high-quality diesel with furfural and 2-methylfuran from hemicellulose.
Li, Guangyi; Li, Ning; Wang, Zhiqiang; Li, Changzhi; Wang, Aiqin; Wang, Xiaodong; Cong, Yu; Zhang, Tao
2012-10-01
Hydroxyalkylation-alkylation (HAA) coupled with hydrodeoxygenation is a promising route for the synthesis of renewable high-quality diesel or jet fuel. In this work, a series of solid-acid catalysts were firstly used for HAA between lignocellulose-derived furan and carbonyl compounds. Among the investigated catalysts, Nafion-212 resin demonstrated the highest activity and stability. Owing to the high activity of the reactants and the advantage in industrial integration, the HAA of 2-methylfuran (2-MF) and furfural can be considered as a prospective route in future applications. Catalyst loading, reaction temperature, and time had evident effects on the HAA of 2-MF and furfural over Nafion-212 resin. Finally, the HAA product of 2-MF and furfural was hydrogenated over a Pd/C catalyst and hydrodeoxygenated over Pt-loaded solid-acid catalysts. Pt/zirconium phosphate (Pt/ZrP) was found to be the best catalyst for hydrodeoxygenation. Over the 4 % Pt/ZrP catalyst, a 94 % carbon yield of diesel and 75 % carbon yield of C15 hydrocarbons (with 6-butylundecane as the major component) was achieved. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cooking does not decrease hydrophilic antioxidant capacity of wild blueberries.
Murphy, Rebecca Ree; Renfroe, Michael H; Brevard, Patricia Bowling; Lee, Robert E; Gloeckner, Janet W
2009-01-01
The present study examined the effects of domestic cooking methods on the hydrophilic antioxidant activity (HAA) of wild blueberries. Baked, microwaved, simmered, and pan-fried frozen wild blueberries, and a thawed uncooked control, were analyzed for HAA using an ABTS/H(2)O(2)/HRP decoloration method. All cooking treatments were derived from recipes using wild blueberries, and were performed in triplicate. A randomized block design was used to determine whether there were statistical differences in antioxidant content after cooking and between each of the trials. There were no statistically significant decreases after cooking the thawed berries. On both a fresh weight and a dry weight basis, pan-fried blueberries had significantly higher HAA than baked, simmered, and control blueberries (Pcooked berries retained significant HAA. Cooked wild blueberries can be recommended as a good source of dietary antioxidants.
Supraleitung Grundlagen und Anwendungen
Buckel, Werner
2013-01-01
Grundlegende Konzepte und Eigenschaften von Supraleitern, die Herstellung und Entwicklung von neuen supraleitenden Materialien sowie moderne Anwendungsbereiche sind die Schwerpunktthemen des Buches. Das größte Potential zur Nutzung der Supraleitung liegt in der Energietechnik. Fast unbemerkt trägt die Einführung von Kabeln, Magneten, Transformatoren oder Lagern aus supraleitenden Materialien bei zur Effizienzsteigerung bei der Stromübertragung oder in Motoren. Durch seiner klare Sprache und zahlreiche erläuternde Abbildungen eignet sich der Band hervorragend als einführendes Lehrbuch. Der Schwierigkeitsgrad wird von Kapitel zu Kapitel gesteigert. So können auch Einsteiger ohne einschlägige Vorkenntnisse dem Stoff folgen. Dank der über 350 Literaturhinweise bekommt der Leser außerdem einen Überblick über die wichtigsten Publikationen zum Thema. Ein unverzichtbares Lehrbuch also für Physik-Studenten und Studierende der Ingenieurwissenschaften. Fachleuten in Forschung und Praxis leistet das Buch au...
Grundlagen des Tissue Engineering
Mayer, Jörg; Blum, Janaki; Wintermantel, Erich
Die Organtransplantation stellt eine verbreitete Therapie dar, um bei krankheitsoder unfallbedingter Schädigung eines Organs die Gesamtheit seiner Funktionen wieder herzustellen, indem es durch ein Spenderorgan ersetzt wird. Organtransplantationen werden für die Leber, die Niere, die Lunge, das Herz oder bei schweren grossflächigen Verbrennungen der Haut vorgenommen. Der grosse apparative, personelle und logistische Aufwand und die Risiken der Transplantationschirurgie (Abstossungsreaktionen) sowie die mangelnde Verfügbarkeit von immunologisch kompatiblen Spenderorganen führen jedoch dazu, dass der Bedarf an Organtransplantaten nur zu einem sehr geringen Teil gedeckt werden kann. Sind Spenderorgane nicht verfügbar, können in einzelnen Fällen lebenswichtige Teilfunktionen, wie beispielsweise die Filtrationsfunktion der Niere durch die Blutreinigung mittels Dialyse ersetzt oder, bei mangelnder Funktion der Bauchspeicheldrüse (Diabetes), durch die Verabreichung von Insulin ein normaler Zustand des Gesamtorganismus auch über Jahre hinweg erhalten werden. Bei der notwendigen lebenslangen Anwendung apparativer oder medikamentöser Therapie können für den Patienten jedoch häufig schwerwiegende, möglicherweise lebensverkürzende Nebenwirkungen entstehen. Daher werden in der Forschung Alternativen gesucht, um die Funktionen des ausgefallenen Organs durch die Implantation von Zellen oder in vitro gezüchteten Geweben möglichst umfassend wieder herzustellen. Dies erfordert biologisch aktive Implantate, welche die für den Stoffwechsel des Organs wichtigen Zellen enthalten und einen organtypischen Stoffwechsel entfalten.
Grundlagen der zeichnerischen Darstellung
Döring, Peter
Eine Technische Zeichnung muss nach DIN 6774 Teil 1 in der Weise angefertigt werden, dass sie übersichtlich, unmissverständlich, auch in verkleinertem Maßstab lesbar bleibt, kostengünstig reproduzierbar und dauerhaft archivierbar ist. Zu dem Zweck benötigt man entsprechendes Papier und angepasstes Zeichengerät. Heute ist die Anfertigung mit entsprechenden Rechnerprogrammen möglich.
Supraleitung Grundlagen und Anwendungen
Buckel, Werner
2004-01-01
Seit nunmehr drei Jahrzehnten ist der "Buckel" das Referenzwerk in deutscher Sprache zum Thema Supraleitung. Immer wieder aktualisiert, hat das Lehrbuch Generationen von Studenten begleitet. In der 6., vollständig überarbeiteten Auflage wird das bewährte didaktische Konzept beibehalten, inhaltlich wurde der Band dem aktuellen Stand von Forschung und Technik angepasst. Das Autorenteam um Prof. Kleiner verzichtet auf komplizierte mathematische Herleitungen. Es baut ganz auf das bewährte Step-by-Step-Prinzip: Der Schwierigkeitsgrad wird von Kapitel zu Kapitel gesteigert. So können auch Einsteiger ohne einschlägige Vorkenntnisse dem Stoff bequem folgen. Dank seiner klaren Sprache und zahlreicher Abbildungen eignet sich der Band hervorragend als einführendes Lehrbuch - und zwar nicht nur für Physik-Studenten, sondern auch für Studierende angrenzender Natur- und Ingenieurwissenschaften. Grundlegende Eigenschaften, supraleitende Elemente, Cooper-Paarung, Thermodynamik, kritische Ströme, Josephsonkontakte...
Marketing : eine fallstudienbasierte Einführung
Griese, K.M.; Bröring, S.
2011-01-01
Studenten sowie Praktiker erhalten eine praxisorientierte Einführung in die zentralen Grundlagen des Marketing. Ausgangspunkt jedes Kapitels ist eine Fallstudie, die eine konkrete praktische Rahmenbedingung eines Unternehmens vorstellt. Diese Situation wird in den Ausführungen dann mit den
Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...
Indian Academy of Sciences (India)
(TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...
BACKGROUND:Trihalomethanes (THMs) and haloaretic acids (HAAs) are regulated disinfection by-products (DBPs); their joint reproductive toxicity in drinking water is unknown.OBJECTIVE: We aimed to evaluate a drinking water mixture of the four regulated THMs and five regulated HAAs ...
Energy Technology Data Exchange (ETDEWEB)
Uhse, K.; Aichert, G. (comps.)
2001-09-01
The station was installed on behalf of the Federal Minister of the Interior (BMI) in 1971. It carries out the following tasks: Development of fundamentals for fully automatic multicomponent measuring networks for monitoring of air pollution; prediction of pollutant concentrations on the basis of emission cadastres and meteorological factors; development of fundamentals for dispersion calculations; investigations of atmospheric oxidants, heavy metals and pollutant reactions (motor car exhaust); validation of measuring methods. [German] Im Auftrag des Bundesministers des Innern (BMI) wurde 1971 aufbauend auf den Ergebnissen der Probemessstation eine 'Pilotstation zur Ueberwachung der Luftreinhaltung im Gebiet Frankfurt am Main' mit folgenden Aufgaben eingerichtet: - Erstellung von Grundlagen fuer vollautomatische Mehrkomponentenmessnetze zur Ueberwachung der Luftreinhaltung - Vorhersagbarkeit von Immissionskonzentrationen bezogen auf Emissionskataster und meteorologische Einfluesse - Erstellung von Grundlagen fuer die Ausbreitungsrechnung - Untersuchungen zu Oxidantien, Schwermetallen und Reaktionen von Luftverunreinigungen in der Atmosphaere (Kfz-Abgase) - Pruefung entsprechender Messverfahren. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Gallego Carrera, D.; Renn, O.; Dreyer, M.
2009-06-15
This report for the Swiss Federal Office of Energy (SFOE) discusses the concept of how information concerning deep geological repositories for radioactive wastes should be presented and communicated to those in the areas which have been designated as potential sites for the repositories. Communication basics based on scientific knowledge in this area are discussed. The importance of a concept for general communication and risk-communication as a particular challenge are discussed. Trust and transparency are quoted as being indispensable in this connection. Ways of dealing with various target audiences and the media are examined. The report is concluded with a check-list that deals with important questions arising from the process of communicating information on deep geological repositories for radioactive wastes
Mehrez, O Abou; Dossier-Berne, F; Legube, B
2015-01-01
Chlorination and monochloramination of aminophenols (AP) were carried out in aqueous solution at 25°C and at pH 8.5. Oxidant demand and disinfection by-product formation were determined in excess of oxidant. Experiments have shown that chlorine consumption of AP was 40-60% higher than monochloramine consumption. Compared with monochloramination, chlorination of AP formed more chloroform and haloacetic acids (HAA). Dichloroacetic acid was the major species of HAA. Chloroform and HAA represented, respectively, only 1-8% and 14-15% of adsorbable organic halides (AOX) by monochloramination but up to 29% and 39% of AOX by chlorination.
Marsà, Alicia; Cortés, Constanza; Hernández, Alba; Marcos, Ricard
2018-04-07
Disinfection by-products (DBPs) are compounds produced in the raw water disinfection processes. Although increased cancer incidence has been associated with exposure to this complex mixture, the carcinogenic potential of individual DBPs remains not well known; thus, further studies are required. Haloacetic acids (HAAs) constitute an important group among DBPs. In this study, we have assessed the in vitro carcinogenic potential of three HAAs namely chloro-, bromo-, and iodoacetic acids. Using a long-term (8 weeks) and sub-toxic doses exposure scenario, different in vitro transformation markers were evaluated using a human urothelial cell line (T24). Our results indicate that long-term exposure to low doses of HAAs did not reproduce the genotoxic effects observed in acute treatments, where oxidative DNA damage was induced. No changes in the transformation endpoints analyzed were observed, as implied by the absence of significant morphological, cell growth rate and anchorage-independent cell growth pattern modifications. Interestingly, HAA-long-term exposed cells developed resistance to oxidative stress damage, what would explain the observed differences between acute and long-term exposure conditions. Accordingly, data obtained under long-term exposure to sub-toxic doses of HAAs could be more accurate, in terms of risk assessment, than under acute exposure scenarios. Copyright © 2018. Published by Elsevier Inc.
Sontag, Ralph
2007-01-01
Modelleisenbahnen können Kinderspielzeug oder anspruchsvolles Hobby sein. Heute fahren viele Bahnen digital und werden mittels Digital Command Control (DCC) gesteuert. Im Vortrag sollen die Grundlagen des Protokolls erläutert und die Grundfunktionen mittels des Decoder Programmers SPROG II unter Linux ausprobiert werden.
Associations Between Disinfection By-Product Exposures and Craniofacial Birth Defects.
Kaufman, John A; Wright, J Michael; Evans, Amanda; Rivera-Núñez, Zorimar; Meyer, Amy; Narotsky, Michael G
2018-02-01
The aim of this study was to examine associations between craniofacial birth defects (CFDs) and disinfection by-product (DBP) exposures, including the sum of four trihalomethanes (THM4) and five haloacetic acids (HAA5) (ie, DBP9). We calculated first trimester adjusted odds ratios (aORs) for different DBPs in a matched case-control study of 366 CFD cases in Massachusetts towns with complete 1999 to 2004 THM and HAA data. We detected elevated aORs for cleft palate with DBP9 (highest quintile aOR = 3.52; 95% CI: 1.07, 11.60), HAA5, trichloroacetic acid (TCAA), and dichloroacetic acid. We detected elevated aORs for eye defects with TCAA and chloroform. This is the first epidemiological study of DBPs to examine eye and ear defects, as well as HAAs and CFDs. The associations for cleft palate and eye defects highlight the importance of examining specific defects and DBPs beyond THM4.
Effect of Pre-ozonation on Haloacetic Acids Formation in Ganga River Water at Kanpur, India
Naladala, Nagasrinivasa Rao; Singh, Rambabu; Katiyar, Kumud Lata Devi; Bose, Purnendu; Dutta, Venkatesh
2017-11-01
Almost all natural water bodies which are considered to be sustainable sources of drinking water contain organic matter in dissolved form and pathogens. This dissolved organic matter and pathogens cannot be removed effectively through traditional filtering processes in drinking water treatment plants. Chlorination of such water for disinfection results in large amounts of disinfection by-products (DBPs), mainly trihalomethanes and haloacetic acids (HAAs), which showed many health effects like cancer and reproductive problems in lab animals and in human beings as well. Complete removal of dissolved organic carbon (DOC), which is a precursor compound for HAAs formation, is impossible from a practical point of view; hence, it will be better if DOC activity towards DBPs formation can be reduced via some process. The present article describes the process of pre-ozonating post-coagulated Ganga River water at Kanpur in a continuous flow mode and its effect on HAAs formation. Nearly 58% reduction in HAAs formation was observed during this study at higher doses of ozone.
Haloacetic acids in the aquatic environment. Part II: ecological risk assessment
International Nuclear Information System (INIS)
Hanson, Mark L.; Solomon, Keith R.
2004-01-01
Haloacetic acids (HAAs) are environmental contaminants found in aquatic ecosystems throughout the world as a result of both anthropogenic and natural production. The ecological risk posed by these compounds to organisms in freshwater environments, with a specific focus on aquatic macrophytes, was characterized. The plants evaluated were Lemna gibba, Myriophyllum spicatum and M. sibiricum and the HAAs screened were monochloroacetic acid (MCA), dichloroacetic acid (DCA), trichloroacetic acid (TCA), trifluoroacetic acid (TFA) and chlorodifluoroacetic acid (CDFA). Laboratory toxicity data formed the basis of the risk assessment, but field studies were also utilized. The estimated risk was calculated using hazard quotients (HQ), as well as effect measure distributions (EMD) in a modified probabilistic ecological risk assessment. EMDs were used to estimate HAA thresholds of toxicity for use in HQ assessments. This threshold was found to be a more sensitive measure of low toxicity than the no observed effect concentrations (NOEC) or the effective concentration (EC 10 ). Using both deterministic and probabilistic methods, it was found that HAAs do not pose a significant risk to freshwater macrophytes at current environmental concentrations in Canada, Europe or Africa for both single compound and mixture exposures. Still, HAAs are generally found as mixtures and their potential interactions are not fully understood, rendering this phase of the assessment uncertain and justifying further effects characterization. TCA in some environments poses a slight risk to phytoplankton and future concentrations of TFA and CDFA are likely to increase due to their recalcitrant nature, warranting continued environmental surveillance of HAAs. - Current environmental concentrations of haloacetic acids do not pose a risk to aquatic macrophytes, but could impact plankton
Shen, X. C.; Zhang, Y. L.; Cui, Y. Q.; Xu, L. Y.; Li, X.; Qi, J. H.
2017-07-01
Heterocyclic aromatic amines (HAAs) are potent mutagens that formed at high temperature in cooked, protein-rich food. Owing to their frequent intake, an accurate method is essential to access human health risk of HAAs exposure through detecting these compounds in various heat-treated meat products. In this study, a liquid chromatography-electrospray tandem mass spectrometry (LC--ESI-MS/MS) method was developed to perform the determination of 9 mutagenic heterocyclic amines (HAAs) in meat samples with multiple reaction monitoring (MRM) mode. Ultrasound assisted extraction and diatomaceous earth was employed to extract HAAs from food samples, and the analytes were purified and enriched using tandem solid phase extraction, with propyl sulfonic acid coupled to a C18 cartridge. Two parameters, extraction time and eluent, were carefully optimized to improve the extraction and purification efficiency. The LC separation was carried out using a Zorbax SB-C18 (3.5 μm particle size, 2.1 × 150 mm i.d.) column and optimized some parameters, such as pH, concentration and volume. Under the optimal experimental conditions, recoveries ranged from 52.97% to 97.11% with good quality parameters: limit of detection values between 0.02 and 0.24 ng mL-1, linearity (R2>0.998), and run-to-run and day-to-day precisions lower than 9.81% achieved. To evaluate the performance of the method in high throughput analysis of complex meat samples, the LC-MS/MS method was applied to the analysis of HAAs in three food samples, and the results demonstrated that the method can be used for the trace determination of HAAs in pork samples.
Energy Technology Data Exchange (ETDEWEB)
Becker, B. [Vereinigung Deutscher Elektrizitaetswerke e.V. (VDEW), Frankfurt am Main (Germany); Beckers, F. [Isar-Amperwerke AG, Muenchen (Germany); Dewald, N. [Bayernwerk AG, Muenchen (Germany); Hauffe, P. [Pfalzwerke AG, Ludwigshafen am Rhein (Germany); Hein, F. [EVS AG Stuttgart (Germany); Hoederath, M. [Vereinigte Elektrizitaetswerke Westfalen AG (VEW), Dortmund (Germany); Seyen, R. [Staedtische Werke Nuernberg GmbH (Germany)
1998-01-12
The working group on information processing (IP) basics (in German: `IV-Grundlagen`) has prepared this contribution dealing with controlling applied to information processing. This new report, on the one hand, takes into consideration the role of the organizational IP unit as one offering its services to all sections of a company. On the other hand, information processing as an operational infrastructure influencing all business processes becomes increasingly important with respect to the competitiveness of the EVU. Therefore, quality management applied to IP projects and IP services must support this development. (orig./RHM) [Deutsch] Der VDEW Arbeitskreis `IV-Grundlagen` hat einen Beitrag zum Controlling fuer die Informationsverarbeitung erstellt. Hier geht zum einen die Rolle der Organisationseinheit IV als Dienstleister fuer alle Unternehmensbereiche ein. Zum anderen gewinnt die Informationsverarbeitung als betriebliche Infrastruktur fuer alle Geschaeftsprozesse zunehmende Bedeutung fuer die Wettbewerbsfaehigkeit der EVU. Das Qualitaetsmanagement fuer IV-Projekte und fuer IV-Service muss dies unterstuetzen. (orig./RHM)
Burattini, Ilaria; Bellagamba, Maria Paola; Spagnoli, Cristina; D'Ascenzo, Rita; Mazzoni, Nadia; Peretti, Anna; Cogo, Paola E; Carnielli, Virgilio P
2013-11-01
To compare the effect of 2.5 vs 4 g/kg/d of amino acid (AA) in parenteral nutrition of extremely low birth weight infants on metabolic tolerance, short-term growth, and neurodevelopment. One hundred thirty-one infants with birth weight between 500 and 1249 g were randomized to 2.5 (standard AA [SAA] group) or 4 (high AA [HAA] group) g/kg/d AA intake, with equal nonprotein energy. The primary outcome was body size at 36 weeks. One hundred thirty-one patients were randomized and 114 analyzed (58 SAA group and 56 HAA group). Study groups had similar demographics and clinical characteristics. Elevated blood urea (BU >70 mg/dL = BU nitrogen >32.6 mg/dL) occurred in 24% vs 59% (P = .000) and hyperglycemia (>175 mg/dL) in 34% vs 11% (P = .003) of the SAA and HAA patients, respectively. Body weight, length, and head circumference at 36 weeks and 2 years were similar between groups. Bayley Scales of Infant and Toddler Development, Third Edition score was 94 ± 13 in the SAA group and 97 ± 15 in the HAA group (P = .35). The HAA group had higher BU levels and better glucose control. An extra 8 g/kg of AA over the first 10 days of life did not improve growth and neurodevelopment. Copyright © 2013 Mosby, Inc. All rights reserved.
Pezdirc, Marko; Žegura, Bojana; Filipič, Metka
2013-09-01
Heterocyclic aromatic amines (HAAs) are potential human carcinogens formed in well-done meats and fish. The most abundant are 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-Amino-3,4,8-trimethyl-3H-imidazo[4,5-f]quinoxaline (4,8-DiMeIQx) and 2-Amino-3-methyl-3H-imidazo[4,5-f]quinoline (IQ). HAAs exert genotoxic activity after metabolic transformation by CYP1A enzymes, that is well characterized, however the genomic and intervening responses are not well explored. We have examined cellular and genomic responses of human hepatoma HepG2 cells after 24h exposure to HAAs. Comet assay revealed increase in formation of DNA strand breaks by PhIP, MeIQx and IQ but not 4,8-DiMeIQx, whereas increased formation of micronuclei was not observed. The four HAAs up-regulated expression of genes encoding metabolic enzymes CYP1A1, CYP1A2 and UGT1A1 and expression of TP53 and its downstream regulated genes CDKN1A, GADD45α and BAX. Consistent with the up-regulation of CDKN1A and GADD45α the cell-cycle analysis showed arrest in S-phase by PhIP and IQ, and in G1-phase by 4,8-DiMeIQx and MeIQx. The results indicate that upon exposure to HAAs the cells respond with the cell-cycle arrest, which enables cells to repair the damage or eliminate them by apoptosis. However, elevated expression of BCL2 and down-regulation of BAX may indicate that HAAs could suppress apoptosis meaning higher probability of damaged cells to survive and mutate. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Hiroyasu Umakoshi
Full Text Available To quantify the imaging findings of patients with interstitial pneumonia (IP and emphysema using three-dimensional curved high-resolution computed tomography (3D-cHRCT at a constant depth from the chest wall, and compare the results to visual assessment of IP and each patient's diffusing capacity of the lungs for carbon monoxide (DLco.We retrospectively reviewed the axial CT findings and pulmonary function test results of 95 patients with lung cancer (72 men and 23 women, aged 45-84 years with or without IP, as follows: non-IP (n = 47, mild IP (n = 31, and moderate IP (n = 17. The 3D-cHRCT images of the lung at a 1-cm depth from the chest wall were reconstructed automatically using original software; total area (TA, high-attenuation area (HAA >-500 HU, and low-attenuation area (LAA <-950 HU were calculated on a workstation. The %HAA and %LAA were calculated as follows: [Formula: see text], and [Formula: see text].The %HAA and %LAA respective values were 3.2±0.9 and 27.7±8.2, 3.9±1.2 and 27.6±5.9, and 6.9±2.2 and 25.4±8.7 in non-IP, mild IP, and moderate IP patients, respectively. There were significant differences in %HAA between the 3 groups of patients (P<0.001, but no differences in %LAA (P = 0.558. Multiple linear regression analysis revealed that %HAA and %LAA were negatively correlated with predicted DLco (standard partial regression coefficient [b*] = -0.453, P<0.001; b* = -0.447, P<0.001, respectively.The %HAA and %LAA values computed using 3D-cHRCT were significantly correlated with DLco and may be important quantitative parameters for both IP and emphysema.
Antioxidant Properties of Kynurenines: Density Functional Theory Calculations
2016-01-01
Kynurenines, the main products of tryptophan catabolism, possess both prooxidant and anioxidant effects. Having multiple neuroactive properties, kynurenines are implicated in the development of neurological and cognitive disorders, such as Alzheimer's, Parkinson's, and Huntington's diseases. Autoxidation of 3-hydroxykynurenine (3HOK) and its derivatives, 3-hydroxyanthranilic acid (3HAA) and xanthommatin (XAN), leads to the hyperproduction of reactive oxygen species (ROS) which damage cell structures. At the same time, 3HOK and 3HAA have been shown to be powerful ROS scavengers. Their ability to quench free radicals is believed to result from the presence of the aromatic hydroxyl group which is able to easily abstract an electron and H-atom. In this study, the redox properties for kynurenines and several natural and synthetic antioxidants have been calculated at different levels of density functional theory in the gas phase and water solution. Hydroxyl bond dissociation enthalpy (BDE) and ionization potential (IP) for 3HOK and 3HAA appear to be lower than for xanthurenic acid (XAA), several phenolic antioxidants, and ascorbic acid. BDE and IP for the compounds with aromatic hydroxyl group are lower than for their precursors without hydroxyl group. The reaction rate for H donation to *O-atom of phenoxyl radical (Ph-O*) and methyl peroxy radical (Met-OO*) decreases in the following rankings: 3HOK ~ 3HAA > XAAOXO > XAAENOL. The enthalpy absolute value for Met-OO* addition to the aromatic ring of the antioxidant radical increases in the following rankings: 3HAA* < 3HOK* < XAAOXO* < XAAENOL*. Thus, the high free radical scavenging activity of 3HAA and 3HOK can be explained by the easiness of H-atom abstraction and transfer to O-atom of the free radical, rather than by Met-OO* addition to the kynurenine radical. PMID:27861556
Potentially bioavailable natural organic carbon and hydrolyzable amino acids in aquifer sediments
Thomas, Lashun K.; Widdowson, Mark A.; Novak, John T.; Chapelle, Francis H.; Benner, Ronald; Kaiser, Karl
2012-01-01
This study evaluated the relationship between concentrations of operationally defined potentially bioavailable organic -carbon (PBOC) and hydrolyzable amino acids (HAAs) in sediments collected from a diverse range of chloroethene--contaminated sites. Concentrations of PBOC and HAA were measured using aquifer sediment samples collected at six selected study sites. Average concentrations of total HAA and PBOC ranged from 1.96 ± 1.53 to 20.1 ± 25.6 mg/kg and 4.72 ± 0.72 to 443 ± 65.4 mg/kg, respectively. Results demonstrated a statistically significant positive relationship between concentrations of PBOC and total HAA present in the aquifer sediment (p amino acids are known to be readily biodegradable carbon compounds, this relationship suggests that the sequential chemical extraction procedure used to measure PBOC is a useful indicator of bioavailable carbon in aquifer sediments. This, in turn, is consistent with the interpretation that PBOC measurements can be used for estimating the amount of natural organic carbon available for driving the reductive dechlorination of chloroethenes in groundwater systems.
Nie, Xuebiao; Liu, Wenjun; Zhang, Liping; Liu, Qing
2017-06-01
The genotoxicity of drinking water treated with 6 disinfection methods and the effects of disinfection conditions were investigated using the umu-test. The pretreatment procedure of samples for the umu-test was optimized for drinking water analysis. The results of the umu-test were in good correlation with those of the Ames-test. The genotoxicity and production of haloacetic acids (HAAs) were the highest for chlorinated samples. UV+chloramination is the safest disinfection method from the aspects of genotoxicity, HAA production and inactivation effects. For chloramination, the effects of the mass ratio of Cl 2 to N of chloramine on genotoxicity were also studied. The changes of genotoxicity were different from those of HAA production, which implied that HAA production cannot represent the genotoxic potential of water. The genotoxicity per chlorine decay of chlorination and chloramination had similar trends, indicating that the reaction of organic matters and chlorine made a great contribution to the genotoxicity. The results of this study are of engineering significance for optimizing the operation of waterworks. Copyright © 2016. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Searle, R.C.; Schultheiss, P.J.; Weaver, P.P.E.; Noel, M.; Kidd, R.B.; Jacobs, C.L.; Huggett, Q.J.
1985-01-01
This report summarises geological and geophysical studies carried out by the Institute of Oceanographic Sciences up to December 1983 in an area of the Madeira Abyssal Plain in order to assess its suitability for the disposal of heat-emitting radioactive waste. The results of work carried out in the same area by the Rijks Geologische Dienst of the Netherlands are also reviewed in the report. Other oceanographic studies in the area in the fields of geochemistry, biology and oceanography are briefly touched upon. (author)
"Welch Schauspiel! Aber ach! ein Schauspiel : Fußball und Theater
Thiergen, Peter
2009-01-01
Der Essay zeigt, wie eng Fußball und Schauspiel/Theater/Drama zusammenhängen. Dabei wird nicht nur einer Vielzahl von sprachlichen und insbesondere metaphorischen Entsprechungen nachgespürt, in denen sich die beiden Publikumsereignisse wechselseitig interpretieren, sondern auch gezeigt, auf welchen medialen Grundlagen, Erfahrungen und Rezeptionsdispositionen diese Entsprechungen beruhen.
Von der Geschäftsidee zum Businessplan Businessplan für Schülerunternehmen
Prof. Dr. Ingo Bieberstein; Dr. Ulrich Scholz
2011-01-01
Das Buch gibt einen Einblick in die Grundlagen der Betriebswirtschaftslehre und will das Verständnis für ökonomische Zusammenhänge fördern. Das Buch gibt eine Anleitung zur Erstellung eines Businessplans mit vielen praktischen Beispielen. Die Zielgruppe dieses Buches sind Schüler, aber auch
Harn, van J.
2009-01-01
Wageningen UR Livestock Research testte vier strooiselmaterialen voor vleeskuikens. Hoeveelheid en soort hadden geen effect op de resultaten. Snijmaissilage vroeg meer energie, maar de ammoniakemissie was lager
Meie esimesed naisfotograafid / Annika Haas
Haas, Annika, 1974-
2016-01-01
Tallinna fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kuraatorid Betty Ester-Väljaots, Merili Reinpalu, kunstnik Lilian Juhkam. Eesti naisfotograafide Anna Kuke ja Evi Lembergi eluloolisi andmeid, nende looming
Meie esimesed naisfotograafid / Annika Haas
Haas, Annika, 1974-
2015-01-01
Eesti naisfotograafid Hilja Riet ja Lydia Tarem. Fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kus tutvustatakse Hilja Rieti, Lydia Taremi, Anna Kuke ja Evi Lembergi loomingut. Näituse kuraatorid Betty Ester-Väljaots, Merili Reinpalu
Breast cancer, heterocyclic aromatic amines from meat and N-acetyltransferase 2 genotype.
Delfino, R J; Sinha, R; Smith, C; West, J; White, E; Lin, H J; Liao, S Y; Gim, J S; Ma, H L; Butler, J; Anton-Culver, H
2000-04-01
Breast cancer risk has been hypothesized to increase with exposure to heterocyclic aromatic amines (HAAs) formed from cooking meat at high temperature. HAAs require enzymatic activation to bind to DNA and initiate carcinogenesis. N-acetyltransferase 2 (NAT2) enzyme activity may play a role, its rate determined by a polymorphic gene. We examined the effect of NAT2 genetic polymorphisms on breast cancer risk from exposure to meat by cooking method, doneness and estimated HAA [2-amino-1-methyl-6-phenylimidazole[4,5-b]pyridine (PhIP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) and 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline (DiMeIQx)] intake. Women were recruited with suspicious breast masses and questionnaire data were collected prior to biopsy to blind subjects and interviewers to diagnoses. For 114 cases with breast cancer and 280 controls with benign breast disease, NAT2 genotype was determined using allele-specific PCR amplification to detect slow acetylator mutations. HAAs were estimated from interview data on meat type, cooking method and doneness, combined with a quantitative HAA database. Logistic regression models controlled for known risk factors, first including all controls, then 108 with no or low risk (normal breast or no hyperplasia) and finally 149 with high risk (hyperplasia, atypical hyperplasia, complex fibroadenomas). Meat effects were examined within NAT2 strata to assess interactions. We found no association between NAT2 and breast cancer. These Californian women ate more white than red meat (control median 46 versus 8 g/day). There were no significant associations of breast cancer with red meat for any doneness. White meat was significantly protective (>67 versus chicken, including well done, pan fried and barbecued chicken. MeIQx and DiMeIQx were not associated with breast cancer. A protective effect of PhIP was confounded after controlling for well done chicken. Results were unchanged using low or high risk controls or dropping
Extracts of medicinal plants as functional beer additives
Directory of Open Access Journals (Sweden)
Đorđević Sofija
2016-01-01
Full Text Available This paper is based on determining the level of the antioxidant activity of beer, to which sensory acceptable amounts of selected extracts of medicinal plants were added, with the aim of obtaining a beer with increased functional and new sensory features. For purposes of this study a commercial lager beer type Pils and extracts of herbal drugs: Melissae folium, Thymi herba, Juniperi fructus, Urticae radix and Lupuli strobuli, were used. Total phenols were analyzed by the method of Folin-Ciocalteu, and the antioxidant activity of samples using FRAP and DPPH test. Sensory evaluation of beer was conducted on 80 subjects, using a nine levels hedonic scale. The results showed that the content of total phenols was the highest in the beer which thyme, juniper and lemon balm were added to (384.22, 365.38 and 363.08 mg GAE/L, respectively, representing the increase of 37.09, 30.36 and 29.55% (respectively compared to the commercial lager beer. Values of antioxidant activity were correlated with the content of total phenols. The extract of lemon balm blended in the best manner with the baseline, commercial lager beer in terms of sensory acceptability. New beer, enriched with lemon balm, had a pleasant, appealing and harmonious flavor and aroma.
Nuclear waste - where to go?; Atommuell - wohin?
Energy Technology Data Exchange (ETDEWEB)
Dornsiepen, Ulrich
2015-07-01
The question of the final di9sposal of nuclear waste is a problem of international importance. The solution of the problem is of increasing urgency; the discussion is controversial and implies a lot of emotions. In Germany there is consensus that the nuclear wastes have to be disposed within the country in deep geological formations. This kind of final disposal is predominantly a geological problem and has to be solved from the geological point of view. The geologist Ulrich Dornsiepen presents the problems of the final disposal in an objective way without ideology and generally understandable. Such a presentation is necessary since the public information and participation is demanded but the open geological questions and their scientific solutions are never explained for the public. [German] Die Frage der endgueltigen Lagerung von Atommuell ist ein Problem von nationaler Tragweite, dessen Loesung immer dringender wird, bisher aber sehr kontrovers diskutiert wird und mit vielen Emotionen verknuepft ist. Es besteht in Deutschland ein Konsens, diese Abfaelle innerhalb der Landesgrenzen dauerhaft in tief liegenden Gesteinsschichten abzulagern. Diese Art der Endlagerung ist aber in erster Linie ein geologisches Problem und so auch nur von geologischer Seite her zu loesen. Daher stellt der Geologe Ulrich Dornsiepen die Problematik der Endlagerung objektiv, ideologiefrei und allgemein verstaendlich dar. Ein solches Hoerbuch ist dringend noetig, da zwar die Information und Beteiligung breiter, betroffener Bevoelkerungsteile eingefordert, aber niemals versucht wird, die offenen geologischen Fragen und ihre wissenschaftliche Loesung verstaendlich zu machen.
Grundlagen der Nachrichtenübertragung
Plaßmann, Wilfried
Die Nachrichtentechnik hat die Aufgabe, Nachrichten auszutauschen. Nachrichten sind z. B. Fragen, Beobachtungen und Befehle. Unter dem Begriff Nachrichtenübertragung wird hier die elektrische Nachrichtenübertragung verstanden, denn zur Übermittlung von Nachrichten werden Spannungen und Ströme sowie elektrische und magnetische Felder eingesetzt. Die Übertragung beginnt mit der Nachrichtenquelle, die die Nachrichten aussendet, und endet mit der Nachrichtensenke, die sie empfängt. Zwischen beiden liegt das elektrische Nachrichtenübertragungssystem, dessen Funktionseinheiten dargestellt sind und erläutert werden.
Chen, Xin; Zhang, Dong; Lu, Yin-hao; Zheng, Wei-wei; Wu, Yu-xin; Wei, Xiao; Tian, Da-jun; Wang, Xia; Zhang, Hao; Guo, Shuai; Jiang, Song-hui; Qu, Wei-dong
2010-10-01
To investigate the pollutant levels of regulated disinfection by-products trihalomethanes (THMs) and haloacetic acids (HAAs) in raw water from the Huangpu River, the Yangtze River and different treatment processes and finished water, and to explore the changes tendency in transmission and distribution pipeline network. A total of 65 ml water samples with two replicates were collected from different raw water, corresponding treatment processes, finished water and six national surveillance points in main network of transmission and distribution, water source for A water plant and B, C water plant was the Huangpu River and the Yangtze River, respectively. Regulated THMs and HAAs above water samples were detected by gas chromatography. The total trihalomethanes (THM(4)) concentration in different treatment processes of A water plant was ND-9.64 µg/L, dichlorobromomethane was the highest (6.43 µg/L). The THM(4) concentration in B and C water plant was ND to 38.06 µg/L, dibromochloromethane (12.24 µg/L) and bromoform (14.07 µg/L) were the highest in the B and the C water plant respectively. In addition to trichloroacetic acid in A water plant from the raw water, the other HAAs came from different treatment processes. The total haloacetic acids (HAA(6)) concentration of different treated processes in A water plant was 3.21 - 22.97 µg/L, mobromoacetic acid (10.40 µg/L) was the highest. Dibromoacetic acid was the highest both in B (8.25 µg/L) and C (8.84 µg/L) water plant, HAA(6) concentration was ND to 27.18 µg/L. The highest and the lowest concentration of THM(4) were found from the main distribution network of C and A water plant respectively, but the concentration of HAA(6) in the main water pipes network of A water plant was the highest, and the lowest in C water plant. The THMs concentration was 21.11 - 31.18 µg/L in C water plant and 6.72 - 8.51 µg/L in A water plant. The concentration of HAA(6) was 25.02 - 37.31 µg/L in A water plant and 18.69 - 23
Directory of Open Access Journals (Sweden)
Chin-Fu Cheng
2012-01-01
Full Text Available Hemagglutinating proteins (HAPs were purified from Poker-chip Venus (Meretrix lusoria and Corbicula clam (Corbicula fluminea using gel-filtration chromatography on a Sephacryl S-300 column. The molecular weights of the HAPs obtained from Poker-chip Venus and Corbicula clam were 358 kDa and 380 kDa, respectively. Purified HAP from Poker-chip Venus yielded two subunits with molecular weights of 26 kDa and 29 kDa. However, only one HAP subunit was purified from Corbicula clam, and its molecular weight was 32 kDa. The two Poker-chip Venus HAPs possessed hemagglutinating ability (HAA for erythrocytes of some vertebrate animal species, especially tilapia. Moreover, HAA of the HAP purified from Poker-chip Venus was higher than that of the HAP of Corbicula clam. Furthermore, Poker-chip Venus HAPs possessed better HAA at a pH higher than 7.0. When the temperature was at 4°C–10°C or the salinity was less than 0.5‰, the two Poker-chip Venus HAPs possessed better HAA compared with that of Corbicula clam.
Halogenating reaction activity of aromatic organic compounds during disinfection of drinking water
International Nuclear Information System (INIS)
Guo Gaimei; Chen Xiaodong
2009-01-01
The halogenating reactions of five aromatic organic compounds (AOCs) with aqueous chlorine (HOCl/OCl - ) and aqueous bromine (HOBr/OBr - ) were studied with an aim to compare the formation properties of haloacetic acids (HAAs) for the corresponding chlorination or bromination reactions of AOCs, respectively. The experiment results indicated that the HAAs substitution efficiency for the bromination reactions of AOCs was greater than that for the chlorination reactions, and the formation of HAAs had a strong dependence on the chemical structure of AOCs. The chlorination or bromination reaction activities for the AOCs with electron donating functional groups were higher than that for them with electron withdrawing functional groups. The kinetic experiments indicated that the reactions of aqueous bromine with phenol were faster than those of aqueous chlorine with phenol and the halogen consumption exhibited rapid initial and slower consumption stages for the reactions of phenol with aqueous chlorine and bromine, respectively. In addition, the HAAs production for the chlorination reaction of phenol decreased with the increase of pH. These conclusions could provide the valuable information for the effective control of the disinfection by-products during drinking water treatment operation
Drijfmesttoediening op klei in voorjaar mogelijk
Pol-van Dasselaar, van den A.; Everts, H.
2001-01-01
Voor de teelt van maos op kleigrond kan toediening van drijfmest uitgesteld worden tot het voorjaar. Voordelen hiervan zijn een betere benutting van de mineralen, minder mineralenverliezen en een lager stikstofoverschot.
Family Reintegration Following Guard Deployment
2010-09-20
Somalia Peacekeepers. Journal of Consulting and Clinical Psychology, 72(5), 909-913. Haas DM . Pazdernik LA. Olsen CH. A cross-sectional survey of the...relationship between partner deployment and stress in pregnancy during wartime. Haas DM . Pazdernik LA. Partner deployment and stress in pregnant...Identify 3-5 key words relating to the proposal. (Required) I used MESH Headings instead of the CRISP Thesaurus for key
Separation of beryllium and mercury from lithium chloride solution by gaseous extraction
International Nuclear Information System (INIS)
Sevast'yanov, A.I.; Chepovol, V.I.
1989-01-01
The possibility is shown of extracting beryllium and mercury by acetylacetone (HAA) from lithium chloride solution by passing argon through the solution and the optimum conditions have been determined. The dependence of the degree of extraction and the distribution coefficients on various parameters of the liquid phase are presented, viz. the initial pH value, the lithium chloride concentration, and the initial HAA content
Prieto-Blanco, M C; Alpendurada, M F; López-Mahía, P; Muniategui-Lorenzo, S; Prada-Rodríguez, D; Machado, S; Gonçalves, C
2012-05-30
Haloacetic acids (HAAs) are organic pollutants originated from the drinking water disinfection process, which ought to be controlled and minimized. In this work a method for monitoring haloacetic acids (HAAs) in water samples is proposed, which can be used in quality control laboratories using the techniques most frequently available. Among its main advantages we may highlight its automated character, including minimal steps of sample preparation, and above all, its improved selectivity and sensitivity in the analysis of real samples. Five haloacetic acids (HAA5) were analyzed using solid-phase extraction (SPE) combined with ion-pair liquid chromatography and tandem mass spectrometry. For the optimization of the chromatographic separation, two amines (triethylamine, TEA and dibutylamine, DBA) as ion pair reagents were compared, and a better selectivity and sensitivity was obtained using DBA, especially for monohaloacetic acids. SPE conditions were optimized using different polymeric adsorbents. The electrospray source parameters were studied for maximum precursor ion accumulation, while the collision cell energy of the triple quadrupole mass spectrometer was adjusted for optimum fragmentation. Precursor ions detected were deprotonated, dimeric and decarboxylated ions. The major product ions formed were: ionized halogen atom (chloride and bromide) and decarboxylated ions. After enrichment of the HAAs in Lichrolut EN adsorbent, the limits of detection obtained by LC-MS/MS analysis (between 0.04 and 0.3 ng mL(-1)) were comparable to those obtained by GC-MS after derivatization. Linearity with good correlation coefficients was obtained over two orders of magnitude irrespective of the compound. Adequate recoveries were achieved (60-102%), and the repeatability and intermediate precision were in the range of 2.4-6.6% and 3.8-14.8%, respectively. In order to demonstrate the usefulness of the method for routine HAAs monitoring, different types of water samples were
Builenbrand geeft opbrengst- en kwaliteitsverlies bij snijmais
Wel, van der C.
1994-01-01
In sterk aangetaste maos moet de voederwaarde met in-vitro-onderzoek worden vastgesteld. Door het lagere drogestofgehalte van aangetaste planten zijn de verliezen in de kuil groter dan bij een gezond gewas.
Mayring, Philipp
1985-01-01
Der Beitrag beschreibt einen Ansatz systematischer, regelgeleiteter qualitativer Analyse von Text, der methodische Stärken der quantitativen Inhaltsanalyse teilweise übernimmt und zu einem qualitativ orientierten Instrumentarium ausweitet. Dazu werden historische Entwicklungslinien der Inhaltsanalyse aufgezeigt und die Grundlagen der Technik (Analyseeinheiten, Schrittmodelle, Arbeiten mit Kategoriensystemen, Gütekriterien) expliziert. Schließlich werden an Techniken Qualitativer Inhaltsanalys...
Embolization of Isolated Hypogastric Artery Aneurysm: A Case Report and a Review of the Literature
International Nuclear Information System (INIS)
Medici, Lorenzo de; Bucci, Federico; Nesi, Fabrizio; Rabitti, Giorgio
2006-01-01
A 75-year-old man with arterial hypertension, coronary artery disease, and myocardial infarction was referred to our service because of an asymptomatic hypogastric artery aneurysm (HAA) detected by a routine compued tomography (CT) scan. As shown on the angio-CT the maximum transverse diameter (m.t.d.) of the HAA was 47 mm. There were no symptoms of distal embolization or compression on the pelvic structures. We performed the successful complete thrombosis of the aneurysm using vascular plugs via a controlateral femoral approach. The control angiogram was satisfactory and there were no intraoperative complications. A CT-angiography done 4 months after the procedure showed no signs of refilling of the aneurysm sac. This case illustrates some possible advantages of vascular plugs in the treatment of isolated HAA
GRAPHICAL DETERMINATION OF DISSOCIATION CONSTANT ...
African Journals Online (AJOL)
DR. AMINU
conform to the general equation of straight – line graph; y = mx + c, where y = pH, m = slope, x = log. [HA]/[A] and C = intercept = pKa. Thus the pKa is obtained as the intercept of the graph of pH versus – log [HA]/[A] as shown in Figures 1,2 and 3 for glycine, alanine and valine respectively. The values obtained were 9.87 ...
Sack, Coralynn S; Doney, Brent C; Podolanczuk, Anna J; Hooper, Laura G; Seixas, Noah S; Hoffman, Eric A; Kawut, Steven M; Vedal, Sverre; Raghu, Ganesh; Barr, R Graham; Lederer, David J; Kaufman, Joel D
2017-10-15
The impact of a broad range of occupational exposures on subclinical interstitial lung disease (ILD) has not been studied. To determine whether occupational exposures to vapors, gas, dust, and fumes (VGDF) are associated with high-attenuation areas (HAA) and interstitial lung abnormalities (ILA), which are quantitative and qualitative computed tomography (CT)-based measurements of subclinical ILD, respectively. We performed analyses of participants enrolled in MESA (Multi-Ethnic Study of Atherosclerosis), a population-based cohort aged 45-84 years at recruitment. HAA was measured at baseline and on serial cardiac CT scans in 5,702 participants. ILA was ascertained in a subset of 2,312 participants who underwent full-lung CT scanning at 10-year follow-up. Occupational exposures were assessed by self-reported VGDF exposure and by job-exposure matrix (JEM). Linear mixed models and logistic regression were used to determine whether occupational exposures were associated with log-transformed HAA and ILA. Models were adjusted for age, sex, race/ethnicity, education, employment status, tobacco use, and scanner technology. Each JEM score increment in VGDF exposure was associated with 2.64% greater HAA (95% confidence interval [CI], 1.23-4.19%). Self-reported vapors/gas exposure was associated with an increased odds of ILA among those currently employed (1.76-fold; 95% CI, 1.09-2.84) and those less than 65 years old (1.97-fold; 95% CI, 1.16-3.35). There was no consistent evidence that occupational exposures were associated with progression of HAA over the follow-up period. JEM-assigned and self-reported exposures to VGDF were associated with measurements of subclinical ILD in community-dwelling adults.
Energy Technology Data Exchange (ETDEWEB)
Seifert, B. [Umweltbundesamt Berlin (Germany). Inst. fuer Wasser-, Boden- und Lufthygiene
1999-03-01
The article discusses the existing bases for the derivation and use of assessment criteria for TVOC concentrations. For enhanced understanding, some aspects of VOC analytics are dealt with beforehand. (orig./MG) [Deutsch] Im vorliegenden Artikel werden die vorhandenen Grundlagen fuer die Ableitung und Verwendung von Bewertungskriterien fuer TVOC-Konzentrationen diskutiert. Zum besseren Verstaendnis werden einleitend einige Aspekte der VOC-Analytik eroertert. (orig/MG)
Schlögl, Andreas E.
2007-01-01
Theoretische Grundlagen zur temperaturabhängigen Modellbildung bipolarer Leistungshalbleiter wurden untersucht, optimiert und validiert. Basierend auf der neuen Formulierung von Trägerbeweglichkeiten nach Mnatsakanov wurde eine neue Kontinuitätsgleichung zur Beschreibung des bipolaren Stromtransports in schwach dotierten Driftzonen hergeleitet und charakterisiert. Ein vollständiges Leistungsdioden-Modell wurde erstellt. Zur temperaturabhängigen Validierung wurden experimentelle Techniken entw...
Beek, C.L.; Heinen, M.; Clevering, O.A.; Kleef, van J.
2005-01-01
Gedurende twee uitspoelseizoenen zijn hydrologische en chemische bepalingen uitgevoerd in een grasbufferstrook en in de aangrenzende akker op een akkerbouwbedrijf op zandgrond. Nitraatconcentraties in het (bovenste) grondwater waren lager onder de bufferstrook dan onder de akker. Stabiele
Effect of Growth Conditions on Flocculation and Cell Surface Hydrophobicity of Brewing Yeast
Czech Academy of Sciences Publication Activity Database
Kopecká, J.; Němec, M.; Matoulková, D.; Čejka, P.; Jelínková, Markéta; Felsberg, Jürgen; Sigler, Karel
2015-01-01
Roč. 73, č. 2 (2015), s. 143-150 ISSN 0361-0470 Institutional support: RVO:61388971 Keywords : Ale and lager yeast * Cell surface hydrophobicity * FLO genes Subject RIV: EI - Biotechnology ; Bionics Impact factor: 0.492, year: 2015
Energy Technology Data Exchange (ETDEWEB)
Serrano, Maria; Montesinos, Isabel; Cardador, M.J.; Silva, Manuel; Gallego, Mercedes, E-mail: mercedes.gallego@uco.es
2015-06-01
In this work, we studied a total of 46 regulated and non-regulated disinfection by-products (DBPs) including 10 trihalomethanes (THMs), 13 haloacetic acids (HAAs), 6 halonitromethanes (HNMs), 6 haloacetonitriles (HANs) and 11 aldehydes at different points in a drinking water treatment plant (DWTP) and its distribution network. Determining an increased number of compounds and using accurate, sensitive analytical methodologies for new DBPs can be useful to overcome some challenges encountered in the comprehensive assessment of the quality and safety of drinking water. This paper provides a detailed picture of the spatial and seasonal variability of DBP concentrations from raw water to distribution network. Samples were collected on a monthly basis at seven different points in the four seasons of a year to acquire robust data for DBPs and supplementary quality-related water parameters. Only 5 aldehydes and 2 HAAs were found in raw water. Chlorine dioxide caused the formation of 3 new aldehydes (benzaldehyde included), 5 HAAs and chloroform. The concentrations of DBPs present in raw water were up to 6 times higher in the warmer seasons (spring and summer). The sedimentation process further increased their concentrations and caused the formation of three new ones. Sand filtration substantially removed aldehydes and HAAs (15–50%), but increased the levels of THMs, HNMs and HANs by up to 70%. Chloramination raised the levels of 8 aldehydes and 7 HAAs; also, it caused the formation of monoiodoacetic acid, dibromochloromethane, dichloroiodomethane and bromochloroacetonitrile. Therefore, this treatment increases the levels of existing DBPs and leads to the formation of new ones to a greater extent than does chlorine dioxide. Except for 5 aldehydes, the 23 DBPs encountered at the DWTP exit were found at increased concentrations in the warmer seasons (HAAs by about 50% and THMs by 350%). - Highlights: • Occurrence of 46 regulated and non-regulated DBPs through a DWTP was
International Nuclear Information System (INIS)
Serrano, Maria; Montesinos, Isabel; Cardador, M.J.; Silva, Manuel; Gallego, Mercedes
2015-01-01
In this work, we studied a total of 46 regulated and non-regulated disinfection by-products (DBPs) including 10 trihalomethanes (THMs), 13 haloacetic acids (HAAs), 6 halonitromethanes (HNMs), 6 haloacetonitriles (HANs) and 11 aldehydes at different points in a drinking water treatment plant (DWTP) and its distribution network. Determining an increased number of compounds and using accurate, sensitive analytical methodologies for new DBPs can be useful to overcome some challenges encountered in the comprehensive assessment of the quality and safety of drinking water. This paper provides a detailed picture of the spatial and seasonal variability of DBP concentrations from raw water to distribution network. Samples were collected on a monthly basis at seven different points in the four seasons of a year to acquire robust data for DBPs and supplementary quality-related water parameters. Only 5 aldehydes and 2 HAAs were found in raw water. Chlorine dioxide caused the formation of 3 new aldehydes (benzaldehyde included), 5 HAAs and chloroform. The concentrations of DBPs present in raw water were up to 6 times higher in the warmer seasons (spring and summer). The sedimentation process further increased their concentrations and caused the formation of three new ones. Sand filtration substantially removed aldehydes and HAAs (15–50%), but increased the levels of THMs, HNMs and HANs by up to 70%. Chloramination raised the levels of 8 aldehydes and 7 HAAs; also, it caused the formation of monoiodoacetic acid, dibromochloromethane, dichloroiodomethane and bromochloroacetonitrile. Therefore, this treatment increases the levels of existing DBPs and leads to the formation of new ones to a greater extent than does chlorine dioxide. Except for 5 aldehydes, the 23 DBPs encountered at the DWTP exit were found at increased concentrations in the warmer seasons (HAAs by about 50% and THMs by 350%). - Highlights: • Occurrence of 46 regulated and non-regulated DBPs through a DWTP was
Grosse Axiallager mit Hybridschmierung - Theoretische und experimentelle Betrachtungen
DEFF Research Database (Denmark)
Santos, Ilmar; Fuerst, Axel
2003-01-01
Der vorliegende Artikel praesentiert die Simulation eines grossen axialen Kippsegmentlagers unter Beruecksichtigung der hybriden Schmierung, d.h. gleichzeitige hydrodynamische und hydrostatische Schmierung. Ein Vergleich mit Messungen zeigt, dass fuer das betrachtete Lager mit 2,2 m Durchmesser die...
Quantifying biometric life insurance risks with non-parametric smoothing methods
Tomas, J.
2013-01-01
Julien Tomas beschrijft verdelingsvrije afrondingsmethoden van de sterfte-ervaring bij levensverzekeringen. Net als parametrische methoden neigen ook deze methoden naar onzuivere schattingen, maar zodanig dat het mogelijk is een grotere onzuiverheid op te laten wegen tegen een lagere
2010-04-01
... by volume shall bear the class designations “beer”, “lager beer”, “lager”, “ale”, “porter”, or “stout... high temperature, possessing the characteristics generally attributed to “ale,” “porter,” or “stout...
2011-12-01
Silberg , David J. Haas w ^m^e^ä^ Approved for Public Release; distribution is unlimited. f REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188...PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Eric Silberg , David Haas 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 99-2-5300-010-12 17...THIS PAGE UNCLASSIFIED 17. LIMITATION OF ABSTRACT UL 18. NUMBER OF PAGES 2 7 19a. NAME OF RESPONSIBLE PERSON Eric Silberg 19b. TELEPHONE
DEFF Research Database (Denmark)
Rodriguez De Turco, Elena B; Jackson, Fannie R; DeCoster, Mark A
2002-01-01
The lipid mediators generated by phospholipases A(2) (PLA(2)), free arachidonic acid (AA), eicosanoids, and platelet-activating factor, modulate neuronal activity; when overproduced, some of them become potent neurotoxins. We have shown, using primary cortical neuron cultures, that glutamate...... and secretory PLA(2) (sPLA(2)) from bee venom (bv sPLA(2)) and Taipan snake venom (OS2) elicit synergy in inducing neuronal cell death. Low concentrations of sPLA(2) are selective ligands of cell-surface sPLA(2) receptors. We investigated which neuronal arachidonoyl phospholipids are targeted by glutamate......) and in minor changes in other phospholipids. A similar profile, although of greater magnitude, was observed 20 hr posttreatment. Glutamate (80 microM) induced much less mobilization of (3)H-AA than did sPLA(2) and resulted in a threefold greater degradation of (3)H-AA PE than of (3)H-AA PC by 20 hr...
Dietary exposure to heterocyclic amines in a Chinese population.
Wong, Kin-Yoke; Su, Jin; Knize, Mark G; Koh, Woon-Puay; Seow, Adeline
2005-01-01
Heterocyclic aromatic amines (HAAs) formed in meat during high-temperature cooking have been associated with risk of colorectal and breast cancer. Incidence of these cancers is increasing in Singapore, a country with 77% ethnic Chinese. The purpose of this study was to estimate HAA levels in the Chinese diet and individual levels of exposure to these compounds because little is known. Twenty-five samples (each pooled from three sources) of meat and fish, cooked as commonly consumed, were analyzed by high-performance liquid chromatography for concentrations (ng/g) of 2-amino-3-methylimidazo[4,5-f]quinoline, 2-amino-3, 4-dimethylimidazo[4,5-f]quinoline (MeIQ), 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3, 4,8-trimethylimidazo[4,5-f]quinoxaline (4,8-DiMeIQx), 2- amino-3,7,8-trimethylimidazo[4,5-f]quinoxaline, 2-amino -1,6-dimethylfuro[3,2-e]imidazo[4,5-b]pyridine, and 2- amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). Dietary meat consumption data (g/day), including meat type and cooking method, were gathered from food-frequency questionnaires completed by 497 randomly sampled Chinese men and women aged 20-59 yr. PhIP, MeIQx, and 4,8-DiMeIQx were the most abundant HAAs detected. Total HAA concentrations ranged from roasted pork had the highest levels. The estimated mean daily exposure to HAA was 49.95 ng/day (P10 14.0 ng/day, P90 95.8 ng/day); this was 50% higher among younger (20-39 yr) compared with older individuals. Seven specific meat-cooking method combinations contributed 90.1% of this intake, namely, pan-fried fish, pork, and chicken, deep-fried chicken as well as fish, roasted/barbecued pork, and grilled minced beef.
Longitudinale studie naar de aanwezigheid van legionella en amoeben in drinkwaterinstallaties
Schalk JAC; Redeker S; Docters van Leeuwen AE; Lodder WJ; de Roda Husman AM; LZO; cib
2012-01-01
In Nederland wordt bij prioritaire instellingen met collectieve leidingwaterinstallaties, zoals ziekenhuizen en verzorgingstehuizen, twee keer per jaar gecontroleerd of legionella in de waterleidingen aanwezig is. De concentratie legionellabacteriën in het water moet wettelijk lager zijn dan 100
Parvez, Shahid; Frost, Kali; Sundararajan, Madhura
2017-05-20
In the absence of shorter term disinfectant byproducts (DBPs) data on regulated Trihalomethanes (THMs) and Haloacetic acids (HAAs), epidemiologists and risk assessors have used long-term annual compliance (LRAA) or quarterly (QA) data to evaluate the association between DBP exposure and adverse birth outcomes, which resulted in inconclusive findings. Therefore, we evaluated the reliability of using long-term LRAA and QA data as an indirect measure for short-term exposure. Short-term residential tap water samples were collected in peak DBP months (May-August) in a community water system with five separate treatment stations and were sourced from surface or groundwater. Samples were analyzed for THMs and HAAs per the EPA (U.S. Environmental Protection Agency) standard methods (524.2 and 552.2). The measured levels of total THMs and HAAs were compared temporally and spatially with LRAA and QA data, which showed significant differences ( p water stations showed higher levels than LRAA or QA. Significant numbers of samples in surface water stations exceeded regulatory permissible limits: 27% had excessive THMs and 35% had excessive HAAs. Trichloromethane, trichloroacetic acid, and dichloroacetic acid were the major drivers of variability. This study suggests that LRAA and QA data are not good proxies of short-term exposure. Further investigation is needed to determine if other drinking water systems show consistent findings for improved regulation.
de-Carvalho, Jorge; Rodrigues, Rogério M M; Tomé, Brigitte; Henriques, Sílvia F; Mira, Nuno P; Sá-Correia, Isabel; Ferreira, Guilherme N M
2014-04-21
A novel quartz crystal microbalance (QCM) analytical method is developed based on the transmission line model (TLM) algorithm to analyze the binding of transcription factors (TFs) to immobilized DNA oligoduplexes. The method is used to characterize the mechanical properties of biological films through the estimation of the film dynamic shear moduli, G and G, and the film thickness. Using the Saccharomyces cerevisiae transcription factor Haa1 (Haa1DBD) as a biological model two sensors were prepared by immobilizing DNA oligoduplexes, one containing the Haa1 recognition element (HRE(wt)) and another with a random sequence (HRE(neg)) used as a negative control. The immobilization of DNA oligoduplexes was followed in real time and we show that DNA strands initially adsorb with low or non-tilting, laying flat close to the surface, which then lift-off the surface leading to final film tilting angles of 62.9° and 46.7° for HRE(wt) and HRE(neg), respectively. Furthermore we show that the binding of Haa1DBD to HRE(wt) leads to a more ordered and compact film, and forces a 31.7° bending of the immobilized HRE(wt) oligoduplex. This work demonstrates the suitability of the QCM to monitor the specific binding of TFs to immobilized DNA sequences and provides an analytical methodology to study protein-DNA biophysics and kinetics.
Gibis, Monika; Weiss, Jochen
2017-08-15
Microcrystalline cellulose (MCC) or carboxymethyl cellulose (CMC) can be used as fat replacers; both are nondigestible fibers. As water-holding compounds, the impact of added CMC or MCC was studied concerning the formation of heterocyclic amines (HAAs). Low-fat patties with 0.5-3% MCC/CMC were prepared using 90% of beef and 10% of an aqueous fiber dispersion and were determined for HAA-levels after grilling. The HAAs in patties containing CMC(MCC) were found in the following concentrations; MeIQx (2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline) 0.6-2.7 (0.9-3.3)ng/g, 4,8-DiMeIQx (2-Amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline) n.d.-1.5 (n.d.-2.2)ng/g and PhIP (2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine) 0.03-0.3 (0.06-0.2)ng/g. The patties clearly contained lower HAA-levels with increasing addition of CMC or MCC. A continuous increase of the concentrations of comutagenic harman was observed (CMC: 1.2-13.2; MCC: 5.2-11.4ng/g) for increasing levels of fibers and a slight decrease of the content of norharman for MCC (0.5-1.6ng/g). No clear tendency was found for norharman using CMC (0.3-1.1ng/g). Copyright © 2017 Elsevier Ltd. All rights reserved.
Fundamentals of mechatronics; Grundlagen der Mechatronik
Energy Technology Data Exchange (ETDEWEB)
Bernstein, H.
2000-07-01
Mechatronics combines the disciplines of electrotechnics, electronics, computer science, mechanical engineering, design, pneumatics, hydraulics and process engineering, and the book addresses students and experts in all these fields. It comprises a CD which runs on PC under Windows and illustrates the theory of mechatronics and presents examples. [German] Die Mechatronik (Kunstwort aus Mechanik und Elektronik) stellt die technische Verbindung zwischen den Fachdisziplinen Elektrotechnik, Elektronik, Informatik, Maschinenbau, Antriebstechnik, Konstruktion, Pneumatik, Hydraulik und Verfahrenstechnik dar, und dementsprechend ist dieses Buch auf das Studium bzw. das Berufbild der einzelnen Aufgabenfelder abgestimmt. Durch die Bauelemente der analogen bzw. digitalen Schaltungstechnik und der Leistungselektronik wurden die Voraussetzungen fuer die Mechatronik in der Automatisierungstechnik geschaffen, die in der Industrie nicht nur zu einer Produktionssteigerung fuehrten, sondern auch die Herstellungsgenauigkeit der Fabrikate wesentlich erhoehten. Durch die Programme auf den beiden dem Buch beiliegenden CD-ROM laesst sich die Theorie der mechatronischen Teilgebiete direkt am PC unter Windows simulieren. Anhand kurzer, aussagekraeftiger Simulationsbeispiele werden die grundlegenden bzw. weiterentwickelten Elemente der Mechatronik gezeigt. Ob in der Antriebstechnik oder in der elektrischen Schaltungstechnik, alle Versuche lassen sich komplett und einfach simulieren und veraendern, so dass jeder Lernschritt nachvollziehbar ist. (orig.)
Selektion und Qualifikation von non-professionellen Helfern für die psychologische Nothilfe
Hersberger, Johanna
2006-01-01
Mit der Vereinbarung einer Zusammenarbeit zwischen dem Bundesamt für Bevölkerungsschutz (BABS) und der Föderation der Schweizer Psychologinnen und Psychologen (FSP) vom Oktober 2000 wurden die Grundlagen für die gemeinsame Ausbildung von non-professionellen Helfern in psychologischer Nothilfe gelegt. Ausgehend von einer heterogenen Ausbildungslandschaft und uneinheitlichen Einsatzgepflogenheiten hatte die Kooperation BABS/FSP den Anspruch, nicht nur eine den wissenschaftlich...
Nonlinear terahertz spectroscopy in one and two dimensions
Kühn, Wilhelm
2011-01-01
Die vorliegende Dissertation behandelt Grundlagen und Anwendungen der nichtlinearen Terahertzspektrospie (THz). Diese Arbeit zeigt erstmalig, dass sich die Inversion des Quantenkaskadenlasers nach einer Störung schon innerhalb von hundert Femtosekunden wieder erholt. Außerdem wurde der exakte Generationsprozess von THz Impulsen in einem Laser-induzierten zwei-Farben Plasma untersucht. Durch Vergleich mit Simulationen wird eindeutig der Ionisationsstrom im Plasma als Quelle der THz Strahlung i...
Energy Technology Data Exchange (ETDEWEB)
Holzmann, Gerhard; Wangelin, Matthias; Bruns, Rainer
2012-07-01
The book discusses all relevant renewable constructional materials made from fibre or dyeing plants along with their physical and chemical fundamentals. Protection of resources, environmental protection, and pollutants in constructional materials are gone into as well. [German] Dieses Buch behandelt alle wichtige nachwachsenden, pflanzlichen Baustoffe aus Faser- und Faerberpflanzen sowie dazugehoerige physikalische und chemische Grundlagen. Angesprochen werden auch Ressourcen- und Umweltschutz sowie Schadstoffe aus Bauprodukten.
Feddersen, Lars Harald
2010-01-01
DIE DARSTELLUNG RUDOLF VIRCHOWS IN DER VOSSISCHEN ZEITUNG IM ZEITRAUM VOM 1. JANUAR 1844 BIS ZUM 31. DEZEMBER 1865 Rudolf Virchow erforschte u.a. als Pathologe, Hygieniker, Anthropologe, Ethnologe und Prähistoriker bedeutende Grundlagen der modernen Wissenschaft. Diese vielschichtigen Tätigkeitsbereiche zeichnen ihn als einen der bedeutendsten Wissenschaftler v.a. der Medizingeschichte aus. Als Politiker engagierte sich Virchow in erster Linie im sozial- und gesellschaftspolitischen Bereich. ...
Post, van der C.J.; Knies, P.; Koning, de A.N.M.
1987-01-01
Het onderzoek spitste zich toe op: toepassingsmogelijkheden van water met een temperatuur van 40 graden Celsius of lager bij teelten van groente- en bloemisterijgewassen in de grond; wortel- en luchttemperatuurregimes bij verwarming van potplanten via verwarmde tabletten; en warmte en
Prospects for Closer Israeli-NATO Cooperation
2015-09-01
Actions and Arab Perceptions.” In The Middle East and the United States, 5th ed., edited by David W. Lesch and Mark L. Haas, 177–96. Boulder, CO...Ibid. 110 David W. Lesch, Mark L. Haas, eds., The Middle East and the United States, 5th ed. (Boulder, CO, Westview Press, 2014), 2 21 beginning...to Israel in 2005, NATO Secretary General Jaap de Hoop Scheffer stated, “the interplay of Middle Eastern and transatlantic security is becoming
International Nuclear Information System (INIS)
2011-03-01
As a preliminary action ahead of Stage 2 in the Sectoral Plan 'Deep Geological Disposal' ('Sachplan Geologische Tiefenlager': SGT) the bodies in charge of the management of the radioactive wastes have to determine, together with the Swiss Federal Nuclear Safety Inspectorate (ENSI), which complementary investigations are needed for the provisional safety assessment of the foreseen repositories. In particular, comparisons between the different sites must be possible. If some doubts remain, new investigations have to be conducted. In SGT Stage 1 the National Cooperative for the Disposal of Radioactive Waste (NAGRA) stated that a time period of 100'000 years shall be considered for the storage of low- and intermediate-level radioactive wastes (SMA) and of 1 million years for the storage of high-level wastes (HAA). In SGT Stage 2, considerations about possible modifications of the biosphere during the considered time periods for SMA as well as for HAA have to be included. In what regards the host rock, ENSI declares that the dataset describing the Opalinus clay is sufficient for the site-specific safety analyses. What regards the Wellenberg site for a SMA repository, ENSI has earlier analysed the license request of the NAGRA. For the Mergel formations of the Helveticum, NAGRA conducted a complete safety analysis. ENSI considers the knowledge acquired for these rock types as sufficient for the technical safety comparisons in SGT Stage 2. The knowledge of the rock 'Brauner Dogger' is correct but some more information about the lithostratigraphy and the biostratigraphy is requested. The understanding of the effect of the rock density reduction on the hydraulic conductibility of Opalinus clay and Mergel formations is accurate enough for the comparisons in SGT Stage 2. For the 'Brauner Dogger', comparable data are missing, but the proposed thickness of 300 m of the host rock offers a sufficient protection against density reduction effects. Concerning the behaviour of the
International Nuclear Information System (INIS)
Tan, Connieal; Wang, Yiru; Deng, Zhuo; Xu, Na; Song, Xinhong; Liu, Haihong; Rong, Mingcong; Chen, Xi
2014-01-01
We report on a preconcentration disk for the determination of trace amounts of heterocyclic aromatic amines (HAAs) in the groups of quinoline and quinoxaline congeners as possible human carcinogens. The disk is based on nanocomposite (NC) prepared from graphene oxide as the precursor and from gold nanoparticles that act as building blocks to form a three-dimensional NC. If deposited in the sampling valve of a HPLC system, the material displays excellent extraction capability for HAAs owing to its large surface and π-π stacking interaction. Following an optimization of the extraction parameters, the method was successfully applied to the simultaneous determination of polar HAAs in meat samples with detection limit of 0.09 to 0.16 ng g −1 and recoveries of 69.5 to 122.7 %. The disk was used in more than 150 subsequent preconcentration cycles without obvious loss of the absorption capability. The results reveal that this new NC represents an excellent sorbent for purposes of preconcentration. (author)
Andra, Syam S; Makris, Konstantinos C; Botsaris, George; Charisiadis, Pantelis; Kalyvas, Harris; Costa, Costas N
2014-02-15
Changes in disinfectant type could trigger a cascade of reactions releasing pipe-anchored metals/metalloids into finished water. However, the effect of pre-formed disinfection by-products on the release of sorbed contaminants (arsenic-As in particular) from drinking water distribution system pipe scales remains unexplored. A bench-scale study using a factorial experimental design was performed to evaluate the independent and interaction effects of trihalomethanes (TTHM) and haloacetic acids (HAA) on arsenic (As) release from either scales-only or scale-biofilm conglomerates (SBC) both anchored on asbestos/cement pipe coupons. A model biofilm (Pseudomonas aeruginosa) was allowed to grow on select pipe coupons prior experimentation. Either TTHM or HAA individual dosing did not promote As release from either scales only or SBC, detecting water. In the case of scales-only coupons, the combination of the highest spike level of TTHM and HAA significantly (pwater in pipe networks remains to be investigated in the field. Copyright © 2013 Elsevier B.V. All rights reserved.
Metingen in buitenlucht op het RIVM-terrein te Bilthoven na het Fukushima kernongeval in maart 2011
Overwater R; Kwakman P; Twenhofel CJW; Knetsch GJ; Scheele MP; van Velthoven PFJ; le Sager P; Kroonenberg FC; Smetsers RCGM; LSO; mev
2011-01-01
De in Nederland gemeten radioactiviteit uit Japan ligt duizenden keren lager dan tijdens Tsjernobyl en vormt geen risico voor de Nederlandse bevolking. De berekende stralingsdosis door inhalatie van I-131 over de gehele meetperiode bedraagt minder dan 0,00001 millisievert. De stralingsdosis van
Ruiz Nunez, Begona
2018-01-01
We onderzochten de voedingsinname van patiënten die wachtten op een hartoperatie. Innames van groente, fruit, vezels, vitamine D en visolievetzuren (EPA+DHA) bleken lager dan aanbevolen, maar vergelijkbaar met de gezonde Nederlandse bevolking. Hun onevenwichtige voedingspatroon kan het risico op
Cardio-metabolic risk in children prenatally exposed to maternal psychosocial stress
van Dijk, A.E.
2012-01-01
Dertig procent van zwangere vrouwen ervaart symptomen van angst en depressie. Zulke ‘reguliere’ psychosociale stress is geassocieerd met een kortere zwangerschapsduur en een lager geboortegewicht, maar de associaties zijn zwak. Er is geen bewijs gevonden voor de hypothese dat kinderen die worden
Stressoren om rekening mee te houden (deel 1) : vissen en hun gevoeligheden
Leenstra, S.H.; Scheerboom, J.
2014-01-01
Stress verlaagt bij vissen de immunologische weerstand. Men mag daarom verwachten dat na stress ziektes uitbreken, met lagere visproductie, langere groeitijd en hogere voederconversie tot gevolg. Dit is tegen de wens van een viskweker, die streeft naar continue groei, optimale voederconversie en een
Efficient engineering of marker-free synthetic allotetraploids of Saccharomyces.
Alexander, William G; Peris, David; Pfannenstiel, Brandon T; Opulente, Dana A; Kuang, Meihua; Hittinger, Chris Todd
2016-04-01
Saccharomyces interspecies hybrids are critical biocatalysts in the fermented beverage industry, including in the production of lager beers, Belgian ales, ciders, and cold-fermented wines. Current methods for making synthetic interspecies hybrids are cumbersome and/or require genome modifications. We have developed a simple, robust, and efficient method for generating allotetraploid strains of prototrophic Saccharomyces without sporulation or nuclear genome manipulation. S. cerevisiae×S. eubayanus, S. cerevisiae×S. kudriavzevii, and S. cerevisiae×S. uvarum designer hybrid strains were created as synthetic lager, Belgian, and cider strains, respectively. The ploidy and hybrid nature of the strains were confirmed using flow cytometry and PCR-RFLP analysis, respectively. This method provides an efficient means for producing novel synthetic hybrids for beverage and biofuel production, as well as for constructing tetraploids to be used for basic research in evolutionary genetics and genome stability. Copyright © 2015 Elsevier Inc. All rights reserved.
Applications of GIS for the cadaster of dumpsites and the dumpsites evaluation
Directory of Open Access Journals (Sweden)
Igor Šebenik
1992-12-01
necessaru for qualitative remediation programes. There's no documentation data, they are usually lost and only contradictorg oral data are accessable. Technology of GIS seems to be very convenient for dumpsites data managing. The 'dumpsites lager' has to be fully used in environmental GIS. Well developed atribute data base and maps in scale 1:5000 or 1:1OOOO are a good base for a lager construction. A pilot GIS with this data was developed for water protection area of spring Rižana in year 1991. This year an application for data retrieval was developed for the needs of Mininstry for environmental protection and physical planning. Next step in establishing of system for dumpsites monitoring is a development of an expert sgstem for the prioritisation of hazards dumpsites cause, based on the data collected in GIS.
Effect of structural disorder on quantum oscillations in graphite
Energy Technology Data Exchange (ETDEWEB)
Camargo, B. C., E-mail: b.c-camargo@yahoo.com.br; Kopelevich, Y. [Instituto de Fisica Gleb Wataghin, Universidade Estadual de Campinas, Unicamp 13083-970, Campinas, São Paulo (Brazil); Usher, A.; Hubbard, S. B. [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)
2016-01-18
We have studied the effect of structural disorder on the de Haas van Alphen and Shubnikov de Haas quantum oscillations measured in natural, Kish, and highly oriented pyrolytic graphite samples at temperatures down to 30 mK and at magnetic fields up to 14 T. The measurements were performed on different samples characterized by means of x-ray diffractometry, transmission electron microscopy, and atomic-force microscopy techniques. Our results reveal a correlation between the amplitude of quantum oscillations and the sample surface roughness.
Apolin, Martin
2008-01-01
Physik soll verständlich sein und Spaß machen! Deshalb beginnt jedes Kapitel in Big Bang mit einem motivierenden Überblick und Fragestellungen und geht dann von den Grundlagen zu den Anwendungen, vom Einfachen zum Komplizierten. Dabei bleibt die Sprache einfach, alltagsorientiert und belletristisch. Band 8 vermittelt auf verständliche Weise Relativitätstheorie, Kern- und Teilchenphysik (und deren Anwendungen in der Kosmologie und Astrophysik), Nanotechnologie sowie Bionik.
Energy Technology Data Exchange (ETDEWEB)
Maltry, W.; Ziegler, T.; Richter, I.
1997-04-01
The report deals with problems associated with the harnessing of solar energy for drying bulk farm products: technical fundamentals, enthalpy diagrams, models for grain drying, experimental investigations, analysis of drying processes, benefits and applications of drying processes, advances. (HW) [Deutsch] Der Bericht behandelt die Probleme der Solarenergienutzung zur Trockung landwirtschaftlicher Massengueter: - Trocknungstechnische Grundlagen - Enthalpie-Diagramme - Modelle zur Koernertrocknung - experimentelle Untersuchungen - Analyse von Trocknungsprozesse - Nutzen und Verwertbarkeit der Trocknungsprozesse - Fortschritte. (HW)
Betoninstandsetzung unter Wasser : Mörtelentwicklung und Applikationstechniken
Nguyen-Sauerbaum, Lina Phan Anh
2017-01-01
Für die Instandsetzung von Betonbauteilen unter Wasser stehen aktuell keine gängigen Verfahren zur Verfügung, die ohne Trockenlegung oder Einschalen des Bauteils auskommen. Diese Arbeit legt die Grundlagen für eine Betoninstandsetzung unter Wasser ohne Einschalen des Bauwerks. Es wurden neue Mörtel entwickelt, die unter Wasser einsetzbar sind und Applikationstechniken untersucht, die eine Applikation unter Wasser mit erfolgreichem Haftverbund erlauben. There are currently no established...
Aerosol behaviour modeling and measurements
Energy Technology Data Exchange (ETDEWEB)
Gieseke, J A; Reed, L D [Batelle Memorial Institute, Columbus, OH (United States)
1977-01-01
Aerosol behavior within Liquid Metal Fast Breeder Reactor (LMFBR) containments is of critical importance since most of the radioactive species are expected to be associated with particulate forms and the mass of radiologically significant material leaked to the ambient atmosphere is directly related to the aerosol concentration airborne within the containment. Mathematical models describing the behavior of aerosols in closed environments, besides providing a direct means of assessing the importance of specific assumptions regarding accident sequences, will also serve as the basic tool with which to predict the consequences of various postulated accident situations. Consequently, considerable efforts have been recently directed toward the development of accurate and physically realistic theoretical aerosol behavior models. These models have accounted for various mechanisms affecting agglomeration rates of airborne particulate matter as well as particle removal rates from closed systems. In all cases, spatial variations within containments have been neglected and a well-mixed control volume has been assumed. Examples of existing computer codes formulated from the mathematical aerosol behavior models are the Brookhaven National Laboratory TRAP code, the PARDISEKO-II and PARDISEKO-III codes developed at Karlsruhe Nuclear Research Center, and the HAA-2, HAA-3, and HAA-3B codes developed by Atomics International. Because of their attractive short computation times, the HAA-3 and HAA-3B codes have been used extensively for safety analyses and are attractive candidates with which to demonstrate order of magnitude estimates of the effects of various physical assumptions. Therefore, the HAA-3B code was used as the nucleus upon which changes have been made to account for various physical mechanisms which are expected to be present in postulated accident situations and the latest of the resulting codes has been termed the HAARM-2 code. It is the primary purpose of the HAARM
Verlaging gebruiksnorm fosfaat nog geen probleem
Dekker, P.H.M.; Ehlert, P.A.I.
2008-01-01
Gaat verlaging van de gebruiksnorm voor fosfaat niet ten koste van productie en kwaliteit? Onderzoek wijst uit dat die reductie over veel jaren vooralsnog niet tot verliezen leidt. Gespecialiseerde bedrijven in peen en bladgewassen kunnen op termijn op lagere productie uitkomen. De gebruiksnorm voor
Welzijnsrichtlijn vleeskuikens : 20 lux bij vleeskuikens : het kan
Harn, van J.
2009-01-01
De lichtsterkte op ooghoogte van de kuikens moet op 80 procent van het vloeroppervlak minimaal 20 lux bedragen, volgens de EU-welzijnsrichtlijn voor vleeskuikens. Momenteel worden vleeskuikens gehouden bij lichtsterktes die lager zijn vanwege de vrees voor stress en onrust bij de kuikens. Uit
Actieve geluid- en trillingsreductie met piëzo actuator arrays in lichtgewicht panelen
Berkhoff, Arthur P.
2004-01-01
Overmatig geluid van trillende panelen wordt doorgaans gereduceerd door het toevoegen van gewicht. Vaak is het toevoegen van gewicht ongewenst, zoals in auto's en vliegtuigen, waar het leidt tot een toename van het brandstofverbruik. Actieve panelen kunnen bij een gelijk gewicht leiden tot lagere
Gaming supports youth with aquired brain injury? : a pilot study
Karen van Stein Callenfels; A.J. (Arend) de Kloet; Inge Verhoeven; M.A.M. (Monique) Berger; Thea Vliet Vlieland
2012-01-01
De incidentie van niet aangeboren hersenletsel (NAH) bij personen in de leeftijd tot 25 jaar in Nederland is aanzienlijk, met ca. 18.000 nieuwe gevallen per jaar. Kinderen en jongeren met NAH hebben naast fysieke, cognitieve en emotionele beperkingen, een significant lager niveau van sociale
Features of Hepatitis in Hepatitis-associated Aplastic Anemia: Clinical and Histopathologic Study.
Patel, Kalyani R; Bertuch, Alison; Sasa, Ghadir S; Himes, Ryan W; Wu, Hao
2017-01-01
Hepatitis-associated aplastic anemia (HAA) is a rare variant of aplastic anemia in which patients present with severe pancytopenia after an episode of acute hepatitis. The marrow failure is often rapid, severe, and usually fatal if untreated. The preceding hepatitis is largely under-studied. Retrospective study of the clinical and histopathologic features of hepatitis in pediatric patients who subsequently developed aplastic anemia and comparison with consecutive cases of acute liver failure and random cases of autoimmune hepatitis during the same time frame. All 7 patients of HAA had significant elevations in aminotransferases and conjugated hyperbilirubinemia at initial presentation. Echoing liver function indices, cholestatic hepatitis with sinusoidal obstruction-type endothelial injury was seen histomorphologically. Autoimmune hepatitis serology such as anti-F-actin, anti-liver/kidney microsome, and hypergammaglobulinemia was negative in all patients. Five of 7 patients (71.4%) had, however, elevated antinuclear antibody, all with a speckled pattern. Hepatitis virus serology was negative in all patients. By immunohistochemical staining, the lobular CD8/CD4 lymphocyte ratio was markedly elevated in all of the initial samples with significant reduction in this ratio (P = 0.03) in 3 patients post treatment (ursodiol, antibiotics, and/or immunosuppressive therapy). Hepatitis preceding HAA is characterized by marked elevation of aminotransferases, conjugated hyperbilirubinemia, elevated antinuclear antibody with a speckled pattern, cholestatic hepatitis with sinusoidal obstruction morphology, and CD8 dominant lobular infiltrates. The present study suggests HAA may result from cytotoxic T-cell-mediated sinusoidal endothelial and hepatocytic injury.
The isolation of beryllium and mercury from lithium chloride solution by means of gas extraction
International Nuclear Information System (INIS)
Sevast'yanov, A.I.; Chepovoj, V.I.
1988-01-01
The possibility and optimal conditions of beryllium and mercury extraction using acetylacetone (HAA) from lithium chloride solution by argon blowing through the solution are determined. Dependences of extraction degrees and distribution coefficients on different parameters of liquid phase: initial pH value, lithium chloride concentration and initial content of HAA, are presented. The degree of beryllium extraction reaches the maximum at liquid phase pH of 4.4-5.25 and concentration of lithium chloride of 8.5 mol/l. Distribution coefficient changes in inverse proportion to the extraction degree
Energy Technology Data Exchange (ETDEWEB)
Prueter, J. [Alfred Toepfer Akademie fuer Naturschutz (NNA), Schneverdingen (Germany); Horlitz, T.; Sander, A. [Arbeitsgemeinschaft Umweltplanung (ARUM), Hannover (Germany)
2000-07-01
Since late 1997, a cooperative project headed by Alfred Toepfer Akademie fuer Naturschutz has been investigating ''Models of conservation and its application in agriculture - goals, instruments and cost of sustainable, environment-friendly agriculture in the Elbe river valley in Niedersachsen''. The project receives funds in the context of the BMBF project ''Elbe river ecology''. Using the specific methods and tools of ecology, landscaping, agriculture and economics, the fundamentals for future interdisciplinary landscape development concepts will be established. The contribution presents the methodology of concept development and some exemplary goals for sustainable agricultural development in the context of the project. [German] Seit Ende 1997 widmet sich im Rahmen der BMBF-Forschungsfoerderung ''Elbe-Oekologie'' ein Verbundforschungsvorhaben unter Federfuehrung der Alfred Toepfer Akademie fuer Naturschutz dem Thema ''Leitbilder des Naturschutzes und deren Umsetzung mit der Landwirtschaft - Ziele, Instrumente und Kosten einer umweltschonenden und nachhaltigen Landwirtschaft im niedersaechsischen Elbetal''. Mit den spezifischen Methoden und fachlichen Instrumenten der Oekologie, der Landschaftsplanung sowie der Agrarwissenschaften einschliesslich Oekonomie sollen Grundlagen fuer moegliche ressortuebergreifend getragene Konzepte fuer die zukuenftige Landschaftsentwicklung erarbeitet werden. Im folgenden werden methodische Grundlagen der Konzeptentwicklung und beispielhafte Zielaussagen fuer eine nachhaltige Landbewirtschaftung aus dem laufenden Projekt vorgestellt. (orig.)
Eerste kwartaal 2009 vleesvarkens: saldo negatief door hogere biggenprijs
Bolhuis, J.; Wisman, J.H.
2009-01-01
De gestegen export en verminderde import van levende varkens hebben geleid tot minder slachtingen in 2008 ten opzichte van 2007. Als gevolg hiervan is er minder varkensvlees uitgevoerd. De prijzen voor vleesvarkens zijn in het eerste kwartaal van 2009 iets lager dan in dezelfde periode van vorig
2001-01-01
Der Orientierungsrahmen "Bildung für eine nachhaltige Entwicklung" wurde 1998 durch die Bund-Länder-Kommission für Bildungsplanung und Forschungsförderung (BLK) beschlossen. In dem vorliegenden Dokument wird auf der Grundlage einer Umfrage der BLK-Geschäftsstelle bei den Kultus- und Wissenschaftsministerien über seine Umsetzung berichtet. Der Bericht gliedert sich wie folgt: 1. Rechtliche und politische Grundlagen sowie landesspezifische Initiativen/Programme einer Bildung für nachhaltige Ent...
Apolin, Martin
2008-01-01
Physik soll verständlich sein und Spaß machen! Deshalb beginnt jedes Kapitel in Big Bang mit einem motivierenden Überblick und Fragestellungen und geht dann von den Grundlagen zu den Anwendungen, vom Einfachen zum Komplizierten. Dabei bleibt die Sprache einfach, alltagsorientiert und belletristisch. Der Band 6 RG behandelt die Gravitation, Schwingungen und Wellen, Thermodynamik und eine Einführung in die Elektrizität anhand von Alltagsbeispielen und Querverbindungen zu anderen Disziplinen.
Apolin, Martin
2008-01-01
Physik soll verständlich sein und Spaß machen! Deshalb beginnt jedes Kapitel in Big Bang mit einem motivierenden Überblick und Fragestellungen und geht dann von den Grundlagen zu den Anwendungen, vom Einfachen zum Komplizierten. Dabei bleibt die Sprache einfach, alltagsorientiert und belletristisch. In Band 7 werden neben einer Einführung auch viele aktuelle Aspekte von Quantenmechanik (z. Beamen) und Elektrodynamik (zB Elektrosmog), sowie die Klimaproblematik und die Chaostheorie behandelt.
Review: Keith F. Punch (2005). Introduction to Social Research—Quantitative & Qualitative Approaches
Constantinos N. Phellas
2006-01-01
Introduction to Social Research enthält insgesamt zwölf sehr detaillierte und gut zugängliche Kapitel über quantitative, qualitative und mixed-method Ansätze und richtet sich an Personen, die gerade beginnen, sich mit den Sozialwissenschaften zu befassen. In die nun vorgelegte 2. Auflage wurden zahlreiche illustrative Anwendungsbeispiele aufgenommen, die es Studierenden ermöglichen, die Grundlagen sozialwissenschaftlicher Forschung zu verstehen. Ich selbst werde dieses Buch neuen Studentinnen...
Phellas, Constantinos N.
2006-01-01
Introduction to Social Research enthält insgesamt zwölf sehr detaillierte und gut zugängliche Kapitel über quantitative, qualitative und mixed-method Ansätze und richtet sich an Personen, die gerade beginnen, sich mit den Sozialwissenschaften zu befassen. In die nun vorgelegte 2. Auflage wurden zahlreiche illustrative Anwendungsbeispiele aufgenommen, die es Studierenden ermöglichen, die Grundlagen sozialwissenschaftlicher Forschung zu verstehen. Ich selbst werde dieses Buch neuen Studentinnen...
Quantitative Datenanalyse: Arbeiten mit SPSS Statistics : Eine Einführung
Hoidn, Sabine
2012-01-01
Bei diesem Buch handelt es sich um eine verständliche Einführung in das Arbeiten mit dem quantitativen Datenanalyseprogramm SPSS Statistics. Die Studierenden setzen sich mit den Grundlagen zum Arbeiten mit SPSS Statistics auseinander, können selbständig eine SPSS Statistics-Datei erstellen, Daten einlesen, zusammenfügen und modifizieren, erfasste Daten managen und die gebräuchlichsten tabellarischen und grafischen Grundauswertungen sowie Analyseverfahren durchführen und interpretieren. Au...
Klopp, Eric
2010-01-01
Die explorative Faktorenanalyse (EFA) ist ein Verfahren aus der multivariaten Statistik. Mithilfe der Faktorenanalyse kann aus den Beobachtungen vieler manifester Variablen (z .B Items eines Fragebogens) auf wenige zugrunde liegende latente Variablen, die Faktoren genannt werden, geschlossen werden. Eine EFA führt zu einer Reduktion der Variablen auf wenige, den manifesten Variablen zugrunde liegende Faktoren. Der folgende Text gibt einen Überblick über die Grundlagen der EFA sowie der wichti...
Mangisch, Christian; Blatter, Martin
2009-01-01
Der Kurs “Innovationsmanagement im Marketing“ vermittelt den Teilnehmenden Wissen zum Innovationsmanagement, zum innovativen Team und zu innovativen Marketing Trends. Diese Kurse sind online auf dem folgenden Link www.ritzycampus.ch zu finden. Die Teilnehmer müssen für den Online-Kurs keine speziellen Kenntnisse oder Voraussetzungen mitbringen. Diese Online-Kurse im Fach Marketing sind an ein breites Publikum gerichtet. Sie ermöglichen den Studierenden im Eigenstudium die Grundlagen der Theme...
Vom Lamarckismus, vom Hakenkreuz und von meinen Katzen
Koch, Richard
2005-01-01
Richard Koch (1882-1949) zählt zu den bedeutendsten Medizintheoretikern und -historikern des 20. Jahrhunderts. Neben Arbeiten zu ihrem geschichtlichen Selbstverständnis ist Koch insbesondere wegen seiner Überlegungen zu den wissenschaftstheoretisch-philosophischen Grundlagen der Medizin in die Geschichtsbücher eingegangen. Als Jude mußte Koch Deutschland 1936 verlassen und emigrierte in die Sowjetunion. Er arbeitete bis zu seinem Tod 1949 als Arzt im kaukasischen Badeort Essentuki. Neben wiss...
Neues aus dem Forschungsfeld Deutsch als Zweitsprache. Sammelrezension
Directory of Open Access Journals (Sweden)
Claus Altmayer
2015-03-01
Full Text Available Neues aus dem Forschungsfeld Deutsch als Zweitsprache. Sammelrezension (Teil 2 von Bernt Ahrenholz (Hrsg. (2009, Empirische Befunde zu DaZ-Erwerb und Sprachförderung. Beiträge aus dem 3. ‚Workshop Kinder mit Migrationshintergrund‘; Karen Schramm & Christoph Schröder (Hrsg. (2009, Empirische Zugänge zu Spracherwerb und Sprachförderung in Deutsch als Zweitsprache; Stefan Jeuk (2010, Deutsch als Zweitsprache in der Schule. Grundlagen - Diagnose – Förderung
Analysis of the hybrid genomes of brewing yeasts
Bolat, I.
2016-01-01
One of the best guarded secrets of brewers is represented by the brewing yeast employed in beer fermentation, due to its profound impact upon the specific flavour profile of the final product. The current research tackles the genome diversity of lager brewing strains as well as their impact on
Synthesis and evaluation of novel linear and branched polyacrylamides for enhanced oil recovery
Wever, Diego-Armando Zacarias
2013-01-01
De efficientie van oliewinning ligt gemiddeld lager dan 50% voor alle oliebronnen in de wereld. Verbeterde olie extractie (EOR) heeft als doel om de efficientie te verbeteren. Water oplosbare polymeren worden gebruikt om de verplaatsing efficiëntie te verbeteren van de water fase die geïnjecteerd
Invioed van de zuurtegraad van varkensurine op de ammoniakemissie
Eizing, A.; Aarnink, A.J.A.
1996-01-01
Dit rapport beschrijft het effect van een lagere urine-pH op de ammoniakemissie in een varkensstal. Het onderzoek is uitgevoerd in een modelopstelling met de zogenaamde stalsimulator, waarbij de invloed van de urine-pH op de ammoniakemissie werd onderzocht. Hiervoor werd de urine van vleesvarkens op
Econometrics versus the Bookmakers. An econometric approach to sports betting
Hansen, Sindre Michael
2016-01-01
Bruk av økonometri for å estimere sannsynligheter for ulike utfall i fotballkamper, over en Premier League sesong. Lager en modell basert på Bradley-Terry. Resultatet av estimeringene testes deretter ved å sammenligne med historisk odds satt av ulike spilltilbydere, og anvendes for hypotetiske innsatser. Modellen viser profitt.
Postema, K.; Hermens, Hermanus J.; de Vries, J.; de Vries, J.; Koopman, Hubertus F.J.M.; Eisma, W.H.
1997-01-01
The energy storing and releasing behaviour of 2 energy storing feet (ESF) and 2 conventional prosthetic feet (CF) were compared (ESF: Otto Bock Dynamic Pro and Hanger Quantum; CF: Otto Bock Multi Axial and Otto Bock Lager). Ten trans-tibial amputees were selected. The study was designed as a
Removal of haloacetic acids from swimming pool water by reverse osmosis and nanofiltration.
Yang, Linyan; She, Qianhong; Wan, Man Pun; Wang, Rong; Chang, Victor W-C; Tang, Chuyang Y
2017-06-01
Recent studies report high concentrations of haloacetic acids (HAAs), a prevalent class of toxic disinfection by-products, in swimming pool water (SPW). We investigated the removal of 9 HAAs by four commercial reverse osmosis (RO) and nanofiltration (NF) membranes. Under typical SPW conditions (pH 7.5 and 50 mM ionic strength), HAA rejections were >60% for NF270 with molecular weight cut-off (MWCO) equal to 266 Da and equal or higher than 90% for XLE, NF90 and SB50 with MWCOs of 96, 118 and 152 Da, respectively, as a result of the combined effects of size exclusion and charge repulsion. We further included 7 neutral hydrophilic surrogates as molecular probes to resolve the rejection mechanisms. In the absence of strong electrostatic interaction (e.g., pH 3.5), the rejection data of HAAs and surrogates by various membranes fall onto an identical size-exclusion (SE) curve when plotted against the relative-size parameter, i.e., the ratio of molecular radius over membrane pore radius. The independence of this SE curve on molecular structures and membrane properties reveals that the relative-size parameter is a more fundamental SE descriptor compared to molecular weight. An effective molecular size with the Stokes radius accounting for size exclusion and the Debye length accounting for electrostatic interaction was further used to evaluate the rejection. The current study provides valuable insights on the rejection of trace contaminants by RO/NF membranes. Copyright © 2017. Published by Elsevier Ltd.
Wu, Shimin; Anumol, Tarun; Gandhi, Jay; Snyder, Shane A
2017-03-03
The addition of oxidants for disinfecting water can lead to the formation of potentially carcinogenic compounds referred to as disinfection byproducts (DBPs). Haloacetic acids (HAAs) are one of the most widely detected DBPs in US water utilities and some of them are regulated by the US Environmental Protection Agency (USEPA). The present study developed a method to analyze all the compounds in the USEPA method 557 (nine HAAs, bromate and dalapon) plus four potentially more toxic iodinated HAAs in water by coupling ion chromatography with tandem mass spectrometry (IC-MS/MS). This aqueous direct injection method has significant advantages over traditional GC methods, which require a derivatization and sample extraction that are laborious, time-consuming, and can negatively impact reproducibility. The method developed in this study requires half the time of the current USEPA method 557 on IC-MS/MS while including more compounds and achieving sub-μg/L level method detection limits (MDLs) for all 15 target analytes. The single laboratory lowest concentration minimum reporting level (LCMRL) has also been determined in reagent water, which ranged from 0.011 to 0.62μg/L for the analytes. The mean recoveries of the analytes during matrix spike recovery tests were 77-125% in finished drinking water and 81-112% in surface water. This method was then applied to untreated, chlorinated, and chloraminated groundwater and surface water samples. Bromate and 9 HAAs were detected at different levels in some of these samples. Copyright © 2017 Elsevier B.V. All rights reserved.
Flexible Airspace Management (FAM) Research 2010 Human-in-the-Loop Simulation
Lee, Paul U.; Brasil, Connie; Homola, Jeffrey; Kessell, Angela; Prevot, Thomas; Smith, Nancy
2011-01-01
A human-in-the-Ioop (HITL) simulation was conducted to assess potential user and system benefits of Flexible Airspace Management (FAM) concept, as well as designing role definitions, procedures, and tools to support the FAM operations in the mid-term High Altitude Airspace (HAA) environment. The study evaluated the benefits and feasibility of flexible airspace reconfiguration in response to traffic overload caused by weather deviations, and compared them to those in a baseline condition without the airspace reconfiguration. The test airspace consisted of either four sectors in one Area of Specialization or seven sectors across two Areas. The test airspace was assumed to be at or above FL340 and fully equipped Vvith data communications (Data Comm). Other assumptions were consistent with those of the HAA concept. Overall, results showed that FAM operations with multiple Traffic Management Coordinators, Area Supervisors, and controllers worked remarkably well. The results showed both user and system benefits, some of which include the increased throughput, decreased flight distance, more manageable sector loads, and better utilized airspace. Also, the roles, procedures, airspace designs, and tools were all very well received. Airspace configuration options that resulted from a combination of algorithm-generated airspace configurations with manual modifications were well acceptec and posed little difficuIty and/or workload during airspace reconfiguration process. The results suggest a positive impact of FAM operations in HAA. Further investigation would be needed to evaluate if the benefits and feasibility would extend in either non-HAA or mixed equipage environment.
Gustav Steinmann (1856-1929): Ein deutscher Ordinarius der Kaiserzeit
Seibold, Eugen; Seibold, Ilse
2010-10-01
Cretaceous stratigraphy of parts of Bolivia. In 1885 he was appointed Professor of Geology and Mineralogy in Jena. By 1886, he moved to a full professorship to the University of Freiburg im Breisgau, starting a period of wide-ranging activities covering a great variety of subjects in seminars, lectures and often strenuous fieldtrips, for he was also an enthusiastic mountaineer. With the authoritarian style of his period, he kept his staff and students enormously busy in all respects. He successfully convinced the regional government to erect a new institute building that is still in use today. Nevertheless, in 1906, he accepted the chair of geology and palaeontology in Bonn, along with the title of “Geheimer Bergrat”. Once again he successfully built a new institute, along the lines of the one in Freiburg. His ceaseless activity also continued in Bonn. In addition, he founded new scientific societies: in 1907 the “Niederrheinische Geologische Verein” and in 1910 the “Geologische Vereinigung” amongst others. However, he suffered from severe restrictions during World War I, the occupation of Bonn and the financial crisis during the 1920s. In 1924, he retired, and in 1925, his wife passed away. Nevertheless, with the help of former students, his “Geology of Peru” was published in 1929 and a summary of his ophiolite research appeared in 1927 in Madrid. Throughout his life, he attempted to participate in all International Geological Congresses with their long fieldtrips and the opportunities for personal contacts. Steinmann was a multi-faceted personality, some of them quite “sharp”. He had diverse interests and ideas combined with a profound knowledge in many fields. He had enormous energy and also expected the same from others. After a long trip to the Far East he died in 1929 in Bonn. His most important organizational achievement was certainly the foundation of the “Geologische Vereinigung” (1910) with its renowned annual meetings and its journal, the “Geologische
Seltskond : [fotod] / tekst ja fotod Annika Haas
2008-01-01
8. dets. esitles Helle Michelson Eesti Lastekirjanduse Keskuses mälestusteraamatut "Lehitsetud leheküljed: Meenutusi elust ja lastekirjandusest" (Tallinn : Tänapäev, 2008) Kohal viibisid lastekirjanikud Ellen Niit, Jaak Urmet jt.
USA kiidetud noise-rock Eestis / Annika Haas
Haas, Annika
2008-01-01
Müra-rock'i viljelevast USA duost Magik Markers (ansambel osaleb režissöör Veiko Õunapuu uue mängufilmi "Püha Tõnu kiusamine" võtetel ja annab kaks kontserti - 13. nov. Tallinnas klubis Tapper ja 15. nov. Tartus klubis Trehv)
Seltskond : [fotod] / tekst ja fotod Annika Haas
2008-01-01
29. mail tutvustasid autorid oma lasteraamatuid Eesti Lastekirjanduse Keskuses: Kass, Kristiina. Petra lood. [Tallinn] : Tänapäev, 2008 ; Vainola, Kätlin. Mia, Konrad ja avanevad uksed : [jutustus] / pildid joonistanud Toomas Pääsuke. [Tallinn] : Tänapäev, 2008 ; Saarna, Meelike. Mattias ja mamma. [Tallinn] : Tänapäev, 2008
Magneto-transporte em sistemas semicondutores com gas de eletrons bidimensional
Alvaro Guedes Soares
1994-01-01
Resumo: O objetivo básico deste trabalho foi a implantação de técnicas de magneto-transporte em heteroestruturas semicondutoras que apresentam gás de elétron bidimensional (2-DEG), particularmente, o Efeito Shubnikov-de Haas (SdH) e Efeito Hall Quântico (QHE). Neste sentido foi realizada a recuperação de uma bobina supercondutora (criostato e sistema de controle) que permite medidas em campo magnético de até 14 Tesla. Medidas de oscilações Shubnikov-de Haas e Efeito Hall Quântico foram fei...
Testing scales for beer brand loyalty
DEFF Research Database (Denmark)
Sudzina, Frantisek
2017-01-01
and Carlsberg beers, and to compare Cronbach's alphas for the two brands when evaluated by the same respondents. Both brands are produced by the Carlsberg Group, and both are lagers. The Carlsberg Group markets Tuborg as a more premium brand, and it also aims at women. Both validated loyalty scales - (repeat...
Hypertextsorten : Definition, Struktur, Klassifikation
Rehm, Georg
2005-01-01
Suchmaschinen im WWW indexieren und durchsuchen Dokumente in großer Geschwindigkeit. Trotz der quantitativ beeindruckenden Ergebnisse lässt die Qualität der Treffer jedoch oft zu wünschen übrig. Die vorliegende Arbeit zielt darauf ab, die theoretischen und praktischen Grundlagen für strukturelle Verbesserungen der Funktionsweise von Suchmaschinen zu liefern. Der Schlüssel hierfür liegt in der maschinellen Identifikation von Hypertextsorten. Dieser Begriff bezeichnet den generellen Typ e...
1991-05-01
155rrmHg) SF SOF* 8.FEET 0 Z 8D(118 nvnHg) 5ZE 70 I. - ZcnZ aw xt- 50 00 40< 4:0 Q.J 3D -< O20 10) 10 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75...University of Utah 1985 2. Alo, r v ., Pechner P. U., ":mraocvlarlinsen - Grundlagen und Operatiansiohre" Sonder- druck F. E-ske Verlag Stuttgart 1984 3
Catón, Matthias
2006-01-01
Das Buch Rethinking Social Inquiry, herausgegeben von Henry E. BRADY und David COLLIER, ist eine Antwort auf den Band von KING, KEOHANE und VERBA (1994), in dem versucht wird, Standards der quantitativen Forschung in der qualitativen Forschung einzuführen. Die Autoren des hier rezensierten Buchs kritisieren viele der Vorschläge, da sie argumentieren, dass qualitative Forschung anderer Werkzeuge bedürfe. Trotzdem stimmen sie zu, dass die Grundlagen des Forschungsaufbaus ähnlich sind. Das Buch ...
Matthias Catón
2006-01-01
Das Buch Rethinking Social Inquiry, herausgegeben von Henry E. BRADY und David COLLIER, ist eine Antwort auf den Band von KING, KEOHANE und VERBA (1994), in dem versucht wird, Standards der quantitativen Forschung in der qualitativen Forschung einzuführen. Die Autoren des hier rezensierten Buchs kritisieren viele der Vorschläge, da sie argumentieren, dass qualitative Forschung anderer Werkzeuge bedürfe. Trotzdem stimmen sie zu, dass die Grundlagen des Forschungsaufbaus ähnlich sind. Das Buch ...
Bäumlisberger, Damian; Brink, Alexander
2012-01-01
"Der Beitrag ergründet die normativen Grundlagen der Standards zum Schutz der Arbeitnehmerrechte der International Labour Organization. Auf Basis der kantischen Position des US-amerikanischen Wirtschaftsethikers Norman E. Bowie zeigen die Autoren, dass sich Bowies Theorieansatz grundsätzlich dazu eignet, die vier Kernbereiche der ILO-Aktivitäten ethisch zu fundieren. Jedoch stößt Bowies Position bei der Begründung der ILO-Standards auch auf Grenzen, die nur teilweise mittels zusätzlicher, mit...
Ungleiche Ungleichheiten:Zu den Gemeinsamkeiten und Unterschieden von Sexismus und Rassismus
Späte, K. (Katrin)
2011-01-01
Sexismus durchzieht fast alle gesellschaftlichen Teilbereiche und deren Grundlagen, im Kern ging es schon Jahrtausende lang um die Rechtfertigung der Herrschaft von Männern über Frauen. Die Minderwertigkeit „der Frau“ wurde unter Rückgriff auf natürliche Begebenheiten bewiesen. Die Grundlage sowohl von Sexismus als auch von Rassismus ist eine Konstruktion: Beim Sexismus die des „weiblichen Geschlechts“, beim Rassismus die der „Rasse“. Während sich die Benennung des Objekts von Rassismus im...
Einfluss freier Fettsäuren auf die Insulinsekretion beim Menschen
Steigenberger, Mirjam Elisabeth
2008-01-01
Zu den pathophysiologischen Grundlagen des Diabetes mellitus Typ 2 gehören die Insulinresistenz und die gestörte Insulinsekretion. Ziel dieser Arbeit war es, zu untersuchen, ob der Spiegel der freien Fettsäuren im Nüchternplasma bei Risikopersonen für Diabetes mellitus Typ 2 die Insulinsekretion beeinträchtigt. Hierfür untersuchten wir in einer Querschnittsuntersuchung 1055 Probanden mit positiver Familienanamnese für Typ 2 Diabetes mellitus. Unabhängig von Alter, Geschlecht, Insulinsensitivi...
Marie Springborn
2015-01-01
Im ersten Band der Reihe „Angewandte Sexualwissenschaft“ führt Torsten Linke in theoretische Grundlagen und Termini der sexuellen Bildung in der Sozialen Arbeit ein, analysiert Ergebnisse der Studie „PARTNER 4 - Jugendsexualität 2013“ und liefert Ansätze für die praktische Arbeit im Bereich der sexuellen Bildung und Beratung. Der analytische Fokus liegt dabei auf der Sozialisationsinstanz Familie, die in der psychosexuellen Entwicklung von Kindern und Jugendlichen westlicher Gesellschaften, b...
Basics of energy policy; Grundlagen der Energiepolitik
Energy Technology Data Exchange (ETDEWEB)
Reiche, D. (ed.)
2005-07-01
This book displays basics of German and international energy policy. It explains the subject area for newcomers like students as well as for experts from industry, sciences or journalism and is intended to be a valuable source of information and helpfull reference book. It is made purposely in a way to be read section-wise. How is the state of development of special energy sources as coal, wind power or tidal and wave power respectively? Which actors operate in energy policy, what instruments of energy policy can be used by the legislator? The book is supposed to answer those questions. It was tried to achieve a high level of readability and useability by structuring and the use of many pictures and tables. (orig./uke)
Attitude and loyalty to two brands of beer of the same producer
DEFF Research Database (Denmark)
Sudzina, Frantisek
2017-01-01
The focus of the presented research is attitude and loyalty to two brands of beer produced by the Carlsberg Group - Tuborg and Carlsberg. Both beers are lagers. The Carlsberg Group markets Tuborg as a more premium brand, and it also aims to promote it to women. Unlike in the Netherlands with one...
Loyalty to two brands of beer of the same producer
DEFF Research Database (Denmark)
Sudzina, Frantisek
2017-01-01
The focus of the paper is loyalty to two brands of beer produced by the Carlsberg Group - Tuborg and Carlsberg. Both beers are lagers. The Carlsberg Group markets Tuborg as a more premium brand, and it also aims to promote it to women. Unlike in the Netherlands with one brand - Heineken and unlike...
Energy Technology Data Exchange (ETDEWEB)
Weber, M.-A.; Giesel, F.L.; Kauczor, H.-U.; Essig, M. [Deutsches Krebsforschungszentrum (DKFZ) Heidelberg (Germany). Abteilung Radiologie; Risse, F.; Schad, L.R. [Deutsches Krebsforschungszentrum (DKFZ) Heidelberg (Germany). Abteilung Medizinische Physik in der Radiologie
2005-07-01
mathematischer Modelle, denen die Prinzipien der Indikatorverduennungstheorie zugrunde liegen, in die Kontrastmittelkonzentration umgerechnet. Mittels einer ''Region-of-interest-Analyse'' koennen Werte fuer den regionalen zerebralen Blutfluss und das regionale Blutvolumen berechnet werden. Dieser Uebersichtsartikel beschreibt die physikalischen Grundlagen der Technik und fasst deren radiologische Anwendungen fuer die Neuroonkologie zusammen. Studien an relativ kleinen Patientenkollektiven berichten ueber eine Verbesserung der Differenzierung von Tumorrezidiv und Therapiekomplikationen, wie etwa der Strahlennekrose. Die Methode verhilft zur besseren Unterscheidung zwischen neoplastischen und nichtneoplastischen ZNS-Prozessen sowie zwischen ZNS-Lymphomen, Glioblastomen und singulaeren Metastasen und der Abgrenzung niedergradiger von anaplastischen Gliomen. Bei niedergradigen Gliomen kann die T2*-Dynamik den am staerksten vaskularisierten Tumoranteil mit der hoechsten Anaplastizitaet zur zielgerichteten Biopsie visualisieren. Die ersten Ergebnisse zeigen, dass die T2*-Dynamik ein diagnostisches Instrument zur Visualisierung regionaler Variationen der Mikrovaskularitaet in gesundem und krankhaft veraendertem Hirngewebe ist. (orig.)
Disinfection By-Product Exposures and the Risk of Specific Cardiac Birth Defects
Wright, J. Michael; Evans, Amanda; Kaufman, John A.; Rivera-Núñez, Zorimar; Narotsky, Michael G.
2016-01-01
Background: Epidemiological studies suggest that women exposed to disinfection by-products (DBPs) have an increased risk of delivering babies with cardiovascular defects (CVDs). Objective: We examined nine CVDs in relation to categorical DBP exposures including bromoform, chloroform, dibromochloromethane (DBCM), bromodichloromethane (BDCM), monobromoacetic acid (MBAA), dichloroacetic acid (DCAA), trichloroacetic acid (TCAA), and summary DBP measures (HAA5, THMBr, THM4, and DBP9). Methods: We calculated adjusted odds ratios (aORs) in a case–control study of birth defects in Massachusetts with complete quarterly 1999–2004 trihalomethane (THM) and haloacetic acid (HAA) data. We randomly matched 10 controls each to 904 CVD cases based on week of conception. Weight-averaged aggregate first-trimester DBP exposures were assigned to individuals based on residence at birth. Results: We detected associations for tetralogy of Fallot and the upper exposure categories for TCAA, DCAA, and HAA5 (aOR range, 3.34–6.51) including positive exposure–response relationships for DCAA and HAA5. aORs consistent in magnitude were detected between atrial septal defects and bromoform (aOR = 1.56; 95% CI: 1.01, 2.43), as well as DBCM, chloroform, and THM4 (aOR range, 1.26–1.67). Ventricular septal defects (VSDs) were associated with the highest bromoform (aOR = 1.85; 95% CI: 1.20, 2.83), MBAA (aOR = 1.81; 95% CI: 0.85, 3.84), and DBCM (aOR = 1.54; 95% CI: 1.00, 2.37) exposure categories. Conclusions: To our knowledge, this is the first birth defect study to develop multi-DBP adjusted regression models as well as the first CVD study to evaluate HAA exposures and the second to evaluate bromoform exposures. Our findings, therefore, inform exposure specificity for the consistent associations previously reported between THM4 and CVDs including VSDs. Citation: Wright JM, Evans A, Kaufman JA, Rivera-Núñez Z, Narotsky MG. 2017. Disinfection by-product exposures and the risk of specific
Melo, A; Faria, M A; Pinto, E; Mansilha, C; Ferreira, I M P L V O
2016-10-01
Water disinfection plays a crucial role in water safety but it is also a matter of concern as the use of disinfectants promotes the formation of disinfection by-products (DBPs). Haloacetic acids (HAAs) are one of the major classes of DBPs since they are frequently found in treated water, are ubiquitous, pervasive and have high water solubility, so a great concern emerged about their formation, occurrence and toxicity. Exposure to HAAs is influenced by consumption patterns and diet of individuals thus their bioavailability is an important parameter to the overall toxicity. In the current study the bioacessibility of the most representative HAAs (chloroacetic acid - MCAA, bromoacetic acid - MBAA, dichloroacetic acid - DCAA, dibromoacetic acid - DBAA, and trichloroacetic acid - TCAA) after simulated in vitro digestion (SIVD) in tap water and transport across Caco-2 monolayers was evaluated. Compounds were monitored in 8 points throughout the digestion phases by an optimized LC-MS/MS methodology. MCAA and MBAA were not bioaccessible after SIVD whereas DCAA, DBAA and TCAA are highly bioaccessible (85 ± 4%, 97 ± 4% and 106 ± 7% respectively). Concerning transport assays, DCAA and DBAA were highly permeable throughout the Caco-2 monolayer (apparent permeability and calculated fraction absorbed of 13.62 × 10(-6) cm/s and 90% for DCAA; and 8.82 × 10(-6) cm/s and 84% for DBAA), whereas TCAA showed no relevant permeability. The present results may contribute to efficient risk analysis studies concerning HAAs oral exposure from tap water taking into account the different biological behaviour of these chemically similar substances. Copyright © 2016 Elsevier Ltd. All rights reserved.
Antioxidant activity of rice plants sprayed with herbicides
Directory of Open Access Journals (Sweden)
Marcos André Nohatto
2016-03-01
Full Text Available Understanding the physiological defense behavior of plants subjected to herbicide application may help to identify products with higher or lower capacity to cause oxidative stress in crops. This study aimed at evaluating the effect of herbicides in the antioxidant activity of rice plants. The experimental design was completely randomized, with six replications. Treatments consisted of the herbicides bentazon (photosystem II inhibitor; 960 g ha-1, penoxsulam (acetolactate synthase inhibitor; 60 g ha-1, cyhalofop-butyl (acetyl coenzyme-A carboxylase inhibitor; 315 g ha-1 and a control. After the herbicides application, samples of rice shoots were collected at 12, 24, 48 and 96 hours after application (HAA. The components evaluated were hydrogen peroxide (H2O2, lipid peroxidation and activity of the antioxidant enzymes superoxide dismutase (SOD and catalase (CAT. Bentazon (up to 24 HAA and penoxsulam (48 and 96 HAA reduced the CAT activity. Moreover, these herbicides increased the levels of H2O2, lipid peroxidation and SOD activity, indicating a condition of oxidative stress in rice plants. The cyhalofop-butyl herbicide did not alter the antioxidant activity, showing that it causes less stress to the crop.
Advanced oxidation processes of decomposing dichloroacetic acid and trichloroacetic acid in water
Institute of Scientific and Technical Information of China (English)
WANG Kun-ping; GUO Jin-song; YANG Min; JUNJI Hirotsuji; DENG Rong-sen; LIU Wei
2008-01-01
We studied the decomposition of two haloacetic acids (HAAs), dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA), in water by single oxidants ozone (O3) and ultraviolet radiation (UV) and the advanced oxidation processes (AOPs) constituted by the combinations of O3/UV, H2O2/UV, O3 /H2O2, and O3/H2O2/UV. The concentrations of HAAs were analyzed at specified time intervals to track their decomposition. Except for O3 and UV, the four combined oxidation processes remarkably enhance the decomposition of DCAA and TCAA owing to the generated very reactive hydroxyl radicals. The fastest decomposition process is O3/H2O2/UV, closely followed by O3/UV. DCAA is much easier to decompose than TCAA. The kinetics of HAA decomposition by O3/UV can be described well by a pseudo first-order reaction model under a constant initial dissolved O3 concentration and fixed UV radiation. Humic acids and HCO3- in the reaction system both decrease the decomposition rate constants for DCAA and TCAA. The amount of H2O2 accumulates in the presence of humic acids in the O3/UV process.
Mallik, Prabhat K; Shi, Hua; Pande, Jayanti
2017-09-16
The molecular chaperones, α-crystallins, belong to the small heat shock protein (sHSP) family and prevent the aggregation and insolubilization of client proteins. Studies in vivo have shown that the chaperone activity of the α-crystallins is raised or lowered in various disease states. Therefore, the development of tools to control chaperone activity may provide avenues for therapeutic intervention, as well as enable a molecular understanding of chaperone function. The major human lens α-crystallins, αA- (HAA) and αB- (HAB), share 57% sequence identity and show similar activity towards some clients, but differing activities towards others. Notably, both crystallins contain the "α-crystallin domain" (ACD, the primary client binding site), like all other members of the sHSP family. Here we show that RNA aptamers selected for HAA, in vitro, exhibit specific affinity to HAA but do not bind HAB. Significantly, these aptamers also exclude the ACD. This study thus demonstrates that RNA aptamers against sHSPs can be designed that show high affinity and specificity - yet exclude the primary client binding region - thereby facilitating the development of RNA aptamer-based therapeutic intervention strategies. Copyright © 2017 Elsevier Inc. All rights reserved.
Reductive dehalogenation of haloacetic acids by hemoglobin-loaded carbon nanotube electrode.
Li, Yu-Ping; Cao, Hong-Bin; Zhang, Yi
2007-01-01
Hemoglobin (Hb) was immobilized on carbon nanotube (CNT) electrode to catalyze the dehalogenation of haloacetic acids (HAAs). FTIR and UV measurements were performed to investigate the activity-keep of Hb after immobilization on CNT. The electrocatalytic behaviors of the Hb-loaded electrode for the dehalogenation of HAAs were studied by cyclic voltammmetry and constant-potential electrolysis technique. An Hb-loaded packed-bed flow reactor was also constructed for bioelectrocatalytic dehalogenation of HAAs. The results showed that Hb retained its nature, the essential features of its native secondary structure, and its biocatalytic activity after immobilization on CNT. Chloroacetic acids and bromoacetic acids could be dehalogenated completely with Hb catalysis through a stepwise dehalogenation process at -0.400V (vs. saturated calomel electrode (SCE)) and -0.200V (vs. SCE), respectively. The removal of 10.5mM trichloroacetic acid and dichloroacetic acid is ca. 97% and 63%, respectively, with electrolysis for 300min at -0.400V (vs. SCE) using the Hb-loaded packed-bed flow reactor, and almost 100% of tribromoacetic acid and dibromoacetic acid was removed with electrolysis for 40min at -0.200V (vs. SCE). The average current efficiency of Hb-catalytic dehalogenation almost reaches 100%.
Rosa, M; Lucchi, P; Mariani, L; Caprioglio, A
2012-09-01
The purpose of this study was to evaluate the effectiveness of Haas RPE anchored on deciduous teeth in the early mixed dentition, for inducing the spontaneous correction of permanent incisor's crossbite, without compliance, without post bite-plane and no involvement of the permanent teeth. The sample group comprised 50 consecutive patients (mean age 8y 5m, SD 2y 1m), 31 males, 19 females. They showed a cross-bite affecting one or more permanent incisors, for a total of 70 teeth. The patients were treated with Haas RPE appliance anchored on second deciduous molars and bonded on deciduous canines. No direct forces were applied on the permanent teeth. Anterior crossbite self-corrected 'spontaneously' in 84% of the cases. Lateral incisors had a higher rate of self-correction than central incisors. All hyper-divergent subjects showed a spontaneous crossbite self-correction. The early maxillary expansion by Haas RPE anchored on deciduous teeth is an efficient and effective procedure to induce the anterior crossbite self-correction in the early mixed dentition without the need of a bite-plane, no involvement of the permanent teeth and without compliance.
Holistic and consumer-centric assessment of beer: A multi-measurement approach.
Jaeger, Sara R; Cardello, Armand V; Chheang, Sok L; Beresford, Michelle K; Hedderley, Duncan I; Pineau, Benedicte
2017-09-01
Despite occupying a cornerstone position in consumer research and innovation, product liking/disliking provides only partial insight into consumer behaviour. By adopting a consumer-centric perspective and drawing on additional factors that underpin food-related consumer behaviour, a more complete product understanding is gained. The present research showcases this approach in a study with New Zealand beer (incl. pilsner, lager and ale categories). Implementation of a multi-variate approach with 128 regular beer drinkers provided assessments pertaining to liking and sensory novelty/complexity, situational appropriateness of consumption, as well as attitudes/perceptions and emotional associations. The 9 samples grouped into two clusters, where 4 of the beers were similar in being perceived as having less complex flavours, being appropriate for many uses and evoking stronger emotional associations of "relaxed/calm." The 4 beers were perceived as "easy to drink", and were, on average, most liked. One of the samples in this cluster was lighter in alcohol (2.5% ABV), but not inferior to beers with 4-5% ABV. The 5 beers in the second cluster were, on average, less liked and were associated with more negative emotions, e.g. "unhappy, "jittery", and "tense". Additional insights were gained from segmentation which identified two groups of consumers, named 'Lager Lovers' and 'Ale Aficionados'. Beers 1-4 were positively perceived by 'Lager Lovers' but less so by 'Ale Aficionados', and vice versa. The study was conducted under central location test conditions compatible with testing protocols often used in product research. The study protocol can be amended to include few/many consumer-centric measures and extended to product testing where packaging, brand, and other extrinsic information is available to consumers. Copyright © 2017 Elsevier Ltd. All rights reserved.
Saccharomyces pastorianus: genomic insights inspiring innovation for industry.
Gibson, Brian; Liti, Gianni
2015-01-01
A combination of biological and non-biological factors has led to the interspecific hybrid yeast species Saccharomyces pastorianus becoming one of the world's most important industrial organisms. This yeast is used in the production of lager-style beers, the fermentation of which requires very low temperatures compared to other industrial fermentation processes. This group of organisms has benefited from both the whole-genome duplication in its ancestral lineage and the subsequent hybridization event between S. cerevisiae and S. eubayanus, resulting in strong fermentative ability. The hybrid has key traits, such as cold tolerance and good maltose- and maltotriose-utilizing ability, inherited either from the parental species or originating from genetic interactions between the parent genomes. Instability in the nascent allopolyploid hybrid genome may have contributed to rapid evolution of the yeast to tolerate conditions prevalent in the brewing environment. The recent discovery of S. eubayanus has provided new insights into the evolutionary history of S. pastorianus and may offer new opportunities for generating novel industrially-beneficial lager yeast strains. Copyright © 2014 John Wiley & Sons, Ltd.
Origami-inspired metamaterial absorbers for improving the larger-incident angle absorption
International Nuclear Information System (INIS)
Shen, Yang; Pang, Yongqiang; Wang, Jiafu; Ma, Hua; Pei, Zhibin; Qu, Shaobo
2015-01-01
When a folded resistive patch array stands up on a metallic plane, it can exhibit more outstanding absorption performance. Our theoretical investigations and simulations demonstrated that the folded resistive patch arrays can enhance the absorption bandwidth progressively with the increase of the incident angle for the oblique transverse magnetic incidence, which is contrary to the conventional resistive frequency selective surface absorber. On illumination, we achieved a 3D structure metamaterial absorber with the folded resistive patches. The proposed absorber is obtained from the inspiration of the origami, and it has broadband and lager-incident angle absorption. Both the simulations and the measurements indicate that the proposed absorber achieves the larger-incident angle absorption until 75° in the frequency band of 3.6–11.4 GHz. In addition, the absorber is extremely lightweight. The areal density of the fabricated sample is about 0.023 g cm −2 . Due to the broadband and lager-incident angle absorption, it is expected that the absorbers may find potential applications such as stealth technologies and electromagnetic interference. (paper)
Essays in Road Pricing – Modeling, Evaluation and Case Studies
Winter, Martin
2009-01-01
Die Dissertation beschäftigt sich zum einen mit der Simulation und wohlfahrtsökonomischen Bewertung urbaner Road-Pricing-Lösungen (Kapitel 2-4), zum anderen mit den Auswirkungen hoher bzw. volatiler Rohölpreise auf den Verkehrssektor in Deutschland (Kapitel 5). Nach einer kurzen Einführung in Kapitel 1 widmet sich Kapitel 2 den theoretischen Grundlagen und der übergreifenden Methodik der Arbeit. Zunächst werden externe Effekte des innerstädtischen Straßenverkehrs kategorisiert und Charakteris...
Eine praktische Anwendung von CMC-Flächen in der Bionik
Apeltauer, Christian
2011-01-01
Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...
Energy Technology Data Exchange (ETDEWEB)
Koch, T. [Duisburg Univ. (Gesamthochschule) (Germany). Lehrstuhl fuer Technische Chemie; Staus, S. [Duisburg Univ. (Gesamthochschule) (Germany). Lehrstuhl fuer Technische Chemie; Schoenbucher, A. [Duisburg Univ. (Gesamthochschule) (Germany). Lehrstuhl fuer Technische Chemie
1997-08-01
After presenting the most common semi-empirical simulation model, the authors describe the newly developed field model and its modules with their mathematical and physical fundamentals. First results are presented for the calculation of a diffusion flame. (orig./GL) [Deutsch] In der vorliegenden Arbeit wird, nach einer Darstellung der gebraeuchlichen halbempirischen Simulationsmodelle, das entwickelte Feldmodell beschrieben und seine einzelnen Module mit ihren mathematischen und physikalischen Grundlagen vorgestellt. Im Anschluss werden erste Ergebnisse fuer die Berechnung einer Diffusionsflamme aufgezeigt. (orig./GL)
Directory of Open Access Journals (Sweden)
Ines Pohlkamp
2012-01-01
Full Text Available Betrachtungen der Anderen, wie der ‚Verbrecher‘, der ‚Irren‘, ‚der Tiere‘ und der ‚Wilden‘, sind bis heute Grundlagen der auf Differenz aufbauenden Disziplinen und strukturieren die gesamte Wissensproduktion. Der Tagungsband bietet vielseitige und erhellende Einblicke in die brüchigen Konstruktionen ‚der/des geschlechtlich Anderen‘ – hier als Figuren der Alterität konzeptionalisiert – und trägt damit vor allem zum interdisziplinären Austausch und zur wissenschaftlichen Dekonstruktion der Geschlechter der Anderen bei.
Energy Technology Data Exchange (ETDEWEB)
Weyns, W.
2010-10-15
Recently, the Belgian organization NIRAS presented its 'Draft Waste Plan'. In this plan NIRAS chooses clay as the reference option for final geological disposal of high-level radioactive and/or long-living nuclear waste (b and C waste). The author presents an overview of the current state of affairs in scientific research on underground storage of radioactive waste in Belgian clay layers. [Dutch] Recent presenteerde het Belgische NIRAS het 'Ontwerp Afvalplan'. In dit plan kiest NIRAS als referentieoptie voor definitieve geologische berging van hoogradioactief en/of langlevend kernafval (B- en C-afval) in klei. De auteur geeft een overzicht van de stand van zaken van wetenschappelijk onderzoek naar ondergrondse opslag van radioactief afval in Belgische kleilagen.
Ni, Weijuan; McNaughton, Lynn; LeMaster, David M; Sinha, Rashmi; Turesky, Robert J
2008-01-09
The concentrations of heterocyclic aromatic amines (HAAs) were determined, by liquid chromatography-electrospray ionization/tandem mass spectrometry (LC-ESI-MS/MS), in 26 samples of beef, pork, and chicken cooked to various levels of doneness. The HAAs identified were 2-amino-3-methylimidazo[4,5- f]quinoline, 2-amino-1-methylimidazo[4,5- b]quinoline, 2-amino-1-methylimidazo[4,5- g]quinoxaline (I gQx), 2-amino-3-methylimidazo[4,5- f]quinoxaline, 2-amino-1,7-dimethylimidazo[4,5- g]quinoxaline (7-MeI gQx), 2-amino-3,8-dimethylimidazo[4,5- f]quinoxaline, 2-amino-1,6-dimethyl-furo[3,2- e]imidazo[4,5- b]pyridine, 2-amino-1,6,7-trimethylimidazo[4,5- g]quinoxaline, 2-amino-3,4,8-trimethylimidazo[4,5- f]quinoxaline, 2-amino-1,7,9-trimethylimidazo[4,5- g]quinoxaline, 2-amino-1-methyl-6-phenylimidazo[4,5- b]pyridine (PhIP), 2-amino-9 H-pyrido[2,3- b]indole, and 2-amino-3-methyl-9 H-pyrido[2,3- b]indole. The concentrations of these compounds ranged from chicken (up to 305 microg/kg), broiled bacon (16 microg/kg), and pan-fried bacon (4.9 microg/kg). 7-MeI gQx was the most abundant HAA formed in very well done pan-fried beef and steak, and in beef gravy, at concentrations up to 30 microg/kg. Several other linear tricyclic ring HAAs containing the I gQx skeleton are formed at concentrations in cooked meats that are relatively high in comparison to the concentrations of their angular tricyclic ring isomers, the latter of which are known experimental animal carcinogens and potential human carcinogens. The toxicological properties of these recently discovered I gQx derivatives warrant further investigation and assessment.
Wynes, Jacob; Lamm, Bradley M; Andrade, Bijan J; Malay, D Scot
2016-01-01
We used preoperative radiographic and intraoperative anatomic measurements to predict and achieve, respectively, the precise amount of capital fragment lateral translation required to restore anatomic balance to the first metatarsophalangeal joint. Correlation was used to relate the amount of capital fragment translation and operative reduction of the first intermetatarsal angle (IMA), hallux abductus angle (HAA), tibial sesamoid position (TSP), metatarsus adductus angle, and first metatarsal length. The mean capital fragment lateral translation was 5.54 ± 1.64 mm, and the mean radiographic reductions included a first IMA of 5.04° ± 2.85°, an HAA of 9.39° ± 8.38°, and a TSP of 1.38 ± 0.9. These changes were statistically (p < .001) and clinically (≥32.55%) significant. The mean reduction of the metatarsus adductus angle was 0.66° ± 4.44° and that for the first metatarsal length was 0.33 ± 7.27 mm, and neither of these were statistically (p = .5876 and 0.1247, respectively) or clinically (≤3.5%) significant. Pairwise correlations between the amount of lateral translation of the capital fragment and the first IMA, HAA, and TSP values were moderately positive and statistically significant (r = 0.4412, p = .0166; r = 0.5391, p = .0025; and r = 0.3729, p = .0463; respectively). In contrast, the correlation with metatarsus adductus and the first metatarsal shortening were weak and not statistically significant (r = 0.2296, p = .2308 and r = -0.2394, p = .2109, respectively). The results of our study indicate that predicted preoperative and executed intraoperative lateral translation of the capital fragment correlates with statistically and clinically significant reductions in the first IMA, HAA, and TSP. Copyright © 2016 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.
Yang, Xue; Li, Yunliang; Li, Suyun; Oladejo, Ayobami Olayemi; Wang, Yucheng; Huang, Shanfen; Zhou, Cunshan; Wang, Yang; Mao, Li; Zhang, Yanyan; Ma, Haile; Ye, Xiaofei
2017-09-01
The effects of ultrasonic frequency mode, power density, pretreatment time and other parameters under low power density on the degree of hydrolysis (DH) of defatted wheat germ protein (DWGP) and angiotensin-I-converting enzyme (ACE) inhibitory activity of DWGP hydrolysate were studied in this research. Ultraviolet-visible (UV-Vis) spectra, free sulfhydryl (SH), disulfide bond (SS), surface hydrophobicity and hydrophobic protein content of ultrasound-pretreated protein and hydrophobic amino acid (HAA) content of alcalase-hydrolysate of DWGP were measured under optimized ultrasonic condition. The ultrasonic frequency mode with dual-fixed frequency combination of 28/40kHz showed higher ACE inhibitory activity of DWGP hydrolysate compared with that of other ultrasound frequency modes and all the ultrasonic frequency combinations involving in 28kHz showed higher ACE inhibitory activity. Under the dual-fixed frequency ultrasound mode of 28/40kHz, ultrasonic power density of 60W/L, pretreatment time of 70min, temperature of 60°C and substrate concentration of 60g/L, the ACE inhibitory activity of DWGP hydrolysate was the highest with its value of 74.75% (increased by 62.30% compared to control). However, all the ultrasonic pretreatment did not increase the DH of DWGP significantly (p>0.05). The changes in UV-Vis spectra, SH and SS groups, surface hydrophobicity and hydrophobic protein content indicated that the structure of DWGP unfolded after ultrasound pretreatment. The HAA content of hydrolysate from the pretreated DWGP increased significantly (p<0.05). The results proved that ultrasound pretreatment loosed the protein structure and exposed more HAA residues of protein to be attacked easily by alcalase. This resulted in the increase in the HAA content which related to the ACE inhibitory activity. Copyright © 2017 Elsevier B.V. All rights reserved.
Maya-Meraz, Irma O; Espino-Díaz, Miguel; Molina-Corral, Francisco J; González-Aguilar, Gustavo A; Jacobo-Cuellar, Juan L; Sepulveda, David R; Olivas, Guadalupe I
2014-11-01
One of the main quality parameters in apples is aroma, its main precursors are fatty acids (FA) and amino acids (AA). In this study, alginate edible coatings were used as carriers of linoleic acid or isoleucine to serve as precursors for the production of aroma in cut apples. Apple wedges were immersed in a CaCl2 solution and coated with one of the following formulations: alginate solution (Alg-Ca), Alg-Ca-low-level linoleic acid (0.61 g/Lt), (LFA), Alg-Ca-high-level linoleic acid (2.44 g/L; HFA), Alg-Ca-low-level isoleucine (0.61 g/L; LAA), and Alg-Ca-high-level isoleucine (2.44 g/L; HAA). Apple wedges were stored at 3 °C and 85% relative humidity for 21 d and key volatiles were studied during storage. Addition of precursors, mainly isoleucine, showed to increase the production of some key volatiles on coated fresh-cut apples during storage. The concentration of 2-methyl-1-butanol was 4 times higher from day 12 to day 21 in HAA, while 2-methyl butyl acetate increased from day 12 to day 21 in HAA. After 21 d, HAA-apples presented a 40-fold value of 2-methyl-butyl acetate, compared to Alg-Ca cut apples. Values of hexanal increased during cut apple storage when the coating carried linoleic acid, mainly on HFA, from 3 to 12 d. The ability of apples to metabolize AA and FA depends on the concentration of precursors, but also depends on key enzymes, previous apple storage, among others. Further studies should be done to better clarify the behavior of fresh-cut apples as living tissue to metabolize precursors contained in edible coatings for the production of volatiles. © 2014 Institute of Food Technologists®
International Nuclear Information System (INIS)
Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Le Hegarat, Ludovic; Aninat, Caroline; Robin, Marie-Anne; Guguen-Guillouzo, Christiane
2010-01-01
Human exposure to heterocyclic aromatic amines (HAA) usually occurs through mixtures rather than individual compounds. However, the toxic effects and related mechanisms of co-exposure to HAA in humans remain unknown. We compared the effects of two of the most common HAA, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), individually or in combination, in the metabolically competent human hepatoma HepaRG cells. Various endpoints were measured including cytotoxicity, apoptosis, oxidative stress and DNA damage by the comet assay. Moreover, the effects of PhIP and/or MeIQx on mRNA expression and activities of enzymes involved in their activation and detoxification pathways were evaluated. After a 24 h treatment, PhIP and MeIQx, individually and in combination, exerted differential effects on apoptosis, oxidative stress, DNA damage and cytochrome P450 (CYP) activities. Only PhIP induced DNA damage. It was also a stronger inducer of CYP1A1 and CYP1B1 expression and activity than MeIQx. In contrast, only MeIQx exposure resulted in a significant induction of CYP1A2 activity. The combination of PhIP with MeIQx induced an oxidative stress and showed synergistic effects on apoptosis. However, PhIP-induced genotoxicity was abolished by a co-exposure with MeIQx. Such an inhibitory effect could be explained by a significant decrease in CYP1A2 activity which is responsible for PhIP genotoxicity. Our findings highlight the need to investigate interactions between HAA when assessing risks for human health and provide new insights in the mechanisms of interaction between PhIP and MeIQx.
Energy Technology Data Exchange (ETDEWEB)
Hohenlohe, A zu; Kosinowski, M; Radtke, H
1994-12-31
The present article describes the legal groundwork of the Administrative Agreement on the Financing of Site Rehabilitation in the new Laender. It then lists 19 large-scale projects and depicts the organisational structure adopted for their implementation. Finally it presents various site rehabilitation concepts and financial schemes. (SR) [Deutsch] Der Artikel beschreibt die gesetzlichen Grundlagen des Verwaltungsabkommens zur Finanzierung der Altlastensanierung in den neuen Bundeslaendern. Anschliessend werden 19 Grossprojekte aufgelistet und die Organisationsstruktur zur Umsetzung der Sanierungsarbeiten dargestellt. Abschliessend werden Altlatensanierungskonzepte und Finanzrahmen dargestellt. (SR)
Siglenverzeichnis und Abkürzungen der Werke Wittgensteins
2017-01-01
AüL Aufzeichnungen über Logik BB Aufzeichnungen über Logik BGM Bemerkungen über die Grundlagen der Mathematik BLF Bemerkungen über logische Form BPP Bemerkungen über die Philosophie der Psychologie BüF Bemerkungen über die Farben PB Philosophische Bemerkungen PG Philosophische Grammatik PU Philosophische Untersuchungen T Tractatus Logico-philosophicus TB Tagebücher 1914-1916 ÜG Über Gewißheit V&G Vorlesungen und Gespräche über Ästhetik, Psychoanalyse und religiösen Glauben WWK Wittgenstein un...
Observation of Rashba zero-field spin splitting in a strained germanium 2D hole gas
International Nuclear Information System (INIS)
Morrison, C.; Rhead, S. D.; Foronda, J.; Leadley, D. R.; Myronov, M.; Wiśniewski, P.
2014-01-01
We report the observation, through Shubnikov-de Haas oscillations in the magnetoresistance, of spin splitting caused by the Rashba spin-orbit interaction in a strained Ge quantum well epitaxially grown on a standard Si(001) substrate. The Shubnikov-de Haas oscillations display a beating pattern due to the spin split Landau levels. The spin-orbit parameter and Rashba spin-splitting energy are found to be 1.0 × 10 −28 eVm 3 and 1.4 meV, respectively. This energy is comparable to 2D electron gases in III-V semiconductors, but substantially larger than in Si, and illustrates the suitability of Ge for modulated hole spin transport devices.
Disinfection byproduct formation in drinking water sources: A case study of Yuqiao reservoir.
Zhai, Hongyan; He, Xizhen; Zhang, Yan; Du, Tingting; Adeleye, Adeyemi S; Li, Yao
2017-08-01
This study investigated the potential formation of disinfection byproducts (DBPs) during chlorination and chloramination of 20 water samples collected from different points of Yuqiao reservoir in Tianjin, China. The concentrations of dissolved organic matter and ammonia decreased downstream the reservoir, while the specific UV absorbance (SUVA: the ratio of UV 254 to dissolved organic carbon) increased [from 0.67 L/(mg*m) upstream to 3.58 L/(mg*m) downstream]. The raw water quality played an important role in the formation of DBPs. During chlorination, haloacetic acids (HAAs) were the major DBPs formed in most of the water samples, followed by trihalomethanes (THMs). CHCl 3 and CHCl 2 Br were the major THM species, while trichloroacetic acid (TCAA) and dichloroacetic acid (DCAA) were the major HAA species. Chloramination, on the other hand, generally resulted in lower concentrations of THMs (CHCl 3 ), HAAs (TCAA and DCAA), and haloacetonitriles (HANs). All the species of DBPs formed had positive correlations with the SUVA values, and HANs had the highest one (R 2 = 0.8). The correlation coefficients between the analogous DBP yields and the SUVA values in chlorinated samples were close to those in chloraminated samples. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Chiavelli Lucas U.R.
2016-01-01
Full Text Available Usually, water treatment plants employ chlorine or sodium hypochlorite during the disinfection process, ensuring that there are not any pathogenic microorganisms in water. However, chlorine might react with natural organic matter and lead to formation of potentially carcinogenic by-products regarding human health, such as haloacetic acids (HAAs. Several countries regulate the levels of these acids in drinking water. Therefore, their concentrations must be monitored with the greatest accuracy as possible. In order to achieve this goal, a method through gas chromatography coupled with mass spectrometry (GC-MS was validated and applied to the determination of HAAs in samples of water destined to the public water service provision from the city of Maringá, Paraná State, Brazil. Measurements between two periods have close recovery values, indicating that the method has good accuracy during the same day. The limits of detection (LOD and quantification (LOQ were satisfactory, with LOD 0.42 μg L-1 and LOQ 1.40 μg L-1 for dichloro-acetic acid (DCAA analysis. Recovery values obtained for the nine haloace-tics acids (HAA9 corresponded to 69.9-107.3 % for samples. The repeatability performed for two periods presented close relative standard deviation (RSD values, indicating that the method has good accuracy during the same day.
Akiyama, Megumi; Matsui, Yoshihiko; Kido, Junki; Matsushita, Taku; Shirasaki, Nobutaka
2018-06-01
The probability distributions of total potential doses of disinfection byproducts and volatile organic compounds via ingestion, inhalation, and dermal exposure were estimated with Monte Carlo simulations, after conducting physiologically based pharmacokinetic model simulations to takes into account the differences in availability between the three exposures. If the criterion that the 95th percentile estimate equals the TDI (tolerable daily intake) is regarded as protecting the majority of a population, the drinking water criteria would be 140 (trichloromethane), 66 (bromodichloromethane), 157 (dibromochloromethane), 203 (tribromomethane), 140 (dichloroacetic acid), 78 (trichloroacetic acid), 6.55 (trichloroethylene, TCE), and 22 μg/L (perchloroethylene). The TCE criterion was lower than the Japanese Drinking Water Quality Standard (10 μg/L). The latter would allow the intake of 20% of the population to exceed the TDI. Indirect inhalation via evaporation from water, especially in bathrooms, was the major route of exposure to compounds other than haloacetic acids (HAAs) and accounted for 1.2-9 liter-equivalents/day for the median-exposure subpopulation. The ingestion of food was a major indirect route of exposure to HAAs. Contributions of direct water intake were not very different for trihalomethanes (30-45% of TDIs) and HAAs (45-52% of TDIs). Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
G K Singh
2017-01-01
Full Text Available Approximately, 140 million people worldwide live permanently at high altitudes (HAs and approximately another 40 million people travel to HA area (HAA every year for reasons of occupation, sports or recreation. In India, whole of Ladakh region, part of Northwest Kashmir, Northern part of Sikkim and Tenga valley of Arunachal are considered inhabited areas of HAA. The low quantity of oxygen, high exposure of ultraviolet (UV light, very low humidity, extreme subzero temperature in winter, high wind velocity, make this region difficult for lowlanders as well as for tourists. Acute mountain sickness, HA pulmonary edema, HA cerebral edema, and thromboembolic conditions are known to occur in HA. However, enough knowledge has not been shared on dermatoses peculiar to this region. Xerosis, UV-related skin disorders (tanning, photomelanosis, acute and chronic sunburn, polymorphic light eruption, chronic actinic dermatitis, actinic cheilitis, etc., cold injuries (frostbite, chilblains, acrocyanosis, erythrocyanosis, etc. nail changes (koilonychias, airborne contact dermatitis, insect bite reaction, and skin carcinoma (basal cell carcinomas, squamous cell carcinomas, and also rarely malignant melanoma are the dermatoses seen in HAAs. Early diagnosis and knowledge of HA dermatoses may prevent serious consequences of disease and improve the quality of life for the visitors as well as for native of the place.
Directory of Open Access Journals (Sweden)
Molnar Jelena J.
2012-01-01
Full Text Available This paper investigates the influence of different matrices (groundwater a realistic natural matrix and commercial humic acid solution a synthetic matrix on the nature and content of haloacetic acid (HAA precursors in ozonized water (0.4 to 3.0 mg O3/mg DOC; pH 6. Natural organic matter (NOM characterization of the natural matrix showed it was largely of hydrophobic character (65% fulvic and 14% humic acids, with the hydrophilic fractions HPIA and HPI-NA at 12% and 9%, respectively. At approximately the same dissolved organic carbon (DOC content of the investigated matrices (~10 mg /L, a greater degree of hydrophobicity was seen in the humic acid solution than in the natural matrix, resulting in a higher content of HAA precursors (559 ± 21 μg/L in the synthetic matrix compared to 309 ± 15 μg/L in the natural matrix. By applying different ozone doses (0.4 to 3.0 mg O3/mg DOC, the DOC content of the studied matrices was reduced by 6-22%, with a maximum process efficacy being achieved with 3.0 mg O3/mg DOC. Ozonation also lead to changes in the NOM structure, i.e. complete oxidation of the humic acid fractions in both investigated matrices. After oxidation, hydrophilic structures dominate the natural water matrix (65%, whereas the synthetic matrix has an equal distribution of hydrophobic and hydrophilic fractions (~50%. Changes in the content and structure of NOM during ozonation resulted in the reduction of the total HAA precursors content (63-85%, using 3.0 mg O3/mg DOC. Detailed analysis of the reactivity of the residual HAA precursor materials shows that ozonation using 3.0 mg O3/mg DOC reduced the reactivity of the NOM fractions in comparison to the raw water. By contrast, HAA precursor material present in the commercial HA solution was transformed after ozonation into other reactive compounds, i.e. precursors which originated from the fulvic acid and hydrophilic fractions. The results of the laboratory testing indicate that the
Pathak, Khyatiben V; Chiu, Ting-Lan; Amin, Elizabeth Ambrose; Turesky, Robert J
2016-03-21
Arylamines (AAs) and heterocyclic aromatic amines (HAAs) are structurally related carcinogens formed during the combustion of tobacco or cooking of meat. They undergo cytochrome P450 mediated N-hydroxylation to form metabolites which bind to DNA and lead to mutations. The N-hydroxylated metabolites of many AAs also can undergo a co-oxidation reaction with oxy-hemolgobin (HbO2) to form methemoglobin (met-Hb) and the arylnitroso intermediates, which react with the β-Cys(93) chain of Hb to form Hb-arylsulfinamide adducts. The biochemistry of arylamine metabolism has been exploited to biomonitor certain AAs through their Hb arylsulfinamide adducts in humans. We examined the reactivity of HbO2 with the N-hydroxylated metabolites of 4-aminobiphenyl (ABP, HONH-ABP), aniline (ANL, HONH-ANL), and the HAAs 2-amino-9H-pyrido[2,3-b]indole (AαC, HONH-AαC), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP, HONH-PhIP), and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx, HONH-MeIQx). HONH-ABP, HO-ANL, and HONH-AαC induced methemoglobinemia and formed Hb sulfinamide adducts. However, HONH-MeIQx and HONH-PhIP did not react with the oxy-heme complex, and met-Hb formation and chemical modification of the β-Cys(93) residue were negligible. Molecular modeling studies showed that the distances between the H-ON-AA or H-ON-HAA substrates and the oxy-heme complex of HbO2 were too far away to induce methemoglobinemia. Different conformational changes in flexible helical and loop regions around the heme pocket induced by the H-ON-AA or H-ON-HAAs may explain the different proclivities of these chemicals to induce methemoglobinemia. Hb-Cys(93β) sulfinamide and sulfonamide adducts of ABP, ANL, and AαC were identified, by Orbitrap MS, following the proteolysis of Hb with trypsin, Glu-C, or Lys-C. Hb sulfinamide and sulfonamide adducts of ABP were identified in the blood of mice exposed to ABP, by Orbitrap MS. This is the first report of the identification of intact Hb
Aasta pressifotod žürii perspektiivist / Annika Haas
Haas, Annika, 1974-
2015-01-01
Konkursist "Aasta pressifoto", pressifotograafide igapäevatööst. "Aasta pressifoto 2014" peapreemia pälvis Dmitri Kotjuhi "Noored suusatajad", portreefoto kategooria võitis Renee Altrovi "Eesti Vabariigi president", uudisfoto kategooria Margus Ansu "Klassijuhataja tunnid", olemusfoto kategooria Priit Simsoni "Kaotatud sõda"
Arousal and consumer in-store behavior.
Groeppel-Klein, Andrea
2005-11-15
From a psychophysiological point of view, arousal is a fundamental feature of behavior. As reported in different empirical studies based on insights from theories of consumer behavior, store atmosphere should evoke phasic arousal reactions to attract consumers. Most of these empirical investigations used verbal scales to measure consumers' perceived phasic arousal at the point-of-sale (POS). However, the validity of verbal arousal measurement is questioned; self-reporting methods only allow a time-lagged measurement. Furthermore, the selection of inappropriate items to represent perceived arousal is criticized, and verbal reports require some form of cognitive evaluation of perceived arousal by the individual, who might (in a non-measurement condition) not even be aware of the arousal. By contrast, phasic electrodermal reaction (EDR) has proven to be the most appropriate and valid indicator for measuring arousal [W. Boucsein, Physiologische Grundlagen und Messmethoden der dermalen Aktivität. In: F. Rösler (Ed.), Enzyklopädie der Psychologie, Bereich Psychophysiologie, Band 1: Grundlagen and Methoden der Psychophysiologie, Kapitel, Vol. 7, Hogrefe, Göttingen, 2001, pp. 551-623] that could be relevant to behavior. EDR can be recorded simultaneously to the perception of stimuli. Furthermore, telemetric online device can be used, which enables physiological arousal measurement while participants can move freely through the store and perform the assigned task in the experiments. The present paper delivers insights on arousal theory and results from empirical studies using EDR to measure arousal at the POS.
Energy Technology Data Exchange (ETDEWEB)
Otto, J. [Ingenieurbuero Dr. Ellrich und Partner, Muenchen (Germany)
1995-12-31
In chapter 6 of the anthology about building control the planning of digital building automation is described. The basics for the system arrangements are presented such as award, construction, inspection approval, and cashing up. Major points are quality criteria as well as the separation of the performance ranges. (BWI) [Deutsch] Kapitel 6 des Sammelbandes ueber Building Control ist der Planung der digitalen Gebaeudeautomation gewidmet. Es werden dabei Grundlagen fuer die Systemfestlegung vorgestellt sowie Vergabe, Ausfuehrung, Abnahme und Abrechnung diskutiert. Wesentliche Punkte sind dabei Qualitaetskriterien sowie die Abgrenzung der Leistungsbereiche. (BWI)
Anthropometry of Women of the U. S. Army--1977. Report Number 1. Methodology and Survey Plan
1977-06-01
on the opposite side of unilateral measurements, on 1,166 office workers, reported in: Von T. Peters . 1969. "Anthropo- metrische and Physiologische...Sitting," Erg onomics, 12 (6): 883-902. Peters , Von T. 1969. "Anthropometrisch e und Physiologische Grundlagen zur Gestaltung von Buroarbe itssitzen11...19H H !HI ~5 H zec HC 28 1H· ~H ET <n 1:!t< ~ .. 1’:0 SEO < 0 170 510 13C ~30 101 107 32 111 53 37 7> 23 22 e1 •e 56
Wörterbuchregister. Grundlagen einer Theorie der Register in ...
African Journals Online (AJOL)
rbr
sprache ↑ Schülersprache ↑ Stu- dentensprache. Epochenbezeichnung. Ersatzwort ↑ Fremdwortverdeut- schung ↑ Lehnschöpfung ↑ Lehn- übersetzung ↑ Lehnübertragung. (9). Birkler, Hubertus → Ettle, Josef. Birkmoser, Hanni → Falk, Hermann. Birkner, Friede → Stein, Elfriede. Birkner, Polten → Brosowski, Paul.
Grundlagen der ultraschallgezielten transurethralen Stammzelltherapie der Harn-Inkontinenz
Directory of Open Access Journals (Sweden)
Strasser H
2005-01-01
Full Text Available In präklinischen Studien wurden Sicherheit und Durchführbarkeit von durch transurethralen Ultraschall geführten Injektionen von autologen Myo- und Fibroblasten zur Behandlung der Stressinkontinenz untersucht. Zwischen 2002 und März 2005 wurden 129 inkontinente Patienten (Alter 3685 Jahre, 92 Frauen, 37 Männer in eine klinische Studie aufgenommen, um zu untersuchen, ob die Stressinkontinenz effektiv mittels durch transurethralen Ultraschall geführte Injektionen von autologen Myo- und Fibroblasten behandelt werden kann. Die Patienten litten an Stress- oder gemischter Harninkontinenz. Vor und nach der Therapie wurden ein definierter Inkontinenz-Score, Veränderungen der Lebensqualität sowie Morphologie und Funktion von Urethra und Rhabdosphinkter bewertet. Der transurethrale Ultraschall wurde zur Untersuchung und Visualisierung des unteren Harntraktes verwendet. Zusätzlich wurden vor und nach der Behandlung urodynamische und Labortests durchgeführt. Es wurden kleine Muskelbiopsien am Oberarm unter Lokalanästhesie entnommen und die Zellen in einem GMP-Labor zum Wachstum gebracht. Die Fibroblasten wurden fallweise mit einer kleinen Menge an Kollagen als Trägermaterial (ca. 2,5 ml gemischt. Mittels transurethralem Ultraschall und einer speziell entwickelten Injektionsvorrichtung wurden die Fibroblasten in die urethrale Mukosa zur Atrophiebehandlung injiziert. Die Myoblasten wurden direkt in den Rabdosphinkter zur Muskelrekonstruktion injiziert. Bei 108 Patienten konnte die Harninkontinenz nach der Injektion geheilt werden. Die postoperative Lebensqualität sowie die Dicke von Urethra und Rhabdosphinkter und die Aktivität und Kontraktilität des Rhabdosphinkter waren nach der Behandlung wesentlich verbessert. Bei 21 Patienten kam es zu einer Verbesserung der Harninkontinenz. Es traten keine Nebenwirkungen oder Komplikationen auf.
Fundamentals of mechatronics. 2. ed.; Grundlagen der Mechatronik
Energy Technology Data Exchange (ETDEWEB)
Bernstein, H.
2004-07-01
Mechatronics combines the disciplines of electrotechnics, electronics, computer science, mechanical engineering, design, pneumatics, hydraulics and process engineering, and the book addresses students and experts in all these fields. It comprises a CD which runs on PC under Windows and illustrates the theory of mechatronics and presents examples. (GL) [German] Die Mechatronik (Kunstwort aus Mechanik und Elektronik) stellt die technische Verbindung zwischen den Fachdisziplinen Elektrotechnik, Elektronik, Informatik, Maschinenbau, Antriebstechnik, Konstruktion, Pneumatik, Hydraulik und Verfahrenstechnik dar, und dementsprechend ist dieses Buch auf das Studium bzw. das Berufbild der einzelnen Aufgabenfelder abgestimmt. Durch die Bauelemente der analogen bzw. digitalen Schaltungstechnik und der Leistungselektronik wurden die Voraussetzungen fuer die Mechatronik in der Automatisierungstechnik geschaffen, die in der Industrie nicht nur zu einer Produktionssteigerung fuehrten, sondern auch die Herstellungsgenauigkeit der Fabrikate wesentlich erhoehten. Durch die Programme auf den beiden dem Buch beiliegenden CD-ROM laesst sich die Theorie der mechatronischen Teilgebiete direkt am PC unter Windows simulieren. Anhand kurzer, aussagekraeftiger Simulationsbeispiele werden die grundlegenden bzw. weiterentwickelten Elemente der Mechatronik gezeigt. Ob in der Antriebstechnik oder in der elektrischen Schaltungstechnik, alle Versuche lassen sich komplett und einfach simulieren und veraendern, so dass jeder Lernschritt nachvollziehbar ist. (orig.)
Antioxidant properties of commercial alcoholic and nonalcoholic beverages.
Lugasi, Andrea; Hóvári, Judit
2003-04-01
Recent interest in food phenolics has increased greatly, because of their antioxidant and free radical scavenging abilities. Popular beverages in the world include tea, coffee, cocoa, beer, wine and fruit/vegetable juices. All of these beverages contain phenolic compounds. In present study total polyphenol content and in vitro antioxidant properties were investigated in 16 red wines, 5 white wines, 5 lager beers, 3 dark beers, 17 fruit juices and 5 vegetable juices. High polyphenol content was measured in red wines (1720 +/- 546 mg x L(-1)) and in some fruit juices such as elderberry and prunes (5,680 and 1,807 mg x L(-1), respectively). The concentration of polyphenols was between 159 and 5,680 mg x L(-1) in fruit juices and between 255 and 696 mg x L(-1) in vegetable ones, while low level of phenolics was observed in dark and lager beers and white wines (473, 376 and 392 mg x L(-1), respectively). All samples exhibited significant antioxidant properties such as hydrogen-donating ability, reducing power, chelating ability and total antioxidant status (TAS) value. These antioxidant properties strongly correlated with the total polyphenol content of the beverages.
Estimating the temporal evolution of Alzheimer's disease pathology with autopsy data.
Royall, Donald R; Palmer, Raymond F
2012-01-01
The temporal growth of Alzheimer's disease (AD) neuropathology cannot be easily determined because autopsy data are available only after death. We combined autopsy data from 471 participants in the Honolulu-Asia Aging Study (HAAS) into latent factor measures of neurofibrillary tangle and neuritic plaque counts. These were associated with intercept and slope parameters from a latent growth curve (LGC) model of 9-year change in cognitive test performance in 3244 autopsied and non-autopsied HAAS participants. Change in cognition fully mediated the association between baseline cognitive performance and AD lesions counts. The mediation effect of cognitive change on both AD lesion models effectively dates them within the period of cognitive surveillance. Additional analyses could lead to an improved understanding of lesion propagation in AD.
Energy Technology Data Exchange (ETDEWEB)
Brugge, J.V.M.; Vrouwe, B.J. [T and A Survey, Amsterdam (Netherlands)
2010-12-15
The Dutch government aims to store nuclear waste in the Dutch soil. Geological research organization T and A Survey mapped the areas that match with the demands of the Dutch government regarding underground storage of nuclear waste. These are areas in which the Clay layer of Boom has a minimal thickness of 100 meters and the depth of the top of the clay formation is at least 500 meters. [Dutch] De Nederlandse overheid wil kernafval ondergronds opslaan in de Nederlandse bodem. Geologisch onderzoeksbureau T and A Survey brengt de gebieden in kaart, die voldoen aan de door de overheid gestelde eisen voor mogelijke ondergrondse opslag van kernafval. Het gaat om gebieden waar de Boomse kleilaag een minimale dikte van 100 meter heeft en de diepte van de top van de kleiformatie minimaal 500 meter bedraagt.
Presidential Green Chemistry Challenge: 1996 Designing Greener Chemicals Award
Presidential Green Chemistry Challenge 1996 award winner, Rohm and Haas, developed Sea-Nine, a marine antifoulant to control plants and animals on ship hulls. Sea-Nine replaces persistent, toxic organotin antifoulants.
Energy Technology Data Exchange (ETDEWEB)
Schnyder, G.; Ritz, Ch.
2007-03-15
This final report for the Swiss Federal Office of Energy (SFOE) reports on the technical prerequisites necessary for the implementation of various measures that are to be taken to promote efficient electrical drive systems. The document defines the approach taken and describes the methodologies to be used, including market analysis, the collection of basic data, the definition of measures and the acquisition of partners. The potential for making savings is estimated. Eight areas of action are defined, including the organisation of tutorials, exchange of experience, knowledge transfer, basic consulting services, the deployment of consultants, the setting-up of an Internet portal, information transfer in conferences and the optimisation of auxiliaries in domestic installations. A comprehensive annex completes the report.
Krogerus, Kristoffer; Seppänen-Laakso, Tuulikki; Castillo, Sandra; Gibson, Brian
2017-04-21
Interspecific hybridization has proven to be a potentially valuable technique for generating de novo lager yeast strains that possess diverse and improved traits compared to their parent strains. To further enhance the value of hybridization for strain development, it would be desirable to combine phenotypic traits from more than two parent strains, as well as remove unwanted traits from hybrids. One such trait, that has limited the industrial use of de novo lager yeast hybrids, is their inherent tendency to produce phenolic off-flavours; an undesirable trait inherited from the Saccharomyces eubayanus parent. Trait removal and the addition of traits from a third strain could be achieved through sporulation and meiotic recombination or further mating. However, interspecies hybrids tend to be sterile, which impedes this opportunity. Here we generated a set of five hybrids from three different parent strains, two of which contained DNA from all three parent strains. These hybrids were constructed with fertile allotetraploid intermediates, which were capable of efficient sporulation. We used these eight brewing strains to examine two brewing-relevant phenotypes: stress tolerance and phenolic off-flavour formation. Lipidomics and multivariate analysis revealed links between several lipid species and the ability to ferment in low temperatures and high ethanol concentrations. Unsaturated fatty acids, such as oleic acid, and ergosterol were shown to positively influence growth at high ethanol concentrations. The ability to produce phenolic off-flavours was also successfully removed from one of the hybrids, Hybrid T2, through meiotic segregation. The potential application of these strains in industrial fermentations was demonstrated in wort fermentations, which revealed that the meiotic segregant Hybrid T2 not only didn't produce any phenolic off-flavours, but also reached the highest ethanol concentration and consumed the most maltotriose. Our study demonstrates the
Produce bi oethanol from waste; Lager bioetanol av avfall
Energy Technology Data Exchange (ETDEWEB)
Nilsen, Jannicke
2011-07-01
Borregaard has received 100 million in support to the development of new technology for 2 generation bi oethanol. But a full-scale plant might as well end in Brazil (not Norway). All biomass, whether it's straw or even three, consisting of about 45% cellulose, 30% lignin and 25% sugars (hemi cellulose). About half of lignin production goes to the cement industry in the form of cement improvement products. (AG)
De syntaxis in het moedertaalonderwijs op de lagere school
Boersma, Uilkje Jeltje
1960-01-01
Het eerste deel van deze studie omvat een historisch overzicht van grammaticale stromingen binnen en buiten het nederlandse taalgebied, die onze traditie hebben gevormd. Dit gedeelte beoogt: zeker niet een uitputtende en zuiver filologische beschrijving van de geschiedenis der nederlandse taalkunde
Li, Shujiao; Lin, Hang; Qu, Cheng; Tang, Yuping; Shen, Juan; Li, Weixia; Yue, Shijun; Kai, Jun; Shang, Guanxiong; Zhu, Zhenhua; Zhang, Changbin; Liu, Pei; Yan, Hui; Zhang, Li; Qian, Li; Qian, Dawei; Duan, Jin-ao
2015-07-21
The compatibility of Angelicae Sinensis Radix (Danggui) and Carthami Flos (Honghua), a famous herb pair Gui-Hong, can produce synergistic and complementary hematinic effects. Our previous studies have indicated that Gui-Hong has therapeutic potential treatment in hemolytic and aplastic anemia (HAA). The present study aimed to investigate the hematinic effects of Danggui, Honghua and Gui-Hong on HAA rats induced by acetyl phenylhydrazine (APH) and cyclophosphamide (CP) and to explore the underlying hematinic regulation mechanisms. Rats were divided into 5 groups, and drugs were administered by oral gavage one time each day for continuous 7 days from the experiment began. Urine and plasma were analyzed by ultra-high-performance liquid chromatography coupled to quadrupole time-of-flight mass spectrometry (UHPLC-QTOF/MS). Partial least-squares discriminate analysis (PLS-DA) models were built to evaluate the therapeutic effects of Danggui, Honghua and Gui-Hong. Pearson correlation matrix analysis method was used to discover the correlations between potential biomarkers and biochemical indicators of HAA rats. Seven potential biomarkers contribute to the separation of model group and control group were tentatively identified. The levels of l-kynurenine, phenylalanine, nicotinic acid and sphingosine increased significantly (Pmetabonomics method is a promising tool in the efficacy and mechanism research of traditional Chinese medicines. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kolpa, R.; Smith, K.
1993-07-01
This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA
Energy Technology Data Exchange (ETDEWEB)
Kolpa, R.; Smith, K.
1993-07-01
This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA.
Le Roux, Julien; Gallard, Hervé
2011-01-01
Disinfection with chloramines is often used to reduce the production of regulated disinfection by-products (DBPs) such as trihalomethanes (THMs) and haloacetic acids (HAAs). However, chloramination can lead to the formation of N
de Fusarium isolé du fruit de tomate (Solanum lycopersicum L ...
African Journals Online (AJOL)
Dina
A phytopathogenic fungus Fusarium F-02 is isolated from rotten tomato fruit. ..... between Trichoderma harzianum and Pythium ultimum”. .... [31] - HAAS, and C. KEEL, “Regulation of antibiotic production in root-colonizing Pseudomonas spp.
Pollenanalytisch en Geologisch onderzoek van het Onder- en Midden-Pleistoceen van Noord-Nederland
Brouwer, A.
1949-01-01
Pollen analytical and geological investigations of the Lower and Middle Pleistocene in the Northern Netherlands. The Pleistocene deposits in the northern part of the Netherlands, form through their extreme thickness up to more than 300 m, a promising object for study from the stratigraphical point
Kolmekesi ühest Peipsi-äärsest asjast / Tiit Lepp
Lepp, Tiit
2007-01-01
Annika Haasi, Birgit Püve ja Age Petersoni fotonäitus "Prichudie, Revisited" Peipsiääre valla inimestest ja elust-olust kunstikeskuses AmbulARToorium Tartumaaal. Kommenteerinud Annika Haas, Birgit Püve, Age Peterson
Requirements on the provisional safety analyses and technical comparison of safety measures
International Nuclear Information System (INIS)
2010-04-01
The concept of a Geological Underground Repository (SGT) was adopted by the Swiss Federal Council on April 2 nd , 2008. It fixes the goals and the safety technical criteria as well as the procedures for the choice of the site for an underground repository. Those responsible for waste management evaluate possible site regions according to the present status of geological knowledge and based on the safety criteria defined in SGT as well as on technical feasibility. In a first step, they propose geological repository sites for high level (HAA) and for low and intermediate level (SMA) radioactive wastes and justify their choice in a report delivered to the Swiss Federal Office of Energy. The Swiss Federal Council reviews the choices presented and, in the case of positive evaluation, approves them and considers them as an initial orientation. In a second step, based on the possible sites according to step 1, the waste management institution responsible has to reduce the repositories chosen for HAA and SMA by taking into account safety aspects, technical feasibility as well as space planning and socio-economical aspects. In making this choice, safety aspects have the highest priority. The criteria used for the evaluation in the first step have to be defined using provisional quantitative safety analyses. On the basis of the whole appraisal, including space planning and socio-economical aspects, those responsible for waste management propose at least two repository sites for HAA- and SMA-waste. Their selection is then reviewed by the authorities and, in the case of a positive assesment, the selection is taken as an intermediate result. The remaining sites are further studied to examine site choice and the delivery of a request for a design license. If necessary, the requested geological knowledge has to be confirmed by new investigations. Based on the results of the choosing process and a positive evaluation by the safety authorities, the Swiss Federal Council has to
Energy Technology Data Exchange (ETDEWEB)
Becht, Stefanie [Unfallkrankenhaus Berlin (Germany). Inst. fuer Radiologie; Bittner, Roland C. [Helios Klinikum Emil von Behring, Berlin (Germany). Inst. fuer Diagnostische und Interventionelle Radiologie; Ohmstede, Anke [Klinikum Oldenburg gGmbH (Germany). MTA-Schule; Pfeiffer, Andreas [Klinikum Stuttgart (Germany). Servicecenter Informationstechnik; Rossdeutscher, Reinhard [Johanniter-Krankenhaus im Flaeming, Treuenbrietzen (Germany). Abt. fuer Roentgendiagnostik
2008-07-01
The standard textbook on x-ray diagnostics has been revised by the MTRA team and radiologists: The book covers the following topics: General information: the profession of a radiologist, the x-ray department, radiation protection, quality assurance, basic physics, x-ray imaging, analog and digital image processing, archives, image interpretation. Skeleton diagnostics; Inner organs (thorax organs, neck, abdomen, gastrointestinal tract, colon, gall bladder and biliary tract): Special x-ray diagnostic methods: x-ray diagnostic of the female and male chest, x-ray diagnostics of bone joints (arthrography, and contrast media), x-ray diagnostics of the urinary-genital system, x-ray diagnostics of cavities and syrinx, x-ray diagnostics of arteries (arteriography, angiography), percutaneous transluminal angioplasty, x-ray diagnostics of veins (phlebography), x-ray diagnostics of lymphatic vessels and lymph nodes, x-ray diagnostics of spinal cord (myelography); Specific imaging methods: computerized tomography. [German] Ein erfahrenes Team aus MTRA und Radiologen ueberarbeitete und verbesserte das bewaehrte Standardwerk grundlegend. Detailliert, praezise und ausfuehrlich erlaeutert die 6. Neuauflage technische und physikalische Grundlagen, Strahlenschutz, alle wichtigen Einstellungen (vom Skelettsystem bis hin zur Mammadiagnostik) und aktuelle Leitlinien. Nah an der Praxis sind insbesondere die Hinweise zur Patientenvorbereitung und -lagerung, Qualitaetskriterien und Bildmerkmale sowie viele Tipps und Checklisten. Alle Einstellbilder sowie die Mehrzahl der radiologischen Aufnahmen sind erneuert. Die Kapitel zur digitalen Radiographie und den Grundlagen der MRT sind neu, die Kapitel zu CT-Protokollen und zur interventionellen Radiologie erweitert. Ein ausfuehrliches Glossar rundet das Buch ab. Insgesamt ein wertvolles und unverzichtbares Standardwerk fuer Ausbildung und Beruf. (orig.)
Tahir, Muhammad; Schwingenschlö gl, Udo
2013-01-01
We show that the surface states of magnetic topological insulators realize an activated behavior and Shubnikov de Haas oscillations. Applying an external magnetic field perpendicular to the surface of the topological insulator in the presence
Rabbit Hemorrhagic Disease Virus-2 (RHDV2): bij de konijnen af
IJzer, J.; van Zeeland, Y.R.A.; Montizaan, Margriet; Egberink, H.F.; König, P.; van Geijlswijk, I.M.
2016-01-01
Dit artikel beschrijft de achtergronden en de omvang van de RHDV2-uitbraak van 2015/begin 2016 onder wilde en gehouden konijnen in Nederland en bespreekt de mogelijkheden tot vaccinatie. RHDV2-infectie veroorzaakt een zeer besmettelijke, vaak acuut dodelijke ziekte van het konijn (Oryctolagus cuniculus}. Er zijn enkele verschillen met infectie met het klassieke RHDV, waaronder een langere incubatietijd, sterker variabele mortaliteit, een breder gastheerspectrum en een lagere leeftijdsresisten...
Studie: Lagerverwaltungssysteme und ihr Leistungsprofil: Jetzt auch im Internet
Figgener, O.
2001-01-01
Die internationale Marktstudie über Lagerverwaltungssysteme ist für das Jahr 2000 abgeschlossen. Seit April 2001 sind die Ergebnisse in einem neu-geschaffenem Internet-Portal zugänglich. In dem Portal "Warehouse Logistics" werden darüber hinaus Informationen und Veranstaltungen zu dem Themenkomplex Lager und Logistik veröffentlicht. Links zu Anbietern von LVS und Lagertechnik sind dort genauso hinterlegt wie aktuelle Vorträge oder Veröffentlichungen.
National Research Council Canada - National Science Library
Fritts, David C
2008-01-01
... for which significant wave and turbulence activity may pose an operational or functional risk. The specific goal for MDA purposes was to create a forecasting methodology for turbulence activity at the expected High Altitude Airship (HAA...
Ere täht Britta / Britta Vahur ; interv. Jüri Muttika
Vahur, Britta, 1984-
2006-01-01
Rubriigis "elu ühes päevas" TV 3 uues telesarjas "Helena" peaosalist kehastav Britta Vahur endast. Lisaks sarja stsenaristi Marko Lillemägi kirjutatud "Seriaalikangelanna Helena Haas (23)", mis kirjeldab seriaali Helena päeva
Vom Zurechtlegen der Niederlage als Grundlage: Kritik der (Rechts‐Grundlagenforschung
Directory of Open Access Journals (Sweden)
David R. Wenger
2006-06-01
Full Text Available Philosophie als Magd des Rechts (Ancilla Iuris ist eine ambivalente Gestalt. Indem sie etwa die Rechtsdogmatik nach allen Regeln ihrer Kunst dekonstruiert und deren unbewusste oder gar mutwillig verheimlichte Grundlagen bloßlegt, legt sie diese zugleich auch selber fest. Es hat also jede so genannte Grundlagenforschung auch ihre eigenen festen Stellungen und Standpunkte, die sie allerdings nicht sehen kann, weil sie auf ihnen steht. Gegenstrebig fügen sich in ihr Kritik und Dogmatik; sie sind sich als Befragung und Begründung entgegengesetzt und schlagen ineinander um: das ist die Dialektik der Sache.
Moderne mathematische Methoden der Physik
Goldhorn, Karl-Heinz; Kraus, Margarita
2010-01-01
Der große Vorzug dieses Lehrbuchs liegt in seiner kompromisslosen Konzentration auf begriffliche Klarheit bei bewusstem Verzicht auf für Physiker irrelevante Details. Es richtet sich u.a. an Studierende von Master-, Aufbau-, Graduierten- und Promotionsstudiengängen im Bereich der theoretischen und mathematischen Physik. Die Auswahl des Stoffes deckt ein breites Spektrum mathematischer Konzepte und Methoden ab, die für die heutige Physik relevant sind. Dieser zweite Band konzentriert sich dabei auf mathematische Grundlagen der Quantenmechanik: Unbeschränkte Operatoren im Hilbertraum, Spektraltheorie sowie Symmetriegruppen und ihre Darstellungen mit besonderem Augenmerk auf Rotations- und Lorentzgruppe.
Wu, Ming J.; Clarke, Frank M.; Rogers, Peter J.; Young, Paul; Sales, Narelle; O’Doherty, Patrick J.; Higgins, Vincent J.
2011-01-01
This study was carried out with fresh Australian lager beer which was sampled directly off the production line, the same samples aged for 12 weeks at 30 °C, and the vintage beer which was kept at 20 °C for 5 years. Characteristic Australian lager flavour was maintained in the fresh and vintage beers but was lost in the aged beer. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and free thiol group labelling analyses of beer proteins found that this flavour stability correlated with the presence of an unknown 10 kilodaltons (kDa) protein with a higher level of free thiols. The protein was purified by size-exclusion chromatography, then peptide sequencing and database matching identified it as the barley lipid transfer protein (LTP1). Further characterisation using diphenylpicrylhydrazyl (DPPH) free radical scavenging and a Saccharomyces cerevisiae-based antioxidant screening assay demonstrated that the LTP1 protein was active in DPPH reduction and antioxidant activity. The absence of free thiol in the aged beer indicates that the thiol functional groups within the LTP1 protein were saturated and suggests that it is important in the flavour stability of beer by maintaining reduction capacity during the ageing process. PMID:22016646
Brooks, J Renée; Buchmann, Nina; Phillips, Sue; Ehleringer, Bruce; Evans, R David; Lott, Mike; Martinelli, Luiz A; Pockman, William T; Sandquist, Darren; Sparks, Jed P; Sperry, Lynda; Williams, Dave; Ehleringer, James R
2002-10-23
The carbon isotope ratios (delta(13)C) of 160 beers from around the world ranged from -27.3 to -14.9 per thousand, primarily due to variation in the percentage of C(3) or C(4) plant carbon in the final product. Thirty-one percent of beers had a carbon signature of C(3) plants (barley, rice, etc.), whereas the remaining 69% contained some C(3)-C(4) mixture (mean of mixtures, 39 +/- 11% C(4) carbon). Use of C(4) carbon (corn, cane sugar, etc.) was not confined to beers from any particular region (Pacific Rim, Mexico, Brazil, Europe, Canada, and the United States). However, the delta(13)C of European beers indicated mostly C(3) plant carbon. In contrast, U.S. and Canadian beers contained either only C(3) or C(3)-C(4) mixtures; Brazilian, Mexican, and Pacific Rim beers were mostly C(3)-C(4) mixtures. Among different lagers, U.S.-style lagers generally contained more C(4) carbon than did imported pilsners. Among different ales, those brewed by large high-production breweries contained significant proportions of C(4) carbon, while C(4) carbon was not detected in microbrewery or home-brew ales. Furthermore, inexpensive beers generally contained more C(4) carbon than expensive beers.
THE EFFECT OF COUNTRY-OF-ORIGIN ON NEW ZEALAND CONSUMERS BEER PURCHASING BEHAVIOR
Directory of Open Access Journals (Sweden)
Jashim Khan
2017-03-01
Full Text Available Country of Origin (COO sits along with marketing mix factor in the global market place. Given the importance of COO, studies have touched the field of COO effects, though studies pertaining to alcoholic beverage purchase behavior, particularly in the New Zealand remains limited. This study explores the potential impact of demographics on the magnitude of Country of Origin effects for two lager beer products. The data was collected via survey format from 211 respondents living in Auckland, New Zealand. The results from this study suggest that older consumers are more dependent upon the country of origin information when evaluating a product and, particularly when presented with unfamiliar brands, they tend to perceive imported lager beer as being of higher quality, more trendy and more value for money. Also customer perceptions differ based on the customer’s socio-economic status. Middle income customers are more likely to have favorable opinions about imported products, whereas, lower and higher income customers tend to have weaker views on this issue.
Energy Technology Data Exchange (ETDEWEB)
Graham, N.; Schnell, L.; Arnold, G. [Federal-Mogul Wiesbaden GmbH and Co. KG (Germany)
2003-10-01
Lead has always been an important metal in plain bearing technology. Completely lead-free solutions for high-end engine applications are still not considered to be technically achievable. Therefore, the European End of Life Directive (2000/53/EC), which took effect on 1 July 2003, lists copper-based lead/bronze bearings as an exception. The bearing group of Federal-Mogul has now announced its exit from the lead industry and addresses the issue layer by layer. A recently introduced adaptive bearing offers a lead-free overplate for high-performance internal combustion engine applications. This new bearing changes its technical characteristics during the running-in phase. (orig.) [German] Blei war schon immer eine wichtige Komponente in der Gleitlagertechnik. Bis heute gelten vollstaendig bleifreie Loesungen fuer hochbelastete Gleitlager als technisch nicht machbar. Deshalb nennt die europaeische Altautoverordnung (2000/53/EG), die seit dem 1. Juli 2003 in Kraft ist, als Ausnahme die kupferbasierten Bleibronzelager. Die Gleitlagergruppe von Federal-Mogul hat jetzt ihren Rueckzug aus der Verarbeitung von Blei angekuendigt und geht das Thema Schicht fuer Schicht an. Ein kuerzlich eingefuehrtes, anpassungsfaehiges Lager fuer High-End-Verbrennungsmotoren verfuegt ueber eine bleifreie Laufschicht. Bei diesem neuen Lager veraendern sich die technischen Eigenschaften waehrend der Einlaufphase. (orig.)
Sinha, R; Rothman, N; Brown, E D; Salmon, C P; Knize, M G; Swanson, C A; Rossi, S C; Mark, S D; Levander, O A; Felton, J S
1995-10-15
Heterocyclic aromatic amines (HAAs) are mutagenic and carcinogenic compounds found in meats cooked at high temperatures. Although chicken is consumed in large quantities in the United States, there is little information on its HAA content. The objective of this study was to measure the five predominant HAAs (IQ, MeIQ, MeIQx, DiMeIQx, and PhIP) in chicken cooked by various methods to different degrees of doneness. Chicken breasts were panfried, oven-broiled, or grilled/barbecued. Whole chickens were roasted or stewed. Skinless, boneless chicken breasts were cooked to three degrees of doneness: just until done, well done, or very well done. High levels of PhIP (ranging from 12 to 480 ng/g cooked meat) were found in chicken breasts when panfried, oven-broiled, and grilled/barbecued but not in while roasted or stewed chicken. PhIP concentration increased in skinless, boneless chicken breast with longer cooking time, higher internal temperature, and greater degree of surface browning. PhIP concentration was also high in chicken breasts cooked with skin and bones. MeIQx and DiMeIQx levels increased with the degree of doneness, whereas IQ and MeIQ were not detectable in any of these chicken samples. Certain cooking methods produce PhIP, a known colon and breast carcinogen in rodents and possibly a human carcinogen, at substantially higher levels in chicken than has been reported previously in red meat.
Energy Technology Data Exchange (ETDEWEB)
Varanusupakul, Pakorn [Chromatography and Separation Research Unit, Department of Chemistry, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330 (Thailand)], E-mail: pakorn.v@chula.ac.th; Vora-adisak, Narongchai; Pulpoka, Bancha [Chromatography and Separation Research Unit, Department of Chemistry, Faculty of Science, Chulalongkorn University, Phayathai Road, Patumwan, Bangkok 10330 (Thailand)
2007-08-15
An alternative method for gas chromatographic determination of haloacetic acids (HAAs) in water using direct derivatization followed by hollow fiber membrane liquid-phase microextraction (HF-LPME) has been developed. The method has improved the sample preparation step according to the conventional US EPA Method 552.2 by combining the derivatization and the extraction into one step prior to determination by gas chromatography electron captured detector (GC-ECD). The HAAs were derivatized with acidic methanol into their methyl esters and simultaneously extracted with supported liquid hollow fiber membrane in headspace mode. The derivatization was attempted directly in water sample without sample evaporation. The HF-LPME was performed using 1-octanol as the extracting solvent at 55 deg. C for 60 min with 20% Na{sub 2}SO{sub 4}. The linear calibration curves were observed for the concentrations ranging from 1 to 300 {mu}g L{sup -1} with the correlation coefficients (R{sup 2}) being greater than 0.99. The method detection limits of most analytes were below 1 {mu}g L{sup -1} except DCAA and MCAA that were 2 and 18 {mu}g L{sup -1}, respectively. The recoveries from spiked concentration ranged from 97 to 109% with %R.S.D. less than 12%. The method was applied for determination of HAAs in drinking water and tap water samples. The method offers an easy one step high sample throughput sample preparation for gas chromatographic determination of haloacetic acids as well as other contaminants in water.
Arnold, Mayara; Batista, Jacimaria; Dickenson, Eric; Gerrity, Daniel
2018-07-01
The purpose of this research was to investigate the impacts of ozone dose and empty bed contact time (EBCT) in ozone-biofiltration systems on disinfection byproduct (DBP) formation potential. The data were used to evaluate the possibility of using DBP formation potential as an alternative guideline for total organic carbon (TOC) removal in potable reuse applications. A pilot-scale ozone-biofiltration system was operated with O 3 /TOC ratios ranging from 0.1 to 2.25 and EBCTs ranging from 2 to 20 min. The biofiltration columns contained anthracite or biological activated carbon (BAC). Bench-scale chlorination was performed using the uniform formation conditions (UFC) approach, and quenched samples were analyzed for total trihalomethanes (TTHMs) and regulated haloacetic acids (HAA5s). The data demonstrated that ozone-biofiltration achieved TOC removals ranging from ∼10 to 30%, depending on operational conditions, but biofiltration without ozone generally achieved <10% TOC removal. UFC testing demonstrated that ozone alone was efficient in transforming bulk organic matter and reducing DBP formation potential by 10-30%. The synergistic combination of ozone and biofiltration achieved average overall reductions in TTHM and HAA5 formation potential of 26% and 51%, respectively. Finally, a maximum TOC concentration of 2.0 mg/L was identified as a recommended treatment target for reliable compliance with TTHM and HAA5 regulations for potable reuse systems in the United States. Copyright © 2018 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Varanusupakul, Pakorn; Vora-adisak, Narongchai; Pulpoka, Bancha
2007-01-01
An alternative method for gas chromatographic determination of haloacetic acids (HAAs) in water using direct derivatization followed by hollow fiber membrane liquid-phase microextraction (HF-LPME) has been developed. The method has improved the sample preparation step according to the conventional US EPA Method 552.2 by combining the derivatization and the extraction into one step prior to determination by gas chromatography electron captured detector (GC-ECD). The HAAs were derivatized with acidic methanol into their methyl esters and simultaneously extracted with supported liquid hollow fiber membrane in headspace mode. The derivatization was attempted directly in water sample without sample evaporation. The HF-LPME was performed using 1-octanol as the extracting solvent at 55 deg. C for 60 min with 20% Na 2 SO 4 . The linear calibration curves were observed for the concentrations ranging from 1 to 300 μg L -1 with the correlation coefficients (R 2 ) being greater than 0.99. The method detection limits of most analytes were below 1 μg L -1 except DCAA and MCAA that were 2 and 18 μg L -1 , respectively. The recoveries from spiked concentration ranged from 97 to 109% with %R.S.D. less than 12%. The method was applied for determination of HAAs in drinking water and tap water samples. The method offers an easy one step high sample throughput sample preparation for gas chromatographic determination of haloacetic acids as well as other contaminants in water
Bilateral cross-bite treated by repeated rapid maxillary expansions: a 17-year follow-up case.
Cozzani, M; Mazzotta, L; Caprioglio, A
2014-07-01
The objective of this paper is to show the clinical results after the repeated application of a Haas expander for rapid maxillary expansion (RME) anchored onto deciduous teeth in a 7-year-old patient that presented bilateral cross-bite, superior crowding and no space for permanent lateral incisors eruption. A first Haas expander was applied to the patient. She was told to activate it once a day, each activation was equal to 0.20 mm. After the first RME, the bilateral cross-bite was solved but still there was not enough space for lateral incisor eruption. A second and then a third Haas expander were applied, with the same activation protocol as the first one, in order to gain space in the anterior region and to achieve proper eruption of the lateral incisors. The patient was then treated with fixed appliances. At debonding the patient presented well aligned arch-forms: space for lateral incisor eruption was gained and superior crowding was solved. Bilateral cross-bite was also corrected. She was seen again 10 years and 17 years after expansions: she showed no relapse and presented a good functional occlusion that had remained stable, and an aesthetically pleasant smile, however she exhibited gingival recessions. Repeated rapid maxillary expansion, anchored onto deciduous teeth, performed in early mixed dentition represents a safe and successful treatment to correct severe bilateral cross- bites and to create space for maxillary incisor eruption.
[Presidendipaar Ingrid ja Arnold Rüütel] / Annika Haas
Haas, Annika
2007-01-01
President Arnold Rüütel ja Ingrid Rüütel Briti suursaadiku Nigel Haywoodi lahkumispeol Tallinna Teaduste Akadeemia peasaalis. Foto allkiri: Presidendipaar Ingrid ja Arnold Rüütel kuulavad Briti suursaadiku Nigel Haywoodi kiidulaulu Eesti kiire arengu aadressil
Natural astringency in foodstuffs--a molecular interpretation.
Halsam, E; Lilley, T H
1988-01-01
The structures of plant polyphenols (vegetable tannins) are briefly reviewed. Their interactions with proteins, polysaccharides, and the alkaloid caffeine are discussed at the molecular level, and these fundamental properties are related to the quality of astringency that polyphenols possess. The various ways in which astringency may be modified and ultimately lost are outlined in relation to the aging of red wines, the formation of nonbiological hazes in beers and lagers, and the ripening of fruit.
Hansen, Jørgen
1999-01-01
Dimethyl sulfide (DMS) is a sulfur compound of importance for the organoleptic properties of beer, especially some lager beers. Synthesis of DMS during beer production occurs partly during wort production and partly during fermentation. Methionine sulfoxide reductases are the enzymes responsible for reduction of oxidized cellular methionines. These enzymes have been suggested to be able to reduce dimethyl sulfoxide (DMSO) as well, with DMS as the product. A gene for an enzymatic activity lead...
Developing a reduced consumer-led lexicon to measure emotional response to beer
Chaya, Carolina; Eaton, Curtis; Hewson, Louise; Fernández Vázquezc, Rocío; Fernández-Ruiz, Virginia; Smart, Katherine A.; Hort, Joanne
2015-01-01
Previous researchers have recently recommended and utilised consumer-led lexicons to measure emotional response. This study further advances this approach by 1) making the lexicon generation process more efficient by using consumer focus groups as opposed to individual consumer interviews and 2) decreasing the number of responses required from each consumer by reducing the lexicon to categories of similar terms. In response to 10 lager samples which were manipulated in order to control select...
Kirju ja vastuoluline "Wien Modern 2007" / Saale Kareda
Kareda, Saale, 1968-
2008-01-01
Festivalist "Wien Modern 2007", festivali peaheliloojad Georg Friedrich Haas ja Luciano Berio. Pikemalt G. F. Haasi muusikast ja festivali kontsertidest. Frank Schefferi filmide retrospektiivist, pikemalt filmist "Helicopter String Quartet" - helilooja Karlheinz Stockhausenist. Järgneb nr. 3, lk. 67-75
Quantum magnetotransport properties of topological insulators under strain
Tahir, M.; Schwingenschlö gl, Udo
2012-01-01
scattering in the first Born approximation. We also calculate the Hall conductivity using the Kubo formalism. Evidence for the beating of Shubnikov–de Haas oscillations is found from the temperature and magnetic field dependence of the collisional and Hall
Energy Technology Data Exchange (ETDEWEB)
Mohr, M.; Ziegelmann, A.; Unger, H.
1995-12-01
In the First Technical Report the fundamental ideas for the realization of this project are presented and the future possible maximum gross employment effects of an expansion of renewable energy systems in North-Rhine-Westphalia with consideration of the present-day cost structure are quantified in an initial stage. In this connection gross employment effects are defined as exclusive positive job effects without consideration of possible negative employment effects on the basis of less investments in other sectors of the economy. Based on a subdivided presentation of the intended course of the project and a formulation of its main objectives, a detailed description of the theoretical background of the applied methods of input-output analysis is provided. After the presentation of some different methods and the necessary assumptions, the analysis takes the so-called `Keynesian income multiplier` into account to accommodate the effects of an increase in national income. To use a known investment distribution, grouped in 21 sub-divisions according to categories of applications, within the scope of an input-output-analysis, the investments are converted. After the determination of the matrices, necessary to quantify employment effects, the maximum possible gross effects concerning the future job market of the Federal Republic of Germany will be assessed with consideration of the fluctuations in productivity on sector level. A total of 700.000 new jobs can be expected, of which about 27% are due to the increase of personal disposable income and the resulting rise in consumer spending respectively. (orig./UA) [Deutsch] Im vorliegenden 1. Technischen Fachbericht werden konzeptionelle Grundlagen zur Realisierung des Vorhabens eroertert und es wird eine erste Abschaetzung der potentiellen Bruttobeschaeftigungswirkungen eines Ausbaus erneuerbarer Energiesysteme in Nordrhein-Westfalen durchgefuehrt. Unter Bruttobeschaeftigungswirkungen werden dabei ausschliesslich positive
Particlc detectors. Foundations and applications; Teilchendetektoren. Grundlagen und Anwendungen
Energy Technology Data Exchange (ETDEWEB)
Kolanoski, Hermann; Wermes, Norbert
2016-08-01
The following topics are dealt with: Interaction of particles with matter, motion of charge carriers in electric and magnetic fields, signal generation by moving charges, non-electronic detectors, gas-filled detectors, semiconductor detectors, track reconstruction and momentum measurement, photodetectors, Cherenkov detectors, transition-radiation detectors, scintillation detectors, particle identification, calorimeters, detection of cosmic particles, signal processing and noise, trigger and data acquisition systems. (HSI)
1987-04-01
facilities. BBN is developing a series of increasingly sophisticated natural language understanding systems which will serve as an integrated interface...Haas, A.R. A Syntactic Theory of Belief and Action. Artificial Intelligence. 1986. Forthcoming. [6] Hinrichs, E. Temporale Anaphora im Englischen
The haloacetic acids (HAA) are a family of chemicals that are drinking water disinfection byproducts. We previously reported that bromo- and chloro-acetic acids alter embryonic development when mouse conceptuses are directly exposed to these xenobiotics in whole embryo culture. C...
Directory of Open Access Journals (Sweden)
Caio Ferraz Campos
2013-03-01
Full Text Available The objective of this work was to evaluate conditions the effectiveness of acetolactate synthase (ALS and protoporphyrinogen oxidase (PROTOX inhibitors in the Bidens pilosa control under two water deficit conditions, as well as to determine the action under the content of soluble carbohydrates and protein and free amino acids of weed. The experimental design was randomized completely design, with four replications, with the treatments setup in a factorial scheme 4x2, with four herbicides (fomesafen lactofen, chlorimuron-ethyl and imazethapyr, and two soil water conditions (-0.5 MPa and –0.01MPa. At 7, 14, 21 and 28 days after application (DAA, was assessed visually control efficiency of herbicides. For the determination of organic solutes plants were collected at 24, 48, 72 and 96 hours after application (HAA, except for the amino acids were analyzed 48, 72 e 96 HAA. Herbicides fomesafen and lactofen were efficient to control E. heterophylla, while the ALS inhibitors (chlorimuron-ethyl e imazethapyr provided an unsatisfactory control. Water deficit altered the efficiency of herbicides, mainly chlorimuronethyl. Lactofen provided a smaller content of soluble carbohydrates, in the same way, the protein ranged in the 72 HAA, the lower value observed for imazethapyr e lactofen respectively. Herbicide lactofen increased the concentration of free amino acids, while the imposition of water deficit caused an increase in soluble carbohydrate content.O estudo teve como objetivo avaliar a eficiência de herbicidas inibidores da acetolactato sintase (ALS e protoporfirinogênio oxidase (PROTOX no controle de Euphorbia heterophylla sob duas condições hídricas, bem como determinar a ação destes sob o conteúdo de carboidratos e proteínas solúveis e aminoácidos livres da planta daninha. O delineamento experimental utilizado foi inteiramente casualizado, com quatro repetições, com os tratamentos dispostos em esquema fatorial 4x2, sendo quatro
Energy Technology Data Exchange (ETDEWEB)
Warnecke, H.J. [ed.] [Fraunhofer-Institut fuer Produktionstechnik und Automatisierung (IPA), Stuttgart (Germany)
1992-12-31
This manual is the second, completely revised edition of the standard manual ``Maintenance - Fundamentals``, which was first published in 1981. It presents an outline of all relevant fields of maintenance today and contains practical information on new and established methods of maintenance management and technology. With its comprehensive concept, which addresses any industrial enterprise that wants to remain competitive, the manual is indispensable for maintenance managers in industry, service enterprises and consultancies. Vol.1, ``Maintenance Management``, informs the reader on fundamentals, design with a view to maintenance, organisation of maintenance work, personnel management, industrial safety and economic aspects of maintenance. Current issues such as product liability, electronic data processing, expert systems, environmental protection, controlling based on characteristic data, etc. are gone into. Graphical representations, concrete procedural information and exemplary solutions may be used directly as working tools for the practice of maintenance. (orig.) [Deutsch] Das vorliegende Handbuch ist die zweite, voellig ueberarbeitete und erweiterte Auflage des Standardwerkes ``Instandhaltung - Grundlagen``, das 1981 erstmals erschien. Es gibt einen Ueberblick ueber alle relevanten Gebiete einer modernen Instandhaltung und vermittelt praxisnahes Wissen ueber neue und bewaehrte Methoden und Verfahren des Instandhaltungsmanagements und der Instandhaltungstechnik. Mit dieser umfassenden Konzeption, die auf die Belange des im Wettbewerb stehenden Industriebetriebes ausgerichtet ist, wendet sich das Handbuch an die Fuehrungskraefte der Instandhaltung in der Industrie sowie an Dienstleistungs- und Beratungsunternehmen. Im Band 1 ``Instandhaltungsmanagement`` kann sich der Leser ueber Grundlagen, instandhaltungsgerechtes Konstruieren, Organisation der Instandhaltung, Personalmanagement, Arbeitssicherheit sowie Wirtschaftlichkeit der Instandhaltung informieren
2011-06-01
This report presents the replication of an MTI study conducted in 2001 by Peter Haas and Richard Werbel.1 That research, itself a continuation of an earlier project completed in 2000, included an analysis of transportation tax elections in 11 urban a...
Maltotriose utilization of lager yeast strains in high-gravity brewing
Dietvorst, Judith
2006-01-01
Een nieuwe ontwikkeling in de bierbrouwerij is het gebruik van hogere wortconcentraties in een proces dat ‘high-gravity brewing’ wordt genoemd. Dit proces heeft als voordeel dat het de produktiviteit van de brouwerij verhoogt. Een nadeel is echter dat door de hogere suikerconcentraties de capaciteit
Analysis of aging in lager brewing yeast during serial repitching.
Bühligen, Franziska; Lindner, Patrick; Fetzer, Ingo; Stahl, Frank; Scheper, Thomas; Harms, Hauke; Müller, Susann
2014-10-10
Serial repitching of brewing yeast inoculates is an important economic factor in the brewing industry, as their propagation is time and resource intensive. Here, we investigated whether replicative aging and/or the population distribution status changed during serial repitching in three different breweries with the same brewing yeast strain but different abiotic backgrounds and repitching regimes with varying numbers of reuses. Next to bud scar numbers the DNA content of the Saccharomyces pastorianus HEBRU cells was analyzed. Gene expression patterns were investigated using low-density microarrays with genes for aging, stress, storage compound metabolism and cell cycle. Two breweries showed a stable rejuvenation rate during serial repitching. In a third brewery the fraction of virgin cells varied, which could be explained with differing wort aeration rates. Furthermore, the number of bud scars per cell and cell size correlated in all 3 breweries throughout all runs. Transcriptome analyses revealed that from the 6th run on, mainly for the cells positive gene expression could be seen, for example up-regulation of trehalose and glycogen metabolism genes. Additionally, the cells' settling in the cone was dependent on cell size, with the lowest and the uppermost cone layers showing the highest amount of dead cells. In general, cells do not progressively age during extended serial repitching. Copyright © 2014 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Leissring, Bernd [Bergtechnisches Ingenieurbuero GEOPRAX Bernd Leissring und Nick Leissring GbR, Chemnitz (Germany)
2015-07-01
Regions with special geologic and mining circumstances can lead to higher radon loads in the ground air. Are such locations built on by buildings, higher radon concentrations are preassigned and proved. By tracer gas analysis check-ups you can clearly prove the influences by radon, which accumulates in the mining buildings and its migration into the building area / buildings. The exhaustive area covering loads were also recorded by radon measurements in the buildings. Steady monthly long time measurements in over 100 buildings in Schneeberg show dynamics of the influences at changes of the weather movements in the underground hollows. Changes of the weather streams in the mining area lead to change of the radon concentration in the measured houses.At radon redevelopments in the mining cities the mining conditioned influxes into the houses must be exhaustively considered.
Self-esteem and self-love: the analysis of the notions
Omelchanko E.,
2018-01-01
The notions of self-esteem and self-love are related in many respects, in everyday life, these notions are usually mixed. At first sight, they have the same meaning: to love oneself. But the real sense of such love is different. The difference between them is lager and deeper than similarity. The present article is a comparative analysis of the concepts of self-esteem, self-love (egoism): the semantic differences between scientific, culturological and religious conceptions are fixed. The ...
Bluedec in product design: Isolatiemateriaal op basis van aerogel
Beurden, van, K.M.M. (Karin); Goselink, E.A. (Erik)
2014-01-01
Aerogel is een zeer kostbaar voor de ruimtevaart ontwikkeld basismateriaal. Bluedec is een isolatiemateriaal bestaande uit een non woven kunststof dat met deze aerogel geïmpregneerd is. Hierdoor ontstaat een zeer goed isolerend materiaal dat goedkoper is dan aerogel. De warmtegeleidingscoëfficiënt van Bluedec in de basisuitvoering is 0,0135 W/m*K . Dat is lager dan conventionele isolatiematerialen, zie ook pagina 4. Voordeel hiervan is dat vergelijkbare of betere warmte-isolati...
DEFF Research Database (Denmark)
Hansen, Kamilla Marie Speht; Willach, Sarah; Antoniou, Maria
2012-01-01
This study investigated the formation and predicted toxicity of different groups of disinfection byproducts (DBPs) from human exudates in relation to chlorination of pool water at different pH values. Specifically, the formation of the DBP groups trihalomethanes (THMs), haloacetic acids (HAAs......), haloacetonitriles (HANs) and trichloramine (NCl3), resulting from the chlorination of body fluid analog, were investigated at 6.0 ≤ pH ≤ 8.0. Either the initial concentration of active chorine or free chlorine was kept constant in the tested pH range. THM formation was reduced by decreasing pH but HAN, and NCl3...... formation was investigated and found to follow the same pH dependency as without bromide present, with the overall DBP formation increasing, except for HAAs. Estimation of genotoxicity and cytotoxicity of the chlorinated human exudates showed that among the quantified DBP groups, HAN formation were...
Soladoye, O P; Shand, P; Dugan, M E R; Gariépy, C; Aalhus, J L; Estévez, M; Juárez, M
2017-09-01
This study aimed to examine the influence of cooking methods and pre-determined refrigerated storage days on the production of lipid oxidation (TBARS), protein oxidation (PROTOX) and heterocyclic aromatic amines (HAA) in bacon. Forty-four pork bellies selected from pigs varying in breed, sex and diets to introduce variability in composition were processed as bacon. Sliced-bacon was stored at 4°C either for 2 or 28days and these storage groups were cooked either with microwave or frying pan. Microwave led to significantly higher PROTOX (P0.05) by the cooking methods and storage times. Similarly, the fatty acid composition of pork belly did not significantly influence the production of HAA, TBARS and PROTOX produced in bacon during cooking. Overall, microwave cooking had lesser impact on the production of carcinogenic compounds in bacon with only minor impact on sensory attributes. Copyright © 2017. Published by Elsevier Ltd.
Professionell entwickeln mit Java EE 7 das umfassende Handbuch
Salvanos, Alexander
2014-01-01
Ein praxisorientiertes Lehrbuch zur JEE 7 und zugleich ein Standardwerk, das Sie auf Ihrem Weg zum Enterprise-Entwickler begleitet. Inklusive Best Practices für leichtgewichtige Enterprise Applications, Standards zu servicebasierten Anwendungen, Persistence API, Dependency Injection, HTML5 und Performance-Tuning. Aus dem Inhalt: Grundlagen und Installation Software-Architektur mit Java EE Webanwendungen mit HTML5 und CSS3 Java Standard Tag Library Asynchrone Servlets und Non-blocking I/O Datenbanken anbinden mit der JDBC API Java Server Faces Datenbank-Organisation Java Persistence API Objektrelationales Mapping Transaktionssicherheit Performance-Tuning Internationalisierung Enterprise Java Beans WebSockets PrimeFaces Deployment Galileo Press heißt von jetzt an Rheinwerk Verlag.
Riots ‒ Anmerkungen zu Begriff und Konzept
Directory of Open Access Journals (Sweden)
Dieter Rucht
2016-05-01
Full Text Available Ausgehend von sozialwissenschaftlichen Befunden werden zunächst ältere massenpsychologische Deutungen von riots zurückgewiesen. Die überwiegende Mehrzahl der im riot Aufbegehrenden entspricht nicht dem Typus entfremdeter und verängstigter Einzeltäter_innen. Zweitens benennt der Beitrag eine Reihe von Bedingungen für das Zustandekommen von riots. Drittens wird der Begriff ‚riot‘ in formaler Hinsicht näher bestimmt und einerseits von moderateren Formen des Protests, andererseits von geplanter und organisierter Gewalt (z. B. Terrorismus abgegrenzt. Abschließend wird die Frage des politischen Gehalts von riots und deren normativen Grundlagen erörtert.
Directory of Open Access Journals (Sweden)
Svenja Kaduk
2010-01-01
Full Text Available Der Sammelband von Angelika Epple und Angelika Schaser bietet sowohl einen internationalen Überblick als auch detaillierte Einblicke in derzeitige geschlechtergeschichtliche und historiografische Forschungen. Die Beiträge erweitern zum einen den traditionellen historiografischen Kanon und fragen zum anderen nach den geschlechtlichen Grundlagen von In- und Exklusionen in der Geschichtswissenschaft. Dieser Wissenszuwachs treibt aber die nunmehr schon traditionell seitens der Geschlechtergeschichte geforderte Neuformulierung der ‚allgemeinen‘ (Historiografie-Geschichte nicht merklich voran. Ein erster Schritt in diese Richtung läge möglicherweise in der Formulierung einer Differenztheorie als analytischem Rahmen für eine pluralistische ‚Neu‘erzählung.
Liu, Chao; Croue, Jean-Philippe
2015-01-01
Previous studies showed that significant bromate (BrO3-) can be formed via the CuO-catalyzed disproportionation of hypobromous acid (HOBr) pathway. In this study, the influence of CuO on the formation of BrO3- and halogenated disinfection byproducts (DBPs) (e.g., trihalomethanes, THMs and haloacetic acids, HAAs) during chlorination of six dissolved organic matter (DOM) isolates was investigated. Only in the presence of slow reacting DOM (from treated Colorado River water, i.e., CRW-BF-HPO), significant BrO3- formation is observed, which competes with bromination of DOM (i.e., THM and HAA formation). Reactions between HOBr and 12 model compounds in the presence of CuO indicates that CuO-catalyzed HOBr disproportionation is completely inhibited by fast reacting phenols, while it predominates in the presence of practically unreactive compounds (acetone, butanol, propionic, and butyric acids). In the presence of slow reacting di- and tri-carboxylic acids (oxalic, malonic, succinic, and citric acids), BrO3- formation varies, depending on its competition with bromoform and dibromoacetic acid formation (i.e., bromination pathway). The latter pathway can be enhanced by CuO due to the activation of HOBr. Therefore, increasing CuO dose (0-0.2 g L-1) in a reaction system containing chlorine, bromide, and CRW-BF-HPO enhances the formation of BrO3-, total THMs and HAAs. Factors including pH and initial reactant concentrations influence the DBP formation. These novel findings have implications for elevated DBP formation during transportation of chlorinated waters in copper-containing distribution systems.
Liu, Chao
2015-12-02
Previous studies showed that significant bromate (BrO3-) can be formed via the CuO-catalyzed disproportionation of hypobromous acid (HOBr) pathway. In this study, the influence of CuO on the formation of BrO3- and halogenated disinfection byproducts (DBPs) (e.g., trihalomethanes, THMs and haloacetic acids, HAAs) during chlorination of six dissolved organic matter (DOM) isolates was investigated. Only in the presence of slow reacting DOM (from treated Colorado River water, i.e., CRW-BF-HPO), significant BrO3- formation is observed, which competes with bromination of DOM (i.e., THM and HAA formation). Reactions between HOBr and 12 model compounds in the presence of CuO indicates that CuO-catalyzed HOBr disproportionation is completely inhibited by fast reacting phenols, while it predominates in the presence of practically unreactive compounds (acetone, butanol, propionic, and butyric acids). In the presence of slow reacting di- and tri-carboxylic acids (oxalic, malonic, succinic, and citric acids), BrO3- formation varies, depending on its competition with bromoform and dibromoacetic acid formation (i.e., bromination pathway). The latter pathway can be enhanced by CuO due to the activation of HOBr. Therefore, increasing CuO dose (0-0.2 g L-1) in a reaction system containing chlorine, bromide, and CRW-BF-HPO enhances the formation of BrO3-, total THMs and HAAs. Factors including pH and initial reactant concentrations influence the DBP formation. These novel findings have implications for elevated DBP formation during transportation of chlorinated waters in copper-containing distribution systems.
International Nuclear Information System (INIS)
Ambrosch, K.-E.
1985-01-01
Lead salts are small gap semiconductors that are used for infrared detectors and lasers. PbMnTe and PbEuTe are semimagnetic semiconductors. Magnetotransport properties of epitaxial films and epitaxial heterostructures (PbTe / PbSnTe) are investigated. Epitaxial films of PbSnTe, PbMnTe and PbEuTe have been used for Shubnikov de Haas - experiments in tilted magnetic fields. This method allows the quantitative determination of the electric carrier distribution with respect to the crystal directions. The nonequal distribution is caused by strain effects that are more important for PbMnTe than for PbSnTe and PbEuTe. Magnetoresistance experiments show a deviation from cubic symmetry that leads to the same results for the carrier distribution as the Shubnikov de Haas effect. Magnetoresistance experiments performed with PbTe / PbSnTe heterostructures show no megnetoresistance if the magnetic field is in plane with the layers. The difference of the magnetoresistance for single films and heterostructures is explained by 'quasitwodimensional' carriers. Shubnikov de Haas experiments performed on heterostructures as a function of the tilt angle of the magnetic field show different behaviour compared to that of single films. Using additional information about effective masses and strain it was possible to distinguish between 'two-' and 'threedimensional' electronic systems. The distribution of carriers in single films and heterostructures has been determined by means of magnetotransport experiments. The results are explained by strain effects of the crystal lattice. In addition heterostructures show a 'quasitwodimensional' behaviour caused by interaction of their layers. (Author)
Directory of Open Access Journals (Sweden)
Aiwu Zhang
2015-12-01
Full Text Available The complexity of the single linear hyperspectral pushbroom imaging based on a high altitude airship (HAA without a three-axis stabilized platform is much more than that based on the spaceborne and airborne. Due to the effects of air pressure, temperature and airflow, the large pitch and roll angles tend to appear frequently that create pushbroom images highly characterized with severe geometric distortions. Thus, the in-flight calibration procedure is not appropriate to apply to the single linear pushbroom sensors on HAA having no three-axis stabilized platform. In order to address this problem, a new ground-based boresight calibration method is proposed. Firstly, a coordinate’s transformation model is developed for direct georeferencing (DG of the linear imaging sensor, and then the linear error equation is derived from it by using the Taylor expansion formula. Secondly, the boresight misalignments are worked out by using iterative least squares method with few ground control points (GCPs and ground-based side-scanning experiments. The proposed method is demonstrated by three sets of experiments: (i the stability and reliability of the method is verified through simulation-based experiments; (ii the boresight calibration is performed using ground-based experiments; and (iii the validation is done by applying on the orthorectification of the real hyperspectral pushbroom images from a HAA Earth observation payload system developed by our research team—“LanTianHao”. The test results show that the proposed boresight calibration approach significantly improves the quality of georeferencing by reducing the geometric distortions caused by boresight misalignments to the minimum level.
Approximation Properties for Groups and von Neumann Algebras
DEFF Research Database (Denmark)
Knudby, Søren
The main topic of the thesis is approximation properties for locally compact groups with applications to operator algebras. In order to study the relationship between weak amenability and the Haagerup property, the weak Haagerup property and the weak Haagerup constant are introduced. The weak Haa...
Yokotani, Atushi; Mizuno, Toshio; Mukumoto, Toru; Kawahara, Kousuke; Ninomiya, Takahumi; Sawada, Hiroshi; Kurosawa, Kou
We have analyzed the drilling process with femtosecond laser on the silicon surface in order to investigate a degree of thermal effect during the dicing process of the very thin silicon substrate. A regenerative amplified Ti:Al2O3 laser (E= 30˜500 μJ/pulse, τ= 200 fs, λ= 780 nm, f= 10 Hz) was used and focused onto a 50 μm-thick silicon sample. ICCD (Intensified Charge coupled Device) camera with a high-speed gate of 5 ns was utilized to take images of processing hole. First, we investigated the dependence of laser energy on the speed of the formation of the drilled hole. As a result, it was found that the lager the energy, the slower the speed of the formation under the minimum hole was obtained. Consequently, in the case of defocused condition, even when the smaller the energy density was used, the very slow speed of formation and the much lager thermal effects are simultaneously observed. So we can say that the degree of the thermal effects is not simply related to energy density of the laser but strongly related to the speed of the formation, which can be measured by the ICCD camera. The similar tendency was also obtained for other materials, which are important for the fabrication of ICs (Al, Cu, SiO2 and acrylic resin).
Directory of Open Access Journals (Sweden)
Veljović Mile
2015-01-01
Full Text Available Over the last decade, the market of special beers with improved healthy function and/or with new refreshing taste has significantly increased. One of the possible solutions enables grape and mixing beer with bioactive component responsible for well known health promoting action of red wine. The influence of the addition of Prokupac grape on the physicochemical properties and the fermentation kinetics of the grape beer were studied and results were compared with control lager beer. The effect of grape addition on the activity of yeast was also studied. Original extract, alcohol content, degree of fermentation, fermentation rate and yeast growth were significantly higher in beers with grapes as a consequence of higher concentration of simple sugars in grapes compared with pure wort. Based on the CIELab chromatic parameters the color of grape beer samples was yellow with certain proportion of redness, while the control beer was purely yellow. The increase in the concentration of grape mash affects the reduction of lightness and yellowness of beers, while the redness of samples was directly proportional with grape quantity. The phenolic content and antioxidant capacity of grape beers was remarkably higher compared with control beer, which indicates that the grape beer is a better source of natural antioxidants than regular lager beer. [Projekat Ministarstva nauke Republike Srbije, br. 46001
Alternative analysis: the prime numbers theory and an extension of the real numbers set
Sukhotin A.; Zvyagin M.
2016-01-01
Here we consider the theory of prime numbers at a new methodology. The theory of prime numbers is one of the most ancient mathematical branches. We found an estimate of the all prime numbers sum using the notions of infinite lager numbers and infinitely small numbers, farther we estimated the value of the maximal prime number. We proved that Hardy–Littlewood Hypothesis has the positive decision too. The infinite small numbers define a new methodology of the well–known function o(x) applicatio...
Stimulation of appetite by alcohol.
Hetherington, M. M.; Cameron, F.; Wallis, D. J.; Pirie, L. M.
2001-01-01
To investigate the effects of alcohol on appetite and food intake, 26 males attended the laboratory on three occasions. On each occasion, they were given a standard breakfast. Visual analog scale ratings of hunger, desire to eat and fullness (appetite ratings) were recorded from before breakfast until their return to the laboratory for lunch. Thirty minutes before lunch, subjects either rested (baseline), were given 330 ml of a no-alcohol lager (264 kJ: no-alcohol condition) or 330 m...
Structural Causes and Cyber Effects: Why International Order is Inevitable in Cyberspace
2014-01-01
articles in the same work by Ernst Haas, Donald J. Puchala and Raymond F. Hopkins, Oran R. Young, Arthur A. Stein, Robert Keohane , Robert Jervis, John...Gerard Ruggie, and Krasner. 33. Robert O. Keohane , After Hegemony: Cooperation and Discord in the World Political Economy (Princeton: Princeton
KOPÁČKOVÁ, Stanislava
2016-01-01
This thesis focuses on the work of the Čapeks Brothers and monitors their premonition of a coming destruction, the World War II. It consists of two parts theoretical and practical. The practical part presents poster set freely interpreting a Hugo Haas film The White Disease.
The aims of the current study were to investigate the presence of carcinogenic and mutagenic heterocyclic aromatic amines (HAAs) in chicken burgers (CBs) and chicken nuggets (CNs) purchased from fast food restaurants and the effects of green tea extract addition (GTE) to the covering material as wel...
Quantum Effects in Inverse Opal Structures
Bleiweiss, Michael; Datta, Timir; Lungu, Anca; Yin, Ming; Iqbal, Zafar; Palm, Eric; Brandt, Bruce
2002-03-01
Properties of bismuth inverse opals and carbon opal replicas were studied. The bismuth nanostructures were fabricated by pressure infiltration into porous artificial opal, while the carbon opal replicas were created via CVD. These structures form a regular three-dimensional network in which the bismuth and carbon regions percolate in all directions between the close packed spheres of SiO_2. The sizes of the conducting regions are of the order of tens of nanometers. Static susceptibility of the bismuth inverse opal showed clear deHaas-vanAlphen oscillations. Transport measurements, including Hall, were done using standard ac four and six probe techniques in fields up to 17 T* and temperatures between 4.2 and 200 K. Observations of Shubnikov-deHaas oscillations in magnetoresistance, one-dimensional weak localization, quantum Hall and other effects will be discussed. *Performed at the National High Magnetic Field Lab (NHMFL) FSU, Tallahassee, FL. This work was partially supported by grants from DARPA-nanothermoelectrics, NASA-EPSCOR and the USC nanocenter.
Cardador, Maria Jose; Gallego, Mercedes
2012-01-25
Chloroacetic, bromoacetic, and iodoacetic acids can be found in alcoholic beverages when they are used as preservatives/stabilizers or as disinfectants. As they are toxic components, their addition is not permitted under European Union and U.S. regulations. To date, no sensitive methods are available, and those proposed are very laborious. This paper describes a sensitive and straightforward method for the determination of the three monohalogenated acetic acids (m-HAAs) in wines and beers using static headspace extraction coupled with gas chromatography-mass spectrometry. Prior to extraction, the target analytes were esterified to increase their volatility, and all parameters related to the extraction/methylation process were optimized to achieve high efficiency (>90%). The study examined the influence both of the ethanol concentration on the headspace partitioning and of the primary acids present in wine on the derivatization reaction of the m-HAAs. The proposed method allows the determination of these compounds at microgram per liter levels in alcoholic beverages.
Singleton, J; Hayes, W; Schlüter, J A
2003-01-01
The apparent quasiparticle scattering rates in high-quality crystals of the quasi-two-dimensional superconductor kappa-(BEDT-TTF) sub 2 Cu(NCS) sub 2 are studied using the Shubnikov-de Haas effect and megahertz penetration-depth experiments. The width of the superconducting transition observed in the megahertz experiments, taken in conjunction with the field dependence of the Shubnikov-de Haas oscillations, gives evidence that the broadening of the Landau levels is primarily caused by spatial inhomogeneities. This indicates a quasiparticle lifetime for the Landau states >> 3 ps. The megahertz data can also be used to derive an apparent scattering time (0.14- 0.56 ps) from the skin depth. This is much shorter than the Landau-state lifetime, in strong contrast to the expectations of Landau Fermi-liquid theory. The simplest explanation for the data is that only a fraction of the crystal contributes to the metallic conductivity, an observation which may be related to the recently observed 'glassy' transition in k...
Kramer, D.A.
2007-01-01
Seawater and natural brines accounted for about 52 percent of U.S. magnesium compounds production in 2006. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties from well brines in Michigan. Caustic-calcined magnesia was recovered from sea-water by Premier Chemicals in Florida; from well brines in Michigan by Martin Marietta and Rohm and Haas; and from magnesite in Nevada by Premier Chemicals. Intrepid Potash-Wendover and Great Salt Lake Minerals recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from brucite by Applied Chemical Magnesias in Texas, from seawater by SPI Pharma in Delaware and Premier Chemicals in Florida, and by Martin Marietta and Rohm and Haas from their operations mentioned above. About 59 percent of the magnesium compounds consumed in the United States was used for refractories that are used mainly to line steelmaking furnaces. The remaining 41 percent was consumed in agricultural, chemical, construction, environmental and industrial applications.
Mechanical control over valley magnetotransport in strained graphene
Energy Technology Data Exchange (ETDEWEB)
Ma, Ning, E-mail: maning@stu.xjtu.edu.cn [Department of Physics, MOE Key Laboratory of Advanced Transducers and Intelligent Control System, Taiyuan University of Technology, Taiyuan 030024 (China); Department of Applied Physics, MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Zhang, Shengli, E-mail: zhangsl@mail.xjtu.edu.cn [Department of Applied Physics, MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Liu, Daqing, E-mail: liudq@cczu.edu.cn [School of Mathematics and Physics, Changzhou University, Changzhou 213164 (China)
2016-05-06
Recent experiments report that the graphene exhibits Landau levels (LLs) that form in the presence of a uniform strain pseudomagnetic field with magnitudes up to hundreds of tesla. We further reveal that the strain removes the valley degeneracy in LLs, and leads to a significant valley polarization with inversion symmetry broken. This accordingly gives rise to the well separated valley Hall plateaus and Shubnikov–de Haas oscillations. These effects are absent in strainless graphene, and can be used to generate and detect valley polarization by mechanical means, forming the basis for the new paradigm “valleytronics” applications. - Highlights: • We explore the mechanical strain effects on the valley magnetotransport in graphene. • We analytically derive the dc collisional and Hall conductivities under strain. • The strain removes the valley degeneracy in Landau levels. • The strain causes a significant valley polarization with inversion symmetry broken. • The strain leads to the well separated valley Hall and Shubnikov–de Haas effects.
Pasqualone, Antonella; Gambacorta, Giuseppe; Summo, Carmine; Caponio, Francesco; Di Miceli, Giuseppe; Flagella, Zina; Marrese, Pier Paolo; Piro, Gabriella; Perrotta, Carla; De Bellis, Luigi; Lenucci, Marcello Salvatore
2016-12-15
A study was carried out to produce functional pasta by adding bran aqueous extract (BW) and bran oleoresin (BO) obtained using ultrasound and supercritical CO2, respectively, or a powdery lyophilized tomato matrix (LT). The bioactive compounds, hydrophilic and lipophilic antioxidant activity (HAA and LAA) in vitro, were evaluated. BW supplementation did not improve antioxidant activity, whilst LT pasta showed unconventional taste and odor. BO pasta had good levels of tocochromanols (2551μg/100g pasta f.w.) and carotenoids (40.2μg/100g pasta f.w.), and the highest HAA and LAA. The oleoresin altered starch swelling and gluten network, as evidenced by scanning electron microscopy, therefore BO pasta had structural characteristics poor compared with the control (4.8% vs. 3.2% cooking loss), although this difference did not affect significantly overall sensory judgment (74 vs. 79 for BO and control, respectively). BO supplementation was most effective for increasing antioxidant activity without jeopardizing pasta quality. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bioremediation of petroleum wastes from the refining of lubricant oils
International Nuclear Information System (INIS)
Prince, M.; Sambasivam, Y.
1993-01-01
The results of an initial feasibility study on the bioremediation of sludge are presented. The sludge used in the study was taken from a site containing waste produced during the refining of lubricant oils to which sulfuric acid had been added. The effectiveness of bioremediation was examined using shake flask experiments with indigenous and other bacteria sources and nutrient supplementation. The initial results show limited effectiveness of biological treatment at conditions employing indigenous bacteria and low (2%) sludge concentrations in Bushnell-Haas media. In addition, the indigenous bacteria were seen to degrade the polycyclic aromatic hydrocarbons naphthalene, penanthrene and pyrene which are present at some locations at the site. No apparent degradation of material was seen using conditions of high (30%) sludge concentrations in Bushnell-Haas medium under a variety of conditions. In addition, nutrients were rapidly depleted at these sludge concentrations, with the exception of sulfates which were produced when high sludge concentrations were used. 23 refs., 8 figs., 3 tabs
2011-07-13
... NWRs CCP'' in the subject line of the message. Fax: Attn: Dan Haas, Planning Team Leader, (509) 546... fills an important role in the management of mallards, northern pintails, and tundra swans during.... An extensive system of managed and unmanaged wetlands fills an important role in the management of...
Haas, Harald
2016-08-01
The humble household light bulb - once a simple source of illumination - could soon be transformed into the backbone of a revolutionary new wireless communications network based on visible light. Harald Haas explains how this “LiFi” system works and how it could shape our increasingly data-driven world
Reduction of Aromatic and Heterocyclic Aromatic N-Hydroxylamines by Human Cytochrome P450 2S1
Wang, Kai; Guengerich, F. Peter
2013-01-01
Many aromatic amines and heterocyclic aromatic amines (HAAs) are known carcinogens for animals and there is also strong evidence for some in human cancer. The activation of these compounds, including some arylamine drugs, involves N-hydroxylation, usually by cytochrome P450 enzymes (P450) in Family 1 (1A2, 1A1, and 1B1). We previously demonstrated that the bioactivation product of the anti-cancer agent 2-(4-amino-3-methylphenyl)-5-fluorobenzothiazole (5F 203), an N-hydroxylamine, can be reduced by P450 2S1 to its amine precursor under anaerobic conditions and, to a lesser extent, under aerobic conditions (Wang, K., and Guengerich, F. P. (2012) Chem. Res. Toxicol. 25, 1740–1751). In the present study, we tested the hypothesis that P450 2S1 is involved in the reductive biotransformation of known carcinogenic aromatic amines and HAAs. The N-hydroxylamines of 4-aminobiphenyl (4-ABP), 2-naphthylamine (2-NA), and 2-aminofluorene (2-AF) were synthesized and found to be reduced by P450 2S1 under both anaerobic and aerobic conditions. The formation of amines due to P450 2S1 reduction also occurred under aerobic conditions but was less apparent because the competitive disproportionation reactions (of the N-hydroxylamines) also yielded amines. Further, some nitroso and nitro derivatives of the arylamines could also be reduced by P450 2S1. None of the amines tested were oxidized by P450 2S1. These results suggest that P450 2S1 may be involved in the reductive detoxication of several of the activated products of carcinogenic aromatic amines and HAAs. PMID:23682735
Hallux abductus interphalangeus in normal feet, early-stage hallux limitus, and hallux valgus.
Castillo-Lopez, Jose M; Ramos-Ortega, Javier; Reina-Bueno, Maria; Domínguez-Maldonado, Gabriel; Palomo-Toucedo, Inmaculada C; Munuera, Pedro V
2014-03-01
Excessive deviation of the distal phalanx in abduction frequently occurs in advanced stages of hallux rigidus but not in hallux valgus. Therefore, theoretically there should be no significant differences in the hallux interphalangeal angle (HIPA) between individuals with normal feet, those with hallux valgus, and those with mild hallux limitus. The objective of the present study was thus to determine if significant differences in HIPA exist in the early stages of hallux valgus or hallux limitus deformities. The hallux interphalangeal angle was measured in three groups of participants: a control group with normal feet (45 participants), a hallux valgus group (49 participants), and a hallux limitus group (48 participants). Both of the pathologies were at an early stage. A dorsoplantar radiograph under weightbearing conditions was taken for each individual, and measurements (HIPA and hallux abductus angle [HAA]) were taken using AutoCAD (Autodesk Inc, San Rafael, California) software. Intergroup comparisons of HIPA, and correlations between HIPA, HAA, and hallux dorsiflexion were calculated. The comparisons revealed no significant differences in the values of HIPA between any of the groups (15.2 ± 5.9 degrees in the control group, 15.5 ± 3.9 degrees in the hallux valgus group, and 16.15 ± 4.3 in the hallux limitus group; P = 0.634). The Pearson correlation coefficients in particular showed no correlation between hallux dorsiflexion, HAA, and HIPA. For the study participants, there were similar deviations of the distal phalanx of the hallux with respect to the proximal phalanx in normal feet and in feet with the early stages of the hallux limitus and hallux valgus deformities.
Energy Technology Data Exchange (ETDEWEB)
Wildschut, J. [Praktijkonderzoek Plant en Omgeving PPO, Wageningen UR, Lisse (Netherlands); Campen, J.C. (Glastuinbouw, Wageningen UR, Wageningen (Netherlands)
2010-11-15
Next to possible benefits such as improved greenhouse utilization, resulting in a lower cost price and production expansion without expanding the greenhouse, multi-layer heating (in the greenhouse and/or cell) offers significant opportunities to reduce the energy use in the forcing process [Dutch] Naast mogelijke voordelen als een betere kasbenutting, waardoor een lagere kostprijs, en productieuitbreiding zonder kasuitbreiding, biedt het broeien in meerdere lagen (in de kas en/of in de cel) grote mogelijkheden om het energieverbruik in de broeierij terug te dringen.
Energy Technology Data Exchange (ETDEWEB)
Gronauer, A; Helm, M; Schoen, H [Bayerische Landesanstalt fuer Landtechnik der Technischen Univ. Muenchen-Weihenstephan (Germany)
1998-12-31
Topics of this article are: composting of biological wastes; techniques, operation modes, regional concepts, engineering, hygienical, ecological, economical aspects. (SR) gardening plots. The project comprised three parts: Composting techniques, applications of compost in agriculture and gardening, and applications in landscaping. This volume comprises the summaries of the three part-projects. (orig./SR) [Deutsch] Das uebergeordnete Ziel des Weihenstephaner Verbundvorhabens bestand darin, fachliche Grundlagen und Entscheidungshilfen fuer den Bereich der Kompostierung und der Verwertung von biogenen Reststoffen, insbesondere der getrennt erfassten organischen Abfaelle aus den Haushaltungen (Bioabfall), zu schaffen. In diesem Rahmen sollen sowohl verschiedene Verfahren und Techniken der Kompostierung als auch regionale Konzepte hinsichtlich verfahrenstechnischer, hygienischer, oekologischer, oekonomischer und die Entsorgungssicherheit betreffender Aspekte untersucht und bewertet werden. (orig./SR)
Döring, Peter
Der besondere Vorteil der OPs liegt darin, dass sich seine Eigenschaften durch einfache äußere Beschaltungen stark variieren lassen. OPs sind daher in immer größer werdendem Umfang in analogen Schaltungen, aber auch in Schaltungen der Digitaltechnik anwendbar und integrierbar. In diesem Kapitel wird das Bauelement ausführlich vorgestellt und ein Eindruck von seinen universellen Einsatzmöglichkeiten vermittelt. Behandelt werden dazu folgende Themen: Einführung; Differenzverstärker; Grundlagen des Operationsverstärkers; Operationsverstärker: Kennlinie, invertierender und nichtinvertierender Betrieb, Kenndaten; Operationsverstärker mit Gegenkopplung: frequenzabhängig und frequenzunabhängig, Schaltbeispiele. Operationsverstärker als Leistungsverstärker; Aktive Filterschaltungen (Gauß-Filter, Bandsperre).
Einstein und Heisenberg Begründer der modernen Physik
Kleinknecht, Konrad
2017-01-01
Dieses Buch erzählt die spannende Geschichte der großartigen Entdeckungen des 20. Jahrhunderts: der Einsteinschen Relativitätstheorie und der Heisenbergschen Quantenmechanik. Diese Entdeckungen legten die Grundlagen der heutigen Physik, ohne die unsere digitalisierte Welt der Computer, Satelliten und neuen Werkstoffe nicht möglich wäre. Konrad Kleinknecht versteht es, komplizierte physikalische Zusammenhänge verständlich zu schildern und verbindet die Geschichte der modernen Physik mit den Lebensläufen der beiden außergewöhnlichen Physiker. Er beschreibt in dieser Doppelbiographie die Gemeinsamkeiten und Gegensätze der beiden Koryphäen und zeigt, wie ihr Wirken das 20. Jahrhundert zum Jahrhundert der Physik formte.
Zegarelli, Mark
2015-01-01
Der schnelle Überblick für Schüler und jeden, den es sonst noch interessiert Müssen Sie sich in der Schule oder im Beruf mit Mathematik beschäftigen und es hapert schon an den Grundlagen? Frei nach dem Motto »Einst gelernt, doch längst vergessen« bereiten oft gerade die einfachen Fragestellungen Probleme. Wie viel Prozent sind das nochmal? Wie war das doch gleich mit der Bruchrechnung und wie berechnet man eigentlich den Flächeninhalt eines Dreiecks? Keine Sorge, Mark Zegarelli erklärt es Ihnen einfach, aber zugleich amüsant, und hilft Ihnen so, Ihre Wissenslücken zu schließen. Damit ist Mathe
Energy Technology Data Exchange (ETDEWEB)
Knapp, W.
1997-05-01
The article describes the solar aircraft `Icare`` which was constucted in a joint project by engineers and scientists of Stuttgart university. The aircraft requires slightly more than one kW for staying up. The theoretical fundamentals are presented in the dissertation of Peer Frank, ``Aircraft design for minimum fuel consumption` (Institute of Aircraft Engineering, Stuttgart, 1992). (orig.) [Deutsch] Allein mit Sonnenkraft kann das Flugzeug `Icare` fliegen. Es entstand in Gemeinschaftsarbeit von Ingenieuren und Wissenschaftlern der Stuttgarter Universitaet. Das Solarflugzeug Icare benoetigt etwas ueber ein Kilowatt, um oben zu bleiben. In seiner Doktorarbeit `Die Auslegung von Flugzeugen mit geringstem Antriebsleistungsbedarf` (Institut fuer Flugzeugbau, Stuttgart, 1992) hat der Duesseldorfer Peer Frank die theoretischen Grundlagen dazu behandelt. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Gronauer, A.; Helm, M.; Schoen, H. [Bayerische Landesanstalt fuer Landtechnik der Technischen Univ. Muenchen-Weihenstephan (Germany)
1997-12-31
Topics of this article are: composting of biological wastes; techniques, operation modes, regional concepts, engineering, hygienical, ecological, economical aspects. (SR) gardening plots. The project comprised three parts: Composting techniques, applications of compost in agriculture and gardening, and applications in landscaping. This volume comprises the summaries of the three part-projects. (orig./SR) [Deutsch] Das uebergeordnete Ziel des Weihenstephaner Verbundvorhabens bestand darin, fachliche Grundlagen und Entscheidungshilfen fuer den Bereich der Kompostierung und der Verwertung von biogenen Reststoffen, insbesondere der getrennt erfassten organischen Abfaelle aus den Haushaltungen (Bioabfall), zu schaffen. In diesem Rahmen sollen sowohl verschiedene Verfahren und Techniken der Kompostierung als auch regionale Konzepte hinsichtlich verfahrenstechnischer, hygienischer, oekologischer, oekonomischer und die Entsorgungssicherheit betreffender Aspekte untersucht und bewertet werden. (orig./SR)
Dem Sog der Arbeit widerstehen. Leben im egalitären Modell
Directory of Open Access Journals (Sweden)
Aschermann Ellen
2007-07-01
Full Text Available Die Autorinnen untersuchen die Einschätzungen von deutschschweizer Ehepaaren und ihren heranwachsenden Kindern zum Leben in einem egalitären Familienmodell. Die Längsschnittstudie umfasst dabei einen Zeitraum von 10 Jahren. In halbstrukturierten Interviews werden die Veränderungen in der Organisation in Arbeits-, Haushalts- und Familienbereich erhoben und mittels qualitativer Analyse strukturiert. Der erste Band enthält die theoretischen Grundlagen und die Befunde zu den Veränderungen bei den Eltern. Im zweiten Band wird auf die Erfahrungen der Kinder eingegangen, die in diesen Familien aufwuchsen. Auch sie wurden mit halbstrukturierten Interviews befragt. Zusätzlich wird die Kinderperspektive mit einer stärker traditionell aufwachsenden Kontrollgruppe verglichen.
International Nuclear Information System (INIS)
Bezdecny, Steven A.; Karmaus, Peer; Roth, Robert A.; Ganey, Patricia E.
2007-01-01
Polychlorinated biphenyls (PCBs) are ubiquitous, persistent environmental contaminants that affect a number of cellular systems, including neutrophils. Among the effects caused by the noncoplanar PCB 2,2',4,4'-tetrachlorobiphenyl (2244-TCB) in granulocytic HL-60 cells are increases in superoxide anion production, activation of phospholipase A 2 with subsequent release of arachidonic acid (AA) and upregulation of the inflammatory gene cyclooxygenase-2 (COX-2). The objective of this study was to determine the signal transduction pathways involved in the upregulation of COX-2 by 2244-TCB. Treatment of HL-60 cells with 2244-TCB led to increased expression of COX-2 mRNA. This increase was prevented by the transcriptional inhibitor actinomycin D in cells pretreated with 2244-TCB for 10 min. The increase in COX-2 mRNA was associated with release of 3 H-AA, phosphorylation of p38 and extracellular signal-regulated kinase (ERK) mitogen-activated protein (MAP) kinases, increased levels of nuclear NF-κB and increased superoxide anion production. Bromoenol lactone, an inhibitor of the calcium-independent phospholipase A 2 , reduced 3 H-AA release but had no effect on COX-2 mRNA, protein or activity. Pretreatment with SB-202190 or SB-203580, inhibitors of the p38 MAP kinase pathway, prevented the 2244-TCB-mediated induction of COX-2 and phosphorylation of p38 and ERK MAP kinases. These inhibitors did not alter 3 H-AA release. Treatment with PD 98059 or U 0126, inhibitors of the MAP/ERK (MEK) pathway, prevented the 2244-TCB-mediated activation of ERK but had no effect on COX-2 induction or p38 phosphorylation. 2244-TCB treatment did not affect c-Jun N-terminal kinase (JNK) phosphorylation. 2244-TCB exposure increased the amount of nuclear NF-κB. This increase was prevented by pretreatment with p38 MAP kinase inhibitors, but not by pretreatment with MEK inhibitors. Pretreatment with inhibitors of NF-κB prevented the 2244-TCB-mediated induction of COX-2 mRNA. 2244-TCB
Die Grundlagen der Normativität bei Kant und Spener
Directory of Open Access Journals (Sweden)
Anna SZYRWIŃSKA
2011-12-01
Full Text Available In one of the chapters in Conflict of Faculties, Kant presents so-called “Spener’s problem”. Kant refers to the conception of the 17th century theologian Philipp Jakob Spener, concerning the problem of radical moral transformation of individuals. Spener became famous as one of the founders and main exponents of pietistic theology, which in the 18th century became one of the most significant intellectual trends at the University of Königsberg and about which one may assume, that it could influence the evolution of Kantian philosophy. The goal of the article is to compare the main assumptions of Spener’s theology with Kantian theory of moral motivation. The analysis focuses on the possibility of describing the phenomenon of normativity in both conceptions.
Energy Technology Data Exchange (ETDEWEB)
Kranz, H.R. [Siemens AG, Karlsruhe (Germany)
1995-12-31
In chapter 17 of the anthology about building control the communication between and with technical building systems is described. The following aspects are discussed: From the matrix cable to the standard bus, data transmission, communication terms, components of communication systems, type of data transmission, types of connection, networks, protocols, the ISO/OSI reference model, application of automation in the field of communication, services and profiles, communication objects. (BWI) [Deutsch] Kapitel 17 des Sammelbandes ueber Building Control ist dem Thema der Kommunikation zwischen und mit technischen Gebaeudesystemen gewidmet. In diesem Zusammenhang werden folgende Themen angesprochen: Vom Matrixkabel zum Standard-Bus; Daten-Transport; Kommunikations-Begriffe; Komponenten der Kommunikations-Systeme; Art der Datenuebertragung; Verbindungsarten, Netze, Protokolle; Das ISO/OSI Referenzmodell; Automation als Anwendung in der Kommunikation; Dienste und Profile; Kommunikationsobjekte. (BWI)
Indriarini et al., Afr., J. Infect. Dis. (2018) 12(S): 127-132 https://doi ...
African Journals Online (AJOL)
Desi
2017-10-27
Oct 27, 2017 ... Diaz R, Kremer K, De Haas PE. (1998). Molecular Epidemiology of Tuberculosis in Cuba outside of Havana,. July 1994 – June 1995: Utility of Spoligotyping Versus IS6110 Restriction Fragmen Length Polymorphism. International Journal of Tuberculosis and Lung Disease; 2: 743-750. 9. Elias D, Akuffo H, ...
Ayurgenomics: Understanding human individuality through ...
Indian Academy of Sciences (India)
mitali
Knowledge. VATA. PITTA. KAPHA. Stratification of Healthy based on prakriti. Axes of variation in Prakriti. EGLN1-HIF axis in. HAA/HAPE/asthma. Hypoxia responsiveness. (EGLN1 –HIF1-vWF). Hypoxia axis differentially regulated in VADU cohort. Hypoxia and Hemostasis axes linked through Prakriti. VWF levels also differ.
Effects on insect growth regulators on the hairy rose beetle, Tropinota squalida (Col., Scarabeidae)
Czech Academy of Sciences Publication Activity Database
Hussein, Hany; Dimetry, N.; Zidan, Z.; Iss-hak, R. R.; Sehnal, František
2005-01-01
Roč. 129, č.3 (2005), s. 142-148 ISSN 0931-2048 Grant - others:Rohm and Haas Insecticidal Research Laboratories(US) RH-2485; Zoecon Corporation(US) ZR-512S Institutional research plan: CEZ:AV0Z50070508 Keywords : Epicometis * Tropinota * azadirachtin Subject RIV: ED - Physiology Impact factor: 0.703, year: 2005
Directory of Open Access Journals (Sweden)
Guy Mitsuyuki Tsumanuma
2010-07-01
Full Text Available O fungo Phakopsora pachyrhizi Sydow & Sydow representa grande ameaça à sojicultura nas principais regiões produtoras do mundo, onde significativas perdas foram relatadas. Na quantificação de danos causados, muitas são as variáveis a serem estudadas, como área abaixo da curva de progresso da doença (AACPD, absorção de luz da área foliar sadia (HAA e duração da área foliar sadia (HAD, além das curvas de progresso da doença. Neste trabalho, objetivou-se verificar a influência de diferentes herbicidas e fungicidas no progresso da doença, bem como suas implicações nas variáveis referentes à área foliar sadia e à produtividade da cultura. Os tratamentos testados em duas cultivares ('MG/BR46 Conquista' e 'BRS Valiosa RR' foram: 1. Testemunha; 2. Testemunha com herbicidas; 3. Herbicidas e pyraclostrobin (V4 + pyraclostrobin + epoxiconazole (R2 e R5.1; 4. Herbicidas e pyraclostrobin (V4 + epoxiconazole (R2 e R5.1; e 5. Herbicidas (V4 + pyraclostrobin + epoxiconazole (R2 e R5.1. Os herbicidas utilizados em 'MG/BR-46 Conquista' foram sethoxydim, bentazon e chlorimuron-ethyl, sendo utilizado glyphosate na 'BRS Valiosa RR'. O modelo logístico foi o que melhor se adequou à severidade média das avaliações e à curva de progresso da doença. Para o terço inferior, posição do dossel mais propícia à doença, o modelo logístico com taxa variável foi o que mais se ajustou aos dados. A pulverização de pyraclostrobin + epoxiconazole reduziu a taxa de desenvolvimento de P. pachyrhizi em relação à epoxiconazole. A utilização da mistura influenciou as variáveis AACPD, HAA e HAD, sendo estas consideradas apropriadas para a quantificação dos danos provocados pela ferrugem asiática. Na 'MG/BR-46 Conquista', a ação dos herbicidas afetaram temporariamente a área foliar, atingindo indiretamente as variáveis HAA e HAD.Phakopsora pachyrhizi Sydow & Sydow is the worst threat for soybean crop in the most important growing
Energy Technology Data Exchange (ETDEWEB)
1986-01-01
Some authors report about the thermal and thermomechanical behavior, the geomechanical behavior, the influence of ionizing radiation on the mechanical behavior, subrosion and formation of caprock, early quaternary sediments, investigation of near-surface saline groundwaters, the risk of quaternary dissolution and the migration of the Gorleben salt dome. The tectonic and hydraulic test in cretaceous and jurassic sediments in the environment of the Konrad mine were subject of further injuries. The term extraction or excavation, the mass displacement by mineral exploitation, water balance, transport of pollutants in the subsoil, contaminations of ground water by abandoned waste disposal sites, and the regional groundwater drawndown in strata of the Bunter Sandstone caused by an open pit lignite mine are described.
Energy Technology Data Exchange (ETDEWEB)
Kampman, B.E.; Croezen, H.J.; Verbraak, G.M.; Brouwer, F.P.E.
2010-06-15
A number of new gaseous fuels for cars and ships is becoming more popular: compressed natural gas (CNG), liquid natural gas (LNG) and biogas. This report presents the results of a study of the costs and environmental effects of these gas applications and compares them to diesel and petrol and the 'common' biofuels biodiesel and bio-ethanol. The green gas applications emit much less CO2 than biodiesel and bio-ethanol from wheat. The air-polluting emissions are much lower in all cases. The basic cost of driving or sailing on these gaseous fuels (excl. levies and taxes) are significantly higher than in case of diesel, but in some cases van be comparable or even lower than in case of liquid biofuels. [Dutch] Een aantal nieuwe gasvormige brandstoffen voor auto's en schepen is in opkomst: aardgas onder druk (CNG), vloeibaar aardgas (LNG) en biogassen. In dit rapport worden de resultaten van een onderzoek naar de kosten en de milieueffecten van deze gastoepassingen gepresenteerd en vergeleken met diesel en benzine en de 'gewone' biobrandstoffen bio-diesel en bio-ethanol. De groen gas-toepassingen stoten aanzienlijk minder CO2 uit dan biodiesel en bio-ethanol uit tarwe. De luchtvervuilende emissies zijn in alle gevallen een stuk lager. De kale kosten van rijden en varen op deze gasvormige brandstoffen (excl. heffingen en belastingen) zijn wel aanzienlijk hoger dan bij diesel, maar kunnen in sommige toepassingen vergelijkbaar of lager uitkomen dan van de vloeibare biobrandstoffen.
Exploring Professional Identity Development in Alcohol and Drug Counselors in the 21st Century
Simmons, Lori; Haas, Deborah; Massella, John; Young, Jared; Toth, Paul
2017-01-01
Professional identity development is an emerging area for alcohol and drug counselors. Few studies have investigated professional identity in alcohol and drug counselors (Ogborne, Braun, & Schmidt, 2001; Massella, Simons, Young, Haas, & Toth 2013). The goal of the current study is to add to this area of research. A total of 1,333 certified…
African Journals Online (AJOL)
Demetris AJ, Drachenberg CB, Gibson IW, Grimm. PC, Haas M, Lerut E, Liapis H, Mannon RB, Marcus. PB, Mengel M, Mihatsch MJ, Nankivell BJ, Nickeleit. V, Papadimitriou JC, Platt JL, Randhawa P, Roberts. I, Salinas-Madriga L, Salomon DR, Seron D, Sheaff. M, Weening JJ. Banff'05 Meeting Report: differential diagnosis ...
Shedding light on DOC release by benthic primary producers and its consumption by bioeroding sponges
Mueller, B.
2015-01-01
DOM is increasingly recognized for its important role in the element cycling and the generalecosystem functioning of tropical coral reefs (e.g., Rohwer and Youle 2010; Barott and Rohwer2012; De Goeij et al. 2013; Haas et al. 2013b). The DOM pool on coral reefs is mainly fueled bythe DOM release of
Reactivities of N-acetylgalactosamine-specific lectins with human IgA1 proteins
DEFF Research Database (Denmark)
Moore, J.S.; Kulhavy, R.; Tomana, M.
2007-01-01
, VV reacted with sugars of both IgA subclasses and IgG, indicating that it also recognized N-linked glycans without GalNAc. Furthermore, HAA and HPA from several manufacturers differed in their ability to bind various IgA1 myeloma proteins and other GalNAc-containing glycoproteins in ELISA and Western...
Breakdown of the quantum Hall effect in InAs/AlSb quantum wells due to counterflowing edge channels
Wees, B.J. van; Meijer, G.I.; Kuipers, J.J.; Klapwijk, T.M.; Graaf, W. van de; Borghs, G.
1995-01-01
We investigated magnetotransport in the two-dimensional electron gas (2DEG) present in InAs/AlSb quantum wells. The filling factor Ng underneath a gate electrode was reduced relative to the bulk filling factor Nb. For Ng
Energy Technology Data Exchange (ETDEWEB)
NONE
2012-03-15
Subsidised, energy efficient building example projects in the Netherlands show that the additional cost of 10 to 15% for the initial investment are compensated by the much lower energy cost later on. A study has been conducted of the relation between investments, housing expenses and energy efficient building [Dutch] Gesubsidieerde, energiezuinig gebouwde voorbeeldprojecten in Nederland tonen aan dat de meerkosten van 10% tot 15% voor de initiele investering opwegen tegen de veel lagere energiekosten later. Een studie is uitgevoerd naar de relatie tussen investeringen, woonlasten en energiezuinig bouwen.
Energy Technology Data Exchange (ETDEWEB)
Brands, R. [Cumulus Nederland, Cuijk (Netherlands)
2006-11-15
For decades air conditioners are equipped with humidifiers. A large number of humidifier types are available. Adiabatic humidification is an energy efficient technique, although it is important to control the installation conditions, water treatment (reversed osmosis) and the risk of legionella. [Dutch] Al decennia lang worden er luchtbehandelingkasten gebouwd met een bevochtigingssectie. Door de jaren heen is een enorme verscheidenheid ontstaan van bevochtigingssystemen. Adiabatische bevochtiging staat in de belangstelling vanwege het lagere energiegebruik. Hierbij moeten de installatievoorwaarden, de waterbehandeling (omgekeerde osmose) en het legionellarisico goed in de gaten worden gehouden.
DEFF Research Database (Denmark)
Walther, Andrea; Ravasio, Davide; Qin, Fen
2015-01-01
The 19th century witnessed many advances in scientific enzymology and microbiology that laid the foundations for modern biotechnological industries. In the current study, we analyze the content of original lager beer samples from the 1880s, 1890s and 1900s with emphasis on the carbohydrate content......, with decreasing contamination by enzymatic and microbial activities over this time span. Samples are sufficiently well preserved to allow comparisons to present-day references, thus yielding molecular signatures of the effects of 20th century science on beer production. Opposite to rather stable carbohydrate...
Uma análise empírica sobre as preferências do consumidor brasileiro de cervejas artesanais
Santos, Vinicius Cassar Kfuri
2014-01-01
Um dos produtos mais consumidos do mundo vem passando por grandes transformações, e a cerveja que conhecemos como tipo Pilsen (Light Lager) deixou de ser opção única nas prateleiras. Dado o potencial de crescimento do setor no Brasil, o objetivo deste trabalho é mapear as preferências do consumidor de cerveja artesanal, usando técnicas de preferência declarada, a partir da aplicação de questionários que convidam o entrevistado a elencar suas preferências diante das combinações dos atribut...
Kontext+7, Lærervejledning og web
DEFF Research Database (Denmark)
Hansen, Niels Jacob; Johnsen, Lars Busch; Lindhardt, Bent Kofod
KonteXt+7 Lærervejledning/Web består af en trykt lærervejledning og et tilhørende website: kontextplus.dk. Lærervejledningen indeholder en didaktisk del, en side til side-vejledning og en evalueringsdel. Web-delen indeholder arbejdsark, hjælpeark, serviceark og evalueringsark til hvert kapitel til...... i matematik KonteXt + 7, Kernebog/Web er klar på lager første uge i august. De to første kapitler vil blive lagt på kontextplus.dk, så du har mulighed for at forberede din undervisning i god tid....
Energy Technology Data Exchange (ETDEWEB)
Koelemeijer, R. [Planbureau voor de Leefomgeving PBL, Den Haag (Netherlands);
2012-08-15
Greenhouse gas emissions in Europe need to be lowered by 80-95% in 2050 compared to 1990 to curb global warming to 2°C. This article addresses the consequences for air quality of various ways to realize such a drastic emission reduction [Dutch] Emissies van broeikasgassen in Europa moeten in 2050 80-95% lager zijn dan in 1990 om de opwarming van de aarde te beperken tot 2C. Dit artikel gaat in op de consequenties voor de luchtkwaliteit van verschillende manieren om zo'n vergaande emissiereductie te realiseren.
Weiss, W. J.; Becker, W.; Schindler, S.
2012-12-01
The United States Environmental Protection Agency's 2006 Stage 2 Disinfectant / Disinfection Byproduct Rule (DBPR) for finished drinking waters is intended to reduce overall DBP levels by limiting the levels of total trihalomethanes (TTHM) and five of the haloacetic acids (HAA5). Under Stage 2, maximum contaminant levels (MCLs), 80 μg/L for TTHM and 60 μg/L for HAA5, are based on a locational running annual average for individual sites instead of as the system-wide quarterly running annual average of the Stage 1 DBPR. This means compliance will have to be met at sampling locations of peak TTHM and HAA5 concentrations rather than an average across the entire system. Compliance monitoring under the Stage 2 DBPR began on April 1, 2012. The New York City (NYC) Department of Environmental Protection (DEP) began evaluating potential impacts of the Stage 2 DBPR on NYC's unfiltered water supply in 2002 by monitoring TTHM and HAA5 levels at various locations throughout the distribution system. Initial monitoring indicated that HAA5 levels could be of concern in the future, with the potential to intermittently violate the Stage 2 DBPR at specific locations, particularly those with high water age. Because of the uncertainty regarding the long-term prospect for compliance, DEP evaluated alternatives to ensure compliance, including operational changes (reducing chlorine dose, changing flow configurations to minimize water age, altering pH, altering source water withdrawals); changing the residual disinfectant from free chlorine to chloramines; and engineered treatment alternatives. This paper will discuss the potential for using DEP's Operations Support Tool (OST) and enhanced reservoir monitoring to support optimization of source water withdrawals to minimize finished water DBP levels. The OST is a state-of-the-art decision support system (DSS) to provide computational and predictive support for water supply operations and planning. It incorporates a water supply system
Radioactive waste management in Switzerland
International Nuclear Information System (INIS)
Hugi, M.
2011-01-01
The Federal Nuclear Safety Inspectorate ENSI is the Supervisory Authority for Nuclear Safety and Security of Swiss Nuclear Facilities. The responsibilities include the evaluation and operational monitoring of the existing five Swiss nuclear power plants, the radioactive waste disposals and the nuclear research facilities. The supervisory area includes project planning, operational issues, and decommissioning of plants. ENSI supervises the formation, handling and storage of radioactive waste, the work on deep geological disposal and the transport of radioactive materials. The disposal of radioactive waste is regulated by the Swiss Nuclear Energy Act (2005) and the Nuclear Energy Ordinance (2005). The protection of humans and the environment must be guaranteed permanently. Waste disposal must be carried out in the own country by deep geological repositories. The licensing procedure for the disposal facilities is concentrated at the federal level, the cooperation of the location canton, neighboring cantons and the neighboring countries is ensured. The general license for the deep geological repository is subject to an optional referendum. The polluter pays principle applies to the disposal of radioactive waste. The waste producers are legally obliged to dispose of them and have founded the National Cooperative for the Storage of Radioactive Waste (Nagra). The federal government is responsible for waste from medicine, industry and research (MIF). The Federal Council approved the waste management certificate for low and intermediate level waste (SMA) in 1988. High-level-waste (HAA) and long-live-intermediate-level-waste (LMA), where approved in 2006. Nagra's disposal concept envisages two separate deep geological repositories for SMA and HAA / LMA in a suitable, tectonically stable, low-permeability rock formation. If a site meets both the SMA and HAA / LMA storage requirements, the selection process may result in a common location for all radioactive waste. Until the
GEMAS - Soil geochemistry and health implications
Ernstsen, Vibeke; Ladenberger, Anna; Wragg, Joanna; Gulan, Aleksandra
2014-05-01
activity on soil composition and its health consequences. References Reimann, C., Birke, M., Demetriades, A., Filzmoser, P. & O'Connor, P. (Editors), 2014. Chemistry of Europe's agricultural soils - Part A: Methodology and interpretation of the GEMAS data set. Geologisches Jahrbuch (Reihe B), Schweizerbarth, Hannover, 528 pp. Reimann, C., Birke, M., Demetriades, A., Filzmoser, P. & O'Connor, P. (Editors), 2014. Chemistry of Europe's agricultural soils - Part B: General background information and further analysis of the GEMAS data set. Geologisches Jahrbuch (Reihe B), Schweizerbarth, Hannover, 352 pp.
Kim, Sangyub; Guo, Jingshu; O’Sullivan, M. Gerald; Gallaher, Daniel D.; Turesky, Robert J.
2015-01-01
Considerable evidence suggests that environmental factors, including diet and cigarette smoke, are involved in the pathogenesis of colon cancer. Carcinogenic nitroso compounds (NOC), such as N-nitrosodimethylamine (NDMA), are present in tobacco and processed red meat, and NOC have been implicated in colon cancer. Azoxymethane (AOM), commonly used for experimental colon carcinogenesis, is an isomer of NDMA, and it produces the same DNA adducts as does NDMA. Heterocyclic aromatic amines (HAAs) formed during the combustion of tobacco and high-temperature cooking of meats are also associated with an elevated risk of colon cancer. The most abundant carcinogenic HAA formed in tobacco smoke is 2-amino-9H-pyrido[2,3-b]indole (AαC), whereas 2-amino-3,4-dimethylimidazo[4,5-f]quinoline (MeIQ) is the most potent carcinogenic HAA formed during the cooking of meat and fish. However, the comparative tumor-initiating potential of AαC, MeIQ, and AOM is unknown. In this report, we evaluate the formation of DNA adducts as a measure of genotoxicity, and the induction of colonic aberrant crypt foci (ACF) and dysplastic ACF, as an early measure of carcinogenic potency of these compounds in the colon of male A/J mice. Both AαC and AOM induced a greater number of DNA adducts than MeIQ in the liver and colon. AOM induced a greater number of ACF and dysplastic ACF than either AαC or MeIQ. Conversely, based on adduct levels, MeIQ-DNA adducts were more potent than AαC- and AOM-DNA adducts at inducing ACF. Long-term feeding studies are required to relate levels of DNA adducts, induction of ACF, and colon cancer by these colon genotoxicants. PMID:26734915
Directory of Open Access Journals (Sweden)
Chake Keerqin
2017-03-01
Full Text Available Broilers that have early access to feed have been shown to have enhanced immune system and gut development and heightened resilience against necrotic enteritis (NE. This study examined the effect of early feeding a high amino acid density diet on performance of broilers under a sub-clinical NE challenge model. Ross 308 broilers (n = 576 were assigned to a 2 × 2 × 2 factorial design with 2 feeding regimes (feed access either within 6 h post-hatch or after 48 h post-hatch, 2 diets (control diet or the control diet with an additional 10% digestible amino acids [HAA] and either presence or absence of NE challenge. Oral administrations of Eimeria species (d 9 and a field strain of Clostridium perfringens (d 14 were used to induce NE. Broiler performance was analysed at d 13, 23, 30 and 35. Intestinal lesion score and bacterial count were analysed on d 16. The NE challenge reduced overall bird performance and induced severe intestinal lesions, without causing notable mortality. At d 23 bird weight was significantly lower (P < 0.001 in the challenged birds compared with the unchallenged birds, but by d 30 the challenged birds had recovered and challenge no longer had an impact on bird performance. Birds fed the HAA diet had greater body weight by d 35 and heightened Lactobacillus content in the ileum at d 16 (P < 0.05. Birds that were fed the HAA diet after a period of fasting performed better in terms of feed conversion ratio (FCR under challenge. The findings from this study suggest there are beneficial effects of feeding high amino acid diets to birds in response to external stresses, such as post-hatch fasting and subclinical NE.
Determination of haloacetic acids in water by ion chromatography--method development.
Lopez-Avila, V; Liu, Y; Charan, C
1999-01-01
The microextraction/ion chromatographic (IC) method developed in this study involves extraction of 9 haloacetic acids (HAAs) from aqueous samples (acidified with sulfuric acid to a pH of copper sulfate pentahydrate and sodium sulfate) with methyl tert-butyl ether (MTBE), back extraction into reagent water, and analysis by IC with conductivity detection. The separation column consists of an Ion Pac AG-11 (2 mm id x 50 mm length) guard column and an Ion Pac AS-11 (2 mm id x 250 mm length) analytical column, and the concentration column is a 4 mm id x 35 mm length Dionex TAC-LP column. Use of the 2 mm id Dionex AS-11 column improved detection limits especially for trichloracetic acid (TCAA), bromodichloroacetic acid (BDCAA), dibromochloroacetic acid (DBCAA), and tribromoacetic acid (TBAA). The peak interfering with BCAA elutes at the same retention time as nitrate; however, we have not confirmed the presence of nitrate. Stability studies indicate that HAAs are stable in water for at least 8 days when preserved with ammonium chloride at 100 mg/L and stored at 4 degrees C in the dark. At day 30, recoveries were still high (e.g., 92.1-106%) for dichloroacetic acid (DCAA), BCAA, dibromoacetic acid (DBAA), trichloroacetic acid (TCAA), BDCAA, and DBCAA. However, recoveries of monochloroacetic acid (MCAA), monobromoacetic acid (MBAA), and TBAA were only 54.6, 56.8, and 66.8%, respectively. Stability studies of HAAs in H2SO4-saturated MTBE indicate that all compounds except TBAA are stable for 48 h when stored at 4 degrees C in the dark. TBAA recoveries dropped to 47.1% after 6 h of storage and no TBAA was detected after 48 h of storage. The method described here is only preliminary and was tested in only one laboratory. Additional research is needed to improve method performance.
Multi-terminal transport measurements of MoS2 using a van der Waals heterostructure device platform
DEFF Research Database (Denmark)
Cui, Xu; Lee, Gwan-Hyoung; Kim, Young Duck
2015-01-01
in performance, including a record-high Hall mobility reaching 34,000 cm2 V-1 s-1 for six-layer MoS2 at low temperature, confirming that low-temperature performance in previous studies was limited by extrinsic interfacial impurities rather than bulk defects in the MoS2. We also observed Shubnikov-de Haas...
40 CFR 141.622 - Subpart V monitoring plan.
2010-07-01
... procedures; and (iv) Monitoring plans for any other systems in the combined distribution system if the State... current distribution system locations with expected high TTHM or HAA5 levels. The State may also require modifications in your monitoring plan. If you are a subpart H system serving > 3,300 people, you must submit a...
2003-12-01
Application to Land-Cover Change in the Brazilian Amazon ,” Remote Sensing of Environment, vol 52, pp 137-154. Anderson, G.L., J.D. Hanson, and R.H. Haas...FORTRAN, Cambridge University Press. Price, K.P., D. A. Pyke,and L. Mendes. 1992. “Shrub Dieback in a Semiarid Ecosystem; The Integration of Remote
de Haas–van Alphen effect and Fermi surface properties of single-crystal CrB.sub.2./sub..
Czech Academy of Sciences Publication Activity Database
Brasse, M.; Chioncel, L.; Kuneš, Jan; Bauer, A.; Regnat, A.; Blum, C.G.F.; Wurmehl, S.; Pfleiderer, C.; Wilde, M.A.; Grundler, D.
2013-01-01
Roč. 88, č. 15 (2013), "155138-1"-"155138-7" ISSN 1098-0121 Institutional support: RVO:68378271 Keywords : CrB 2 * de Haas -van Alphen effect * non-collinear magnetic order Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.664, year: 2013 http://link. aps .org/doi/10.1103/PhysRevB.88.155138
Aoki, H; Endo, M; Nakayama, M; Takei, H; Kimura, N; Kunii, S; Terashima, T; Uji, S; Matsumoto, T
2002-01-01
We report our recent developments of experimental systems for measuring the de Haas-van Alphen (dHvA) effect under hydrostatic and uniaxial pressures. The dHvA effect of CeB sub 6 has been studied under both hydrostatic and uniaxial pressures and the effects of the pressures on the electronic structure are discussed.
Fermi Surface and Antiferromagnetism in Europium Metal
DEFF Research Database (Denmark)
Andersen, O. Krogh; Loucks, T. L.
1968-01-01
of the nearly cubical part of the hole surface at P, and we also discuss the effects of the electron surface at H. Since it is likely that barium and europium have similar Fermi surfaces, we have presented several extremal areas and the corresponding de Haas-van Alphen frequencies in the hope that experimental...
Waltman, Michael S.
2018-01-01
Whereas hate is defined as extreme negative feelings for others because of some aspect of their identity (Perry, 2001; Waltman & Haas, 2011), hate speech is discourse devoted to the vilification of the other's identity (Waltman, 2015; Waltman & Mattheis, 2017). It is an attempt to vandalize the other's identity to such an extent that the…
Pramana – Journal of Physics | Indian Academy of Sciences
Indian Academy of Sciences (India)
In > 0 and ≲ 6 K the resistivity shows an anomalous magnetic-history dependence together with an unusual relaxation behavior. In the isothermal resistivity Shubnikov–de Haas (SdH) oscillations, arising from a low-density system of mobile As-4 holes, with a frequency of 25 T have been recorded. From the - and ...
Roy, B C; Sedgewick, G; Aalhus, J L; Basarab, J A; Bruce, H L
2015-12-01
Increased meat toughness with animal age has been attributed to mature trivalent collagen cross-link formation. Intramuscular trivalent collagen cross-link content may be decreased by reducing animal age at slaughter and/or inducing muscle re-modeling with growth promotants. This hypothesis was tested in m. gluteus medius (GM) and m. semitendinosus (ST) from 112 beef steers finished at either 12 to 13 (rapid growth) or 18 to 20 (slow growth) months of age. Hereford-Aberdeen Angus (HAA) or Charolais-Red Angus (CRA) steers were randomly assigned to receive implants (IMP), ractopamine (RAC), both IMP and RAC, or none (control). RAC decreased pyridinoline (mol/mol collagen) and IMP increased Ehrlich chromogen (EC) (mol/mol collagen) in the GM. In the ST, RAC increased EC (mol/mol collagen) but decreased EC (nmol/g raw muscle) in slow growing CRA steers. Also, IMP increased ST pyridinoline (nmol/g raw muscle) of slow-growing HAA steers. Results indicated alteration of perimysium collagen cross-links content in muscle in response to growth promotants. Copyright © 2015 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Mishra, Manna Kumari [Solid State Physics Laboratory, Lucknow Road, Timarpur, Delhi-110054 (India); Netaji Subhas Institute of Technology, Dwarka, New Delhi-110078 (India); Sharma, Rajesh K., E-mail: rksharma@sspl.drdo.in; Manchanda, Rachna; Bag, Rajesh K.; Muralidharan, Rangarajan [Solid State Physics Laboratory, Lucknow Road, Timarpur, Delhi-110054 (India); Thakur, Om Prakash [Netaji Subhas Institute of Technology, Dwarka, New Delhi-110078 (India)
2014-09-15
Magnetotransport in two distinct AlGaN/GaN HEMT structures grown by Molecular Beam Epitaxy (MBE) on Fe-doped templates is investigated using Shubnikov de-Haas Oscillations in the temperature range of 1.8–6 K and multicarrier fitting in the temperature range of 1.8–300 K. The temperature dependence of the two dimensional electron gas mobility is extracted from simultaneous multicarrier fitting of transverse and longitudinal resistivity as a function of magnetic field and the data is utilized to estimate contribution of interface roughness to the mobility and the corresponding transport lifetime. The quantum scattering time obtained from the analysis of Shubnikov de Haas Oscillations in transverse magnetoresistance along with the transport lifetime time were used to estimate interface roughness amplitude and lateral correlation length. The results indicate that the insertion of AlN over layer deposited prior to the growth of GaN base layer on Fe doped GaN templates for forming HEMT structures reduced the parallel conduction but resulted in an increase in interface roughness.
Directory of Open Access Journals (Sweden)
Ieva Švagždytė
2015-03-01
Full Text Available The article reviews the influence of cutting rates on macrogeometry deflection of milling complex form products and turning an outside surface. For that purpose, one of the most popular aluminium alloys 6082 has been chosen. A ball nose mill of 8 mm in diameter has been milled employing CNC vertical centre HAAS MINI MILL and applying CNC lathe HAAS ST 20 for turning. Measurements have been carried out using coordinate measuring machine DEA micro-hite DCC, applying the probe sphere of 3mm in diameter and the probe equipped with a needle. A deviation of the surface profile from tangent to therophore parabola has been investigated. The determinants R2 of the obtained regressive equation have disclosed that the depth of the cut has the biggest influence on macrogeometry deflections, whereas feed rate has a slighter influence and cutting speed has no radical influence. For the turning process, the depth of the cut has the strongest influence on circularity while cilindrisity has been mainly affected by cutting speed.
International Nuclear Information System (INIS)
Mishra, Manna Kumari; Sharma, Rajesh K.; Manchanda, Rachna; Bag, Rajesh K.; Muralidharan, Rangarajan; Thakur, Om Prakash
2014-01-01
Magnetotransport in two distinct AlGaN/GaN HEMT structures grown by Molecular Beam Epitaxy (MBE) on Fe-doped templates is investigated using Shubnikov de-Haas Oscillations in the temperature range of 1.8–6 K and multicarrier fitting in the temperature range of 1.8–300 K. The temperature dependence of the two dimensional electron gas mobility is extracted from simultaneous multicarrier fitting of transverse and longitudinal resistivity as a function of magnetic field and the data is utilized to estimate contribution of interface roughness to the mobility and the corresponding transport lifetime. The quantum scattering time obtained from the analysis of Shubnikov de Haas Oscillations in transverse magnetoresistance along with the transport lifetime time were used to estimate interface roughness amplitude and lateral correlation length. The results indicate that the insertion of AlN over layer deposited prior to the growth of GaN base layer on Fe doped GaN templates for forming HEMT structures reduced the parallel conduction but resulted in an increase in interface roughness
ABCOVE program: preliminary results of tests AB5 and AB6
International Nuclear Information System (INIS)
Hilliard, R.K.; Muhlestein, L.D.
1984-01-01
A program for aerosol behavior code validation and evaluation (ABCOVE) is in progress in the United States. Purpose of the ABCOVE program is to provide a basis for judging the adequacy of existing aerosol behavior computer codes to describe inherent aerosol behavior in containment buildings during postulated breeder reactor accidents. The program involves pretest calculations by code developers and users, large-scale confirmatory tests in the 850-m 3 containment vessel of the Containment Systems Test Facility (CSTF), and blind post-test analyses and comparisons with experimental data. Two ABCOVE tests have been performed in the CSTF to date. In the first test, a single-species aerosol was used, with the aerosol being generated by spraying sodium at a high rate into an air atmosphere. In the second test, the experimental conditions simulated an accident environment in which a fission product aerosol, NaI, was released in the presence of a sodium fire. Pretest computer code predictions were made by seven organizations using eight computer codes (HAA-3, HAA-4, HAARM-3, SOFIA, QUICK, QUICKM, MAEROS, and CONTAIN)
International Nuclear Information System (INIS)
Nangalama, A.W.
1989-01-01
In order to understand the role of glucocorticoids in the regulation of gonadotropin release by the pituitary gland, the short-term effects of cortisol perifusion (1.5 h to 8 hrs) on GnRH-induced LH secretion were investigated. To determine the biochemical mechanism(s) by which cortisol can act to modulate GnRH-induced LH release, the interactions of cortisol and arachidonic acid in GnRH-stimulated LH release were examined. Cortisol perifusion for 1.5 hr had no effect on GnRH-induced LH release, but longer treatment periods (4 hr-8 hrs) significantly reduced GnRH-stimulated LH release (4.0 hr, p -4 M AA was administered for 20 min before a 10 min, 10 -10 M GnRH pulse. Like cortisol, chloroquine also failed to inhibit AA-induced LH release. Perifusion with 10 -6 M cortisol for 6.0 hours significantly (p 3 ]AA release 24% below the basal (100%) [ 3 H]AA secretion. Reduction of [ 3 H]AA release was accompanied by decreased GnRH-stimulated LH secretion
Electrons at the monkey saddle: A multicritical Lifshitz point
Shtyk, A.; Goldstein, G.; Chamon, C.
2017-01-01
We consider two-dimensional interacting electrons at a monkey saddle with dispersion ∝px3-3 pxpy2 . Such a dispersion naturally arises at the multicritical Lifshitz point when three Van Hove saddles merge in an elliptical umbilic elementary catastrophe, which we show can be realized in biased bilayer graphene. A multicritical Lifshitz point of this kind can be identified by its signature Landau level behavior Em∝(Bm ) 3 /2 and related oscillations in thermodynamic and transport properties, such as de Haas-Van Alphen and Shubnikov-de Haas oscillations, whose period triples as the system crosses the singularity. We show, in the case of a single monkey saddle, that the noninteracting electron fixed point is unstable to interactions under the renormalization-group flow, developing either a superconducting instability or non-Fermi-liquid features. Biased bilayer graphene, where there are two non-nested monkey saddles at the K and K' points, exhibits an interplay of competing many-body instabilities, namely, s -wave superconductivity, ferromagnetism, and spin- and charge-density waves.
Directory of Open Access Journals (Sweden)
F.B. Araújo
2003-08-01
Full Text Available Foram estudadas seis marcas de cervejas produzidas no Brasil, das quais as marcas 1, 2, 3 e 4 foram provenientes de microcervejarias e as 5 e 6 são líderes do mercado nacional, com o objetivo de avaliar sua qualidade pelas características físico-químicas e sensoriais. A marca 1 constituiu cerveja "ale", tipo Trigo; a 2, cerveja "lager", tipo Amber; e as demais foram cervejas "lager", tipo Pilsen. As marcas 1 e 2 apresentaram concentrações mais elevadas de ácidos voláteis e foram as que evidenciaram maior intensidade do gosto amargo. Observou-se que as marcas provenientes de microcervejarias foram as que apresentaram maior intensidade dos atributos sensoriais, devendo-se ressaltar que as marcas 1 e 2 foram as que apresentaram cor, aroma de levedura, aroma de fruta, aroma de papelão, sabor oxidado, gosto doce e aroma de diacetil mais intensos. As marcas que apresentaram, mediante análise físico-química, maior concentração de acetato de etila foram as que tiveram aroma de fruta perceptível pela equipe sensorial, não sendo este atributo detectado nas marcas 3, 4, 5 e 6. O aroma de solvente não foi detectado em nenhuma das marcas avaliadas, o que indica que a concentração de álcoois superiores estava abaixo do limiar sensorial de detecção. As marcas 3, 4 e 5 foram utilizadas para avaliar a aceitação do produto, não tendo sido verificada diferença significativa (p > 0,05 entre elas, que se situaram entre os termos hedônicos "gostei muito" e "gostei ligeiramente", o que contraria o esperado, já que as microcervejarias objetivam uma cerveja diferenciada e de maior atração para o consumidor.Six brands of beer produced in Brazil, of which brands 1, 2, 3 and 4 derived from small brewery and brands 5 and 6 were leaders of the national market, were studied to evaluate their quality through physical-chemical and sensorial characteristics. Brand 1 constitutes the "ale" Wheat type and brand 2 the "lager" Amber type. The other
Carpenter, Kurt D.; Kraus, Tamara E.C.; Goldman, Jami H.; Saraceno, John Franco; Downing, Bryan D.; Bergamaschi, Brian A.; McGhee, Gordon; Triplett, Tracy
2013-01-01
This study characterized the amount and quality of organic matter in the Clackamas River, Oregon, to gain an understanding of sources that contribute to the formation of chlorinated and brominated disinfection by-products (DBPs), focusing on regulated DBPs in treated drinking water from two direct-filtration treatment plants that together serve approximately 100,000 customers. The central hypothesis guiding this study was that natural organic matter leaching out of the forested watershed, in-stream growth of benthic algae, and phytoplankton blooms in the reservoirs contribute different and varying proportions of organic carbon to the river. Differences in the amount and composition of carbon derived from each source affects the types and concentrations of DBP precursors entering the treatment plants and, as a result, yield varying DBP concentrations and species in finished water. The two classes of DBPs analyzed in this study-trihalomethanes (THMs) and haloacetic acids (HAAs)-form from precursors within the dissolved and particulate pools of organic matter present in source water. The five principal objectives of the study were to (1) describe the seasonal quantity and character of organic matter in the Clackamas River; (2) relate the amount and composition of organic matter to the formation of DBPs; (3) evaluate sources of DBP precursors in the watershed; (4) assess the use of optical measurements, including in-situ fluorescence, for estimating dissolved organic carbon (DOC) concentrations and DBP formation; and (5) assess the removal of DBP precursors during treatment by conducting treatability "jar-test" experiments at one of the treatment plants. Data collection consisted of (1) monthly sampling of source and finished water at two drinking-water treatment plants; (2) event-based sampling in the mainstem, tributaries, and North Fork Reservoir; and (3) in-situ continuous monitoring of fluorescent dissolved organic matter (FDOM), turbidity, chlorophyll-a, and
1960-02-24
fellow inmost respectable trousers and with his hair cut in the "hatf-bbx" ./polubokg/ style. And the dandified lad seldom appears to be a quite...8217v\\:’.’ In H. DementyeVs story, «% Roads,.» the character of Feliks Petunia evideSly^Haa not wprS out, in our opinion; he: is^an architect who
Verstedeliking, Suid-Afrikaanse letterkundes en die kultuurteks
African Journals Online (AJOL)
“cultural text” is further employed as a theoretical instrument. The identification of repeating sets of representation is central to the demarcation of a “cultural text about ...... 2. die groot figure, baarde dae-oud,. 3. met krae opgeslaan, die wind is koud,. 4. en mompel oor die weer in Afrikaans;. 5. die koppe stug asof haas suf ...
IMF toetab Eesti maksureformi / Andris Feldmanis, Kertu Ruus
Feldmanis, Andris, 1982-
2004-01-01
Rahvusvahelise Valuutafondi (IMF) Eesti missiooni juht Richard Haas tutvustab äsjailmunud IMF-i raportis esitatud hinnangut Eesti majanduse hetkeseisu kohta ja võimalikke järgneva 15 aasta makroohtusid, sh jooksevkonto puudujääki ja laenamise kiiret kasvu. Rahandusminister Taavi Veskimägi ja Eesti Panga presidendi Vahur Krafti kommentaarid. Diagramm: Eesti laenukoormuse kasv kiireim
Directory of Open Access Journals (Sweden)
Marie Springborn
2015-10-01
Full Text Available Im ersten Band der Reihe „Angewandte Sexualwissenschaft“ führt Torsten Linke in theoretische Grundlagen und Termini der sexuellen Bildung in der Sozialen Arbeit ein, analysiert Ergebnisse der Studie „PARTNER 4 - Jugendsexualität 2013“ und liefert Ansätze für die praktische Arbeit im Bereich der sexuellen Bildung und Beratung. Der analytische Fokus liegt dabei auf der Sozialisationsinstanz Familie, die in der psychosexuellen Entwicklung von Kindern und Jugendlichen westlicher Gesellschaften, bei zunehmender Digitalisierung und ausgedehnter Postadoleszenz, eine wichtige Rolle bei der Vermittlung von Sexualkultur einnimmt und in der, aus Sicht des Autors, unterschiedliche Wissenszugänge sowie Einstellungen auf Grund von Geschlecht(-erverhältnissen, sozioökonomischem Status und Migrationserfahrungen vorhanden seien.
Oma ninast kaugemal: Aasia ja Euroopa fotokunsti võrdlusi / Annika Haas
Haas, Annika, 1974-
2016-01-01
Rahvusvahelisest portreefotovõistlusest "Kuala Lumpur International Photo Awards 2016" (KLPA 2016). Saksa fotokunstnikest Kathrin Tschirnerist ja Heiko Tiemannist, Jaapani fotokunstnikust Mayumi Suzukist, Jeemeni-Bosnia-Ameerika päritolu fotokunstnikust Alia Alist, Malaisia fotokunstnikest Eiffel Chongist ja Nadirah Zakariyast
Paris Photo 2015 / Kristel Schwede, Annika Haas, Laura Põld, Piret Frey
2015-01-01
Rahvusvaheline fotomess "Paris Photo 2015" 12. kuni 15. novembrini Pariisi messihallis Grand Palais. Eestit esindasid messil oma loominguga Jaanus Samma, Sigrid Viir, Krista Mölder (Temnikova & Kasela galerii)
Energy Technology Data Exchange (ETDEWEB)
Rieser, A
2009-09-15
This report helps to the popularization of the Nagra works accomplished for the management and disposal of the radioactive wastes in Switzerland. The programme for management and disposal of the radioactive wastes are extensively determined by regulations. Protection of mankind and environment is the primary objective. The basic storage process is considered as having been solved. The question addressed in the report is where the facility has to be built; the site selection procedure includes five steps: 1) according to their type the wastes have to be allocated to two different repositories: for low- and intermediate-level wastes (L/ILW), and for high-level and alpha-toxic wastes (HLW); 2) the safety concept for both repositories and the requirements on the geology have to be determined; 3) large suitable geological-tectonic zones must be found where repositories could be built; 4) in these geological zones a suitable host rock has to be identified; 5) the most important spatial geological conditions of the host rock (minimum depth with respect to surface erosion, maximum depth in terms of engineering requirements, lateral extent) have to be identified. Based on these criteria, three suitable siting regions for a HLW repository were found in the North of Switzerland. The preferred host rock is Opalinus clay because of its very low permeability; it is therefore an excellent barrier against nuclide transport. In the three proposed siting regions, Opalinus clay is present in sufficient volumes at a suitable depth. For a L/ILW repository six different possible siting regions were identified, five in Northern Switzerland and one in Central Switzerland. In the three siting regions found for a possible HLW repository, it would also be possible to built a combined repository for both HLW and L/ILW wastes.
Quantum mechanics by walking 1. Foundations; Quantenmechanik zu Fuss 1. Grundlagen
Energy Technology Data Exchange (ETDEWEB)
Pade, Jochen [Oldenburg Univ. (Germany)
2012-11-01
Quantum mechanics by walking introduces to the foundations of non-relativistic quantum mechanics. This book applies to studyings of teaching physics as well as all studyings of physics, who look for an appropriate, easy, fresh, and modern approach to the field. In the present first volume the essential principles of quantum mechanics are worked out. in order to be able to develop their mathematical formulation as fastly and clearly as possible, systematically between wave mechanics and algebraic presentation is changed. Beside themes, which are traditionally in textbooks of quantum mechanics, extensively actual aspects like interaction-free quantum measurement, neutrino oscillations, or quantum cryptography are considered as well as fundamental problems and epistemological questions discussed, as they occur in connection with the measurement process. The list of the postulates of quantum mechanics closes this volume; they form the framework for the extensions and applications, which are discussed in the second volume. The required mathematical aids are introduced step by step. In the appendix the most important mathematical tools are compactly collected, so that supplementing literature can be far reachingly abandoned. Furthermore in the appendix supplementing themes are deepened as for instance the Quantum Zeno effect or delayed-choice experiments.
Schweizer Text Korpus – Theoretische Grundlagen, Korpusdesign und Abfragemöglichkeiten
Directory of Open Access Journals (Sweden)
Bickel, Hans
2009-01-01
Full Text Available The SWISS TEXT CORPUS (CHTK has made it its goal to extensively document the German language of the 20th century in Switzerland. In this way, and in its parallel function as a sub-corpus of the Corpus C4, that will consist of 20 million text words (tokens each from Germany, Austria, Italy/South Tirol and, as already said, Switzerland, it represents a classical reference corpus both for the standard German language in Switzerland as well as in the entire German-speaking area of Western Europe. A reference corpus should meet the requirement of comprehensively depicting the central repertoire of a language, i.e. the generally used vocabulary of this language, which is why questions of corpus structure and general planning (corpus design play a decisive role (cf. Lemnitzer/Zinsmeister (2006: 106, where the type of the reference corpus is contrasted with the special corpus. Four and a half years after the start of the project, the SWISS TEXT CORPUS was made available to the general public in April 2009, as a research instrument. The following article outlines in brief the history of this research project and deals with fundamental and specific decisions that had to be made in the design of such a reference corpus, and with how the CHTK is compiled. Together with a concluding overview of some retrieval and analysis options offered by the CHTK, this article also provides an overview of the potential of this new research instrument and supplies the background knowledge required to work with the CHTK. For reasons of space, the methods of working, the corpus-driven approaches, cannot be thematised here (cf. Bubenhofer 2008, 2006.
Industrial development in Indonesia - key data. Grundlagen der Industriellen Entwicklung Indonesiens
Energy Technology Data Exchange (ETDEWEB)
Gocht, W. (Forschungsinstitut fuer Internationale Technische und Wirtschaftliche Zusammenarbeit, Aachen (Germany))
1993-01-01
In the case of Indonesia 3 goals in particular were linked to the industrial process: to improve the balance of payments, to reduce unemployment and to develop remote regions. Thus, development plans and official development policy have not adopted merely one strategic approach to industrialization, but have combined several: export diversification, promition of labour-intensive, small-scale and large-scale enterprises, and industrial production linked to basic needs. In 1991 the KfW gave financial support to the following projects: transformer plant and Suralaya, railway investment programme, electricity transmission system Krian-Paiton, supply of 3 ferries, staff development fund III. (BWI)
Energy Technology Data Exchange (ETDEWEB)
Glaeser, B [ed.
1989-01-01
Can human ecology contribute towards originating a preventive environmental policy. Following a discussion of the demands of preventive environmental policy between theory and practice, the book presents the scientific approach 'human ecology' from a social-scientific angle. Then the question of the foundation in environmentally-related ethics is dealt with. The application and realizability of human-ecological considerations are tested with reference to different sectors of politics, and positive and negative indications of the chances of realization of a preventive environmental policy are discussed. (orig.).
Organic sponges for cost-effective CVOC abatement. Final report, September 1992--April 1994
International Nuclear Information System (INIS)
Flanagan, W.P.; Grade, M.M.; Horney, D.P.; Mackenzie, P.D.; Salvo, J.J.; Sivavec, T.M.; Stephens, M.L.
1994-07-01
Air contaminated with CVOCs (chlorinated volatile organic compounds) arise from air stripping of ground water or from soil and dual phase vapor extraction. A research program was undertaken to develop sorbents better than activated carbon for remediation. Two such sorbents were found: Dow's XUS polymer and Rohm and Haas' Ambersorb 563 (carbonaceous). Opportunities exist to further develop sorption and biodegradation technologies
40 CFR 141.623 - Reduced monitoring.
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Reduced monitoring. 141.623 Section....623 Reduced monitoring. (a) You may reduce monitoring to the level specified in the table in this paragraph (a) any time the LRAA is ≤0.040 mg/L for TTHM and ≤0.030 mg/L for HAA5 at all monitoring locations...
Organic sponges for cost-effective CVOC abatement. Final report, September 1992--April 1994
Energy Technology Data Exchange (ETDEWEB)
Flanagan, W.P.; Grade, M.M.; Horney, D.P.; Mackenzie, P.D.; Salvo, J.J.; Sivavec, T.M.; Stephens, M.L.
1994-07-01
Air contaminated with CVOCs (chlorinated volatile organic compounds) arise from air stripping of ground water or from soil and dual phase vapor extraction. A research program was undertaken to develop sorbents better than activated carbon for remediation. Two such sorbents were found: Dow`s XUS polymer and Rohm and Haas` Ambersorb 563 (carbonaceous). Opportunities exist to further develop sorption and biodegradation technologies.
Plesiophysa guadeloupensis ("Fischer" Mazé, 1883
Directory of Open Access Journals (Sweden)
W Lobato Paraense
2003-06-01
Full Text Available A description is presented of the shell and anatomic characters of the planorbid mollusk Plesiophysa guadeloupensis ("Fischer" Mazé, 1883, based on topotypic specimens from a pond in Borricaud (Grande Terre, Guadeloupe. Comparison with previous descriptions of nominal species of Plesiophysa points to its identity with P. ornata (Haas, 1938, of which it is a senior synonym.
International Nuclear Information System (INIS)
Nakamura, Ai; Takeuchi, Tetsuya; Tatetsu, Yasutomi; Maehira, Takahiro; Hedo, Masato; Nakama, Takao; Ōnuki, Yoshichika; Harima, Hisatomo
2015-01-01
The electronic states in EuBi 3 and EuPd 3 are known to be Eu-divalent and Eu- trivalent, respectively, from the previous studies using polycrystal samples. In the present study, we succeeded in growing high-quality single crystals, and carried out the de Haas-van Alphen (dHvA) measurements and energy band calculations to clarify the Fermi surface properties
Comparison between different bio-treatments of a hydrocarbon ...
African Journals Online (AJOL)
Ramya
2011-10-31
Oct 31, 2011 ... As cost is a critical issue, it is also important to determine ... studies. A modified minimal salts nutrient solution based on. Bushnell Haas medium ... used was an Alltech EC-5 (30 m × 0.25 mm with 0.25 µm film thickness), with helium ... Fungal ITS genes were amplified using a nested PCR approach. The first ...
Uniaxial Pressure Effect on the SdH Oscillations in Heavy-Fermion Semimetal CeRu4Sb12
International Nuclear Information System (INIS)
Saha, S. R.; Kobayashi, M.; Sugawara, H.; Namiki, T.; Abe, K.; Aoki, Y.; Sato, H.
2003-01-01
We report the first successful Shubnikov-de Haas (SdH) experiment under uniaxial pressure in the anomalous heavy-fermion semimetal CeRu 4 Sb 12 . The nature of the quantum oscillations in the magnetoresistance is found to be significantly sensitive to uniaxial pressure. The results reveal that the nearly spherical Fermi surface elongates along the direction of the uniaxial pressure. (author)
Construction schedule management of China Experimental Fast Reactor
International Nuclear Information System (INIS)
Wang Yue
2012-01-01
China Experimental Fast Reactor (CEFR) in the first Fast Reactor in China, which is one of large project of the National High Technology Research and Development Program ('863' Program). On 21 st July 2011, CEFR had succeeded to connect to power grid, the target of construction had come true. To a large item, schedule management is one of the most important management, this paper a overall discussion about CEFR item. It has proved that the management of CEFR project is scientific, normative and high-efficiency, it will be valuable for lager Fast Reactor item and designers in interrelated field. (author)
Study of resonant magnet exciting system for the 3 GeV proton synchrotron
Energy Technology Data Exchange (ETDEWEB)
Koseki, Shoichiro; Zhang, Fengqing; Watanabe, Yasuhiro; Tani, Norio [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Adachi, Toshikazu; Someya, Hirohiko [High Energy Accelerator Research Organization, Tsukuba, Ibaraki (Japan)
2001-07-01
Exciting system for magnets of the 3 GeV Proton synchrotron is under consideration. A resonant exciting system is studied, and two type of power supply are compared. One is a parallel supply that is used generally. Another is a modified series supply. Either of them uses IGBT sinusoidal converters. Capacity of the power converter of the series supply for bending magnets becomes 28.8 MVAp. This is lager more than twice compared with the parallel supply. In the other hand, the series supply has good control performance and flexibility. More study is necessary to decide finally. (author)
DEFF Research Database (Denmark)
Michelsen, Aage U.; Janus, Pagh
2002-01-01
Mass Customization er et produktionskoncept, der søger at kombinere masseproduktion og enkeltstyksproduktion på en sådan måde, at det er muligt at "masseproducere" kundespecifikke produkter. Postponement er i denne forbindelse et centralt begreb, idet det vedrører placeringen af dekoblingspunktet...... ("customer order decoupling point"), dvs. placeringen af det lager, hvorfra efterfølgende produktion og distribution er styret af kundespecifikke produkter. I artiklen fokuseres på, at hvis produktion og distribution ikke opfattes som to sekventielle systemer, men som ét integreret system, så opstår der en...
Energy saving in the storage. Simply smart; Energiesparen im Lager. Einfach smart
Energy Technology Data Exchange (ETDEWEB)
Gutmann, Michael [SEW-Eurodrive GmbH und Co. KG, Bruchsal (Germany). Produktbereich Servo Drive Technology
2012-04-20
Smart-power package from SEW Euro Drive GmbH and Co. KG (Bruchsal, Federal Republic of Germany) saves time in the selection of components, installation and commissioning. These advantages also are used by Mlog-logistics GmbH (Neustadt, Federal Republic of Neustadt). At this, a package of integrated components - servo amplifier, servo motors, planetary gearboxes and control systems - is used in its shelf operating device M-Dynamic.
Arachidonic acid metabolism in fibroblasts derived from canine myocardium
International Nuclear Information System (INIS)
Weber, D.R.; Prescott, S.M.
1986-01-01
Canine fibroblasts from normal or healing infarcted myocardium were grown in culture. The cells were morphologically indistinguishable, but the doubling time of cells from healing myocardium was 39.6 +/- 3.5 hr whereas that of normals was 24 +/- 3.7 (n=5, p 3 H]arachidonate (AA) into phospholipids. Calcium ionophore A23187 (10 μM) caused release and metabolism of [ 3 H] AA. A23187 or AA (10μM) induced production of 6-keto PGF1α, PGE2, and a hydroxy metabolite of AA. RIA of 6-keto PGF1α showed that subconfluent cells from healing myocardium produced 1202 +/- 354 pg/mg protein whereas that of normals was 551 +/- 222 (n=7, p 3 H]AA released but did not metabolize [ 3 H]AA. In coincubations, fibroblasts incorporated myocyte-derived AA. Subsequent stimulation of the fibroblasts with A23187 induced the synthesis of 6-keto PGF1α, PGE2 and a hydroxy metabolite. The fibroblast content of healing myocardium was 35-1000 times that of normal tissue (n=7). Thus even a moderate change in AA metabolism, amplified by the AA released from deteriorating myocytes, may be a significant physiologic or pathologic event
Energy Technology Data Exchange (ETDEWEB)
Morrison, C., E-mail: c.morrison.2@warwick.ac.uk; Casteleiro, C.; Leadley, D. R.; Myronov, M. [Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom)
2016-09-05
The complex quantum transport of a strained Ge quantum well (QW) modulation doped heterostructure with two types of mobile carriers has been observed. The two dimensional hole gas (2DHG) in the Ge QW exhibits an exceptionally high mobility of 780 000 cm{sup 2}/Vs at temperatures below 10 K. Through analysis of Shubnikov de-Haas oscillations in the magnetoresistance of this 2DHG below 2 K, the hole effective mass is found to be 0.065 m{sub 0}. Anomalous conductance peaks are observed at higher fields which deviate from standard Shubnikov de-Haas and quantum Hall effect behaviour due to conduction via multiple carrier types. Despite this complex behaviour, analysis using a transport model with two conductive channels explains this behaviour and allows key physical parameters such as the carrier effective mass, transport, and quantum lifetimes and conductivity of the electrically active layers to be extracted. This finding is important for electronic device applications, since inclusion of highly doped interlayers which are electrically active, for enhancement of, for example, room temperature carrier mobility, does not prevent analysis of quantum transport in a QW.
Salmon, C P; Knize, M G; Felton, J S; Zhao, B; Seow, A
2006-04-01
Chicken and fish samples prepared by 42 Singapore Chinese in their homes were obtained. Researchers were present to collect data on raw sample weight, cooking time, maximum cooking surface temperature, and cooked sample weight. Each participant prepared one pan-fried fish sample and two pan-fried chicken samples, one marinated, one not marinated. The cooked samples were analyzed for five heterocyclic aromatic amine (HAA) mutagens, including MeIQx (2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline); 4,8-DiMeIQx (2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline); 7,8-DiMeIQx (2-amino-3,7,8-trimethylimidazo[4,5-f]quinoxaline); PhIP (2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine), and IFP (2-amino-(1,6-dimethylfuro[3,2-e]imidazo[4,5-b])pyridine). A paired Student's t-test showed that marinated chicken had lower concentrations of PhIP (pchicken, and also that weight loss due to cooking was less in marinated chicken than in non-marinated chicken (pchicken (pchicken (pchicken (pchicken (pchicken (p<0.05). This study provides new information on HAA content in the Singapore Chinese diet.
Tracing disinfection byproducts in full-scale desalination plants
Le Roux, Julien
2015-03-01
The aim of this study was to assess the formation and the behavior of halogenated byproducts (regulated THMs and HAAs, as well as nitrogenous, brominated and iodinated DBPs including the emerging iodo-THMs) along the treatment train of full-scale desalination plants. One thermal multi-stage flash distillation (MSF) plant and two reverse osmosis (RO) plants located on the Red Sea coast of Saudi Arabia. DBPs formed during the prechlorination step were efficiently removed along the treatment processes (MSF or RO). Desalination plants fed with good seawater quality and using intermittent chlorine injection did not show high DBP formation and discharge. One RO plant with a lower raw water quality and using continuous chlorination at the intake formed more DBPs. In this plant, some non-regulated DBPs (e.g., dibromoacetonitrile and iodo-THMs) reached the product water in low concentrations (< 1.5 μg/L). Regulated THMs and HAAs were far below their maximum contamination levels set by the US Environmental Protection Agency. Substantial amounts of DBPs are disposed to the sea; low concentrations of DBPs were indeed detected in the water on shore of the desalination plants.
Magnetic properties of anyonic systems in a normal phase
International Nuclear Information System (INIS)
Aronov, I.E.; Naftulin, S.A.
1992-08-01
We apply the concept of fractional statistics to the two-dimensional conductors. The effective Lagrangian of an external magnetic field in anyon medium at finite temperature and density is presented. The diamagnetic response to the external field is studied at temperatures above T c (i.e. in the normal phase) for various values of external parameters. Oscillations of both thermodynamic (the de Haas - van Alphen effect) and kinetic (the Shubnikov - de Haas effect) quantities are re-examined. Numerous peculiarities arise from the fact that anyon systems possess a non-zero ''statistical'' flux Φ (which is known to be a manifestation of the spontaneous parity breakdown). The cyclotron resonance is suggested as a direct test on possible parity violation (which is the key point of anyonics). The cyclotron mass dependences on external parameters reported in a series of experimental articles (H. Kublbeck and J.P. Kotthaus, Phys. Rev. Lett. 35, 1019 (1975); G. Abstreiter, J.P. Kotthaus, J.F. Koch and G. Dorda, Phys. Rev. B14, 2480 (1976)) may be attributed to an unusual behaviour or magnetic permeability in anyon medium. (author). 20 refs, 2 figs
Morrison, C.; Casteleiro, C.; Leadley, D. R.; Myronov, M.
2016-09-01
The complex quantum transport of a strained Ge quantum well (QW) modulation doped heterostructure with two types of mobile carriers has been observed. The two dimensional hole gas (2DHG) in the Ge QW exhibits an exceptionally high mobility of 780 000 cm2/Vs at temperatures below 10 K. Through analysis of Shubnikov de-Haas oscillations in the magnetoresistance of this 2DHG below 2 K, the hole effective mass is found to be 0.065 m0. Anomalous conductance peaks are observed at higher fields which deviate from standard Shubnikov de-Haas and quantum Hall effect behaviour due to conduction via multiple carrier types. Despite this complex behaviour, analysis using a transport model with two conductive channels explains this behaviour and allows key physical parameters such as the carrier effective mass, transport, and quantum lifetimes and conductivity of the electrically active layers to be extracted. This finding is important for electronic device applications, since inclusion of highly doped interlayers which are electrically active, for enhancement of, for example, room temperature carrier mobility, does not prevent analysis of quantum transport in a QW.
Advanced methods of fatigue assessment
Radaj, Dieter
2013-01-01
The book in hand presents advanced methods of brittle fracture and fatigue assessment. The Neuber concept of fictitious notch rounding is enhanced with regard to theory and application. The stress intensity factor concept for cracks is extended to pointed and rounded corner notches as well as to locally elastic-plastic material behaviour. The averaged strain energy density within a circular sector volume around the notch tip is shown to be suitable for strength-assessments. Finally, the various implications of cyclic plasticity on fatigue crack growth are explained with emphasis being laid on the DJ-integral approach. This book continues the expositions of the authors’ well known reference work in German language ‘Ermüdungsfestigkeit – Grundlagen für Ingenieure’ (Fatigue strength – fundamentals for engineers).
Satellitenbewegung, band III: Natiirliche und gesteuerte bewegung.
Jochim, E. F.
2014-12-01
Im dritten Band der Satellitenbewegung werden in fortlaufender Nummerierung einige für Untersuchungen der Bewegung der künstlichen Satelliten wichtige Grundlagen der Astrodynamik mit ausführlichen mathematischen Formelsystemen behandelt. Dazu zählen die unterschiedlichen Aspekte der Bewegung der natürlichen Himmelskörper, die Steuerung und Kontrolle von künstlichen Objekten, und insbesondere die für eine Satellitenbahnanalyse wichtigen physikalischen Beeinflussungen einer Satellitenbewegung. Mathematisch entscheidend ist die Wahl geeigneter Bahnparameter, die ein bestimmtes Bewegungsproblem widerspruchsfrei und singularitätenfrei zu behandeln gestatten. Für die Behandlung routinemäßiger Aufgabenstellungen der Satellitenbewegung, in erster Linie einer präzisen Bahnbestimmung und Bahnverbesserung, kann auf eine Fülle von lehrbuchartigen Monographien verwiesen werden, so dass diese Problematik in der vorliegenden Arbeit nur angedeutet werden soll.
Energy Technology Data Exchange (ETDEWEB)
Heimann, B.; Popp, K. [Hannover Univ. (Germany). Inst. fuer Mechanik; Gerth, W. [Hannover Univ. (Germany). Inst. fuer Regelungstechnik
2001-07-01
Mechatronics combines the main disciplines electrical- and mechanical engineering and informatics. Its increasing importance occurs in all kind of on-line control systems, process control, sensor guided robots, magnetic bearings, automobile engineering etc. This book addresses students in all this fields. The main topics are: actuators, sensors, signal processing, data processing, simulation of multibody systems, planning of trajectories, control of mechatronic systems and as an attachment mathematical fundamentals.(GL) [German] Die Mechatronik vereinigt die Hauptfachgebiete Elektrotechnik, Maschinenbau und Informatik. Ihre wachsende Bedeutung findet sich wieder in der gesamten Leittechnik, Verfahrenstechnik, sensorgefuehrte Roboter, Magnetlager, Fahrzeugtechnik usw. Dieses Buch spricht Studenten in all diesen Fachgebieten an. Inhaltliche Hauptkapitel sind: Aktoren, Sensoren, Signalverarbeitung, Prozessdatenverarbeitung, Modellbildung von Mehrkoerpersystemen, Trajektorplanung, Regelung mechatronischer Systeme mit ausfuehrlichen Beispielen und schliesslich ein Anhang mit mathematischen Grundlagen.(GL)
Partial Least Squares Strukturgleichungsmodellierung (PLS-SEM)
DEFF Research Database (Denmark)
Hair, Joseph F.; Hult, G. Tomas M.; Ringle, Christian M.
(PLS-SEM) hat sich in der wirtschafts- und sozialwissenschaftlichen Forschung als geeignetes Verfahren zur Schätzung von Kausalmodellen behauptet. Dank der Anwenderfreundlichkeit des Verfahrens und der vorhandenen Software ist es inzwischen auch in der Praxis etabliert. Dieses Buch liefert eine...... anwendungsorientierte Einführung in die PLS-SEM. Der Fokus liegt auf den Grundlagen des Verfahrens und deren praktischer Umsetzung mit Hilfe der SmartPLS-Software. Das Konzept des Buches setzt dabei auf einfache Erläuterungen statistischer Ansätze und die anschauliche Darstellung zahlreicher Anwendungsbeispiele anhand...... einer einheitlichen Fallstudie. Viele Grafiken, Tabellen und Illustrationen erleichtern das Verständnis der PLS-SEM. Zudem werden dem Leser herunterladbare Datensätze, Aufgaben und weitere Fachartikel zur Vertiefung angeboten. Damit eignet sich das Buch hervorragend für Studierende, Forscher und...