WorldWideScience

Sample records for gus operon fusions

  1. Identifying Growth Conditions for Nicotiana benthimiana Resulting in Predictable Gene Expression of Promoter-Gus Fusion

    Science.gov (United States)

    Sandoval, V.; Barton, K.; Longhurst, A.

    2012-12-01

    Revoluta (Rev) is a transcription factor that establishes leaf polarity inArabidopsis thaliana. Through previous work in Dr. Barton's Lab, it is known that Revoluta binds to the ZPR3 promoter, thus activating the ZPR3 gene product inArabidopsis thaliana. Using this knowledge, two separate DNA constructs were made, one carrying revgene and in the other, the ZPR3 promoter fussed with the GUS gene. When inoculated in Nicotiana benthimiana (tobacco), the pMDC32 plasmid produces the Rev protein. Rev binds to the ZPR3 promoter thereby activating the transcription of the GUS gene, which can only be expressed in the presence of Rev. When GUS protein comes in contact with X-Gluc it produce the blue stain seen (See Figure 1). In the past, variability has been seen of GUS expression on tobacco therefore we hypothesized that changing the growing conditions and leaf age might improve how well it's expressed.

  2. Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

    Science.gov (United States)

    Blume, B; Grierson, D

    1997-10-01

    The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

  3. DESY: Gus Voss retires

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    As mentioned briefly in the previous issue (page 28), last year Gus Voss reached the age of 65 and therefore was released from official duties at DESY from the beginning of this year. However, as a senior scientist, he keeps an office at DESY and will continue his work in all the international committees of which he is a member, as well as giving colleagues and friends around the world the benefit of his advice - ''if requested'', as he likes to phrase it. Gus Voss was leader of DESY's Accelerator Division and as such a Laboratory Director for exactly 22 years. He contributed to planning the first electron synchrotron at DESY back in 1958-9. Then he went to CEA (Cambridge, Massachusetts), where he directed with Ken Robinson the famous bypass electron-positron collider project. He is also well known for his important contributions to accelerator technology, like low beta insertion for storage rings, which he made (again with Ken Robinson) in 1966. In January 1973 he returned to DESY, called by Wolfgang Paul, then chairman of the Board of Directors. He arrived in time to commission and inaugurate the DORIS electronpositron storage ring in 1974 and then directed the design and construction of the bigger PETRA ring, which began operation in 1978. Together with Bjorn Wiik he directed construction of the HERA electronproton collider, in operation since 1992. During the last few years he took strong interest in linear colliders, together with Norbert Holtkamp building a 400 MeV test section to develop new linear collider technology. Voss' position at DESY is taken over by Dieter Trines (52) who contributed to the construction and commissioning of PETRA from 1975. Dieter Trines spent two years in the TASSO Group at PETRA and in 1983 joined the HERA effort as head of the Proton Ring Vacuum Group

  4. Autogenous regulation and kinetics of induction of Pseudomonas aeruginosa recA transcription as analyzed with operon fusions

    International Nuclear Information System (INIS)

    Horn, J.M.; Ohman, D.E.

    1988-01-01

    A promoterless chloramphenicol acetyltransferase gene (cat) was used to construct recA-cat operon fusions to quantitatively examine the transcriptional regulation of the Pseudomonas aeruginosa recA gene in P. aeruginosa PAO. Wild-type P. aeruginosa containing the recA8-cat fusion was treated with methyl methanesulfonate (MMS) and showed immediate induction of chloramphenicol acetyltransferase (CAT) specific activity, whereas a recA::Tn501 mutant of P. aeruginosa containing recA8-cat showed no induction with MMS. This indicated that a functional copy of recA was required for derepression of recA transcription and that P. aeruginosa recA protein was a positive regulatory factor promoting its own expression. Compared with that in the wild type, the uninduced level of CAT in recA8-cat-containing cells was reduced by approximately one-half in the recA::Tn501 mutant, indicating that recA+-dependent spontaneous induction contributes to the uninduced levels of recA expression in P. aeruginosa. MMS (0.012%) caused recA-directed CAT synthesis to increase almost immediately, with maximum CAT activity, fourfold higher than uninduced levels, attained at 60 min postinduction. The kinetics of recA8-cat fusion activity were shown to be directly related to the MMS doses used. Another fusion called recAa1-cat, where cat was located between the two transcriptional terminators of the P. aeruginosa recA gene, also showed dose-dependent induction by MMS, but the CAT activity from recAa1-cat was only one-half of that obtained with recA8-cat under the same conditions. Treatment of recA+ P. aeruginosa containing recA8-cat with UV irradiation produced an immediate effect on recA8-cat transcription and showed little UV dose dependency at doses of 5 J/m2 or greater

  5. Using fusions with luxAB from Vibrio harveyi MAV to quantify induction and catabolite repression of the xyl operon in Staphylococcus carnosus TM300.

    Science.gov (United States)

    Sizemore, C; Geissdörfer, W; Hillen, W

    1993-03-01

    The luxA,B genes from the Gram-negative marine bacterium Vibrio harveyi MAV were used in Staphylococcus carnosus TM300 as a reporter system for regulated expression of xylose utilization. The luciferase genes were fused to the xyl operon from Staphylococcus xylosus C2a. Expression of bioluminescence was induced through addition of xylose and repressed in the presence of glucose. A method to quantitate bioluminescence directly from the culture is described.

  6. A maize spermine synthase 1 PEST sequence fused to the GUS reporter protein facilitates proteolytic degradation.

    Science.gov (United States)

    Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco

    2014-05-01

    Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  7. Toward the development of an efficient transposon marker system for soil bacteria based on the gusA gene

    International Nuclear Information System (INIS)

    Corbo, Joseph C.

    1991-01-01

    On account of the numerous drawbacks of presently existing marker gene systems, we have decided to concentrate on the use of the gusA gene as a marker, since it avoids many of the problems encountered by these other systems. Before I discuss the goals of my work, I would like briefly to describe the beta-gtucuronidase enzyme, its structural gene gusA, and their normal function in E. coli. The gusA gene was originally isolated from E. coli, one of the major constituents of the microflora of the mammalian gastrointestinal tract. In its native host it forms an operon with two other genes, gusB and gusC, and is involved in the uptake and degradation of glucuronidated compounds. Since glucuronidation (the covalent attachment of a glucuronide group) is the principal means of detoxification of xenobiotic compounds in human beings, it is reasonable enough that E. co//should have evolved such an enzyme. By selectively taking up the glucuronated compounds which it encounters in the gut, E. co//acquires a food source, glucuronic acid, which it obtains by hydrolyzing the glucuronide from its aglycone by means of the beta-glucuronidase enzyme. When we assay beta-glucuronidase activity we employ a colorless substrate known as X-gluc which has the chemical formula 5-bromo-4-chloro-3-indolyl beta-D-glucuronide. Upon removal of the glucuronide group the aglycone quickly dimerizes via oxidation to produce an insoluble, deep blue precipitate, which is readily identifiable as the hallmark sign of beta-glucuronidase activity. In this work it was tried to accomplish two related goals: the first goal was to build a marker gene construct using the gusA gene that would meet the requirements for a marker system that I have outlined above; the second goal was to find the best possible marker delivery system that would allow maximal ease of transfer of the marker gene from a host strain to the soil bacterium which is to be marked

  8. Properties of in situ Escherichia coli -D-glucuronidase (GUS ...

    African Journals Online (AJOL)

    A study of the activity of Escherichia coli -D-glucuronidase (GUS) in polluted stagnant and running water samples was performed with an objective of assessing the viability of a direct marker enzyme assay as a suitable alternative to membrane filtration for the indication of faecal pollution in water intended for drinking ...

  9. Transient expression of exogenous gus gene in Porphyra yezoensis (Rhodophyta)

    Science.gov (United States)

    Kuang, Mei; Wang, Su-Juan; Li, Yao; Shen, Da-Leng; Zeng, Cheng-Kui

    1998-03-01

    Electroporation, PEC, PEG plus electroporation and Biolistics methods were tested in gene transformation of P. yezoensis. The exogenous gus was from plasmid of pBI121 and pCAMBIA1301, both contain the CaMV35S promoter. The receptors included the protoplasts, tissues and free-living conchocelis filaments of P. yezoensis. Several factors, for example, the voltage, capacitance and bivalent cations, etc., were studied. Results show that these four methods are all efficient for gene transformation in P. yezoensis; and that PEG is the best one, with transformation efficiency of up to 4×10-5. GUS activity was detected 26 days after transformation by using PEG method.

  10. Analysis of AtGUS1 and AtGUS2 in Arabidopsis root apex by a highly sensitive TSA-MISH method.

    Science.gov (United States)

    Bruno, Leonardo; Ronchini, Matteo; Gagliardi, Olimpia; Corinti, Tamara; Chiappetta, Adriana; Gerola, Paolo; Bitonti, Maria B

    2015-01-01

    A new highly sensitive whole-mount in situ hybridization method, based on tyramide signal amplification (TSA-MISH) was developed and a combined GFP detection and TSA-MISH procedure was applied for the first time in plants, to precisely define the spatial pattern of AtGUS1 and AtGUS2 expression in the root apex. β-glucuronidases (GUSs) belonging to the glycosyl hydrolases (GHs) 79 family, are widely distributed in plants, but their functional role has not yet been fully investigated. In the model system Arabidopsis Thaliana, three different AtGUS genes have been identified which encode proteins with putative different fates. Endogenous GUS expression has been detected in different organs and tissues, but the cyto-histological domains of gene expression remain unclear. The results here reported show co-expression of AtGUS1 and AtGUS2 in different functional zones of the root apex (the cap central zone, the root cap meristem, the staminal cell niche and the cortical cell layers of the proximal meristem), while AtGUS2 is exclusively expressed in the cap peripheral layer and in the epidermis in the elongation zone. Interestingly, both genes are not expressed in the stelar portion of the proximal meristem. A spatial (cortex vs. stele) and temporal (proximal meristem vs. transition zone) regulation of AtGUS1 and AtGUS2 expression is therefore active in the root apex. This expression pattern, although globally consistent with the involvement of GUS activity in both cell proliferation and elongation, clearly indicates that AtGUS1 and AtGUS2 could control distinct downstream process depending on the developmental context and the interaction with other players of root growth control. In the future, the newly developed approaches may well be very useful to dissect such interactions.

  11. Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

    Science.gov (United States)

    Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

    2015-10-23

    The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

  12. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  13. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

    OpenAIRE

    Chung, T; Resnik, E; Stueland, C; LaPorte, D C

    1993-01-01

    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  14. Evidence against the selfish operon theory.

    Science.gov (United States)

    Pál, Csaba; Hurst, Laurence D

    2004-06-01

    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  15. Fusion

    CERN Document Server

    Mahaffey, James A

    2012-01-01

    As energy problems of the world grow, work toward fusion power continues at a greater pace than ever before. The topic of fusion is one that is often met with the most recognition and interest in the nuclear power arena. Written in clear and jargon-free prose, Fusion explores the big bang of creation to the blackout death of worn-out stars. A brief history of fusion research, beginning with the first tentative theories in the early 20th century, is also discussed, as well as the race for fusion power. This brand-new, full-color resource examines the various programs currently being funded or p

  16. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  17. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  18. The relative value of operon predictions

    NARCIS (Netherlands)

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  19. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    International Nuclear Information System (INIS)

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

    1994-01-01

    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  20. Transient GUS gene expression in cassava (Manihot esculenta Crantz using Agrobacterium tumefaciens leaf infiltration

    Directory of Open Access Journals (Sweden)

    Paula Díaz T.

    2014-09-01

    Full Text Available Objective. Assess transient gene expression of GUS in cassava (Manihot esculenta Crantz leaves using Agrobacterium tumefaciens infiltration. Materials and methods. A. tumefaciens strains GV3101 and AGL1 containing pCAMBIA1305.2 were used to evaluate transient gene expression of β-glucuronidase (GUS. A. tumefaciens infiltration (agroinfiltration was made using both leaves from in vitro and 1 month old greenhouse plants. Leaves were incubated in X-GLUC buffer, stained and photographed to detect GUS activity. Results. Agroinfiltration assays showed GUS transient expression in leaves of cassava varieties widely cultivated in the north coast and eastern savannah, MCOL2215 (Venezuelan and CM6438-14 (Vergara, respectively. A. tumefaciens agressive strain AGL1 showed high efficiency inducing GUS expression in cassava leaves. Conclusions. We recommend using A. tumefaciens agressive strain AGL1 for agroinfiltration to assess transient expression in cassava leaves.

  1. Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

    2003-09-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  2. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

    2003-01-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  3. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  4. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  5. PEMIKIRAN GUS DUR TENTANG PENDIDIKAN KARAKTER DAN KEARIFAN LOKAL

    Directory of Open Access Journals (Sweden)

    LukLuk Nur Mufidah

    2015-08-01

    Full Text Available Abstract: Education which emphasized on cognition domain should be changed by balancing it with skills (psychomotor and attitudes (affective. It is intended that education is able to produce savvy generations who have high moral standards. To that end, KH Abdurrahman Wahid -or better known as Gus Dur- had a concept of character building in education by promoting morality in education. Character building in education is the education which is based on local wisdom. Local wisdom is social norms and values contained in tradition and customs as well as in Islamic teachings that govern how a balance should be established between carrying capacity of the natural environment, lifestyle, and the needs of human beings. In the language of Gus Dur, local wisdom was called the indigenization of Islam in which the teachings of Islam and local traditions were used as a moral basis in the real life of people. Because the cultivation of moral values could be done through education, the local wisdom should be the basic concept of education process. Customs become an integral part in daily life, while religion becomes a way of life to conform to the guidance of Allah. Local wisdom formed from local traditions and locality of religious teachings was able to provide life lessons that were useful for the development process of maturity through the educational process.           الملخص: إن التربية المفضّلة الجانب المعرفي – كما يقع الآن -  لابد من تركها، ويكون البديل هو الموازنة بين الجانب المعرفي والجانب النفسحركي والمهني. والهدف من هذا تخريج الطلاب أو الأجيال الأذكياء المتأدّبين المتخلّقين. وفي هذا كان لكياهي الحاج عبد الرحمن وحيد المعروف بغوسدور فكرة عن التربية الخلقية وهي التربية التي

  6. Development of GUS for control applications at the Advanced Photon Source

    International Nuclear Information System (INIS)

    Chung, Y.; Barr, D.; Borland, M.; Kirchman, J.; Decker, G.; Kim, K.

    1994-01-01

    A script-based interpretive shell GUS (General Purpose Data Acquisition for Unix Shell) has been developed for application to the Advanced Photon Source (APS) control. The primary design objective of GUS is to provide a mechanism for efficient data flow among modularized objects called Data Access Modules (DAMs). GUS consists of four major components: user interface, kernel, built-in command module, and DAMS. It also incorporates the Unix shell to make use of the existing utility programs for file manipulation and data analysis. At this time, DAMs have been written for device access through EPICS (Experimental Physics and Industrial Control System), data I/O for SDDS (Self-Describing Data Set) files, matrix manipulation, graphics display, digital signal processing, and beam position feedback system control. The modular and object-oriented construction of GUS will facilitate addition of more DAMs with other functions in the future

  7. REMap: Operon Map of M. tuberculosis

    Science.gov (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  8. Impact of ubiquitous inhibitors on the GUS gene reporter system: evidence from the model plants Arabidopsis, tobacco and rice and correction methods for quantitative assays of transgenic and endogenous GUS

    Directory of Open Access Journals (Sweden)

    Gerola Paolo D

    2009-12-01

    Full Text Available Abstract Background The β-glucuronidase (GUS gene reporter system is one of the most effective and employed techniques in the study of gene regulation in plant molecular biology. Improving protocols for GUS assays have rendered the original method described by Jefferson amenable to various requirements and conditions, but the serious limitation caused by inhibitors of the enzyme activity in plant tissues has thus far been underestimated. Results We report that inhibitors of GUS activity are ubiquitous in organ tissues of Arabidopsis, tobacco and rice, and significantly bias quantitative assessment of GUS activity in plant transformation experiments. Combined with previous literature reports on non-model species, our findings suggest that inhibitors may be common components of plant cells, with variable affinity towards the E. coli enzyme. The reduced inhibitory capacity towards the plant endogenous GUS discredits the hypothesis of a regulatory role of these compounds in plant cells, and their effect on the bacterial enzyme is better interpreted as a side effect due to their interaction with GUS during the assay. This is likely to have a bearing also on histochemical analyses, leading to inaccurate evaluations of GUS expression. Conclusions In order to achieve reliable results, inhibitor activity should be routinely tested during quantitative GUS assays. Two separate methods to correct the measured activity of the transgenic and endogenous GUS are presented.

  9. Truncated presequences of mitochondrial F1-ATPase beta subunit from Nicotiana plumbaginifolia transport CAT and GUS proteins into mitochondria of transgenic tobacco.

    Science.gov (United States)

    Chaumont, F; Silva Filho, M de C; Thomas, D; Leterme, S; Boutry, M

    1994-02-01

    The mitochondrial F1-ATPase beta subunit (ATPase-beta) of Nicotiana plumbaginifolia is nucleus-encoded as a precursor containing an NH2-terminal extension. By sequencing the mature N. tabacum ATPase-beta, we determined the length of the presequence, viz. 54 residues. To define the essential regions of this presequence, we produced a series of 3' deletions in the sequence coding for the 90 NH2-terminal residues of ATPase-beta. The truncated sequences were fused with the chloramphenicol acetyl transferase (cat) and beta-glucuronidase (gus) genes and introduced into tobacco plants. From the observed distribution of CAT and GUS activity in the plant cells, we conclude that the first 23 amino-acid residues of ATPase-beta remain capable of specifically targeting reporter proteins into mitochondria. Immunodetection in transgenic plants and in vitro import experiments with various CAT fusion proteins show that the precursors are processed at the expected cleavage site but also at a cryptic site located in the linker region between the presequence and the first methionine of native CAT.

  10. Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Atlung, Tove

    1996-01-01

    The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

  11. NARINGENIN ENHANCED EFFICIENCY OF GUS ACTIVITY IN Passiflora mollissima (H.B.K. Bailey

    Directory of Open Access Journals (Sweden)

    G.O. Cancino

    2004-06-01

    Full Text Available The flavonoid naringenin has been investigated as a possible vir gene inducer in Agrobacterium-mediated transformation in Passiflora mollissima, P. giberti and Nicotiana tabacum cv. Xanthi. The transformation efficiency percentage of explants showing blue GUS expression and the extent of staining following inoculation with Agrobacterium tumefaciens strains EHA 105 and 1065, carrying gus and nptII genes was enhanced with the supplementation of the co-cultivation medium with naringenin. Supplementation of medium with 100µM (strain EHA 105 and 300 µM (strain 1065 naringenin was most effective at enhancing mean (±s.e.m., n=3 GUS activity in leaf explants (20.3 ± 2.4%, strain EHA; 105; 6.0 ± 0.57%, strain 1065 and nodal segments (16.7 ± 2.4% strain EHA 105; 8.3 ± 0.57% strain 1065 of P. mollissima. In P. giberti and N. tabacum maximum GUS activity was obtained in leaf and root explants with 100µM naringenin for both strains analysed. Additionally, when naringenin was added to Luria Bertani (LB medium, both bacterial growth via optical density and colony forming units were higher when compared to control. This is the first report of the use of naringenin to enhance gene transfer from Agrobacterium to plants. These findings suggest that naringenin can be used as an alternative to acetosyringone for vir gene induction in Agrobacterium. This approach may be especially useful in plants that are generally recalcitrant to Agrobacterium-mediatedtransformation.

  12. Mas Gusó: a Roman military Settlement in the suburbium of Emporiae

    Directory of Open Access Journals (Sweden)

    Josep Casas Genover

    2016-11-01

    Full Text Available Although the site of Mas Gusó (province of Girona has been interpreted as a Roman uilla, this is actually a public building. Its existence have to be contextualized within the frame of the structures established by the Roman authority for territorial control closely linked to the creation of a new road network and a tax collection system. We also analyse its survival until the 3rd century AD, which are closely related to the nearby city of Emporiae.

  13. Characterization of inhibitor(s) of β-glucuronidase enzyme activity in GUS-transgenic wheat

    KAUST Repository

    Ramadan, Ahmed M Ali; Eissa, Hala F.; El-Domyati, Fotouh M.; Saleh, Osama Mesilhy; Ibrahim, Nasser E.; Salama, M. I.; Mahfouz, Magdy M.; Bahieldin, Ahmed M.

    2011-01-01

    The uidA gene, encoding for β-glucuronidase (GUS), is the most frequently used reporter gene in plants. As a reporter enzyme, GUS can be assayed both qualitatively and quantitatively. In wheat, there are numerous reports of failure in detecting GUS enzyme activity in tissues of transgenic plants, while other reports have suggested presence of β-glucuronidase inhibitor(s) in wheat tissues. In the present study, we show that the β-glucuronidase enzyme activity is not only tissue-specific but also genotype-dependent. Our data demonstrate that the glucuronic acid could be the candidate inhibitor for β-glucuronidase enzyme activity in wheat leaves and roots. It should be noted that the assays to detect β-glucuronidase enzyme activity in wheat should be interpreted carefully. Based on the data of our present study, we recommend studying the chemical pathways, the unintended effects and the possible loss-of-function of any candidate transgene prior to transformation experiments. © 2011 Springer Science+Business Media B.V.

  14. Characterization of inhibitor(s) of β-glucuronidase enzyme activity in GUS-transgenic wheat

    KAUST Repository

    Ramadan, Ahmed M Ali

    2011-06-26

    The uidA gene, encoding for β-glucuronidase (GUS), is the most frequently used reporter gene in plants. As a reporter enzyme, GUS can be assayed both qualitatively and quantitatively. In wheat, there are numerous reports of failure in detecting GUS enzyme activity in tissues of transgenic plants, while other reports have suggested presence of β-glucuronidase inhibitor(s) in wheat tissues. In the present study, we show that the β-glucuronidase enzyme activity is not only tissue-specific but also genotype-dependent. Our data demonstrate that the glucuronic acid could be the candidate inhibitor for β-glucuronidase enzyme activity in wheat leaves and roots. It should be noted that the assays to detect β-glucuronidase enzyme activity in wheat should be interpreted carefully. Based on the data of our present study, we recommend studying the chemical pathways, the unintended effects and the possible loss-of-function of any candidate transgene prior to transformation experiments. © 2011 Springer Science+Business Media B.V.

  15. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  16. Stochastic simulations of the tetracycline operon

    Science.gov (United States)

    2011-01-01

    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  17. glucuronidase (GUS)

    African Journals Online (AJOL)

    user

    2011-01-24

    Jan 24, 2011 ... Department of Horticulture, College of Agronomy and Biological Technology, China Agricultural ..... tions were the disadvantages of using visual evaluation ... ImageMasterTM 2D Platinum (GE Healthcare) was used to.

  18. GUS gene expression driven by a citrus promoter in transgenic tobacco and 'Valencia' sweet orange Expressão do gene GUS controlado por promotor de citros em plantas transgênicas de tabaco e laranja 'Valência'

    Directory of Open Access Journals (Sweden)

    Fernando Alves de Azevedo

    2006-11-01

    Full Text Available The objective of this work was the transformation of tobacco and 'Valencia' sweet orange with the GUS gene driven by the citrus phenylalanine ammonia-lyase (PAL gene promoter (CsPP. Transformation was accomplished by co-cultivation of tobacco and 'Valência' sweet orange explants with Agrobacterium tumefaciens containing the binary vector CsPP-GUS/2201. After plant transformation and regeneration, histochemical analyses using GUS staining revealed that CsPP promoter preferentially, but not exclusively, conferred gene expression in xylem tissues of tobacco. Weaker GUS staining was also detected throughout the petiole region in tobacco and citrus CsPP transgenic plants.O objetivo deste trabalho foi realizar a transformação de plantas de tabaco e laranja 'Valência' com o gene GUS controlado pelo promotor do gene da fenilalanina amônia-liase (PAL de citros (CsPP. Foi realizada transformação genética por meio do co-cultivo de explantes de tabaco e laranja 'Valência' com Agrobacterium tumefaciens que continha o vetor binário CsPP-GUS/2201. Após a transformação e a regeneração, a detecção da atividade de GUS por ensaios histoquímicos revelou que o promotor CsPP, preferencialmente, mas não exclusivamente, confere expressão gênica em tecidos do xilema de tabaco. Expressão mais baixa de GUS também foi detectada na região de tecido de pecíolo, em plantas transgênicas (CsPP de tabaco e laranja 'Valência'.

  19. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Directory of Open Access Journals (Sweden)

    Qinna Cui

    Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  20. Teaching the Big Ideas of Biology with Operon Models

    Science.gov (United States)

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  1. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Sun Yuan

    2006-02-01

    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  2. Quantitative transient GUS expression in J-104 rice calli through manipulation of in vitro culture conditions.

    Directory of Open Access Journals (Sweden)

    Maylin Pérez Bernal

    2009-10-01

    This paper purposes suitable conditions for callus induction and co-cultivation with Agrobacterium tumefaciens of J-104 rice cultivar. It was evaluated the effect of different concentrations of 2.4-D and agar, and the inclusion of L-proline and L-glutamine in callus culture medium. The use of 2.5 mg/L 2.4-D and 0.8% agar allowed the highest percentage of embryogenic calli. Callus formation was improved considerably with 500 mg/L of L-proline and L-glutamine in the culture medium. Different factors were studied throughout co-cultivation of calli with A. tumefaciens: inoculation time, co-cultivation temperature, concentration of acetosyringone and co-cultivation period. Transient GUS expression was quantified by fluorometry in all co-cultivated calli. The best results were obtained with the following conditions: 10 min as inoculation time, 100µM acetosyringone in co-cultivation medium, temperature of 20ºC, and 3 days as co-cultivation period. Key words: Agar; callus; co-cultivation; fluorometric GUS activity. Resumen Se describen las condiciones óptimas para la callogénesis y cocultivo de callos con Agrobacterium tume-faciens de la variedad de arroz J-104. Se determinó el efecto de diferentes concentraciones de 2.4-D, agar y de L-prolina y L-glutamina en el medio de cultivo de callos. El uso de 2,5 mg/L de 2.4-D y 0,8% de agar permitió lograr el porcentaje más alto de callos embriogénicos. La formación de callos fue mejorada considerablemente con la adición de 500 mg/L de L-prolina e igual concentración de L-glutamina en el medio de cultivo. Se estudiaron diferentes factores en el cocultivo de los callos con A. tumefaciens: tiempo de inoculación, concentración de acetosiringona, temperatura y tiempo de cocultivo. Para comparar el efecto de cada factor sobre la expresión GUS se cuantificó la actividad transitoria mediante fluorimetría. Los valores más altos de actividad fluorimétrica fueron obtenidos con las siguientes condiciones: 10 min de

  3. Transcriptome dynamics-based operon prediction in prokaryotes.

    Science.gov (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  4. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  5. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  6. A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

    Directory of Open Access Journals (Sweden)

    Enrico eMuhr

    2016-01-01

    Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

  7. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

    Science.gov (United States)

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2015-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  8. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  9. EXPRESIÓN GUS EN EXPLANTES DE Solanum phureja (Juz. et. Buk Var. Criolla Colombia, TRANSFORMADOS CON Agrobacterium tumefaciens

    Directory of Open Access Journals (Sweden)

    IVÁN DARÍO BARRERO-FARFÁN

    2008-01-01

    Full Text Available La expresión transitoria y estable del gen gusA-intron en explantes internodales de papa criolla variedad Criolla Colombia cocultivados con Agrobacterium tumefaciens es reportada. Con el fin de determinar la susceptibilidad de esta variedad a la transformación mediada por A. tumefaciens, explantes internodales de Solanum phureja fueron infectados con la cepa LBA4404 de A. tumefaciens que contiene el plásmido pCAMBIA2301. Este plásmido contiene el gen ntpII que confiere resistencia a kanamicina y el gen reportero gusA-intron. La selección de los explantes potencialmente transgénicos fue realizada en medios con kanamicina. La eficiencia de transformación estable y transitoria fue calculada con base en la actividad GUS (ß-glucuronidasa, detectada por el ensayo histoquímico X-gluc. La expresión transitoria y estable del gen gusA-intron fue observada en células del explante más bien que en tejidos completos. Estos resultados demuestran que la papa criolla (S. phureja Juz. et. Buk variedad Criolla Colombia es susceptible a la infección por A. tumefaciens.

  10. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Science.gov (United States)

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  11. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

    Science.gov (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

    2015-05-25

    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  12. Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

    Science.gov (United States)

    Crawford, I P; Han, C Y; Silverman, M

    1991-01-01

    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  13. THE USE OF gusA REPORTER GENE TO MONITOR THE SURVIVAL OF INTRODUCED BACTERIA IN THE SOIL

    Directory of Open Access Journals (Sweden)

    Edi Husen

    2013-07-01

    Full Text Available An effective marker to monitor the survival of introduced bacteria in the soil is required for further evaluation of their beneficial effects on plant growth. This study tested the use of gusA gene as a marker to trace the fate of three Gram negative bacteria in the root, rhizosphere, and soil. The study was conducted at the laboratory and greenhouse of the National Institute of Molecular Biology and Biotechnology, Philippines from January to December 2001. Isolates TCaR 61 and TCeRe 60, and Azotobacter vinelandii Mac 259 were selected as test bacteria based on their ability to produce indole-3acetic acid and solubilize precipitated phosphate, which may promote plant growth in the field. These bacteria were marked with gusA reporter gene from Escherichia coli strain S17-1(λ-pir containing mTn5SSgusA21. The gusA (β-glucuronidase gene from the donor (E. coli was transferred to each bacterium (recipient through bacterial conjugation in mating procedures using tryptone-yeast agar followed by the selection of the transconjugants (bacteria receiving gusA in tryptone-yeast agar supplemented with double antibiotics and X-GlcA (5bromo-4chloro- 3indoxyl-β-D-glucuronic acid. The antibiotics used were rifampicin and either streptomycin or spectinomycin based on antibiotic profiles of the donor and recipients. The results showed that the insertion of gusA gene into bacterial genomes of the recipient did not impair its phenotypic traits; the growth rates of the transconjugants as well as their ability to produce indole-3acetic acid and solubilize precipitated phosphate in pure culture were similar to their wild types. All transconjugants colonized the roots of hot pepper (Capsicum annuum L. and survived in the rhizosphere and soil until the late of vegetative growth stage. The distinct blue staining of transconjugants as the expression of gusA gene in media containing X-GlcA coupled with their resistance to rifampicin and streptomycin or spectinomycin

  14. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    Science.gov (United States)

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  15. Induction of the mar operon by miscellaneous groceries.

    Science.gov (United States)

    Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

    2004-01-01

    To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

  16. Evolution and Biophysics of the Escherichia coli lac Operon

    Science.gov (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  17. High-efficiency Agrobacterium rhizogenes-mediated transformation of heat inducible sHSP18.2-GUS in Nicotiana tabacum.

    Science.gov (United States)

    Chen, Shih-Cheng; Liu, Hui-Wen; Lee, Kung-Ta; Yamakawa, Takashi

    2007-01-01

    The chimerical gene, Arabidopsis thaliana sHSP18.2 promoter fused to E. coli gusA gene, was Agrobacterium rhizogenes-mediated transformed into Nicotiana tabacum as a heat-regulatable model, and the thermo-inducible expression of GUS activity in N. tabacum transgenic hairy roots was profiled. An activation of A. rhizogenes with acetosyringone (AS) before cocultured with tobacco's leaf disc strongly promoted transgenic hairy roots formation. Transgenic hairy roots formation efficiency of A. rhizogenes precultured with 200 microM AS supplementation was 3.1-fold and 7.5-fold, respectively, compared to the formation efficiency obtained with and without AS supplementation in coculture. Transgenic hairy roots transformed with different AS concentration exhibited a similar pattern of thermo-inducibility after 10 min to 3 h heat treatments detected by GUS expression. The peak of expressed GUS specific activity, 399,530 pmol MUG per mg total protein per min, of the transgenic hairy roots was observed at 48 h after 3 h of 42 degrees C heat treatment, and the expressed GUS specific activity was 7-26 times more than that reported in A. thaliana, tobacco BY-2 cells and Nicotiana plumbaginifolia. Interference caused by AS supplementation on the growth of transgenic hairy roots, time-course of GUS expression and its expression level were not observed.

  18. Tricistronic operon expression of the genes gcaD (tms), which encodes N-acetylglucosamine 1-phosphate uridyltransferase, prs, which encodes phosphoribosyl diphosphate synthetase, and ctc in vegetative cells of Bacillus subtilis

    DEFF Research Database (Denmark)

    Hilden, Ida; Krath, Britta N.; Hove-Jensen, Bjarne

    1995-01-01

    The gcaD, prs, and ctc genes were shown to be organized as a tricistronic operon. The transcription of the prs gene, measured as phosphoribosyl diphosphate synthetase activity, and of the ctc gene, measured as β-galactosidase activity specified by a ctc-lacZ protein fusion, were dependent...

  19. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

    Science.gov (United States)

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

    2017-07-01

    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  20. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Science.gov (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  1. Tissue- and Cell-Specific Cytokinin Activity in Populus × canescens Monitored by ARR5::GUS Reporter Lines in Summer and Winter.

    Science.gov (United States)

    Paul, Shanty; Wildhagen, Henning; Janz, Dennis; Teichmann, Thomas; Hänsch, Robert; Polle, Andrea

    2016-01-01

    Cytokinins play an important role in vascular development. But knowledge on the cellular localization of this growth hormone in the stem and other organs of woody plants is lacking. The main focus of this study was to investigate the occurrence and cellular localization of active cytokinins in leaves, roots, and along the stem of Populus × canescens and to find out how the pattern is changed between summer and winter. An ARR5::GUS reporter construct was used to monitor distribution of active cytokinins in different tissues of transgenic poplar lines. Three transgenic lines tested under outdoor conditions showed no influence of ARR5::GUS reporter construct on the growth performance compared with the wild-type, but one line lost the reporter activity. ARR5::GUS activity indicated changes in the tissue- and cell type-specific pattern of cytokinin activity during dormancy compared with the growth phase. ARR5::GUS activity, which was present in the root tips in the growing season, disappeared in winter. In the stem apex ground tissue, ARR5::GUS activity was higher in winter than in summer. Immature leaves from tissue-culture grown plants showed inducible ARR5::GUS activity. Leaf primordia in summer showed ARR5::GUS activity, but not the expanded leaves of outdoor plants or leaf primordia in winter. In stem cross sections, the most prominent ARR5::GUS activity was detected in the cortex region and in the rays of bark in summer and in winter. In the cambial zone the ARR5::GUS activity was more pronounced in the dormant than in growth phase. The pith and the ray cells adjacent to the vessels also displayed ARR5::GUS activity. In silico analyses of the tissue-specific expression patterns of the whole PtRR type-A family of poplar showed that PtRR10, the closest ortholog to the Arabidopsis ARR5 gene, was usually the most highly expressed gene in all tissues. In conclusion, gene expression and tissue-localization indicate high activity of cytokinins not only in summer, but

  2. CONDOP: an R package for CONdition-Dependent Operon Predictions.

    Science.gov (United States)

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

    2016-10-15

    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

    Science.gov (United States)

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

    2016-01-01

    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  4. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  5. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  6. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  7. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  8. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

    OpenAIRE

    Stewart, V; Yanofsky, C

    1986-01-01

    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  9. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    NARCIS (Netherlands)

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

    2013-01-01

    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  10. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie

    1991-01-01

    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  11. Rapid customised operon assembly by yeast recombinational cloning.

    Science.gov (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  12. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk

    2004-01-01

    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  13. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  14. Specific degradation of 3' regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5'-3' spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  15. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  16. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Science.gov (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  17. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  18. GUS and GFP transformation of the biocontrol strain Clonostachys rosea IK726 and the use of these marker genes in ecological studies

    DEFF Research Database (Denmark)

    Lübeck, M.; Knudsen, I.M.B.; Jensen, B.

    2002-01-01

    Marker genes were introduced in the biocontrol strain Clonostachys rosea IK726 (IBT 9371) as a tool for monitoring the strain in ecological studies. The beta-glucuronidase (GUS) reporter gene and a gene encoding the green fluorescent protein (GFP) were, in separate experiments, integrated into th...

  19. GH3::GUS reflects cell-specific developmental patterns and stress-induced changes in wood anatomy in the poplar stem.

    Science.gov (United States)

    Teichmann, Thomas; Bolu-Arianto, Waode Hamsinah; Olbrich, Andrea; Langenfeld-Heyser, Rosemarie; Göbel, Cornelia; Grzeganek, Peter; Feussner, Ivo; Hänsch, Robert; Polle, Andrea

    2008-09-01

    GH3 genes related to the auxin-inducible Glycine max (L.) Merr. GmGH3 gene encode enzymes that conjugate amino acids to auxin. To investigate the role of GH3 enzymes in stress responses and normal wood development, Populus x canescens (Ait.) was transformed with the promoter-reporter construct GH3::GUS containing a GH3 promoter and the 5' UTR from soybean. beta-Glucuronidase (GUS) activity was present in the vascular tissues of leaves and in developing lateral roots and was inducible in silent tissues by external auxin application. A decrease in GUS activity from the stem apex to the bottom corresponded to decreases in auxin concentrations in these tissues. High auxin concentration and high GH3::GUS activity were present in the pith tissue, which may provide storage for auxin compounds. GH3 reporter was active in ray cells, paratracheal parenchyma cells, maturing vessels and in cells surrounding maturing phloem fibers but not in the cambium and immature phloem, despite high auxin concentrations in the latter tissues. However, the GH3 promoter in these tissues became active when the plants were exposed to abiotic stresses, like bending or salinity, causing changes in wood anatomy. We suggest that adjustment of the internal auxin balance in wood in response to environmental cues involves GH3 auxin conjugate synthases.

  20. Structural characterization of the Salmonella typhimurium LT2 umu operon

    International Nuclear Information System (INIS)

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

    1990-01-01

    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  1. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  2. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Science.gov (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  3. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  4. Aplicação de genes marcadores em estudos de ecologia microbiana com ênfase no sistema GUS Applications of markers genes on ecologic microbial studies with enphasis on GUS system

    Directory of Open Access Journals (Sweden)

    Fábio Martins Mercante

    2000-06-01

    Full Text Available Muitos aspectos ecológicos envolvidos nas interações entre espécies leguminosas e estirpes de rizóbio têm sido facilmente entendidos com o emprego de técnicas que utilizam genes marcadores. A introdução de um gene marcador específico tem se mostrado altamente viável para análises dessas interações. Os genes marcadores são capazes de codificar para produtos que podem ser facilmente identificados ou medidos, especialmente, enzimas que podem atuar em diferentes substratos, fornecendo produtos coloridos ou fluorescentes facilmente detectáveis. De uma maneira geral, os genes marcadores têm sido utilizados em diferentes aspectos da ecologia microbiana, como nos estudos de competição entre estirpes de rizóbio, expressão de genes simbióticos, colonização da rizosfera e raízes, entre outros. Em todos esses estudos, os genes repórteres precisam ser introduzidos no genoma alvo através de um plasmídeo ou por inserção cromossomal. Nesta revisão, são enfatizados, principalmente, os diversos usos e aplicações de genes marcadores nos estudos de ecologia microbiana, com ênfase no sistema GUS (b-glucuronidase.Many of the ecological aspects involved with the interactions between legume species and rhizobia strains have been made easily to understood with the use of reporter gene techniques. The introduction of a specific reporter gene in an organism has shown to be highly efficient to analyze such interactions. These reporter genes generally code for products that can be easily identified or measured, mainly enzymes that can act on a variety of substrates, supplying colored or fluorescent detectable products. In general, the marker genes have been used in different aspects of microbial ecology, as in the competition studies among rhizobia strains, symbiotic gene expression, rhizosphere and root colonization, among others. In all studies, the marker genes need to be introduced into the genome by a plasmid or through a chromosomal

  5. Fusion energy

    International Nuclear Information System (INIS)

    Gross, R.A.

    1984-01-01

    This textbook covers the physics and technology upon which future fusion power reactors will be based. It reviews the history of fusion, reaction physics, plasma physics, heating, and confinement. Descriptions of commercial plants and design concepts are included. Topics covered include: fusion reactions and fuel resources; reaction rates; ignition, and confinement; basic plasma directory; Tokamak confinement physics; fusion technology; STARFIRE: A commercial Tokamak fusion power plant. MARS: A tandem-mirror fusion power plant; and other fusion reactor concepts

  6. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    International Nuclear Information System (INIS)

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

    1993-01-01

    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  7. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Science.gov (United States)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  8. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  9. The Legionella pneumophila kai operon is implicated in stress response and confers fitness in competitive environments

    Science.gov (United States)

    Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen

    2014-01-01

    Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615

  10. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  11. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

    Science.gov (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  12. Monitoring the colonization of sugarcane and rice plants by the endophytic diazotrophic bacterium Gluconacetobacter diazotrophicus marked with gfp and gusA reporter genes.

    Science.gov (United States)

    Rouws, L F M; Meneses, C H S G; Guedes, H V; Vidal, M S; Baldani, J I; Schwab, S

    2010-09-01

    To evaluate the colonization process of sugarcane plantlets and hydroponically grown rice seedlings by Gluconacetobacter diazotrophicus strain PAL5 marked with the gusA and gfp reporter genes. Sugarcane plantlets inoculated in vitro with PAL5 carrying the gfp::gusA plasmid pHRGFPGUS did not present green fluorescence, but beta-glucuronidase (GUS)-stained bacteria could be observed inside sugarcane roots. To complement this existing inoculation methodology for micropropagated sugarcane with a more rapid colonization assay, we employed hydroponically grown gnotobiotic rice seedlings to study PAL5-plant interaction. PAL5 could be isolated from the root surface (10(8) CFU g(-1)) and from surface-disinfected root and stem tissues (10(4) CFU g(-1)) of inoculated plants, suggesting that PAL5 colonized the internal plant tissues. Light microscopy confirmed the presence of bacteria inside the root tissue. After inoculation of rice plantlets with PAL5 marked with the gfp plasmid pHRGFPTC, bright green fluorescent bacteria could be seen colonizing the rice root surface, mainly at the sites of lateral root emergence, at root caps and on root hairs. The plasmids pHRGFPGUS and pHRGFPTC are valid tools to mark PAL5 and monitor the colonization of micropropagated sugarcane and hydroponic rice seedlings. These tools are of use to: (i) study PAL5 mutants affected in bacteria-plant interactions, (ii) monitor plant colonization in real time and (iii) distinguish PAL5 from other bacteria during the study of mixed inoculants.

  13. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Science.gov (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

    Science.gov (United States)

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

    2012-01-01

    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  15. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Science.gov (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  16. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    DEFF Research Database (Denmark)

    Danielsen, S; Kilstrup, M; Barilla, K

    1992-01-01

    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  17. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  18. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  19. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

    Science.gov (United States)

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

    2011-11-01

    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  20. EMP Fusion

    OpenAIRE

    KUNTAY, Isık

    2010-01-01

    This paper introduces a novel fusion scheme, called EMP Fusion, which has the promise of achieving breakeven and realizing commercial fusion power. The method is based on harnessing the power of an electromagnetic pulse generated by the now well-developed flux compression technology. The electromagnetic pulse acts as a means of both heating up the plasma and confining the plasma, eliminating intermediate steps. The EMP Fusion device is simpler compared to other fusion devices and this reduces...

  1. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  2. Transformation of tobacco cpDNA with fusion E7GGG/GUS gene and homologous recombination mediated elimination of the marker gene

    Czech Academy of Sciences Publication Activity Database

    Bříza, Jindřich; Vlasák, Josef; Ryba, Š.; Ludvíková, V.; Niedermeierová, Hana

    2013-01-01

    Roč. 27, č. 2 (2013), s. 3644-3648 ISSN 1310-2818 R&D Projects: GA AV ČR IAA500960903 Institutional support: RVO:60077344 Keywords : E7GGG oncogene * chloroplast transformation * marker-free plant * homologous recombination Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.379, year: 2013

  3. Osteoclast Fusion

    DEFF Research Database (Denmark)

    Marie Julie Møller, Anaïs; Delaissé, Jean-Marie; Søe, Kent

    2017-01-01

    on the nuclearity of fusion partners. While CD47 promotes cell fusions involving mono-nucleated pre-osteoclasts, syncytin-1 promotes fusion of two multi-nucleated osteoclasts, but also reduces the number of fusions between mono-nucleated pre-osteoclasts. Furthermore, CD47 seems to mediate fusion mostly through...... individual fusion events using time-lapse and antagonists of CD47 and syncytin-1. All time-lapse recordings have been studied by two independent observers. A total of 1808 fusion events were analyzed. The present study shows that CD47 and syncytin-1 have different roles in osteoclast fusion depending...... broad contact surfaces between the partners' cell membrane while syncytin-1 mediate fusion through phagocytic-cup like structure. J. Cell. Physiol. 9999: 1-8, 2016. © 2016 Wiley Periodicals, Inc....

  4. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  5. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

    Science.gov (United States)

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

    2013-07-01

    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

    Science.gov (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

    2017-09-01

    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  7. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

    Science.gov (United States)

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  8. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

    Science.gov (United States)

    Ray, J. Christian J; Igoshin, Oleg A.

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  9. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  10. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  11. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  12. Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

    Science.gov (United States)

    Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

    2017-11-01

    The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and

  13. Ancient DNA unravels the truth behind the controversial GUS Greenlandic Norse fur samples: the bison was a horse, and the muskox and beats were goats

    DEFF Research Database (Denmark)

    Sinding, Mikkel-Holger; Arneborg, Jette; Nyegaard, Georg

    2015-01-01

    The Norse Greenlandic archaeological site known as ‘the Farm Beneath the Sand’ (GUS) has sourced many well-preserved and unique archaeological artefacts. Some of the most controversial finds are tufts of hair, which previous morphological-based examination concluded derive from bison, black bear...... mitochondrial 16S DNA analysis. The results revealed that the putative bison was, in fact horse, while the bears and muskox were goat. The results demonstrate the importance of using genetic analyses to validate results derived from morphological analyses on hair, in particular where such studies lead...

  14. Fusion power

    International Nuclear Information System (INIS)

    Hancox, R.

    1981-01-01

    The principles of fusion power, and its advantages and disadvantages, are outlined. Present research programmes and future plans directed towards the development of a fusion power reactor, are summarized. (U.K.)

  15. Fusion rings and fusion ideals

    DEFF Research Database (Denmark)

    Andersen, Troels Bak

    by the so-called fusion ideals. The fusion rings of Wess-Zumino-Witten models have been widely studied and are well understood in terms of precise combinatorial descriptions and explicit generating sets of the fusion ideals. They also appear in another, more general, setting via tilting modules for quantum......This dissertation investigates fusion rings, which are Grothendieck groups of rigid, monoidal, semisimple, abelian categories. Special interest is in rational fusion rings, i.e., fusion rings which admit a finite basis, for as commutative rings they may be presented as quotients of polynomial rings...

  16. Fusion: introduction

    International Nuclear Information System (INIS)

    Decreton, M.

    2006-01-01

    The article gives an overview and introduction to the activities of SCK-CEN's research programme on fusion. The decision to construct the ITER international nuclear fusion experiment in Cadarache is highlighted. A summary of the Belgian contributions to fusion research is given with particular emphasis on studies of radiation effects on diagnostics systems, radiation effects on remote handling sensing systems, fusion waste management and socio-economic studies

  17. Membrane fusion

    DEFF Research Database (Denmark)

    Bendix, Pól Martin

    2015-01-01

    At Stanford University, Boxer lab, I worked on membrane fusion of small unilamellar lipid vesicles to flat membranes tethered to glass surfaces. This geometry closely resembles biological systems in which liposomes fuse to plasma membranes. The fusion mechanism was studied using DNA zippering...... between complementary strands linked to the two apposing membranes closely mimicking the zippering mechanism of SNARE fusion complexes....

  18. Fusion Canada

    International Nuclear Information System (INIS)

    1987-07-01

    This first issue of a quarterly newsletter announces the startup of the Tokamak de Varennes, describes Canada's national fusion program, and outlines the Canadian Fusion Fuels Technology Program. A map gives the location of the eleven principal fusion centres in Canada. (L.L.)

  19. Analysis of reporter proteins GUS and DsRed driven under the control of CaMV35S promoter in syncytia induced by beet cyst nematode Heterodera schachtii in Arabidopsis roots

    Directory of Open Access Journals (Sweden)

    Muhammad Amjad Ali

    2016-05-01

    Full Text Available Background: Cyst nematodes induce specialized feeding structures called syncytia in the plant roots. The expression of CaMV promoter in syncytia has remained topic of debate. The objective of this research was to study the activity of CaMV promoter by using reporter proteins like GUS and DsRed under the control of CaMV35S promoter in syncytia induced by H. schachtii in Arabidopsis roots. Methods: pMAA-Red and pPZP3425 plasmids were used to study expression of GUS and DsRed in syncytia. The plants were grown in 2% Knop medium under sterile conditions in growth chambers at 25°C in long day conditions. GUS activity in syncytia was studied through staining of syncytia using X-gluc solution. Ds-Red fluorescence in syncytia was detected by using an inverse microscope equipped with UV filter. Results: The expression analysis of DsRed protein driven by CaMV promoter demonstrated that this promoter is active in syncytia at all the time points. All the syncytia showed DsRed expression at 5 dpi. At 7 dpi, 10 dpi and 15 dpi over 90%, 80% and 50% of the syncytia showed DsRed fluorescence respectively. There was very high fluorescence in the syncytia as compared to the uninfected root segments due to high expression. CaMV::GUS lines showed GUS expression in 80% of 5dpi syncytia. However, unlike expression of DsRed, the number of GUS stained syncytia decreased quickly to around 50% at 7 dpi and to about 5% in the 15 dpi syncytia. Conclusions: The results conclude that CaMV promoter is more active in younger syncytia as compared to older syncytia but can be used for expression in syncytia. Moreover, DsRed protein could be used as better reporter for evaluation of gene expression in syncytia as compared to GUS.

  20. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Unknown

    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  1. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  2. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

    OpenAIRE

    Riyanti, Eny Ida; Rogers, Peter L

    2009-01-01

    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  3. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  4. Fusion neutronics

    CERN Document Server

    Wu, Yican

    2017-01-01

    This book provides a systematic and comprehensive introduction to fusion neutronics, covering all key topics from the fundamental theories and methodologies, as well as a wide range of fusion system designs and experiments. It is the first-ever book focusing on the subject of fusion neutronics research. Compared with other nuclear devices such as fission reactors and accelerators, fusion systems are normally characterized by their complex geometry and nuclear physics, which entail new challenges for neutronics such as complicated modeling, deep penetration, low simulation efficiency, multi-physics coupling, etc. The book focuses on the neutronics characteristics of fusion systems and introduces a series of theories and methodologies that were developed to address the challenges of fusion neutronics, and which have since been widely applied all over the world. Further, it introduces readers to neutronics design’s unique principles and procedures, experimental methodologies and technologies for fusion systems...

  5. Solving a discrete model of the lac operon using Z3

    Science.gov (United States)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  6. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  7. Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

    Science.gov (United States)

    Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

    2015-08-18

    Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Fusion Physics

    Energy Technology Data Exchange (ETDEWEB)

    Kikuchi, Mitsuru; Lackner, Karl; Tran, Minh Quang [eds.

    2012-09-15

    Recreating the energy production process of the Sun - nuclear fusion - on Earth in a controlled fashion is one of the greatest challenges of this century. If achieved at affordable costs, energy supply security would be greatly enhanced and environmental degradation from fossil fuels greatly diminished. Fusion Physics describes the last fifty years or so of physics and research in innovative technologies to achieve controlled thermonuclear fusion for energy production. The International Atomic Energy Agency (IAEA) has been involved since its establishment in 1957 in fusion research. It has been the driving force behind the biennial conferences on Plasma Physics and Controlled Thermonuclear Fusion, today known as the Fusion Energy Conference. Hosted by several Member States, this biennial conference provides a global forum for exchange of the latest achievements in fusion research against the backdrop of the requirements for a net energy producing fusion device and, eventually, a fusion power plant. The scientific and technological knowledge compiled during this series of conferences, as well as by the IAEA Nuclear Fusion journal, is immense and will surely continue to grow in the future. It has led to the establishment of the International Thermonuclear Experimental Reactor (ITER), which represents the biggest experiment in energy production ever envisaged by humankind.

  9. Fusion breeder

    International Nuclear Information System (INIS)

    Moir, R.W.

    1982-01-01

    The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outline specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs

  10. Fusion Implementation

    International Nuclear Information System (INIS)

    Schmidt, J.A.

    2002-01-01

    If a fusion DEMO reactor can be brought into operation during the first half of this century, fusion power production can have a significant impact on carbon dioxide production during the latter half of the century. An assessment of fusion implementation scenarios shows that the resource demands and waste production associated with these scenarios are manageable factors. If fusion is implemented during the latter half of this century it will be one element of a portfolio of (hopefully) carbon dioxide limiting sources of electrical power. It is time to assess the regional implications of fusion power implementation. An important attribute of fusion power is the wide range of possible regions of the country, or countries in the world, where power plants can be located. Unlike most renewable energy options, fusion energy will function within a local distribution system and not require costly, and difficult, long distance transmission systems. For example, the East Coast of the United States is a prime candidate for fusion power deployment by virtue of its distance from renewable energy sources. As fossil fuels become less and less available as an energy option, the transmission of energy across bodies of water will become very expensive. On a global scale, fusion power will be particularly attractive for regions separated from sources of renewable energy by oceans

  11. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

    Science.gov (United States)

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.

    1998-01-01

    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  12. Specific degradation of 3[prime prime or minute] regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5[prime prime or minute]-3[prime prime or minute] spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, T.H.; Moury, B.; Johannessen, M.M.

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  13. Thermonuclear fusion

    International Nuclear Information System (INIS)

    Weisse, J.

    2000-01-01

    This document takes stock of the two ways of thermonuclear fusion research explored today: magnetic confinement fusion and inertial confinement fusion. The basic physical principles are recalled first: fundamental nuclear reactions, high temperatures, elementary properties of plasmas, ignition criterion, magnetic confinement (charged particle in a uniform magnetic field, confinement and Tokamak principle, heating of magnetized plasmas (ohmic, neutral particles, high frequency waves, other heating means), results obtained so far (scale laws and extrapolation of performances, tritium experiments, ITER project), inertial fusion (hot spot ignition, instabilities, results (Centurion-Halite program, laser experiments). The second part presents the fusion reactor and its associated technologies: principle (tritium production, heat source, neutron protection, tritium generation, materials), magnetic fusion (superconducting magnets, divertor (role, principle, realization), inertial fusion (energy vector, laser adaptation, particle beams, reaction chamber, stresses, chamber concepts (dry and wet walls, liquid walls), targets (fabrication, injection and pointing)). The third chapter concerns the socio-economic aspects of thermonuclear fusion: safety (normal operation and accidents, wastes), costs (costs structure and elementary comparison, ecological impact and external costs). (J.S.)

  14. Fusion devices

    International Nuclear Information System (INIS)

    Fowler, T.K.

    1977-01-01

    Three types of thermonuclear fusion devices currently under development are reviewed for an electric utilities management audience. Overall design features of laser fusion, tokamak, and magnetic mirror type reactors are described and illustrated. Thrusts and trends in current research on these devices that promise to improve performance are briefly reviewed. Twenty photographs and drawings are included

  15. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  16. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Science.gov (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  17. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

    Science.gov (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

    2014-01-01

    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  18. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Science.gov (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  19. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

    Science.gov (United States)

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

    2014-10-01

    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  20. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

    Science.gov (United States)

    Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

    2013-01-01

    The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

  1. Atomic fusion, Gerrard atomic fusion

    International Nuclear Information System (INIS)

    Gerrard, T.H.

    1980-01-01

    In the approach to atomic fusion described here the heat produced in a fusion reaction, which is induced in a chamber by the interaction of laser beams and U.H.F. electromagnetic beams with atom streams, is transferred to a heat exchanger for electricity generation by a coolant flowing through a jacket surrounding the chamber. (U.K.)

  2. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  3. Peaceful fusion

    Energy Technology Data Exchange (ETDEWEB)

    Englert, Matthias [IANUS, TU Darmstadt (Germany)

    2014-07-01

    Like other intense neutron sources fusion reactors have in principle a potential to be used for military purposes. Although the use of fissile material is usually not considered when thinking of fusion reactors (except in fusion-fission hybrid concepts) quantitative estimates about the possible production potential of future commercial fusion reactor concepts show that significant amounts of weapon grade fissile materials could be produced even with very limited amounts of source materials. In this talk detailed burnup calculations with VESTA and MCMATH using an MCNP model of the PPCS-A will be presented. We compare different irradiation positions and the isotopic vectors of the plutonium bred in different blankets of the reactor wall with the liquid lead-lithium alloy replaced by uranium. The technical, regulatory and policy challenges to manage the proliferation risks of fusion power will be addressed as well. Some of these challenges would benefit if addressed at an early stage of the research and development process. Hence, research on fusion reactor safeguards should start as early as possible and accompany the current research on experimental fusion reactors.

  4. SOS-like induction in Bacillus subtilis: induction of the RecA protein analog and a damage-inducible operon by DNA damage in Rec+ and DNA repair-deficient strains

    International Nuclear Information System (INIS)

    Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.

    1988-01-01

    We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation

  5. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  6. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

    Science.gov (United States)

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

    2013-02-01

    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

  7. GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

    NARCIS (Netherlands)

    KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  8. Cold fusion

    International Nuclear Information System (INIS)

    Suh, Suk Yong; Sung, Ki Woong; Kang, Joo Sang; Lee, Jong Jik

    1995-02-01

    So called 'cold fusion phenomena' are not confirmed yet. Excess heat generation is very delicate one. Neutron generation is most reliable results, however, the records are erratic and the same results could not be repeated. So there is no reason to exclude the malfunction of testing instruments. The same arguments arise in recording 4 He, 3 He, 3 H, which are not rich in quantity basically. An experiment where plenty of 4 He were recorded is attached in appendix. The problem is that we are trying to search cold fusion which is permitted by nature or not. The famous tunneling effect in quantum mechanics will answer it, however, the most fusion rate is known to be negligible. The focus of this project is on the theme that how to increase that negligible fusion rate. 6 figs, 4 tabs, 1512 refs. (Author)

  9. Cold fusion

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Suk Yong; Sung, Ki Woong; Kang, Joo Sang; Lee, Jong Jik [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1995-02-01

    So called `cold fusion phenomena` are not confirmed yet. Excess heat generation is very delicate one. Neutron generation is most reliable results, however, the records are erratic and the same results could not be repeated. So there is no reason to exclude the malfunction of testing instruments. The same arguments arise in recording {sup 4}He, {sup 3}He, {sup 3}H, which are not rich in quantity basically. An experiment where plenty of {sup 4}He were recorded is attached in appendix. The problem is that we are trying to search cold fusion which is permitted by nature or not. The famous tunneling effect in quantum mechanics will answer it, however, the most fusion rate is known to be negligible. The focus of this project is on the theme that how to increase that negligible fusion rate. 6 figs, 4 tabs, 1512 refs. (Author).

  10. Laser fusion

    International Nuclear Information System (INIS)

    Ashby, D.E.T.F.

    1976-01-01

    A short survey is given on laser fusion its basic concepts and problems and the present theoretical and experimental methods. The future research program of the USA in this field is outlined. (WBU) [de

  11. Fusion energy

    International Nuclear Information System (INIS)

    Anon.

    1979-01-01

    The efforts of the Chemical Technology Division in fusion energy include the areas of fuel handling, processing, and containment. Current studies are concerned largely with the development of vacuum pumps for fusion reactors and experiments and with development and evaluation of techniques for recovering tritium from solid or liquid breeding blankets. In addition, a small effort is devoted to support of the ORNL design of a major Tokamak experiment, The Next Step (TNS)

  12. Laser fusion

    International Nuclear Information System (INIS)

    Key, M.H.; Oxford Univ.

    1990-04-01

    The use of lasers to drive implosions for the purpose of inertially confined fusion is an area of intense activity where progress compares favourably with that made in magnetic fusion and there are significant prospects for future development. In this brief review the basic concept is summarised and the current status is outlined both in the area of laser technology and in the most recent results from implosion experiments. Prospects for the future are also considered. (author)

  13. Nuclear fusion

    International Nuclear Information System (INIS)

    Al-zaelic, M.M.

    2013-01-01

    Nuclear fusion can be relied on to solve the global energy crisis if the process of limiting the heat produced by the fusion reaction (Plasma) is successful. Currently scientists are progressively working on this aspect whereas there are two methods to limit the heat produced by fusion reaction, the two methods are auto-restriction using laser beam and magnetic restriction through the use of magnetic fields and research is carried out to improve these two methods. It is expected that at the end of this century the nuclear fusion energy will play a vital role in overcoming the global energy crisis and for these reasons, acquiring energy through the use of nuclear fusion reactors is one of the most urge nt demands of all mankind at this time. The conclusion given is that the source of fuel for energy production is readily available and inexpensive ( hydrogen atoms) and whole process is free of risks and hazards, especially to general health and the environment . Nuclear fusion importance lies in the fact that energy produced by the process is estimated to be about four to five times the energy produced by nuclear fission. (author)

  14. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  16. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

    Science.gov (United States)

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

    2014-12-01

    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  17. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    NARCIS (Netherlands)

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

    2006-01-01

    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  18. clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

    Science.gov (United States)

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

    2015-03-01

    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  19. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Czech Academy of Sciences Publication Activity Database

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

    2007-01-01

    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  20. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  1. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  2. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  3. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  4. Cold fusion

    International Nuclear Information System (INIS)

    Koster, J.

    1989-01-01

    In this contribution the author the phenomenom of so-called cold fusion, inspired by the memorable lecture of Moshe Gai on his own search for this effect. Thus much of what follows was presented by Dr. Gai; the rest is from independent reading. What is referred to as cold fusion is of course the observation of possible products of deuteron-deuteron (d-d) fusion within deuterium-loaded (dentended) electrodes. The debate over the two vanguard cold fusion experiments has raged under far more public attention than usually accorded new scientific phenomena. The clamor commenced with the press conference of M. Fleishmann and S. Pons on March 23, 1989 and the nearly simultaneous wide circulation of a preprint of S. Jones and collaborators. The majority of work attempting to confirm these observations has at the time of this writing yet to appear in published form, but contributions to conferences and electronic mail over computer networks were certainly filled with preliminary results. To keep what follows to a reasonable length the author limit this discussion to the searches for neutron (suggested by ref. 2) or for excessive heat production (suggested by ref. 1), following a synopsis of the hypotheses of cold fusion

  5. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Science.gov (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  6. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  7. Regulation of the rhaEWRBMA Operon Involved in l-Rhamnose Catabolism through Two Transcriptional Factors, RhaR and CcpA, in Bacillus subtilis.

    Science.gov (United States)

    Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro

    2015-12-28

    The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological

  8. Fusion events

    International Nuclear Information System (INIS)

    Aboufirassi, M; Angelique, J.C.; Bizard, G.; Bougault, R.; Brou, R.; Buta, A.; Colin, J.; Cussol, D.; Durand, D.; Genoux-Lubain, A.; Horn, D.; Kerambrun, A.; Laville, J.L.; Le Brun, C.; Lecolley, J.F.; Lefebvres, F.; Lopez, O.; Louvel, M.; Meslin, C.; Metivier, V.; Nakagawa, T.; Peter, J.; Popescu, R.; Regimbart, R.; Steckmeyer, J.C.; Tamain, B.; Vient, E.; Wieloch, A.; Yuasa-Nakagawa, K.

    1998-01-01

    The fusion reactions between low energy heavy ions have a very high cross section. First measurements at energies around 30-40 MeV/nucleon indicated no residue of either complete or incomplete fusion, thus demonstrating the disappearance of this process. This is explained as being due to the high amount o energies transferred to the nucleus, what leads to its total dislocation in light fragments and particles. Exclusive analyses have permitted to mark clearly the presence of fusion processes in heavy systems at energies above 30-40 MeV/nucleon. Among the complete events of the Kr + Au reaction at 60 MeV/nucleon the majority correspond to binary collisions. Nevertheless, for the most considerable energy losses, a class of events do occur for which the detected fragments appears to be emitted from a unique source. These events correspond to an incomplete projectile-target fusion followed by a multifragmentation. Such events were singled out also in the reaction Xe + Sn at 50 MeV/nucleon. For the events in which the energy dissipation was maximal it was possible to isolate an isotropic group of events showing all the characteristics of fusion nuclei. The fusion is said to be incomplete as pre-equilibrium Z = 1 and Z = 2 particles are emitted. The cross section is of the order of 25 mb. Similar conclusions were drown for the systems 36 Ar + 27 Al and 64 Zn + nat Ti. A cross section value of ∼ 20 mb was determined at 55 MeV/nucleon in the first case, while the measurement of evaporation light residues in the last system gave an upper limit of 20-30 mb for the cross section at 50 MeV/nucleon

  9. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

    Directory of Open Access Journals (Sweden)

    Ziqing eDeng

    2013-07-01

    Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

  10. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  11. Nuclear fusion

    International Nuclear Information System (INIS)

    Huber, H.

    1978-01-01

    A comprehensive survey is presented of the present state of knowledge in nuclear fusion research. In the first part, potential thermonuclear reactions, basic energy balances of the plasma (Lawson criterion), and the main criteria to be observed in the selection of appropriate thermonuclear reactions are dealt with. This is followed by a discussion of the problems encountered in plasma physics (plasma confinement and heating, transport processes, plasma impurities, plasma instabilities and plasma diagnostics) and by a consideration of the materials problems involved, such as material of the first wall, fuel inlet and outlet, magnetic field generation, as well as repair work and in-service inspections. Two main methods have been developed to tackle these problems: reactor concepts using the magnetic pinch (stellarator, Tokamak, High-Beta reactors, mirror machines) on the one hand, and the other concept using the inertial confinement (laser fusion reactor). These two approaches and their specific problems as well as past, present and future fusion experiments are treated in detail. The last part of the work is devoted to safety and environmental aspects of the potential thermonuclear aspects of the potential thermonuclear reactor, discussing such problems as fusion-specific hazards, normal operation and potential hazards, reactor incidents, environmental pollution by thermal effluents, radiological pollution, radioactive wastes and their disposal, and siting problems. (orig./GG) [de

  12. Short fusion

    CERN Multimedia

    2002-01-01

    French and UK researchers are perfecting a particle accelerator technique that could aid the quest for fusion energy or make X-rays that are safer and produce higher-resolution images. Led by Dr Victor Malka from the Ecole Nationale Superieure des Techniques Avancees in Paris, the team has developed a better way of accelerating electrons over short distances (1 page).

  13. Magnetic fusion

    International Nuclear Information System (INIS)

    2002-01-01

    This document is a detailed lecture on thermonuclear fusion. The basic physics principles are recalled and the technological choices that have led to tokamaks or stellarators are exposed. Different aspects concerning thermonuclear reactors such as safety, economy and feasibility are discussed. Tore-supra is described in details as well as the ITER project

  14. Cold fusion

    International Nuclear Information System (INIS)

    Seo, Suk Yong; You, Jae Jun

    1996-01-01

    Nearly every technical information is chased in the world. All of them are reviewed and analyzed. Some of them are chosen to study further more to review every related documents. And a probable suggestion about the excitonic process in deuteron absorbed condensed matter is proposed a way to cold fusion. 8 refs. (Author)

  15. Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

    Science.gov (United States)

    Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

    2018-06-01

    Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

  16. Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon.

    Science.gov (United States)

    Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel

    2014-01-01

    Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

  17. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Science.gov (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  18. Cold fusion, Alchemist's dream

    International Nuclear Information System (INIS)

    Clayton, E.D.

    1989-09-01

    In this report the following topics relating to cold fusion are discussed: muon catalysed cold fusion; piezonuclear fusion; sundry explanations pertaining to cold fusion; cosmic ray muon catalysed cold fusion; vibrational mechanisms in excited states of D 2 molecules; barrier penetration probabilities within the hydrogenated metal lattice/piezonuclear fusion; branching ratios of D 2 fusion at low energies; fusion of deuterons into 4 He; secondary D+T fusion within the hydrogenated metal lattice; 3 He to 4 He ratio within the metal lattice; shock induced fusion; and anomalously high isotopic ratios of 3 He/ 4 He

  19. Magnetic fusion; La fusion magnetique

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-07-01

    This document is a detailed lecture on thermonuclear fusion. The basic physics principles are recalled and the technological choices that have led to tokamaks or stellarators are exposed. Different aspects concerning thermonuclear reactors such as safety, economy and feasibility are discussed. Tore-supra is described in details as well as the ITER project.

  20. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  1. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    International Nuclear Information System (INIS)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

    2007-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  2. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  3. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    OpenAIRE

    Burbank, Lindsey P.; Van Horn, Christopher R.

    2017-01-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  4. Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

    Czech Academy of Sciences Publication Activity Database

    Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

    2015-01-01

    Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

  5. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

    Science.gov (United States)

    Chowdhury, Nilkanta; Bagchi, Angshuman

    2017-07-01

    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  6. Splenogonadal Fusion

    Directory of Open Access Journals (Sweden)

    Sung-Lang Chen

    2008-11-01

    Full Text Available Splenogonadal fusion (SGF is a rare congenital non-malignant anomaly characterized by fusion of splenic tissue to the gonad, and can be continuous or discontinuous. Very few cases have been diagnosed preoperatively, and many patients who present with testicular swelling undergo unnecessary orchiectomy under the suspicion of testicular neoplasm. A 16-year-old boy presented with a left scrotal mass and underwent total excision of a 1.6-cm tumor without damaging the testis, epididymis or its accompanying vessels. Pathologic examination revealed SFG (discontinuous type. If clinically suspected before surgery, the diagnosis may be confirmed by Tc-99m sulfur colloid imaging, which shows uptake in both the spleen and accessory splenic tissue within the scrotum. Frozen section should be considered if there remains any doubt regarding the diagnosis during operation.

  7. Laser fusion

    International Nuclear Information System (INIS)

    Eliezer, S.

    1982-02-01

    In this paper, the physics of laser fusion is described on an elementary level. The irradiated matter consists of a dense inner core surrounded by a less dense plasma corona. The laser radiation is mainly absorbed in the outer periphery of the plasma. The absorbed energy is transported inward to the ablation surface where plasma flow is created. Due to this plasma flow, a sequence of inward going shock waves and heat waves are created, resulting in the compression and heating of the core to high density and temperature. The interaction physics between laser and matter leading to thermonuclear burn is summarized by the following sequence of events: Laser absorption → Energy transport → Compression → Nuclear Fusion. This scenario is shown in particular for a Nd:laser with a wavelength of 1 μm. The wavelength scaling of the physical processes is also discussed. In addition to the laser-plasma physics, the Nd high power pulsed laser is described. We give a very brief description of the oscillator, the amplifiers, the spatial filters, the isolators and the diagnostics involved. Last, but not least, the concept of reactors for laser fusion and the necessary laser system are discussed. (author)

  8. Fusion spectroscopy

    International Nuclear Information System (INIS)

    Peacock, N.J.

    1995-09-01

    This article traces developments in the spectroscopy of high temperature laboratory plasma used in controlled fusion research from the early 1960's until the present. These three and a half decades have witnessed many orders of magnitude increase in accessible plasma parameters such as density and temperature as well as particle and energy confinement timescales. Driven by the need to interpret the radiation in terms of the local plasma parameters, the thrust of fusion spectroscopy has been to develop our understanding of (i) the atomic structure of highly ionised atoms, usually of impurities in the hydrogen isotope fuel; (ii) the atomic collision rates and their incorporation into ionization structure and emissivity models that take into account plasma phenomena like plasma-wall interactions, particle transport and radiation patterns; (iii) the diagnostic applications of spectroscopy aided by increasingly sophisticated characterisation of the electron fluid. These topics are discussed in relation to toroidal magnetically confined plasmas, particularly the Tokamak which appears to be the most promising approach to controlled fusion to date. (author)

  9. Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

    International Nuclear Information System (INIS)

    Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

    1988-01-01

    The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

  10. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  11. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  12. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  13. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  14. Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

    Science.gov (United States)

    Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

    2014-01-01

    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  15. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Science.gov (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  16. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    Science.gov (United States)

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

    Science.gov (United States)

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V

    1999-09-01

    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  18. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Science.gov (United States)

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  19. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

    Science.gov (United States)

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

    2013-10-01

    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  20. Expressão transiente do gene gus, sob regulação de quatro promotores, em diferentes tecidos de mamoeiro (Carica papaya L. e videira (Vitis sp. Transient expression of the gus gene, under the regulation of four promoters, on different tissues of papaya (Carica papaya l. and grape (Vitis sp.

    Directory of Open Access Journals (Sweden)

    Adelar Almeida Pinto

    2002-12-01

    Full Text Available O mamoeiro (Carica papaya L. e a videira (Vitis vinifera L. destacam-se entre as fruteiras produzidas no Brasil por serem plantadas em quase todo o território nacional e apresentarem importância econômica e social. A tecnologia de produção de organismos geneticamente modificados, também conhecidos como "transgênicos", tem grande potencial de uso no desenvolvimento de fruteiras melhoradas. Porém, questões de propriedade intelectual limitam o uso da engenharia genética por países em desenvolvimento, que normalmente não detêm direitos sobre processos ou produtos necessários ao uso desta. Neste contexto, o presente estudo buscou avaliar promotores de expressão gênica alternativos ao CaMV 35S, que é o mais utilizado no desenvolvimento de transgênicos, mas é patenteado. Para tanto, construções gênicas com o gene gus sob a regulação de diferentes promotores foram testadas para expressão transiente em diversos tecidos de mamoeiro e videira. Expressão transiente foi avaliada em embriões somáticos, folhas, caules, raízes e frutos. O promotor do gene UBQ3, que é constitutivo e se encontra em domínio publico, mostrou ser uma alternativa promissora para futuros trabalhos de transformação genética de mamoeiro, mas não de videira.Papaya (Carica papaya L. and grapes (Vitis vinifera L. are among the most important fruit crops produced in Brazil, and are cultivated in several regions around the country being of economical and social importance. Genetic engineering has great potential on the development of genetically improved fruit crops. However, intellectual property issues constantly limit the commercial use of this technology in developing countries. Thus, the present study aimed to evaluate gene promoters as alternatives to the 35S CaMV, which is the most used so far in the development of transgenic plants, but it is patented. In order to do that, the expression of the gus gene under the regulation of distinct promoters was

  1. Fusion Machines

    International Nuclear Information System (INIS)

    Weynants, R.R.

    2004-01-01

    A concise overview is given of the principles of inertial and magnetic fusion, with an emphasis on the latter in view of the aim of this summer school. The basis of magnetic confinement in mirror and toroidal geometry is discussed and applied to the tokamak concept. A brief discussion of the reactor prospects of this configuration identifies which future developments are crucial and where alternative concepts might help in optimising the reactor design. The text also aims at introducing the main concepts encountered in tokamak research that will be studied and used in the subsequent lectures

  2. Fusion Canada issue 10

    International Nuclear Information System (INIS)

    1990-02-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on Fusion Materials Research, ITER physics research, fusion performance record at JET, and design options for reactor building. 4 figs

  3. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  4. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  5. Revitalizing Fusion via Fission Fusion

    Science.gov (United States)

    Manheimer, Wallace

    2001-10-01

    Existing tokamaks could generate significant nuclear fuel. TFTR, operating steady state with DT might generate enough fuel for a 300 MW nuclear reactor. The immediate goals of the magnetic fusion program would necessarily shift from a study of advanced plasma regimes in larger sized devices, to mostly known plasmas regimes, but at steady state or high duty cycle operation in DT plasmas. The science and engineering of breeding blankets would be equally important. Follow on projects could possibly produce nuclear fuel in large quantity at low price. Although today there is strong opposition to nuclear power in the United States, in a 21st century world of 10 billion people, all of whom will demand a middle class life style, nuclear energy will be important. Concern over greenhouse gases will also drive the world toward nuclear power. There are studies indicating that the world will need 10 TW of carbon free energy by 2050. It is difficult to see how this can be achieved without the breeding of nuclear fuel. By using the thorium cycle, proliferation risks are minimized. [1], [2]. 1 W. Manheimer, Fusion Technology, 36, 1, 1999, 2.W. Manheimer, Physics and Society, v 29, #3, p5, July, 2000

  6. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

    Science.gov (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

    2013-07-01

    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  7. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

    Science.gov (United States)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2015-01-01

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  8. The effect of stochasticity on the lac operon: an evolutionary perspective.

    Directory of Open Access Journals (Sweden)

    Milan van Hoek

    2007-06-01

    Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

  9. Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    T Sabari Sankar

    2009-03-01

    Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

  10. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

    Science.gov (United States)

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

    2015-01-01

    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  11. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

    Science.gov (United States)

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

    2010-07-01

    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  12. Catalysed fusion

    CERN Document Server

    Farley, Francis

    2012-01-01

    A sizzling romance and a romp with subatomic particles at CERN. Love, discovery and adventure in the city where nations meet and beams collide. Life in a large laboratory. As always, the challenges are the same. Who leads? Who follows? Who succeeds? Who gets the credit? Who gets the women or the men? Young Jeremy arrives in CERN and joins the quest for green energy. Coping with baffling jargon and manifold dangers, he is distracted by radioactive rats, lovely ladies and an unscrupulous rival. Full of doubts and hesitations, he falls for a dazzling Danish girl, who leads him astray. His brilliant idea leads to a discovery and a new route to cold fusion. But his personal life is scrambled. Does it bring fame or failure? Tragedy or triumph?

  13. Fusion cuisine

    DEFF Research Database (Denmark)

    Peters, Chris; Broersma, Marcel

    2018-01-01

    JJournalism studies as an academic field is characterized by multidisciplinarity. Focusing on one object of study, journalism and the news, it established itself by integrating and synthesizing approaches from established disciplines – a tendency that lives on today. This constant gaze to the out......JJournalism studies as an academic field is characterized by multidisciplinarity. Focusing on one object of study, journalism and the news, it established itself by integrating and synthesizing approaches from established disciplines – a tendency that lives on today. This constant gaze...... to the outside for conceptual inspiration and methodological tools lends itself to a journalism studies that is a fusion cuisine of media, communication, and related scholarship. However, what happens when this object becomes as fragmented and multifaceted as the ways we study it? This essay addresses...

  14. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    Science.gov (United States)

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  15. The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis

    OpenAIRE

    Ahn, Sang-Joon; Burne, Robert A.

    2006-01-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

  16. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  17. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Science.gov (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  18. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  19. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Science.gov (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  20. Purification and crystallization of Phd, the antitoxin of the phd/doc operon

    International Nuclear Information System (INIS)

    Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

    2010-01-01

    The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

  1. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

    Science.gov (United States)

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  2. The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

    Science.gov (United States)

    Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

    2007-01-01

    Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

  3. par genes in Mycobacterium bovis and Mycobacterium smegmatis are arranged in an operon transcribed from "SigGC" promoters

    Directory of Open Access Journals (Sweden)

    Casart Yveth

    2008-03-01

    Full Text Available Abstract Background The ParA/Soj and ParB/Spo0J proteins, and the cis-acting parS site, participate actively in chromosome segregation and cell cycle progression. Genes homologous to parA and parB, and two putative parS copies, have been identified in the Mycobacterium bovis BCG and Mycobacterium smegmatis chromosomes. As in Mycobacterium tuberculosis, the parA and parB genes in these two non-pathogenic mycobacteria are located near the chromosomal origin of replication. The present work focused on the determination of the transcriptional organisation of the ~6 Kb orf60K-parB region of M. bovis BCG and M. smegmatis by primer extension, transcriptional fusions to the green fluorescence protein (GFP and quantitative RT-PCR. Results The parAB genes were arranged in an operon. However, we also found promoters upstream of each one of these genes. Seven putative promoter sequences were identified in the orf60K-parB region of M. bovis BCG, whilst four were identified in the homologous region of M. smegmatis, one upstream of each open reading frame (ORF. Real-time PCR assays showed that in M. smegmatis, mRNA-parA and mRNA-parB levels decreased between the exponential and stationary phases. In M. bovis BCG, mRNA-parA levels also decreased between the exponential and stationary phases. However, parB expression was higher than parA expression and remained almost unchanged along the growth curve. Conclusion The majority of the proposed promoter regions had features characteristic of Mycobacterium promoters previously denoted as Group D. The -10 hexamer of a strong E. coli σ70-like promoter, located upstream of gidB of M. bovis BCG, overlapped with a putative parS sequence, suggesting that the transcription from this promoter might be regulated by the binding of ParB to parS.

  4. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  5. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  6. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  7. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

    Science.gov (United States)

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

    2016-08-01

    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  8. Towards nuclear fusion reactors

    International Nuclear Information System (INIS)

    1993-11-01

    The results of nuclear fusion researches in JAERI are summarized. In this report, following themes are collected: the concept of fusion reactor (including ITER), fusion reactor safety, plasma confinement, fusion reactor equipment, and so on. Includes glossary. (J.P.N.)

  9. Fusion Canada issue 28

    International Nuclear Information System (INIS)

    1995-06-01

    A short bulletin from the National Fusion Program highlighting in this issue the Canada - US fusion meeting in Montreal, fusion breeder work in Chile, new management at CFFTP, fast electrons in tokamaks: new data from TdeV, a program review of CCFM and Velikhov to address Montreal fusion meeting. 1 fig

  10. Fusion systems engineering

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    Summaries of research are included for each of the following topics: (1) fusion reactor systems studies, (2) development of blanket processing technology for fusion reactors, (3) safety studies of fusion concepts, (4) the MACK/MACKLIB system for nuclear response functions, and (5) energy storage and power supply systems for fusion reactors

  11. Scientific-technical exchange of experiences between Germany and the GUS, the Baltic and MOE states, and central Asia and other regions. Workshop and establishment of a common knowledge base for nuclear safety and security. Final report; Wissenschaftlich-technischer Erfahrungsaustausch Deutschlands mit der GUS, den Baltischen und den MOE-Staaten sowie Laendern Zentralasiens und anderer Regionen. Arbeitstreffen und Schaffung gemeinsamer Wissensbasen fuer nukleare Sicherheit und Sicherung. Abschlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    Dabrowski, Anna

    2017-03-15

    The report on the workshop concerning scientific-technical exchange of experiences between Germany and the GUS, the Baltic and MOE states, and central Asia and other regions includes the following issues: Results an d success of know-how transfer from West to East, topical issues for mutual exchange of experience, scope of the project, concept of the realization of mutual exchange of experiences. The emphasis of the workshop covered the following issues: emergency preparedness, international requirements concerning nuclear safety and radiation protection, transport of radioactive wastes and communication in nuclear technology.

  12. Fusions between green fluorescent protein and beta-glucuronidase as sensitive and vital bifunctional reporters in plants.

    Science.gov (United States)

    Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P

    1998-11-01

    By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.

  13. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  14. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

    Science.gov (United States)

    Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

    2014-12-01

    The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

  15. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  16. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Elasri, Mohamed O

    2014-06-11

    Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

  17. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Directory of Open Access Journals (Sweden)

    Astha Agarwal

    2013-01-01

    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  18. Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

    Directory of Open Access Journals (Sweden)

    Mariana Noelia Viale

    2014-01-01

    Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

  19. Expression, purification and functional characterization of AmiA of acetamidase operon of Mycobacterium smegmatis.

    Science.gov (United States)

    Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha

    2014-11-01

    Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.

  20. The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

    Science.gov (United States)

    Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

    2014-01-01

    The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

  1. Dynamics and bistability in a reduced model of the lac operon

    Science.gov (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

    2004-06-01

    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  2. Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.

    Science.gov (United States)

    Marincola, Gabriella; Wolz, Christiane

    2017-06-02

    In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

    Science.gov (United States)

    Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

    2018-01-22

    Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

  4. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Science.gov (United States)

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  5. Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

    Science.gov (United States)

    Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

    2000-10-01

    Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

  6. Fusion systems engineering

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    Research during this report period has covered the following areas: (1) fusion reactor systems studies, (2) development of blanket processing technology for fusion reactors, (3) safety studies of fusion concepts, (4) MACKLIB-IV, a new library of nuclear response functions, (5) energy storage and power supply requirements for commercial fusion reactors, (6) blanket/shield design evaluation for commercial fusion reactors, and (7) cross section measurements, evaluations, and techniques

  7. Fusion fuel and renewables

    International Nuclear Information System (INIS)

    Entler, Slavomir

    2015-01-01

    It is shown that fusion fuel meets all aspects applied when defining renewables. A table of definitions of renewables is presented. The sections of the paper are as follows: An industrial renewable source; Nuclear fusion; Current situation in research; Definitions of renewable sources; Energy concept of nuclear fusion; Fusion fuel; Natural energy flow; Environmental impacts; Fusion fuel assessment; Sustainable power; and Energy mix from renewables. (P.A.)

  8. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

    OpenAIRE

    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

    1993-01-01

    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  9. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  10. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Christiansen, Gunna; Molin, S

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

  11. Cold fusion

    International Nuclear Information System (INIS)

    Bush, R.T.

    1991-01-01

    The transmission resonance model (TRM) is combined with some electrochemistry of the cathode surface and found to provide a good fit to new data on excess heat. For the first time, a model for cold fusion not only fits calorimetric data but also predicts optimal trigger points. This suggests that the model is meaningful and that the excess heat phenomenon claimed by Fleischmann and Pons is genuine. A crucial role is suggested for the overpotential and, in particular, for the concentration overpotential, i.e., the hydrogen overvoltage. Self-similar geometry, or scale invariance, i.e., a fractal nature, is revealed by the relative excess power function. Heat bursts are predicted with a scale invariance in time, suggesting a possible link between the TRM and chaos theory. The model describes a near-surface phenomenon with an estimated excess power yield of ∼1 kW/cm 3 Pd, as compared to 50 W/cm 3 of reactor core for a good fission reactor. Transmission resonance-induced nuclear transmutation, a new type of nuclear reaction, is strongly suggested with two types emphasized: transmission resonance-induced neutron transfer reactions yielding essentially the same end result as Teller's hypothesized catalytic neutron transfer and a three-body reaction promoted by standing de Broglie waves. In this paper suggestions for the anomalous production of heat, particles, and radiation are given

  12. Fusion energy

    International Nuclear Information System (INIS)

    1990-09-01

    The main purpose of the International Thermonuclear Experimental Reactor (ITER) is to develop an experimental fusion reactor through the united efforts of many technologically advanced countries. The ITER terms of reference, issued jointly by the European Community, Japan, the USSR, and the United States, call for an integrated international design activity and constitute the basis of current activities. Joint work on ITER is carried out under the auspices of the International Atomic Energy Agency (IAEA), according to the terms of quadripartite agreement reached between the European Community, Japan, the USSR, and the United States. The site for joint technical work sessions is at the MaxPlanck Institute of Plasma Physics. Garching, Federal Republic of Germany. The ITER activities have two phases: a definition phase performed in 1988 and the present design phase (1989--1990). During the definition phase, a set of ITER technical characteristics and supporting research and development (R ampersand D) activities were developed and reported. The present conceptual design phase of ITER lasts until the end of 1990. The objectives of this phase are to develop the design of ITER, perform a safety and environmental analysis, develop site requirements, define future R ampersand D needs, and estimate cost, manpower, and schedule for construction and operation. A final report will be submitted at the end of 1990. This paper summarizes progress in the ITER program during the 1989 design phase

  13. Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

    Directory of Open Access Journals (Sweden)

    Terezinha Knöbl

    2006-06-01

    Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

  14. Fusion technology: The Iter fusion experiment

    International Nuclear Information System (INIS)

    Dietz, K.J.

    1994-01-01

    Plans for the Iter international fusion experiment, in which the European Union, Japan, Canada, Russia, Sweden, Switzerland, and the USA cooperate, were begun in 1985, and construction work started in early 1994. These activities serve for the preparation of the design and construction documents for a research reactor in which a stable fusion plasma is to be generated. This is to be the basis for the construction of a fusion reactor for electricity generation. Preparatory work was performed in the Tokamak experiments with JET and TFTR. The fusion power of 1.5 GW will be attained, thus enabling Iter to keep a deuterium-tritium plasma burning. (orig.) [de

  15. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

    Science.gov (United States)

    Rajagopalan, Ramya; Kroos, Lee

    2017-05-15

    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  16. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

    Science.gov (United States)

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

    2016-10-15

    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  17. RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.

    Science.gov (United States)

    Lei, Mei G; Lee, Chia Y

    2015-12-01

    Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

  18. Review of fusion synfuels

    International Nuclear Information System (INIS)

    Fillo, J.A.

    1980-01-01

    Thermonuclear fusion offers an inexhaustible source of energy for the production of hydrogen from water. Depending on design, electric generation efficiencies of approx. 40 to 60% and hydrogen production efficiencies by high-temperature electrolysis of approx. 50 to 65% are projected for fusion reactors using high-temperatures blankets. Fusion/coal symbiotic systems appear economically promising for the first generation of commercial fusion synfuels plants. Coal production requirements and the environmental effects of large-scale coal usage would be greatly reduced by a fusion/coal system. In the long term, there could be a gradual transition to an inexhaustible energy system based solely on fusion

  19. Barriers to fusion

    International Nuclear Information System (INIS)

    Berriman, A.C.; Butt, R.D.; Dasgupta, M.; Hinde, D.J.; Morton, C.R.; Newton, J.O.

    1999-01-01

    The fusion barrier is formed by the combination of the repulsive Coulomb and attractive nuclear forces. Recent research at the Australian National University has shown that when heavy nuclei collide, instead of a single fusion barrier, there is a set of fusion barriers. These arise due to intrinsic properties of the interacting nuclei such deformation, rotations and vibrations. Thus the range of barrier energies depends on the properties of both nuclei. The transfer of matter between nuclei, forming a neck, can also affect the fusion process. High precision data have been used to determine fusion barrier distributions for many nuclear reactions, leading to new insights into the fusion process

  20. Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

    Science.gov (United States)

    Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

    2016-01-01

    An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

  1. Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

    Science.gov (United States)

    Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

    2015-05-01

    Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  2. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

    Science.gov (United States)

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

  3. Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

    NARCIS (Netherlands)

    Nouwen, N; Driessen, AJM

    2005-01-01

    Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

  4. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

    DEFF Research Database (Denmark)

    Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

    2011-01-01

    Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

  5. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    NARCIS (Netherlands)

    Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

  6. Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal

    2005-01-01

    control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...

  7. Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

    Science.gov (United States)

    Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

    2015-01-01

    Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

  8. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

    Science.gov (United States)

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

    2006-03-01

    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  9. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  10. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

    Science.gov (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

    2018-01-01

    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  11. Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

    Science.gov (United States)

    Ghosh, Semanti; Bagchi, Angshuman

    2015-12-01

    Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

  12. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

    Science.gov (United States)

    Pérez-Oseguera, Angeles; Cevallos, Miguel A

    2013-11-01

    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

    Science.gov (United States)

    Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

    2014-09-01

    Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  14. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

    Science.gov (United States)

    Burbank, Lindsey P; Van Horn, Christopher R

    2017-11-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  15. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

    Science.gov (United States)

    Ahn, Sang-Joon; Burne, Robert A

    2006-10-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

  16. Role of the Escherichia coli glnALG operon in regulation of ammonium transport

    International Nuclear Information System (INIS)

    Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

    1986-01-01

    Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

  17. HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

    Science.gov (United States)

    Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

    2016-01-01

    Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    Science.gov (United States)

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  19. Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    April M Sapp

    Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

  20. Fusion reactor design studies

    International Nuclear Information System (INIS)

    Emmert, G.A.; Kulcinski, G.L.; Santarius, J.F.

    1990-01-01

    This report discusses the following topics on the ARIES tokamak: systems; plasma power balance; impurity control and fusion ash removal; fusion product ripple loss; energy conversion; reactor fueling; first wall design; shield design; reactor safety; and fuel cost and resources

  1. Laser fusion: an overview

    International Nuclear Information System (INIS)

    Boyer, K.

    1975-01-01

    The laser fusion concept is described along with developments in neodymium and carbon dioxide lasers. Fuel design and fabrication are reviewed. Some spin-offs of the laser fusion program are discussed. (U.S.)

  2. Fusion Canada issue 23

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-01-01

    A short bulletin from the National Fusion Program highlighting in this issue TdeV tokamak updates, fusion research in Korea, CCFM program review, TdeV divertor plasma, and CFFTP program review. 4 figs.

  3. Fusion Canada issue 27

    International Nuclear Information System (INIS)

    1995-03-01

    A short bulletin from the National Fusion Program highlighting in this issue ITER reactor siting, a major upgrade for TdeV tokamak, Ceramic Breeders: new tritium mapping technique and Joint Fusion Symposium. 2 figs

  4. Fusion Canada issue 20

    International Nuclear Information System (INIS)

    1993-03-01

    Fusion Canada's publication of the National Fusion Program. Included in this issue is the CFFTP Industrial Impact Study, CCFM/TdeV Update:helium pumping, research funds, and deuterium in beryllium - high temperature behaviour. 3 figs

  5. Fusion Canada issue 23

    International Nuclear Information System (INIS)

    1994-01-01

    A short bulletin from the National Fusion Program highlighting in this issue TdeV tokamak updates, fusion research in Korea, CCFM program review, TdeV divertor plasma, and CFFTP program review. 4 figs

  6. Canada's Fusion Program

    International Nuclear Information System (INIS)

    Jackson, D. P.

    1990-01-01

    Canada's fusion strategy is based on developing specialized technologies in well-defined areas and supplying these technologies to international fusion projects. Two areas are specially emphasized in Canada: engineered fusion system technologies, and specific magnetic confinement and materials studies. The Canadian Fusion Fuels Technology Project focuses on the first of these areas. It tritium and fusion reactor fuel systems, remote maintenance and related safety studies. In the second area, the Centre Canadian de fusion magnetique operates the Tokamak de Varennes, the main magnetic fusion device in Canada. Both projects are partnerships linking the Government of Canada, represented by Atomic Energy of Canada Limited, and provincial governments, electrical utilities, universities and industry. Canada's program has extensive international links, through which it collaborates with the major world fusion programs, including participation in the International Thermonuclear Experimental Reactor project

  7. Fusion systems engineering

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    Information is given on each of the following topics: (1) fusion reactor systems studies, (2) development of blanket processing technology for fusion reactors, (3) safety studies of CTR concepts, and (4) cross section measurements and techniques

  8. Fusion Canada issue 6

    International Nuclear Information System (INIS)

    1989-02-01

    A short bulletin from the National Fusion Program. Included in this issue is a funding report for CFFTP, a technical update for Tokamak de Varennes and a network for university research by the National Fusion Program. 4 figs

  9. Fusion Canada issue 18

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1992-08-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the ITER agreement signed with the EDA, the robotic maintenance for NET, the CFFTP Fusion Pilot Study, the new IEA joint programs on environment, safety and economic aspects of fusion power, and a review by the CCFM advisory committee. 3 figs.

  10. User's perspective on fusion

    International Nuclear Information System (INIS)

    Ashworth, C.P.

    1976-01-01

    The need in fusion, from the electric utilities viewpoint, is for fusion to be a real option, not huge, complicated nuclear plants costing $10 billion each and requiring restructuring the energy industry to provide and use them. A course for future fusion reactor work in order to be a real option is discussed. The advantages of alternate concepts to the tokamak are presented

  11. Fusion Canada issue 17

    International Nuclear Information System (INIS)

    1992-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on increased funding for the Canadian Fusion Program, news of the compact Toroid fuelling gun, an update on Tokamak de Varennes, the Canada - U.S. fusion meeting, measurements of plasma flow velocity, and replaceable Tokamak divertors. 4 figs

  12. Fusion Canada issue 18

    International Nuclear Information System (INIS)

    1992-08-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the ITER agreement signed with the EDA, the robotic maintenance for NET, the CFFTP Fusion Pilot Study, the new IEA joint programs on environment, safety and economic aspects of fusion power, and a review by the CCFM advisory committee. 3 figs

  13. CO2-laser fusion

    International Nuclear Information System (INIS)

    Stark, E.E. Jr.

    1978-01-01

    The basic concept of laser fusion is described, with a set of requirements on the laser system. Systems and applications concepts are presented and discussed. The CO 2 laser's characteristics and advantages for laser fusion are described. Finally, technological issues in the development of CO 2 laser systems for fusion applications are discussed

  14. Fusion Canada issue 9

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-11-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on availability of Canadian Tritium, an ITER update, a CCFM update on Tokamak and the new team organization, an international report on Fusion in Canada and a Laser Fusion Project at the University of Toronto. 3 figs.

  15. Heavy ion fusion

    International Nuclear Information System (INIS)

    Bangerter, R.O.

    1986-01-01

    This report on the International Symposium on Heavy Ion Fusion held May 27-29, 1986 summarizes the problems and achievements in the areas of targets, accelerators, focussing, reactor studies, and system studies. The symposium participants recognize that there are large uncertainties in Heavy Ion Fusion but many of them are also optimistic that HIF may ultimately be the best approach to fusion

  16. Fusion Canada issue 17

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1992-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on increased funding for the Canadian Fusion Program, news of the compact Toroid fuelling gun, an update on Tokamak de Varennes, the Canada - U.S. fusion meeting, measurements of plasma flow velocity, and replaceable Tokamak divertors. 4 figs.

  17. Fusion Canada issue 25

    International Nuclear Information System (INIS)

    1994-08-01

    A short bulletin from the National Fusion Program highlighting in this issue an economic impact study of the Canadian site for ITER, Harvey Skarsgard: fusion pioneer retires, NFP: Phillips and Holtslander exchange roles, Europe's fusion funding proposals and an update of CCFM/TdeV. 1 fig

  18. Fusion reactors - types - problems

    International Nuclear Information System (INIS)

    Schmitter, K.H.

    1979-07-01

    A short account is given of the principles of fusion reactions and of the expected advantages of fusion reactors. Descriptions are presented of various Tokamak experimental devices being developed in a number of countries and of some mirror machines. The technical obstacles to be overcome before a fusion reactor could be self-supporting are discussed. (U.K.)

  19. Cold fusion research

    International Nuclear Information System (INIS)

    1989-11-01

    I am pleased to forward to you the Final Report of the Cold Fusion Panel. This report reviews the current status of cold fusion and includes major chapters on Calorimetry and Excess Heat, Fusion Products and Materials Characterization. In addition, the report makes a number of conclusions and recommendations, as requested by the Secretary of Energy

  20. Fusion Canada issue 9

    International Nuclear Information System (INIS)

    1989-11-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on availability of Canadian Tritium, an ITER update, a CCFM update on Tokamak and the new team organization, an international report on Fusion in Canada and a Laser Fusion Project at the University of Toronto. 3 figs

  1. Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

    Science.gov (United States)

    Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

    2014-01-01

    Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

  2. Viral membrane fusion

    International Nuclear Information System (INIS)

    Harrison, Stephen C.

    2015-01-01

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism

  3. Viral membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, Stephen C., E-mail: harrison@crystal.harvard.edu

    2015-05-15

    Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formed draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.

  4. Fusion technology 1992

    International Nuclear Information System (INIS)

    Ferro, C.; Gasparatto, M.; Knoepfel, H.

    1993-01-01

    The aim of the biennial series of symposia on the title subject, organized by the European Fusion Laboratories, is the exchange of information on the design, construction and operation of fusion experiments and on the technology being developed for the next step devices and fusion reactors. The coverage of the volume includes the technological aspects of fusion reactors in relation to new developments, this forming a guideline for the definition of future work. These proceedings comprise three volumes and contain both the invited lectures and contributed papers presented at the symposium which was attended by 569 participants from around the globe. The 343 papers, including 12 invited papers, characterize the increasing interest of industry in the fusion programme, giving a broad and current overview on the progress and trends fusion technology is experiencing now, as well as indicating the future for fusion devices

  5. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    Science.gov (United States)

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  6. The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2008-01-01

    The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

  7. Economics of fusion research

    International Nuclear Information System (INIS)

    1977-01-01

    This report provides the results of a study of methods of economic analysis applied to the evaluation of fusion research. The study recognizes that a hierarchy of economic analyses of research programs exists: standard benefit-cost analysis, expected value of R and D information, and expected utility analysis. It is shown that standard benefit-cost analysis, as commonly applied to research programs, is inadequate for the evaluation of a high technology research effort such as fusion research. A methodology for performing an expected value analysis is developed and demonstrated and an overview of an approach to perform an expected utility analysis of fusion research is presented. In addition, a potential benefit of fusion research, not previously identified, is discussed and rough estimates of its magnitude are presented. This benefit deals with the effect of a fusion research program on optimal fossil fuel consumption patterns. The results of this study indicate that it is both appropriate and possible to perform an expected value analysis of fusion research in order to assess the economics of a fusion research program. The results indicate further that the major area of benefits of fusion research is likely due to the impact of a fusion research program on optimal fossil fuel consumption patterns and it is recommended that this benefit be included in future assessments of fusion research economics

  8. Economics of fusion research

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    1977-10-15

    This report provides the results of a study of methods of economic analysis applied to the evaluation of fusion research. The study recognizes that a hierarchy of economic analyses of research programs exists: standard benefit-cost analysis, expected value of R and D information, and expected utility analysis. It is shown that standard benefit-cost analysis, as commonly applied to research programs, is inadequate for the evaluation of a high technology research effort such as fusion research. A methodology for performing an expected value analysis is developed and demonstrated and an overview of an approach to perform an expected utility analysis of fusion research is presented. In addition, a potential benefit of fusion research, not previously identified, is discussed and rough estimates of its magnitude are presented. This benefit deals with the effect of a fusion research program on optimal fossil fuel consumption patterns. The results of this study indicate that it is both appropriate and possible to perform an expected value analysis of fusion research in order to assess the economics of a fusion research program. The results indicate further that the major area of benefits of fusion research is likely due to the impact of a fusion research program on optimal fossil fuel consumption patterns and it is recommended that this benefit be included in future assessments of fusion research economics.

  9. Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

    DEFF Research Database (Denmark)

    Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

    2005-01-01

    Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

  10. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

    Directory of Open Access Journals (Sweden)

    Orlando Díaz-Hernández

    2010-07-01

    Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  11. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

    Science.gov (United States)

    Díaz-Hernández, Orlando; Santillán, Moisés

    2010-01-01

    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  12. stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

    Science.gov (United States)

    Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

    2015-07-07

    Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

  13. Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

    Science.gov (United States)

    Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

    2017-11-01

    Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

  14. Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

    Science.gov (United States)

    2012-01-01

    Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

  15. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  16. Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

    Science.gov (United States)

    Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

    2001-01-01

    Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

  17. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

    Science.gov (United States)

    Kim, Dae Hun; Ko, Kwan Soo

    2015-07-01

    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

    Science.gov (United States)

    Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

    2016-05-01

    Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

    Science.gov (United States)

    de Oliveira, Rafael R; Nicholson, Wayne L

    2016-01-01

    To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

  20. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

    Science.gov (United States)

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

    2017-05-01

    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  1. Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

    Science.gov (United States)

    Kim, Moonjeong; Kim, Kwang-Sun

    2017-07-06

    The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

    Science.gov (United States)

    Boyd, D A; Mulvey, M R

    2013-02-01

    To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

  3. Recycling fusion materials

    International Nuclear Information System (INIS)

    Ooms, L.

    2005-01-01

    The inherent safety and environmental advantages of fusion power in comparison with other energy sources play an important role in the public acceptance. No waste burden for future generations is therefore one of the main arguments to decide for fusion power. The waste issue has thus been studied in several documents and the final conclusion of which it is stated that there is no permanent disposal waste needed if recycling is applied. But recycling of fusion reactor materials is far to be obvious regarding mostly the very high specific activity of the materials to be handled, the types of materials and the presence of tritium. The main objective of research performed by SCK-CEN is to study the possible ways of recycling fusion materials and analyse the challenges of the materials management from fusion reactors, based on current practices used in fission reactors and the requirements for the manufacture of fusion equipment

  4. The controlled thermonuclear fusion

    International Nuclear Information System (INIS)

    Barre, Bertrand

    2014-01-01

    After some generalities on particle physics, and on fusion and fission reactions, the author outlines that the fission reaction is easier to obtain than the fusion reaction, evokes the fusion which takes place in stars, and outlines the difficulty to manage and control this reaction: one of its application is the H bomb. The challenge is therefore to find a way to control this reaction and make it a steady and continuous source of energy. The author then presents the most promising way: the magnetic confinement fusion. He evokes its main issues, the already performed experiments (tokamak), and gives a larger presentation of the ITER project. Then, he evokes another way, the inertial confinement fusion, and the two main experimental installations (National Ignition Facility in Livermore, and the Laser Megajoule in Bordeaux). Finally, he gives a list of benefits and drawbacks of an industrial nuclear fusion

  5. Laser fusion overview

    International Nuclear Information System (INIS)

    Nuckolls, J.

    1976-01-01

    Because of recent breakthroughs in the target area, and in the glass laser area, the scientific feasibility of laser fusion--and of inertial fusion--may be demonstrated in the early 1980's. Then the development in that time period of a suitable laser (or storage ring or other driving source) would make possible an operational inertial fusion reactor in this century. These are roughly the same time scales as projected by the Tokamak magnetic confinement approach. It thus appears that the 15-20 year earlier start by magnetic confinement fusion may be overcome. Because inertial confinement has been demonstrated, and inertial fusion reactors may operate on smaller scales than Tokamaks, laser fusion may have important technical and economic advantages

  6. Synthetic fuels and fusion

    Energy Technology Data Exchange (ETDEWEB)

    Fillo, J A; Powell, J; Steinberg, M [Brookhaven National Lab., Upton, NY (USA)

    1981-03-01

    The decreasing availability of fossil fuels emphasizes the need to develop systems which will produce synthetic fuel to substitute for and supplement the natural supply. An important first step in the synthesis of liquid and gaseous fuels is the production of hydrogen. Thermonuclear fusion offers an inexhaustible source of energy for the production of hydrogen from water. Depending on design, electric generation efficiencies of approx. equal to 40-60% and hydrogen production efficiencies by high temperature electrolysis of approx. equal to 50-70% are projected for fusion reactors using high temperature blankets. Fusion/coal symbiotic systems appear economically promising for the first generation of commercial fusion synfuels plants. Coal production requirements and the environmental effects of large-scale coal usage would be greatly reduced by a fusion/coal system. In the long-term, there could be a gradual transition to an inexhaustible energy system based solely on fusion.

  7. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.

    Science.gov (United States)

    Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M

    2016-09-12

    The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .

  8. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Directory of Open Access Journals (Sweden)

    Løvdal Irene S

    2012-03-01

    Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

  9. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Science.gov (United States)

    2012-01-01

    Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

  10. Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

    Science.gov (United States)

    Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

    2002-01-01

    Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

  11. Magnetic-fusion program

    International Nuclear Information System (INIS)

    1980-08-01

    In February 1980, the Director of Energy Research requested that the Energy Research Advisory Board (ERAB) review the Department of Energy (DOE) Magnetic Fusion Program. Of particular concern to the DOE was the judicious choice of the next major steps toward demonstration of economic power production from fusion. Of equal concern was the overall soundness of the DOE Magnetic Fusion Program: its pace, scope, and funding profiles. Their finding and recommendations are included

  12. Magnetic fusion technology

    CERN Document Server

    Dolan, Thomas J

    2014-01-01

    Magnetic Fusion Technology describes the technologies that are required for successful development of nuclear fusion power plants using strong magnetic fields. These technologies include: ? magnet systems, ? plasma heating systems, ? control systems, ? energy conversion systems, ? advanced materials development, ? vacuum systems, ? cryogenic systems, ? plasma diagnostics, ? safety systems, and ? power plant design studies. Magnetic Fusion Technology will be useful to students and to specialists working in energy research.

  13. Status of fusion maintenance

    International Nuclear Information System (INIS)

    Fuller, G.M.

    1984-01-01

    Effective maintenance will be an essential ingredient in determining fusion system productivity. This level of productivity will result only after close attention is paid to the entire system as an entity and appropriate integration of the elements is made. The status of fusion maintenance is reviewed in the context of the entire system. While there are many challenging developmental tasks ahead in fusion maintenance, the required technologies are available in several high-technology industries, including nuclear fission

  14. Membrane fusion and exocytosis.

    Science.gov (United States)

    Jahn, R; Südhof, T C

    1999-01-01

    Membrane fusion involves the merger of two phospholipid bilayers in an aqueous environment. In artificial lipid bilayers, fusion proceeds by means of defined transition states, including hourglass-shaped intermediates in which the proximal leaflets of the fusing membranes are merged whereas the distal leaflets are separate (fusion stalk), followed by the reversible opening of small aqueous fusion pores. Fusion of biological membranes requires the action of specific fusion proteins. Best understood are the viral fusion proteins that are responsible for merging the viral with the host cell membrane during infection. These proteins undergo spontaneous and dramatic conformational changes upon activation. In the case of the paradigmatic fusion proteins of the influenza virus and of the human immunodeficiency virus, an amphiphilic fusion peptide is inserted into the target membrane. The protein then reorients itself, thus forcing the fusing membranes together and inducing lipid mixing. Fusion of intracellular membranes in eukaryotic cells involves several protein families including SNAREs, Rab proteins, and Sec1/Munc-18 related proteins (SM-proteins). SNAREs form a novel superfamily of small and mostly membrane-anchored proteins that share a common motif of about 60 amino acids (SNARE motif). SNAREs reversibly assemble into tightly packed helical bundles, the core complexes. Assembly is thought to pull the fusing membranes closely together, thus inducing fusion. SM-proteins comprise a family of soluble proteins that bind to certain types of SNAREs and prevent the formation of core complexes. Rab proteins are GTPases that undergo highly regulated GTP-GDP cycles. In their GTP form, they interact with specific proteins, the effector proteins. Recent evidence suggests that Rab proteins function in the initial membrane contact connecting the fusing membranes but are not involved in the fusion reaction itself.

  15. Fusion facility siting considerations

    International Nuclear Information System (INIS)

    Bussell, G.T.

    1985-01-01

    Inherent in the fusion program's transition from hydrogen devices to commercial power machines is a general increase in the size and scope of succeeding projects. This growth will lead to increased emphasis on safety, environmental impact, and the external effects of fusion in general, and of each new device in particular. A critically important consideration in this regard is site selection. The purpose of this paper is to examine major siting issues that may affect the economics, safety, and environmental impact of fusion

  16. Fusion research principles

    CERN Document Server

    Dolan, Thomas James

    2013-01-01

    Fusion Research, Volume I: Principles provides a general description of the methods and problems of fusion research. The book contains three main parts: Principles, Experiments, and Technology. The Principles part describes the conditions necessary for a fusion reaction, as well as the fundamentals of plasma confinement, heating, and diagnostics. The Experiments part details about forty plasma confinement schemes and experiments. The last part explores various engineering problems associated with reactor design, vacuum and magnet systems, materials, plasma purity, fueling, blankets, neutronics

  17. Nuclear fusion power

    International Nuclear Information System (INIS)

    Dinghee, D.A.

    1983-01-01

    In this chapter, fusion is compared with other inexhaustible energy sources. Research is currently being conducted both within and outside the USA. The current confinement principles of thermonuclear reactions are reveiwed with the discussion of economics mainly focusing on the magnetic confinement concepts. Environmental, health and safety factors are of great concern to the public and measures are being taken to address them. The magnetic fusion program logic and the inertial fusion program logic are compared

  18. Inertial confinement fusion (ICF)

    International Nuclear Information System (INIS)

    Nuckolls, J.

    1977-01-01

    The principal goal of the inertial confinement fusion program is the development of a practical fusion power plant in this century. Rapid progress has been made in the four major areas of ICF--targets, drivers, fusion experiments, and reactors. High gain targets have been designed. Laser, electron beam, and heavy ion accelerator drivers appear to be feasible. Record-breaking thermonuclear conditions have been experimentally achieved. Detailed diagnostics of laser implosions have confirmed predictions of the LASNEX computer program. Experimental facilities are being planned and constructed capable of igniting high gain fusion microexplosions in the mid 1980's. A low cost long lifetime reactor design has been developed

  19. Inertial fusion energy

    International Nuclear Information System (INIS)

    Decroisette, M.; Andre, M.; Bayer, C.; Juraszek, D.; Le Garrec, B.; Deutsch, C.; Migus, A.

    2005-01-01

    We first recall the scientific basis of inertial fusion and then describe a generic fusion reactor with the different components: the driver, the fusion chamber, the material treatment unit, the target factory and the turbines. We analyse the options proposed at the present time for the driver and for target irradiation scheme giving the state of art for each approach. We conclude by the presentation of LMJ (laser Megajoule) and NIF (national ignition facility) projects. These facilities aim to demonstrate the feasibility of laboratory DT ignition, first step toward Inertial Fusion Energy. (authors)

  20. Laser fusion program overview

    International Nuclear Information System (INIS)

    Emmett, J.L.

    1977-01-01

    This program is structured to proceed through a series of well defined fusion milestones to proof of the scientific feasibility, of laser fusion with the Shiva Nova system. Concurrently, those key technical areas, such as advanced lasers, which are required to progress beyond proof of feasibility, are being studied. We have identified and quantified the opportunities and key technical issues in military applications, such as weapons effects simulations, and in civilian applications, such as central-station electric power production. We summarize the current status and future plans for the laser fusion program at LLL, emphasizing the civilian applications of laser fusion

  1. Frontiers in fusion research

    CERN Document Server

    Kikuchi, Mitsuru

    2011-01-01

    Frontiers in Fusion Research provides a systematic overview of the latest physical principles of fusion and plasma confinement. It is primarily devoted to the principle of magnetic plasma confinement, that has been systematized through 50 years of fusion research. Frontiers in Fusion Research begins with an introduction to the study of plasma, discussing the astronomical birth of hydrogen energy and the beginnings of human attempts to harness the Sun's energy for use on Earth. It moves on to chapters that cover a variety of topics such as: * charged particle motion, * plasma kinetic theory, *

  2. Fusion of Nonionic Vesicles

    DEFF Research Database (Denmark)

    Bulut, Sanja; Oskolkova, M. Z.; Schweins, R.

    2010-01-01

    We present an experimental study of vesicle fusion using light and neutron scattering to monitor fusion events. Vesicles are reproducibly formed with an extrusion procedure using an single amphiphile triethylene glycol mono-n-decyl ether in water. They show long-term stability for temperatures ar...... a barrier to fusion changing from 15 k(B)T at T = 26 degrees C to 10k(H) T at T = 35 degrees C. These results are compatible with the theoretical predictions using the stalk model of vesicle fusion....

  3. Fusion reactor safety

    International Nuclear Information System (INIS)

    1987-12-01

    Nuclear fusion could soon become a viable energy source. Work in plasma physics, fusion technology and fusion safety is progressing rapidly in a number of Member States and international collaboration continues on work aiming at the demonstration of fusion power generation. Safety of fusion reactors and technological and radiological aspects of waste management are important aspects in the development and design of fusion machines. In order to provide an international forum to review and discuss the status and the progress made since 1983 in programmes related to operational safety aspects of fusion reactors, their waste management and decommissioning concepts, the IAEA had organized the Technical Committee on ''Fusion Reactor Safety'' in Culham, 3-7 November 1986. All presentations of this meeting were divided into four sessions: 1. Statements on National-International Fusion Safety Programmes (5 papers); 2. Operation and System Safety (15 papers); 3. Waste Management and Decommissioning (5 papers); 4. Environmental Impacts (6 papers). A separate abstract was prepared for each of these 31 papers. Refs, figs, tabs

  4. Magnetic fusion reactor economics

    International Nuclear Information System (INIS)

    Krakowski, R.A.

    1995-01-01

    An almost primordial trend in the conversion and use of energy is an increased complexity and cost of conversion systems designed to utilize cheaper and more-abundant fuels; this trend is exemplified by the progression fossil fission → fusion. The present projections of the latter indicate that capital costs of the fusion ''burner'' far exceed any commensurate savings associated with the cheapest and most-abundant of fuels. These projections suggest competitive fusion power only if internal costs associate with the use of fossil or fission fuels emerge to make them either uneconomic, unacceptable, or both with respect to expensive fusion systems. This ''implementation-by-default'' plan for fusion is re-examined by identifying in general terms fusion power-plant embodiments that might compete favorably under conditions where internal costs (both economic and environmental) of fossil and/or fission are not as great as is needed to justify the contemporary vision for fusion power. Competitive fusion power in this context will require a significant broadening of an overly focused program to explore the physics and simbiotic technologies leading to more compact, simplified, and efficient plasma-confinement configurations that reside at the heart of an attractive fusion power plant

  5. Incomplete fusion studies

    International Nuclear Information System (INIS)

    Singh, B.P.

    2011-01-01

    In order to study the incomplete fusion reaction dynamics at energies ≅ 4-7 MeV/nucleon, several experiments have been carried out using accelerator facilities available in India. The measurements presented here cover a wide range of projectile-target combinations and enhance significantly our knowledge about incomplete fusion reaction dynamics. Here, the three sets of measurements have been presented; (i) excitation functions, (ii) forward recoil range distributions and (iii) the spin distributions. The first evidence of these reactions has been obtained from the measurement and analysis of excitation functions for xn/αxn/2αxn-channels. The measured excitation functions have been analyzed within the framework of compound nucleus model. The results obtained indicate the occurrence of fusion incompleteness at low beam energies. However, in order to determine the relative contribution of complete and incomplete fusion reaction processes, the recoil range distributions of the heavy residues have also been measured and analyzed within the framework of breakup fusion model which confirmed the fusion incompleteness in several heavy ion reactions involving α-emitting reaction channels. Further, in order to study the role of l-values in these reactions the spin distributions of the residues populated in case of complete and incomplete channels have been measured and are found to be distinctly different. The analysis of the data on spin distribution measurements indicate that the mean values of driving input angular momenta associated with direct-α-emitting (incomplete fusion) channels are higher than that observed for fusion-evaporation xn or α-emitting (complete fusion) channels, and is found to increase with direct α-multiplicity in the forward cone. One of the important conclusions drawn in the present work is that, there is significant incomplete fusion contribution even at energies slightly above the barrier. Further, the projectile structure has been found to

  6. The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

    2014-01-01

    Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

  7. Mirror fusion--fission hybrids

    International Nuclear Information System (INIS)

    Lee, J.D.

    1978-01-01

    The fusion-fission concept and the mirror fusion-fission hybrid program are outlined. Magnetic mirror fusion drivers and blankets for hybrid reactors are discussed. Results of system analyses are presented and a reference design is described

  8. Cell fusion and nuclear fusion in plants.

    Science.gov (United States)

    Maruyama, Daisuke; Ohtsu, Mina; Higashiyama, Tetsuya

    2016-12-01

    Eukaryotic cells are surrounded by a plasma membrane and have a large nucleus containing the genomic DNA, which is enclosed by a nuclear envelope consisting of the outer and inner nuclear membranes. Although these membranes maintain the identity of cells, they sometimes fuse to each other, such as to produce a zygote during sexual reproduction or to give rise to other characteristically polyploid tissues. Recent studies have demonstrated that the mechanisms of plasma membrane or nuclear membrane fusion in plants are shared to some extent with those of yeasts and animals, despite the unique features of plant cells including thick cell walls and intercellular connections. Here, we summarize the key factors in the fusion of these membranes during plant reproduction, and also focus on "non-gametic cell fusion," which was thought to be rare in plant tissue, in which each cell is separated by a cell wall. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. The fusion reactor

    International Nuclear Information System (INIS)

    Brennan, M.H.

    1974-01-01

    Basic principles of the fusion reactor are outlined. Plasma heating and confinement schemes are described. These confinement systems include the linear Z pinch, magnetic mirrors and Tokamaks. A fusion reactor is described and a discussion is given of its environmental impact and its fuel situation. (R.L.)

  10. Fusion Canada issue 8

    International Nuclear Information System (INIS)

    1989-08-01

    A short bulletin from the National Fusion Program. Included in this issue are Canada-ITER contributions, NET Fuel Processing Loop, Bilateral Meeting for Canada-Europe, report from Tokamak de Varennes and a report from the University of Toronto on materials research for Fusion Reactors. 3 figs

  11. Fusion Canada issue 15

    International Nuclear Information System (INIS)

    1991-10-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the 1996 IAEA Fusion Conference site, operations at the Tokamak de Varennes including divertor pumping of impurities and pumping of carbon monoxide and methane, a discussion of the CFFTP and it's role. 1 fig

  12. Energy by nuclear fusion

    International Nuclear Information System (INIS)

    Buende, R.; Daenner, W.; Herold, H.; Raeder, J.

    1976-12-01

    This report reviews the state of knowledge in a number of fields of fusion research up to autumn 1976. Section 1 gives a very brief presentation of the elementary fusion reactions, the energies delivered by them and the most basic energy balances leading to Lawson-type diagrams. Section 2 outlines the reserves and cost of lithium and deuterium, gives estimates of the total energy available from DT fusion and comments on production technology, availlability and handling of the fuels. In section 3 a survey is given of the different concepts of magnetic confinement (stellarators, tokamaks, toroidal pinches, mirror machines, two-component plasmas), of confinement by walls, gas blankets and imploding liners and, finally, of the concepts of interial confinement (laser fusion, beam fusion). The reactors designed or outlined on the basis of the tokamak, high-β, mirror, and laser fusion concepts are presented in section 4, which is followed in section 5 by a discussion of the key problems of fusion power plants. The present-day knowledge of the cost structure of fusion power plants and the sensitivity of this structure with respect to the physical and technical assumptions made is analysed in section 6. Section 7 and 8 treat the aspects of safety and environment. The problems discussed include the hazard potentials of different designs (radiological, toxicological, and with respect to stored energies), release of radioactivity, possible kinds of malfunctioning, and the environmental impact of waste heat, radiation and radioactive waste (orig.) [de

  13. Fusion helps diversification

    NARCIS (Netherlands)

    Liang, S.; Ren, Z.; de Rijke, M.

    2014-01-01

    A popular strategy for search result diversification is to first retrieve a set of documents utilizing a standard retrieval method and then rerank the results. We adopt a different perspective on the problem, based on data fusion. Starting from the hypothesis that data fusion can improve performance

  14. Fusion Canada issue 22

    International Nuclear Information System (INIS)

    1993-10-01

    A short bulletin from the National Fusion Program highlighting in this issue a bi-lateral meeting between Canada and Japan, water and hydrogen detritiation, in-situ tokamak surface analysis, an update of CCFM/TdeV and tritium accounting Industry guidance in Fusion, fast probe for plasma-surface interaction. 4 figs

  15. International fusion research council

    International Nuclear Information System (INIS)

    Belozerov, A.N.

    1977-01-01

    A brief history of the International Fusion Research Council (IFRC) is given and the minutes of the 1976 meeting in Garching are summarized. At the Garching meeting, the IFRC evaluated the quality of papers presented at recent IAEA conferences on plasma physics and controlled thermonuclear research, and made recommendations on the organization and timing of future meetings on nuclear fusion

  16. Fusion Canada issue 15

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1991-10-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the 1996 IAEA Fusion Conference site, operations at the Tokamak de Varennes including divertor pumping of impurities and pumping of carbon monoxide and methane, a discussion of the CFFTP and it`s role. 1 fig.

  17. Magnetic Fusion Program Plan

    International Nuclear Information System (INIS)

    1985-02-01

    This Plan reflects the present conditions of the energy situation and is consistent with national priorities for the support of basic and applied research. It is realistic in taking advantage of the technical position that the United States has already established in fusion research to make cost-effective progress toward the development of fusion power as a future energy option

  18. Fusion Canada issue 8

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-08-01

    A short bulletin from the National Fusion Program. Included in this issue are Canada-ITER contributions, NET Fuel Processing Loop, Bilateral Meeting for Canada-Europe, report from Tokamak de Varennes and a report from the University of Toronto on materials research for Fusion Reactors. 3 figs.

  19. Sensor Data Fusion

    DEFF Research Database (Denmark)

    Plascencia, Alfredo; Stepán, Petr

    2006-01-01

    The main contribution of this paper is to present a sensor fusion approach to scene environment mapping as part of a Sensor Data Fusion (SDF) architecture. This approach involves combined sonar array with stereo vision readings.  Sonar readings are interpreted using probability density functions...

  20. Coatings for laser fusion

    International Nuclear Information System (INIS)

    Lowdermilk, W.H.

    1981-01-01

    Optical coatings are used in lasers systems for fusion research to control beam propagation and reduce surface reflection losses. The performance of coatings is important in the design, reliability, energy output, and cost of the laser systems. Significant developments in coating technology are required for future lasers for fusion research and eventual power reactors

  1. Fusion reactor materials

    International Nuclear Information System (INIS)

    Sethi, V.K.; Scholz, R.; Nolfi, F.V. Jr.; Turner, A.P.L.

    1980-01-01

    Data are given for each of the following areas: (1) effects of irradiation on fusion reactor materials, (2) hydrogen permeation and materials behavior in alloys, (3) carbon coatings for fusion applications, (4) surface damage of TiB 2 coatings under energetic D + and 4 He + irradiations, and (5) neutron dosimetry

  2. The IGNITEX fusion project

    International Nuclear Information System (INIS)

    Carrera, R.

    1987-01-01

    The author discusses the recently proposed fusion ignition experiment, IGNITEX. He emphasizes the basic ideas of this concept rather than the specific details of the physics and engineering aspects of the experiment. This concept is a good example of the importance of maintaining an adequate balance between the basic scientific progress in fusion physics and the new technologies that are becoming available in order to make fusion work. The objective of the IGNITEX project is to produce and control ignited plasmas for scientific study in the simplest and least expensive way possible. Being able to study this not-yet-produced regime of plasma operation is essential to fusion research. Two years after the fission nuclear reaction was discovered, a non-self-sustained fission reaction was produced in a laboratory, and in one more year a self-sustained reaction was achieved at the University of Chicago. However, after almost forty years of fusion research, a self-sustained fusion reaction has yet not been produced in a laboratory experiment. This fact indicates the greater difficulty of the fusion experiment. Because of the difficulty involved in the production of a self-sustained fusion reaction, it is necessary to propose such an experiment with maximum ignition margins, maximum simplicity, and minimum financial risk

  3. Controlled thermonuclear fusion

    CERN Document Server

    Bobin, Jean Louis

    2014-01-01

    The book is a presentation of the basic principles and main achievements in the field of nuclear fusion. It encompasses both magnetic and inertial confinements plus a few exotic mechanisms for nuclear fusion. The state-of-the-art regarding thermonuclear reactions, hot plasmas, tokamaks, laser-driven compression and future reactors is given.

  4. Fusion Power Deployment

    International Nuclear Information System (INIS)

    Schmidt, J.A.; Ogden, J.M.

    2002-01-01

    Fusion power plants could be part of a future portfolio of non-carbon dioxide producing energy supplies such as wind, solar, biomass, advanced fission power, and fossil energy with carbon dioxide sequestration. In this paper, we discuss key issues that could impact fusion energy deployment during the last half of this century. These include geographic issues such as resource availability, scale issues, energy storage requirements, and waste issues. The resource needs and waste production associated with fusion deployment in the U.S. should not pose serious problems. One important feature of fusion power is the fact that a fusion power plant should be locatable within most local or regional electrical distribution systems. For this reason, fusion power plants should not increase the burden of long distance power transmission to our distribution system. In contrast to fusion power, regional factors could play an important role in the deployment of renewable resources such as wind, solar and biomass or fossil energy with CO2 sequestration. We examine the role of these regional factors and their implications for fusion power deployment

  5. Fusion Canada issue 4

    International Nuclear Information System (INIS)

    1988-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a technical update on Tokamak de Varennes, a report on the Beatrix II Breeding Materials Test Program, the Tritium glovebox system for UPM, Saudi Arabia, a broad update of the Canadian Fusion Fuels Technology Project is also included. 1 fig

  6. Fusion Canada issue 12

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-10-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on Darlington`s Tritium Removal Facility, work at universities on Deuterium Diffusivity in Beryllium, Fusion Studies, confinement research and the operation of divertors at Tokamak de Varennes. 5 figs.

  7. Fusion Canada issue 22

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1993-10-01

    A short bulletin from the National Fusion Program highlighting in this issue a bi-lateral meeting between Canada and Japan, water and hydrogen detritiation, in-situ tokamak surface analysis, an update of CCFM/TdeV and tritium accounting Industry guidance in Fusion, fast probe for plasma-surface interaction. 4 figs.

  8. Fusion Canada issue 4

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1988-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a technical update on Tokamak de Varennes, a report on the Beatrix II Breeding Materials Test Program, the Tritium glovebox system for UPM, Saudi Arabia, a broad update of the Canadian Fusion Fuels Technology Project is also included. 1 fig.

  9. Fusion Canada issue 19

    International Nuclear Information System (INIS)

    1992-12-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on the IAEA Plasma Biasing Meeting, the new IEA program -Nuclear Technology of Fusion reactors, TFTR tritium purification system, an update by CCFM on machine additions and modifications, and news of a new compact Toroid injector at the University of Saskatchewan. 1 fig

  10. Fusion Canada issue 14

    International Nuclear Information System (INIS)

    1991-05-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on a fusion cooperation agreement between Japan and Canada, an update at Tokamak de Varennes on plasma biasing experiments and boronization tests and a collaboration between Canada and the U.S. on a compact toroid fuelling gun. 4 figs

  11. Fusion Canada issue 12

    International Nuclear Information System (INIS)

    1990-10-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on Darlington's Tritium Removal Facility, work at universities on Deuterium Diffusivity in Beryllium, Fusion Studies, confinement research and the operation of divertors at Tokamak de Varennes. 5 figs

  12. Controlled Nuclear Fusion.

    Science.gov (United States)

    Glasstone, Samuel

    This publication is one of a series of information booklets for the general public published by The United States Atomic Energy Commission. Among the topics discussed are: Importance of Fusion Energy; Conditions for Nuclear Fusion; Thermonuclear Reactions in Plasmas; Plasma Confinement by Magnetic Fields; Experiments With Plasmas; High-Temperature…

  13. Industry's role in inertial fusion

    International Nuclear Information System (INIS)

    Glass, A.J.

    1983-01-01

    This paper is an address to the Tenth Symposium on Fusion Engineering. The speaker first addressed the subject of industry's role in inertial fusion three years earlier in 1980, outlining programs that included participation in the Shiva construction project, and the industrial participants' program set up in the laser fusion program to bring industrial scientists and engineers into the laboratory to work on laser fusion. The speaker is now the president of KMS Fusion, Inc., the primary industrial participant in the inertial fusion program. The outlook for fusion energy and the attitude of the federal government toward the fusion program is discussed

  14. Towards fusion power

    International Nuclear Information System (INIS)

    Venkataraman, G.

    1975-01-01

    An attempt has been made to present general but broad review of the recent developments in the field of plasma physics and its application to fusion power. The first chapter describes the fusion reactions and fusion power systems. The second chapter deals in detail with production and behaviour of plasma, screening, oscillations, instability, energy losses, temperature effects, etc. Magnetic confinements, including pinch systems, toroidal systems such as Tokamac and stellarator, minor machine, etc. are discussed in detail in chapter III. Laser produced plasma, laser implosion and problems associated with it and future prospects are explained in chapter IV. Chapter V is devoted entirely to the various aspects of hybrid systems. The last chapter throws light on problems of fusion technology, such as plasma heating, vacuum requirements, radiation damage, choice of materials, blanket problems, hazards of fusion reactions, etc. (K.B.)

  15. Fusion fuel blanket technology

    International Nuclear Information System (INIS)

    Hastings, I.J.; Gierszewski, P.

    1987-05-01

    The fusion blanket surrounds the burning hydrogen core of a fusion reactor. It is in this blanket that most of the energy released by the nuclear fusion of deuterium-tritium is converted into useful product, and where tritium fuel is produced to enable further operation of the reactor. As fusion research turns from present short-pulse physics experiments to long-burn engineering tests in the 1990's, energy removal and tritium production capabilities become important. This technology will involve new materials, conditions and processes with applications both to fusion and beyond. In this paper, we introduce features of proposed blanket designs and update and status of international research. In focusing on the Canadian blanket technology program, we discuss the aqueous lithium salt blanket concept, and the in-reactor tritium recovery test program

  16. Decomposition of incomplete fusion

    International Nuclear Information System (INIS)

    Sobotka, L.B.; Sarantities, D.G.; Stracener, D.W.; Majka, Z.; Abenante, V.; Semkow, T.M.; Hensley, D.C.; Beene, J.R.; Halbert, M.L.

    1989-01-01

    The velocity distribution of fusion-like products formed in the reaction 701 MeV 28 Si+ 100 Mo is decomposed into 26 incomplete fusion channels. The momentum deficit of the residue per nonevaporative mass unit is approximately equal to the beam momentum per nucleon. The yields of the incomplete fusion channels correlate with the Q-value for projectile fragmentation rather than that for incomplete fusion. The backward angle multiplicities of light particles and heavy ions increase with momentum transfer, however, the heavy ion multiplicities also depend on the extent of the fragmentation of the incomplete fusion channel. These data indicate that at fixed linear momentum transfer, increased fragmentation of the unfused component is related to a reduced transferred angular momentum. 22 refs., 6 figs., 1 tab

  17. Nuclear fusion: The issues

    International Nuclear Information System (INIS)

    Griffin, R.D.

    1993-01-01

    The taming of fusion energy, has proved one of the most elusive quests of modern science. For four decades, the United States has doggedly pursued energy's holy grail, pumping more than $9 billion into research and reactor prototypes. This year, the federal government is slated to spend $339 million on fusion, more than the combined amount the government will spend for research on oil, natural gas, solar power, wind power, geothermal energy, biofuels and conservation. This article summarizes the technical, political in terms of international cooperation, economic, planning, etc. issues surrounding the continued development of fusion as a possible power source for the next century. Brief descriptions of how fusion works and of the design of a tokamak fusion machine are included

  18. Fusion safety data base

    International Nuclear Information System (INIS)

    Laats, E.T.; Hardy, H.A.

    1983-01-01

    The purpose of this Fusion Safety Data Base Program is to provide a repository of data for the design and development of safe commercial fusion reactors. The program is sponsored by the United States Department of Energy (DOE), Office of Fusion Energy. The function of the program is to collect, examine, permanently store, and make available the safety data to the entire US magnetic-fusion energy community. The sources of data will include domestic and foreign fusion reactor safety-related research programs. Any participant in the DOE Program may use the Data Base Program from his terminal through user friendly dialog and can view the contents in the form of text, tables, graphs, or system diagrams

  19. Compact fusion reactors

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    Fusion research is currently to a large extent focused on tokamak (ITER) and inertial confinement (NIF) research. In addition to these large international or national efforts there are private companies performing fusion research using much smaller devices than ITER or NIF. The attempt to achieve fusion energy production through relatively small and compact devices compared to tokamaks decreases the costs and building time of the reactors and this has allowed some private companies to enter the field, like EMC2, General Fusion, Helion Energy, Lawrenceville Plasma Physics and Lockheed Martin. Some of these companies are trying to demonstrate net energy production within the next few years. If they are successful their next step is to attempt to commercialize their technology. In this presentation an overview of compact fusion reactor concepts is given.

  20. Some fusion perspectives

    International Nuclear Information System (INIS)

    McNally, J.R. Jr.

    1977-01-01

    Some of the concepts of nuclear fusion reactions, advanced fusion fuels, environmental impacts, etc., are explored using the following general outline: I. Principles of Fusion (Nuclear Fuels and Reactions, Lawson Condition, n tau vs T, Nuclear Burn Characteristics); II. Magnetic Mirror Possibilities (the Ion Layer and Electron Layer, Exponential Build-up at MeV energies, Lorentz trapping at GeV energies); III. Pellet Fuel Fusion Prospects (Advanced Pellet Fuel Fusion Prospects, Burn Characteristics and Applications, Excitation-heating Prospects for Runaway Ion Temperatures). Inasmuch as the outline is very skeletal, a significant research and development effort may be in order to evaluate these prospects in more detail and hopefully ''harness the H-bomb'' for peaceful applications, the author concludes. 28 references

  1. Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

    Science.gov (United States)

    Ray, Sujay; Banerjee, Arundhati

    2015-10-01

    Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

  2. Investigations of image fusion

    Science.gov (United States)

    Zhang, Zhong

    1999-12-01

    The objective of image fusion is to combine information from multiple images of the same scene. The result of image fusion is a single image which is more suitable for the purpose of human visual perception or further image processing tasks. In this thesis, a region-based fusion algorithm using the wavelet transform is proposed. The identification of important features in each image, such as edges and regions of interest, are used to guide the fusion process. The idea of multiscale grouping is also introduced and a generic image fusion framework based on multiscale decomposition is studied. The framework includes all of the existing multiscale-decomposition- based fusion approaches we found in the literature which did not assume a statistical model for the source images. Comparisons indicate that our framework includes some new approaches which outperform the existing approaches for the cases we consider. Registration must precede our fusion algorithms. So we proposed a hybrid scheme which uses both feature-based and intensity-based methods. The idea of robust estimation of optical flow from time- varying images is employed with a coarse-to-fine multi- resolution approach and feature-based registration to overcome some of the limitations of the intensity-based schemes. Experiments show that this approach is robust and efficient. Assessing image fusion performance in a real application is a complicated issue. In this dissertation, a mixture probability density function model is used in conjunction with the Expectation- Maximization algorithm to model histograms of edge intensity. Some new techniques are proposed for estimating the quality of a noisy image of a natural scene. Such quality measures can be used to guide the fusion. Finally, we study fusion of images obtained from several copies of a new type of camera developed for video surveillance. Our techniques increase the capability and reliability of the surveillance system and provide an easy way to obtain 3-D

  3. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Directory of Open Access Journals (Sweden)

    Luke Czapla

    Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  4. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    Science.gov (United States)

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

    Science.gov (United States)

    Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

    2014-05-01

    During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

  6. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

    Science.gov (United States)

    Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

    The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  7. Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon

    Science.gov (United States)

    Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.

    2008-12-01

    Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

  8. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Science.gov (United States)

    Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

    2013-01-01

    The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  9. Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2004-05-01

    The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).

  10. The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus.

    Directory of Open Access Journals (Sweden)

    Jin Hwan Park

    2015-09-01

    Full Text Available A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3',5'-cyclic diguanylic acid (c-di-GMP and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose.

  11. US fusion community discussion on fusion strategies

    International Nuclear Information System (INIS)

    Marton, W.A.

    1998-01-01

    On April 26 - May 1, 1998, a US Fusion Community Forum for Major Next-Step Experiments was held at Madison, Wisconsin, USA. Both the Single Integrated Step strategy and the Multiple Machine strategy have substantial support from the about 180 scientists and engineers who participated

  12. Materials for fusion reactors

    International Nuclear Information System (INIS)

    Ehrlich, K.; Kaletta, D.

    1978-03-01

    The following report describes five papers which were given during the IMF seminar series summer 1977. The purpose of this series was to discuss especially the irradiation behaviour of materials intended for the first wall of future fusion reactors. The first paper deals with the basic understanding of plasma physics relating to the fusion reactor and presents the current state of art of fusion technology. The next two talks discuss the metals intended for the first wall and structural components of a fusion reactor. Since 14 MeV neutrons play an important part in the process of irradiation damage their role is discussed in detail. The question which machines are presently available to simulate irradiation damage under conditions similar to the ones found in a fusion reactor are investigated in the fourth talk which also presents the limitations of the different methods of simulation. In this context also discussed is the importance future intensive neutron sources and materials test reactors will have for this problem area. The closing paper has as a theme the review of the present status of research of metallic and non-metallic materials in view of the quite different requirements for different fusion systems; a closing topic is the world supply on rare materials required for fusion reactors. (orig) [de

  13. Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

    Science.gov (United States)

    Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

    2016-01-01

    The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

  14. Fusion research in Hungary

    International Nuclear Information System (INIS)

    Zoletnik, S.

    2004-01-01

    Hungarian fusion research started in the 1970s, when the idea of installing a small tokamak experiment emerged. In return to computer equipment a soviet tokamak was indeed sent to Hungary and started to operate as MT-1 at the Central Research Institute for Physics (KFKI) in 1979. Major research topics included diagnostic development, edge plasma studies and investigation of disruptions. Following a major upgrade in 1992 (new vacuum vessel, active position control and PC network based data acquisition system) the MT-1M tokamak was used for the study of transport processes with trace impurity injection, micropellet ablation studies, X-ray tomography and laser blow-off diagnostic development. Although funding ceased in the middle of the 90's the group was held alive by collaborations with EU fusion labs: FZ -Juelich, IPP-Garching and CRPP-EPFL Lausanne. In 1998 the machine was dismantled due to reorganization of the Hungarian Academy of Sciences. New horizons opened to fusion research from 1999, when Hungary joined EURATOM and a fusion Association was formed. Since then fusion physics studies are done in collaboration with major EU fusion laboratories, Hungarian researchers also play an active role in JET diagnostics upgrade and ITER design. Major topics are pellet ablation studies, plasma turbulence diagnosis using Beam Emission Spectroscopy and other techniques, tomography and plasma diagnostics using various neutral beams. In fusion relevant technology R and D Hungary has less records. Before joining EURATOM some materials irradiation studies were done at the Budapest Research Reactor at KFKI-AEKI. The present day fusion technology programme focuses still on irradiation studies, nuclear material database and electromagnetic testing techniques. Increasing the fusion technology research activities is a difficult task, as the competition in Hungarian industry is very strong and the interest of organizations in long-term investments into R and D is rather weak and

  15. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

    Science.gov (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  16. HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

    Science.gov (United States)

    Roy, Ajit; Ranjan, Akash

    2016-02-23

    Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

  17. Mirror fusion reactors

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    Conceptual design studies were made of fusion reactors based on the three current mirror-confinement concepts: the standard mirror, the tandem mirror, and the field-reversed mirror. Recent studies of the standard mirror have emphasized its potential as a fusion-fission hybrid reactor, designed to produce fuel for fission reactors. We have designed a large commercial hybrid and a small pilot-plant hybrid based on standard mirror confinement. Tandem mirror designs include a commercial 1000-MWe fusion power plant and a nearer term tandem mirror hybrid. Field-reversed mirror designs include a multicell commercial reactor producing 75 MWe and a single-cell pilot plant

  18. Mirror fusion reactors

    International Nuclear Information System (INIS)

    Carlson, G.A.; Moir, R.W.

    1978-01-01

    We have carried out conceptual design studies of fusion reactors based on the three current mirror confinement concepts: the standard mirror, the tandem mirror, and the field-reversed mirror. Recent studies of the standard mirror have emphasized its potential as a fusion-fission hybrid reactor, designed to produce fission fuel for fission reactors. We have designed a large commercial hybrid based on standard mirror confinement, and also a small pilot plant hybrid. Tandem mirror designs include a commercial 1000 MWe fusion power plant and a nearer term tandem mirror hybrid. Field-reversed mirror designs include a multicell commercial reactor producing 75 MWe and a single cell pilot plant

  19. Fusion Reactor Materials

    International Nuclear Information System (INIS)

    Decreton, M.

    2002-01-01

    The objective of SCK-CEN's programme on fusion reactor materials is to contribute to the knowledge on the radiation-induced behaviour of fusion reactor materials and components as well as to help the international community in building the scientific and technical basis needed for the construction of the future reactor. Ongoing projects include: the study of the mechanical and chemical (corrosion) behaviour of structural materials under neutron irradiation and water coolant environment; the investigation of the characteristics of irradiated first wall material such as beryllium; investigations on the management of materials resulting from the dismantling of fusion reactors including waste disposal. Progress and achievements in these areas in 2001 are discussed

  20. Remote sensing image fusion

    CERN Document Server

    Alparone, Luciano; Baronti, Stefano; Garzelli, Andrea

    2015-01-01

    A synthesis of more than ten years of experience, Remote Sensing Image Fusion covers methods specifically designed for remote sensing imagery. The authors supply a comprehensive classification system and rigorous mathematical description of advanced and state-of-the-art methods for pansharpening of multispectral images, fusion of hyperspectral and panchromatic images, and fusion of data from heterogeneous sensors such as optical and synthetic aperture radar (SAR) images and integration of thermal and visible/near-infrared images. They also explore new trends of signal/image processing, such as

  1. Beam dancer fusion device

    International Nuclear Information System (INIS)

    Maier, H.B.

    1984-01-01

    To accomplish fusion of two or more fusion fuel elements numerous minute spots of energy or laser light are directed to a micro target area, there to be moved or danced about by a precision mechanical controlling apparatus at the source of the laser light or electromagnetic energy beams, so that merging and coinciding patterns of light or energy beams can occur around the area of the fuel atoms or ions. The projecting of these merging patterns may be considered as target searching techniques to locate responsive clusters of fuel elements and to compress such elements into a condition in which fusion may occur. Computerized programming may be used

  2. Fusion Reactor Materials

    International Nuclear Information System (INIS)

    Decreton, M.

    2001-01-01

    The objective of SCK-CEN's programme on fusion reactor materials is to contribute to the knowledge on the behaviour of fusion reactor materials and components during and after irradiation. Ongoing projects include: the study of the mechanical behaviour of structural materials under neutron irradiation; the investigation of the characteristics of irradiated first wall material such as beryllium; the detection of abrupt electrical degradation of insulating ceramics under high temperature and neutron irradiation; and the study of dismantling and waste disposal strategy for fusion reactors. Progress and achievements in these areas in 2000 are discussed

  3. Japanese fusion research

    International Nuclear Information System (INIS)

    Uchida, T.

    1987-01-01

    The Japan experience during thirty years in nuclear fusion research is reported, after attending the 1st Geneva Conference in 1955, Osaka University, immedeately began linear pinch study using capacitor bank discharge. Subsequently to his trial several groups were organized to ward fusion R and D at universities in Tokyo, Nagoya, Kyoto, Sendai and son on. Based upon the recommendation of Japan Science Council, Institut of Plasma Physics (IPP) was established at Nagoya University in 1961 When the 1st International Conference on Plasma Physics and Controlled Nuclear Fusion Research was held in Saltzburg. The gloomy Bohm barrier had stood in front of many of experiments at that time. (author) [pt

  4. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    Science.gov (United States)

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  5. Biofilm plasmids with a rhamnose operon are widely distributed determinants of the 'swim-or-stick' lifestyle in roseobacters.

    Science.gov (United States)

    Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn

    2016-10-01

    Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.

  6. Dynamic in vivo mutations within the ica operon during persistence of Staphylococcus aureus in the airways of cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Bianca Schwartbeck

    2016-11-01

    Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.

  7. The Small Protein HemP Is a Transcriptional Activator for the Hemin Uptake Operon in Burkholderia multivorans ATCC 17616.

    Science.gov (United States)

    Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka

    2017-08-15

    Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the

  8. Inertial thermonuclear fusion by laser

    International Nuclear Information System (INIS)

    Watteau, J.P.

    1993-12-01

    The principles of deuterium tritium (DT) magnetic or inertial thermonuclear fusion are given. Even if results would be better with heavy ions beams, most of the results on fusion are obtained with laser beams. Technical and theoretical aspects of the laser fusion are presented with an extrapolation to the future fusion reactor. (A.B.). 34 refs., 17 figs

  9. Inertial fusion commercial power plants

    International Nuclear Information System (INIS)

    Logan, B.G.

    1994-01-01

    This presentation discusses the motivation for inertial fusion energy, a brief synopsis of five recently-completed inertial fusion power plant designs, some general conclusions drawn from these studies, and an example of an IFE hydrogen synfuel plant to suggest that future fusion studies consider broadening fusion use to low-emission fuels production as well as electricity

  10. Why and how of fusion

    International Nuclear Information System (INIS)

    Miley, G.H.

    1977-01-01

    The potential advantages of fusion power are listed. The approaches to plasma containment are mentioned and the status of the fusion program is described. The ERDA and EPRI programs are discussed. The Fusion Energy Foundation's activities are mentioned. Fusion research at the U. of Ill. is described briefly

  11. Fusion in the energy system

    DEFF Research Database (Denmark)

    Fusion energy is the fundamental energy source of the Universe, as the energy of the Sun and the stars are produced by fusion of e.g. hydrogen to helium. Fusion energy research is a strongly international endeavor aiming at realizing fusion energy production in power plants on Earth. Reaching...... of integration into the future electricity system and socio-economic studies of fusion energy will be presented, referring to the programme of Socio-Economic Research on Fusion (SERF) under the European Fusion Energy Agreement (EFDA)....

  12. Fusion-power demonstration

    International Nuclear Information System (INIS)

    Henning, C.D.; Logan, B.G.; Carlson, G.A.; Neef, W.S.; Moir, R.W.; Campbell, R.B.; Botwin, R.; Clarkson, I.R.; Carpenter, T.J.

    1983-01-01

    As a satellite to the MARS (Mirror Advanced Reactor Study) a smaller, near-term device has been scoped, called the FPD (Fusion Power Demonstration). Envisioned as the next logical step toward a power reactor, it would advance the mirror fusion program beyond MFTF-B and provide an intermediate step toward commercial fusion power. Breakeven net electric power capability would be the goal such that no net utility power would be required to sustain the operation. A phased implementation is envisioned, with a deuterium checkout first to verify the plasma systems before significant neutron activation has occurred. Major tritium-related facilities would be installed with the second phase to produce sufficient fusion power to supply the recirculating power to maintain the neutral beams, ECRH, magnets and other auxiliary equipment

  13. International aspects of fusion

    International Nuclear Information System (INIS)

    Stacey, W.M. Jr.

    1979-12-01

    International collaborative efforts in magnetic confinement fusion in which the USA is involved are reviewed. These efforts are carried under the auspices of international agencies and through bilateral agreements

  14. Magnetic fusion energy

    International Nuclear Information System (INIS)

    Anon.

    1978-01-01

    The efforts of the Chemical Technology Division in the area of fusion energy include fuel handling, processing, and containment. These studies are closely coordinated with the ORNL Fusion Energy Division. Current experimental studies are concerned with the development of vacuum pumps for fusion reactors, the evaluation and development of techniques for recovering tritium (fuel) from either solid or liquid lithium containing blankets, and the use of deep beds of sorbents as roughing pumps and/or transfer operations. In addition, a small effort is devoted to the support of the ORNL design of The Next Step (TNS) in tokamak reactor development. The more applied studies--vacuum pump development and TNS design--are funded by the DOE/Magnetic Fusion Energy, and the more fundamental studies--blanket recovery and sorption in deep beds--are funded by the DOE/Basic Energy Sciences

  15. Fusion technology programme

    International Nuclear Information System (INIS)

    Finken, D.

    1984-04-01

    KfK participates to the Fusion Technology Programme of the European Community. Most of the work in progress addresses the Next European Torus (NET) and the long term technology aspects as defined in the 82/86 programme. A minor part serves to preparation of future contributions and to design studies on fusion concepts in a wider perspective. The Fusion Technology Programme of Euratom covers mainly aspects of nuclear engineering. Plasma engineering, heating, refueling and vacuum technology are at present part of the Physics Programme. In view of NET, integration of the different areas of work will be mandatory. KfK is therefore prepared to address technical aspects beyond the actual scope of the physics experiments. The technology tasks are reported project wise under title and code of the Euratom programme. Most of the projects described here are shared with other European fusion laboratories as indicated in the table annexed to this report. (orig./GG)

  16. Fusion-breeder program

    International Nuclear Information System (INIS)

    Moir, R.W.

    1982-01-01

    The various approaches to a combined fusion-fission reactor for the purpose of breeding 239 Pu and 233 U are described. Design aspects and cost estimates for fuel production and electricity generation are discussed

  17. Cold nuclear fusion device

    International Nuclear Information System (INIS)

    Ogino, Shinji.

    1991-01-01

    Selection of cathode material is a key to the attainment of cold nuclear fusion. However, there are only few reports on the cathode material at present and an effective development has been demanded. The device comprises an anode and a cathode and an electrolytic bath having metal salts dissolved therein and containing heavy water in a glass container. The anode is made of gold or platinum and the cathode is made of metals of V, Sr, Y, Nb, Hf or Ta, and a voltage of 3-25V is applied by way of a DC power source between them. The metal comprising V, Sr, Y, Nb, Hf or Ta absorbs deuterium formed by electrolysis of heavy water effectively to cause nuclear fusion reaction at substantially the same frequency and energy efficiency as palladium and titanium. Accordingly, a cold nuclear fusion device having high nuclear fusion generation frequency can be obtained. (N.H.)

  18. Cell fusions in mammals

    DEFF Research Database (Denmark)

    Larsson, Lars-Inge; Bjerregaard, Bolette; Talts, Jan Fredrik

    2008-01-01

    Cell fusions are important to fertilization, placentation, development of skeletal muscle and bone, calcium homeostasis and the immune defense system. Additionally, cell fusions participate in tissue repair and may be important to cancer development and progression. A large number of factors appear...... to regulate cell fusions, including receptors and ligands, membrane domain organizing proteins, proteases, signaling molecules and fusogenic proteins forming alpha-helical bundles that bring membranes close together. The syncytin family of proteins represent true fusogens and the founding member, syncytin-1......, has been documented to be involved in fusions between placental trophoblasts, between cancer cells and between cancer cells and host ells. We review the literature with emphasis on the syncytin family and propose that syncytins may represent universal fusogens in primates and rodents, which work...

  19. Fusion Canada issue 11

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1990-06-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on operation at Tokamak de Varennes, CRITIC irradiations at AECL, Tritium systems at TFTR, physics contribution at ITER. 4 figs.

  20. Fusion technology (FT)

    International Nuclear Information System (INIS)

    1978-01-01

    The annual report of tha fusion technology (FT) working group discusses the projects carried out by the participating institutes in the fields of 1) fuel injection and plasma heating, 2) magnetic field technology, and 3) systems investigations. (HK) [de

  1. Fusion technology development

    International Nuclear Information System (INIS)

    1979-08-01

    This report includes information on the following chapters: (1) conceptual design studies, (2) magnetics, (3) plasma heating, fueling, and exhaust, (4) materials for fusion reactors, (5) alternate applications, and (6) environment and safety

  2. Fusion reactor materials

    International Nuclear Information System (INIS)

    Rowcliffe, A.F.; Burn, G.L.; Knee', S.S.; Dowker, C.L.

    1994-02-01

    This is the fifteenth in a series of semiannual technical progress reports on fusion reactor materials. This report combines research and development activities which were previously reported separately in the following progress reports: Alloy Development for Irradiation Performance; Damage Analysis and Fundamental Studies; Special purpose Materials. These activities are concerned principally with the effects of the neutronic and chemical environment on the properties and performance of reactor materials; together they form one element of the overall materials programs being conducted in support of the Magnetic Fusion Energy Program of the U.S. Department of Energy. The Fusion Reactor Materials Program is a national effort involving several national laboratories, universities, and industries. The purpose of this series of reports is to provide a working technical record for the use of the program participants, and to provide a means of communicating the efforts of materials scientists to the rest of the fusion community, both nationally and worldwide

  3. Fusion cost normalization

    International Nuclear Information System (INIS)

    Schulte, S.C.; Willke, T.L.

    1978-01-01

    The categorization and accounting methods described in this paper provide a common format that can be used to assess the economic character of magnetically confined fusion reactor design concepts. The format was developed with assistance from the fusion economics community, thus ensuring that the methods meet with the approval of potential users. The format will aid designers in the preparation of design concept cost estimates and also provide policy makers with a tool to assist in appraising which design concepts may be economically promising. Adherence to the format when evaluating prospective fusion reactor design concepts will result in the identification of the more promising concepts, thus enabling the fusion power alternatives with better economic potential to be quickly and efficiently developed

  4. Complimentary Advanced Fusion Exploration

    National Research Council Canada - National Science Library

    Alford, Mark G; Jones, Eric C; Bubalo, Adnan; Neumann, Melissa; Greer, Michael J

    2005-01-01

    .... The focus areas were in the following regimes: multi-tensor homographic computer vision image fusion, out-of-sequence measurement and track data handling, Nash bargaining approaches to sensor management, pursuit-evasion game theoretic modeling...

  5. Fusion plasma physics

    CERN Document Server

    Stacey, Weston M

    2012-01-01

    This revised and enlarged second edition of the popular textbook and reference contains comprehensive treatments of both the established foundations of magnetic fusion plasma physics and of the newly developing areas of active research. It concludes with a look ahead to fusion power reactors of the future. The well-established topics of fusion plasma physics -- basic plasma phenomena, Coulomb scattering, drifts of charged particles in magnetic and electric fields, plasma confinement by magnetic fields, kinetic and fluid collective plasma theories, plasma equilibria and flux surface geometry, plasma waves and instabilities, classical and neoclassical transport, plasma-materials interactions, radiation, etc. -- are fully developed from first principles through to the computational models employed in modern plasma physics. The new and emerging topics of fusion plasma physics research -- fluctuation-driven plasma transport and gyrokinetic/gyrofluid computational methodology, the physics of the divertor, neutral ...

  6. Fusion power demonstration

    International Nuclear Information System (INIS)

    Henning, C.D.; Logan, B.G.

    1983-01-01

    As a satellite to the MARS (Mirror Advanced Reactor Study) a smaller, near-term device has been scoped, called the FPD (Fusion Power Demonstration). Envisioned as the next logical step toward a power reactor, it would advance the mirror fusion program beyond MFTF-B and provide an intermediate step toward commercial fusion power. Breakeven net electric power capability would be the goal such that no net utility power would be required to sustain the operation. A phased implementation is envisioned, with a deuterium checkout first to verify the plasma systems before significant neutron activation has occurred. Major tritium-related facilities would be installed with the second phase to produce sufficient fusion power to supply the recirculating power to maintain the neutral beams, ECRH, magnets and other auxiliary equipment

  7. Optical Fiber Fusion Splicing

    CERN Document Server

    Yablon, Andrew D

    2005-01-01

    This book is an up-to-date treatment of optical fiber fusion splicing incorporating all the recent innovations in the field. It provides a toolbox of general strategies and specific techniques that the reader can apply when optimizing fusion splices between novel fibers. It specifically addresses considerations important for fusion splicing of contemporary specialty fibers including dispersion compensating fiber, erbium-doped gain fiber, polarization maintaining fiber, and microstructured fiber. Finally, it discusses the future of optical fiber fusion splicing including silica and non-silica based optical fibers as well as the trend toward increasing automation. Whilst serving as a self-contained reference work, abundant citations from the technical literature will enable readers to readily locate primary sources.

  8. Controlled thermonuclear fusion

    International Nuclear Information System (INIS)

    Sakanaka, P.H.

    1984-01-01

    A simplified review on the status of the controlled thermonuclear fusion research aiming to present the motivation, objective, necessary conditions and adopted methods to reach the objective. (M.C.K.) [pt

  9. Fusion safety program plan

    International Nuclear Information System (INIS)

    Crocker, J.G.; Holland, D.F.; Herring, J.S.

    1980-09-01

    The program plan consists of research that has been divided into 13 different areas. These areas focus on the radioactive inventories that are expected in fusion reactors, the energy sources potentially available to release a portion of these inventories, and analysis and design techniques to assess and ensure that the safety risks associated with operation of magnetic fusion facilities are acceptably low. The document presents both long-term program requirements that must be fulfilled as part of the commercialization of fusion power and a five-year plan for each of the 13 different program areas. Also presented is a general discussion of magnetic fusion reactor safety, a method for establishing priorities in the program, and specific priority ratings for each task in the five-year plan

  10. Fusion Revisits CERN

    CERN Multimedia

    2001-01-01

    It's going to be a hot summer at CERN. At least in the Main Building, where from 13 July to 20 August an exhibition is being hosted on nuclear fusion, the energy of the Stars. Nuclear fusion is the engine driving the stars but also a potential source of energy for mankind. The exhibition shows the different nuclear fusion techniques and research carried out on the subject in Europe. Inaugurated at CERN in 1993, following collaboration between Lausanne's CRPP-EPFL and CERN, with input from Alessandro Pascolini of Italy's INFN, this exhibition has travelled round Europe before being revamped and returning to CERN. 'Fusion, Energy of the Stars', from 13 July onwards, Main Building

  11. Fusion Simulation Program

    International Nuclear Information System (INIS)

    Greenwald, Martin

    2011-01-01

    Many others in the fusion energy and advanced scientific computing communities participated in the development of this plan. The core planning team is grateful for their important contributions. This summary is meant as a quick overview the Fusion Simulation Program's (FSP's) purpose and intentions. There are several additional documents referenced within this one and all are supplemental or flow down from this Program Plan. The overall science goal of the DOE Office of Fusion Energy Sciences (FES) Fusion Simulation Program (FSP) is to develop predictive simulation capability for magnetically confined fusion plasmas at an unprecedented level of integration and fidelity. This will directly support and enable effective U.S. participation in International Thermonuclear Experimental Reactor (ITER) research and the overall mission of delivering practical fusion energy. The FSP will address a rich set of scientific issues together with experimental programs, producing validated integrated physics results. This is very well aligned with the mission of the ITER Organization to coordinate with its members the integrated modeling and control of fusion plasmas, including benchmarking and validation activities. (1). Initial FSP research will focus on two critical Integrated Science Application (ISA) areas: ISA1, the plasma edge; and ISA2, whole device modeling (WDM) including disruption avoidance. The first of these problems involves the narrow plasma boundary layer and its complex interactions with the plasma core and the surrounding material wall. The second requires development of a computationally tractable, but comprehensive model that describes all equilibrium and dynamic processes at a sufficient level of detail to provide useful prediction of the temporal evolution of fusion plasma experiments. The initial driver for the whole device model will be prediction and avoidance of discharge-terminating disruptions, especially at high performance, which are a critical

  12. The fusion dilemma

    International Nuclear Information System (INIS)

    Carruthers, R.

    1981-01-01

    The present position in fusion research is reviewed and discussed with relation to the requirements of an economic reactor. Meeting these requirements calls for a mission-oriented project of interdisciplinary character whose timely evolution from one with a research orientation, is a challenging management problem. The cost-effectiveness of future expenditure on fusion research is dependent upon acknowledging this challenge and realistically facing the difficult tasks which it presents. (U.K.)

  13. Possible fusion reactor

    International Nuclear Information System (INIS)

    Yoshikawa, S.

    1976-05-01

    A scheme to improve performance characteristics of a tokamak-type fusion reactor is proposed. Basically, the tokamak-type plasma could be moved around so that the plasma could be heated by compression, brought to the region where the blanket surrounds the plasma, and moved so as to keep wall loading below the acceptable limit. This idea should be able to help to economize a fusion reactor

  14. Fusion power plant economics

    International Nuclear Information System (INIS)

    Miller, R.L.

    1996-01-01

    The rationale, methodology, and updated comparative results of cost projections for magnetic-fusion-energy central-station electric power plants are considered. Changing market and regulatory conditions, particularly in the U.S., prompt fundamental reconsideration of what constitutes a competitive future energy-source technology and has implications for the direction and emphasis of appropriate near-term research and development programs, for fusion and other advanced generation systems. 36 refs., 2 figs., 2 tabs

  15. Sonoluminescence and bubble fusion

    OpenAIRE

    Arakeri, Vijay H

    2003-01-01

    Sonoluminescence (SL), the phenomenon of light emission from nonlinear motion of a gas bubble, involves an extreme degree of energy focusing. The conditions within the bubble during the last stages of the nearly catastrophic implosion are thought to parallel the efforts aimed at developing inertial confinement fusion. A limited review on the topic of SL and its possible connection to bubble nuclear fusion is presented here. The emphasis is on looking for a link between the various forms o...

  16. Fusion reactor materials

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    The following topics are briefly discussed: (1) surface blistering studies on fusion reactor materials, (2) TFTR design support activities, (3) analysis of samples bombarded in-situ in PLT, (4) chemical sputtering effects, (5) modeling of surface behavior, (6) ion migration in glow discharge tube cathodes, (7) alloy development for irradiation performance, (8) dosimetry and damage analysis, and (9) development of tritium migration in fusion devices and reactors

  17. Bringing together fusion research

    International Nuclear Information System (INIS)

    Leiser, M.

    1982-01-01

    The increasing involvement of the IAEA in fusion, together with the growing efforts devoted to this area, are described. The author puts forward the idea that one of the most important aspects of this involvement is in providing a world-wide forum for scientists. The functions of the IFRC (International Fusion Research Council) as an advisory group are outlined, and the role played by IFRC in the definition and objectives of INTOR (International Tokamak Reactor) are briefly described

  18. Fusion Canada issue 13

    International Nuclear Information System (INIS)

    1991-01-01

    A short bulletin from the National Fusion Program. Included in this issue is a report on Canada's plans to participate in the Engineering Design Activities (EDA), bilateral meetings with Canada and the U.S., committee meeting with Canada-Europe, an update at Tokamak de Varennes on Plasma Biasing experiments and boronized graphite tests, fusion materials research at the University of Toronto using a dual beam accelerator and a review of the CFFTP and the CCFM. 2 figs

  19. Conference on Norwegian fusion research

    International Nuclear Information System (INIS)

    The question of instituting a systematic research programme in Norway on aspects of thermonuclear and plasma physics has been raised. The conference here reported was intended to provide basic information on the status of fusion research internationally and to discuss a possible Norwegian programme. The main contributions covered the present status of fusion research, international cooperation, fusion research in small countries and minor laboratories, fusion research in Denmark and Sweden, and a proposed fusion experiment in Bergen. (JIW)

  20. Status of fusion technology

    International Nuclear Information System (INIS)

    Mohan, Ashok

    1978-01-01

    The current status of fusion technology is surveyed. Limited reserves of fossil fuel and dangers of proliferation from nuclear reactors have brought into focus the need to develop an optional energy source. Fusion is being looked upon as an optional energy source which is free from environmental hazards unlike fossil fuels and nuclear reactors. Investments in R and D of fusion energy have increased rapidly in USA, Japan, USSR and European countries. Out of the various fusion fuels known, a mixture of D and T is widely chosen. The main problem in fusion technology is the confinement of plasma for a time sufficient to start the fusion reaction. This can be done magnetically or inertially. The three approaches to magnetic confinement are : (1) tokamak, (2) mirror and (3) pinch. Inertial confinement makes use of lasers or electron beams or ion beams. Both the methods of confinement i.e. magnetic and inertial have problems which are identified and their nature is discussed. (M.G.B.)

  1. Energy from inertial fusion

    International Nuclear Information System (INIS)

    1995-03-01

    This book contains 22 articles on inertial fusion energy (IFE) research and development written in the framework of an international collaboration of authors under the guidance of an advisory group on inertial fusion energy set up in 1991 to advise the IAEA. It describes the actual scientific, engineering and technological developments in the field of inertial confinement fusion (ICF). It also identifies ways in which international co-operation in ICF could be stimulated. The book is intended for a large audience and provides an introduction to inertial fusion energy and an overview of the various technologies needed for IFE power plants to be developed. It contains chapters on (i) the fundamentals of IFE; (ii) inertial confinement target physics; (iii) IFE power plant design principles (requirements for power plant drivers, solid state laser drivers, gas laser drivers, heavy ion drivers, and light ion drivers, target fabrication and positioning, reaction chamber systems, power generation and conditioning and radiation control, materials management and target materials recovery), (iv) special design issues (radiation damage in structural materials, induced radioactivity, laser driver- reaction chamber interfaces, ion beam driver-reaction chamber interfaces), (v) inertial fusion energy development strategy, (vi) safety and environmental impact, (vii) economics and other figures of merit; (viii) other uses of inertial fusion (both those involving and not involving implosions); and (ix) international activities. Refs, figs and tabs

  2. Perspectives of fusion power

    International Nuclear Information System (INIS)

    Jensen, V.O.

    1984-01-01

    New and practically inexhaustible sources of energy must be developed for the period when oil, coal and uranium will become scarce and expensive. Nuclear fusion holds great promise as one of these practically inexhaustible energy sources. Based on the deuteriumtritium reaction with tritium obtained from naturally occuring lithium, which is also widely available in Europe, the accessible energy resources in the world are 3.10 12 to 3.10 16 toe; based on the deuterium-deuterium reaction, the deuterium content of the oceans corresponds to 10 20 toe. It is presently envisaged that in order to establish fusion as a large-scale energy source, three major thresholds must be reached: - Scientific feasibility, - Technical feasibility, i.e. the proof that the basic technical problems of the fusion reactor can be solved. - Commercial feasibility, i.e. proof that fusion power reactors can be built on an industrial scale, can be operated reliably and produce usable energy at prices competitive with other energy sources. From the above it is clear that the route to commercial fusion will be long and costly and involve the solution of extremely difficult technical problems. In view of the many steps which have to be taken, it appears unlikely that commercial fusion power will be in general use within the next 50 years and by that time world-wide expenditure on research, development and demonstration may well have exceeded 100 Bio ECU. (author)

  3. Controlled thermonuclear fusion: research on magnetic fusion

    International Nuclear Information System (INIS)

    Paris, P.J.

    1988-12-01

    Recent progress in thermonuclear fusion research indicates that the scientists' schedule for the demonstration of the scientific feasibility will be kept and that break-even will be attained in the course of the next decade. To see the implementation of ignition, however, the generation of future experiments must be awaited. These projects are currently under study. With technological research going on in parallel, they should at the same time contribute to the design of a reactor. Fusion reactors will be quite different from the fission nuclear reactors we know, and the waste of the plants will also be of a different nature. It is still too early to define the precise design of a fusion reactor. On the basis of a toric machine concept like that of the tokamak, we can, however, envisage that the problems with which we are confronted will be solved one after the other. As we have just seen, these will be the objectives of the future experimental installations where ignition will be possible and where the flux of fast neutrons will be so strong that they will allow the study of low-activation materials which will be used in the structure of the reactor. But this is also a task in which from now onwards numerous laboratories in Europe and in the world participate. The works are in fact punctiform, and often the mutual incidences can only be determined by an approach simulated by numerical codes. (author) 19 figs., 6 tabs., 8 refs

  4. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

    2015-01-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

  5. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

    2015-09-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Structural insights into RipC, a putative citrate lyase β subunit from a Yersinia pestis virulence operon

    International Nuclear Information System (INIS)

    Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.

    2011-01-01

    Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein

  8. UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon

    International Nuclear Information System (INIS)

    Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.

    1988-01-01

    Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs

  9. Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA

    DEFF Research Database (Denmark)

    Poulsen, Peter; Jensen, Kaj Frank

    1992-01-01

    We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...

  10. Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

    Directory of Open Access Journals (Sweden)

    Silvia Dossena

    2013-12-01

    Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

  11. Towards a generic user support system (GUS)

    International Nuclear Information System (INIS)

    Garland, W.J.; Wilson, R.J.

    1993-01-01

    One relevant issue confronting the operator of a nuclear power plant is information and task overload. The goal, then, of the various developers is to improve the current situations by creating an environment where the operator can perform at optimum capacity. This is to be accomplished by providing tools and techniques which reduce operator involvement in low level tasks (freeing up time for higher level cognitive tasks) and assist in information and knowledge manipulation so that high level tasks can be performed more efficiently. This paper reviews the operational environment of nuclear plants from the viewpoint of engineering design and from the viewpoint of the operators and technical support staff. Principles are advanced for a generic operator companion. These design principles are being applied to a test case: the Point Lepreau NGS secondary side central sampling system. 6 refs., 6 figs

  12. Queer Orientation with Gus Van Sant's Elephant

    NARCIS (Netherlands)

    Aydemir, M.

    2016-01-01

    Sexuality, common discourse tells us, constitutes an identity - or an orientation. Unlike the easily reified ‘identity’, however, the latter term can be taken to suggest the intimate enfolding of the erotic within a specific environment, milieu or Umwelt. I explore that possibility in relation to

  13. The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli

    OpenAIRE

    Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent

    2000-01-01

    In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...

  14. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

    2015-01-01

    ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

  15. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans.

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G

    2015-08-01

    In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

  16. Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0 : PedB is the immunity protein and PedD is the precursor processing enzyme

    NARCIS (Netherlands)

    Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.

    The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises

  17. Advanced fusion reactor

    International Nuclear Information System (INIS)

    Tomita, Yukihiro

    2003-01-01

    The main subjects on fusion research are now on D-T fueled fusion, mainly due to its high fusion reaction rate. However, many issues are still remained on the wall loading by the 14 MeV neutrons. In the case of D-D fueled fusion, the neutron wall loading is still remained, though the technology related to tritium breeding is not needed. The p- 6 Li and p- 11 B fueled fusions are not estimated to be the next generation candidate until the innovated plasma confinement technologies come in useful to achieve the high performance plasma parameters. The fusion reactor of D- 3 He fuels has merits on the smaller neutron wall loading and tritium handling. However, there are difficulties on achieving the high temperature plasma more than 100 keV. Furthermore the high beta plasma is needed to decrease synchrotron radiation loss. In addition, the efficiency of the direct energy conversion from protons coming out from fusion reaction is one of the key parameters in keeping overall power balance. Therefore, open magnetic filed lines should surround the plasma column. In this paper, we outlined the design of the commercial base reactor (ARTEMIS) of 1 GW electric output power configured by D- 3 He fueled FRC (Field Reversed Configuration). The ARTEMIS needs 64 kg of 3 He per a year. On the other hand, 1 million tons of 3 He is estimated to be in the moon. The 3 He of about 10 23 kg are to exist in gaseous planets such as Jupiter and Saturn. (Y. Tanaka)

  18. Ion beam inertial fusion

    International Nuclear Information System (INIS)

    Bangerter, R.O.

    1995-01-01

    About twenty years ago, A. W. Maschke of Brookhaven National Laboratory and R. L. Martin of Argonne National Laboratory recognized that the accelerators that have been developed for high energy and nuclear physics are, in many ways, ideally suited to the requirements of inertial fusion power production. These accelerators are reliable, they have a long operating life, and they can be efficient. Maschke and Martin noted that they can focus ion beams to small focal spots over distances of many meters and that they can readily operate at the high pulse repetition rates needed for commercial power production. Fusion, however, does impose some important new constraints that are not important for high energy or nuclear physics applications. The most challenging new constraint from a scientific standpoint is the requirement that the accelerator deliver more than 10 14 W of beam power to a small quantity (less than 100 mg) of matter. The most challenging constraint from an engineering standpoint is accelerator cost. Maschke showed theoretically that accelerators could produce adequate work. Heavy-ion fusion is widely recognized to be a promising approach to inertial fusion power production. It provides an excellent opportunity to apply methods and technology developed for basic science to an important societal need. The pulsed-power community has developed a complementary, parallel approach to ion beam fusion known as light-ion fusion. The talk will discuss both heavy-ion and light-ion fusion. It will explain target physics requirements and show how they lead to constraints on the usual accelerator parameters such as kinetic energy, current, and emittance. The talk will discuss experiments that are presently underway, specifically experiments on high-current ion sources and injectors, pulsed-power machines recirculating induction accelerators, and transverse beam combining. The talk will give a brief description of a proposed new accelerator called Elise

  19. Fusion Canada issue 29

    International Nuclear Information System (INIS)

    1995-10-01

    A short bulletin from the National Fusion Program highlighting in this issue Canada-Europe Accords: 5 year R and D collaboration for the International Thermonuclear Experimental Reactor (ITER) AECL is designated to arrange and implement the Memorandum of Understanding (MOU) and the ITER Engineering Design Activities (EDA) while EUROTAM is responsible for operating Europe's Fusion R and D programs plus MOU and EDA. The MOU includes tokamaks, plasma physics, fusion technology, fusion fuels and other approaches to fusion energy (as alternatives to tokamaks). STOR-M Tokamak was restarted at the University of Saskatchewan following upgrades to the plasma chamber to accommodate the Compact Toroid (CT) injector. The CT injector has a flexible attachment thus allowing for injection angle adjustments. Real-time video images of a single plasma discharge on TdeV showing that as the plasma density increases, in a linear ramp divertor, the plasma contact with the horizontal plate decreases while contact increases with the oblique plate. Damage-resistant diffractive optical elements (DOE) have been developed for Inertial Confinement Fusion (ICF) research by Gentac Inc. and the National Optics Institute, laser beam homogeniser and laser harmonic separator DOE can also be made using the same technology. Studies using TdeV indicate that a divertor will be able to pump helium from the tokamak with a detached-plasma divertor but helium extraction performance must first be improved, presently the deuterium:helium retention radio-indicates that in order to pump enough helium through a fusion reactor, too much deuterium-tritium fuel would be pumped out. 2 fig

  20. Advanced fusion reactor

    Energy Technology Data Exchange (ETDEWEB)

    Tomita, Yukihiro [National Inst. for Fusion Science, Toki, Gifu (Japan)

    2003-04-01

    The main subjects on fusion research are now on D-T fueled fusion, mainly due to its high fusion reaction rate. However, many issues are still remained on the wall loading by the 14 MeV neutrons. In the case of D-D fueled fusion, the neutron wall loading is still remained, though the technology related to tritium breeding is not needed. The p-{sup 6}Li and p-{sup 11}B fueled fusions are not estimated to be the next generation candidate until the innovated plasma confinement technologies come in useful to achieve the high performance plasma parameters. The fusion reactor of D-{sup 3}He fuels has merits on the smaller neutron wall loading and tritium handling. However, there are difficulties on achieving the high temperature plasma more than 100 keV. Furthermore the high beta plasma is needed to decrease synchrotron radiation loss. In addition, the efficiency of the direct energy conversion from protons coming out from fusion reaction is one of the key parameters in keeping overall power balance. Therefore, open magnetic filed lines should surround the plasma column. In this paper, we outlined the design of the commercial base reactor (ARTEMIS) of 1 GW electric output power configured by D-{sup 3}He fueled FRC (Field Reversed Configuration). The ARTEMIS needs 64 kg of {sup 3}He per a year. On the other hand, 1 million tons of {sup 3}He is estimated to be in the moon. The {sup 3}He of about 10{sup 23} kg are to exist in gaseous planets such as Jupiter and Saturn. (Y. Tanaka)

  1. Myoblast fusion in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Haralalka, Shruti [Stowers Institute for Medical Research, Kansas City, MO 64110 (United States); Abmayr, Susan M., E-mail: sma@stowers.org [Stowers Institute for Medical Research, Kansas City, MO 64110 (United States); Department of Anatomy and Cell Biology, University of Kansas Medical Center, Kansas City, MO 66160 (United States)

    2010-11-01

    The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

  2. Fusion, magnetic confinement

    International Nuclear Information System (INIS)

    Berk, H.L.

    1992-01-01

    An overview is presented of the principles of magnetic confinement of plasmas for the purpose of achieving controlled fusion conditions. Sec. 1 discusses the different nuclear fusion reactions which can be exploited in prospective fusion reactors and explains why special technologies need to be developed for the supply of tritium or 3 He, the probable fuels. In Sec. 2 the Lawson condition, a criterion that is a measure of the quality of confinement relative to achieving fusion conditions, is explained. In Sec. 3 fluid equations are used to describe plasma confinement. Specific confinement configurations are considered. In Sec. 4 the orbits of particle sin magneti and electric fields are discussed. In Sec. 5 stability considerations are discussed. It is noted that confinement systems usually need to satisfy stability constraints imposed by ideal magnetohydrodynamic (MHD) theory. The paper culminates with a summary of experimental progress in magnetic confinement. Present experiments in tokamaks have reached the point that the conditions necessary to achieve fusion are being satisfied

  3. Fusion technology programme

    International Nuclear Information System (INIS)

    Finken, D.

    1986-05-01

    In 1982, KfK joined the fusion programme of EURATOM as a further association introducing its experience in nuclear technology. KfK closely cooperates with IPP Garching, the two institutions forming a research unit aiming at planning and realization of future development steps of fusion. KfK has combined its forces in the Nuclear Fusion Project (PKF) with participation of several KfK departments to the project tasks. Previous work of KfK in magnetic fusion has addressed mainly superconducting magnets, plasma heating by cluster ions and studies on structural materials. At present, emphasis of our work has concentrated increasingly on the nuclear part, i.e. the first wall and blanket structures and the elements of the tritium extraction and purification system. Associated to this component development are studies of remote maintenance and safety. Most of the actual work addresses NET, the next step to a demonstration of fusion feasibility. NET is supposed to follow JET, the operating plasma physics experiment of Euratom, on the 1990's. Detailed progress of the work in the past half year is described in this report. (orig./GG)

  4. Challenges of nuclear fusion

    International Nuclear Information System (INIS)

    Kunkel, W.B.

    1987-01-01

    After 30 years of research and development in many countries, the magnetic confinement fusion experiments finally seem to be getting close to the original first goal: the point of ''scientific break-even''. Plans are being made for a generation of experiments and tests with actual controlled thermonuclear fusion conditions. Therefore engineers and material scientists are hard at work to develop the required technology. In this paper the principal elements of a generic fusion reactor are described briefly to introduce the reader to the nature of the problems at hand. The main portion of the presentation summarises the recent advances made in this field and discusses the major issues that still need to be addressed in regard to materials and technology for fusion power. Specific examples are the problems of the first wall and other components that come into direct contact with the plasma, where both lifetime and plasma contamination are matters of concern. Equally challenging are the demands on structural materials and on the magnetic-field coils, particularly in connection with the neutron-radiation environment of fusion reactors. Finally, the role of ceramics must be considered, both for insulators and for fuel breeding purposes. It is evident that we still have a formidable task before us, but at this point none of the problems seem to be insoluble. (author)

  5. The need for fusion

    International Nuclear Information System (INIS)

    Llewellyn Smith, Chris

    2005-01-01

    World energy use is predicted to double in the next 40 years. Currently 80% is provided by burning fossil fuels, but this is not sustainable indefinitely because (i) it is driving climate change, and (ii) fossil fuels will eventually be exhausted (starting with oil). The resulting potential energy crisis requires increased investment in energy research and development (which is currently very small on the scale of the $3 trillion p.a. energy market, and falling). The wide portfolio of energy work that should be supported must include fusion, which is one of the very few options that are capable in principle of supplying a large fraction of need. The case for fusion has been strengthened by recent advances in plasma physics and fusion technology that are reflected in the forthcoming European Fusion Power Plant Conceptual Study, which addresses safety and cost issues. The big questions are - How can we deliver fusion power as fast as possible? How long is it likely to take? I argue for a fast track programme, and describe a fast-track model developed at Culham, which is intended to stimulate debate on the way ahead and the resources that are needed

  6. Myoblast fusion in Drosophila

    International Nuclear Information System (INIS)

    Haralalka, Shruti; Abmayr, Susan M.

    2010-01-01

    The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

  7. Material for fusion reactor

    International Nuclear Information System (INIS)

    Abhishek, Anuj; Ranjan, Prem

    2011-01-01

    To make nuclear fusion power a reality, the scientists are working restlessly to find the materials which can confine the power generated by the fusion of two atomic nuclei. A little success in this field has been achieved, though there are still miles to go. Fusion reaction is a special kind of reaction which must occur at very high density and temperature to develop extremely large amount of energy, which is very hard to control and confine within using the present techniques. As a whole it requires the physical condition that rarely exists on the earth to carry out in an efficient manner. As per the growing demand and present scenario of the world energy, scientists are working round the clock to make effective fusion reactions to real. In this paper the work presently going on is considered in this regard. The progress of the Joint European Torus 2010, ITER 2005, HiPER and minor works have been studied to make the paper more object oriented. A detailed study of the technological and material requirement has been discussed in the paper and a possible suggestion is provided to make a contribution in the field of building first ever nuclear fusion reactor

  8. Coatings for fusion reactor environments

    International Nuclear Information System (INIS)

    Mattox, D.M.

    1979-01-01

    The internal surfaces of a tokamak fusion reactor control the impurity injection and gas recycling into the fusion plasma. Coating of internal surfaces may provide a desirable and possibly necessary design flexibility for achieving the temperatures, ion densities and containment times necessary for net energy production from fusion reactions to take place. In this paper the reactor environments seen by various componentare reviewed along with possible materials responses. Characteristics of coating-substrate systems, important to fusion applications, are delineated and the present status of coating development for fusion applications is reviewed. Coating development for fusion applications is just beginning and poses a unique and important challenge for materials development

  9. Fusion: Energy for the future

    International Nuclear Information System (INIS)

    1991-05-01

    Fusion, which occurs in the sun and the stars, is a process of transforming matter into energy. If we can harness the fusion process on Earth, it opens the way to assuring that future generations will not want for heat and electric power. The purpose of this booklet is to introduce the concept of fusion energy as a viable, environmentally sustainable energy source for the twenty-first century. The booklet presents the basic principles of fusion, the global research and development effort in fusion, and Canada's programs for fusion research and development

  10. Vacuum engineering for fusion research and fusion reactors

    International Nuclear Information System (INIS)

    Pittenger, L.C.

    1976-01-01

    The following topics are described: (1) surface pumping by cryogenic condensation, (2) operation of large condensing cryopumps, (3) pumping for large fusion experiments, and (4) vacuum technology for fusion reactors

  11. Controlled thermonuclear fusion

    International Nuclear Information System (INIS)

    Trocheris, M.

    1975-01-01

    An outline is given of the present position of research into controlled fusion. After a brief reminder of the nuclear reactions of fusion and the principle of their use as a source of energy, the results obtained by the method of magnetic confinement are summarized. Among the many solutions that have been imagined and tried out to achieve a magnetic containing vessel capable of holding the thermonuclear plasma, the devices of the Tokamak type have a good lead and that is why they are described in greater detail. An idea is then given of the problems that arise when one intends conceiving the thermonuclear reactor based on the principle of the Tokamaks. The last section deals with fusion by lasers which is a new and most attractive alternative, at least from the viewpoint of basis physics. The report concludes with an indication of the stages to be passed through to reach production of energy on an industrial scale [fr

  12. Peaceful Uses of Fusion

    Science.gov (United States)

    Teller, E.

    1958-07-03

    Applications of thermonuclear energy for peaceful and constructive purposes are surveyed. Developments and problems in the release and control of fusion energy are reviewed. It is pointed out that the future of thermonuclear power reactors will depend upon the construction of a machine that produces more electric energy than it consumes. The fuel for thermonuclear reactors is cheap and practically inexhaustible. Thermonuclear reactors produce less dangerous radioactive materials than fission reactors and, when once brought under control, are not as likely to be subject to dangerous excursions. The interaction of the hot plasma with magnetic fields opens the way for the direct production of electricity. It is possible that explosive fusion energy released underground may be harnessed for the production of electricity before the same feat is accomplished in controlled fusion processes. Applications of underground detonations of fission devices in mining and for the enhancement of oil flow in large low-specific-yield formations are also suggested.

  13. Ceramics for fusion applications

    International Nuclear Information System (INIS)

    Clinard, F.W. Jr.

    1987-01-01

    Ceramics are required for a variety of uses in both near-term fusion devices and in commercial powerplants. These materials must retain adequate structural and electrical properties under conditions of neutron, particle and ionizing irradiation; thermal and applied stresses; and physical and chemical sputtering. Ceramics such as Al 2 O 3 , MgAl 2 O 4 , BeO, Si 3 N 4 and SiC are currently under study for fusion applications, and results to date show widely-varying responses to the fusion environment. Materials can be identified today that will meet initial operating requirements, but improvements in physical properties are needed to achieve satisfactory lifetimes for critical applications. (author)

  14. Inverse fusion PCR cloning.

    Directory of Open Access Journals (Sweden)

    Markus Spiliotis

    Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.

  15. Laser for fusion energy

    International Nuclear Information System (INIS)

    Holzrichter, J.F.

    1995-01-01

    Solid state lasers have proven to be very versatile tools for the study and demonstration of inertial confinement fusion principles. When lasers were first contemplated to be used for the compression of fusion fuel in the late 1950s, the laser output energy levels were nominally one joule and the power levels were 10 3 watts (pulse duration's of 10 -3 sec). During the last 25 years, lasers optimized for fusion research have been increased in power to typically 100,000 joules with power levels approaching 10 14 watts. As a result of experiments with such lasers at many locations, DT target performance has been shown to be consistent with high gain target output. However, the demonstration of ignition and gain requires laser energies of several megajoules. Laser technology improvements demonstrated over the past decade appear to make possible the construction of such multimegajoule lasers at affordable costs. (author)

  16. Ceramics for fusion applications

    International Nuclear Information System (INIS)

    Clinard, F.W. Jr.

    1986-01-01

    Ceramics are required for a variety of uses in both near-term fusion devices and in commercial powerplants. These materials must retain adequate structural and electrical properties under conditions of neutron, particle, and ionizing irradiation; thermal and applied stresses; and physical and chemical sputtering. Ceramics such as Al 2 O 3 , MgAl 2 O 4 , BeO, Si 3 N 4 and SiC are currently under study for fusion applications, and results to date show widely-varying response to the fusion environment. Materials can be identified today which will meet initial operating requirements, but improvements in physical properties are needed to achieve satisfactory lifetimes for critical applications

  17. Fusion Reactor Materials

    Energy Technology Data Exchange (ETDEWEB)

    Decreton, M

    2002-04-01

    The objective of SCK-CEN's programme on fusion reactor materials is to contribute to the knowledge on the radiation-induced behaviour of fusion reactor materials and components as well as to help the international community in building the scientific and technical basis needed for the construction of the future reactor. Ongoing projects include: the study of the mechanical and chemical (corrosion) behaviour of structural materials under neutron irradiation and water coolant environment; the investigation of the characteristics of irradiated first wall material such as beryllium; investigations on the management of materials resulting from the dismantling of fusion reactors including waste disposal. Progress and achievements in these areas in 2001 are discussed.

  18. Fusion reactor wastes

    International Nuclear Information System (INIS)

    Young, J.R.

    1976-01-01

    The fusion reactor currently is being developed as a clean source of electricity with an essentially infinite source of fuel. These reactors are visualized as using a fusion reaction to generate large quantities of high temperature energy which can be used as process heat or for the generation of electricity. The energy would be created primarily as the kinetic energy of neutrons or other reaction products. Neutron energy could be converted to high-temperature heat by moderation and capture of the neutrons. The energy of other reaction products could be converted to high-temperature heat by capture, or directly to electricity by direct conversion electrostatic equipment. An analysis to determine the wastes released as a result of operation of fusion power plants is presented

  19. Heavy ion inertial fusion

    International Nuclear Information System (INIS)

    Keefe, D.; Sessler, A.M.

    1980-01-01

    Inertial fusion has not yet been as well explored as magnetic fusion but can offer certain advantages as an alternative source of electric energy for the future. Present experiments use high-power beams from lasers and light-ion diodes to compress the deuterium-tritium (D-T) pellets but these will probably be unsuitable for a power plant. A more promising method is to use intense heavy-ion beams from accelerator systems similar to those used for nuclear and high-energy physics; the present paper addresses itself to this alternative. As will be demonstrated the very high beam power needed poses new design questions, from the ion-source through the accelerating system, the beam transport system, to the final focus. These problems will require extensive study, both theoretically and experimentally, over the next several years before an optimum design for an inertial fusion driver can be arrived at. (Auth.)

  20. On impact fusion

    International Nuclear Information System (INIS)

    Winterberg, F.

    1997-01-01

    Impact fusion is a promising, but much less developed road towards inertial confinement fusion. It offers an excellent solution to the so-called stand-off problem for thermonuclear microexplosions but is confronted with the challenge to accelerate macroscopic particles to the needed high velocities of 10 2 -10 3 km/s. To reach these velocities, two ways have been studied in the past. The electric acceleration of a beam of microparticles, with the particles as small as large clusters, and the magnetic acceleration of gram-size ferromagnetic or superconducting projectiles. For the generation of an intense burst of soft X-rays used for the indirect drive, impact fusion may offer new promising possibilities

  1. Fusion research at ORNL

    International Nuclear Information System (INIS)

    1982-03-01

    The ORNL Fusion Program includes the experimental and theoretical study of two different classes of magnetic confinement schemes - systems with helical magnetic fields, such as the tokamak and stellarator, and the ELMO Bumpy Torus (EBT) class of toroidally linked mirror systems; the development of technologies, including superconducting magnets, neutral atomic beam and radio frequency (rf) heating systems, fueling systems, materials, and diagnostics; the development of databases for atomic physics and radiation effects; the assessment of the environmental impact of magnetic fusion; and the design of advanced demonstration fusion devices. The program involves wide collaboration, both within ORNL and with other institutions. The elements of this program are shown. This document illustrates the program's scope; and aims by reviewing recent progress

  2. Canadian fusion program

    International Nuclear Information System (INIS)

    Brown, T.S.

    1982-06-01

    The National Research Council of Canada is establishing a coordinated national program of fusion research and development that is planned to grow to a total annual operating level of about $20 million in 1985. The long-term objective of the program is to put Canadian industry in a position to manufacture sub-systems and components of fusion power reactors. In the near term the program is designed to establish a minimum base of scientific and technical expertise sufficient to make recognized contributions and thereby gain access to the international effort. The Canadian program must be narrowly focussed on a few specializations where Canada has special indigenous skills or technologies. The programs being funded are the Tokamak de Varennes, the Fusion Fuels Technology Project centered on tritium management, and high-power gas laser technology and associated diagnostic instrumentation

  3. Ceramics for fusion devices

    International Nuclear Information System (INIS)

    Clinard, F.W. Jr.

    1984-01-01

    Ceramics are required for a number of applications in fusion devices, among the most critical of which are magnetic coil insulators, windows for RF heating systems, and structural uses. Radiation effects dominate consideration of candidate materials, although good pre-irradiation properties are a requisite. Materials and components can be optimized by careful control of chemical and microstructural content, and application of brittle material design and testing techniques. Future directions for research and development should include further extension of the data base in the areas of electrical, structural, and thermal properties; establishment of a fission neutron/fusion neutron correlation including transmutation gas effects; and development of new materials tailored to meet the specific needs of fusion reactors

  4. Heavy ion inertial fusion

    International Nuclear Information System (INIS)

    Keefe, D.; Sessler, A.M.

    1980-07-01

    Inertial fusion has not yet been as well explored as magnetic fusion but can offer certain advantages as an alternative source of electric energy for the future. Present experiments use high-power beams from lasers and light-ion diodes to compress the deuterium-tritium (D-T) pellets but these will probably be unsuitable for a power plant. A more promising method is to use intense heavy-ion beams from accelerator systems similar to those used for nuclear and high-energy physics; the present paper addresses itself to this alternative. As will be demonstrated the very high beam power needed poses new design questions, from the ion source through the accelerating system, the beam transport system, to the final focus. These problems will require extensive study, both theoretically and experimentally, over the next several years before an optimum design for an inertial fusion driver can be arrived at

  5. Alternate laser fusion drivers

    International Nuclear Information System (INIS)

    Pleasance, L.D.

    1979-11-01

    One objective of research on inertial confinement fusion is the development of a power generating system based on this concept. Realization of this goal will depend on the availability of a suitable laser or other system to drive the power plant. The primary laser systems used for laser fusion research, Nd 3+ : Glass and CO 2 , have characteristics which may preclude their use for this application. Glass lasers are presently perceived to be incapable of sufficiently high average power operation and the CO 2 laser may be limited by and issues associated with target coupling. These general perceptions have encouraged a search for alternatives to the present systems. The search for new lasers has been directed generally towards shorter wavelengths; most of the new lasers discovered in the past few years have been in the visible and ultraviolet region of the spectrum. Virtually all of them have been advocated as the most promising candidate for a fusion driver at one time or another

  6. Neutrons and fusion

    International Nuclear Information System (INIS)

    Maynard, C.W.

    1976-01-01

    The production of energy from fusion reactions does not require neutrons in the fundamental sense that they are required in a fission reactor. Nevertheless, the dominant fusion reaction, that between deuterium and tritium, yields a 14 MeV neutron. To contrast a fusion reactor based on this reaction with the fission case, 3 x 10 20 such neutrons produced per gigawatt of power. This is four times as many neutrons as in an equivalent fission reactor and they carry seven times the energy of the fission neutrons. Thus, they dominate the energy recovery problem and create technological problems comparable to the original plasma confinement problem as far as a practical power producing device is concerned. Further contrasts of the fusion and fission cases are presented to establish the general role of neutrons in fusion devices. Details of the energy deposition processes are discussed and those reactions necessary for producing additional tritium are outlined. The relatively high energy flux with its large intensity will activate almost any materials of which the reactor may be composed. This activation is examined from the point of view of decay heat, radiological safety, and long-term storage. In addition, a discussion of the deleterious effects of neutron interactions on materials is given in some detail; this includes the helium and hydrogen producing reactions and displacement rate of the lattice atoms. The various materials that have been proposed for structural purposes, for breeding, reflecting, and moderating neutrons, and for radiation shielding are reviewed from the nuclear standpoint. The specific reactions of interest are taken up for various materials and finally a report is given on the status and prospects of data for fusion studies

  7. Insulators for fusion applications

    International Nuclear Information System (INIS)

    1987-04-01

    Design studies for fusion devices and reactors have become more detailed in recent years and with this has come a better understanding of requirements and operating conditions for insulators in these machines. Ceramic and organic insulators are widely used for many components of fusion devices and reactors namely: radio frequency (RF) energy injection systems (BeO, Al 2 O 3 , Mg Al 2 O 4 , Si 3 N 4 ); electrical insulation for the torus structure (SiC, Al 2 O 3 , MgO, Mg Al 2 O 4 , Si 4 Al 2 O 2 N 6 , Si 3 N 4 , Y 2 O 3 ); lightly-shielded magnetic coils (MgO, MgAl 2 O 4 ); the toroidal field coil (epoxies, polyimides), neutron shield (B 4 C, TiH 2 ); high efficiency electrical generation; as well as the generation of very high temperatures for high efficiency hydrogen production processes (ZrO 2 and Al 2 O 3 - mat, graphite and carbon - felt). Timely development of insulators for fusion applications is clearly necessary. Those materials to be used in fusion machines should show high resistance to radiation damage and maintain their structural integrity. Now the need is urgent for a variety of radiation resistant materials, but much effort in these areas is required for insulators to be considered seriously by the design community. This document contains 14 papers from an IAEA meeting. It was the objective of this meeting to identify existing problems in analysing various situations of applications and requirements of electrical insulators and ceramics in fusion and to recommend strategies and different stages of implementation. This meeting was endorsed by the International Fusion Research Council

  8. International fusion research

    International Nuclear Information System (INIS)

    Pease, R.S.

    1983-01-01

    Nuclear energy of the light elements deuterium and lithium can be released if the 100 MK degree temperature required for deuterium-tritium thermonuclear fusion reactions can be achieved together with sufficient thermal insulation for a net energy yield. Progress of world-wide research shows good prospect for these physical conditions being achieved by the use of magnetic field confinement and of rapidly developing heating methods. Tokamak systems, alternative magnetic systems and inertial confinement progress are described. International co-operation features a number of bilateral agreements between countries: the Euratom collaboration which includes the Joint European Torus, a joint undertaking of eleven Western European nations of Euratom, established to build and operate a major confinement experiment; the development of co-operative projects within the OECD/IEA framework; the INTOR workshop, a world-wide study under IAEA auspices of the next major step in fusion research which might be built co-operatively; and assessments of the potential of nuclear fusion by the IAEA and the International Fusion Research Council. The INTOR (International Tokamak Reactor) studies have outlined a major plant of the tokamak type to study the engineering and technology of fusion reactor systems, which might be constructed on a world-wide basis to tackle and share the investment risks of the developments which lie ahead. This paper summarizes the recent progress of research on controlled nuclear fusion, featuring those areas where international co-operation has played an important part, and describes the various arrangements by which this international co-operation is facilitated. (author)

  9. Intense fusion neutron sources

    International Nuclear Information System (INIS)

    Kuteev, B. V.; Goncharov, P. R.; Sergeev, V. Yu.; Khripunov, V. I.

    2010-01-01

    The review describes physical principles underlying efficient production of free neutrons, up-to-date possibilities and prospects of creating fission and fusion neutron sources with intensities of 10 15 -10 21 neutrons/s, and schemes of production and application of neutrons in fusion-fission hybrid systems. The physical processes and parameters of high-temperature plasmas are considered at which optimal conditions for producing the largest number of fusion neutrons in systems with magnetic and inertial plasma confinement are achieved. The proposed plasma methods for neutron production are compared with other methods based on fusion reactions in nonplasma media, fission reactions, spallation, and muon catalysis. At present, intense neutron fluxes are mainly used in nanotechnology, biotechnology, material science, and military and fundamental research. In the near future (10-20 years), it will be possible to apply high-power neutron sources in fusion-fission hybrid systems for producing hydrogen, electric power, and technological heat, as well as for manufacturing synthetic nuclear fuel and closing the nuclear fuel cycle. Neutron sources with intensities approaching 10 20 neutrons/s may radically change the structure of power industry and considerably influence the fundamental and applied science and innovation technologies. Along with utilizing the energy produced in fusion reactions, the achievement of such high neutron intensities may stimulate wide application of subcritical fast nuclear reactors controlled by neutron sources. Superpower neutron sources will allow one to solve many problems of neutron diagnostics, monitor nano-and biological objects, and carry out radiation testing and modification of volumetric properties of materials at the industrial level. Such sources will considerably (up to 100 times) improve the accuracy of neutron physics experiments and will provide a better understanding of the structure of matter, including that of the neutron itself.

  10. Intense fusion neutron sources

    Science.gov (United States)

    Kuteev, B. V.; Goncharov, P. R.; Sergeev, V. Yu.; Khripunov, V. I.

    2010-04-01

    The review describes physical principles underlying efficient production of free neutrons, up-to-date possibilities and prospects of creating fission and fusion neutron sources with intensities of 1015-1021 neutrons/s, and schemes of production and application of neutrons in fusion-fission hybrid systems. The physical processes and parameters of high-temperature plasmas are considered at which optimal conditions for producing the largest number of fusion neutrons in systems with magnetic and inertial plasma confinement are achieved. The proposed plasma methods for neutron production are compared with other methods based on fusion reactions in nonplasma media, fission reactions, spallation, and muon catalysis. At present, intense neutron fluxes are mainly used in nanotechnology, biotechnology, material science, and military and fundamental research. In the near future (10-20 years), it will be possible to apply high-power neutron sources in fusion-fission hybrid systems for producing hydrogen, electric power, and technological heat, as well as for manufacturing synthetic nuclear fuel and closing the nuclear fuel cycle. Neutron sources with intensities approaching 1020 neutrons/s may radically change the structure of power industry and considerably influence the fundamental and applied science and innovation technologies. Along with utilizing the energy produced in fusion reactions, the achievement of such high neutron intensities may stimulate wide application of subcritical fast nuclear reactors controlled by neutron sources. Superpower neutron sources will allow one to solve many problems of neutron diagnostics, monitor nano-and biological objects, and carry out radiation testing and modification of volumetric properties of materials at the industrial level. Such sources will considerably (up to 100 times) improve the accuracy of neutron physics experiments and will provide a better understanding of the structure of matter, including that of the neutron itself.

  11. X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

    Science.gov (United States)

    Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

    2000-01-01

    A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln

  12. Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy

    Directory of Open Access Journals (Sweden)

    Keyhani Nemat O

    2004-06-01

    Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered

  13. Confinement inertial fusion. Power reactors of nuclear fusion by lasers

    International Nuclear Information System (INIS)

    Velarde, G.; Ahnert, C.; Aragones, J.M.; Leira, G; Martinez-Val, J.M.

    1980-01-01

    The energy crisis and the need of the nuclear fusion energy are analized. The nuclear processes in the laser interation with the ablator material are studied, as well as the thermohydrodinamic processes in the implossion, and the neutronics of the fusion. The fusion reactor components are described and the economic and social impact of its introduction in the future energetic strategies.(author)

  14. Nuclear fusion: Pursuing the Soft [Symposium on fusion technology] option

    International Nuclear Information System (INIS)

    Kenward, M.

    1991-01-01

    Fusion research has come a long way since the fusion community held the first Symposium on fusion technology (Soft) in Britain 30 years ago. Some of the recent achievements of the Jet project are reported from this year's symposium, the 16th in the series, held in London at the beginning of September. (author)

  15. Fusion Energy Update

    International Nuclear Information System (INIS)

    Whitson, M.O.

    1982-01-01

    Fusion Energy Update (CFU) provides monthly abstracting and indexing coverage of current scientific and technical reports, journal articles, conference papers and proceedings, books, patents, theses, and monographs for all sources on fusion energy. All information announced in CFU, plus additional backup information, is included in the energy information data base of the Department of Energy's Technical Information Center. The subject matter covered by CFU includes plasma physics, the physics and engineering of blankets, magnet coils and fields, power supplies and circuitry, cooling systems, fuel systems, radiation hazards, power conversion systems, inertial confinement systems, and component development and testing

  16. Fusion Reactor Materials

    International Nuclear Information System (INIS)

    Decreton, M.

    2000-01-01

    SCK-CEN's research and development programme on fusion reactor materials includes: (1) the study of the mechanical behaviour of structural materials under neutron irradiation (including steels, inconel, molybdenum, chromium); (2) the determination and modelling of the characteristics of irradiated first wall materials such as beryllium; (3) the detection of abrupt electrical degradation of insulating ceramics under high temperature and neutron irradiation; (4) the study of the dismantling and waste disposal strategy for fusion reactors.; (5) a feasibility study for the testing of blanket modules under neutron radiation. Main achievements in these topical areas in the year 1999 are summarised

  17. Vacuum fusion of uranium

    International Nuclear Information System (INIS)

    Stohr, J.A.

    1957-01-01

    After having outlined that vacuum fusion and moulding of uranium and of its alloys have some technical and economic benefits (vacuum operations avoid uranium oxidation and result in some purification; precision moulding avoids machining, chip production and chemical reprocessing of these chips; direct production of the desired shape is possible by precision moulding), this report presents the uranium fusion unit (its low pressure enclosure and pumping device, the crucible-mould assembly, and the MF supply device). The author describes the different steps of cast production, and briefly comments the obtained results

  18. Pulsed power for fusion

    International Nuclear Information System (INIS)

    Martin, T.H.

    1976-01-01

    A review which traces the development of high power pulsed accelerators from the original inception at the Atomic Weapons Research Establishment, Aldermaston, England, for Bremsstrahlung output, through the low impedance accelerators, to the double-sided accelerators for fusion will be given. Proto II is presently being assembled at Sandia and preliminary testing on the Marx has been completed. Examples of various techniques will be shown from Sandia accelerators. Requirements for accelerators capable of achieving fusion levels will be developed and problem areas outlined. The diode insulator flashover problem presently limits the maximum current available from the accelerators

  19. Atomic data for fusion

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, H.T.; Kirkpatrick, M.I.; Alvarez, I.; Cisneros, C.; Phaneuf, R.A. (eds.); Barnett, C.F.

    1990-07-01

    This report provides a handbook of recommended cross-section and rate-coefficient data for inelastic collisions between hydrogen, helium and lithium atoms, molecules and ions, and encompasses more than 400 different reactions of primary interest in fusion research. Published experimental and theoretical data have been collected and evaluated, and the recommended data are presented in tabular, graphical and parametrized form. Processes include excitation and spectral line emission, charge exchange, ionization, stripping, dissociation and particle interchange reactions. The range of collision energies is appropriate to applications in fusion-energy research.

  20. Small mirror fusion reactors

    International Nuclear Information System (INIS)

    Carlson, G.A.; Schultz, K.R.; Smith, A.C. Jr.

    1978-01-01

    Basic requirements for the pilot plants are that they produce a net product and that they have a potential for commercial upgrade. We have investigated a small standard mirror fusion-fission hybrid, a two-component tandem mirror hybrid, and two versions of a field-reversed mirror fusion reactor--one a steady state, single cell reactor with a neutral beam-sustained plasma, the other a moving ring field-reversed mirror where the plasma passes through a reaction chamber with no energy addition