WorldWideScience

Sample records for growth phase onset

  1. Physics of Substorm Growth Phase, Onset, and Dipolarization

    Energy Technology Data Exchange (ETDEWEB)

    C.Z. Cheng

    2003-10-22

    A new scenario of substorm growth phase, onset, and depolarization during expansion phase and the corresponding physical processes are presented. During the growth phase, as a result of enhanced plasma convection, the plasma pressure and its gradient are continued to be enhanced over the quiet-time values in the plasma sheet. Toward the late growth phase, a strong cross-tail current sheet is formed in the near-Earth plasma sheet region, where a local magnetic well is formed, the plasma beta can reach a local maximum with value larger than 50 and the cross-tail current density can be enhanced to over 10nA/m{sup 2} as obtained from 3D quasi-static magnetospheric equilibrium solutions for the growth phase. The most unstable kinetic ballooning instabilities (KBI) are expected to be located in the tailward side of the strong cross-tail current sheet region. The field lines in the most unstable KBI region map to the transition region between the region-1 and region-2 currents in the ionosphere, which is consistent with the observed initial brightening location of the breakup arc in the intense proton precipitation region. The KBI explains the AMPTE/CCE observations that a low-frequency instability with a wave period of 50-75 seconds is excited about 2-3 minutes prior to substorm onset and grows exponentially to a large amplitude at the onset of current disruption (or current reduction). At the current disruption onset higher frequency instabilities are excited so that the plasma and electromagnetic field fluctuations form a strong turbulent state. Plasma transport takes place due to the strong turbulence to relax the ambient plasma pressure profile so that the plasma pressure and current density are reduced and the ambient magnetic field intensity increases by more than a factor of 2 in the high-beta(sub)eq region and the field line geometry recovers from tail-like to dipole-like dipolarization.

  2. Effect of second phase particles topology on the onset temperature of abnormal grain growth in Fe - 3%Si steels

    Directory of Open Access Journals (Sweden)

    Stoyka, V.

    2008-01-01

    Full Text Available The relations between regimes of dynamic annealing, state of secondary particles system and the onset temperature of abnormal grain growth are investigated. Two distinguish types of Fe-3%Si grain-oriented steels, after one and two stage cold rolling, were studied. The second phase particles remain unaffected in first type of steel during the heat treatment. Vice versa, the increased density of second phases was observed after annealing in the second type of the investigated materials. It is shown that start/onset of abnormal grain growth strongly depends on both volume fraction of second phase particles and annealing temperature. Texture and magnetic properties of the investigated samples are investigated within the current study.

  3. Surface and upper air meteorological features during onset phase

    Indian Academy of Sciences (India)

    There was a sharp fall in the temperature difference between 850 and 500 hPa, and the height of zero degree isotherm about 2–3 days before the monsoon onset. The flux of sensible heat was positive (sea to air) over south Arabian Sea during the onset phase. Over the Bay of Bengal higher negative (air to sea) values of ...

  4. Surface and upper air meteorological features during onset phase of ...

    Indian Academy of Sciences (India)

    quality data for the study of monsoon onset processes. The present work aims at gaining more insight into the monsoon onset processes utilizing. ARMEX-II data, especially the thermodynamical structure of the troposphere and air–sea interaction characteristics over the sea areas during pre-onset and onset periods of the ...

  5. Cadmium delays puberty onset and testis growth in adolescents.

    Science.gov (United States)

    Interdonato, Monica; Pizzino, Gabriele; Bitto, Alessandra; Galfo, Federica; Irrera, Natasha; Mecchio, Anna; Pallio, Giovanni; Ramistella, Vincenzo; De Luca, Filippo; Santamaria, Angelo; Minutoli, Letteria; Marini, Herbert; Squadrito, Francesco; Altavilla, Domenica

    2015-09-01

    Cadmium (Cd) has been shown to impair pubertal development in experimental animals. However, no data are available for male adolescents with increased urinary cadmium levels. The aim of this cross-sectional study was to evaluate pubertal onset and pituitary-gonadal axis hormones in male adolescents with increased urinary levels of Cd. We studied 111 males, aged 12-14 years living in the Milazzo-Valle del Mela area. A control age-matched population (n = 60) living 28-45 km far from the industrial site was also enrolled. Pubertal stages were assessed by clinical examination according to Tanner's score. Mean testicular volume was also investigated by ultrasound examination. Urinary Cd concentration and blood levels of FSH, LH, testosterone and inhibin B were also investigated. Cd levels were significantly higher in adolescents living in the Milazzo-Valle del Mela area, compared to both age-matched subjects living far from the industrial plants and the reference values. Our population showed also a delayed onset of puberty, a smaller testicular volume and lower testosterone levels. An inverse correlation was found between urinary Cd and testicular volume (r = -0·25; P = 0·0008), testosterone levels (Spearman's r = -0·0·37; two-tailed P puberty in male adolescents and impaired testicular growth. © 2014 John Wiley & Sons Ltd.

  6. Phase diagrams and crystal growth

    Science.gov (United States)

    Venkrbec, Jan

    1980-04-01

    Phase diagrams are briefly treated as generalized property-composition relationships, with respect to crystal technology optimization. The treatment is based on mutual interaction of three systems related to semiconductors: (a) the semiconducting material systems, (b0 the data bank, (c) the system of crystallization methods. A model is proposed enabling optimatization on the path from application requirements to the desired material. Further, several examples of the selection as to the composition of LED and laser diode material are given. Some of molten-solution-zone methods are being successfully introduced for this purpose. Common features of these methods, the application of phase diagrams, and their pecularities compared with other crystallization methods are illustrated by schematic diagrams and by examples. LPE methods, particularly the steady-state LPE methods such as Woodall's ISM and Nishizawa's TDM-CVP, and the CAM-S (Crystallization Method Providing Composition Autocontrol in Situ) have been chosen as examples. Another approach of exploiting phase diagrams for optimal material selection and for determination of growth condition before experimentation through a simple calculation is presented on InP-GaP solid solutions. Ternary phase diagrams are visualized in space through calculation and constructions based on the corresponding thermodynamic models and anaglyphs. These make it easy to observe and qualitatively analyze the crystallization of every composition. Phase diagrams can be also used as a powerful tool for the deduction of new crystallization methods. Eutectic crystallization is an example of such an approach where a modified molten-solution-zone method can give a sandwich structure with an abrupt concentration change. The concentration of a component can range from 0 to 100% in the different solid phases.

  7. Surface and upper air meteorological features during onset phase of ...

    Indian Academy of Sciences (India)

    Over the Bay of Bengal higher negative (air to sea) values of sensible flux prevailed before the monsoon onset which became less negative with the advance of monsoon over that region. The pre-onset period was characterized by large sea surface temperature (SST) gradient over the Arabian Sea with rapid decrease ...

  8. Computation of Onset and Growth of Delamination in Double Cantilever beam Specimens Subjected to Fatigue Loading

    OpenAIRE

    Krishna Lok Singh; Madhu K.S; Mallikarjun Vaggar

    2014-01-01

    In this article, the delamination onset and growth behavior of double cantilever beam (DCB) specimens has been presented. The modeling of a debonded region using master and slave surface technique for DCB specimens is done in ABAQUS CAE. The analysis of DCB specimens comprising of fatigue cyclic load has been done in ABAQUS. An onset and Paris delamination growth regimes are plotted. The growth regime being linear in log-log scale, the prediction of constants of this regime has been obtained ...

  9. Simulation of the Indian summer monsoon onset-phase rainfall using a regional model

    Directory of Open Access Journals (Sweden)

    C. V. Srinivas

    2015-09-01

    Full Text Available This study examines the ability of the Advanced Research WRF (ARW regional model to simulate Indian summer monsoon (ISM rainfall climatology in different climate zones during the monsoon onset phase in the decade 2000–2009. The initial and boundary conditions for ARW are provided from the NCEP/NCAR Reanalysis Project (NNRP global reanalysis. Seasonal onset-phase rainfall is compared with corresponding values from 0.25° IMD (India Meteorological Department rainfall and NNRP precipitation data over seven climate zones (perhumid, humid, dry/moist, subhumid, dry/moist, semiarid and arid of India to see whether dynamical downscaling using a regional model yields advantages over just using large-scale model predictions. Results show that the model could simulate the onset phase in terms of progression and distribution of rainfall in most zones (except over the northeast with good correlations and low error metrics. The observed mean onset dates and their variability over different zones are well reproduced by the regional model over most climate zones. It has been found that the ARW performed similarly to the reanalysis in most zones and improves the onset time by 1 to 3 days in zones 4 and 7, in which the NNRP shows a delayed onset compared to the actual IMD onset times. The variations in the onset-phase rainfall during the below-normal onset (June negative and above-normal onset (June positive phases are well simulated. The slight underestimation of onset-phase rainfall in the northeast zone could be due to failure in resolving the wide extent of topographic variations and the associated multiscale interactions in that zone. Spatial comparisons showed improvement of pentad rainfall in both space and quantity in ARW simulations over NNRP data, as evident from a wider eastward distribution of pentad rainfall over the Western Ghats, central and eastern India, as in IMD observations. While NNRP under-represented the high pentad rainfall over

  10. Simulation of the Indian summer monsoon onset-phase rainfall using a regional model

    KAUST Repository

    Srinivas, C. V.

    2015-09-11

    This study examines the ability of the Advanced Research WRF (ARW) regional model to simulate Indian summer monsoon (ISM) rainfall climatology in different climate zones during the monsoon onset phase in the decade 2000–2009. The initial and boundary conditions for ARW are provided from the NCEP/NCAR Reanalysis Project (NNRP) global reanalysis. Seasonal onset-phase rainfall is compared with corresponding values from 0.25° IMD (India Meteorological Department) rainfall and NNRP precipitation data over seven climate zones (perhumid, humid, dry/moist, subhumid, dry/moist, semiarid and arid) of India to see whether dynamical downscaling using a regional model yields advantages over just using large-scale model predictions. Results show that the model could simulate the onset phase in terms of progression and distribution of rainfall in most zones (except over the northeast) with good correlations and low error metrics. The observed mean onset dates and their variability over different zones are well reproduced by the regional model over most climate zones. It has been found that the ARW performed similarly to the reanalysis in most zones and improves the onset time by 1 to 3 days in zones 4 and 7, in which the NNRP shows a delayed onset compared to the actual IMD onset times. The variations in the onset-phase rainfall during the below-normal onset (June negative) and above-normal onset (June positive) phases are well simulated. The slight underestimation of onset-phase rainfall in the northeast zone could be due to failure in resolving the wide extent of topographic variations and the associated multiscale interactions in that zone. Spatial comparisons showed improvement of pentad rainfall in both space and quantity in ARW simulations over NNRP data, as evident from a wider eastward distribution of pentad rainfall over the Western Ghats, central and eastern India, as in IMD observations. While NNRP under-represented the high pentad rainfall over northeast, east and

  11. Onset of Convection in Two Liquid Layers with Phase Change

    Energy Technology Data Exchange (ETDEWEB)

    McFadden, G B; Coriell, S R; Gurski, K F; Cotrell, D L

    2006-09-14

    We perform linear stability calculations for horizontal fluid bilayers that can undergo a phase transformation, taking into account both buoyancy effects and thermocapillary effects in the presence of a vertical temperature gradient. We compare the familiar case of the stability of two immiscible fluids in a bilayer geometry with the less-studied case that the two fluids represent different phases of a single-component material, e.g., the water-steam system. The two cases differ in their interfacial boundary conditions: the condition that the interface is a material surface is replaced by the continuity of mass flux across the interface, together with an assumption of thermodynamic equilibrium that in the linearized equations represents the Clausius-Clapeyron relation relating the interfacial temperature and pressures. For the two-phase case, we find that the entropy difference between the phases plays a crucial role in determining the stability of the system. For small values of the entropy difference between the phases, the two-phase system can be linearly unstable to either heating from above or below. The instability is due to the Marangoni effect in combination with the effects of buoyancy (for heating from below). For larger values of the entropy difference the two-phase system is unstable only for heating from below, and the Marangoni effect is masked by effects of the entropy difference. To help understand the mechanisms driving the instability on heating from below we have performed both long-wavelength and short-wavelength analyses of the two-phase system. The short-wavelength analysis shows that the instability is driven by a coupling between the flow normal to the interface and the latent heat generation at the interface. The mechanism for the large wavelength instability is more complicated, and the detailed form of the expansion is found to depend on the Crispation and Bond numbers as well as the entropy difference. The two-phase system allows a

  12. Increases in plasma sheet temperature with solar wind driving during substorm growth phases

    Science.gov (United States)

    Forsyth, C; Watt, C E J; Rae, I J; Fazakerley, A N; Kalmoni, N M E; Freeman, M P; Boakes, P D; Nakamura, R; Dandouras, I; Kistler, L M; Jackman, C M; Coxon, J C; Carr, C M

    2014-01-01

    During substorm growth phases, magnetic reconnection at the magnetopause extracts ∼1015 J from the solar wind which is then stored in the magnetotail lobes. Plasma sheet pressure increases to balance magnetic flux density increases in the lobes. Here we examine plasma sheet pressure, density, and temperature during substorm growth phases using 9 years of Cluster data (>316,000 data points). We show that plasma sheet pressure and temperature are higher during growth phases with higher solar wind driving, whereas the density is approximately constant. We also show a weak correlation between plasma sheet temperature before onset and the minimum SuperMAG AL (SML) auroral index in the subsequent substorm. We discuss how energization of the plasma sheet before onset may result from thermodynamically adiabatic processes; how hotter plasma sheets may result in magnetotail instabilities, and how this relates to the onset and size of the subsequent substorm expansion phase. PMID:26074645

  13. Clinical outcome and placental characteristics of monochorionic diamniotic twin pairs with early- and late-onset discordant growth.

    Science.gov (United States)

    Lewi, Liesbeth; Gucciardo, Leonardo; Huber, Agnes; Jani, Jacques; Van Mieghem, Tim; Doné, Elisa; Cannie, Mieke; Gratacós, Eduardo; Diemert, Anke; Hecher, Kurt; Lewi, Paul; Deprest, Jan

    2008-11-01

    The purpose of this study was to examine the clinical and placental characteristics of monochorionic diamniotic twin pregnancies with early-onset discordant growth diagnosed at 20 weeks, late-onset discordant growth diagnosed at 26 weeks or later, and concordant growth. We studied a prospective cohort that underwent an ultrasound scan in the first trimester, at 16, 20, and 26 weeks. We excluded pregnancies complicated by twin-to-twin transfusion syndrome, miscarriage, fetal death less than 16 weeks, or severe congenital anomalies. Placental sharing and angioarchitecture were assessed by injection of each cord vessel with dyed barium sulphate. The 2 territories were delineated on an X-ray angiogram. The diameter of each intertwin anastomosis was measured on a digital photograph. We included 178 twin pairs. Early onset discordant growth, late-onset discordant growth, and concordant growth occurred in 15, 13, and 150 pregnancies, respectively. Twin pairs with early-onset discordant growth had lower survival rates and were delivered at an earlier gestational age than pairs with late-onset discordant and concordant growth. The degree of birthweight discordance was similar in early- and late-onset discordant growth. Severe intertwin hemoglobin differences at the time of birth occurred in 0%, 38%, and 3% of pairs with early-onset discordant growth, late-onset discordant growth, and concordant growth, respectively. The placentas of pairs with early-onset discordant growth were more unequally shared and had larger arterioarterial anastomoses and a larger total anastomotic diameter as compared with placentas of pairs with late onset-discordant or concordant growth. Unequal placental sharing appears to be involved in the etiology of early-onset discordant growth, whereas a late intertwin transfusion imbalance may be involved in some cases with late-onset discordant growth.

  14. Microbial growth with vapor-phase substrate

    Energy Technology Data Exchange (ETDEWEB)

    Hanzel, Joanna; Thullner, Martin; Harms, Hauke [UFZ - Helmholtz Centre for Environmental Research, Department of Environmental Microbiology, Permoserstrasse 15, 04318 Leipzig (Germany); Wick, Lukas Y., E-mail: lukas.wick@ufz.de [UFZ - Helmholtz Centre for Environmental Research, Department of Environmental Microbiology, Permoserstrasse 15, 04318 Leipzig (Germany)

    2011-04-15

    Limited information exists on influences of the diffusive transport of volatile organic contaminants (VOC) on bacterial activity in the unsaturated zone of the terrestrial subsurface. Diffusion of VOC in the vapor-phase is much more efficient than in water and results in effective VOC transport and high bioavailability despite restricted mobility of bacteria in the vadose zone. Since many bacteria tend to accumulate at solid-water, solid-air and air-water interfaces, such phase boundaries are of a special interest for VOC-biodegradation. In an attempt to evaluate microbial activity toward air-borne substrates, this study investigated the spatio-temporal interplay between growth of Pseudomonas putida (NAH7) on vapor-phase naphthalene (NAPH) and its repercussion on vapor-phase NAPH concentrations. Our data demonstrate that growth rates of strain PpG7 were inversely correlated to the distance from the source of vapor-phase NAPH. Despite the high gas phase diffusivity of NAPH, microbial growth was absent at distances above 5 cm from the source when sufficient biomass was located in between. This indicates a high efficiency of suspended bacteria to acquire vapor-phase compounds and influence headspace concentration gradients at the centimeter-scale. It further suggests a crucial role of microorganisms as biofilters for gas-phase VOC emanating from contaminated groundwater or soil. - Research highlights: > Suspended bacteria have a high efficiency to degrade vapor-phase naphthalene. > Bacteria influence NAPH vapor-phase concentration gradients at centimeter-scale. > Microbial growth on vapor-phase naphthalene is inversely correlated to its source. > Bacteria are good biofilters for gas-phase NAPH emanating from contaminated sites. - Suspended bacteria have a high efficiency to degrade vapor-phase naphthalene and effectively influence vapor-phase naphthalene concentration gradients at the centimeter scale.

  15. Social, educational and vocational outcomes in patients with childhood-onset and young-adult-onset growth hormone deficiency.

    Science.gov (United States)

    Mitra, M Tanya; Jönsson, Peter; Åkerblad, Ann-Charlotte; Clayton, Peter; Kołtowska-Häggström, Maria; Korbonits, Márta; Toogood, Andy; Gleeson, Helena

    2017-04-01

    Hypopituitarism diagnosed in childhood, adolescence and young adulthood has the potential to affect growth and somatic development. Less is known about the impact of such a diagnosis on other aspects of development. An analysis of the KIMS database (Pfizer International Metabolic Database) was performed to explore social, educational and vocational outcomes of adult patients diagnosed in childhood, adolescence and young adulthood compared with adult-onset controls. A total of 2952 adult patients diagnosed with hypothalamic pituitary conditions before the age of 25 were divided into two groups: childhood-onset [educational and vocational outcomes. Compared with the AO control group, CO and YAO patients were between 4·5 and 8·0 times more likely to live with their parents in adulthood; CO and YAO patients were also less likely to live in partnership and to have children. The impact on educational and vocational outcomes was less marked than on social outcomes with no significant differences compared with the AO control group. Educational and vocational outcomes showed the lowest level in male and female CO and YAO patients who had been previously diagnosed with a brain tumour. Social outcomes were more affected than educational and vocational outcomes. Although CO patients are more adversely affected, YAO patients were also failing to achieve social milestones. This has consequences for the delivery of endocrine care in both paediatric and adult services. © 2016 John Wiley & Sons Ltd.

  16. Childhood-onset growth hormone deficiency, cognitive function and brain N-acetylaspartate

    NARCIS (Netherlands)

    van Dam, PS; de Winter, CF; de Vries, R; van der Grond, J; Drent, ML; Lijffijt, M; Kenemans, JL; Aleman, A; de Haan, EHF; Koppeschaar, HPF

    Cognitive deficits have been reported in adults with childhood-onset growth hormone (GH) deficiency. We evaluated cognitive deficits simultaneously with parameters for neuronal integrity using H-1 magnetic resonance spectroscopy (MRS) in a cross-sectional design. We studied 11 adults (mean age 24.5

  17. Childhood-onset growth hormone deficiency, cognitive function and brain N-acetylaspartate

    NARCIS (Netherlands)

    van Dam, P Sytze; de Winter, Channa F; de Vries, Rehana; Van Der Grond, Jeroen; Drent, Madeleine L; Lijffijt, Marijn; Kenemans, J Leon; Aleman, André; de Haan, Edward H F; Koppeschaar, Hans P F

    Cognitive deficits have been reported in adults with childhood-onset growth hormone (GH) deficiency. We evaluated cognitive deficits simultaneously with parameters for neuronal integrity using (1)H magnetic resonance spectroscopy (MRS) in a cross-sectional design. We studied 11 adults (mean age 24.5

  18. Bone Mineral Density and Body Composition in Adolescents with Childhood-Onset Growth Hormone Deficiency

    NARCIS (Netherlands)

    Boot, Annemieke M.; van der Sluis, Inge M.; Krenning, Eric P.; Keizer-Schrama, Sabine M. P. F. de Muinck

    2009-01-01

    Background/Aims: The aim of the present study was to evaluate bone mineral density (BMD) and body composition of patients with childhood-onset growth hormone (GH) deficiency (GHD) treated with GH during the transition period. Methods: BMD and body composition, measured by dual-energy X-ray

  19. SABRE observations of structured ionospheric flows during substorm expansion phase onset

    Directory of Open Access Journals (Sweden)

    E. G. Bradshaw

    1994-08-01

    Full Text Available The irregularity velocity patterns observed by the SABRE coherent radar at substorm expansion phase onset, which is identified by magnetometer observations of Pi2 pulsations, are occasionally highly structured. In all the examples of structured velocity patterns examined, the SABRE viewing area is located at longitudes within the inferred substorm current wedge. Three types of structured velocity regime are apparent depending on the level of magnetic activity and the position of the radar viewing area relative to the substorm enhanced currents and the Pi2 pulsation generation region. Firstly, vortex-like velocity patterns are observed and these may be caused by the field-aligned currents associated with the substorm current wedge. Secondly, regions of equatorward velocity are also observed at times of substorm expansion phase onset moving longitudinally across the SABRE viewing area. The longitudinal movement is usually westward although an example of eastward motion has been observed. The phase velocity of these regions of equatorward flow is typically 1-3 km s-1. The observed equatorward velocities occur at the poleward edge or poleward of the background convection velocities observed by SABRE. These equatorward velocities may be related to the westward travelling surge and to the expansion (eastwards as well as westwards of the brightening arc region at substorm onset. Thirdly, the flow rotates equatorward within the field of view but does not then appear to move longitudinally. These equatorward velocities may relate to the earthward surge of plasma from the magnetotail at substorm onset.

  20. Shining light in dark corners: diagnosis and management of late-onset fetal growth restriction.

    Science.gov (United States)

    MacDonald, Teresa M; McCarthy, Elizabeth A; Walker, Susan P

    2015-02-01

    Fetal growth restriction (FGR) is the single biggest risk factor for stillbirth. In the absence of any effective treatment for fetal growth restriction, the mainstay of management is close surveillance and timely delivery. While such statements are almost self-evident, the daily clinical challenge of late-onset fetal growth restriction remains; the competing priorities of minimising stillbirth risk, while avoiding excessive obstetric intervention and the neonatal sequelae of iatrogenic preterm birth. This dilemma is made harder because the tools for late-onset FGR diagnosis and surveillance compare poorly to those used in early-onset FGR; screening tests in early pregnancy have limited predictive value; most cases escape clinical detection, a phenomenon set to worsen given the obesity epidemic; there is a failure of consensus on the definition of small for gestational age, and ancillary tools, such as umbilical artery Doppler--of value in identification of preterm FGR--are less useful in the late-preterm period and at term. Most importantly, the problem is common; 96% of all births occur after 32 weeks. This means a poor noise/signal ratio of any test or management algorithm will inevitably have large clinical consequences. Into such a dark corner, we cast some light; a summary on diagnostic criteria, new developments to improve the diagnosis of late-onset FGR and a suggested approach to management. © 2015 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.

  1. Cellular heterogeneity in vertical growth phase melanoma.

    Science.gov (United States)

    Laga, Alvaro C; Murphy, George F

    2010-12-01

    Melanoma growing as a tumorigenic nodule is one of the most virulent neoplasms to which the flesh is heir. At a considerably small tumor size, it incurs significant risk for widespread metastatic dissemination. There are no effective means of surgical intervention, chemical therapy, or immunologic therapy for advanced and metastatic melanoma. To review the literature and highlight recent cardinal advances in the understanding of melanoma vertical growth, with specific emphasis on how its recognition and characterization may be applied to diagnostic practice and development of novel investigative approaches. Literature review, archival material, personal experience, and research collaborators. The study of tumorigenic melanoma, both in primary lesions and in metastases, is the key to the eventual eradication of this highly virulent neoplasm that may disseminate widely when only occupying the volume of a grain of rice. Morphology often provides the first insight into structure and function. A growing database using meticulous and inclusive criteria to define tumor stem cells in the context of clinically relevant models now indicates that the key to melanoma heterogeneity may reside in a small subpopulation with the ability to self-renew and form tumors despite most cells present being significantly less virulent. Hopefully, from these insights into melanoma tumor progression from radial growth phase to heterogeneous and tumorigenic vertical growth phase will come additional answers to how smart therapies may be developed that specifically target those vertical growth phase cells that most pertain to patient survival.

  2. Nanoparticle growth by particle-phase chemistry

    Science.gov (United States)

    Apsokardu, Michael J.; Johnston, Murray V.

    2018-02-01

    The ability of particle-phase chemistry to alter the molecular composition and enhance the growth rate of nanoparticles in the 2-100 nm diameter range is investigated through the use of a kinetic growth model. The molecular components included are sulfuric acid, ammonia, water, a non-volatile organic compound, and a semi-volatile organic compound. Molecular composition and growth rate are compared for particles that grow by partitioning alone vs. those that grow by a combination of partitioning and an accretion reaction in the particle phase between two organic molecules. Particle-phase chemistry causes a change in molecular composition that is particle diameter dependent, and when the reaction involves semi-volatile molecules, the particles grow faster than by partitioning alone. These effects are most pronounced for particles larger than about 20 nm in diameter. The modeling results provide a fundamental basis for understanding recent experimental measurements of the molecular composition of secondary organic aerosol showing that accretion reaction product formation increases linearly with increasing aerosol volume-to-surface-area. They also allow initial estimates of the reaction rate constants for these systems. For secondary aerosol produced by either OH oxidation of the cyclic dimethylsiloxane (D5) or ozonolysis of β-pinene, oligomerization rate constants on the order of 10-3 to 10-1 M-1 s-1 are needed to explain the experimental results. These values are consistent with previously measured rate constants for reactions of hydroperoxides and/or peroxyacids in the condensed phase.

  3. Growth hormone effects on cortical bone dimensions in young adults with childhood-onset growth hormone deficiency

    DEFF Research Database (Denmark)

    Hyldstrup, L; Conway, G S; Racz, K

    2012-01-01

    Growth hormone (GH) treatment in young adults with childhood-onset GH deficiency has beneficial effects on bone mass. The present study shows that cortical bone dimensions also benefit from GH treatment, with endosteal expansion and increased cortical thickness leading to improved bone strength....... INTRODUCTION: In young adults with childhood-onset growth hormone deficiency (CO GHD), GH treatment after final height is reached has been shown to have beneficial effects on spine and hip bone mineral density. The objective of the study was to evaluate the influence of GH on cortical bone dimensions. METHODS......: Patients (n = 160; mean age, 21.2 years; 63% males) with CO GHD were randomised 2:1 to GH or no treatment for 24 months. Cortical bone dimensions were evaluated by digital x-ray radiogrammetry of the metacarpal bones every 6 months. RESULTS: After 24 months, cortical thickness was increased compared...

  4. Nanoparticle growth by particle-phase chemistry

    Directory of Open Access Journals (Sweden)

    M. J. Apsokardu

    2018-02-01

    Full Text Available The ability of particle-phase chemistry to alter the molecular composition and enhance the growth rate of nanoparticles in the 2–100 nm diameter range is investigated through the use of a kinetic growth model. The molecular components included are sulfuric acid, ammonia, water, a non-volatile organic compound, and a semi-volatile organic compound. Molecular composition and growth rate are compared for particles that grow by partitioning alone vs. those that grow by a combination of partitioning and an accretion reaction in the particle phase between two organic molecules. Particle-phase chemistry causes a change in molecular composition that is particle diameter dependent, and when the reaction involves semi-volatile molecules, the particles grow faster than by partitioning alone. These effects are most pronounced for particles larger than about 20 nm in diameter. The modeling results provide a fundamental basis for understanding recent experimental measurements of the molecular composition of secondary organic aerosol showing that accretion reaction product formation increases linearly with increasing aerosol volume-to-surface-area. They also allow initial estimates of the reaction rate constants for these systems. For secondary aerosol produced by either OH oxidation of the cyclic dimethylsiloxane (D5 or ozonolysis of β-pinene, oligomerization rate constants on the order of 10−3 to 10−1 M−1 s−1 are needed to explain the experimental results. These values are consistent with previously measured rate constants for reactions of hydroperoxides and/or peroxyacids in the condensed phase.

  5. Contribution of growth phases to adult size.

    Science.gov (United States)

    Sheehy, A; Gasser, T; Molinari, L; Largo, R H

    2000-01-01

    Based on the data of the First Zurich Longitudinal Growth Study we investigate how interindividual differences in adult size arise in the variables leg height, sitting height and standing height, arm length, bi-iliac width and bihumeral width. Specifically, we are also interested in the question of whether across sexes and variables the same growth phases and the same parameters are predictive for achieving a certain adult size. A rather complex pattern emerges, demonstrating that regulation of growth is not the same for boys and girls and moreover is not the same for the six anthropometric variables studied. Prepubertal growth is characterized by its intensity (average velocity) and by its duration. Whereas duration has by itself no appreciable influence on adult size, prepubertal intensity determines adult size to a high degree across all variables and both sexes. The intensity of prepubertal growth determines adult size to a larger degree for boys than for girls. For a given size at the end of the prepubertal period, a small duration enhances the chance of obtaining a large adult size. Compared with prepubertal growth, the amount of variance of adult size explained is small for pubertal parameters, and--with respect to linear measures--significant for girls only. A small duration of prepubertal growth is in the following mainly compensated by a stronger pubertal spurt (PS), to a varying degree across variables. The overall picture which emerges indicates that sitting height--and to a lesser extent bihumeral width--develop in a more irregular fashion than the variables bi-iliac width and leg height.

  6. Management of Very Early-onset Fetal Growth Restriction: Results from 92 Consecutive Cases.

    Science.gov (United States)

    Hoellen, Friederike; Beckmann, Annika; Banz-Jansen, Constanze; Weichert, Jan; Rody, Achim; Bohlmann, Michael K

    2016-01-01

    To evaluate management of early-onset intrauterine growth restriction (IUGR) and to define outcome according to obstetric setting. During an 11-year period (2000-2011), data of patients presenting with IUGR and preterm delivery of less than 30 weeks of gestation at a tertiary perinatal center were retrospectively reviewed. A total of 92 pregnancies were investigated. Delivery was indicated for fetal reasons in 38 out of 92 patients. Sixteen children of our cohort died within one year post partum, out of which eight had suffered from severe early-onset IUGR causing iatrogenic preterm delivery. Concerning the fetal outcome, gestational age at delivery and antenatal exposure to corticosteroids were found to be crucial. In some cases, respiratory distress syndrome prophylaxis and a "wait and see" approach to management in favor of a prolongation of the pregnancy might be favorable. Randomized prospective trials in early-onset IUGR with threatened preterm deliveries are needed in order to define guidelines for an individually tailored management of early-onset preterm infants. Copyright © 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  7. Hospital nurses' views of the signs and symptoms that herald the onset of the dying phase in oncology patients

    NARCIS (Netherlands)

    Roos M.B. Nieweg; G.F. van der Werff; Wolter Paans

    2012-01-01

    Determining the onset of the dying phase is important, because care aims and interventions change once this phase begins. In the dying phase, maximising comfort is paramount, even if doing so causes a deterioration of cognitive functions. In this delicate context, it is necessary to give special

  8. Vascular endothelial growth factor, capillarization, and function of the rat plantaris muscle at the onset of hypertrophy.

    NARCIS (Netherlands)

    Degens, H.; Moore, J.A.; Alway, S.E.

    2003-01-01

    Capillary proliferation occurs during compensatory hypertrophy. We investigated whether the expression of vascular endothelial growth factor (VEGF) is elevated at the onset of hypertrophy when capillary proliferation is minimal, and whether muscle damage as assessed by muscle force deficits, may

  9. The onset condition of equatorial plasma bubbles - the role of seeding mechanism and growth condition

    Science.gov (United States)

    Kil, H.; Choi, J. M.; Kwak, Y. S.; Lee, W. K.; Park, J.

    2015-12-01

    We investigate the role of seeding mechanism and growth condition of perturbations in the creation of equatorial plasma bubbles by analyzing the C/NOFS and ROCSAT-1 satellite observations. The initial development times of bubbles were identified by manual processing of the data, and the periodic characteristics in the occurrence of bubbles were investigated using periodograms obtained from segments of bubble chains. Our preliminary results show that bubbles initiate at the time that the pre-reversal enhancement (PRE) ends. This time corresponds to the time that the F region reaches the highest altitude where the growth rate of the Rayleigh-Taylor (R-T) instability is large. The initial onset time of bubbles varies with season and longitude in accordance with the variation of the PRE ending time. Our investigation of the periodicity in the occurrence of bubbles (spacing between bubbles) shows that a dominant periodicity does not exist; the spacing between bubbles ranges from 100 km to over 1000 km. A pronounced periodicity occurs in some series of bubbles, but, in general, multiple periodicity co-exists. The initiation of bubbles at a specific local time but the absence of a preferential wave property in the occurrence of bubbles lead to the conclusion that the onset of bubbles is controlled by the growth condition of the R-T instability.

  10. Phase Matters: Responding to and Learning about Peripheral Stimuli Depends on Hippocampal ? Phase at Stimulus Onset

    Science.gov (United States)

    Nokia, Miriam S.; Waselius, Tomi; Mikkonen, Jarno E.; Wikgren, Jan; Penttonen, Markku

    2015-01-01

    Hippocampal ? (3-12 Hz) oscillations are implicated in learning and memory, but their functional role remains unclear. We studied the effect of the phase of local ? oscillation on hippocampal responses to a neutral conditioned stimulus (CS) and subsequent learning of classical trace eyeblink conditioning in adult rabbits. High-amplitude, regular…

  11. Pulsating aurora and cosmic noise absorption associated with growth-phase arcs

    Directory of Open Access Journals (Sweden)

    D. McKay

    2018-01-01

    Full Text Available The initial stage of a magnetospheric substorm is the growth phase, which typically lasts 1–2 h. During the growth phase, an equatorward moving, east–west extended, optical auroral arc is observed. This is called a growth-phase arc. This work aims to characterize the optical emission and riometer absorption signatures associated with growth-phase arcs of isolated substorms. This is done using simultaneous all-sky camera and imaging riometer observations. The optical and riometric observations allow determination of the location of the precipitation within growth-phase arcs of low- (< 10  keV and high- (>  10 keV energy electrons, respectively. The observations indicate that growth-phase arcs have the following characteristics: 1. The peak of the cosmic noise absorption (CNA arc is equatorward of the optical emission arc. This CNA is contained within the region of diffuse aurora on the equatorward side.2. Optical pulsating aurora are seen in the border region between the diffuse emission region on the equatorward side and the bright growth-phase arc on the poleward side. CNA is detected in the same region. 3. There is no evidence of pulsations in the CNA. 4. Once the equatorward drift starts, it proceeds at constant speed, with uniform separation between the growth-phase arc and CNA of 40 ± 10 km. Optical pulsating aurora are known to be prominent in the post-onset phase of a substorm. The fact that pulsations are also seen in a fairly localized region during the growth phase shows that the substorm expansion-phase dynamics are not required to closely precede the pulsating aurora.

  12. Functional and Radiographic Outcomes Following Growth-Sparing Management of Early-Onset Scoliosis.

    Science.gov (United States)

    Johnston, Charles E; Tran, Dong-Phuong; McClung, Anna

    2017-06-21

    In this study, we sought to evaluate radiographic, functional, and quality-of-life outcomes of patients who have completed growth-sparing management of early-onset scoliosis. This prospective study involved patients with early-onset scoliosis who underwent growth-sparing treatment and either "final" fusion or observation for ≥2 years since the last lengthening procedure. Demographics, radiographic parameters, pulmonary function test (PFT) values, and scores of patient-reported assessments (Early-Onset Scoliosis Questionnaire [EOSQ] and Scoliosis Research Society [SRS]-30) were obtained. At the most recent follow-up, patients performed 2 additional functional outcome tests: step-activity monitoring and a treadmill exercise-tolerance test. Twelve patients were evaluated as "graduates" of growth-sparing management of early-onset scoliosis (mean of 37 months since the most recent surgery). The major scoliosis curve measurement averaged 88° before treatment and 47° at the most recent follow-up. T1-S1 height increased from a mean of 22.3 cm to 34.7 cm and T1-T12 height, from 13.3 to 22.3 cm. At the most recent follow-up, the mean forced expiratory volume in 1 second (FEV1) and forced vital capacity (FVC) as a percentage of the predicted volume were 52.1% and 55.3%, respectively, and were essentially unchanged from the earliest PFT that patients could perform (FEV1 = 53.8% of predicted and FVC = 53.5% of predicted). There was no difference between graduates and controls with respect to activity time or total steps in step-activity monitoring, and in the exercise-tolerance test, graduates walked at the same speed but at a higher heart rate and at a significantly higher (p scoliosis appears to be spine elongation and maintenance of pulmonary function at a level that is no less than the percentage of normal at initial presentation. Functional testing and patient-reported outcomes at a mean of 3 years from the last surgery suggest that activity levels were generally equal

  13. Phase matters: responding to and learning about peripheral stimuli depends on hippocampal θ phase at stimulus onset

    Science.gov (United States)

    Waselius, Tomi; Mikkonen, Jarno E.; Wikgren, Jan; Penttonen, Markku

    2015-01-01

    Hippocampal θ (3–12 Hz) oscillations are implicated in learning and memory, but their functional role remains unclear. We studied the effect of the phase of local θ oscillation on hippocampal responses to a neutral conditioned stimulus (CS) and subsequent learning of classical trace eyeblink conditioning in adult rabbits. High-amplitude, regular hippocampal θ-band responses (that predict good learning) were elicited by the CS when it was timed to commence at the fissure θ trough (Trough group). Regardless, learning in this group was not enhanced compared with a yoked control group, possibly due to a ceiling effect. However, when the CS was consistently presented to the peak of θ (Peak group), hippocampal θ-band responding was less organized and learning was retarded. In well-trained animals, the hippocampal θ phase at CS onset no longer affected performance of the learned response, suggesting a time-limited role for hippocampal processing in learning. To our knowledge, this is the first study to demonstrate that timing a peripheral stimulus to a specific phase of the hippocampal θ cycle produces robust effects on the synchronization of neural responses and affects learning at the behavioral level. Our results support the notion that the phase of spontaneous hippocampal θ oscillation is a means of regulating the processing of information in the brain to a behaviorally relevant degree. PMID:25979993

  14. [Pubertal growth of 1,453 healthy children according to age at pubertal growth spurt onset. The Barcelona longitudinal growth study].

    Science.gov (United States)

    Carrascosa, Antonio; Yeste, Diego; Moreno-Galdó, Antonio; Gussinyé, Miquel; Ferrández, Ángel; Clemente, María; Fernández-Cancio, Mónica

    2018-02-20

    Pubertal growth pattern differs according to age at pubertal growth spurt onset which occurs over a five years period (girls: 8-13 years, boys: 10-15 years). The need for more than one pubertal reference pattern has been proposed. We aimed to obtain five 1-year-age-interval pubertal patterns. Longitudinal (6 years of age-adult height) growth study of 1,453 healthy children to evaluate height-for-age, growth velocity-for-age and weight-for-age values. According to age at pubertal growth spurt onset girls were considered: very-early matures (8-9 years, n=119), early matures (9-10 years, n=157), intermediate matures (10-11 years, n=238), late matures (11-12 years, n=127) and very-late matures (12-13 years, n=102), and boys: very-early matures (10-11 years, n=110), early matures (11-12 years, n=139), intermediate matures (12-13 years, n=225), late matures (13-14 years, n=133) and very-late matures (14-15 years, n=103). Age at menarche and growth up to adult height were recorded. In both sexes, statistically-significant (P<.0001) and clinically-pertinent differences in pubertal growth pattern (mean height-for-age, mean growth velocity-for-age and mean pubertal height gain, values) were found among the five pubertal maturity groups and between each group and the whole population, despite similar adult height values. The same occurred for age at menarche and growth from menarche to adult height (P<.05). In both sexes, pubertal growth spurt onset is a critical milestone determining pubertal growth and sexual development. The contribution of our data to better clinical evaluation of growth according to the pubertal maturity tempo of each child will obviate the mistakes made when only one pubertal growth reference is used. Copyright © 2018. Publicado por Elsevier España, S.L.U.

  15. Early Onset Intrauterine Growth Restriction in a Mouse Model of Gestational Hypercholesterolemia and Atherosclerosis

    Science.gov (United States)

    Busso, Dolores; Mascareño, Lilian; Salas, Francisca; Berkowitz, Loni; Santander, Nicolás; Quiroz, Alonso; Amigo, Ludwig; Valdés, Gloria; Rigotti, Attilio

    2014-01-01

    The susceptibility to develop atherosclerosis is increased by intrauterine growth restriction and prenatal exposure to maternal hypercholesterolemia. Here, we studied whether mouse gestational hypercholesterolemia and atherosclerosis affected fetal development and growth at different stages of gestation. Female LDLR KO mice fed a proatherogenic, high cholesterol (HC) diet for 3 weeks before conception and during pregnancy exhibited a significant increase in non-HDL cholesterol and developed atherosclerosis. At embryonic days 12.5 (E12.5), E15.5, and E18.5, maternal gestational hypercholesterolemia and atherosclerosis were associated to a 22–24% reduction in male and female fetal weight without alterations in fetal number/litter or morphology nor placental weight or structure. Feeding the HC diet exclusively at the periconceptional period did not alter fetal growth, suggesting that maternal hypercholesterolemia affected fetal weight only after implantation. Vitamin E supplementation (1,000 UI of α-tocopherol/kg) of HC-fed females did not change the mean weight of E18.5 fetuses but reduced the percentage of fetuses exhibiting body weights below the 10th percentile of weight (HC: 90% vs. HC/VitE: 68%). In conclusion, our results showed that maternal gestational hypercholesterolemia and atherosclerosis in mice were associated to early onset fetal growth restriction and that dietary vitamin E supplementation had a beneficial impact on this condition. PMID:25295255

  16. EEG phase states at stimulus onset in a variable-ISI Go/NoGo task: Effects on ERP components.

    Science.gov (United States)

    Barry, Robert J; Fogarty, Jack S; De Blasio, Frances M; Karamacoska, Diana

    2018-04-01

    Previous EEG-ERP dynamics studies found non-random "preferred" EEG phases at stimulus onset in a fixed interstimulus interval (ISI) equiprobable auditory Go/NoGo paradigm, with substantial effects on ERP components. Here we changed to a variable ISI task to prevent/reduce preferential phase occurrence. Discrete Fourier transforms decomposed prestimulus EEG at Cz for each trial to calculate the phase of different frequencies at stimulus onset; we combined these into the delta, theta, alpha, and beta bands, and then sorted trials into phase quartiles for each. ERPs from the raw EEG, assessed using temporal Principal Components Analyses, were examined as a function of phase at stimulus onset. Preferential phase occurrence was reduced as predicted, but random phase substantially impacted component amplitudes. For example, negativity in delta enhanced Go and NoGo P3b; and in theta reduced NoGo but not Go P3b. Overall, EEG phases at stimulus onset support differential cognitive processing in this two-choice task. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Early- versus Late-Onset Fetal Growth Restriction Differentially Affects the Development of the Fetal Sheep Brain.

    Science.gov (United States)

    Alves de Alencar Rocha, Anna Karynna; Allison, Beth J; Yawno, Tamara; Polglase, Graeme R; Sutherland, Amy E; Malhotra, Atul; Jenkin, Graham; Castillo-Melendez, Margie; Miller, Suzanne L

    2017-01-01

    Fetal growth restriction (FGR) is a common complication of pregnancy, principally caused by suboptimal placental function, and is associated with high rates of perinatal mortality and morbidity. Clinical studies suggest that the time of onset of placental insufficiency is an important contributor towards the neurodevelopmental impairments that are evident in children who had FGR. It is however currently unknown how early-onset and late-onset FGR differentially affect brain development. The aim of this study was to examine neuropathology in early-onset and late-onset FGR fetal sheep and to determine whether they differentially alter brain development. We induced placental insufficiency and FGR via single umbilical artery ligation at either 88 days (early-onset) or 105 days (late-onset) of fetal sheep gestation (term is approx. 147 days), reflecting a period of rapid white matter brain development. Fetal blood samples were collected for the first 10 days after surgery, and all fetuses were sacrificed at 125 days' gestation for brain collection and subsequent histopathology. Our results show that early-onset FGR fetuses became progressively hypoxic over the first 10 days after onset of placental insufficiency, whereas late-onset FGR fetuses were significantly hypoxic compared to controls from day 1 after onset of placental insufficiency (SaO2 46.7 ± 7.4 vs. 65.7 ± 3.9%, respectively, p = 0.03). Compared to control brains, early-onset FGR brains showed widespread white matter injury, with a reduction in both CNPase-positive and MBP-positive density of staining in the periventricular white matter (PVWM), subcortical white matter, intragyral white matter (IGWM), subventricular zone (SVZ), and external capsule (p brains with reactive astrogliosis (GFAP-positive) in the IGWM and cortex (p brain development that principally mediates altered brain development associated with FGR. © 2017 S. Karger AG, Basel.

  18. Identifying seizure onset zone from electrocorticographic recordings: A machine learning approach based on phase locking value.

    Science.gov (United States)

    Elahian, Bahareh; Yeasin, Mohammed; Mudigoudar, Basanagoud; Wheless, James W; Babajani-Feremi, Abbas

    2017-10-01

    Using a novel technique based on phase locking value (PLV), we investigated the potential for features extracted from electrocorticographic (ECoG) recordings to serve as biomarkers to identify the seizure onset zone (SOZ). We computed the PLV between the phase of the amplitude of high gamma activity (80-150Hz) and the phase of lower frequency rhythms (4-30Hz) from ECoG recordings obtained from 10 patients with epilepsy (21 seizures). We extracted five features from the PLV and used a machine learning approach based on logistic regression to build a model that classifies electrodes as SOZ or non-SOZ. More than 96% of electrodes identified as the SOZ by our algorithm were within the resected area in six seizure-free patients. In four non-seizure-free patients, more than 31% of the identified SOZ electrodes by our algorithm were outside the resected area. In addition, we observed that the seizure outcome in non-seizure-free patients correlated with the number of non-resected SOZ electrodes identified by our algorithm. This machine learning approach, based on features extracted from the PLV, effectively identified electrodes within the SOZ. The approach has the potential to assist clinicians in surgical decision-making when pre-surgical intracranial recordings are utilized. Copyright © 2017 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  19. Effect of extended photoperiod during winter on growth and onset of puberty in Murrah buffalo heifers

    Directory of Open Access Journals (Sweden)

    Ashwani Kumar Roy

    2016-02-01

    Full Text Available Aim: To investigate the effect of extended photoperiod on growth rate, hormonal levels, and puberty in Murrah heifers. Materials and Methods: About 14 Murrah buffalo heifers were divided into normal day photoperiod (NDP; n=7 and extended NDP (ENDP; n=7 groups. The ENDP group was exposed to 4 h of extended photoperiod with artificial light (160 lux after sunset for 3 months during winter. Results: Group, age and group-by-age interaction effects on plasma glucose concentrations were non-significant (p>0.05. A significant effect of age on non-esterified fatty acids (p0.05 while significant (p0.05. Average daily gain and dry matter intake of heifers were nonsignificant between the NDP and ENDP groups but were comparatively higher in ENDP group. By the end of the experiment, 6 out of 7 heifers attained puberty in ENDP group in comparison to 4 out of 7 in NDP group. Conclusion: Extending the photoperiod by artificial light for 4 h during winter season resulted in better growth rate and early onset of puberty in Murrah buffalo heifers.

  20. Onset of Phase Separation in the Double Perovskite Oxide La2MnNiO6

    Energy Technology Data Exchange (ETDEWEB)

    Spurgeon, Steven R.; Sushko, Petr; Devaraj, Arun; Du, Yingge; Droubay, Timothy C.; Chambers, Scott A.

    2018-04-13

    Identification of kinetic and thermodynamic factors that control crystal nucleation and growth represents a central challenge in materials synthesis. Here we report that apparently defect-free growth of La2MnNiO6 (LMNO) thin films supported on SrTiO3 (STO) proceeds up to 1–5 nm, after which it is disrupted by precipitation of NiO phases. Local geometric phase analysis and ensemble-averaged x-ray reciprocal space mapping show no change in the film strain away from the interface, indicating that mechanisms other than strain relaxation induce the formation of the NiO phases. Ab initio simulations suggest that the electrostatic potential build-up associated with the polarity mismatch at the film-substrate interface promotes the formation of oxygen vacancies with increasing thickness. In turn, oxygen deficiency promotes the formation of Ni-rich regions, which points to the built-in potential as an additional factor that contributes to the NiO precipitation mechanisms. These results suggest that the precipitate-free region could be extended further by either incorporating dopants that suppress the built-in potential or by increasing the oxygen fugacity in order to suppress the formation of oxygen vacancies.

  1. Adult growth hormone (GH)-deficient patients demonstrate heterogeneity between childhood onset and adult onset before and during human GH treatment. Adult Growth Hormone Deficiency Study Group

    DEFF Research Database (Denmark)

    Attanasio, A F; Lamberts, S W; Matranga, A M

    1997-01-01

    The onset of adult GH deficiency may be during either adulthood (AO) or childhood (CO), but potential differences have not previously been examined. In this study the baseline and GH therapy (12.5 micrograms/kg per day) data from CO (n = 74; mean age 29 yr) and AO (n = 99; mean age 44 yr) GH-defi...

  2. Placental fibroblast growth factor 21 is not altered in late-onset preeclampsia.

    Science.gov (United States)

    Dekker Nitert, Marloes; Scholz-Romero, Katherin; Kubala, Marta H; McIntyre, H David; Callaway, Leonie K; Barrett, Helen L

    2015-03-08

    Preeclampsia (PE) is associated with alterations of placental function. The incidence of PE is higher in insulin resistant states. Women with PE have high circulating levels of the metabolic regulator fibroblast growth factor 21 (FGF21). FGF21 is synthesized in the placenta. The aim of this study was to compare the expression of FGF21, its receptors, downstream targets and transcriptional regulators in placental tissue from pregnancies with and without late-onset PE. Circulating FGF21 in maternal and cord blood was also studied. mRNA expression was determined by semi-quantitative real-time PCR and normalized for cellular composition in 17 women with and 20 without PE. Protein expression was quantified by Western Blot. FGF21 levels were measured by ELISA in maternal and cord serum of ten mother-baby dyads per condition. Placental FGF21 mRNA and protein expression were similar in PE compared with control. Placental mRNA expression of the FGF receptors (1-4) and the co-receptor beta-Klotho was not different between the groups. There was no difference in the expression of the glucose transporters GLUT1, 3 or 4. PPAR-alpha but not PPAR-gamma expression was decreased in PE. Maternal FGF21 serum levels were not significantly different in PE. FGF21 was detected in cord blood of 6 infants (4 PE, 2 controls) but was undetectable in 14 infants. Late-onset PE is not associated with major changes to the expression of FGF21, its receptors or metabolic targets.

  3. In-situ observation of ULF wave activities associated with substorm expansion phase onset and current disruption

    Directory of Open Access Journals (Sweden)

    J. Liang

    2009-05-01

    Full Text Available In this paper we present two substorm events with coordinated ground-based and in-situ THEMIS observations, and focus our interest on the wave activities in Pi1 and Pi2 bands from minutes before the substorm expansion phase (EP onset to minutes after the local current disruption (CD. We find that Pi2 band (40–100 s wave appears 1–2 min before the substorm onset and last over the entire EP interval, while higher-frequency wave within Pi1 band (10–30 s emerges within few tens of seconds after the EP onset, intensifies during the local CD, and fades afterwards. The pre-onset Pi2 waves are attributed to a ballooning mode which acts as the seed perturbation to the substorm EP onset process. The azimuthal wavenumber estimated from the Doppler shift nature of the ballooning mode is consistent with the longitudinal "wavelength" inferred from the onset auroral structures. The Pi1 waves appearing within few tens of seconds after the EP onset are interpreted as supportive of a two-fluid instability mode of thin current sheet investigated in an accompanying paper (Liu and Liang, 2009. During the local CD, broadband wave activities from Pi2 band to well above the ion gyrofrequency are observed, suggesting the coexistence of various plasma instabilities featuring different frequency ranges.

  4. Disentangling two underlying processes in the initial phase of substance use: Onset and frequency of use in adolescent smoking

    NARCIS (Netherlands)

    Otten, R.; Lier, P.A.C. van; Engels, R.C.M.E.

    2011-01-01

    Purpose: Most studies on adolescent smoking focus either on the probability of smoking onset or frequency of smoking. We assume the existence of two different qualitatively distinct processes in smoking acquisition. Therefore our objective was to test a two-part latent growth model, which assumes

  5. Unusually very late-onset new growth of intraocular retinoblastoma: A case report and review of literature

    Directory of Open Access Journals (Sweden)

    Yeshigeta Gelaw

    2017-04-01

    Conclusions and importance: Despite initial satisfactory treatment and complete regression of the tumor, very late-onset new growth of intraocular retinoblastoma can occur. Hence, life-long follow-up in all patients with retinoblastoma is warranted, given the risk for new tumor formation even later in life. To our knowledge, this is the first report of new growth of intraocular retinoblastoma after regression for more than a decade.

  6. Exchange of fluxes across the air-sea interface during the onset phase of the southwest monsoon

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, D.P.; Rao, M.V.

    in relation to the onset phase of the southwest monsoon which has been triggered by the low pressure system extending from Saurashtra Coast to Lakshadweep Sea. The development of the surface layer has also been discussed in the light of the wind induced near...

  7. The impact of idiopathic childhood-onset growth hormone deficiency (GHD) on bone mass in subjects without adult GHD

    DEFF Research Database (Denmark)

    Lange, Martin; Müller, Jørn; Svendsen, Ole Lander

    2005-01-01

    Despite seemingly adequate growth hormone (GH) treatment during childhood, children with GH deficiency (GHD) have reduced bone mineral density (BMD) at final height. The aim was to evaluate BMD and bone mineral content (BMC) in adults treated for idiopathic childhood-onset (CO) GHD, 18 years after...

  8. Cord Blood Acute Phase Reactants Predict Early Onset Neonatal Sepsis in Preterm Infants.

    Science.gov (United States)

    Mithal, Leena B; Palac, Hannah L; Yogev, Ram; Ernst, Linda M; Mestan, Karen K

    2017-01-01

    Early onset sepsis (EOS) is a major cause of morbidity and mortality in preterm infants, yet diagnosis remains inadequate resulting in missed cases or prolonged empiric antibiotics with adverse consequences. Evaluation of acute phase reactant (APR) biomarkers in umbilical cord blood at birth may improve EOS detection in preterm infants with intrauterine infection. In this nested case-control study, infants (29.7 weeks gestation, IQR: 27.7-32.2) were identified from a longitudinal cohort with archived cord blood and placental histopathology. Patients were categorized using culture, laboratory, clinical, and antibiotic treatment data into sepsis groups: confirmed sepsis (cEOS, n = 12); presumed sepsis (PS, n = 30); and no sepsis (controls, n = 30). Nine APRs were measured in duplicate from cord blood using commercially available multiplex immunoassays (Bio-Plex Pro™). In addition, placental histopathologic data were linked to biomarker results. cEOS organisms were Escherichia coli, Streptococcus agalactiae, Proteus mirabilis, Haemophilus influenzae and Listeria monocytogenes. C-reactive protein (CRP), serum amyloid A (SAA), haptoglobin (Hp), serum amyloid P and ferritin were significantly elevated in cEOS compared to controls (pacute inflammation was associated with APR elevation and was present in all cEOS, 9 PS, and 17 control infants. This study shows that certain APRs are elevated in cord blood of premature infants with EOS of intrauterine origin. SAA, CRP, and Hp at birth have potential diagnostic utility for risk stratification and identification of infants with EOS.

  9. Characterization of adult onset growth hormone deficiency syndrome in patients with hypothalamopituitary diseases: Asian Indian data

    Directory of Open Access Journals (Sweden)

    Bandgar T

    2008-01-01

    Full Text Available Background: Hardly any data is available on Adult onset growth hormone deficiency (AOGHD in Patients with hypothalamopituitary diseases in India. Aims: To characterize Asian Indian AOGHD syndrome in hypothalamopituitary diseases. Settings and Design: Cross-sectional analysis of data from a tertiary care hospital. Materials and Methods: Thirty patients with AOGHD were compared with 30 age-, sex-, body mass index-matched controls with respect to endocrine evaluation, biochemistry, body composition (BC, bone mineral density (BMD, cardiovascular risk profile and quality of life (QoL. Statistical Analysis Used: Comparisons were performed using two-tailed Student′s test (SPSS Software version 10.0. Results: Most of the patients had abnormal BC with central obesity [Truncal FM (%: males {33.9±4.4 (patient vs. 29.31±6.2 (control; P -0.027}; females {39.87±5.93 (patient vs. 35.76±3.16 (control; P - 0.025}] and poor QoL. Patients aged over 45 years did not show low bone mass or lipid abnormalities as compared to controls. Low BMD and abnormal lipid profile {Triglycerides [mg/dl]:170.55±72.5 (patient vs101.24±31.0 (control; P -0.038}; {very low density lipoprotein cholesterol [mg/dl]: 33.54±14.9 (patient vs. 20.25±6.18 (control; P - 0.05} was seen in female patients less than 45 years of age. Conclusions: Male and female (more than 45 years AOGHD patients have increased cardiovascular risk factors and poor QoL while BMD is unaffected. Females less than 45 years of age have the major characteristics of AOGHD and would be the group to benefit maximally with recombinant human Growth Hormone treatment, which is similar to that in the western literature.

  10. Dose dependency of time of onset of radiation-induced growth hormone deficiency

    International Nuclear Information System (INIS)

    Clayton, P.E.; Shalet, S.M.

    1991-01-01

    Growth hormone (GH) secretion during insulin-induced hypoglycemia was assessed on 133 occasions in 82 survivors of childhood malignant disease. All had received cranial irradiation with a dose range to the hypothalamic-pituitary axis of 27 to 47.5 Gy (estimated by a schedule of 16 fractions over 3 weeks) and had been tested on one or more occasions between 0.2 and 18.9 years after treatment. Results of one third of the GH tests were defined as normal (GH peak response, greater than 15 mU/L) within the first 5 years, in comparison with 16% after 5 years. Stepwise multiple linear regression analysis showed that dose (p = 0.007) and time from irradiation (p = 0.03), but not age at therapy, had a significant influence on peak GH responses. The late incidence of GH deficiency was similar over the whole dose range (4 of 26 GH test results normal for less than 30 Gy and 4 of 25 normal for greater than or equal to 30 Gy after 5 years), but the speed of onset over the first years was dependent on dose. We conclude that the requirement for GH replacement therapy and the timing of its introduction will be influenced by the dose of irradiation received by the hypothalamic-pituitary axis

  11. Oxidatively modified LDL particles in the human placenta in early and late onset intrauterine growth restriction.

    Science.gov (United States)

    Pecks, U; Rath, W; Caspers, R; Sosnowsky, K; Ziems, B; Thiesen, H-J; Maass, N; Huppertz, B

    2013-12-01

    Reduced serum LDL concentrations have been observed in pregnancies complicated by intrauterine growth restriction (IUGR) as compared to healthy pregnant women. Since increased oxidative stress has been suggested to play a major role in IUGR we now hypothesized that the lower LDL concentrations are accompanied by an accumulation of oxidized LDLs in the placenta. Fifteen placentas of near term and preterm born IUGR, and a gestational age matched control group (CTRL n = 15) were analyzed. Placental minimal modified LDL and fully oxidized LDL particles were measured by ELISA, and by immunohistochemistry, and were related to maternal and fetal serum lipid profiles. We found fully oxidized LDL but not minimal modified LDL being increased in the preterm subgroup of IUGR (n = 10) as compared to preterm CTRL (n = 10; p placenta possibly taking place in preterm IUGRs. We conclude that the reduced maternal LDL cholesterol concentration in IUGR pregnancies is attributed to increased accumulation of oxidized LDL particles within the placenta at least in early onset IUGR

  12. Adult growth hormone (GH)-deficient patients demonstrate heterogeneity between childhood onset and adult onset before and during human GH treatment. Adult Growth Hormone Deficiency Study Group

    DEFF Research Database (Denmark)

    Attanasio, A F; Lamberts, S W; Matranga, A M

    1997-01-01

    The onset of adult GH deficiency may be during either adulthood (AO) or childhood (CO), but potential differences have not previously been examined. In this study the baseline and GH therapy (12.5 micrograms/kg per day) data from CO (n = 74; mean age 29 yr) and AO (n = 99; mean age 44 yr) GH......-deficient adult patients have been compared. The first 6 months comprised randomized, double-blind treatment with GH or placebo, then all patients were GH-treated for a further 12 months. At baseline the height, body weight, body mass index, lean body mass, and waist/hip ratio of AO patients were significantly (P...

  13. A Bayesian three-parameter logistic model for early- and late-onset DLTs in oncology Phase I studies.

    Science.gov (United States)

    Zheng, Wei; Zhao, Yang; Lu, Yuefeng; Miao, Harry; Liu, Hengchang

    2016-01-01

    We introduce a three-parameter logistic model to analyze the dose limiting toxicity (DLT) as a time-to-event endpoint in oncology Phase I trials. In the proposed model, patients are allowed to stay on trial without the constraint of a maximum follow-up time. Our model accommodates late-onset DLT as well as early-onset DLT, by both of which the dose recommendation is informed. A Bayesian approach is used to incorporate prior knowledge of the test treatment into dose recommendation. Simulation examples show that our proposed model has good operating characteristics in assessing the maximum tolerated dose (MTD).

  14. Adjunctive perampanel in partial-onset seizures: Asia-Pacific, randomized phase III study.

    Science.gov (United States)

    Nishida, T; Lee, S K; Inoue, Y; Saeki, K; Ishikawa, K; Kaneko, S

    2018-04-01

    To evaluate the efficacy, safety, and tolerability of perampanel, a selective, non-competitive, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor antagonist, as an adjunctive treatment for patients with refractory partial-onset seizures (POS) from Asia-Pacific. This multicenter, randomized, double-blind, placebo-controlled trial (ClinicalTrials.gov identifier: NCT01618695) involved patients aged ≥12 years with refractory POS (receiving 1-3 antiepileptic drugs). Patients were randomized (1:1:1:1) to receive once-daily placebo or perampanel 4, 8, or 12 mg over a 6-week titration and 13-week maintenance double-blind period. Enzyme-inducing antiepileptic drugs were equally stratified between groups. The primary efficacy endpoint was percent change in POS frequency per 28 days (double-blind phase vs baseline). Other efficacy endpoints included ≥50% responder rate and seizure freedom. Treatment-emergent adverse events (TEAEs) were also monitored. Of 710 randomized patients, seizure frequency data were available for 704 patients. Median percent changes in POS frequency per 28 days indicated dose-proportional reductions in seizure frequency: -10.8% with placebo and -17.3% (P = .2330), -29.0% (P = .0003), and -38.0% (P < .0001) with perampanel 4, 8, and 12 mg, respectively. In total, 108 (15.3%) patients discontinued treatment; 44 (6.2%) due to TEAEs. TEAEs occurring in ≥5% of patients, and reported at least twice as frequently with perampanel vs placebo, included dizziness and irritability. Adjunctive perampanel (8 and 12 mg/d) significantly improved seizure control in patients with refractory POS. Safety and tolerability were acceptable at daily doses of perampanel 4-12 mg. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Cord Blood Acute Phase Reactants Predict Early Onset Neonatal Sepsis in Preterm Infants.

    Directory of Open Access Journals (Sweden)

    Leena B Mithal

    Full Text Available Early onset sepsis (EOS is a major cause of morbidity and mortality in preterm infants, yet diagnosis remains inadequate resulting in missed cases or prolonged empiric antibiotics with adverse consequences. Evaluation of acute phase reactant (APR biomarkers in umbilical cord blood at birth may improve EOS detection in preterm infants with intrauterine infection.In this nested case-control study, infants (29.7 weeks gestation, IQR: 27.7-32.2 were identified from a longitudinal cohort with archived cord blood and placental histopathology. Patients were categorized using culture, laboratory, clinical, and antibiotic treatment data into sepsis groups: confirmed sepsis (cEOS, n = 12; presumed sepsis (PS, n = 30; and no sepsis (controls, n = 30. Nine APRs were measured in duplicate from cord blood using commercially available multiplex immunoassays (Bio-Plex Pro™. In addition, placental histopathologic data were linked to biomarker results.cEOS organisms were Escherichia coli, Streptococcus agalactiae, Proteus mirabilis, Haemophilus influenzae and Listeria monocytogenes. C-reactive protein (CRP, serum amyloid A (SAA, haptoglobin (Hp, serum amyloid P and ferritin were significantly elevated in cEOS compared to controls (p<0.01. SAA, CRP, and Hp were elevated in cEOS but not in PS (p<0.01 and had AUCs of 99%, 96%, and 95% respectively in predicting cEOS. Regression analysis revealed robust associations of SAA, CRP, and Hp with EOS after adjustment for covariates. Procalcitonin, fibrinogen, α-2-macroglobulin and tissue plasminogen activator were not significantly different across groups. Placental acute inflammation was associated with APR elevation and was present in all cEOS, 9 PS, and 17 control infants.This study shows that certain APRs are elevated in cord blood of premature infants with EOS of intrauterine origin. SAA, CRP, and Hp at birth have potential diagnostic utility for risk stratification and identification of infants with EOS.

  16. Grain nucleation and growth during phase transformations

    DEFF Research Database (Denmark)

    Offerman, S.E.; Dijk, N.H. van; Sietsma, J.

    2002-01-01

    The mechanical properties of polycrystalline materials are largely determined by the kinetics of the phase transformations during the production process. Progress in x-ray diffraction instrumentation at synchrotron sources has created an opportunity to study the transformation kinetics at the level...

  17. Selection for superior growth advances the onset of puberty and increases reproductive performance in ewe lambs.

    Science.gov (United States)

    Rosales Nieto, C A; Ferguson, M B; Macleay, C A; Briegel, J R; Martin, G B; Thompson, A N

    2013-06-01

    The reproductive efficiency of the entire sheep flock could be improved if ewe lambs go through puberty early and produce their first lamb at 1 year of age. The onset of puberty is linked to the attainment of critical body mass, and therefore we tested whether it would be influenced by genetic selection for growth rate or for rate of accumulation of muscle or fat. We studied 136 Merino ewe lambs with phenotypic values for depth of eye muscle (EMD) and fat (FAT) and Australian Sheep Breeding Values at post-weaning age (200 days) for live weight (PWT), eye muscle depth (PEMD) and fat depth (PFAT). First oestrus was detected with testosterone-treated wethers and then entire rams as the ewes progressed from 6 to 10 months of age. Blood concentrations of leptin and IGF-I were measured to test whether they were related to production traits and reproductive performance (puberty, fertility and reproductive rate). In total, 97% of the lambs reached first oestrus at average weight 39.4 ± 0.4 kg (mean ± s.e.m.) and age 219 days (range 163 to 301). Age at first oestrus decreased with increases in values for PWT (P ewe lambs that achieved puberty was positively related with increases in values for EMD (P ewe lambs were pregnant at average weight 44.7 ± 0.5 kg and age 263 days (range 219 to 307). Ewe lambs that were heavier at the start of mating were more fertile (P ewe lambs. The metabolic hormones, IGF-I and leptin, might act as a physiological link between the growing tissues and the reproductive axis.

  18. Regulatory design governing progression of population growth phases in bacteria.

    Directory of Open Access Journals (Sweden)

    Agustino Martínez-Antonio

    Full Text Available It has long been noted that batch cultures inoculated with resting bacteria exhibit a progression of growth phases traditionally labeled lag, exponential, pre-stationary and stationary. However, a detailed molecular description of the mechanisms controlling the transitions between these phases is lacking. A core circuit, formed by a subset of regulatory interactions involving five global transcription factors (FIS, HNS, IHF, RpoS and GadX, has been identified by correlating information from the well- established transcriptional regulatory network of Escherichia coli and genome-wide expression data from cultures in these different growth phases. We propose a functional role for this circuit in controlling progression through these phases. Two alternative hypotheses for controlling the transition between the growth phases are first, a continuous graded adjustment to changing environmental conditions, and second, a discontinuous hysteretic switch at critical thresholds between growth phases. We formulate a simple mathematical model of the core circuit, consisting of differential equations based on the power-law formalism, and show by mathematical and computer-assisted analysis that there are critical conditions among the parameters of the model that can lead to hysteretic switch behavior, which--if validated experimentally--would suggest that the transitions between different growth phases might be analogous to cellular differentiation. Based on these provocative results, we propose experiments to test the alternative hypotheses.

  19. Regulatory design governing progression of population growth phases in bacteria.

    Science.gov (United States)

    Martínez-Antonio, Agustino; Lomnitz, Jason G; Sandoval, Santiago; Aldana, Maximino; Savageau, Michael A

    2012-01-01

    It has long been noted that batch cultures inoculated with resting bacteria exhibit a progression of growth phases traditionally labeled lag, exponential, pre-stationary and stationary. However, a detailed molecular description of the mechanisms controlling the transitions between these phases is lacking. A core circuit, formed by a subset of regulatory interactions involving five global transcription factors (FIS, HNS, IHF, RpoS and GadX), has been identified by correlating information from the well- established transcriptional regulatory network of Escherichia coli and genome-wide expression data from cultures in these different growth phases. We propose a functional role for this circuit in controlling progression through these phases. Two alternative hypotheses for controlling the transition between the growth phases are first, a continuous graded adjustment to changing environmental conditions, and second, a discontinuous hysteretic switch at critical thresholds between growth phases. We formulate a simple mathematical model of the core circuit, consisting of differential equations based on the power-law formalism, and show by mathematical and computer-assisted analysis that there are critical conditions among the parameters of the model that can lead to hysteretic switch behavior, which--if validated experimentally--would suggest that the transitions between different growth phases might be analogous to cellular differentiation. Based on these provocative results, we propose experiments to test the alternative hypotheses.

  20. Phase-field crystal simulation facet and branch crystal growth

    Science.gov (United States)

    Chen, Zhi; Wang, Zhaoyang; Gu, Xinrui; Chen, Yufei; Hao, Limei; de Wit, Jos; Jin, Kexin

    2018-05-01

    Phase-field crystal model with one mode is introduced to describe morphological transition. The relationship between growth morphology and smooth density distribution was investigated. The results indicate that the pattern selection of dendrite growth is caused by the competition between interface energy anisotropy and interface kinetic anisotropy based on the 2D phase diagram. When the calculation time increases, the crystal grows to secondary dendrite at the dimensionless undercooling equal to - 0.4. Moreover, when noise is introduced in the growth progress, the symmetry is broken in the growth mode, and there becomes irregular fractal-like growth morphology. Furthermore, the single crystal shape develops into polycrystalline when the noise amplitude is large enough. When the dimensionless undercooling is less than - 0.3, the noise has a significant effect on the growth shape. In addition, the growth velocity of crystal near to liquid phase line is slow, while the shape far away from the liquid adapts to fast growth. Based on the simulation results, the method was proved to be effective, and it can easily obtain different crystal shapes by choosing the different points in 2D phase diagram.

  1. A Phase-Field Model for Grain Growth

    Energy Technology Data Exchange (ETDEWEB)

    Chen, L.Q.; Fan, D.N.; Tikare, V.

    1998-12-23

    A phase-field model for grain growth is briefly described. In this model, a poly-crystalline microstructure is represented by multiple structural order parameter fields whose temporal and spatial evolutions follow the time-dependent Ginzburg-Landau (TDGL) equations. Results from phase-field simulations of two-dimensional (2D) grain growth will be summarized and preliminary results on three-dimensional (3D) grain growth will be presented. The physical interpretation of the structural order parameter fields and the efficient and accurate semi-implicit Fourier spectral method for solving the TDGL equations will be briefly discussed.

  2. Wave onset in central gray matter - its intrinsic optical signal and phase transitions in extracellular polymers

    Directory of Open Access Journals (Sweden)

    VERA M. FERNANDES-DE-LIMA

    2001-09-01

    Full Text Available The brain is an excitable media in which excitation waves propagate at several scales of time and space. ''One-dimensional'' action potentials (millisecond scale along the axon membrane, and spreading depression waves (seconds to minutes at the three dimensions of the gray matter neuropil (complex of interacting membranes are examples of excitation waves. In the retina, excitation waves have a prominent intrinsic optical signal (IOS. This optical signal is created by light scatter and has different components at the red and blue end of the spectrum. We could observe the wave onset in the retina, and measure the optical changes at the critical transition from quiescence to propagating wave. The results demonstrated the presence of fluctuations preceding propagation and suggested a phase transition. We have interpreted these results based on an extrapolation from Tasaki's experiments with action potentials and volume phase transitions of polymers. Thus, the scatter of red light appeared to be a volume phase transition in the extracellular matrix that was caused by the interactions between the cellular membrane cell coat and the extracellular sugar and protein complexes. If this hypothesis were correct, then forcing extracellular current flow should create a similar signal in another tissue, provided that this tissue was also transparent to light and with a similarly narrow extracellular space. This control tissue exists and it is the crystalline lens. We performed the experiments and confirmed the optical changes. Phase transitions in the extracellular polymers could be an important part of the long-range correlations found during wave propagation in central nervous tissue.O encéfalo é um meio excitável no qual ondas de excitação se propagam em várias escalas de tempo e espaço. Potenciais de axônios ''unidimensionais'' (escala de milisegundos ao longo da membrana axonal e ondas de depressão alastrante (segundos a minutos nas três dimens

  3. Onset of chaos in a single-phase power electronic inverter

    DEFF Research Database (Denmark)

    Avrutin, Viktor; Mosekilde, Erik; Zhusubaliyev, Zhanybai T.

    2015-01-01

    derived from a non-autonomous ordinary differential equation with discontinuous right-hand side. By construction, this stroboscopic map has a high number of border points. It is shown that the onset of chaos occurs stepwise, via irregular cascades of different border collisions, some of which lead...

  4. High risk of adrenal insufficiency in adults previously treated for idiopathic childhood onset growth hormone deficiency

    DEFF Research Database (Denmark)

    Lange, Martin; Feldt-Rasmussen, Ulla; Svendsen, Ole Lander

    2003-01-01

    The aim was to reevaluate a group of adults treated for idiopathic childhood onset GH deficiency (GHD) after 18 yr without GH treatment. Twenty-six (11 females) patients participated. All but two had isolated GHD. Childhood diagnosis was established by insulin tolerance test (ITT). The patients w...

  5. "Dealloying" Phase Separation during Growth of Au on Ni(110)

    DEFF Research Database (Denmark)

    Nielsen, L. Pleth; Besenbacher, Flemming; Stensgaard, I.

    1995-01-01

    Combined scanning tunneling microscopy and ion-scattering studies have revealed a new "dealloying" phase transition during the growth of Au on Ni(110). The Au atoms, which initially alloy into the Ni(110) surface, phase separate into a vacancy-stabilized Au dimer-trimer chain structure at Au...... coverages larger than 0.4 monolayer. Using the effective-medium theory, we show that the resulting structure as well as the physical mechanism responsible for the phase transition are closely related to the surface stress induced by the substituted Au....

  6. Crystal nucleation and dendrite growth of metastable phases in undercooled melts

    International Nuclear Information System (INIS)

    Herlach, Dieter

    2011-01-01

    Research highlights: → Homogenous nucleation. → Effects of convection on dendrite growth kinetics. → Description of disorder trapping validated by experiment. - Abstract: An undercooled melt possesses an enhanced free enthalpy that opens up the possibility to crystallize metastable crystalline solids in competition with their stable counterparts. Crystal nucleation selects the crystallographic phase whereas the growth dynamics controls microstructure evolution. We apply containerless processing techniques such as electromagnetic and electrostatic levitation to containerlesss undercool and solidify metallic melts. Owing to the complete avoidance of heterogeneous nucleation on container-walls a large undercooling range becomes accessible with the extra benefit that the freely suspended drop is direct accessible for in situ observation of crystallization far away from equilibrium. Results of investigations of maximum undercoolability on pure zirconium are presented showing the limit of maximum undercoolability set by the onset of homogeneous nucleation. Rapid dendrite growth is measured as a function of undercooling by a high-speed camera and analysed within extended theories of non-equilibrium solidification. In such both supersaturated solid solutions and disordered superlattice structure of intermetallics are formed at high growth velocities. A sharp interface theory of dendrite growth is capable to describe the non-equilibrium solidification phenomena during rapid crystallization of deeply undercooled melts. Eventually, anomalous growth behaviour of Al-rich Al-Ni alloys is presented, which may be caused by forced convection.

  7. On grain growth kinetics in two-phase polycrystalline materials ...

    Indian Academy of Sciences (India)

    Monte Carlo Potts model simulation was carried out on a 2D square lattice for various surface fractions of second phase particles for over 50,000 iterations. The observations are in good agreement with known theoretical and experimental results with respect to both growth kinetics as well as grain size distribution. Further ...

  8. Hatching time and alevin growth prior to the onset of exogenous feeding in farmed, wild and hybrid Norwegian Atlantic salmon.

    Directory of Open Access Journals (Sweden)

    Monica Favnebøe Solberg

    Full Text Available The onset of exogenous feeding, when juveniles emerge from the gravel, is a critical event for salmonids where early emergence and large size provide a competitive advantage in the wild. Studying 131 farmed, hybrid and wild Norwegian Atlantic salmon families, originating from four wild populations and two commercial strains, we investigated whether approximately 10 generations of selection for faster growth has also resulted in increased somatic growth prior to the onset of exogenous feeding. In addition, we tested whether relaxed selection in farms has allowed for alterations in hatching time between farmed and wild salmon. Across three cohorts, wild salmon families hatched earlier than farmed salmon families, while hybrid families displayed intermediate hatching times. While the observed differences were small, i.e., 1-15 degree-days (0-3 days, as water temperatures were c. 5-6°C, these data suggest additive genetic variation for hatching time. Alevin length prior to exogenous feeding was positively related to egg size. After removal of egg size effects, no systematic differences in alevin length were observed between the wild and farmed salmon families. While these results indicate additive genetic variation for egg development timing, and wild salmon families consistently hatched earlier than farmed salmon families, these differences were so small they are unlikely to significantly influence early life history competition of farmed and wild salmon in the natural environment. This is especially the case given that the timing of spawning among females can vary by several weeks in some rivers. The general lack of difference in size between farmed and wild alevins, strongly suggest that the documented differences in somatic growth rate between wild and farmed Norwegian Atlantic salmon under hatchery conditions are first detectable after the onset of exogenous feeding.

  9. Growth of cadmium zinc telluride by liquid phase electroepitaxy

    International Nuclear Information System (INIS)

    Armour, N.; Dost, S.; Sheibani, H.

    2006-01-01

    This study was undertaken to examine the feasibility of growing CdZnTe by liquid phase electroepitaxy. Based on our successful LPEE system of GaInAs, a new crucible to grow CdZnTe was developed. The development presented numerous difficulties. The physical properties of CdZnTe make this material very difficult to grow. All components of the system were investigated. Electromigration of the solute across the solution carries species towards the growth interface. In liquid Cd-Zn-Te, the CdTe and ZnTe species remain associated, contrary to the GaInAs system. Experiments showed that LPEE growth of CdZnTe is possible and the electromigration mechanism functions well in the CdZnTe solution. Despite this, other problems remained with the new LPEE system. The preparation of the solution proved difficult without pressurizing the LPEE crucible. Control of the reaction required the use of pre-compounded CdTe and ZnTe. Proper control of the solution saturation is imperative to ensure minimal dissolution of the seed prior to growth initiation and a reasonable growth rate during growth. The solution remained an issue during the duration of growth due to the high vapor pressures of the constituents. Tellurium evaporation during growth could lower solution volume until electrical contact across the solution is broken. Careful preparation of appropriate solution volume was imperative for successful growth. In LPEE, a uniform electric current passage across the growth interface is necessary for uniform and stable growth interface. This requires the design of a uniform contact zone between the bottom graphite electrode and the seed crystal. The contact zone issue was not adequately resolved in this study. However, a number of successful growth runs were achieved despite the electrical contact problems. Results show that the LPEE of growth CdZnTe is feasible. (copyright 2006 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  10. Growth of cadmium zinc telluride by liquid phase electroepitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Armour, N.; Dost, S. [Crystal Growth Laboratory, Faculty of Engineering, University of Victoria, Victoria BC, V8W 3P6 (Canada); Sheibani, H. [Department of Industrial Engineering, Alhosn University, Abu Dhabi (United Arab Emirates)

    2006-10-15

    This study was undertaken to examine the feasibility of growing CdZnTe by liquid phase electroepitaxy. Based on our successful LPEE system of GaInAs, a new crucible to grow CdZnTe was developed. The development presented numerous difficulties. The physical properties of CdZnTe make this material very difficult to grow. All components of the system were investigated. Electromigration of the solute across the solution carries species towards the growth interface. In liquid Cd-Zn-Te, the CdTe and ZnTe species remain associated, contrary to the GaInAs system. Experiments showed that LPEE growth of CdZnTe is possible and the electromigration mechanism functions well in the CdZnTe solution. Despite this, other problems remained with the new LPEE system. The preparation of the solution proved difficult without pressurizing the LPEE crucible. Control of the reaction required the use of pre-compounded CdTe and ZnTe. Proper control of the solution saturation is imperative to ensure minimal dissolution of the seed prior to growth initiation and a reasonable growth rate during growth. The solution remained an issue during the duration of growth due to the high vapor pressures of the constituents. Tellurium evaporation during growth could lower solution volume until electrical contact across the solution is broken. Careful preparation of appropriate solution volume was imperative for successful growth. In LPEE, a uniform electric current passage across the growth interface is necessary for uniform and stable growth interface. This requires the design of a uniform contact zone between the bottom graphite electrode and the seed crystal. The contact zone issue was not adequately resolved in this study. However, a number of successful growth runs were achieved despite the electrical contact problems. Results show that the LPEE of growth CdZnTe is feasible. (copyright 2006 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  11. Three-dimensional brain growth abnormalities in childhood-onset schizophrenia visualized by using tensor-based morphometry.

    Science.gov (United States)

    Gogtay, Nitin; Lu, Allen; Leow, Alex D; Klunder, Andrea D; Lee, Agatha D; Chavez, Alex; Greenstein, Deanna; Giedd, Jay N; Toga, Arthur W; Rapoport, Judith L; Thompson, Paul M

    2008-10-14

    Earlier studies revealed progressive cortical gray matter (GM) loss in childhood-onset schizophrenia (COS) across both lateral and medial surfaces of the developing brain. Here, we use tensor-based morphometry to visualize white matter (WM) growth abnormalities in COS throughout the brain. Using high-dimensional elastic image registration, we compared 3D maps of local WM growth rates in COS patients and healthy children over a 5-year period, based on analyzing longitudinal brain MRIs from 12 COS patients and 12 healthy controls matched for age, gender, and scan interval. COS patients showed up to 2.2% slower growth rates per year than healthy controls in WM (P = 0.02, all P values corrected). The greatest differences were in the right hemisphere (P = 0.006). This asymmetry was attributable to a right slower than left hemisphere growth rate mapped in COS patients (P = 0.037) but not in healthy controls. WM growth rates reached 2.6% per year in healthy controls (P = 0.0002). COS patients showed only a 1.3% per year trend for growth in the left hemisphere (P = 0.066). In COS, WM growth rates were associated with improvement in the Children's Global Assessment Scale (R = 0.64, P = 0.029). Growth rates were reduced throughout the brain in COS, but this process appeared to progress in a front-to-back (frontal-parietal) fashion, and this effect was not attributable to lower IQ. Growth rates were correlated with functional prognosis and were visualized as detailed 3D maps. Finally, these findings also confirm that the progressive GM deficits seen in schizophrenia are not the result of WM overgrowth.

  12. Influence of growth rate and onset of boar contact on puberty attainment of replacement gilts raised in Thailand.

    Science.gov (United States)

    Roongsitthichai, Atthaporn; Olanratmanee, Em-On; Tummaruk, Padet

    2014-10-01

    This study aimed to investigate the influence of growth rate and onset of boar contact on age at first observed estrus of the replacement gilts raised in Thailand. In total, 766 gilts were measured for body weight and backfat thickness prior to insemination. Body weight was further calculated for growth rate. Estrus detection was performed twice a day by back pressure test with an existence of mature boars with high libido. The first date of boar exposure and that of first observed estrus were individually recorded. Due to growth rate, they were classified into three groups: high (>700 g/day), moderate (600-700 g/day), and low (gilts were grouped into two categories: early (gilts expressed first observed estrus, averagely, at age 205.1 ± 34.1 days, had a growth rate of 615.5 ± 57.6 g/day, and first contact with boars at 160.7 ± 19.9 days of age. The gilts with low growth rate expressed first estrus later than those with moderate (208.6 ± 2.0 vs 198.0 ± 3.2 days, P = 0.033) and high growth rate (208.6 ± 2.0 vs 193.9 ± 6.7 days, P = 0.005) groups. Together with the influence of boar exposure, the gilts contacted boar earlier with high growth rate showed first estrus at age 180.3 ± 10.1 days, whereas those with later boar contact with low growth rate showed first estrus at age 197.9 ± 3.2 days. In summary, the replacement gilts should have high growth rate and contact boar early to attain puberty faster and possess decent subsequent reproductive performance.

  13. Onset of chaos in a single-phase power electronic inverter.

    Science.gov (United States)

    Avrutin, Viktor; Mosekilde, Erik; Zhusubaliyev, Zhanybai T; Gardini, Laura

    2015-04-01

    Supported by experiments on a power electronic DC/AC converter, this paper considers an unusual transition from the domain of stable periodic dynamics (corresponding to the desired mode of operation) to chaotic dynamics. The behavior of the converter is studied by means of a 1D stroboscopic map derived from a non-autonomous ordinary differential equation with discontinuous right-hand side. By construction, this stroboscopic map has a high number of border points. It is shown that the onset of chaos occurs stepwise, via irregular cascades of different border collisions, some of which lead to bifurcations while others do not.

  14. Insulin-Like Growth Factor 1 and Related Compounds in the Treatment of Childhood-Onset Neurodevelopmental Disorders

    Directory of Open Access Journals (Sweden)

    Cyrus Vahdatpour

    2016-09-01

    Full Text Available Insulin-Like Growth Factor 1 (IGF-1 is a neurotrophic polypeptide with crucial roles to play in Central Nervous System (CNS growth, development and maturation. Following interrogation of the neurobiology underlying several neurodevelopmental disorders and Autism Spectrum Disorders (ASD, both recombinant IGF-1 (mecasermin and related derivatives, such as (1-3 IGF-1, have emerged as potential therapeutic approaches. Clinical pilot studies and early reports have supported the safety/preliminary efficacy of IGF-1 and related compounds in the treatment of Rett Syndrome, with evidence mounting for its use in Phelan McDermid Syndrome and Fragile X Syndrome. In broader ASD, clinical trials are ongoing. Here, we review the role of IGF-1 in the molecular etiologies of these conditions in addition to the accumulating evidence from early clinical studies highlighting the possibility of IGF-1 and related compounds as potential treatments for these childhood-onset neurodevelopmental disorders.

  15. Objective measures of sleep and dim light melatonin onset in adolescents and young adults with delayed sleep phase disorder compared to healthy controls.

    Science.gov (United States)

    Saxvig, Ingvild W; Wilhelmsen-Langeland, Ane; Pallesen, Ståle; Vedaa, Oystein; Nordhus, Inger H; Sørensen, Eli; Bjorvatn, Bjørn

    2013-08-01

    Delayed sleep phase disorder is characterized by a delay in the timing of the major sleep period relative to conventional norms. The sleep period itself has traditionally been described as normal. Nevertheless, it is possible that sleep regulatory mechanism disturbances associated with the disorder may affect sleep duration and/or architecture. Polysomnographic data that may shed light on the issue are scarce. Hence, the aim of this study was to examine polysomnographic measures of sleep in adolescents and young adults with delayed sleep phase disorder, and to compare findings to that of healthy controls. A second aim was to estimate dim light melatonin onset as a marker of circadian rhythm and to investigate the phase angle relationship (time interval) between dim light melatonin onset and the sleep period. Data from 54 adolescents and young adults were analysed, 35 diagnosed with delayed sleep phase disorder and 19 healthy controls. Results show delayed timing of sleep in participants with delayed sleep phase disorder, but once sleep was initiated no group differences in sleep parameters were observed. Dim light melatonin onset was delayed in participants with delayed sleep phase disorder, but no difference in phase angle was observed between the groups. In conclusion, both sleep and dim light melatonin onset were delayed in participants with delayed sleep phase disorder. The sleep period appeared to occur at the same circadian phase in both groups, and once sleep was initiated no differences in sleep parameters were observed. © 2013 European Sleep Research Society.

  16. Phase Characterization of Cucumber Growth: A Chemical Gel Model

    Directory of Open Access Journals (Sweden)

    Bo Li

    2016-01-01

    Full Text Available Cucumber grows with complex phenomena by changing its volume and shape, which is not fully investigated and challenges agriculture and food safety industry. In order to understand the mechanism and to characterize the growth process, the cucumber is modeled as a hydrogel in swelling and its development is studied in both preharvest and postharvest stages. Based on thermodynamics, constitutive equations, incorporating biological quantities, are established. The growth behavior of cucumber follows the classic theory of continuous or discontinuous phase transition. The mechanism of bulged tail in cucumber is interpreted by phase coexistence and characterized by critical conditions. Conclusions are given for advances in food engineering and novel fabrication techniques in mechanical biology.

  17. A generalized-growth model to characterize the early ascending phase of infectious disease outbreaks.

    Science.gov (United States)

    Viboud, Cécile; Simonsen, Lone; Chowell, Gerardo

    2016-06-01

    A better characterization of the early growth dynamics of an epidemic is needed to dissect the important drivers of disease transmission, refine existing transmission models, and improve disease forecasts. We introduce a 2-parameter generalized-growth model to characterize the ascending phase of an outbreak and capture epidemic profiles ranging from sub-exponential to exponential growth. We test the model against empirical outbreak data representing a variety of viral pathogens in historic and contemporary populations, and provide simulations highlighting the importance of sub-exponential growth for forecasting purposes. We applied the generalized-growth model to 20 infectious disease outbreaks representing a range of transmission routes. We uncovered epidemic profiles ranging from very slow growth (p=0.14 for the Ebola outbreak in Bomi, Liberia (2014)) to near exponential (p>0.9 for the smallpox outbreak in Khulna (1972), and the 1918 pandemic influenza in San Francisco). The foot-and-mouth disease outbreak in Uruguay displayed a profile of slower growth while the growth pattern of the HIV/AIDS epidemic in Japan was approximately linear. The West African Ebola epidemic provided a unique opportunity to explore how growth profiles vary by geography; analysis of the largest district-level outbreaks revealed substantial growth variations (mean p=0.59, range: 0.14-0.97). The districts of Margibi in Liberia and Bombali and Bo in Sierra Leone had near-exponential growth, while the districts of Bomi in Liberia and Kenema in Sierra Leone displayed near constant incidences. Our findings reveal significant variation in epidemic growth patterns across different infectious disease outbreaks and highlights that sub-exponential growth is a common phenomenon, especially for pathogens that are not airborne. Sub-exponential growth profiles may result from heterogeneity in contact structures or risk groups, reactive behavior changes, or the early onset of interventions strategies

  18. STRIDER (Sildenafil TheRapy in dismal prognosis early onset fetal growth restriction)

    DEFF Research Database (Denmark)

    Pels, A; Kenny, L C; Alfirevic, Z

    2017-01-01

    randomised placebo-controlled trials have been launched. Women with a singleton pregnancy between 18 and 30 weeks with severe fetal growth restriction of likely placental origin, and where the likelihood of perinatal death/severe morbidity is estimated to be significant are included. Participants...

  19. The Impact of Site Extremes on the Onset of Phenological Phases of Selected Tree Species

    Directory of Open Access Journals (Sweden)

    Jana Škvareninová

    2014-01-01

    Full Text Available In the years 2007–2013 we performed phenological observations of common hazel (Corylus avellana L., blackthorn (Prunus spinosa L., and hawthorn (Crataegus oxyacantha L. at two locations of central Slovakia situated at elevations of 300 m and 530 m a.s.l. The phenophase of first leaves of all tree species started in the second half of April on average, and was conditioned by the average daily air temperatures above 0 °C. The earliest onset was observed at both locations in 2007 due to the highest average air temperature during the observed period, which in March reached the value of 6.1 °C. Colouring of leaves started in the second and third decades of September. Both phenophases began earlier at the location situated at the higher elevation due to the effect of aspect, terrain, and soil depth. During the last 7 years, the average length of the growing season of tree species situated at an elevation of 300 m was from 136 to 152 days, in more extreme conditions at an elevation of 530 m the growing season was shorter by 12 days in the case of blackthorn and by 5 days in the case of hawthorn.

  20. Cosmic ray fluctuation parameter as indicator of 11-year cycle activity growth phase

    International Nuclear Information System (INIS)

    Kozlov, V I; Kozlov, V V

    2013-01-01

    The prolonged 23 cycle minimum has been tested on the basis of introduced by us the fluctuation parameter of galactic cosmic ray (GCR) intensity. Long-term forecast of the onset of new (24) 11-year cycle with an advance of ∼1 year is given. Besides, a middle-term forecast of activity growth phase of the new 24 cycle with the advance of ∼1 Sun rotation is presented. From results of the wavelet-analysis it follows that a low-frequency drift of 11-year cycle period has begun as long ago as the 22 cycle. It is necessary to notice that we have predicted the failure of 11-year cycle period (by our terminology it is called a «low-frequency drift») 3 years prior to its obvious manifestation in 2008-2010. Results of a trajectory analysis of GCR fluctuation parameter on a complex phase plane indicate that the greatest area is 'covered' with a trajectory of the same 22 cycle. It is believed (in the view of G.V. Kuklin, 1982) that the greatest area of phase trajectory is an evidence of abnormal cycle before a «phase catastrophe». It is obvious that since the 22 cycle the prolonged failure of 11-year cycling has begun.

  1. Pulsing blue light through closed eyelids: effects on acute melatonin suppression and phase shifting of dim light melatonin onset

    Directory of Open Access Journals (Sweden)

    Figueiro MG

    2014-12-01

    Full Text Available Mariana G Figueiro, Barbara Plitnick, Mark S Rea Lighting Research Center, Rensselaer Polytechnic Institute, Troy, NY, USA Abstract: Circadian rhythm disturbances parallel the increased prevalence of sleep disorders in older adults. Light therapies that specifically target regulation of the circadian system in principle could be used to treat sleep disorders in this population. Current recommendations for light treatment require the patients to sit in front of a bright light box for at least 1 hour daily, perhaps limiting their willingness to comply. Light applied through closed eyelids during sleep might not only be efficacious for changing circadian phase but also lead to better compliance because patients would receive light treatment while sleeping. Reported here are the results of two studies investigating the impact of a train of 480 nm (blue light pulses presented to the retina through closed eyelids on melatonin suppression (laboratory study and on delaying circadian phase (field study. Both studies employed a sleep mask that provided narrowband blue light pulses of 2-second duration every 30 seconds from arrays of light-emitting diodes. The results of the laboratory study demonstrated that the blue light pulses significantly suppressed melatonin by an amount similar to that previously shown in the same protocol at half the frequency (ie, one 2-second pulse every minute for 1 hour. The results of the field study demonstrated that blue light pulses given early in the sleep episode significantly delayed circadian phase in older adults; these results are the first to demonstrate the efficacy and practicality of light treatment by a sleep mask aimed at adjusting circadian phase in a home setting. Keywords: circadian phase, dim light melatonin onset, light through closed eyelids, blue light, sleep

  2. Characterization of secondary phases in modified vertical bridgman growth czt

    Energy Technology Data Exchange (ETDEWEB)

    Duff, Martine

    2009-07-10

    CdZnTe or 'CZT' crystals are highly suitable for use as a room temperature based spectrometer for the detection and characterization of gamma radiation. Over the last decade, the methods for growing high quality CZT have improved the quality of the produced crystals however there are material features that can influence the performance of these materials as radiation detectors. For example, various structural heterogeneities within the CZT crystals, such as twinning, pipes, grain boundaries (polycrystallinity), and secondary phases (SP) can have a negative impact on the detector performance. In this study, a CZT material was grown by the modified vertical Bridgman growth (MVB) method with zone leveled growth without excess Te in the melt. Visual observations of material from the growth of this material revealed significant voids and SP. Three samples from this material was analyzed using various analytical techniques to evaluate its electrical properties, purity and detector performance as radiation spectrometers and to determine the morphology, dimension and elemental/structural composition of one of the SP in this material. This material was found to have a high resistivity but poor radiation spectrometer performance. It had SP that were rich in polycrystalline aluminum oxide (Al{sub 2}O{sub 3}), metallic Te and polycrystalline CdZnTe and 15 to 50 {micro}m in diameter. Bulk elemental analyses of sister material from elsewhere in the boule did not contain high levels of Al so there is considerable elemental impurity heterogeneity within the boule from this growth.

  3. Continuation of growth hormone therapy versus placebo in transition-phase patients with growth hormone deficiency

    DEFF Research Database (Denmark)

    Jørgensen, Jens; Nørrelund, Helene; Vahl, Nina

    2002-01-01

    In a placebo-controlled, parallel study of 18 patients with a mean age of 20 years who had confirmed growth hormone (GH) deficiency, we evaluated body composition, insulin sensitivity, and glucose turnover at baseline (when all were receiving GH replacement); after 12 months of continued GH therapy...... or placebo; and after a 12-month open phase of GH therapy. In the placebo group, insulin sensitivity and fat mass increased and lipid oxidation decreased, whereas glucose oxidation increased (p...

  4. Large along-strike variations in the onset of Subandean exhumation: Implications for Central Andean orogenic growth

    Science.gov (United States)

    Lease, Richard O.; Ehlers, T.A.; Enkelmann, E.

    2016-01-01

    Plate tectonics drives mountain building in general, but the space-time pattern and style of deformation is influenced by how climate, geodynamics, and basement structure modify the orogenic wedge. Growth of the Subandean thrust belt, which lies at the boundary between the arid, high-elevation Central Andean Plateau and its humid, low-elevation eastern foreland, figures prominently into debates of orogenic wedge evolution. We integrate new apatite and zircon (U-Th)/He thermochronometer data with previously published apatite fission-track data from samples collected along four Subandean structural cross-sections in Bolivia between 15° and 20°S. We interpret cooling ages vs. structural depth to indicate the onset of Subandean exhumation and signify the forward propagation of deformation. We find that Subandean growth is diachronous south (11 ± 3 Ma) vs. north (6 ± 2 Ma) of the Bolivian orocline and that Subandean exhumation magnitudes vary by more than a factor of two. Similar north-south contrasts are present in foreland deposition, hinterland erosion, and paleoclimate; these observations both corroborate diachronous orogenic growth and illuminate potential propagation mechanisms. Of particular interest is an abrupt shift to cooler, more arid conditions in the Altiplano hinterland that is diachronous in southern Bolivia (16-13 Ma) vs. northern Bolivia (10-7 Ma) and precedes the timing of Subandean propagation in each region. Others have interpreted the paleoclimate shift to reflect either rapid surface uplift due to lithosphere removal or an abrupt change in climate dynamics once orographic threshold elevations were exceeded. These mechanisms are not mutually exclusive and both would drive forward propagation of the orogenic wedge by augmenting the hinterland backstop, either through surface uplift or spatially variable erosion. In summary, we suggest that diachronous Subandean exhumation was driven by piecemeal hinterland uplift, orography, and the outward

  5. Phase field simulation of template growth process in textured ceramics

    Science.gov (United States)

    Zhang, Yongmei; Liu, Liangliang

    2018-01-01

    The microstructure evolution of a template particle in a polycrystalline matrix during the templated grain growth process was simulated by a phase field approach. An initial microstructure including a rectangle (representing the template particle) and many circles (representing the matrix particles) was established with MATLAB software. The effects of the size and aspect ratio of the template particle on the development of microstructure were investigated by setting different areas and perimeters of the rectangle, respectively. When the aspect ratio >1, it was found that the template particle grew preferentially in the perpendicular direction rather than in the lateral direction along the casting plane. This could be attributed to the greater interface area between the large template and small matrix particles in the perpendicular direction. The results of the calculations indicated that there was a growth advantage for the template particle when its size was 3.46 times than that of the matrix particles in the two-dimensional system. The growth rate mainly depended on the aspect ratio of the template particle rather than on the template size. The simulation results gave a guiding principle for optimizing the process parameters, such as initial size and aspect ratio of template particle, when preparing highly textured ceramics.

  6. GaSb film growth by liquid phase epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Cruz, M.L.; Martinez-Juarez, J.; Lopez-Salazar, P. [CIDS-ICUAP, BUAP, Av. 14 Sur y San Claudio, C.U. Edif.103C, Col. Sn Manuel, C.P. 72570, Puebla, Pue. (Mexico); Diaz, G.J. [Centro de Investigacion y Estudios Avanzados, IPN, Av. IPN 2508, Col. Sn. Pedro Zacatenco, C.P. 07360, D.F. (Mexico)

    2010-04-15

    Doped GaSb (Gallium Antimonide) films on p-GaSb substrates have been obtained by means of a low-cost and fast-growth method: the liquid phase epitaxy (LPE) technique. The growth temperature was 400 C, and the growth time was varied between1 and 5 min. Characterization of the films was performed by means of high resolution X-ray Diffraction, low temperature-photoluminescence and current-voltage curve measurements. The X-ray diffraction pattern confirms a zincblende-type crystal structure with a high-thin peak centred at 30.36 . The PL spectra at 27 K allowed to confirm the band-gap energy to be 0.8 eV and the I-V curves presented a PN junction behavior which corresponds to the obtained structured. Metal contacts of Au-Zn and Au-Ge were placed to perform electrical characterization (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  7. STRIDER (Sildenafil TheRapy in dismal prognosis early onset fetal growth restriction): an international consortium of randomised placebo-controlled trials

    NARCIS (Netherlands)

    Pels, A.; Kenny, L. C.; Alfirevic, Z.; Baker, P. N.; von Dadelszen, Peter; Gluud, C.; Kariya, C. T.; Mol, B. W.; Papageorghiou, A. T.; van Wassenaer-Leemhuis, A. G.; Ganzevoort, W.; Groom, K. M.

    2017-01-01

    Background: Severe, early-onset fetal growth restriction due to placental insufficiency is associated with a high risk of perinatal mortality and morbidity with long-lasting sequelae. Placental insufficiency is the result of abnormal formation and function of the placenta with inadequate remodelling

  8. STRIDER (Sildenafil TheRapy in dismal prognosis early onset fetal growth restriction): An international consortium of randomised placebo-controlled trials

    NARCIS (Netherlands)

    Pels, A. (A.); L.C. Kenny (Louise C.); Z. Alfirevic (Zarko); P.N. Baker (Philip Newton); P. von Dadelszen (Peter); C. Gluud (Christian); Kariya, C.T. (C. T.); B.W.J. Mol (Ben); Papageorghiou, A. (A.); A.G. van Wassenaer-Leemhuis (Aleid); W. Ganzevoort (Wessel); Groom, K.M. (K. M.); McCowan, L.M. (L. M.); Stone, P.R. (P. R.); Lee, A. (A.); Mackay, L. (L.); Oyston, C. (C.); Gardener, G. (G.); Khashan, A. (A.); Eustace, J. (J.); Dempsey, E. (E.); Jackson, R. (R.); Dickinson, J. (J.); Gill, A. (A.); Muller, P. (P.); Sekar, R. (R.); Reid, R.A. (R. A.); Unterschneider, J. (J.); Welsh, A. (A.); Marlow, J. (J.); Hyett, J. (Jon); Walker, S. (S.); J. Morris; Watson, D. (D.); McKinlay, C. (C.); Harris, S. (S.); von Dadelszen, P. (P.); Lim, K.I. (K. I.); Lalji, S. (S.); Magee, L.A. (L. A.); Lim, K.I. (K. I.); Magee, L.A. (L. A.); Lalji, S. (S.); Kariya, C.T. (C. T.); Lee, T. (T.); Li, J. (J.); Hutfield, A. (A.); Ansermino, M. (M.); Robinson, W. (W.); Singer, J. (J.); Synnes, A.R. (A. R.); Burrows, J. (J.); Audibert, F. (F.); E. Bujold (Emmanuel); Piedboeuf, B. (B.); Piedboeuf, B. (B.); Davidge, S.T. (S. T.); Seaward, G.R. (G. R.); Dwinnell, S. (S.); Gagnon, R. (R.); Gaudet, L. (L.); Young, C. (C.); Murphy, D. (D.); Daly, S. (S.); McAuliffe, F. (F.); Malone, F. (F.); Breathnach, F. (F.); O'Donoghue, K. (K.); Ganzevoort, J.W. (J. W.); Pels, A. (A.); Al-Nasiry, S. (S.); de Boer, M.A. (M. A.); C.J.M. de Groot (Christianne); Sueters, M. (M.); J.B. Derks (Jan); van Drongelen, J. (J.); J.J. Duvekot (Hans); Elvan-Taspinar, A. (A.); J. van Eyck (Jim); van Laar, J. (J.); Morssink, L.P. (L. P.); Alfirevic, Z. (Z.); Price, L. (L.); Astor, A. (A.); Hardman, L. (L.); Sharp, A. (A.); Turner, M. (M.); Cameron, A. (A.); Draper, E. (E.); Clarke, P. (P.); Mckelvey, A. (A.); A.T. Papageorghiou (A.); Alfirevic, Z. (Z.); Masson, G. (G.); Aquilin, J. (J.); Johnstone, E. (E.); Bugg, G. (G.); Howe, D. (D.); Patni, S. (S.); Mousa, H. (H.); Russell, H. (H.); Hannon, T. (T.); M.D. Kilby (Mark); David, A. (A.); Cohen, K. (K.); Impey, L. (L.); Stock, S. (S.); Poon, L. (L.); Pasupath, D. (D.); A. Khalil (Asma); Baker, P.N. (P. N.)

    2017-01-01

    textabstractBackground: Severe, early-onset fetal growth restriction due to placental insufficiency is associated with a high risk of perinatal mortality and morbidity with long-lasting sequelae. Placental insufficiency is the result of abnormal formation and function of the placenta with inadequate

  9. Postpartum Circulating Markers of Inflammation and the Systemic Acute-Phase Response After Early-Onset Preeclampsia.

    Science.gov (United States)

    van Rijn, Bas B; Bruinse, Hein W; Veerbeek, Jan H; Post Uiterweer, Emiel D; Koenen, Steven V; van der Bom, Johanna G; Rijkers, Ger T; Roest, Mark; Franx, Arie

    2016-02-01

    Preeclampsia is an inflammatory-mediated hypertensive disorder of pregnancy and seems to be an early indicator of increased cardiovascular risk, but mechanisms underlying this association are unclear. In this study, we identified levels of circulating inflammatory markers and dynamic changes in the systemic acute-phase response in 44 women with a history of severe early-onset preeclampsia, compared with 29 controls with only uneventful pregnancies at 1.5 to 3.5 years postpartum. Models used were in vivo seasonal influenza vaccination and in vitro whole-blood culture with T-cell stimulants and the toll-like receptor-4 ligand lipopolysaccharide. Outcome measures were C-reactive protein, interleukin-6 (IL-6), IL-18, fibrinogen, myeloperoxidase, and a panel of 13 cytokines representative of the innate and adaptive inflammatory response, in addition to established cardiovascular markers. The in vivo acute-phase response was higher for women with previous preeclampsia than that for controls without such a history, although only significant for C-reactive protein (P=0.04). Preeclampsia was associated with higher IL-1β (Ppreeclampsia: an adaptive response cluster associated with increased C-reactive protein and IL-6 before and after vaccination, increased weight, and low high-density lipoprotein cholesterol; and a toll-like receptor-4 mediated the cluster associated with increased IL-18 before and after vaccination but not associated with other cardiovascular markers. Furthermore, we found interactions between previous preeclampsia, common TLR4 gene variants, and the IL-18 response to vaccination. In conclusion, preeclampsia is associated with alterations in the inflammatory response postpartum mostly independent of other established cardiovascular risk markers. © 2015 American Heart Association, Inc.

  10. Seven years of growth hormone (GH) replacement improves quality of life in hypopituitary patients with adult-onset GH deficiency.

    Science.gov (United States)

    Elbornsson, Mariam; Horvath, Alexandra; Götherström, Galina; Bengtsson, Bengt-Åke; Johannsson, Gudmundur; Svensson, Johan

    2017-02-01

    Few studies have determined the effects of long-term growth hormone (GH) replacement on quality of life (QoL). This study investigated the effects of 7 years of GH replacement on QoL. A prospective, single-center, open-label study of 95 adults (mean age 52.8 years; 46 men) with adult-onset GH deficiency (GHD). QoL was measured using Quality of Life-Assessment for Growth Hormone Deficiency in Adults (QoL-AGHDA) and Psychological General Well-Being (PGWB) scores. The GH dose was gradually increased from 0.13 mg/day to 0.42 mg/day. IGF-I SD score increased from -1.49 at baseline to 0.35 at study end. The GH replacement induced sustained improvements in total QoL-AGHDA and PGWB scores. GHD women had a more marked improvement in total QoL-AGHDA score than GHD men after 5 and 7 years. Most of the improvement in QoL was seen during the first year, but there was a small further improvement also after one year as measured using QoL-AGHDA. All QoL-AGHDA dimensions improved, but the improvement in memory and concentration as well as tenseness occurred later than that of other dimensions. Correlation analysis demonstrated that the patients with the lowest baseline QoL had the greatest improvement in QoL. Seven years of GH replacement improved QoL with the most marked improvements in GHD women and in patients with low baseline QoL. Most, but not all, of the improvement in QoL was seen during the first year. Some QoL-AGHDA dimensions (memory and concentration, tenseness) responded at a slower rate than other dimensions. © 2017 European Society of Endocrinology.

  11. New Predictive Model at 11+0to 13+6Gestational Weeks for Early-Onset Preeclampsia With Fetal Growth Restriction.

    Science.gov (United States)

    Chang, Ying; Chen, Xu; Cui, Hong-Yan; Li, Xing; Xu, Ya-Ling

    2017-05-01

    The aim of the present study was to determine a predictive model for early-onset preeclampsia with fetal growth restriction (FGR) to be used at 11 +0 to 13 +6 gestational weeks, by combining the maternal serum level of pregnancy-associated plasma protein-A (PAPP-A), placental growth factor (PLGF), placental protein 13 (PP13), soluble endoglin (sEng), mean arterial pressure (MAP), and uterine artery Doppler. This was a retrospective cohort study of 4453 pregnant women. Uterine artery Doppler examination was conducted in the first trimester. Maternal serum PAPP-A, PLGF, PP13, and sEng were measured. Mean arterial pressure was obtained. Women were classified as with/without early-onset preeclampsia, and women with preeclampsia were classified as with/without FGR. Receiver operating characteristic analysis was performed to determine the value of the model. There were 30 and 32 pregnant women with early-onset preeclampsia with and without FGR. The diagnosis rate of early-onset preeclampsia with FGR was 67.4% using the predictive model when the false positive rate was set at 5% and 73.2% when the false positive rate was 10%. The predictive model (MAP, uterine artery Doppler measurements, and serum biomarkers) had some predictive value for the early diagnosis (11 +0 to 13 +6 gestational weeks) of early-onset preeclampsia with FGR.

  12. Treatment of infantile-onset spinal muscular atrophy with nusinersen: a phase 2, open-label, dose-escalation study.

    Science.gov (United States)

    Finkel, Richard S; Chiriboga, Claudia A; Vajsar, Jiri; Day, John W; Montes, Jacqueline; De Vivo, Darryl C; Yamashita, Mason; Rigo, Frank; Hung, Gene; Schneider, Eugene; Norris, Daniel A; Xia, Shuting; Bennett, C Frank; Bishop, Kathie M

    2016-12-17

    Nusinersen is a 2'-O-methoxyethyl phosphorothioate-modified antisense drug being developed to treat spinal muscular atrophy. Nusinersen is specifically designed to alter splicing of SMN2 pre-mRNA and thus increase the amount of functional survival motor neuron (SMN) protein that is deficient in patients with spinal muscular atrophy. This open-label, phase 2, escalating dose clinical study assessed the safety and tolerability, pharmacokinetics, and clinical efficacy of multiple intrathecal doses of nusinersen (6 mg and 12 mg dose equivalents) in patients with infantile-onset spinal muscular atrophy. Eligible participants were of either gender aged between 3 weeks and 7 months old with onset of spinal muscular atrophy symptoms between 3 weeks and 6 months, who had SMN1 homozygous gene deletion or mutation. Safety assessments included adverse events, physical and neurological examinations, vital signs, clinical laboratory tests, cerebrospinal fluid laboratory tests, and electrocardiographs. Clinical efficacy assessments included event free survival, and change from baseline of two assessments of motor function: the motor milestones portion of the Hammersmith Infant Neurological Exam-Part 2 (HINE-2) and the Children's Hospital of Philadelphia Infant Test of Neuromuscular Disorders (CHOP-INTEND) motor function test, and compound motor action potentials. Autopsy tissue was analysed for target engagement, drug concentrations, and pharmacological activity. HINE-2, CHOP-INTEND, and compound motor action potential were compared between baseline and last visit using the Wilcoxon signed-rank test. Age at death or permanent ventilation was compared with natural history using the log-rank test. The study is registered at ClinicalTrials.gov, number NCT01839656. 20 participants were enrolled between May 3, 2013, and July 9, 2014, and assessed through to an interim analysis done on Jan 26, 2016. All participants experienced adverse events, with 77 serious adverse events reported in

  13. The onset of the progression of acute phase response mechanisms induced by extreme impacts can be followed by the decrease in blood levels of positive acute phase proteins.

    Science.gov (United States)

    Larina, Olga; Bekker, Anna

    Studies performed at space flights and earth-based simulation models detected the plasma indices of acute phase reaction (APR), i.e. the increase of APR cytokine mediators and alterations in the production of blood acute phase proteins (APP) at the initial stages of adaptation to altered gravity conditions. Acute phase response is the principal constituent of the functional activity of innate immunity system. Changes in plasma APPs contents are considered to serve the restoration of homeostasis state. According to trends of their concentration shifts at the evolving of acute phase reaction APPs are denoted as positive, neutral, or negative. Plasma concentrations of positive acute phase proteins α1-acid glycoprotein (α1-AGP), α1-antitrypsin (α1-AT), and neutral α2-macroglobulin (α2-M) were measured in human study at 12-hour antiorthostatic position (AOP) with 15° head down tilt and hypoxia experiments at 14% oxygen in pressure chamber. Both of these impacts were shown to produce alterations in the APP levels indicative for acute phase response. Nevertheless, in AOP experiment noticeable decrease in α1-AGP concentration occurred by hour 12, and even more pronounced decline of α1-AGP and α1-AT were found on hypoxia hours 12 and 36. Acute phase proteins α1-AGP and α2-M possess the features of proteinase inhibitors. This function is implemented by the formation of complexes with the molecules of proteolytic enzymes which subsequently are removed from the blood flow. Transient decrease in plasma concentrations of protease inhibitors on early phases of APR development was reported to result from the growth of plasma protease activity due to cathepsin release from activated leukocytes, which had not yet been compensated by enhanced APP synthesis. Being a carrier protein for positively charged and neutral substances, α1-AGP shows pronounced elevation in its blood content during APR development. As assumed, it is required for the transportation of the increased

  14. A generalized-growth model to characterize the early ascending phase of infectious disease outbreaks

    Directory of Open Access Journals (Sweden)

    Cécile Viboud

    2016-06-01

    Conclusions: Our findings reveal significant variation in epidemic growth patterns across different infectious disease outbreaks and highlights that sub-exponential growth is a common phenomenon, especially for pathogens that are not airborne. Sub-exponential growth profiles may result from heterogeneity in contact structures or risk groups, reactive behavior changes, or the early onset of interventions strategies, and consideration of “deceleration parameters” may be useful to refine existing mathematical transmission models and improve disease forecasts.

  15. Assessment of left ventricular ejection fraction by gated blood pool scintigraphy on early and late phase from the onset of acute myocardial infarction

    International Nuclear Information System (INIS)

    Nakashima, Yoshiharu; Fukuzaki, Hisashi; Minamiji, Katsumi; Kida, Toru; Okada, Toshio; Yamada, Shigenobu; Goto, Takeshi; Maeda, Kazumi; Yoshida, Yutaka.

    1984-01-01

    To evaluate the change of left ventricular function after the onset of acute myocardial infarction, gated blood pool scintigraphy was performed in 19 patients on early and late phase (6 days and 1 month on the average). There was a difference in left ventricular ejection fraction (LVEF) between patients with anterior and inferior myocardial infarction. Patients with anterior infarction indicated low value of LVEF (31+-7%) on acute phase and its value was increased on chronic phase (37+-8%), whereas patients with inferior infarction had higher value of LVEF not only on acute phase but also on chronic phase (54+-9%→57+-10%), than those with anterior infarction. Left ventricular volume was larger in anterior group than in inferior group and tended to become smaller on chronic phase. In 4 of 10 cases with anterior infarction, a significant improvement of LVEF was found from 28+-6% to 43+-5%, but in 6 cases LVEF was unchanged during the same period. In 3 cases out of improved group, it was demonstrated angiographically that the collateral vessels were developed. It was, thus, suggested that collateral vessels may play an important role in the recovery of myocardial ischemia and wall motion abnormality in the marginal zone of infarcted area. From these results, we concluded that left ventricular function changed serially in most patients from the early phase to the late phase after the onset of acute myocardial infarction. (author)

  16. Use of ultrasonic back-reflection intensity for predicting the onset of crack growth due to low-cycle fatigue in stainless steel under block loading.

    Science.gov (United States)

    Islam, Md Nurul; Arai, Yoshio; Araki, Wakako

    2015-02-01

    The present study proposes the use of ultrasonic back-reflected waves for evaluating low cycle fatigue crack growth from persistent slip bands (PSBs) of stainless steel under block loading. Fatigue under high-low block loading changes the back-reflected intensity of the ultrasonic wave that emanates from the surface. Measuring the change in ultrasonic intensity can predict the start of crack growth with reasonable accuracy. The present study also proposes a modified constant cumulative plastic strain method and a PSB damage evolution model to predict the onset of crack growth under block loads. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Temporal transcriptomic analysis of Desulfovibrio vulgaris Hildenborough transition into stationary phase growth during electrondonor depletion

    Energy Technology Data Exchange (ETDEWEB)

    Clark, M.E.; He, Q.; He, Z.; Huang, K.H.; Alm, E.J.; Wan, X.-F.; Hazen, T.C.; Arkin, A.P.; Wall, J.D.; Zhou, J.-Z.; Fields, M.W.

    2006-08-01

    Desulfovibrio vulgaris was cultivated in a defined medium, and biomass was sampled for approximately 70 h to characterize the shifts in gene expression as cells transitioned from the exponential to the stationary phase during electron donor depletion. In addition to temporal transcriptomics, total protein, carbohydrate, lactate, acetate, and sulfate levels were measured. The microarray data were examined for statistically significant expression changes, hierarchical cluster analysis, and promoter element prediction and were validated by quantitative PCR. As the cells transitioned from the exponential phase to the stationary phase, a majority of the down-expressed genes were involved in translation and transcription, and this trend continued at the remaining times. There were general increases in relative expression for intracellular trafficking and secretion, ion transport, and coenzyme metabolism as the cells entered the stationary phase. As expected, the DNA replication machinery was down-expressed, and the expression of genes involved in DNA repair increased during the stationary phase. Genes involved in amino acid acquisition, carbohydrate metabolism, energy production, and cell envelope biogenesis did not exhibit uniform transcriptional responses. Interestingly, most phage-related genes were up-expressed at the onset of the stationary phase. This result suggested that nutrient depletion may affect community dynamics and DNA transfer mechanisms of sulfate-reducing bacteria via the phage cycle. The putative feoAB system (in addition to other presumptive iron metabolism genes) was significantly up-expressed, and this suggested the possible importance of Fe{sup 2+} acquisition under metal-reducing conditions. The expression of a large subset of carbohydrate-related genes was altered, and the total cellular carbohydrate levels declined during the growth phase transition. Interestingly, the D. vulgaris genome does not contain a putative rpoS gene, a common attribute

  18. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  19. Onset of a pandemic: characterizing the initial phase of the swine flu (H1N1 epidemic in Israel

    Directory of Open Access Journals (Sweden)

    Mendelson Ella

    2011-04-01

    Full Text Available Abstract Background The swine influenza H1N1 first identified in Mexico, spread rapidly across the globe and is considered the fastest moving pandemic in history. The early phase of an outbreak, in which data is relatively scarce, presents scientific challenges on key issues such as: scale, severity and immunity which are fundamental for establishing sound and rapid policy schemes. Our analysis of an Israeli dataset aims at understanding the spatio-temporal dynamics of H1N1 in its initial phase. Methods We constructed and analyzed a unique dataset from Israel on all confirmed cases (between April 26 to July 7, 2009, representing most swine flu cases in this period. We estimated and characterized fundamental epidemiological features of the pandemic in Israel (e.g. effective reproductive number, age-class distribution, at-risk social groups, infections between sexes, and spatial dynamics. Contact data collected during this stage was used to estimate the generation time distribution of the pandemic. Results We found a low effective reproductive number (Re = 1.06, an age-class distribution of infected individuals (skewed towards ages 18-25, at-risk social groups (soldiers and ultra Orthodox Jews, and significant differences in infections between sexes (skewed towards males. In terms of spatial dynamics, the pandemic spread from the central coastal plain of Israel to other regions, with higher infection rates in more densely populated sub-districts with higher income households. Conclusions Analysis of high quality data holds much promise in reducing uncertainty regarding fundamental aspects of the initial phase of an outbreak (e.g. the effective reproductive number Re, age-class distribution, at-risk social groups. The formulation for determining the effective reproductive number Re used here has many advantages for studying the initial phase of the outbreak since it neither assumes exponential growth of infectives and is independent of the

  20. Deviations from cooperative growth mode during eutectoid transformation: Insights from a phase-field approach

    International Nuclear Information System (INIS)

    Ankit, Kumar; Mukherjee, Rajdip; Mittnacht, Tobias; Nestler, Britta

    2014-01-01

    The non-cooperative eutectoid transformation relies on the presence of pre-existing cementite particles in the parent austenitic phase and yields a product, popularly known as the divorced eutectoid. Under isothermal conditions, two of the important parameters that influence the transformation mechanism and determine the final morphology are undercooling (below the A 1 temperature) and interparticle spacing. Although the criteria that govern the morphological transition from lamellar to divorced is experimentally well established, numerical studies giving a detailed exposition of the non-cooperative transformation mechanism have not been reported extensively. In the present work, we employ a multiphase-field model that uses thermodynamic information from the CALPHAD database to numerically simulate the pulling-away of the advancing ferrite–austenite interface from cementite, which results in a transition from lamellar to divorced eutectoid morphology in Fe–C alloy. We also identify the onset of a concurrent growth and coarsening regime at small interparticle spacing and low undercooling. We analyze the simulation results to unravel the essential physics behind this complex spatial and temporal evolution pathway and amend the existing criteria by constructing a Lamellar-Divorced-Coarsening (LDC) map

  1. Growth potential of exponential- and stationary-phase Salmonella Typhimurium during sausage fermentation

    DEFF Research Database (Denmark)

    Birk, Tina; Henriksen, Sidsel; Müller, K.

    2016-01-01

    Raw meat for sausage production can be contaminated with Salmonella. For technical reasons, meat is often frozen prior to mincing but it is unknown how growth of Salmonella in meat prior to freezing affects its growth potential during sausage fermentation. We investigated survival of exponential-...... fermentation, sporadic growth of exponential-phase cells of S. Typhimurium was observed drawing attention to the handling and storage of sausage meat.......Raw meat for sausage production can be contaminated with Salmonella. For technical reasons, meat is often frozen prior to mincing but it is unknown how growth of Salmonella in meat prior to freezing affects its growth potential during sausage fermentation. We investigated survival of exponential...... starter culture. With no starter culture, both strains grew in both growth phases. In general, a functional starter culture abolished S. Typhimurium growth independent of growth phase and we concluded that ensuring correct fermentation is important for sausage safety. However, despite efficient...

  2. On grain growth kinetics in two-phase polycrystalline materials ...

    Indian Academy of Sciences (India)

    of metallic materials is annealing which restores physical and mechanical properties of cold worked metals. Two important processes occur during annealing: primary recrystallization, driven by stored energy and grain growth, driven by the grain boundary surface energy. Since recrystallization and grain growth are the key ...

  3. Growth of high purity semiconductor epitaxial layers by liquid phase ...

    Indian Academy of Sciences (India)

    Unknown

    operation of these devices strongly depend on the quality of the epitaxial layers. The growth system must be able to grow materials with very low unintentional impurity den- sity, high mobility and good luminescence properties. We have used LPE technique to perfect the growth of a num- ber of group III–V epitaxial materials ...

  4. Onset of slugging criterion based on singular points and stability analyses of transient one-dimensional two-phase flow equations of two-fluid model

    International Nuclear Information System (INIS)

    Sung, Chang Kyung; Chun, Moon Hyun

    1996-01-01

    A two-step approach has been used to obtain a new criterion for the onset of slug formation : (1) In the first step, a more general expression than the existing models for the onset of slug flow criterion has been derived from the analysis of singular points and neutral stability conditions of the transient one-dimensional two-phase flow equations of two-fluid model. (2) In the second step, introducing simplifications and incorporating a parameter into the general expression obtained in the first step to satisfy a number of physical conditions a priori specified, a new simple criterion for the onset of slug flow has been derived. Comparisons of the present model with existing models and experimental data show that the present model agree very closely with Taitel and Dukler's model and experimental data in horizontal pipes. In an inclined pipe (θ=50 deg ), however, the difference between the predictions of the present model and those of existing models is appreciably large and the present model gives the best agreement with Ohnuki et al.'s data. 17 refs., 5 figs., 1 tab. (author)

  5. On the origin of plasma sheet reconfiguration during the substorm growth phase

    Science.gov (United States)

    Gordeev, Evgeny; Sergeev, Victor; Merkin, Viacheslav; Kuznetsova, Maria

    2017-09-01

    Recently, Hsieh and Otto (2014) suggested that transport of the closed magnetic flux to the dayside reconnection region may be a key process which controls the reconfiguration of magnetotail during the substorm growth phase. We investigate this problem using global self-consistent MHD simulations and confirm that magnetotail reconfiguration is essentially a 3-D process which cannot be fully described based on 2-D-like tail evolution powered by the magnetic flux loading into the lobes. We found that near-Earth return convection strength on the nightside is directly related to the intensity of dayside reconnection, which causes the formation of antisunward azimuthal pressure gradients that force plasma to flow toward the dayside magnetopause. This near-Earth part of global convection develops immediately after the onset of dayside reconnection and reaches a quasi-steady level in 10-15 min. Its magnitude exceeds the total sunward flux transport in the midtail plasma sheet at X≈-20RE by an order of magnitude, causing significant amount (0.1-0.2 GWb) of closed magnetic flux to be removed from the near-Earth plasma sheet during moderate substorm. In that region the Bz depletion and current sheet thinning are closely related to each other, and the local Jy(Bz) relationship in the simulations matches reasonably well the power law expression found in the plasma sheet. In summary, global simulations confirm quantitatively that near-Earth return convection is primarily responsible for the severe depletion of the closed magnetic flux in the plasma sheet, major tail stretching, and current sheet thinning in the near magnetotail at r < 15RE.

  6. GaN Bulk Growth and Epitaxy from Ca-Ga-N Solutions, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This SBIR proposal addresses the liquid phase epitaxy (LPE) of gallium nitride (GaN) films using nitrogen-enriched metal solutions. Growth of GaN from solutions...

  7. Compact seaweed growth of peritectic phase on confined, flat properitectic dendrites

    Science.gov (United States)

    Ludwig, A.; Mogeritsch, J.

    2016-12-01

    Peritectic alloys form a variety of different solidification morphologies at low growth rates. An alloy with a concentration that corresponds to the hyper-peritectic limit should show a cellular/dendritic solidification of the peritectic phase for growth velocities above the corresponding constitutional undercooling limit. However, due to nucleation retardation of the peritectic phase we observed growth of properitectic dendrites before cellular growth of the peritectic could established. The transition happened via an overgrowth of dendrites with a thin layer of peritectic phase. The observations were made using a transparent, metal-like solidifying peritectic system that was solidified directionally in thin samples. In the gap between the flat dendrites and the tubing walls, the peritectic phase grew with a compact seaweed morphology, whereas in the interdendritic spacing it formed small-curved bumps. At same distance behind the tip region, more and more polycrystalline-like objects appeared at the elongated traces of the compact seaweed morphology.

  8. Proteomic analysis of oil body membrane proteins accompanying the onset of desiccation phase during sunflower seed development

    Science.gov (United States)

    Thakur, Anita; Bhatla, Satish C

    2015-01-01

    A noteworthy metabolic signature accompanying oil body (OB) biogenesis during oilseed development is associated with the modulation of the oil body membranes proteins. Present work focuses on 2-dimensional polyacrylamide gel electrophoresis (2-D PAGE)-based analysis of the temporal changes in the OB membrane proteins analyzed by LC-MS/MS accompanying the onset of desiccation (20–30 d after anthesis; DAA) in the developing seeds of sunflower (Helianthus annuus L.). Protein spots unique to 20–30 DAA stages were picked up from 2-D gels for identification and the identified proteins were categorized into 7 functional classes. These include proteins involved in energy metabolism, reactive oxygen scavenging, proteolysis and protein turnover, signaling, oleosin and oil body biogenesis-associated proteins, desiccation and cytoskeleton. At 30 DAA stage, exclusive expressions of enzymes belonging to energy metabolism, desiccation and cytoskeleton were evident which indicated an increase in the metabolic and enzymatic activity in the cells at this stage of seed development (seed filling). Increased expression of cruciferina-like protein and dehydrin at 30 DAA stage marks the onset of desiccation. The data has been analyzed and discussed to highlight desiccation stage-associated metabolic events during oilseed development. PMID:26786011

  9. Crystal growth, structure and phase studies on gold halides

    NARCIS (Netherlands)

    Janssen, Eugenius Maria Wilhelmus Janssen

    1977-01-01

    Only very corrosive substances attack gold, the most noble metal. In this study the reactivity and the phase diagrams of gold with the halogens chlorine, bromine and iodine have been investigated. owing to the noble behaviour of gold, its halides are sensitive to heat; on heating they decompose into

  10. Ethics and social acceptability of a proposed clinical trial using maternal gene therapy to treat severe early-onset fetal growth restriction.

    Science.gov (United States)

    Sheppard, M; Spencer, R N; Ashcroft, R; David, A L

    2016-04-01

    To evaluate the ethical and social acceptability of a proposed clinical trial using maternal uterine artery vascular endothelial growth factor (VEGF) gene therapy to treat severe early-onset fetal growth restriction (FGR) in pregnant women. We conducted a literature review on the ethics and legality of experimental treatments in pregnant women, in particular advanced therapeutics. Issues that were identified from the literature helped develop interview guides for semistructured, qualitative interviews, carried out in four European countries, with 34 key stakeholders (disability groups, professional bodies and patient support groups) and 24 women/couples who had experienced a pregnancy affected by severe early-onset FGR. The literature review identified two main questions: 'is it ethical to give a pregnant woman a potentially risky treatment from which she does not benefit directly?' and 'is it ethical to treat a condition of the unborn child, who may then be born with a serious disability when, without treatment, they would have died?'. The review concluded that there were no ethical or legal objections to the intervention, or to a trial of this intervention. Overall, respondents viewed the proposed trial in positive terms. Women were generally interested in participating in clinical trials that conferred a potential benefit to their unborn child. The risk of disability of the premature child was a concern, but not considered a major stumbling block for maternal VEGF gene therapy. This study did not identify any fundamental or insurmountable objections to a trial of maternal gene therapy for severe early-onset FGR. Copyright © 2016 ISUOG. Published by John Wiley & Sons Ltd. Copyright © 2016 ISUOG. Published by John Wiley & Sons Ltd.

  11. Liquid phase epitaxial growth of heterostructured hierarchical MOF thin films

    KAUST Repository

    Chernikova, Valeriya

    2017-05-10

    Precise control of epitaxial growth of MOF-on-MOF thin films, for ordered hierarchical tbo-type structures is demonstrated. The heterostructured MOF thin film was fabricated by successful sequential deposition of layers from two different MOFs. The 2-periodic layers, edge-transitive 4,4-square lattices regarded as supermolecular building layers, were commendably cross-linked using a combination of inorganic/organic and organic pillars.

  12. Effect of lag time distribution on the lag phase of bacterial growth - a Monte Carlo analysis

    Science.gov (United States)

    The objective of this study is to use Monte Carlo simulation to evaluate the effect of lag time distribution of individual bacterial cells incubated under isothermal conditions on the development of lag phase. The growth of bacterial cells of the same initial concentration and mean lag phase durati...

  13. Growth and characterization of α and β-phase tungsten films on various substrates

    International Nuclear Information System (INIS)

    Lee, Jeong-Seop; Cho, Jaehun; You, Chun-Yeol

    2016-01-01

    The growth conditions of tungsten thin films were investigated using various substrates including Si, Si/SiO 2 , GaAs, MgO, and Al 2 O 3 , and recipes were discovered for the optimal growth conditions of thick metastable β-phase tungsten films on Si, GaAs, and Al 2 O 3 substrates, which is an important material in spin orbit torque studies. For the Si/SiO 2 substrate, the crystal phase of the tungsten films was different depending upon the tungsten film thickness, and the transport properties were found to dramatically change with the thickness owing to a change in phase from the α + β phase to the α-phase. It is shown that the crystal phase changes are associated with residual stress in the tungsten films and that the resistivity is closely related to the grain sizes

  14. Phase competition in the growth of SrCoOx/LaAlO3 thin films

    Science.gov (United States)

    Zhang, Jie; Meng, Dechao; Huang, Haoliang; Cai, Honglei; Huang, Qiuping; Wang, Jianlin; Yang, Yuanjun; Zhai, Xiaofang; Fu, Zhengping; Lu, Yalin

    2018-02-01

    The reversible topotactic phase transformation between brownmillerite SrCoO2.5 to perovskite SrCoO3 has attracted more and more attention for potential applications as solid oxide fuels and electrolysis cells. However, the relatively easy transformation result from small thermal stable energy barriers between the two phases leads to unstable the structures. In the paper, amounts of SrCoO3-δ films have been prepared by pulsed laser deposition at optimized growth conditions with the temperature range of 590-720°C. The X-ray diffraction (XRD) results demonstrated that a phase competition emerged around 650°C. The Gibbs free energies of two phases at high temperature revealed the difference of stability of these two phases under different growth temperature. The optical spectroscopies and X-ray photoelectron spectroscopies were used to verify the electronic structure and chemical state differences between the two phases with distinct crystal structures.

  15. Entanglement growth during Van der Waals like phase transition

    Directory of Open Access Journals (Sweden)

    Hao Xu

    2017-09-01

    Full Text Available We address the problem of describing the coexistence state of two different black holes and Van der Waals like phase transition in Reissner–Nordström–AdS space–time. We start by a small charged black hole, then introduce a collapsing neutral thin-shell described by Vaidya metric to form a large one. The formation of the large black hole does not change the temperature and free energy of the initial state. We discuss the entanglement growing during the phase transition. The transition is always continuous and the saturation time is determined by the final state. It opens a possibility for studying the holography from excited states to excited states.

  16. Bubble nucleation and growth in slow cosmological phase transitions

    Science.gov (United States)

    Mégevand, Ariel; Ramírez, Santiago

    2018-03-01

    We study the dynamics of cosmological phase transitions in the case of small velocities of bubble walls, vw development of the phase transition. We consider different kinds of approximations and refinements for relevant aspects of the dynamics, such as the dependence of the wall velocity on hydrodynamics, the distribution of the latent heat, and the variation of the nucleation rate. Although in this case the common simplifications of a constant wall velocity and an exponential nucleation rate break down due to reheating, we show that a delta-function rate and a velocity which depends linearly on the temperature give a good description of the dynamics and allow to solve the evolution analytically. We also consider a Gaussian nucleation rate, which gives a more precise result for the bubble size distribution. We discuss the implications for the computation of cosmic remnants.

  17. A generalized-growth model to characterize the early ascending phase of infectious disease outbreaks

    OpenAIRE

    Viboud, C��cile; Simonsen, Lone; Chowell, Gerardo

    2016-01-01

    Background: A better characterization of the early growth dynamics of an epidemic is needed to dissect the important drivers of disease transmission, refine existing transmission models, and improve disease forecasts. Materials and methods: We introduce a 2-parameter generalized-growth model to characterize the ascending phase of an outbreak and capture epidemic profiles ranging from sub-exponential to exponential growth. We test the model against empirical outbreak data representing a var...

  18. The development of a growth regime map for a novel reverse-phase wet granulation process.

    Science.gov (United States)

    Wade, Jonathan B; Martin, Gary P; Long, David F

    2016-10-15

    The feasibility of a novel reverse-phase wet granulation process has been established and potential advantages identified. Granule growth in the reverse-phase process proceeds via a steady state growth mechanism controlled by capillary forces, whereas granule growth in the conventional process proceeds via an induction growth regime controlled by viscous forces. The resultant reverse-phase granules generally have greater mass mean diameter and lower intragranular porosity when compared to conventional granules prepared under the same liquid saturation and impeller speed conditions indicating the two processes may be operating under different growth regimes. Given the observed differences in growth mechanism and consolidation behaviour of the reverse-phase and conventional granules the applicability of the current conventional granulation regime map is unclear. The aim of the present study was therefore to construct and evaluate a growth regime map, which depicts the regime as a function of liquid saturation and Stokes deformation number, for the reverse-phase granulation process. Stokes deformation number was shown to be a good predictor of both granule mass mean diameter and intragranular porosity over a wide range of process conditions. The data presented support the hypothesis that reverse-phase granules have a greater amount of surface liquid present which can dissipate collision energy and resist granule rebound resulting in the greater granule growth observed. As a result the reverse-phase granulation process results in a greater degree of granule consolidation than that produced using the conventional granulation process. Stokes deformation number was capable of differentiating these differences in the granulation process. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. A Kinetic Model for GaAs Growth by Hydride Vapor Phase Epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Schulte, Kevin L.; Simon, John; Jain, Nikhil; Young, David L.; Ptak, Aaron J.

    2016-11-21

    Precise control of the growth of III-V materials by hydride vapor phase epitaxy (HVPE) is complicated by the fact that the growth rate depends on the concentrations of nearly all inputs to the reactor and also the reaction temperature. This behavior is in contrast to metalorganic vapor phase epitaxy (MOVPE), which in common practice operates in a mass transport limited regime where growth rate and alloy composition are controlled almost exclusively by flow of the Group III precursor. In HVPE, the growth rate and alloy compositions are very sensitive to temperature and reactant concentrations, which are strong functions of the reactor geometry. HVPE growth, particularly the growth of large area materials and devices, will benefit from the development of a growth model that can eventually be coupled with a computational fluid dynamics (CFD) model of a specific reactor geometry. In this work, we develop a growth rate law using a Langmuir-Hinshelwood (L-H) analysis, fitting unknown parameters to growth rate data from the literature that captures the relevant kinetic and thermodynamic phenomena of the HVPE process. We compare the L-H rate law to growth rate data from our custom HVPE reactor, and develop quantitative insight into reactor performance, demonstrating the utility of the growth model.

  20. Chirality-Dependent Vapor-Phase Epitaxial Growth and Termination of Single-Wall Carbon Nanotubes

    Science.gov (United States)

    Liu, Bilu; Liu, Jia; Zhou, Chongwu; USC nanolab Team

    2014-03-01

    Chirality-pure single-wall carbon nanotubes are highly desired for both fundamental study and many of their technological applications. Recently, we have shown that chirality-pure short nanotubes can be used as seeds for vapor-phase epitaxial cloning growth, opening up a new route toward chirality-controlled carbon nanotube synthesis. Nevertheless, the yield of vapor-phase epitaxial growth is rather limited at the present stage, due to the lack of mechanistic understanding of the process. Here we report chirality-dependent growth kinetics and termination mechanism for the vapor-phase epitaxial growth of seven single- chirality nanotubes of (9, 1), (6, 5), (8, 3), (7, 6), (10, 2), (6, 6), and (7, 7), covering near zigzag, medium chiral angle, and near armchair semiconductors, as well as armchair metallic nanotubes. Our results reveal that the growth rates of nanotubes increase with their chiral angles while the active lifetimes of the growth hold opposite trend. Consequently, the chirality distribution of a nanotube ensemble is jointly determined by both growth rates and lifetimes. These results correlate nanotube structures and properties with their growth behaviors and deepen our understanding of chirality-controlled growth of nanotubes.

  1. Multiphase flow and transport caused by spontaneous gas phase growth in the presence of dense non-aqueous phase liquid.

    Science.gov (United States)

    Roy, James W; Smith, James E

    2007-01-30

    Disconnected bubbles or ganglia of trapped gas may occur below the top of the capillary fringe through a number of mechanisms. In the presence of dense non-aqueous phase liquid (DNAPL), the disconnected gas phase experiences mass transfer of dissolved gases, including volatile components from the DNAPL. The properties of the gas phase interface can also change. This work shows for the first time that when seed gas bubbles exist spontaneous gas phase growth can be expected to occur and can significantly affect water-gas-DNAPL distributions, fluid flow, and mass transfer. Source zone behaviour was observed in three different experiments performed in a 2-dimensional flow cell. In each case, a DNAPL pool was created in a zone of larger glass beads over smaller glass beads, which served as a capillary barrier. In one experiment effluent water samples were analyzed to determine the vertical concentration profile of the plume above the pool. The experiments effectively demonstrated a) a cycle of spontaneous gas phase expansion and vertical advective mobilization of gas bubbles and ganglia above the DNAPL source zone, b) DNAPL redistribution caused by gas phase growth and mobilization, and c) that these processes can significantly affect mass transport from a NAPL source zone.

  2. A phase-field simulation of uranium dendrite growth on the cathode in the electrorefining process

    Science.gov (United States)

    Shibuta, Yasushi; Unoura, Seiji; Sato, Takumi; Shibata, Hiroki; Kurata, Masaki; Suzuki, Toshio

    2011-07-01

    The uranium dendrite growth on the cathode during the pyroprocessing of uranium is investigated using a novel phase-field model, in which electrodeposition of uranium and zirconium from the molten-salt is taken into account. The threshold concentration of zirconium in the molten salt demarcating the dendritic and planar growth is then estimated as a function of the current density. Moreover, the growth process of both the dendritic and planar electrodeposits has been demonstrated by way of varying the mobility of the phase field, which consists of the effect of attachment kinetics and diffusion.

  3. Defect-phase-dynamics approach to statistical domain-growth problem of clock models

    Science.gov (United States)

    Kawasaki, K.

    1985-01-01

    The growth of statistical domains in quenched Ising-like p-state clock models with p = 3 or more is investigated theoretically, reformulating the analysis of Ohta et al. (1982) in terms of a phase variable and studying the dynamics of defects introduced into the phase field when the phase variable becomes multivalued. The resulting defect/phase domain-growth equation is applied to the interpretation of Monte Carlo simulations in two dimensions (Kaski and Gunton, 1983; Grest and Srolovitz, 1984), and problems encountered in the analysis of related Potts models are discussed. In the two-dimensional case, the problem is essentially that of a purely dissipative Coulomb gas, with a sq rt t growth law complicated by vertex-pinning effects at small t.

  4. Growth hormone (GH) treatment increases serum insulin-like growth factor binding protein-3, bone isoenzyme alkaline phosphatase and forearm bone mineral content in young adults with GH deficiency of childhood onset

    DEFF Research Database (Denmark)

    Juul, A; Pedersen, S A; Sørensen, S

    1994-01-01

    Recent studies have demonstrated that growth hormone (GH)-deficient adults have a markedly decreased bone mineral content compared to healthy adults. However, there are conflicting results regarding the effects of GH treatment on bone mineral content in GH-deficient adults. Therefore, we evaluated...... the effect of GH treatment on a marker of bone formation (bone alkaline phosphatase), hepatic excretory function and distal forearm bone mineral content in GH-deficient adults. Growth hormone was administered subcutaneously in 21 adults (13 males and 8 females) with GH deficiency of childhood onset for 4...... months in a double-blind, placebo-controlled GH trial, while 13 of the patients then received further GH for an additional 14 months. Serum insulin-like growth factor I (IGF-I) increased significantly from 100 to 279 micrograms/l and IGF binding protein-3 (IGFBP-3) from 1930 to 3355 micrograms/l after 4...

  5. Growth hormone (GH) treatment increases serum insulin-like growth factor binding protein-3, bone isoenzyme alkaline phosphatase and forearm bone mineral content in young adults with GH deficiency of childhood onset

    DEFF Research Database (Denmark)

    Juul, A; Pedersen, S A; Sørensen, S

    1994-01-01

    the effect of GH treatment on a marker of bone formation (bone alkaline phosphatase), hepatic excretory function and distal forearm bone mineral content in GH-deficient adults. Growth hormone was administered subcutaneously in 21 adults (13 males and 8 females) with GH deficiency of childhood onset for 4......Recent studies have demonstrated that growth hormone (GH)-deficient adults have a markedly decreased bone mineral content compared to healthy adults. However, there are conflicting results regarding the effects of GH treatment on bone mineral content in GH-deficient adults. Therefore, we evaluated...... months in a double-blind, placebo-controlled GH trial, while 13 of the patients then received further GH for an additional 14 months. Serum insulin-like growth factor I (IGF-I) increased significantly from 100 to 279 micrograms/l and IGF binding protein-3 (IGFBP-3) from 1930 to 3355 micrograms/l after 4...

  6. Effect of vapor-phase oxygen on chemical vapor deposition growth of graphene

    Science.gov (United States)

    Terasawa, Tomo-o.; Saiki, Koichiro

    2015-03-01

    To obtain a large-area single-crystal graphene, chemical vapor deposition (CVD) growth on Cu is considered the most promising. Recently, the surface oxygen on Cu has been found to suppress the nucleation of graphene. However, the effect of oxygen in the vapor phase was not elucidated sufficiently. Here, we investigate the effect of O2 partial pressure (PO2) on the CVD growth of graphene using radiation-mode optical microscopy. The nucleation density of graphene decreases monotonically with PO2, while its growth rate reaches a maximum at a certain pressure. Our results indicate that PO2 is an important parameter to optimize in the CVD growth of graphene.

  7. Formation of a vitreous phase at the surface of some commercial diatomaceous earth prevents the onset of oxidative stress effects.

    Science.gov (United States)

    Ghiazza, Mara; Gazzano, Elena; Bonelli, Barbara; Fenoglio, Ivana; Polimeni, Manuela; Ghigo, Dario; Garrone, Edoardo; Fubini, Bice

    2009-01-01

    To understand the effect of the commercial processing of diatomaceous earths (DEs) on their ultimate surface structure and potential toxicity, we investigated the influence of the industrial processing and the nature of the deposit. Two flux calcined specimens from different deposits, DE/1-FC and DE/2-FC, and the simply calcined sample DE/1-C, from the same deposit as DE/1-FC, were compared in both their bulk and their surface properties. X-ray diffraction (XRD) analysis in a heating chamber revealed the presence of cristobalite in all samples, more abundant on the flux calcined ones. The crystal lattice is probably imperfect, as the alpha-beta transition, visible by XRD in DE/1-FC and DE/2-FC, is not detected by differential scanning calorimetry. Progressive etching with HF solutions suggests that most of the crystalline phase is at the core and not at the outer region of the samples. The combined use of spectroscopic (UV-vis and IR) and calorimetric techniques (heat of adsorption of water as a measure of hydrophilicity) reveals that DE/1-FC and DE/2-FC particles have an external layer of glass, absent in DE/1-C, where iron impurities act as network-forming and sodium ions as modifier species, with few patches of a hydrophobic phase, the latter relatable to a heated pure silica phase. When tested on a macrophage cell line (MH-S) in comparison with appropriate positive and negative controls (an active and an inactive quartz dust, respectively), only DE/1-C exhibited a cell damage and activation similar to that of active quartz (measured by lactate dehydrogenase release, peroxidation of membrane lipids and synthesis of NO). It is likely that the presence of a vitreous phase mitigates or even eliminates the cellular responses of silica in DE.

  8. Crystal growth of an organic non-linear optical material from the vapour phase

    International Nuclear Information System (INIS)

    Hou, W.

    1999-01-01

    Due to the potential applications of organic non-linear optical materials in the areas of optical processing and communication, the investigation of the crystal growth of new organic NLO materials has been an active field for the last 20 years. For such uses it is necessary to produce single crystals of high quality and perfection, free of strain and defects. When crystals are grown from the solution and the melt, solvent and the decomposition component in the melt can introduce impurities and imperfection to the as-grown crystals. For crystals grown from vapour phase, in the absence of the solvent, this cannot occur and the method promises to yield single crystals of higher quality. Despite this attraction, little attention has been paid to the vapour phase growth of organic NLO crystals. It was with this in mind that the following investigation was carried out. Using Methyl p-hydroxybenzoate (p-MHB), a potential organic NLO material, a comparison investigation was made of its crystal growth from both the vapour phase and solution; this included an examination of morphological assessment, structural perfection, surface morphology and growth kinetics of the as-grown crystals and the mass transport properties in the growth ampoule. Collation of this data allows the definition of the best conditions for vapour phase growth to produce specimens of high quality and purity. (author)

  9. Staged cultivation enhances biomass accumulation in the green growth phase of Haematococcus pluvialis.

    Science.gov (United States)

    Sun, Han; Liu, Bin; Lu, Xue; Cheng, Ka-Wing; Chen, Feng

    2017-06-01

    An innovative staged cultivation (SC) method was proposed to overcome the limiting factors associated with the growth of Haematococcus pluvialis in the green growth phase. This strategy led to a 1.16-fold increase in biomass concentration. Light wavelength, nutrient concentration and extracellular metabolite were identified to be key limiting factors when cells of H. pluvialis were in the low, medium, and high cell density sub-phase, respectively. A mix of red and white light (2:1) was demonstrated for the first time to accelerate cell growth in the low cell density sub-phase. Shortage of nutrients during the medium density sub-phase was overcome with a fed-batch approach maintained at stable pH, while the inhibitory effect of extracellular metabolites during the high density sub-phase was overcome with replacement cultivation. The findings of the present study suggest SC in the green growth phase may be a promising approach to significantly enhance biomass accumulation in culturing microalgae. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Bacterial Growth Phase Influences Methylmercury Production by the Sulfate-Reducing Bacterium Desulfovibrio desulfuricans ND132

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Abir [ORNL; Brooks, Scott C [ORNL; Miller, Carrie L [ORNL; Mosher, Jennifer J [ORNL; Yin, Xiangping Lisa [ORNL; Drake, Meghan M [ORNL

    2011-01-01

    The effect of bacterial growth phase is an aspect of mercury (Hg) methylation that previous studies have not investigated in detail. Here we consider the effect of growth phase (mid-log, late-log and late stationary phase) on Hg methylation by the known methylator Desulfovibrio desulfuricans ND132. We tested the addition of Hg alone (chloride-complex), Hg with Suwannee River natural organic matter (SRNOM) (unequilibrated), and Hg equilibrated with SRNOM on monomethylmercury (MMHg) production by ND132 over a growth curve in pyruvate-fumarate media. This NOM did not affect MMHg production even under very low Hg:SRNOM ratios, where Hg binding is predicted to be dominated by high energy sites. Adding Hg or Hg-NOM to growing cultures 24h before sampling (late addition) resulted in {approx}2x greater net fraction of Hg methylated than for comparably aged cultures exposed to Hg from the initial culture inoculation (early addition). Mid- and late-log phase cultures produced similar amounts of MMHg, but late stationary phase cultures (both under early and late Hg addition conditions) produced up to {approx}3x more MMHg, indicating the potential importance of growth phase in studies of MMHg production.

  11. Bacterial Growth Phase Influences Methylmercury Production by the Sulfate-Reducing Bacterium Desulfovibrio desulfuricans ND132

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Abir [ORNL; Brooks, Scott C [ORNL; Miller, Carrie L [ORNL; Mosher, Jennifer J [ORNL; Yin, Xiangping Lisa [ORNL; Drake, Meghan M [ORNL

    2011-01-01

    The effect of bacterial growth phase is an aspect of mercury (Hg) methylation that previous studies have not investigated in detail. Here we consider the effect of growth phase (mid-log, late-log and late stationary phase) on Hg methylation by the known methylator Desulfovibrio desulfuricans ND132. We tested the addition of Hg alone (chloride-complex), Hg with Suwannee River natural organic matter (SRNOM) (unequilibrated), and Hg equilibrated with SRNOM on monomethylmercury (MMHg) production by ND132 over a growth curve in pyruvate fumarate media. This NOM did not affect MMHg production even under very low Hg: SRNOM ratios, where Hg binding is predicted to be dominated by high energy sites. Adding Hg or Hg NOM to growing cultures 24 h before sampling (late addition) resulted in ~2 greater net fraction of Hg methylated than for comparably aged cultures exposed to Hg from the initial culture inoculation (early addition). Mid-and late-log phase cultures produced similar amounts of MMHg, but late stationary phase cultures (both under early and late Hg addition conditions) produced up to ~3 more MMHg, indicating the potential importance of growth phase in studies of MMHg production.

  12. Effect of algal growth phase on Aureococcus anophagefferens susceptibility to hydrogen peroxide

    International Nuclear Information System (INIS)

    Randhawa, Varunpreet; Thakkar, Megha; Wei, Liping

    2013-01-01

    Highlights: •Brown tide alga's susceptibility to H 2 O 2 was examined via growth and physiology responses. •The study was designed equalizing the influence of the media and cell density in test cultures. •Stationary cells was more sensitive to H 2 O 2 than exponential cells. •Stationary cells showed weaker non-protein thiol up-regulation than exponential cells. •Stationary cells mediated greater H 2 O 2 decomposition than exponential cells did. -- Abstract: A cell's growth phase could affect its susceptibility to a biocide in microbial control. This study examines the growth phase dependent susceptibility of a brown tide bloom alga Aureococcus anophagefferens to microbial biocide hydrogen peroxide (H 2 O 2 ). Test cultures of A. anophagefferens cells in exponential and stationary growth phase and similar initial cell density (1.6 × 10 6 cells mL −1 ) were exposed to 0.4–1.6 mg L −1 H 2 O 2 . Changes in algal growth (in vivo fluorescence, total chlorophyll a, and cell density), cell physiology (maximum quantum yield of photosystem II, and total intracellular non-protein thiols), and H 2 O 2 decomposition were quantified. Results show that the stationary phase cells are more susceptible to H 2 O 2 than the exponential phase cells, and this is attributed to the weaker ROS (reactive oxygen species) scavenging system and consequently greater cell damage in stationary phase cells. The stationary phase cells potentially require 30–40% less H 2 O 2 to reach 90% removal within 12 h of treatment as compared to the exponential phase cells. The results have practical implications in brown tide bloom control with respect to the timing and the dosage of H 2 O 2 application

  13. Practical modifications to the Time-to-Event Continual Reassessment Method for phase I cancer trials with fast patient accrual and late-onset toxicities

    Science.gov (United States)

    Polley, Mei-Yin C.

    2014-01-01

    The goal of phase I cancer trials is to determine the highest dose of a treatment regimen with an acceptable toxicity rate. Traditional designs for phase I trials, such as the Continual Reassessment Method (CRM) and the 3+3 design, require each patient or a cohort of patients to be fully evaluated for the dose-limiting toxicity (DLT) before new patients can be enrolled. As such, the trial duration may be prohibitively long. The Time-to-Event Continual Reassessment Method (TITE-CRM, Cheung and Chappell, 2000) circumvents this limitation by allowing staggered patient accrual without the need for complete DLT follow-up of previously treated patients. However, in the setting of fast patient accrual and late-onset toxicities, the TITE-CRM results in overly aggressive dose escalation and exposes a considerable number of patients to toxic doses. We examine a modification to the TITE-CRM proposed by the original TITE-CRM creator and propose an alternative approach useful in this setting by incorporating an accrual suspension rule. A simulation study designed based on a neuro-oncology trial indicates that the modified methods provide a much improved degree of safety than the TITE-CRM while maintaining desirable design accuracy. The practical aspects of the proposed designs are discussed. The modifications presented are useful when planning phase I trials involving chemoradiation therapy. PMID:21590790

  14. Dependence of growth of the phases of multiphase binary systems on the diffusion parameters

    Science.gov (United States)

    Molokhina, L. A.; Rogalin, V. E.; Filin, S. A.; Kaplunov, I. A.

    2017-12-01

    A mathematical model of the diffusion interaction of a binary system with several phases on the equilibrium phase diagram is presented. The theoretical and calculated dependences of the layer thickness of each phase in the multiphase diffusion zone on the isothermal annealing time and the ratio of the diffusion parameters in the neighboring phases with an unlimited supply of both components were constructed. The phase formation and growth in the diffusion zone during "reactive" diffusion corresponds to the equilibrium state diagram for two components, and the order of their appearance in the diffusion zone depends only on the ratio of the diffusion parameters in the phases themselves and on the duration of the incubation periods. The dependence of phase appearance on the incubation periods, annealing time, and difference in the movement rates of the components across the interface boundaries was obtained. An example of the application of the model for processing the experimental data on phase growth in a two-component three-phase system was given.

  15. A Novel Variant in CDKN1C Is Associated With Intrauterine Growth Restriction, Short Stature, and Early-Adulthood-Onset Diabetes

    Science.gov (United States)

    Kerns, Sarah L.; Andrew, Shayne; Geng, Juan; Guevara, Carolina; Guevara-Aguirre, Marco; Guo, Michael; Oddoux, Carole; Shen, Yiping; Zurita, Andres; Rosenfeld, Ron G.; Ostrer, Harry; Hwa, Vivian

    2014-01-01

    Context: CDKN1C, a cyclin-dependent kinase inhibitor and negative regulator of cellular proliferation, is paternally imprinted and has been shown to regulate β-cell proliferation. CDKN1C mutations are associated with growth disorders, including Beckwith-Wiedemann syndrome and IMAGe syndrome. Objective: To investigate the genetic basis for a familial disorder characterized by intrauterine growth restriction, short stature, and early-adulthood-onset diabetes. Design, Setting, and Participants: Genomic DNA samples (15 affected and 26 unaffected from a six-generation pedigree) were analyzed by genome-wide single nucleotide polymorphism arrays, whole exome and Sanger sequencing, and multiplex ligation-dependent probe amplification. Main Outcome Measure(s): Subjects were assessed for height, weight, adrenal gland size, ACTH, diabetes status, and testis volume. Linkage and sequence analyses were performed, and the identified genetic variant was functionally evaluated in reconstitution studies. Results: The pedigree followed a paternally imprinted pattern of inheritance, and genetic linkage analysis identified a single significant 2.6-megabase locus on chromosome 11p15, within the imprinting center region 2. Multiplex ligation-dependent probe amplification did not detect copy number variants or methylation abnormalities. Whole exome sequencing revealed a single novel variant in the proliferating cell nuclear antigen-binding region of CDKN1C (c.842G>T, p.R281I) that co-segregated with affected status and, unlike variants found in IMAGe, did not entirely abrogate proliferating cell nuclear antigen binding. Clinical assessments revealed that affected individuals had low testicular volume but normal adrenal function. Conclusions: We report a novel CDKN1C mutation associated with features of IMAGe syndrome, but without adrenal insufficiency or metaphyseal dysplasia, and characterized by early-adulthood-onset diabetes. Our data expand the range of phenotypes observed with CDKN1

  16. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  17. Phase-field model of vapor-liquid-solid nanowire growth

    Science.gov (United States)

    Wang, Nan; Upmanyu, Moneesh; Karma, Alain

    2018-03-01

    We present a multiphase-field model to describe quantitatively nanowire growth by the vapor-liquid-solid (VLS) process. The free-energy functional of this model depends on three nonconserved order parameters that distinguish the vapor, liquid, and solid phases and describe the energetic properties of various interfaces, including arbitrary forms of anisotropic γ plots for the solid-vapor and solid-liquid interfaces. The evolution equations for those order parameters describe basic kinetic processes including the rapid (quasi-instantaneous) equilibration of the liquid catalyst to a droplet shape with constant mean curvature, the slow incorporation of growth atoms at the droplet surface, and crystallization within the droplet. The standard constraint that the sum of the phase fields equals unity and the conservation of the number of catalyst atoms, which relates the catalyst volume to the concentration of growth atoms inside the droplet, are handled via separate Lagrange multipliers. An analysis of the model is presented that rigorously maps the phase-field equations to a desired set of sharp-interface equations for the evolution of the phase boundaries under the constraint of force balance at three-phase junctions (triple points) given by the Young-Herring relation that includes torque term related to the anisotropy of the solid-liquid and solid-vapor interface excess free energies. Numerical examples of growth in two dimensions are presented for the simplest case of vanishing crystalline anisotropy and the more realistic case of a solid-liquid γ plot with cusped minima corresponding to two sets of (10 ) and (11 ) facets. The simulations reproduce many of the salient features of nanowire growth observed experimentally, including growth normal to the substrate with tapering of the side walls, transitions between different growth orientations, and crawling growth along the substrate. They also reproduce different observed relationships between the nanowire growth

  18. The onset of quadrupole ordering at the structural phase transition in DyB sub 2 C sub 2

    CERN Document Server

    Tanaka, Y; Katsumata, K; Tamasaku, K; Ishikawa, T; Kawamura, N; Suzuki, M; Katori, H A; Lovesey, S W; Yamauchi, H; Onodera, H; Yamaguchi, Y

    2003-01-01

    X-ray diffraction and heat capacity data for DyB sub 2 C sub 2 are used to derive quantitative information about the structural phase transition at 24.7 K. A successful interpretation is achieved in terms of a continuous transition to a crystal structure belonging to the space group P4 sub 2 /mnm (No 136) that supports a motif of Dy 4f quadrupoles which belong to the A sub g representation of the point group C sub 2 sub h for the Dy site in the distorted structure. There is evidence in favour of the Ising universality class for the transition, including a critical exponent beta = 0.30 +- 0.02 and a near-logarithmic divergence of the heat capacity. (letter to the editor)

  19. Continuation of growth hormone therapy versus placebo in transition-phase patients with growth hormone deficiency

    DEFF Research Database (Denmark)

    Jørgensen, Jens; Nørrelund, Helene; Vahl, Nina

    2002-01-01

    In a placebo-controlled, parallel study of 18 patients with a mean age of 20 years who had confirmed growth hormone (GH) deficiency, we evaluated body composition, insulin sensitivity, and glucose turnover at baseline (when all were receiving GH replacement); after 12 months of continued GH therapy...

  20. Recent developments in Liquid Phase Electroepitaxial growth of bulk crystals under magnetic field

    Science.gov (United States)

    Dost, Sadik; Lent, Brian; Sheibani, Hamdi; Liu, Yongcai

    2004-05-01

    This review article presents recent developments in Liquid Phase Electroepitaxial (LPEE) growth of bulk single crystals of alloy semiconductors under an applied static magnetic field. The growth rate in LPEE is proportional to the applied electric current. However, at higher electric current levels the growth becomes unstable due to the strong convection occurring in the liquid zone. In order to address this problem, a significant body of research has been performed in recent years to suppress and control the natural convection for the purpose of prolonging the growth process to grow larger crystals. LPEE growth experiments show that the growth rate under an applied static magnetic field is also proportional and increases with the field intensity level. The modeling of LPEE growth under magnetic field was also the subject of interest. Two-dimensional mathematical models developed for the LPEE growth process predicted that the natural convection in the liquid zone would be suppressed almost completely with increasing the magnetic field level. However, experiments and also three-dimensional models have shown that there is an optimum magnetic field level below which the growth process is stable and the convection in the liquid zone is suppressed, but above such a field level the convective flow becomes very strong and leads to unstable growth with unstable interfaces. To cite this article: S. Dost et al., C. R. Mecanique 332 (2004).

  1. Acute-Phase Blood Pressure Levels Correlate With a High Risk of Recurrent Strokes in Young-Onset Ischemic Stroke.

    Science.gov (United States)

    Mustanoja, Satu; Putaala, Jukka; Gordin, Daniel; Tulkki, Lauri; Aarnio, Karoliina; Pirinen, Jani; Surakka, Ida; Sinisalo, Juha; Lehto, Mika; Tatlisumak, Turgut

    2016-06-01

    High blood pressure (BP) in acute stroke has been associated with a poor outcome; however, this has not been evaluated in young adults. The relationship between BP and long-term outcome was assessed in 1004 consecutive young, first-ever ischemic stroke patients aged 15 to 49 years enrolled in the Helsinki Young Stroke Registry. BP parameters included systolic (SBP) and diastolic BP, pulse pressure, and mean arterial pressure at admission and 24 hours. The primary outcome measure was recurrent stroke in the long-term follow-up. Adjusted for demographics and preexisting comorbidities, Cox regression models were used to assess independent BP parameters associated with outcome. Of our patients (63% male), 393 patients (39%) had prestroke hypertension and 358 (36%) used antihypertensive treatment. The median follow-up period was 8.9 years (interquartile range 5.7-13.2). Patients with a recurrent stroke (n=142, 14%) had significantly higher admission SBP, diastolic BP, pulse pressure, and mean arterial pressure (Pstroke. Patients with SBP ≥160 mm Hg compared with those with SBP strokes (hazard ratio 3.3 [95% confidence interval, 2.05-4.55]; Pstroke, while the 24-hour BP levels were not. In young ischemic stroke patients, high acute phase BP levels are independently associated with a high risk of recurrent strokes. © 2016 American Heart Association, Inc.

  2. Quantitative evaluation of normal and abnormal grain growth of cemented carbides during liquid phase sintering

    Science.gov (United States)

    Chabretou, V.; Lavergne, O.; Missiaen, J.-M.; Allibert, C. H.

    1999-04-01

    The liquid-phase sintering (LPS) of cemented carbides prepared from submicronic powders induces a micro-structural evolution generally ascribed to normal and abnormal grain growth. Such phenomena can be prevented by small additions of inhibitors (Cr, V). Presently, the mechanisms controlling either the grain growth or its inhibition are not strictly identified. In the present work, the effects of major parameters on grain growth (initial WC grain size, liquid composition, liquid fraction) are studied by image analysis of specimens sintered at 1450°C up to 8h.The evolution of the mean intercept and intercept distribution of WC grains is analysed in terms of the possible mechanisms involved.

  3. Randomized, double-blind, placebo-controlled phase 2 study of ganaxolone as add-on therapy in adults with uncontrolled partial-onset seizures.

    Science.gov (United States)

    Sperling, Michael R; Klein, Pavel; Tsai, Julia

    2017-04-01

    To evaluate the efficacy and safety of ganaxolone as adjunctive therapy in adults with uncontrolled partial-onset seizures despite taking up to three concomitant antiepileptic drugs (AEDs). Adults aged 18-69 years and refractory to conventional AEDs were enrolled in a multicenter, double-blind, placebo-controlled trial. After an 8-week baseline period, patients were randomized 2:1 to ganaxolone 1,500 mg/day or placebo for a 10-week treatment period (2-week forced titration and 8-week maintenance) followed by either tapering or entry into an open-label extension study. The primary endpoint was mean weekly seizure frequency. Secondary endpoints included the proportion of patients experiencing ≥50% reduction in seizure frequency (responder rate), percent change in mean weekly seizure frequency, seizure-free days, and quality of life. Safety and tolerability assessments included adverse events (AEs), treatment discontinuation, and clinical laboratory evaluations. Efficacy analyses were performed on the intent-to-treat population. Of 147 randomized patients (98 ganaxolone, 49 placebo), 131 completed the study; 95% of participants titrated up to 1,500 mg/day and 78% maintained this dose. From baseline to endpoint, mean weekly seizure frequency decreased with ganaxolone (6.5-5.2) versus placebo (9.2-10.8), representing an 11.4% decrease versus placebo (p = 0.0489, analysis of covariance [ANCOVA]). Mean percent change from baseline was -17.6% with ganaxolone versus 2.0% with placebo (p = 0.0144, Kruskal-Wallis test). Responder rates were 24% with ganaxolone versus 15% with placebo (p = 0.19). Discontinuation due to adverse events was similar with ganaxolone (7.1%) and placebo (6.1%). Common adverse events were mild to moderate in severity and included dizziness (16.3% vs. 8.2%), fatigue (16.3% vs. 8.2%), and somnolence (13.3% vs. 2.0%). Ganaxolone 1,500 mg/day reduced partial-onset seizure frequency and was generally safe and well tolerated in this phase 2

  4. Impact of salinity and growth phase on alkenone distributions in coastal haptophytes

    NARCIS (Netherlands)

    Chivall, D.; M'Boule, D.; Sinke-Schoen, D.; Sinninghe Damsté, J.S.; Schouten, S.; van der Meer, M.T.J.

    2014-01-01

    Batch cultures of Isochrysis galbana (strain CCMP 1323) and Chrysotila lamellosa (strain CCMP 1307) were grown at salinity values of ca. 10 to ca. 35 and the alkenone distributions determined for different growth phases. U-37(K ') values decreased slightly with salinity for C. lamellosa but were

  5. A study on fatigue crack growth in dual phase martensitic steel in air

    Indian Academy of Sciences (India)

    Dual phase (DP) steel was intercritically annealed at different temperatures from fully martensitic state to achieve martensite plus ferrite, microstructures with martensite contents in the range of 32 to 76%. Fatigue crack growth (FCG) and fracture toughness tests were carried out as per ASTM standards E 647 and E 399, ...

  6. Composition of essential oil of costmary [Balsamita major (L.) Desf.] at different growth phases

    NARCIS (Netherlands)

    Bylaite, E.; Venskutonis, R.; Roozen, J.P.; Posthumus, M.A.

    2000-01-01

    The essential oils from leaves and flowers of costmary, Balsamita major (L.) Desf. (syn. Chrysanthemum balsamita L.), were analyzed at various phases of plant growth. The highest contents of oil both in leaves and in flowers were determined before full blooming, 1.15 and 1.34øw/w), respectively.

  7. Bulk water phase and biofilm growth in drinking water at low nutrient conditions

    DEFF Research Database (Denmark)

    Boe-Hansen, Rasmus; Albrechtsen, Hans-Jørgen; Arvin, Erik

    2002-01-01

    , and cell-specific leucine incorporation rate. Bacteria in the bulk water phase incubated without the presence of biofilmexhibited a bacterial growth rate of 0.30 day1. The biofilmwas radioactively labelled by the addition of 14C-benzoic acid. Subsequently, a biofilmdetachm ent rate of 0.013 day1...

  8. Investigations on the growth kinetics of Laves phase precipitates in 12% Cr creep-resistant steels: Experimental and DICTRA calculations

    International Nuclear Information System (INIS)

    Prat, O.; Garcia, J.; Rojas, D.; Carrasco, C.; Inden, G.

    2010-01-01

    The growth kinetics of Laves phase precipitates (type Fe 2 W) in the early stage of creep (650 deg. C for 10,000 h) in two 12% Cr ferrite-martensitic steels has been investigated. In one alloy the Laves phase formed on tempering, while in the second alloy the Laves phase precipitated during creep. Kinetic simulations were performed using the software DICTRA. The particle size of the Laves phase was measured on transmission electron microscopy samples. The equilibrium phase fraction of the Laves phase was reached in the first thousand hours. Simulations of particle growth showed good agreement with the experimental results. Competitive growth between M 23 C 6 and the Laves phase showed that M 23 C 6 carbides reached their equilibrium after 12 days, whereas the Laves phase reached equilibrium after 3 months. Simulations of the influence of the interfacial energy and addition of Co, Cu and Si on Laves phase precipitation are presented.

  9. Enamel defect of primary dentition in SGA children in relation to onset time of intrauterine growth disturbance

    Directory of Open Access Journals (Sweden)

    Willyanti Soewondo Sjarif

    2013-06-01

    Full Text Available Background: Prenatal disturbances disturb the development of organs resulting in small for gestational age (SGA babies and also causes enamel defects in primary teeth. There are disturbances occur in the beginning of pregnancy causing symmetrical SGA, and asymmetrical type of SGA, where the disturbances occur late in pregnancy. Purpose: This research was to determined differences in severity of enamel defect of primary dentition in small for gestational age children based on the time of intrauterine growth restriction. Methods: This was a clinical epidemiological cohort study. The Ponderal index was used to determine SGA type. The subjects were 129 SGA children aged 9-42 months, 82 with asymmetrical SGA and 47 with symmetrical SGA. Two hundred normal birth weight children were the control group. Intra-oral examinations to determine enamel defect used the FDI modification of the Developmental Defect of Enamel score at 3 months intervals. Statistical t-tests were used to test the difference in severity of enamel defect, and chisquare to find out the difference of Relative Risk Ratio (RRR. Results: The results showed that the enamel defect scores of symmetrical SGA were significantly higher than those with asymmetrical SGA. RRR for severe defect was also significantly higher in symmetrical type for anterior and canines. Conclusion: The study suggested that the severity of enamel defect for infants with symmetrical SGA was higher than those with asymmetrical SGA, indicating that the severity of the defect occurs in the beginning of pregnancy is more severe than in the late pregnancy.Latar belakang: Adanya gangguan prenatal mengganggu perkembangan organ, mengakibatkan terjadinya bayi lahir dengan kecil masa kehamilan (KMK dan defek email pada gigi sulung. Terdapat 2 tipe KMK yaitu tipe simetri; gangguan terjadi pada awal kehamilan; dimana lingkar kepala, berat dan panjang lahir lebih rendah dari normal. Tipe asimetri dimana gangguan terjadi saat

  10. Silicon thin film growth by low temperature liquid phase epitaxy for photovoltaic applications

    International Nuclear Information System (INIS)

    Abdo, F.

    2007-03-01

    In this thesis is presented an economic, clean and innovating way to carry out silicon substrate in thin layer for photovoltaic applications. It is based on layer growth by low temperature liquid phase epitaxy on silicon substrates embrittled by ion implantation. The aim of this work is to find experimental conditions to decrease the epitaxy temperature (≤800 C instead of 1050 C) while conserving a relatively high growth velocity. An innovating method has been implemented; it consists to use two different baths: the first one Al-Sn-Si allows to de-oxidize the silicon substrate surface without using hydrogen and the second one containing Sn-Si allows the growth of a thick layer of silicon. Uniform layers of a thickness of 15μm have been obtained after three hours of growth. Thermodynamic studies exploiting the phase diagrams of ternary or quaternary mixtures have been carried out to reach high growth velocity. Tin and copper based alloys have been chosen, tin for lowering the temperature and copper for increasing the silicon solubility. Layers of 30 μm have been obtained after two hours of growth. It has been shown too that this epitaxy step could be compatible with the technology of ion implantation embrittlement. (O.M.)

  11. Phase competition in the growth of SrCoOx/LaAlO3 thin films

    Directory of Open Access Journals (Sweden)

    Jie Zhang

    2018-02-01

    Full Text Available The reversible topotactic phase transformation between brownmillerite SrCoO2.5 to perovskite SrCoO3 has attracted more and more attention for potential applications as solid oxide fuels and electrolysis cells. However, the relatively easy transformation result from small thermal stable energy barriers between the two phases leads to unstable the structures. In the paper, amounts of SrCoO3-δ films have been prepared by pulsed laser deposition at optimized growth conditions with the temperature range of 590-720°C. The X-ray diffraction (XRD results demonstrated that a phase competition emerged around 650°C. The Gibbs free energies of two phases at high temperature revealed the difference of stability of these two phases under different growth temperature. The optical spectroscopies and X-ray photoelectron spectroscopies were used to verify the electronic structure and chemical state differences between the two phases with distinct crystal structures.

  12. Do rapid BMI growth in childhood and early-onset obesity offer cardiometabolic protection to obese adults in mid-life? Analysis of a longitudinal cohort study of Danish men.

    Science.gov (United States)

    Howe, Laura D; Zimmermann, Esther; Weiss, Ram; Sørensen, Thorkild I A

    2014-04-15

    Some obese individuals have no cardiometabolic abnormalities; they are 'metabolically healthy, but obese' (MHO). Similarly, some non-obese individuals have cardiometabolic abnormalities, that is, 'metabolically at risk, normal weight' (MANW). Previous studies have suggested that early-onset obesity may be associated with MHO. We aimed to assess whether body mass index (BMI) in childhood and early-onset obesity are associated with MHO. General population longitudinal cohort study, Denmark. From 362 200 young men (mean age 20) examined for Danish national service between 1943 and 1977, all obese men (BMI ≥31 kg/m(2), N=1930) were identified along with a random 1% sample of the others (N=3601). Our analysis includes 2392 of these men attending a research clinic in mid-life (mean age 42). For 613 of these men, data on childhood BMI are available. We summarised childhood BMI growth (7-13 years) using a multilevel model. Early-onset obesity was defined as obesity at examination for national service. We defined metabolic health at the mid-life clinic as non-fasting serum cholesterol obesity (BMI ≥30 kg/m(2)) and metabolic health in mid-life. 297 of 1097 (27.1%) of obese men were metabolically healthy; 826 of 1295 (63.8%) non-obese men had at least one metabolic abnormality. There was no evidence that rapid BMI growth in childhood or early-onset obesity was associated with either MHO or the MANW phenotype, for example, among obese men in mid-life, the OR for MHO comparing early-onset obesity with non-early-onset obesity was 0.97 (95% CI 0.85 to 1.10). We found no robust evidence that early-onset obesity or rapid BMI growth in childhood is protective for cardiometabolic health.

  13. Phase-field study of crystal growth in three-dimensional capillaries: Effects of crystalline anisotropy

    Science.gov (United States)

    Debierre, Jean-Marc; Guérin, Rahma; Kassner, Klaus

    2016-07-01

    Phase-field simulations are performed to explore the thermal solidification of a pure melt in three-dimensional capillaries. Motivated by our previous work for isotropic or slightly anisotropic materials, we focus here on the more general case of anisotropic materials. Different channel cross sections are compared (square, hexagonal, circular) to reveal the influence of geometry and the effects of a competition between the crystal and the channel symmetries. In particular, a compass effect toward growth directions favored by the surface energy is identified. At given undercooling and anisotropy, the simulations generally show the coexistence of several growth modes. The relative stability of these growth modes is tested by submitting them to a strong spatiotemporal noise for a short time, which reveals a subtle hierarchy between them. Similarities and differences with experimental growth modes in confined geometry are discussed qualitatively.

  14. STRIDER: Sildenafil Therapy In Dismal prognosis Early-onset intrauterine growth Restriction--a protocol for a systematic review with individual participant data and aggregate data meta-analysis and trial sequential analysis

    NARCIS (Netherlands)

    Ganzevoort, Wessel; Alfirevic, Zarko; von Dadelszen, Peter; Kenny, Louise; Papageorghiou, Aris; van Wassenaer-Leemhuis, Aleid; Gluud, Christian; Mol, Ben Willem; Baker, Philip N.

    2014-01-01

    In pregnancies complicated by early-onset extreme fetal growth restriction, there is a high risk of preterm birth and an overall dismal fetal prognosis. Sildenafil has been suggested to improve this prognosis. The first aim of this review is to assess whether sildenafil benefits or harms these

  15. Theory and modeling of microstructural evolution in polycrystalline materials: Solute segregation, grain growth and phase transformations

    Science.gov (United States)

    Ma, Ning

    2005-11-01

    To accurately predict microstructure evolution and, hence, to synthesis metal and ceramic alloys with desirable properties involves many fundamental as well as practical issues. In the present study, novel theoretical and phase field approaches have been developed to address some of these issues including solute drag and segregation transition at grain boundaries and dislocations, grain growth in systems of anisotropic boundary properties, and precipitate microstructure development in polycrystalline materials. The segregation model has allowed for the prediction of a first-order segregation transition, which could be related to the sharp transition of solute concentration of grain boundary as a function of temperature. The incorporating of interfacial energy and mobility as functions of misorientation and inclination in the phase field model has allowed for the study of concurrent grain growth and texture evolution. The simulation results were analyzed using the concept of local grain boundary energy density, which simplified significantly the development of governing equations for texture controlled grain growth in Ti-6Al-4V. Quantitative phase field modeling techniques have been developed by incorporating thermodynamic and diffusivity databases. The models have been validated against DICTRA simulations in simple 1D problems and applied to simulate realistic microstructural evolutions in Ti-6Al-4V, including grain boundary a and globular a growth and sideplate development under both isothermal aging and continuous cooling conditions. The simulation predictions agree well with experimental observations.

  16. Epitaxial growth of Ge-Sb-Te based phase change materials

    Energy Technology Data Exchange (ETDEWEB)

    Perumal, Karthick

    2013-07-30

    Ge-Sb-Te based phase change materials are considered as a prime candidate for optical and electrical data storage applications. With the application of an optical or electrical pulse, they can be reversibly switched between amorphous and crystalline state, thereby exhibiting large optical and electrical contrast between the two phases, which are then stored as information in the form of binary digits. Single crystalline growth is interesting from both the academic and industrial perspective, as ordered Ge-Sb-Te based metamaterials are known to exhibit switching at reduced energies. The present study deals with the epitaxial growth and analysis of Ge-Sb-Te based thin films. The first part of the thesis deals with the epitaxial growth of GeTe. Thin films of GeTe were grown on highly mismatched Si(111) and (001) substrates. On both the substrate orientations the film grows along [111] direction with an amorphous-to-crystalline transition observed during the initial stages of growth. The amorphous-to-crystalline transition was studied in-vivo using azimuthal reflection high-energy electron diffraction scans and grazing incidence X-ray diffraction. In the second part of the thesis epitaxy and characterization of Sb{sub 2}Te{sub 3} thin films are presented. The third part of the thesis deals with the epitaxy of ternary Ge-Sb-Te alloys. The composition of the films are shown to be highly dependent on growth temperatures and vary along the pseudobinary line from Sb{sub 2}Te{sub 3} to GeTe with increase in growth temperatures. A line-of-sight quadrupole mass spectrometer was used to reliably control the GeSbTe growth temperature. Growth was performed at different Ge, Sb, Te fluxes to study the compositional variation of the films. Incommensurate peaks are observed along the [111] direction by X-ray diffraction. The possibility of superstructural vacancy ordering along the [111] direction is discussed.

  17. Epitaxial growth of Ge-Sb-Te based phase change materials

    International Nuclear Information System (INIS)

    Perumal, Karthick

    2013-01-01

    Ge-Sb-Te based phase change materials are considered as a prime candidate for optical and electrical data storage applications. With the application of an optical or electrical pulse, they can be reversibly switched between amorphous and crystalline state, thereby exhibiting large optical and electrical contrast between the two phases, which are then stored as information in the form of binary digits. Single crystalline growth is interesting from both the academic and industrial perspective, as ordered Ge-Sb-Te based metamaterials are known to exhibit switching at reduced energies. The present study deals with the epitaxial growth and analysis of Ge-Sb-Te based thin films. The first part of the thesis deals with the epitaxial growth of GeTe. Thin films of GeTe were grown on highly mismatched Si(111) and (001) substrates. On both the substrate orientations the film grows along [111] direction with an amorphous-to-crystalline transition observed during the initial stages of growth. The amorphous-to-crystalline transition was studied in-vivo using azimuthal reflection high-energy electron diffraction scans and grazing incidence X-ray diffraction. In the second part of the thesis epitaxy and characterization of Sb 2 Te 3 thin films are presented. The third part of the thesis deals with the epitaxy of ternary Ge-Sb-Te alloys. The composition of the films are shown to be highly dependent on growth temperatures and vary along the pseudobinary line from Sb 2 Te 3 to GeTe with increase in growth temperatures. A line-of-sight quadrupole mass spectrometer was used to reliably control the GeSbTe growth temperature. Growth was performed at different Ge, Sb, Te fluxes to study the compositional variation of the films. Incommensurate peaks are observed along the [111] direction by X-ray diffraction. The possibility of superstructural vacancy ordering along the [111] direction is discussed.

  18. Fitness Impact of Obligate Intranuclear Bacterial Symbionts Depends on Host Growth Phase.

    Science.gov (United States)

    Bella, Chiara; Koehler, Lars; Grosser, Katrin; Berendonk, Thomas U; Petroni, Giulio; Schrallhammer, Martina

    2016-01-01

    According to text book definition, parasites reduce the fitness of their hosts whereas mutualists provide benefits. But biotic and abiotic factors influence symbiotic interactions, thus under certain circumstances parasites can provide benefits and mutualists can harm their host. Here we addressed the question which intrinsic biotic factors shape a symbiosis and are crucial for the outcome of the interaction between the obligate intranuclear bacterium Holospora caryophila ( Alphaproteobacteria; Rickettsiales ) and its unicellular eukaryotic host Paramecium biaurelia (Alveolata; Ciliophora). The virulence of H. caryophila , i.e., the negative fitness effect on host division and cell number, was determined by growth assays of several P. biaurelia strains. The performances of genetically identical lines either infected with H. caryophila or symbiont-free were compared. Following factors were considered as potentially influencing the outcome of the interaction: (1) host strain, (2) parasite strain, and (3) growth phases of the host. All three factors revealed a strong effect on the symbiosis. In presence of H. caryophila , the Paramecium density in the stationary growth phase decreased. Conversely, a positive effect of the bacteria during the exponential phase was observed for several host × parasite combinations resulting in an increased growth rate of infected P. biaurelia . Furthermore, the fitness impact of the tested endosymbionts on different P. biaurelia lines was not only dependent on one of the two involved strains but distinct for the specific combination. Depending on the current host growth phase, the presence of H. caryophila can be harmful or advantageous for P. biaurelia . Thus, under the tested experimental conditions, the symbionts can switch from the provision of benefits to the exploitation of host resources within the same host population and a time-span of less than 6 days.

  19. The extracellular proteome of Rhizobium etli CE3 in exponential and stationary growth phase

    Directory of Open Access Journals (Sweden)

    Mendoza-Hernández Guillermo

    2010-10-01

    Full Text Available Abstract Background The extracellular proteome or secretome of symbiotic bacteria like Rhizobium etli is presumed to be a key element of their infection strategy and survival. Rhizobia infect the roots of leguminous plants and establish a mutually beneficial symbiosis. To find out the possible role of secreted proteins we analyzed the extracellular proteome of R. etli CE3 in the exponential and stationary growth phases in minimal medium, supplemented with succinate-ammonium. Results The extracellular proteins were obtained by phenol extraction and identified by LC-ESI MS/MS. We identified 192 and 191 proteins for the exponential and stationary phases respectively. Using the software Signal P, we predicted signal peptides for 12.95% and 35.60% of the proteins identified in the exponential and stationary phases, respectively, which could therefore be secreted by the Sec pathway. For the exponential growth phase, we found in abundance proteins like the ribosomal proteins, toxins and proteins belonging to the group "defence mechanisms". For the stationary growth phase, we found that the most abundant proteins were those with unknown function, and in many of these we identified characteristic domains of proteases and peptidases. Conclusions Our study provided the first dataset of the secretome of R. etli and its modifications, which may lead to novel insights into the adaptive response of different stages of growth. In addition, we found a high number of proteins with unknown function; these proteins could be analyzed in future research to elucidate their role in the extracellular proteome of R. etli.

  20. Application of growth-phase based light-feeding strategies to simultaneously enhance Chlorella vulgaris growth and lipid accumulation.

    Science.gov (United States)

    Sun, Yahui; Liao, Qiang; Huang, Yun; Xia, Ao; Fu, Qian; Zhu, Xun; Fu, Jingwei; Li, Jun

    2018-05-01

    Considering the variations of optimal light intensity required by microalgae cells along with growth phases, growth-phase light-feeding strategies were proposed and verified in this paper, aiming at boosting microalgae lipid productivity from the perspective of light conditions optimization. Experimental results demonstrate that under an identical time-averaged light intensity, the light-feeding strategies characterized by stepwise incremental light intensities showed a positive effect on biomass and lipid accumulation. The lipid productivity (235.49 mg L -1  d -1 ) attained under light-feeding strategy V (time-averaged light intensity: 225 μmol m -2  s -1 ) was 52.38% higher over that obtained under a constant light intensity of 225 μmol m -2  s -1 . Subsequently, based on light-feeding strategy V, microalgae lipid productivity was further elevated to 312.92 mg L -1  d -1 employing a two-stage based light-feeding strategy V 560 (time-averaged light intensity: 360 μmol m -2  s -1 ), which was 79.63% higher relative to that achieved under a constant light intensity of 360 μmol m -2  s -1 . Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. The effect of the Growth Phase of Staphylococcus aureus on Resistance to Disinfectants in a Suspension Test

    NARCIS (Netherlands)

    Luppens, S.B.I.; Rombouts, F.M.; Abee, T.

    2002-01-01

    The influence of growth phase on the resistance of Staphylococcus aureus to the surface-active agents benzalkonium chloride and dodecylbenzyl sulfonic acid and the oxidizing agents sodium hypochlorite and hydrogen peroxide was studied. The resistances of cells in different growth phases were

  2. Soy isoflavone exposure through all life stages accelerates 17β-estradiol-induced mammary tumor onset and growth, yet reduces tumor burden, in ACI rats.

    Science.gov (United States)

    Möller, Frank Josef; Pemp, Daniela; Soukup, Sebastian T; Wende, Kathleen; Zhang, Xiajie; Zierau, Oliver; Muders, Michael H; Bosland, Maarten C; Kulling, Sabine E; Lehmann, Leane; Vollmer, Günter

    2016-08-01

    There is an ongoing debate whether the intake of soy-derived isoflavones (sISO) mediates beneficial or adverse effects with regard to breast cancer risk. Therefore, we investigated whether nutritional exposure to a sISO-enriched diet from conception until adulthood impacts on 17β-estradiol (E2)-induced carcinogenesis in the rat mammary gland (MG). August-Copenhagen-Irish (ACI) rats were exposed to dietary sISO from conception until postnatal day 285. Silastic tubes containing E2 were used to induce MG tumorigenesis. Body weight, food intake, and tumor growth were recorded weekly. At necropsy, the number, position, size, and weight of each tumor were determined. Plasma samples underwent sISO analysis, and the morphology of MG was analyzed. Tumor incidence and multiplicity were reduced by 20 and 56 %, respectively, in the sISO-exposed rats compared to the control rats. Time-to-tumor onset was shortened from 25 to 20 weeks, and larger tumors developed in the sISO-exposed rats. The histological phenotype of the MG tumors was independent of the sISO diet received, and it included both comedo and cribriform phenotypes. Morphological analyses of the whole-mounted MGs also showed no diet-dependent differences. Lifelong exposure to sISO reduced the overall incidence of MG carcinomas in ACI rats, although the time-to-tumor was significantly shortened.

  3. Toward a tandem gallium phosphide on silicon solar cell through liquid phase epitaxy growth

    International Nuclear Information System (INIS)

    Kotulak, Nicole A.; Diaz, Martin; Barnett, Allen; Opila, Robert L.

    2014-01-01

    Three layers of GaP were epitaxially grown on Si(111) using liquid phase epitaxy (LPE) to demonstrate a path to fabrication of a GaP/Si tandem solar cell. Utilizing a Sn melt with Bi, Mg, and Si additives, direct epitaxial growth on a Si substrate occurred. This was followed by two further epitaxial growths, eliminating Si in the melt, with each layer decreasing in Si concentration. Scanning electron and optical microscopy and electron dispersive spectroscopy were performed in order to determine the characteristics of the growth layers. A fourth layer growth of GaP was attempted utilizing a Ga melt, and the existing structure was able to withstand contact with Ga without dissolution. Epitaxial layers of GaP with a decrease in Si concentration from 10-15% to 6%, then to less than 3%, were accomplished, thereby demonstrating a path to fabrication of a GaP/Si tandem cell using LPE. - Highlights: • A path to a GaP/Si tandem solar cell device was developed using liquid phase epitaxy. • Due to the high solubility of Si in GaP, multiple layers of GaP were grown. • Each epitaxial layer required the development of specific growth conditions

  4. Role of microorganism growth phase in the accumulation and characteristics of biomacromolecules (BMM) in a membrane bioreactor

    DEFF Research Database (Denmark)

    Zhou, Zhongbo; Meng, Fangang; Liang, Shuang

    2012-01-01

    The objective of this study was to highlight the significance of microorganism growth on the production of biomacromolecules (BMM) in a membrane bioreactor (MBR). During the MBR operation, both polysaccharides and proteins in the sludge supernatant were found to increase steadily in exponential...... growth phase (EGP) due to higher organic loading rates and microbial primary metabolism. Subsequently, both increased continuously and then decreased sharply in the following deceleration growth phase (DGP). Finally, the BMM maintained a low and steady level as the sludge reached stationary growth phase...

  5. Fundamental Studies on High Temperature Deformation Recrystallization, and Grain Growth of Two-Phase Materials.

    Science.gov (United States)

    1988-01-01

    trolling the growth process at 9730 K. Details of the investigation and various growth mod- els of ot-p Titanium alloys are presented. G. Grewal is a...ENERGY PLOTS OF PARTICLE AND MATRIX PHASES IN CLASS 2 MICROSTRUCTURES. 𔃽- .3 ŗ 3- 3’...’ ’.3 I 3’..3 3. 69 J. f % F% a. LL 1 6 a D Q L . L EL -. -e LI... TiFO V :"ALLOYS. THE ALOYS WERE ANNEALEDFOVARIOUS TIMES AT 1023 K W. . -,: 79 o, : ’- 3€ ’."- .’-E -’t’t

  6. Analysis of the effect on growth kinetics of gamma prima phase in Inconel 713C alloys

    International Nuclear Information System (INIS)

    Thorp, S.I.; Versaci, R.A.; Ges, A.; Palacio, H.A.

    1993-01-01

    This work shows the analysis of the effect on growth kinetics of gamma prima phase in Inconel 713C alloy of two thermic treatments. In this study, SEM are used and the results are analyzed by means of the theory developed by Lifshitz, Slyozov and Wagner (LSW theory). The findings have revealed that with such theory it is not possible to determine if the process of growth is controlled either through diffusion or through diffusion in the interface as to the time employed in the experiment (2600 hours); the time required is approximately 10000 hours. (Author)

  7. The Effects of Temperature and Growth Phase on the Lipidomes of Sulfolobus islandicus and Sulfolobus tokodaii

    DEFF Research Database (Denmark)

    Jensen, Sara Munk; Neesgaard, Vinnie Lund; Skjoldbjerg, Sandra Landbo Nedergaard

    2015-01-01

    The functionality of the plasma membrane is essential for all organisms. Adaption to high growth temperatures imposes challenges and Bacteria, Eukarya, and Archaea have developed several mechanisms to cope with these. Hyperthermophilic archaea have earlier been shown to synthesize tetraether...... at three different temperatures, with samples withdrawn during lag, exponential, and stationary phases. Three abundant tetraether lipid classes and one diether lipid class were monitored. Beside the expected increase in the number of cyclopentane moieties with higher temperature in both archaea, we...... observed previously unreported changes in the average cyclization of the membrane lipids throughout growth. The average number of cyclopentane moieties showed a significant dip in exponential phase, an observation that might help to resolve the currently debated biosynthesis pathway of tetraether lipids....

  8. Chirality-Controlled Growth of Single-Wall Carbon Nanotubes Using Vapor Phase Epitaxy: Mechanistic Understanding and Scalable Production

    Science.gov (United States)

    2016-09-15

    AFRL-AFOSR-VA-TR-2016-0319 Chirality-Controlled Growth of Single -Wall Carbon Nanotubes Using Vapor Phase Epitaxy: Mechanistic Understanding and...controlled growth of single -wall carbon nanotubes using vapor phase epitaxy: mechanistic understanding and scalable production FA9550-14-1-0115 Zhou...controlled synthesis of single -wall carbon nanotubes. Firstly, we have successfully demonstrated a vapor-phase-epitaxy-analogous general strategy for

  9. Mechanism of growth reduction of the deceleration-phase ablative Rayleigh-Taylor instability

    International Nuclear Information System (INIS)

    Atzeni, Stefano; Temporal, Mauro

    2003-01-01

    The deceleration-phase (dp) ablative Rayleigh-Taylor instability (RTI) of igniting and nonigniting inertial fusion capsules is studied by high-resolution two-dimensional Lagrangian fluid simulations. It is found that growth reduction of the dp-RTI with respect to classical RTI results from the advection of perturbed fluid elements outside a thin unstable fluid layer. Within this layer, at fixed Lagrangian position, perturbations grow approximately classically

  10. Growth of second phase particles in a copper--beryllium alloy. Final technical report

    International Nuclear Information System (INIS)

    Bunch, R.; Wells, R.; Mukherjee, A.K.

    1977-01-01

    Growth of second phase particles from a solid solution of copper-beryllium was studied to determine this alloy's suitability for acoustic emission testing. Optical and Scanning Electron microscopes were used to study the microstructure. Micro and macro hardness tests were also performed. A hardness curve for aging at 550 0 F was determined. Microscopic examination revealed the presence of large inclusions which make this alloy unsuitable for the acoustic tests envisioned

  11. Theoretical Studies of Gas Phase Elementary and Carbon Nanostructure Growth Reactions

    Science.gov (United States)

    2013-09-19

    photodissociation reactions of ketene, methylamine, formic acid , methyl ethyl ketone, acetone and NO3. For instance, for NO3, a totally unknown...to photodissociation reactions of ketene, methylamine, formic acid , methyl ethyl ketone, acetone and NO3. For instance, for NO3, a totally unknown...THEORETICAL STUDIES OF GAS PHASE ELEMENTARY AND CARBON NANOSTRUCTURE GROWTH REACTIONS KEIJI MOROKUMA EMORY UNIVERSITY 09/19/2013 Final Report

  12. High Growth Rate Hydride Vapor Phase Epitaxy at Low Temperature through Use of Uncracked Hydrides

    Energy Technology Data Exchange (ETDEWEB)

    Schulte, Kevin L [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Simon, John D [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Ptak, Aaron J [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Braun, Anna [Rose-Hulman Institute of Technology

    2018-01-22

    We demonstrate hydride vapor phase epitaxy (HVPE) of GaAs with unusually high growth rates (RG) at low temperature and atmospheric pressure by employing a hydride-enhanced growth mechanism. Under traditional HVPE growth conditions that involve growth from Asx species, RG exhibits a strong temperature dependence due to slow kinetics at the surface, and growth temperatures >750 degrees C are required to obtain RG > 60 um/h. We demonstrate that when the group V element reaches the surface in a hydride, the kinetic barrier is dramatically reduced and surface kinetics no longer limit RG. In this regime, RG is dependent on mass transport of uncracked AsH3 to the surface. By controlling the AsH3 velocity and temperature profile of the reactor, which both affect the degree of AsH3 decomposition, we demonstrate tuning of RG. We achieve RG above 60 um/h at temperatures as low as 560 degrees C and up to 110 um/h at 650 degrees C. We incorporate high-RG GaAs into solar cell devices to verify that the electronic quality does not deteriorate as RG is increased. The open circuit voltage (VOC), which is a strong function of non-radiative recombination in the bulk material, exhibits negligible variance in a series of devices grown at 650 degrees C with RG = 55-110 um/h. The implications of low temperature growth for the formation of complex heterostructure devices by HVPE are discussed.

  13. The effect of temperature and bacterial growth phase on protein extraction by means of electroporation.

    Science.gov (United States)

    Haberl-Meglič, Saša; Levičnik, Eva; Luengo, Elisa; Raso, Javier; Miklavčič, Damijan

    2016-12-01

    Different chemical and physical methods are used for extraction of proteins from bacteria, which are used in variety of fields. But on a large scale, many methods have severe drawbacks. Recently, extraction by means of electroporation showed a great potential to quickly obtain proteins from bacteria. Since many parameters are affecting the yield of extracted proteins, our aim was to investigate the effect of temperature and bacterial growth phase on the yield of extracted proteins. At the same time bacterial viability was tested. Our results showed that the temperature has a great effect on protein extraction, the best temperature post treatment being 4°C. No effect on bacterial viability was observed for all temperatures tested. Also bacterial growth phase did not affect the yield of extracted proteins or bacterial viability. Nevertheless, further experiments may need to be performed to confirm this observation, since only one incubation temperature (4°C) and one incubation time before and after electroporation (0.5 and 1h) were tested for bacterial growth phase. Based on our results we conclude that temperature is a key element for bacterial membrane to stay in a permeabilized state, so more proteins flow out of bacteria into surrounding media. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Phase-field-lattice Boltzmann studies for dendritic growth with natural convection

    Science.gov (United States)

    Takaki, Tomohiro; Rojas, Roberto; Sakane, Shinji; Ohno, Munekazu; Shibuta, Yasushi; Shimokawabe, Takashi; Aoki, Takayuki

    2017-09-01

    Simulating dendritic growth with natural convection is challenging because of the size of the computational domain required when compared to the dendrite scale. In this study, a phase-field-lattice Boltzmann model was used to simulate dendritic growth in the presence of natural convection due to a difference in solute concentration. To facilitate and accelerate the large-scale simulation, a parallel computing code with multiple graphics processing units was developed. The effects of the computational domain size as well as those of gravity on the dendritic morphologies were examined by performing two-dimensional free dendritic growth simulations with natural convection. The effects of the gravity direction on the dendrite spacing and morphology were also investigated by simulating unidirectional solidification from multiple seeds.

  15. Studying the relationship between redox and cell growth using quantitative phase imaging (Conference Presentation)

    Science.gov (United States)

    Sridharan, Shamira; Leslie, Matthew T.; Bapst, Natalya; Smith, John; Gaskins, H. Rex; Popescu, Gabriel

    2016-03-01

    Quantitative phase imaging has been used in the past to study the dry mass of cells and study cell growth under various treatment conditions. However, the relationship between cellular redox and growth rates has not yet been studied in this context. This study employed the recombinant Glrx-roGFP2 redox biosensor targeted to the mitochondrial matrix or cytosolic compartments of A549 lung epithelial carcinoma cells. The Glrx-roGFP2s biosensor consists of a modified GFP protein containing internal cysteine residues sensitive to the local redox environment. The formation/dissolution of sulfide bridges contorts the internal chromophore, dictating corresponding changes in florescence emission that provide direct measures of the local redox potential. Combining 2-channel florescent imaging of the redox sensor with quantitative phase imaging allowed observation of redox homeostasis alongside measurements of cellular mass during full cycles of cellular division. The results indicate that mitochondrial redox showed a stronger inverse correlation with cell growth than cytoplasmic redox states; although redox changes are restricted to a 5% range. We are now studying the relationship between mitochondrial redox and cell growth in an isogenic series of breast cell lines built upon the MCF-10A genetic background that vary both in malignancy and metastatic potential.

  16. Impact of metabolism and growth phase on the hydrogen isotopic composition of microbial fatty acids

    Science.gov (United States)

    Heinzelmann, Sandra M.; Villanueva, Laura; Sinke-Schoen, Danielle; Sinninghe Damsté, Jaap S.; Schouten, Stefan; van der Meer, Marcel T. J.

    2015-01-01

    Microorganisms are involved in all elemental cycles and therefore it is important to study their metabolism in the natural environment. A recent technique to investigate this is the hydrogen isotopic composition of microbial fatty acids, i.e., heterotrophic microorganisms produce fatty acids enriched in deuterium (D) while photoautotrophic and chemoautotrophic microorganisms produce fatty acids depleted in D compared to the water in the culture medium (growth water). However, the impact of factors other than metabolism have not been investigated. Here, we evaluate the impact of growth phase compared to metabolism on the hydrogen isotopic composition of fatty acids of different environmentally relevant microorganisms with heterotrophic, photoautotrophic and chemoautotrophic metabolisms. Fatty acids produced by heterotrophs are enriched in D compared to growth water with εlipid/water between 82 and 359‰ when grown on glucose or acetate, respectively. Photoautotrophs (εlipid/water between −149 and −264‰) and chemoautotrophs (εlipid/water between −217 and −275‰) produce fatty acids depleted in D. Fatty acids become, in general, enriched by between 4 and 46‰ with growth phase which is minor compared to the influence of metabolisms. Therefore, the D/H ratio of fatty acids is a promising tool to investigate community metabolisms in nature. PMID:26005437

  17. Origins of discontinuous grain growth during liquid phase sintering of WC-Co cemented carbides

    Energy Technology Data Exchange (ETDEWEB)

    Schreiner, M.; Schmitt, T.; Lux, B.; Lassner, E.

    1984-07-01

    The origins of discontinuous grain growth of fine grained WC powders (about 1 ..mu..m average grain size) with Co binder occurring during liquid phase sintering were studied. The results indicate that small amounts of coarse grained WC powder added to fine grained WC-Co mixtures, which otherwise do not show local grain coarsening during liquid phase sintering, produce enhanced local grain growth of the WC crystals. Effects of milling conditions and sintering temperature on microstructure and mechanical properties, such as transverse rupture strength and hardness, were determined. As already observed in previous studies trace elements in blue oxide can have an important effect on the average grain size and grain size distribution of the WC-powder. Also the considerable influence on the sintering behaviour of such powders described here can be traced back to such impurities. It is shown that phosphorus decreases the melting temperature of the WC-Co system and a heterogeneous distribution of it promotes discontinuous grain growth. Contrary to this, carbon heterogeneities in fine grained WC powders did not cause any discontinuous grain growth at all.

  18. Profiling of Campylobacter jejuni Proteome in Exponential and Stationary Phase of Growth

    Directory of Open Access Journals (Sweden)

    Hana Turonova

    2017-05-01

    Full Text Available Campylobacter jejuni has been reported as a major cause of bacterial food-borne enteritides in developed countries during the last decade. Despite its fastidious growth requirements, including low level of oxygen and high level of CO2, this pathogen is able to persist in the environment without permanent loss of its viability and virulence. As C. jejuni is not able to multiply outside a host, the cells spend significant amount of time in stationary phase of growth. The entry into the stationary phase is often correlated to resistance to various stresses in bacteria. The switching between exponential and stationary phases is frequently mediated by the regulator sigma S (RpoS. However, this factor is absent in C. jejuni and molecular mechanisms responsible for transition of cells to the stationary phase remain elusive. In this work, proteomic profiles of cells from exponential and stationary phases were compared using 2-D electrophoresis (2DE fingerprinting combined with mass spectrometry analysis and qRT-PCR. The identified proteins, whose expression differed between the two phases, are mostly involved in protein biosynthesis, carbon metabolism, stress response and motility. Altered expression was observed also in the pleiotropic regulator CosR that was over-expressed during stationary phase. A shift between transcript and protein level evolution of CosR throughout the growth of C. jejuni was observed using qRT-PCR and (2DE. From these data, we hypothesized that CosR could undergo a negative autoregulation in stationary phase. A consensus sequence resulting from promoter sequence alignment of genes potentially regulated by CosR, including its own upstream region, among C. jejuni strains is proposed. To verify experimentally the potential autoregulation of CosR at the DNA level, electrophoretic mobility shift assay was performed with DNA fragments of CosR promoter region and rCosR. Different migration pattern of the promoter fragments indicates

  19. Growth phase dependent hydrogen isotopic fractionation in alkenone-producing haptophytes

    Science.gov (United States)

    Wolhowe, M. D.; Prahl, F. G.; Probert, I.; Maldonado, M.

    2009-08-01

    Recent works have investigated use of the hydrogen isotopic composition of C37 alkenones (δDK37s, lipid biomarkers of certain haptophyte microalgae, as an independent paleosalinity proxy. We discuss herein the factors impeding the success of such an application and identify the potential alternative use of δDK37s measurements as a proxy for non-thermal, physiological stress impacts on the U37K' paleotemperature index. Batch-culture experiments with the haptophyte Emiliania huxleyi (CCMP 1742) were conducted to determine the magnitude and variability of the isotopic contrasts between individual C37 alkenones. Further experiments were conducted with Emiliania huxleyi (CCMP 1742) andGephyrocapsa oceanica (PZ3-1) to determine whether, and to what extent, δDK37s varies between the physiological extremes of nutrient-replete exponential growth and nutrient-depleted senescence. Emiliania huxleyi was observed to exhibit an isotopic contrast between di- and tri-unsaturated C37 alkenones (αK37:3-K37:2≈0.97) that is nearly identical to that reported recently by others for environmental samples. Furthermore, this contrast appears to be constant with growth stage. The consistency of the offset across different growth stages suggests that a single, well-defined value for αK37:3-K37:2 may exist and that its use in an isotope mass-balance will allow accurate determination of δD values for individual alkenones without having to rely on time- and labor-intensive chemical separations. The isotopic fractionation between growth medium and C37 alkenones was observed to increase dramatically upon the onset of nutrient-depletion-induced senescence, suggesting that δDK37s may serve as an objective tool for recognizing and potentially correcting, at least semi-quantitatively, for the effects of nutrient stress on U37K' temperature records.

  20. Evolution of the postoperative sagittal spinal profile in early-onset scoliosis: is there a difference between rib-based and spine-based growth-friendly instrumentation?

    Science.gov (United States)

    Chen, Zhonghui; Li, Song; Qiu, Yong; Zhu, Zezhang; Chen, Xi; Xu, Liang; Sun, Xu

    2017-12-01

    OBJECTIVE Although the vertical expandable prosthetic titanium rib (VEPTR) and growing rod instrumentation (GRI) encourage spinal growth via regular lengthening, they can create different results because of their different fixation patterns and mechanisms in correcting scoliosis. Previous studies have focused comparisons on coronal plane deformity with minimal attention to the sagittal profile. In this retrospective study, the authors aimed to compare the evolution of the sagittal spinal profile in early-onset scoliosis (EOS) treated with VEPTR versus GRI. METHODS The data for 11 patients with VEPTR and 22 with GRI were reviewed. All patients had more than 2 years' follow-up with more than 2 lengthening procedures. Radiographic measurements were performed before and after the index surgery and at the latest follow-up. The complications in both groups were recorded. RESULTS Patients in both groups had similar diagnoses, age at the index surgery, and number of lengthening procedures. The changes in the major coronal Cobb angle and T1-S1 spinal height were not significantly different between the 2 groups. Compared with the GRI group, the VEPTR group had less correction in thoracic kyphosis (23% ± 12% vs 44% ± 16%, p < 0.001) after the index surgery and experienced a greater correction loss in thoracic kyphosis (46% ± 18% vs 11% ± 8%, p < 0.001) at the latest follow-up. Although the increase in the proximal junctional angle was not significantly different (VEPTR: 7° ± 4° vs GRI: 8° ± 5°, p = 0.569), the incidence of proximal junctional kyphosis was relatively lower in the VEPTR group (VEPTR: 18.2% vs GRI: 22.7%). No significant changes in the spinopelvic parameters were observed, while the sagittal vertical axis showed a tendency toward a neutral position in both groups. The overall complication rate was higher in the VEPTR group than in the GRI group (72.7% vs 54.5%). CONCLUSIONS The VEPTR had coronal correction and spinal growth results similar to those

  1. Red Guava Leaf Harvesting Impact on Flavonoid Optimation in Different Growth Phases

    Directory of Open Access Journals (Sweden)

    MUNIF GHULAMAHDI

    2011-06-01

    Full Text Available Harvesting process is a critical time to identify the quality of raw material for traditional medicine. The time and harvesting techniques, drying process after harvesting, and processing to make the simplicia, are the crucial role to make the good quality of the natural product. On the other hand, there is a lack of general understanding and appreciation about the processes involved in governing shoot and tree growth and development, i.e. red guava. The research objective was to evaluate the influence of leaf harvesting and growth phases on red guava for flavonoid production as antioxidant. Randomized factorial block design in time were laid out with two factors and followed by Duncan’s multiple range test. The treatments were the amount of leaf harvested on tertiary branches (0, 25, 50, and 100% and growth phases of the plant (vegetative and generative. Leaf harvesting 25% on tertiary branches significantly increased the leaf number (766.3 tree-1 and the number of new quarternary branches, decreasing leaf area index (LAI and leaf dry weight at the end of the experiment (22 weeks of observation/WO. The highest leaf dry weight (156.94 g tree-1 and LAI (0.47 was found in harvesting 25% tertiary branches. Harvesting 100% leaf on tertiary branches in vegetative phase significantly produced the lowest flavonoid production (7.82 g tree-1. The result suggested that flavonoid production from red guava leaves should be done by harvesting 50% leaf on tertiary branches in generative phase can be used to produce the highest flavonoid (89.90 g tree-1.

  2. Onset of white striping and progression into wooden breast as defined by myopathic changes underlying Pectoralis major growth. Estimation of growth parameters as predictors for stage of myopathy progression.

    Science.gov (United States)

    Griffin, Jacqueline Reedy; Moraes, Luis; Wick, Macdonald; Lilburn, Michael Snell

    2018-02-01

    The broiler industry has incurred significant economic losses due to two muscle myopathies, white striping (WS) and wooden breast (WB), affecting the Pectoralis major (P. major) of commercial broilers. The present study documented macroscopic changes occurring with age/growth in the P. major and P. minor muscles of commercial broilers from day 2 through day 46 (n = 27/day). Distinct myopathic aberrations observed in both breast muscles corresponded to the onset of WB. These distinct morphological changes were used as determinants in developing a ranking system, defining the ontogeny of WB as the following four stages: (1) WS, (2) petechial epimysium haemorrhages, (3) intramuscular haemorrhages and (4) ischaemia. A cumulative logit proportional odds model was used to relate the rank probabilities with the following growth parameters: body weight, P. major and P. minor weight/yield/length/width/depth. The best-fit model included P. major length/width/depth, P. minor width, P. major and P. minor yield as predictors for rank. Increasing P. major depth, P. minor width and P. major yield increased the odds of falling into higher ranks (more severe myopathy). Conversely, increasing P. major length, P. major width and P. minor yield increased the odds of falling into smaller ranks (less severe myopathy). This study describes the macroscopic changes associated with WB ontogeny in the development of a ranking system and the contribution of growth parameters in the determination of rank (WB severity). Results suggest that physical measurements inherent to selection for high-yielding broiler genotypes are contributing to the occurrence and severity of WS and WB.

  3. Crystal growth of pure substances: Phase-field simulations in comparison with analytical and experimental results

    Science.gov (United States)

    Nestler, B.; Danilov, D.; Galenko, P.

    2005-07-01

    A phase-field model for non-isothermal solidification in multicomponent systems [SIAM J. Appl. Math. 64 (3) (2004) 775-799] consistent with the formalism of classic irreversible thermodynamics is used for numerical simulations of crystal growth in a pure material. The relation of this approach to the phase-field model by Bragard et al. [Interface Science 10 (2-3) (2002) 121-136] is discussed. 2D and 3D simulations of dendritic structures are compared with the analytical predictions of the Brener theory [Journal of Crystal Growth 99 (1990) 165-170] and with recent experimental measurements of solidification in pure nickel [Proceedings of the TMS Annual Meeting, March 14-18, 2004, pp. 277-288; European Physical Journal B, submitted for publication]. 3D morphology transitions are obtained for variations in surface energy and kinetic anisotropies at different undercoolings. In computations, we investigate the convergence behaviour of a standard phase-field model and of its thin interface extension at different undercoolings and at different ratios between the diffuse interface thickness and the atomistic capillary length. The influence of the grid anisotropy is accurately analyzed for a finite difference method and for an adaptive finite element method in comparison.

  4. Subcritical Growth of Electron Phase-space Holes in Planetary Radiation Belts

    Science.gov (United States)

    Osmane, A.; Wilson, L. B., III; Turner, D. L.; Dimmock, A. P.; Pulkkinen, T. I.

    2017-12-01

    The discovery of self-sustained coherent structures with large-amplitude electric fields (E ˜ 10 - 100 mV/m) by the Van Allen Probes has revealed alternative routes through which energy-momentum exchange can take place in planetary radiation belts. When originating from energetic electrons in Landau resonance with large-amplitude whistlers, phase-space electron holes form with small amplitudes of the order of the hot to cold electron density, i.e., qφ/T_e≃ n_h/n_c ≃ 10^{-3}, and orders of magnitude smaller than observed values of the largest phase-space holes amplitude, i.e., qφ /T_e ≃ 1. In this report we present a mechanism through which electron holes can grow nonlinearly (i.e. γ ∝ √{φ}) and subcritically as a result of momentum exchange with passing (untrapped) electrons. Growth rates are computed analytically for plasma parameters consistent with those measured in the Earth's radiation belts under quiet and disturbed conditions. Our results provide an explanation for the fast growth of electron phase-space holes in the Earth's radiation belts from small initial values qφ/T_c ≃ 10^{-3}, to larger values of the order qφ /T_e ≃ 1.

  5. Subcritical growth of electron phase-space holes in the Earth's radiation belts

    Science.gov (United States)

    Osmane, A.; Wilson, L. B., III; Turner, D. L.; Dimmock, A. P.; Pulkkinen, T. I.

    2017-12-01

    The discovery of self-sustained coherent structures with large-amplitude electric fields ( E ˜ 10-100 mV/m) by the Van Allen Probes has revealed alternative routes through which energy-momentum exchange can take place in planetary radiation belts. When originating from energetic electrons in Landau resonance with large-amplitude whistlers, phase-space electron holes form with small amplitudes of the order of the hot to cold electron density, i.e., qφ /Te≃ nh/n_c ≃ 10-3, and orders of magnitude smaller than observed values of the largest phase-space holes amplitude, i.e., qφ /Te ≃ 1. In this report we present a mechanism through which electron holes can grow nonlinearly (i.e. γ ∝ √ {φ }) and subcritically as a result of momentum exchange with passing (untrapped) electrons. Growth rates are computed analytically for plasma parameters consistent with those measured in the Earth's radiation belts under quiet and disturbed conditions. Our results provide an explanation for the fast growth of electron phase-space holes in the Earth's radiation belts from small initial values qφ /Tc ≃ 10-3, to larger values of the order qφ /Te ≃ 1.

  6. Young-Onset Parkinson's

    Science.gov (United States)

    ... What Is Parkinson's? › Young Onset Parkinson's Young-Onset Parkinson's 1. Symptoms 2. How Is Young-Onset PD ... of the foot Why Is Distinguishing Young-Onset Parkinson's Important? Socially, people who are affected by PD ...

  7. Phase diagram of interfacial growth modes by vapor deposition and its application for ZnO nanostructures

    Science.gov (United States)

    Shu, Da-Jun; Xiong, Xiang; Liu, Ming; Wang, Mu

    2017-09-01

    Interfacial growth from vapor has been extensively studied. However, a straightforward picture of the growth mode under different growth conditions is still lacking. In this paper, we develop a comprehensive interfacial growth theory based on the stochastic approach. Using a critical interisland separation, we construct a general phase diagram of the growth modes. It has been revealed that if the Ehrlich-Schwoebel barrier EES is smaller than a critical value, the interfacial growth proceeds in a layer-by-layer (LBL) mode at any deposition rate. However, if EES is larger than the critical value, LBL growth occurs only at very small or very large deposition rates relative to the intralayer hopping rate, and multilayer (ML) growth occurs at a moderate deposition rate. Experiments with zinc oxide growth by chemical vapor deposition have been designed to qualitatively demonstrate the theoretical model. By changing the flux of the carrier gas (nitrogen gas) in chemical vapor deposition, we realize LBL, ML, and then reentrance of LBL homoepitaxial growth of ZnO successively. Moreover, we find that surface kinetics of ZnO is suppressed by decreasing oxygen partial pressure by comparing the experimental observations and theoretical models, which is supported by our recent first-principles calculations. Since the influence of the substrate and the growth species on growth can approximately be represented by binding energy and surface kinetics, we suggest that the phase diagram is essential for interfacial growth of different materials by vapor deposition.

  8. Two genetically separable phases of growth inhibition induced by blue light in Arabidopsis seedlings

    Science.gov (United States)

    Parks, B. M.; Cho, M. H.; Spalding, E. P.; Evans, M. L. (Principal Investigator)

    1998-01-01

    High fluence-rate blue light (BL) rapidly inhibits hypocotyl growth in Arabidopsis, as in other species, after a lag time of 30 s. This growth inhibition is always preceded by the activation of anion channels. The membrane depolarization that results from the activation of anion channels by BL was only 30% of the wild-type magnitude in hy4, a mutant lacking the HY4 BL receptor. High-resolution measurements of growth made with a computer-linked displacement transducer or digitized images revealed that BL caused a rapid inhibition of growth in wild-type and hy4 seedlings. This inhibition persisted in wild-type seedlings during more than 40 h of continuous BL. By contrast, hy4 escaped from the initial inhibition after approximately 1 h of BL and grew faster than wild type for approximately 30 h. Wild-type seedlings treated with 5-nitro-2-(3-phenylpropylamino)-benzoic acid, a potent blocker of the BL-activated anion channel, displayed rapid growth inhibition, but, similar to hy4, these seedlings escaped from inhibition after approximately 1 h of BL and phenocopied the mutant for at least 2.5 h. The effects of 5-nitro-2-(3-phenylpropylamino)-benzoic acid and the HY4 mutation were not additive. Taken together, the results indicate that BL acts through HY4 to activate anion channels at the plasma membrane, causing growth inhibition that begins after approximately 1 h. Neither HY4 nor anion channels appear to participate greatly in the initial phase of inhibition.

  9. High growth rate hydride vapor phase epitaxy at low temperature through use of uncracked hydrides

    Science.gov (United States)

    Schulte, Kevin L.; Braun, Anna; Simon, John; Ptak, Aaron J.

    2018-01-01

    We demonstrate hydride vapor phase epitaxy (HVPE) of GaAs with unusually high growth rates (RG) at low temperature and atmospheric pressure by employing a hydride-enhanced growth mechanism. Under traditional HVPE growth conditions that involve growth from Asx species, RG exhibits a strong temperature dependence due to slow kinetics at the surface, and growth temperatures >750 °C are required to obtain RG > 60 μm/h. We demonstrate that when the group V element reaches the surface in a hydride, the kinetic barrier is dramatically reduced and surface kinetics no longer limit RG. In this regime, RG is dependent on mass transport of uncracked AsH3 to the surface. By controlling the AsH3 velocity and temperature profile of the reactor, which both affect the degree of AsH3 decomposition, we demonstrate tuning of RG. We achieve RG above 60 μm/h at temperatures as low as 560 °C and up to 110 μm/h at 650 °C. We incorporate high-RG GaAs into solar cell devices to verify that the electronic quality does not deteriorate as RG is increased. The open circuit voltage (VOC), which is a strong function of non-radiative recombination in the bulk material, exhibits negligible variance in a series of devices grown at 650 °C with RG = 55-110 μm/h. The implications of low temperature growth for the formation of complex heterostructure devices by HVPE are discussed.

  10. DURIP 98-99: Molecular Beam Epitaxial Growth and In Situ Characterization of Phase Separated Optoelectronic Semiconductors

    National Research Council Canada - National Science Library

    Millunchick, J. Mirecki

    1999-01-01

    This proposal requested funding to procure a Molecular Beam Epitaxy (MBE) chamber with extensive in situ diagnostic capabilities to study phase separation of III-V semiconductor alloys during epitaxial growth...

  11. Aluminum Gallium Nitride Alloys Grown via Metalorganic Vapor-Phase Epitaxy Using a Digital Growth Technique

    Science.gov (United States)

    Rodak, L. E.; Korakakis, D.

    2011-04-01

    This work investigates the use of a digital growth technique as a viable method for achieving high-quality aluminum gallium nitride (Al x Ga1- x N) films via metalorganic vapor-phase epitaxy. Digital alloys are superlattice structures with period thicknesses of a few monolayers. Alloys with an AlN mole fraction ranging from 0.1 to 0.9 were grown by adjusting the thickness of the AlN layer in the superlattice. High-resolution x-ray diffraction was used to determine the superlattice period and c-lattice parameter of the structure, while reciprocal-space mapping was used to determine the a-lattice parameter and evaluate growth coherency. A comparison of the measured lattice parameter with both the nominal value and also the underlying buffer layer is discussed.

  12. Phase-field-lattice Boltzmann study for lamellar eutectic growth in a natural convection melt

    Directory of Open Access Journals (Sweden)

    Ang Zhang

    2017-11-01

    Full Text Available In the present study, the influence of natural convection on the lamellar eutectic growth is determined by a phase-field-lattice Boltzmann study for Al-Cu eutectic alloy. The mass difference resulting from concentration difference led to the fluid flow, and a robust parallel and adaptive mesh refinement algorithm was employed to improve the computational efficiency without any compromising accuracy. Results show that the existence of natural convection would affect the growth undercooling and thus control the interface shape by adjusting the lamellar width. In particular, by alternating the magnitude of the solute expansion coefficient, the strength of the natural convection is changed. Corresponding microstructure patterns are discussed and compared with those under no-convection conditions.

  13. Psychiatric and cognitive adverse events: A pooled analysis of three phase III trials of adjunctive eslicarbazepine acetate for partial-onset seizures.

    Science.gov (United States)

    Andermann, Eva; Biton, Victor; Benbadis, Selim R; Shneker, Bassel; Shah, Aashit K; Carreño, Mar; Trinka, Eugen; Ben-Menachem, Elinor; Biraben, Arnaud; Rocha, Francisco; Gama, Helena; Cheng, Hailong; Blum, David

    2018-03-28

    To evaluate the nature and incidence of psychiatric and cognitive adverse events (AEs) reported with eslicarbazepine acetate (ESL) used as adjunctive treatment for refractory partial-onset seizures (POS) in adults. This was a post-hoc analysis of data pooled from three randomized double-blind, placebo-controlled trials (BIA-2093-301, -302, -304). After an 8-week baseline period, patients received placebo or adjunctive ESL 400mg (studies 301 and 302 only), 800mg, or 1200mg once daily (QD) for 14weeks (2-week titration period, 12-week maintenance period). Psychiatric and cognitive AEs were identified from individual patient data. Suicidality was also evaluated using the Columbia-Classification Algorithm of Suicide Assessment (C-CASA), or the Columbia-Suicide Severity Rating Scale (C-SSRS). P-values were obtained using the chi-square test of independence or Fisher's exact test, without correcting for multiplicity. The analysis population included 1447 patients (ESL, n=1021; placebo, n = 426). Psychiatric treatment-emergent AEs (TEAEs) occurred in 10.8% of patients receiving ESL, and in a comparable proportion (10.3%) of patients receiving placebo (p=0.802). The incidence of depression and suicidality-related TEAEs was higher for ESL (7.4%) vs. placebo (3.8%) (p=0.009). The occurrence of these TEAEs differed between treatment groups (p = 0.010), but there was no notable trend between increasing ESL dose and increasing incidence of depression and suicidality-related TEAEs. Aggression/hostility-related TEAEs occurred in ESL vs. 0.9% taking placebo. The incidence of cognitive TEAEs was higher for ESL (7.1%) vs. placebo (4.0%) (p=0.023); incidences of memory impairment, attention disturbance, apathy, and aphasia were higher for ESL 1200mg than for other treatment groups. Incidences of psychiatric and cognitive serious AEs were (0.6% and 0.2% with ESL, and 0.5% and 0% with placebo, respectively. Psychiatric and cognitive TEAEs leading to discontinuation occurred in 1.9% and

  14. VO{sub 2} (A): Reinvestigation of crystal structure, phase transition and crystal growth mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Rao Popuri, Srinivasa [ICMCB, CNRS, UPR 9048, F-33608 Pessac (France); University of Bordeaux, ICMCB, UPR 9048, F-33608 Pessac (France); National Institute for Research and Development in Electrochemistry and Condensed Matter, Timisoara, Plautius Andronescu Str. No. 1, 300224 Timisoara (Romania); Artemenko, Alla [ICMCB, CNRS, UPR 9048, F-33608 Pessac (France); University of Bordeaux, ICMCB, UPR 9048, F-33608 Pessac (France); Labrugere, Christine [CeCaMA, University of Bordeaux 1, ICMCB, 87 Avenue du Dr. A. Schweitzer, F-33608 Pessac (France); Miclau, Marinela [National Institute for Research and Development in Electrochemistry and Condensed Matter, Timisoara, Plautius Andronescu Str. No. 1, 300224 Timisoara (Romania); Villesuzanne, Antoine [ICMCB, CNRS, UPR 9048, F-33608 Pessac (France); University of Bordeaux, ICMCB, UPR 9048, F-33608 Pessac (France); Pollet, Michaël, E-mail: pollet@icmcb-bordeaux.cnrs.fr [ICMCB, CNRS, UPR 9048, F-33608 Pessac (France); University of Bordeaux, ICMCB, UPR 9048, F-33608 Pessac (France)

    2014-05-01

    Well crystallized VO{sub 2} (A) microrods were grown via a single step hydrothermal reaction in the presence of V{sub 2}O{sub 5} and oxalic acid. With the advantage of high crystalline samples, we propose P4/ncc as an appropriate space group at room temperature. From morphological studies, we found that the oriented attachment and layer by layer growth mechanisms are responsible for the formation of VO{sub 2} (A) micro rods. The structural and electronic transitions in VO{sub 2} (A) are strongly first order in nature, and a marked difference between the structural transition temperatures and electronic transitions temperature was evidenced. The reversible intra- (LTP-A to HTP-A) and irreversible inter- (HTP-A to VO{sub 2} (M1)) structural phase transformations were studied by in-situ powder X-ray diffraction. Attempts to increase the size of the VO{sub 2} (A) microrods are presented and the possible formation steps for the flower-like morphologies of VO{sub 2} (M1) are described. - Graphical abstract: Using a single step and template free hydrothermal synthesis, well crystallized VO{sub 2} (A) microrods were prepared and the P4/ncc space group was assigned to the room temperature crystal structure. Reversible and irreversible phase transitions among different VO{sub 2} polymorphs were identified and their progressive nature was highlighted. Attempts to increase the microrods size, involving layer by layer formation mechanisms, are presented. - Highlights: • Highly crystallized VO{sub 2} (A) microrods were grown via a single step hydrothermal process. • The P4/ncc space group was determined for VO{sub 2} (A) at room temperature. • The electronic structure and progressive nature of the structural phase transition were investigated. • A weak coupling between structural and electronic phase transitions was identified. • Different crystallite morphologies were discussed in relation with growth mechanisms.

  15. New separation methodologies for the distinction of the growth phases of Saccharomyces cerevisiae cell cycle.

    Science.gov (United States)

    Lainioti, G Ch; Kapolos, J; Koliadima, A; Karaiskakis, G

    2010-03-12

    In the present work two separation techniques, namely the gravitational field-flow fractionation (GrFFF) and the reversed-flow gas chromatography (RFGC), are proposed for the distinction of the growth phases of Saccharomyces cerevisiae (AXAZ-1) yeast cycle at different temperatures (30 degrees C, 25 degrees C, 20 degrees C, and 15 degrees C) and pH (2.0, 3.0, 4.0 and 5.0) values. During the fermentation processes, differences observed in the peak profiles, obtained by GrFFF, can be related with the unlike cell growth. The distinction of the phases of AXAZ-1 cell cycle with the GrFFF, was also confirmed with the RFGC technique, which presented similar fermentation time periods for the alcoholic fermentation phases. Simultaneously, the reaction rate constant for each phase of the fermentation process and the activation energies were determined with the aid of the RFGC technique. Finally, the application of both the GrFFF and the RFGC techniques, in combination with high-performance liquid chromatography, allowed us to find the ideal experimental conditions (temperature and pH) for the alcoholic fermentation by AXAZ-1. The results indicate that S. cerevisiae cells performed better at 30 degrees C, whereas at lower temperatures decreases in the fermentation rate and in the number of viable cells were observed. Moreover, the pH of the medium (pH 5.0) resulted in higher fermentation rates and ethanol productivities. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  16. Stabilisation of late transition metal and noble metal films in hexagonal and body centred tetragonal phases by epitaxial growth

    Energy Technology Data Exchange (ETDEWEB)

    Hueger, E.

    2005-08-26

    In this work ultrathin metallic films with a crystal phase different to their natural bulk structure were produced by hetero-epitaxial growth on metallic substrates. A further aim of this work was to understand the initiation, growth and stability of crystal phase modifications of these films. there exist cases where the films turn beyond the pseudomorphic-growth to a crystal phase different from their natural bulk structure. The present work presents and discusses such a case in addition to the general phenomenon of pseudomorphic-growth. In particular it is shown that metals whose natural phase is face centred cubic (fcc) can be grown in body centred tetragonal (bct) or hexagonal close packed (hcp) phases in the form of thin films on (001) surfaces of appropriate substrates. The growth behavior, electron diffraction analysis, appearance conditions, geometric fit considerations, examples and a discussion of the phase stability of non-covered films and superlattices is given reviewing all epitaxial-systems whose diffraction pattern can be explained by the hexagonal or pseudomorphic bct phase. (orig.)

  17. Hydride vapor phase epitaxy growth of GaN, InGaN, ScN, and ScAIN

    NARCIS (Netherlands)

    Bohnen, T.

    2010-01-01

    Chemical vapor deposition (CVD); hydride vapor phase epitaxy (HVPE); gallium nitride (GaN); indium gallium nitride (InGaN); scandium nitride (ScN); scandium aluminum nitride (ScAlN); semiconductors; thin films; nanowires; III nitrides; crystal growth - We studied the HVPE growth of different III

  18. Inverse correlation of genetic risk score with age at onset in bout-onset and progressive-onset multiple sclerosis.

    Science.gov (United States)

    Sorosina, Melissa; Esposito, Federica; Guaschino, Clara; Clarelli, Ferdinando; Barizzone, Nadia; Osiceanu, Ana Maria; Brambilla, Paola; Mascia, Elisabetta; Cavalla, Paola; Gallo, Paolo; Martinelli, Vittorio; Leone, Maurizio; Comi, Giancarlo; D'Alfonso, Sandra; Martinelli Boneschi, Filippo

    2015-10-01

    We correlated the weighted genetic risk score measured using 107 established susceptibility variants for multiple sclerosis (MS) with the age at onset in bout-onset (BOMS, n=906) and progressive-onset MS Italian patients (PrMS) (n=544). We observed an opposite relationship in the two disease courses: a higher weighted genetic risk score was associated with an earlier age at onset in BOMS (rho= -0.1; p=5 × 10(-3)) and a later age at onset in PrMS cases (rho=0.07; p=0.15) (p of difference of regression=1.4 × 10(-2)). These findings suggest that established MS risk variants anticipate the onset of the inflammatory phase, while they have no impact on, or even delay, the onset of the progressive phase. © The Author(s), 2014.

  19. Polycrystalline indium phosphide on silicon by indium assisted growth in hydride vapor phase epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Metaferia, Wondwosen; Sun, Yan-Ting, E-mail: yasun@kth.se; Lourdudoss, Sebastian [Laboratory of Semiconductor Materials, Department of Materials and Nano Physics, KTH—Royal Institute of Technology, Electrum 229, 164 40 Kista (Sweden); Pietralunga, Silvia M. [CNR-Institute for Photonics and Nanotechnologies, P. Leonardo da Vinci, 32 20133 Milano (Italy); Zani, Maurizio; Tagliaferri, Alberto [Department of Physics Politecnico di Milano, P. Leonardo da Vinci, 32 20133 Milano (Italy)

    2014-07-21

    Polycrystalline InP was grown on Si(001) and Si(111) substrates by using indium (In) metal as a starting material in hydride vapor phase epitaxy (HVPE) reactor. In metal was deposited on silicon substrates by thermal evaporation technique. The deposited In resulted in islands of different size and was found to be polycrystalline in nature. Different growth experiments of growing InP were performed, and the growth mechanism was investigated. Atomic force microscopy and scanning electron microscopy for morphological investigation, Scanning Auger microscopy for surface and compositional analyses, powder X-ray diffraction for crystallinity, and micro photoluminescence for optical quality assessment were conducted. It is shown that the growth starts first by phosphidisation of the In islands to InP followed by subsequent selective deposition of InP in HVPE regardless of the Si substrate orientation. Polycrystalline InP of large grain size is achieved and the growth rate as high as 21 μm/h is obtained on both substrates. Sulfur doping of the polycrystalline InP was investigated by growing alternating layers of sulfur doped and unintentionally doped InP for equal interval of time. These layers could be delineated by stain etching showing that enough amount of sulfur can be incorporated. Grains of large lateral dimension up to 3 μm polycrystalline InP on Si with good morphological and optical quality is obtained. The process is generic and it can also be applied for the growth of other polycrystalline III–V semiconductor layers on low cost and flexible substrates for solar cell applications.

  20. Saccharomyces cerevisiae biofilm tolerance towards systemic antifungals depends on growth phase.

    Science.gov (United States)

    Bojsen, Rasmus; Regenberg, Birgitte; Folkesson, Anders

    2014-12-04

    Biofilm-forming Candida species cause infections that can be difficult to eradicate, possibly because of antifungal drug tolerance mechanisms specific to biofilms. In spite of decades of research, the connection between biofilm and drug tolerance is not fully understood. We used Saccharomyces cerevisiae as a model for drug susceptibility of yeast biofilms. Confocal laser scanning microscopy showed that S. cerevisiae and C. glabrata form similarly structured biofilms and that the viable cell numbers were significantly reduced by treatment of mature biofilms with amphotericin B but not voriconazole, flucytosine, or caspofungin. We showed that metabolic activity in yeast biofilm cells decreased with time, as visualized by FUN-1 staining, and mature, 48-hour biofilms contained cells with slow metabolism and limited growth. Time-kill studies showed that in exponentially growing planktonic cells, voriconazole had limited antifungal activity, flucytosine was fungistatic, caspofungin and amphotericin B were fungicidal. In growth-arrested cells, only amphotericin B had antifungal activity. Confocal microscopy and colony count viability assays revealed that the response of growing biofilms to antifungal drugs was similar to the response of exponentially growing planktonic cells. The response in mature biofilm was similar to that of non-growing planktonic cells. These results confirmed the importance of growth phase on drug efficacy. We showed that in vitro susceptibility to antifungal drugs was independent of biofilm or planktonic growth mode. Instead, drug tolerance was a consequence of growth arrest achievable by both planktonic and biofilm populations. Our results suggest that efficient strategies for treatment of yeast biofilm might be developed by targeting of non-dividing cells.

  1. Battle of the Bacteria: Characterizing the Evolutionary Advantage of Stationary Phase Growth

    Directory of Open Access Journals (Sweden)

    Karin E. Kram

    2016-05-01

    Full Text Available Providing students with authentic research opportunities has been shown to enhance learning and increase retention in STEM majors. Accordingly, we have developed a novel microbiology lab module, which focuses on the molecular mechanisms of evolution in E. coli, by examining the growth advantage in stationary phase (GASP phenotype. The GASP phenotype is demonstrated by growing cells into long-term stationary phase (LTSP and then competing them against un-aged cells in a fresh culture. This module includes learning goals related to strengthening practical laboratory skills and improving student understanding of evolution. In addition, the students generate novel data regarding the effects of different environmental stresses on GASP and the relationship between evolution, genotypic change, mutation frequency, and cell stress. Pairs of students are provided with the experimental background, select a specific aspect of the growth medium to modify, and generate a hypothesis regarding how this alteration will impact the GASP phenotype. From this module, we have demonstrated that students are able to achieve the established learning goals and have produced data that has furthered our understanding of the GASP phenotype.

  2. [Chemo- and endocrino-therapy of breast carcinoma xenografts in the dormant or exponential growth phase].

    Science.gov (United States)

    Takeuchi, T

    1995-06-01

    In case of concerning about recurrence case after operative treatment of breast cancer, we must suppose existence of dormant breast cancer cell. To elucidate a rational treatment of the breast cancer in the dormant stage, we have developed a new treatment model using human breast carcinoma xenografts (MCF-7, R-27 and Br-10) in nude mice. After the sc inoculation of the tumors, the treatment was initiated with or without the previous estradiol (E2) stimulation. While MCF-7 was sensitive to mitomycin C (6 mg/kg i.p.) and and tamoxifen pellet (2.5 mg/mouse s.c.) in the dormant and exponential growth phase, R-27 and Br-10 were sensitive to the drugs only in the exponential growth phase but not in the dormant stage. These results suggested that the sensitivity of human breast carcinoma cells in the dormant stage is rather low, however some strain would be also sensitive to the treatment. This model seems to be useful in evaluating the adjuvant therapy of breast carcinoma after surgery.

  3. Near-earth Thin Current Sheets and Birkeland Currents during Substorm Growth Phase

    International Nuclear Information System (INIS)

    Sorin Zaharia; Cheng, C.Z.

    2003-01-01

    Two important phenomena observed during the magnetospheric substorm growth phase are modeled: the formation of a near-Earth (|X| ∼ 9 R E ) thin cross-tail current sheet, as well as the equatorward shift of the ionospheric Birkeland currents. Our study is performed by solving the 3-D force-balance equation with realistic boundary conditions and pressure distributions. The results show a cross-tail current sheet with large current (J φ ∼ 10 nA/m 2 ) and very high plasma β (β ∼ 40) between 7 and 10 R E . The obtained region-1 and region-2 Birkeland currents, formed on closed field lines due to pressure gradients, move equatorward and become more intense (J parallel max ∼ 3 (micro)A/m 2 ) compared to quiet times. Both results are in agreement with substorm growth phase observations. Our results also predict that the cross-tail current sheet maps into the ionosphere in the transition region between the region-1 and region-2 currents

  4. Heterogeneous Sensitivity of Tropical Precipitation Extremes during Growth and Mature Phases of Atmospheric Warming

    Science.gov (United States)

    Parhi, P.; Giannini, A.; Lall, U.; Gentine, P.

    2016-12-01

    Assessing and managing risks posed by climate variability and change is challenging in the tropics, from both a socio-economic and a scientific perspective. Most of the vulnerable countries with a limited climate adaptation capability are in the tropics. However, climate projections, particularly of extreme precipitation, are highly uncertain there. The CMIP5 (Coupled Model Inter- comparison Project - Phase 5) inter-model range of extreme precipitation sensitivity to the global temperature under climate change is much larger in the tropics as compared to the extra-tropics. It ranges from nearly 0% to greater than 30% across models (O'Gorman 2012). The uncertainty is also large in historical gauge or satellite based observational records. These large uncertainties in the sensitivity of tropical precipitation extremes highlight the need to better understand how tropical precipitation extremes respond to warming. We hypothesize that one of the factors explaining the large uncertainty is due to differing sensitivities during different phases of warming. We consider the `growth' and `mature' phases of warming under climate variability case- typically associated with an El Niño event. In the remote tropics (away from tropical Pacific Ocean), the response of the precipitation extremes during the two phases can be through different pathways: i) a direct and fast changing radiative forcing in an atmospheric column, acting top-down due to the tropospheric warming, and/or ii) an indirect effect via changes in surface temperatures, acting bottom-up through surface water and energy fluxes. We also speculate that the insights gained here might be useful in interpreting the large sensitivity under climate change scenarios, since the physical mechanisms during the two warming phases under climate variability case, have some correspondence with an increasing and stabilized green house gas emission scenarios.

  5. Liquid phase electro epitaxy growth kinetics of GaAs-A three-dimensional numerical simulation study

    International Nuclear Information System (INIS)

    Mouleeswaran, D.; Dhanasekaran, R.

    2006-01-01

    A three-dimensional numerical simulation study for the liquid phase electro epitaxial growth kinetic of GaAs is presented. The kinetic model is constructed considering (i) the diffusive and convective mass transport, (ii) the heat transfer due to thermoelectric effects such as Peltier effect, Joule effect and Thomson effect, (iii) the electric current distribution with electromigration and (iv) the fluid flow coupled with concentration and temperature fields. The simulations are performed for two configurations namely (i) epitaxial growth from the arsenic saturated gallium rich growth solution, i.e., limited solution model and (ii) epitaxial growth from the arsenic saturated gallium rich growth solution with polycrystalline GaAs feed. The governing equations of liquid phase electro epitaxy are solved numerically with appropriate initial and boundary conditions using the central difference method. Simulations are performed to determine the following, a concentration profiles of solute atoms (As) in the Ga-rich growth solution, shape of the substrate evolution, the growth rate of the GaAs epitaxial film, the contributions of Peltier effect and electromigration of solute atoms to the growth with various experimental growth conditions. The growth rate is found to increase with increasing growth temperature and applied current density. The results are discussed in detail

  6. Epitaxial growth of cobalt oxide phases on Ru(0001) for spintronic device applications

    Science.gov (United States)

    Olanipekun, Opeyemi; Ladewig, Chad; Kelber, Jeffry A.; Randle, Michael D.; Nathawat, Jubin; Kwan, Chun-Pui; Bird, Jonathan P.; Chakraborti, Priyanka; Dowben, Peter A.; Cheng, Tao; Goddard, W. A., III

    2017-09-01

    Cobalt oxide films are of technological interest as magnetic substrates that may support the direct growth of graphene, for use in various spintronic applications. In this work, we demonstrate the controlled growth of both Co3O4(111) and CoO(111) on Ru(0001) substrates. The growth is performed by Co molecular beam epitaxy, at a temperature of 500 K and in an O2 partial pressure of 10-4 Torr for Co3O4(111), and 7.5 × 10-7 Torr for CoO(111). The films are distinguished by their dissimilar Co 2p x-ray photoemission (XPS) spectra, while XPS-derived O/Co stoichiometric ratios are 1.33 for Co3O4(111) and 1.1 for CoO(111). Electron energy loss (EELS) spectra for Co3O4(111) indicate interband transitions at ˜2.1 and 3.0 eV, while only a single interband transition near 2.0 eV is observed for CoO(111). Low energy electron diffraction (LEED) data for Co3O4(111) indicate twinning during growth, in contrast to the LEED data for CoO(111). For Co3O4(111) films of less than 20 Å average thickness, however, XPS, LEED and EELS data are similar to those of CoO(111). XPS data indicate that both Co oxide phases are hydroxylated at all thicknesses. The two phases are moreover found to be thermally stable to at least 900 K in UHV, while ex situ atomic force microscopy measurements of Co3O4(111)/Ru(0001) indicate an average surface roughness below 1 nm. Electrical measurements indicate that Co3O4(111)/Ru(0001) films exhibit dielectric breakdown at threshold voltages of ˜1 MV cm-1. Collectively, these data show that the growth procedures yield Co3O4(111) films with topographical and electrical characteristics that are suitable for a variety of advanced device applications.

  7. Investigations on the growth kinetics of Laves phase precipitates in 12% Cr creep-resistant steels: Experimental and DICTRA calculations

    Energy Technology Data Exchange (ETDEWEB)

    Prat, O. [Max Planck Institute fuer Eisenforschung GmbH, Max Planck Strasse 1, 40237 Duesseldorf (Germany)] [Universidad de Concepcion, Departamento de Ingenieria de Materiales, Edmundo Larenas 270, Concepcion (Chile); Garcia, J., E-mail: jose.garcia@helmholtz-berlin.de [Helmholtz-Zentrum Berlin fuer Materialien und Energie GmbH, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Rojas, D. [Max Planck Institute fuer Eisenforschung GmbH, Max Planck Strasse 1, 40237 Duesseldorf (Germany); Carrasco, C. [Universidad de Concepcion, Departamento de Ingenieria de Materiales, Edmundo Larenas 270, Concepcion (Chile); Inden, G. [Max Planck Institute fuer Eisenforschung GmbH, Max Planck Strasse 1, 40237 Duesseldorf (Germany)

    2010-10-15

    The growth kinetics of Laves phase precipitates (type Fe{sub 2}W) in the early stage of creep (650 deg. C for 10,000 h) in two 12% Cr ferrite-martensitic steels has been investigated. In one alloy the Laves phase formed on tempering, while in the second alloy the Laves phase precipitated during creep. Kinetic simulations were performed using the software DICTRA. The particle size of the Laves phase was measured on transmission electron microscopy samples. The equilibrium phase fraction of the Laves phase was reached in the first thousand hours. Simulations of particle growth showed good agreement with the experimental results. Competitive growth between M{sub 23}C{sub 6} and the Laves phase showed that M{sub 23}C{sub 6} carbides reached their equilibrium after 12 days, whereas the Laves phase reached equilibrium after 3 months. Simulations of the influence of the interfacial energy and addition of Co, Cu and Si on Laves phase precipitation are presented.

  8. Surfactant controlled growth of GaInP by organometallic vapor phase epitaxy

    Science.gov (United States)

    Lee, R. T.; Shurtleff, J. K.; Fetzer, C. M.; Stringfellow, G. B.; Lee, S.; Seong, T. Y.

    2000-04-01

    The effect of the surfactant Sb has been studied for GaInP semiconductor alloys grown by organometallic vapor phase epitaxy. Dramatic changes in the optical and electrical properties of GaInP with CuPt ordering have been observed. A small concentration of triethylantimony (TESb) in the vapor is found to cause Sb to accumulate at the surface. In situ surface photoabsorption analysis indicates that Sb changes the surface bonding by replacing the [1¯10] P dimers that are responsible for the formation of the CuPt structure during growth with [1¯10] Sb dimers. As a result, the degree of order for the GaInP layers is decreased, as shown by transmission electron diffraction studies. The 20 K photoluminescence spectra show a 131 meV peak energy increase for GaInP layers grown on vicinal substrates when a small amount of Sb [Sb/P(v)=4×10-4] is added to the system during growth. The use of surfactants to control specific properties of materials is expected to be a powerful tool for producing complex structures. In this article, the growth of heterostructures by modulating the Sb concentration in the vapor is demonstrated.

  9. Dynamic light scattering: A fast and reliable method to analyze bacterial growth during the lag phase.

    Science.gov (United States)

    Vargas, Susana; Millán-Chiu, Blanca E; Arvizu-Medrano, Sofía M; Loske, Achim M; Rodríguez, Rogelio

    2017-06-01

    A comparison between plate counting (PC) and dynamic light scattering (DLS) is reported. PC is the standard technique to determine bacterial population as a function of time; however, this method has drawbacks, such as the cumbersome preparation and handling of samples, as well as the long time required to obtain results. Alternative methods based on optical density are faster, but do not distinguish viable from non-viable cells. These inconveniences are overcome by using DLS. Two different bacteria strains were considered: Escherichia coli and Staphylococcus aureus. DLS was performed at two different illuminating conditions: continuous and intermittent. By the increment of particle size as a function of time, it was possible to observe cell division and the formation of aggregates containing very few bacteria. The scattered intensity profiles showed the lag phase and the transition to the exponential phase of growth, providing a quantity proportional to viable bacteria concentration. The results revealed a clear and linear correlation in both lag and exponential phase, between the Log 10 (colony-forming units/mL) from PC and the Log 10 of the scattered intensity I s from DLS. These correlations provide a good support to use DLS as an alternative technique to determine bacterial population. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Investigation of liquid film behavior at the onset of flooding during adiabatic counter-current air-water two-phase flow in an inclined pipe

    International Nuclear Information System (INIS)

    Deendarlianto; Ousaka, Akiharu; Kariyasaki, Akira; Fukano, Tohru

    2005-01-01

    The liquid film characteristics at the onset of flooding in an inclined pipe (16 mm i.d. and 2.2 m in length) have been investigated experimentally. A constant electric current method and visual observation were utilized to elucidate the flow mechanisms at the onset of flooding. Two mechanisms are clarified to control the flooding in lower flooding and upper flooding, respectively. The lower flooding occurred at lower liquid flow rate and high pipe inclination angle. In this mechanism, the liquid film does not block the pipe cross-section. On the other hand, the upper flooding occurred at higher liquid flow rate and low pipe inclination angle. In this case, blocking of the pipe cross-section by large wave and entrainment plays an important role. The experimental data indicated that there was no reversal motion of liquid film at the onset of flooding during the operation of both lower flooding and upper flooding. The effects of pipe inclination angle on the onset of flooding are also discussed

  11. beta Phase Growth and Precipitation in the 5xxx Series Aluminum Alloy System

    Science.gov (United States)

    Scotto D'Antuono, Daniel

    The 5xxx series aluminum alloys are commonly used for structural applications due to their high strength to weight ratio, corrosion resistance, and weldability. This material system is a non-heat treatable aluminum and derives its strength from a super saturation of magnesium (3%>), and from cold rolling. While these materials have many admiral properties, they can undergo a process known as sensitization when exposed to elevated temperatures (50-280°C) for extended periods of time. During this process, magnesium segregates toward the grain boundaries and forms the secondary precipitate β phase (Al3Mg2). When exposed to harsh environments such as sea water, a galvanic couple is formed between the Al matrix and the β phase precipitates. The precipitates become anodic to the matrix and preferentially dissolve leaving gaps along the boundary network, ultimately leading to stress corrosion cracking. While this problem has been known to occur for some time now, questions relating to nucleation sites, misorientation dependence, effect of prior strain, and preferred temperature regimes remain unanswered. The work contained in this thesis attempted to better understand the kinetics, growth, and misorientation dependence, of β phase precipitation using in situ transmission electron microscopy experiments which allowed for direct visualization of the precipitation process. Orientation imaging using a Nanomegas/ASTAR system (OIM in TEM) coupled with the in situ experiments, along with elemental STEM EELs mapping were used to better understand the diffusion of Mg and found low angle boundaries as potential sites for nucleation. The resulting STEM EELs experiments also showed that Mg is much more stable at the grain boundaries than previously thought. Concurrent bulk ex-situ studies were used to compare various heat treatments, as well as to failed in service material showing that the low temperature treatments yield the metastable β’ phase more readily than the

  12. Effect of Strain Restored Energy on Abnormal Grain Growth in Mg Alloy Simulated by Phase Field Methods

    Science.gov (United States)

    Wu, Yan; Huang, Yuan-yuan

    2018-03-01

    Abnormal grain growth of single phase AZ31 Mg alloy in the spatio-temporal process has been simulated by phase field models, and the influencing factors of abnormal grain growth are studied in order to find the ways to control secondary recrystallization in the microstructure. The study aims to find out the mechanisms for abnormal grain growth in real alloys. It is shown from the simulated results that the abnormal grain growth can be controlled by the strain restored energy. Secondary recrystallization after an annealing treatment can be induced if there are grains of a certain orientation in the microstructure with local high restored energy. However, if the value of the local restored energy at a certain grain orientation is not greater than 1.1E 0, there may be no abnormal grain growth in the microstructure.

  13. Measuring laves phase particle size and thermodynamic calculating its growth and coarsening behavior in P92 steels

    DEFF Research Database (Denmark)

    Yao, Bing-Yin; Zhou, Rong-Can; Fan, Chang-Xin

    2010-01-01

    The growth of Laves phase particles in three kinds of P92 steels were investigated. Laves phase particles can be easily separated and distinguished from the matrix and other particles by atom number contrast using comparisons of the backscatter electrons (BSE) images and the secondary electrons (SE......) images in scanning electron microscope (SEM). The smaller Laves phase particle size results in higher creep strength and longer creep exposure time at the same conditions. DICTRA software was used to model the growth and coarsening behavior of Laves phase in the three P92 steels. Good agreements were...... attained between measurements in SEM and modeling by DICTRA. Ostwald ripening should be used for the coarsening calculation of Laves phase in P92 steels for time longer than 20000 h and 50000 h at 650°C and 600°C, respectively. © 2010 Chin. Soc. for Elec. Eng....

  14. Vapor phase growth and photoluminescence of oriented-attachment Zn2GeO4 nanorods array

    Science.gov (United States)

    Tang, Haiping; Zhu, Xingda; He, Haiping

    2016-10-01

    We carry out one-step vapor phase growth of high quality Zn2GeO4 nanorods array to provide insights into the growth mechanism of such ternary oxide nanostructures. The morphology and microstructure of these nanorods are investigated carefully. Under certain conditions, the nanorods follow the oriented-attachment growth which is unusual in vapor-based growth. Each nanorod consists of many nanocrystals aligned along the [110] direction. The nanorods show strong deep ultraviolet absorption around 260 nm and broad longlife green luminescence around 490 nm.

  15. A model for growth of beta-phase particles in zirconium-2.5 wt percent niobium

    International Nuclear Information System (INIS)

    Chow, C.K.; Liner, Y.; Rigby, G.L.

    1984-08-01

    The kinetics of the α → β phase change in Zr-2.5 percent Nb pressure-tube material at constant temperature have been studied. The volume-fraction change of the β phase due to diffusion in an infinite α-phase matrix was considered, and a mathematical model with a numerical solution was developed to predict the transient spherical growth of the β-phase region. This model has been applied to Zr-2.5 wt percent Nb, and the calculated results compared to experiment

  16. Effect of Magnetic Field on Saccharomyces cerevisiae Growth Rate and Division Phases

    International Nuclear Information System (INIS)

    El-Deen, Sh.Sh.

    2005-01-01

    The effect of Electromagnetic field (EMF) on growth rate and twokinds of meiotic and mititic divisions were studied in homothallic S. cerevisiae strain. An electromagnetic field (H) was used as 0.5 T and 1.0 T for 5,10 and 15 minutes. The yeast strain (local isolate, Iso-2) was haploid wild type. It was fluctuated of viable cell number or the survival percent from the beginning to the end growth time in this study (72h). The cell survival percent was decreased within 4th h from the beginning of inoculation. It was 53% at 4 h. The cell survival percent was the highest (94.8%) when cell culture exposed to 0.5 T for 15 min. EMF had been improvement to cell divdsion gap through the second or third generation to reveal 96% replacement low viable without EMF. Initiation, some haploid cells were converted to diploid phases; 60 diploids from 1*10 3 haploid cells. The diploids produced 4 asci. These percent had been increased to 260 diploids phase when its exposure to EMF 1.0 T for 10min. The diploids produced 25 asci. While with 0.5 T for 10 min was convenient to convert these diploids to asci (80%). Morphologically and cytologically does not experiment, neither 0.5 T nor 1.0 T increased cells vacuole size. EMF at 0.5 T for 15 min was induced chromosomes and cell division there were some phass of late metaphase and anaphase within the same culture beginning from single cell and exposed to magnetic field

  17. Do rapid BMI growth in childhood and early-onset obesity offer cardiometabolic protection to obese adults in mid-life?

    DEFF Research Database (Denmark)

    Howe, Laura D; Zimmermann, Esther; Weiss, Ram

    2014-01-01

    -onset obesity may be associated with MHO. We aimed to assess whether body mass index (BMI) in childhood and early-onset obesity are associated with MHO. SETTING: General population longitudinal cohort study, Denmark. PARTICIPANTS: From 362 200 young men (mean age 20) examined for Danish national service between......OBJECTIVE: Some obese individuals have no cardiometabolic abnormalities; they are 'metabolically healthy, but obese' (MHO). Similarly, some non-obese individuals have cardiometabolic abnormalities, that is, 'metabolically at risk, normal weight' (MANW). Previous studies have suggested that early...... 1943 and 1977, all obese men (BMI ≥31 kg/m(2), N=1930) were identified along with a random 1% sample of the others (N=3601). Our analysis includes 2392 of these men attending a research clinic in mid-life (mean age 42). For 613 of these men, data on childhood BMI are available. We summarised childhood...

  18. Plant and Floret Growth at Distinct Developmental Stages During the Stem Elongation Phase in Wheat

    Directory of Open Access Journals (Sweden)

    Zifeng Guo

    2018-03-01

    Full Text Available Floret development is critical for grain setting in wheat (Triticum aestivum, but more than 50% of grain yield potential (based on the maximum number of floret primordia is lost during the stem elongation phase (SEP, from the terminal spikelet stage to anthesis. Dynamic plant (e.g., leaf area, plant height and floret (e.g., anther and ovary size growth and its connection with grain yield traits (e.g., grain number and width are not clearly understood. In this study, for the first time, we dissected the SEP into seven stages to investigate plant (first experiment and floret (second experiment growth in greenhouse- and field-grown wheat. In the first experiment, the values of various plant growth trait indices at different stages were generally consistent between field and greenhouse and were independent of the environment. However, at specific stages, some traits significantly differed between the two environments. In the second experiment, phenotypic and genotypic similarity analysis revealed that grain number and size corresponded closely to ovary size at anthesis, suggesting that ovary size is strongly associated with grain number and size. Moreover, principal component analysis (PCA showed that the top six principal components PCs explained 99.13, 98.61, 98.41, 98.35, and 97.93% of the total phenotypic variation at the green anther, yellow anther, tipping, heading, and anthesis stages, respectively. The cumulative variance explained by the first PC decreased with floret growth, with the highest value detected at the green anther stage (88.8% and the lowest at the anthesis (50.09%. Finally, ovary size at anthesis was greater in wheat accessions with early release years than in accessions with late release years, and anther/ovary size shared closer connections with grain number/size traits at the late vs. early stages of floral development. Our findings shed light on the dynamic changes in plant and floret growth-related traits in wheat and the

  19. Associations of Birth Order with Early Adolescent Growth, Pubertal Onset, Blood Pressure and Size: Evidence from Hong Kong?s ?Children of 1997? Birth Cohort

    OpenAIRE

    Kwok, Man Ki; Leung, Gabriel M.; Schooling, C. Mary

    2016-01-01

    Background Birth order has been proposed as a cardiovascular risk factor, because the lower birth weight and greater infant weight gain typical of firstborns could programme metabolism detrimentally. Methods We examined the associations of birth order (firstborn or laterborn) with birth weight-for-gestational age, length/height and body mass index (BMI) z-scores during infancy, childhood, and puberty using generalized estimating equations, with age at pubertal onset using interval-censored re...

  20. Solution-Phase Epitaxial Growth of Quasi-Monocrystalline Cuprous Oxide on Metal Nanowires

    Science.gov (United States)

    2014-01-01

    The epitaxial growth of monocrystalline semiconductors on metal nanostructures is interesting from both fundamental and applied perspectives. The realization of nanostructures with excellent interfaces and material properties that also have controlled optical resonances can be very challenging. Here we report the synthesis and characterization of metal–semiconductor core–shell nanowires. We demonstrate a solution-phase route to obtain stable core–shell metal–Cu2O nanowires with outstanding control over the resulting structure, in which the noble metal nanowire is used as the nucleation site for epitaxial growth of quasi-monocrystalline Cu2O shells at room temperature in aqueous solution. We use X-ray and electron diffraction, high-resolution transmission electron microscopy, energy dispersive X-ray spectroscopy, photoluminescence spectroscopy, and absorption spectroscopy, as well as density functional theory calculations, to characterize the core–shell nanowires and verify their structure. Metal–semiconductor core–shell nanowires offer several potential advantages over thin film and traditional nanowire architectures as building blocks for photovoltaics, including efficient carrier collection in radial nanowire junctions and strong optical resonances that can be tuned to maximize absorption. PMID:25233392

  1. Proteomic analysis of lactose-starved Lactobacillus casei during stationary growth phase.

    Science.gov (United States)

    Hussain, M A; Knight, M I; Britz, M L

    2009-03-01

    Starvation stress is a condition that nonstarter lactic acid bacteria (NSLAB) normally encounter. This study was aimed to investigate starvation-induced proteins in Lactobacillus casei during stationary growth phase. The impact of carbohydrate starvation on L. casei GCRL163 was investigated using two different media (a modified de Man, Rogosa and Sharpe broth and a semi-defined medium). Cells were grown in the presence of excess lactose (1%) or starvation (0%) and differences in the patterns of one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis and two-dimensional electrophoresis of the cytosolic protein fractions were investigated. Differentially regulated proteins were identified by MALDI-TOF/TOF mass spectrometry. Many differentially regulated proteins were enzymes of various metabolic pathways involved in carbohydrate metabolism to yield energy. Differences in protein expression were also observed in the two culture conditions tested in this experiment. Numerous glycolytic enzymes were differentially regulated under lactose starvation. The differential expression of these glycolytic enzymes suggests a potential survival strategy under harsh growth conditions (i.e. lactose starvation). This paper reports improved understanding of stress responses and survival mechanism of NSLAB under lactose-depleted cheese-ripening condition. This knowledge of how NSLAB bacteria adapt to lactose starvation could be applied to predict the performances of bacteria in other industrial applications.

  2. Proteomic Analysis of Bacillus thuringiensis Strain 4.0718 at Different Growth Phases

    Directory of Open Access Journals (Sweden)

    Xiaohui Li

    2012-01-01

    Full Text Available The growth process of Bacillus thuringiensis Bt4.0718 strain was studied using proteomic technologies. The proteins of Bt whole cells at three phases—middle vegetative, early sporulation, and late sporulation—were extracted with lysis buffer, followed with separation by 2-DE and identified by MALDI-TOF/TOF MS. Bioactive factors such as insecticidal crystal proteins (ICPs including Cry1Ac(3, Cry2Aa, and BTRX28, immune inhibitor (InhA, and InhA precursor were identified. InhA started to express at the middle vegetative phase, suggesting its contribution to the survival of Bt in the host body. At the early sporulation phase, ICPs started their expression. CotJC, OppA, ORF1, and SpoIVA related to the formation of crystals and spores were identified, the expression characteristics of which ensured the stable formation of crystals and spores. This study provides an important foundation for further exploration of the stable expression of ICPs, the smooth formation of crystals, and the construction of recombinant strains.

  3. Patterns of onset and resolution of immune-related adverse events of special interest with ipilimumab: detailed safety analysis from a phase 3 trial in patients with advanced melanoma.

    Science.gov (United States)

    Weber, Jeffrey S; Dummer, Reinhard; de Pril, Veerle; Lebbé, Celeste; Hodi, F Stephen

    2013-05-01

    Ipilimumab 3 mg/kg was the first agent to demonstrate improved survival in previously treated patients with metastatic melanoma in a phase 3 trial (MDX010-20). Ipilimumab produced a characteristic spectrum of immune-related adverse events (irAEs) of special interest, consistent with its immune-based mechanism of action. In MDX010-20, 676 previously treated patients were randomized 3:1:1 to receive ipilimumab 3 mg/kg plus the glycoprotein 100 melanoma antigen vaccine (gp100), ipilimumab 3 mg/kg + placebo, or gp100 vaccine + placebo. For the current report, the authors conducted a detailed analysis of the time to onset and resolution of irAEs associated with ipilimumab therapy. Grade 2 through 5 irAEs generally developed during the induction phase of treatment (0-12 weeks). Most, including grade 3/4 irAEs, were reversible when managed with treatment guidelines using vigilant monitoring and corticosteroids. The median time to resolution (to grade 1 or 0 or to the grade at baseline) of irAEs that had an onset during the induction phase was approximately 6 weeks for grade 2 through 4 irAEs and 8 weeks for grade 3 and 4 irAEs. Across the entire study duration, most grade 2 through 4 irAEs resolved within 12 weeks. Most ipilimumab-associated irAEs, including grade 3/4 symptoms, developed within 12 weeks of initial dosing and resolved within 12 weeks of onset. IrAEs were well characterized in their evolution and could be managed using published algorithms. Copyright © 2013 American Cancer Society.

  4. Experiments and Phase-field Modeling of Hydrate Growth at the Interface of Migrating Gas Fingers

    Science.gov (United States)

    Fu, X.; Jimenez-Martinez, J.; Porter, M. L.; Cueto-Felgueroso, L.; Juanes, R.

    2016-12-01

    The fate of methane bubbles escaping from seafloor seeps remains an important research question, as it directly concerns our understanding of the impact of seafloor methane leakage on ocean biogeochemistry. While the physics of rising bubbles in a water column has been studied extensively, the process is poorly understood when the gas bubbles form a hydrate ``crust" during their ascent. Understanding bubble rise, expansion and dissolution under these conditions is essential to determine the fate of bubble plumes of hydrate-forming gases such as methane and carbon dioxide from natural and man-made accidental releases. Here, we first present experimental observations of the dynamics of a bubble of Xenon in a water-filled and pressurized Hele-Shaw cell. The evolution is controlled by two processes: (1) the formation of a hydrate "crust" around the bubble, and (2) viscous fingering from bubble expansion (Figure 1). To reproduce the experimental observations, we propose a phase-field model that describes the nucleation and thickening of a porous solid shell on a moving gas-liquid interface. We design the free energy of the three-phase system (gas-liquid-hydrate) to rigorously account for interfacial effects, mutual solubility, and phase transformations (hydrate formation and disappearance). We introduce a pseudo-plasticity model with large viscosity variations to describe the plate-like rheology of the hydrate shell. We present high-resolution numerical simulations of the model, which illustrate the emergence of complex "crustal fingering" patterns as a result of gas fingering dynamics modulated by hydrate growth at the interface. Figure caption: Snapshot of the Hele-Shaw cell experiment. As the bubble expands from depressurization of the cell, gas fingers move through the liquid and Xe-hydrate readily forms at the gas-liquid interface, giving rise to complex "crustal fingering" patterns.

  5. Growth heterogeneity in broiler breeder pullets is settled before the onset of feed restriction but is not predicted by size at hatch

    NARCIS (Netherlands)

    Lindholm, C.; Jönsson, J.; Calais, A.; Middelkoop, A.; Yngwe, N.; Berndtson, E.; Lees, J.J.; Hult, E.; Altimiras, J.

    2017-01-01

    Uniform growth is a desirable trait in all large-scale animal production systems because it simplifies animal management and increases profitability. In parental broiler flocks, so-called broiler breeders, low growth uniformity is largely attributed to the feed competition that arises from

  6. Influence of second-phase particles on grain growth in AZ31 magnesium alloy during equal channel angular pressing by phase field simulation

    Science.gov (United States)

    He, Ri; Wang, Mingtao; Zhang, Xiangang; Yaping Zong, Bernie

    2016-06-01

    A phase-field model was established to simulate the refinement effect of different morphological factors of second-phase particles such as Al2O3 on the grain growth of AZ31 magnesium alloy during equal channel angular pressing (ECAP) in realistic spatiotemporal evolution. The simulation results agreed well with limited existing experimental data for the ECAP-processed AZ31 magnesium alloy and were consistent with the law of Zener. Simulations were performed to evaluate the influences of the fraction, size, distribution, and shape of incoherent second-phase particles. The simulation results showed that during high-temperature ECAP processes, the addition of 2 wt.% Al2O3 particles resulted in a strong refinement effect, reducing the grain size by 28.7% compared to that of the alloy without the particles. Nevertheless, when the fraction of particles was greater than 4 wt.%, adding more particles had little effect. In AZ31 Mg alloy, it was found that second-phase particles should have a critical size of 0.5-0.8 μm for the grain refinement effect to occur. If the size is smaller than the critical size, large particles will strongly hinder grain growth; in contrast, if the size is larger than the critical size, large particles will exhibit a weaker hindering effect than small particles. Moreover, the results showed that the refinement effect increased with increasing particle fraction located at grain boundaries with respect to the total particle content. However, the refinement effect was less pronounced when the fraction of particles located at boundaries was greater than 70%. Further simulations indicated that spherical second-phase particles hindered grain growth more than ellipsoid particles and much more than rod-shaped particles when the volume fraction of reinforcing particles was 2%. However, when the volume fraction was greater than 8%, rod-shaped particles best hindered grain growth, and spherical particles exhibited the weakest effect.

  7. Pb sub(1-x) Sn sub(x) Te monocrystal growth by vapor phase transport, with formation of a liquid/solid growth interphase

    International Nuclear Information System (INIS)

    An, C.Y.; Bandeira, I.N.

    1983-01-01

    Due to segregation effects single-crystals of Pb sub(1-x) Sn sub(x) Te growth by Bridgman techniques have an inhomogenous composition profile. A vapor phase transport growth process has been developed in order to reduce convective flows. This is due to the very thin melt layer in front of the crystal, that makes convective flows small and solute mixing in the melt very low. By this process single-crystals with 60 mm lenght by 15 mm diameter and a high degree of homogeneity have been grown. (Author) [pt

  8. Critical Role of Transforming Growth Factor Beta in Different Phases of Wound Healing.

    Science.gov (United States)

    Pakyari, Mohammadreza; Farrokhi, Ali; Maharlooei, Mohsen Khosravi; Ghahary, Aziz

    2013-06-01

    This review highlights the critical role of transforming growth factor beta (TGF-β)1-3 within different phases of wound healing, in particular, late-stage wound healing. It is also very important to identify the TGF-β1-controlling factors involved in slowing down the healing process upon wound epithelialization. TGF-β1, as a growth factor, is a known proponent of dermal fibrosis. Several strategies to modulate or regulate TGF's actions have been thoroughly investigated in an effort to create successful therapies. This study reviews current discourse regarding the many roles of TGF-β1 in wound healing by modulating infiltrated immune cells and the extracellular matrix. It is well established that TGF-β1 functions as a wound-healing promoting factor, and thereby if in excess it may lead to overhealing outcomes, such as hypertrophic scarring and keloid. Thus, the regulation of TGF-β1 in the later stages of the healing process remains as critical issue of which to better understand. One hypothesis is that cell communication is the key to regulate later stages of wound healing. To elucidate the role of keratinocyte/fibroblast cross talk in controlling the later stages of wound healing we need to: (1) identify those keratinocyte-released factors which would function as wound-healing stop signals, (2) evaluate the functionality of these factors in controlling the outcome of the healing process, and (3) formulate topical vehicles for these antifibrogenic factors to improve or even prevent the development of hypertrophic scarring and keloids as a result of deep trauma, burn injuries, and any type of surgical incision.

  9. Measuring laves phase particle size and thermodynamic calculating its growth and coarsening behavior in P92 steels

    DEFF Research Database (Denmark)

    Yao, Bing-Yin; Zhou, Rong-Can; Fan, Chang-Xin

    2010-01-01

    The growth of Laves phase particles in three kinds of P92 steels were investigated. Laves phase particles can be easily separated and distinguished from the matrix and other particles by atom number contrast using comparisons of the backscatter electrons (BSE) images and the secondary electrons (...... attained between measurements in SEM and modeling by DICTRA. Ostwald ripening should be used for the coarsening calculation of Laves phase in P92 steels for time longer than 20000 h and 50000 h at 650°C and 600°C, respectively. © 2010 Chin. Soc. for Elec. Eng....

  10. Growth, intermixing, and surface phase formation for zinc tin oxide nanolaminates produced by atomic layer deposition

    Energy Technology Data Exchange (ETDEWEB)

    Hägglund, Carl, E-mail: carl.hagglund@angstrom.uu.se [Department of Chemical Engineering, Stanford University, Stanford, California 94305 and Department of Engineering Sciences, Division of Solid State Electronics, Uppsala University, 75121 Uppsala (Sweden); Grehl, Thomas; Brongersma, Hidde H. [ION-TOF GmbH, Heisenbergstraße 15, 48149 Münster (Germany); Tanskanen, Jukka T.; Mullings, Marja N.; Mackus, Adriaan J. M.; MacIsaac, Callisto; Bent, Stacey Francine, E-mail: sbent@stanford.edu [Department of Chemical Engineering, Stanford University, Stanford, California 94305 (United States); Yee, Ye Sheng [Department of Electrical Engineering, Stanford University, Stanford, California 94305 (United States); Clemens, Bruce M. [Department of Material Science and Engineering, Stanford University, Stanford, California 94305 (United States)

    2016-03-15

    A broad and expanding range of materials can be produced by atomic layer deposition at relatively low temperatures, including both oxides and metals. For many applications of interest, however, it is desirable to grow more tailored and complex materials such as semiconductors with a certain doping, mixed oxides, and metallic alloys. How well such mixed materials can be accomplished with atomic layer deposition requires knowledge of the conditions under which the resulting films will be mixed, solid solutions, or laminated. The growth and lamination of zinc oxide and tin oxide is studied here by means of the extremely surface sensitive technique of low energy ion scattering, combined with bulk composition and thickness determination, and x-ray diffraction. At the low temperatures used for deposition (150 °C), there is little evidence for atomic scale mixing even with the smallest possible bilayer period, and instead a morphology with small ZnO inclusions in a SnO{sub x} matrix is deduced. Postannealing of such laminates above 400 °C however produces a stable surface phase with a 30% increased density. From the surface stoichiometry, this is likely the inverted spinel of zinc stannate, Zn{sub 2}SnO{sub 4}. Annealing to 800 °C results in films containing crystalline Zn{sub 2}SnO{sub 4}, or multilayered films of crystalline ZnO, Zn{sub 2}SnO{sub 4}, and SnO{sub 2} phases, depending on the bilayer period.

  11. Plasma Membrane Proteomics of Arabidopsis Suspension-Cultured Cells Associated with Growth Phase Using Nano-LC-MS/MS.

    Science.gov (United States)

    Li, Bin; Takahashi, Daisuke; Kawamura, Yukio; Uemura, Matsuo

    2018-01-01

    Arabidopsis thaliana suspension-cultured cells (T87 line) are important model system for studies of responses to biotic and abiotic stresses at the cellular level in vitro since the cells have certain advantages compared with the whole plant system. However, the physiological and morphological characteristics of the cells are influenced by the progress of the growth phase of cells, which may result in different stress tolerance. To obtain comprehensive proteome profiles of the plasma membrane of Arabidopsis thaliana T87 suspension-cultured cells at the lag, log, or stationary growth phase, a shotgun proteomics method using nano-LC-MS/MS is used. The results obtained indicate that proteome profiles of the plasma membrane with the progress of the growth phase of cells dynamically changed, which may be associated with the physiological and morphological characteristics of the plasma membrane of the suspension-cultured cells. The proteomics results are further applied to explain different responsive patterns in the plasma membrane to cold acclimation and ABA treatment, which lead to understanding of different freezing tolerance associated with the growth phase of the cells.

  12. Production of Vibrio vulnificus metalloprotease VvpE begins during the early growth phase: usefulness of gelatin-zymography.

    Science.gov (United States)

    Kim, Choon-Mee; Kang, Sang-Mee; Jeon, Ho-Jong; Shin, Sung-Heui

    2007-07-01

    Recent studies have demonstrated that expression of the vvpE gene begins during the early growth phase albeit at low levels. However, we found that the traditional protease assay method that is used to measure caseinolytic activity in culture supernatants is not suitable for the measurement of extracellular VvpE that is produced at low levels during the early growth phase. By using gelatin-zymography in place of the protease assay, we could specifically detect only VvpE of several proteases produced by Vibrio vulnificus. Moreover, we could sensitively measure VvpE produced at low levels during the early growth phase, which was consistent with transcription of the vvpE gene. The extracellular production of VvpE was reduced or delayed by mutation of the pilD gene which encodes for the type IV leader peptidase/N-methyltransferase associated with the type II general secretion system; the delayed production of VvpE was recovered by in trans complementation of the wild-type pilD gene. These results indicate that VvpE begins to be produced during the early growth phase via the PilD-mediated type II general secretion system, and that the use of gelatin-zymography is recommended as a simple method for the sensitive and specific detection of VvpE production.

  13. Phase transition control, melt growth of (Gd,RE)F.sub.3./sub. single crystal and their luminescent properties

    Czech Academy of Sciences Publication Activity Database

    Yoshikawa, A.; Jouini, A.; Kamada, K.; Boulon, G.; Nikl, Martin; Saito, F.

    2009-01-01

    Roč. 129, č. 12 (2009), s. 1646-1650 ISSN 0022-2313 R&D Projects: GA AV ČR KAN300100802; GA MŠk ME 953 Institutional research plan: CEZ:AV0Z10100521 Keywords : phase transition * growth from melt * fluoride * luminescent materials Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.847, year: 2009

  14. VO2 (A): Reinvestigation of crystal structure, phase transition and crystal growth mechanisms

    Science.gov (United States)

    Rao Popuri, Srinivasa; Artemenko, Alla; Labrugere, Christine; Miclau, Marinela; Villesuzanne, Antoine; Pollet, Michaël

    2014-05-01

    Well crystallized VO2 (A) microrods were grown via a single step hydrothermal reaction in the presence of V2O5 and oxalic acid. With the advantage of high crystalline samples, we propose P4/ncc as an appropriate space group at room temperature. From morphological studies, we found that the oriented attachment and layer by layer growth mechanisms are responsible for the formation of VO2 (A) micro rods. The structural and electronic transitions in VO2 (A) are strongly first order in nature, and a marked difference between the structural transition temperatures and electronic transitions temperature was evidenced. The reversible intra- (LTP-A to HTP-A) and irreversible inter- (HTP-A to VO2 (M1)) structural phase transformations were studied by in-situ powder X-ray diffraction. Attempts to increase the size of the VO2 (A) microrods are presented and the possible formation steps for the flower-like morphologies of VO2 (M1) are described.

  15. Synchronous protein cycling in batch cultures of the yeast Saccharomyces cerevisiae at log growth phase.

    Science.gov (United States)

    Romagnoli, Gabriele; Cundari, Enrico; Negri, Rodolfo; Crescenzi, Marco; Farina, Lorenzo; Giuliani, Alessandro; Bianchi, Michele M

    2011-12-10

    The assumption that cells are temporally organized systems, i.e. showing relevant dynamics of their state variables such as gene expression or protein and metabolite concentration, while tacitly given for granted at the molecular level, is not explicitly taken into account when interpreting biological experimental data. This conundrum stems from the (undemonstrated) assumption that a cell culture, the actual object of biological experimentation, is a population of billions of independent oscillators (cells) randomly experiencing different phases of their cycles and thus not producing relevant coordinated dynamics at the population level. Moreover the fact of considering reproductive cycle as by far the most important cyclic process in a cell resulted in lower attention given to other rhythmic processes. Here we demonstrate that growing yeast cells show a very repeatable and robust cyclic variation of the concentration of proteins with different cellular functions. We also report experimental evidence that the mechanism governing this basic oscillator and the cellular entrainment is resistant to external chemical constraints. Finally, cell growth is accompanied by cyclic dynamics of medium pH. These cycles are observed in batch cultures, different from the usual continuous cultures in which yeast metabolic cycles are known to occur, and suggest the existence of basic, spontaneous, collective and synchronous behaviors of the cell population as a whole. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Fundamental aspects of nucleation and growth in the solution-phase synthesis of germanium nanocrystals

    KAUST Repository

    Codoluto, Stephen C.

    2010-01-01

    Colloidal Ge nanocrystals (NCs) were synthesized via the solution phase reduction of germanium(ii) iodide. We report a systematic investigation of the nanocrystal nucleation and growth as a function of synthesis conditions including the nature of coordinating solvents, surface bound ligands, synthesis duration and temperature. NC synthesis in reaction environments with weakly bound phosphine surface ligand led to the coalescence of nascent particles leading to ensembles with broad lognormal particle diameter distributions. Synthesis in the presence of amine or alkene ligands mitigated particle coalescence. High-resolution transmission electron micrographs revealed that NCs grown in the presence of weak ligands had a high crystal defect density whereas NCs grown in amine solutions were predominantly defect-free. We applied infrared spectroscopy to study the NC surface chemistry and showed that alkene ligands project the NCs from surface oxidation. Photoluminescence spectroscopy measurements showed that alkene ligands passivate surface traps, as indicated by infrared fluorescence, conversely oxidized phosphine and amine passivated NCs did not fluoresce. © 2010 The Royal Society of Chemistry.

  17. Metabolic flux analysis during the exponential growth phase of Saccharomyces cerevisiae in wine fermentations.

    Science.gov (United States)

    Quirós, Manuel; Martínez-Moreno, Rubén; Albiol, Joan; Morales, Pilar; Vázquez-Lima, Felícitas; Barreiro-Vázquez, Antonio; Ferrer, Pau; Gonzalez, Ramon

    2013-01-01

    As a consequence of the increase in global average temperature, grapes with the adequate phenolic and aromatic maturity tend to be overripe by the time of harvest, resulting in increased sugar concentrations and imbalanced C/N ratios in fermenting musts. This fact sets obvious additional hurdles in the challenge of obtaining wines with reduced alcohols levels, a new trend in consumer demands. It would therefore be interesting to understand Saccharomyces cerevisiae physiology during the fermentation of must with these altered characteristics. The present study aims to determine the distribution of metabolic fluxes during the yeast exponential growth phase, when both carbon and nitrogen sources are in excess, using continuous cultures. Two different sugar concentrations were studied under two different winemaking temperature conditions. Although consumption and production rates for key metabolites were severely affected by the different experimental conditions studied, the general distribution of fluxes in central carbon metabolism was basically conserved in all cases. It was also observed that temperature and sugar concentration exerted a higher effect on the pentose phosphate pathway and glycerol formation than on glycolysis and ethanol production. Additionally, nitrogen uptake, both quantitatively and qualitatively, was strongly influenced by environmental conditions. This work provides the most complete stoichiometric model used for Metabolic Flux Analysis of S. cerevisiae in wine fermentations employed so far, including the synthesis and release of relevant aroma compounds and could be used in the design of optimal nitrogen supplementation of wine fermentations.

  18. Metabolic flux analysis during the exponential growth phase of Saccharomyces cerevisiae in wine fermentations.

    Directory of Open Access Journals (Sweden)

    Manuel Quirós

    Full Text Available As a consequence of the increase in global average temperature, grapes with the adequate phenolic and aromatic maturity tend to be overripe by the time of harvest, resulting in increased sugar concentrations and imbalanced C/N ratios in fermenting musts. This fact sets obvious additional hurdles in the challenge of obtaining wines with reduced alcohols levels, a new trend in consumer demands. It would therefore be interesting to understand Saccharomyces cerevisiae physiology during the fermentation of must with these altered characteristics. The present study aims to determine the distribution of metabolic fluxes during the yeast exponential growth phase, when both carbon and nitrogen sources are in excess, using continuous cultures. Two different sugar concentrations were studied under two different winemaking temperature conditions. Although consumption and production rates for key metabolites were severely affected by the different experimental conditions studied, the general distribution of fluxes in central carbon metabolism was basically conserved in all cases. It was also observed that temperature and sugar concentration exerted a higher effect on the pentose phosphate pathway and glycerol formation than on glycolysis and ethanol production. Additionally, nitrogen uptake, both quantitatively and qualitatively, was strongly influenced by environmental conditions. This work provides the most complete stoichiometric model used for Metabolic Flux Analysis of S. cerevisiae in wine fermentations employed so far, including the synthesis and release of relevant aroma compounds and could be used in the design of optimal nitrogen supplementation of wine fermentations.

  19. Changes in Microbial Energy Metabolism Measured by Nanocalorimetry during Growth Phase Transitions

    Science.gov (United States)

    Robador, Alberto; LaRowe, Douglas E.; Finkel, Steven E.; Amend, Jan P.; Nealson, Kenneth H.

    2018-01-01

    Calorimetric measurements of the change in heat due to microbial metabolic activity convey information about the kinetics, as well as the thermodynamics, of all chemical reactions taking place in a cell. Calorimetric measurements of heat production made on bacterial cultures have recorded the energy yields of all co-occurring microbial metabolic reactions, but this is a complex, composite signal that is difficult to interpret. Here we show that nanocalorimetry can be used in combination with enumeration of viable cell counts, oxygen consumption rates, cellular protein content, and thermodynamic calculations to assess catabolic rates of an isolate of Shewanella oneidensis MR-1 and infer what fraction of the chemical energy is assimilated by the culture into biomass and what fraction is dissipated in the form of heat under different limiting conditions. In particular, our results demonstrate that catabolic rates are not necessarily coupled to rates of cell division, but rather, to physiological rearrangements of S. oneidensis MR-1 upon growth phase transitions. In addition, we conclude that the heat released by growing microorganisms can be measured in order to understand the physiochemical nature of the energy transformation and dissipation associated with microbial metabolic activity in conditions approaching those found in natural systems. PMID:29449836

  20. Associations of Birth Order with Early Adolescent Growth, Pubertal Onset, Blood Pressure and Size: Evidence from Hong Kong's "Children of 1997" Birth Cohort.

    Science.gov (United States)

    Kwok, Man Ki; Leung, Gabriel M; Schooling, C Mary

    2016-01-01

    Birth order has been proposed as a cardiovascular risk factor, because the lower birth weight and greater infant weight gain typical of firstborns could programme metabolism detrimentally. We examined the associations of birth order (firstborn or laterborn) with birth weight-for-gestational age, length/height and body mass index (BMI) z-scores during infancy, childhood, and puberty using generalized estimating equations, with age at pubertal onset using interval-censored regression and with age-, sex- and height-standardized blood pressure, height and BMI z-scores at 13 years using linear regression in a population-representative Chinese birth cohort: "Children of 1997" (n = 8,327). Compared with laterborns, firstborns had lower birth weight-for-gestational age (mean difference = -0.18 z-score, 95% confidence interval (CI) -0.23, -0.14), lower infant BMI (-0.09 z-score, 95% CI -0.14, -0.04), greater childhood height (0.10 z-score, 95% CI 0.05, 0.14) and BMI (0.08 z-score, 95% CI 0.03, 0.14), but not greater pubertal BMI (0.05 z-score, 95% CI -0.02, 0.11), adjusted for sex, parental age, birthplace, education and income. Firstborns had earlier onset of pubic hair (time ratio = 0.988, 95% CI 0.980, 0.996), but not breast or genitalia, development. Firstborns had greater BMI (0.07 z-score, 95% CI 0.002, 0.15), but not height (0.05 z-score, 95% CI -0.01, 0.11), at 13 years, but similar blood pressure. Differences by birth order continue into early adolescence with firstborns being heavier with earlier pubic hair development, which could indicate long-term cardiovascular risk.

  1. Associations of Birth Order with Early Adolescent Growth, Pubertal Onset, Blood Pressure and Size: Evidence from Hong Kong's "Children of 1997" Birth Cohort.

    Directory of Open Access Journals (Sweden)

    Man Ki Kwok

    Full Text Available Birth order has been proposed as a cardiovascular risk factor, because the lower birth weight and greater infant weight gain typical of firstborns could programme metabolism detrimentally.We examined the associations of birth order (firstborn or laterborn with birth weight-for-gestational age, length/height and body mass index (BMI z-scores during infancy, childhood, and puberty using generalized estimating equations, with age at pubertal onset using interval-censored regression and with age-, sex- and height-standardized blood pressure, height and BMI z-scores at 13 years using linear regression in a population-representative Chinese birth cohort: "Children of 1997" (n = 8,327.Compared with laterborns, firstborns had lower birth weight-for-gestational age (mean difference = -0.18 z-score, 95% confidence interval (CI -0.23, -0.14, lower infant BMI (-0.09 z-score, 95% CI -0.14, -0.04, greater childhood height (0.10 z-score, 95% CI 0.05, 0.14 and BMI (0.08 z-score, 95% CI 0.03, 0.14, but not greater pubertal BMI (0.05 z-score, 95% CI -0.02, 0.11, adjusted for sex, parental age, birthplace, education and income. Firstborns had earlier onset of pubic hair (time ratio = 0.988, 95% CI 0.980, 0.996, but not breast or genitalia, development. Firstborns had greater BMI (0.07 z-score, 95% CI 0.002, 0.15, but not height (0.05 z-score, 95% CI -0.01, 0.11, at 13 years, but similar blood pressure.Differences by birth order continue into early adolescence with firstborns being heavier with earlier pubic hair development, which could indicate long-term cardiovascular risk.

  2. Multi-phase-field study of the effects of anisotropic grain-boundary properties on polycrystalline grain growth

    Science.gov (United States)

    Miyoshi, Eisuke; Takaki, Tomohiro

    2017-09-01

    Numerical studies of the effects of anisotropic (misorientation-dependent) grain-boundary energy and mobility on polycrystalline grain growth have been carried out for decades. However, conclusive knowledge has yet to be obtained even for the simplest two-dimensional case, which is mainly due to limitations in the computational accuracy of the grain-growth models and computer resources that have been employed to date. Our study attempts to address these problems by utilizing a higher-order multi-phase-field (MPF) model, which was developed to accurately simulate grain growth with anisotropic grain-boundary properties. In addition, we also employ general-purpose computing on graphics processing units to accelerate MPF grain-growth simulations. Through a series of simulations of anisotropic grain growth, we succeeded in confirming that both the anisotropies in grain-boundary energy and mobility affect the morphology formed during grain growth. On the other hand, we found the grain growth kinetics in anisotropic systems to follow parabolic law similar to isotropic growth, but only after an initial transient period.

  3. Determination of the electroporation onset of bilayer lipid membranes as a novel approach to establish ternary phase diagrams: example of the L-α-PC/SM/cholesterol system

    NARCIS (Netherlands)

    van Uitert, I.; le Gac, Severine; van den Berg, Albert

    2010-01-01

    The lipid matrix of cell membranes contains phospholipids belonging to two main classes, glycero- and sphingolipids, as well as cholesterol. This matrix can exist in different phases, liquid disordered (l(d)), liquid ordered (l(o)) and possibly solid (s(o)), or even a combination of these. The

  4. Prenatal unhealthy diet, insulin-like growth factor 2 gene (IGF2) methylation, and attention deficit hyperactivity disorder symptoms in youth with early-onset conduct problems

    NARCIS (Netherlands)

    J. Rijlaarsdam (Jolien); C.A.M. Cecil (Charlotte A.M.); E. Walton (Esther); Mesirow, M.S.C. (Maurissa S. C.); C.L. Relton (Caroline); T.R. Gaunt (Tom); W.L. McArdle (Wendy); Barker, E.D. (Edward D.)

    2017-01-01

    textabstractBackground: Conduct problems (CP) and attention deficit hyperactivity disorder (ADHD) are often comorbid and have each been linked to 'unhealthy diet'. Early-life diet also associates with DNA methylation of the insulin-like growth factor 2 gene (IGF2), involved in fetal and neural

  5. Changes in the onset of spring growth in shrubland species in response to experimental warming along a north-south gradient in Europe

    DEFF Research Database (Denmark)

    Prieto, Patricia; Penuelas, Josep; Niinemets, Üelo

    2009-01-01

    Species responsive to increased temperatures were Vaccinium myrtillus and Empetrum nigrum in Wales, Deschampsia flexuosa in Denmark, Calluna vulgaris in Netherlands, Populus alba in Hungary and Erica multiflora in Spain. Although the acceleration of spring growth was the commonest response to warming...

  6. Effect of a static magnetic field on silicon transport in liquid phase diffusion growth of SiGe

    Energy Technology Data Exchange (ETDEWEB)

    Armour, N.; Dost, S. [Crystal Growth Laboratory, University of Victoria, Victoria, BC V8W 3P6 (Canada)

    2010-03-15

    Liquid phase diffusion experiments have been performed without and with the application of a 0.4 T static magnetic field using a three-zone DC furnace system. SiGe crystals were grown from the germanium side for a period of 72 h. Experiments have led to the growth of single crystal sections varying from 0 to 10 mm thicknesses. Examination of the processed samples (single and polycrystalline sections) has shown that the effect of the applied static magnetic field is significant. It alters the temperature distribution in the system, reduces mass transport in the melt, and leads to a much lower growth rate. The initial curved growth interface was slightly flattened under the effect of magnetic field. There were no growth striations in the single crystal sections of the samples. (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  7. Silicon transport under rotating and combined magnetic fields in liquid phase diffusion growth of SiGe

    Energy Technology Data Exchange (ETDEWEB)

    Armour, N.; Dost, S. [Crystal Growth Laboratory, University of Victoria, Victoria, BC, V8W 3P6 (Canada)

    2010-04-15

    The effect of applied rotating and combined (rotating and static) magnetic fields on silicon transport during the liquid phase diffusion growth of SiGe was experimentally studied. 72-hour growth periods produced some single crystal sections. Single and polycrystalline sections of the processed samples were examined for silicon composition. Results show that the application of a rotating magnetic field enhances silicon transport in the melt. It also has a slight positive effect on flattening the initial growth interface. For comparison, growth experiments were also conducted under combined (rotating and static) magnetic fields. The processed samples revealed that the addition of static field altered the thermal characteristics of the system significantly and led to a complete melt back of the germanium seed. Silicon transport in the melt was also enhanced under combined fields compared with experiments with no magnetic field. (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  8. Loss of ileum decreases serum fibroblast growth factor 19 in relation to liver inflammation and fibrosis in pediatric onset intestinal failure.

    Science.gov (United States)

    Mutanen, Annika; Lohi, Jouko; Heikkilä, Päivi; Jalanko, Hannu; Pakarinen, Mikko P

    2015-06-01

    The pathogenesis of intestinal failure (IF) associated liver disease (IFALD) is uncertain, we therefore investigated the role of FGF19 and pro-inflammatory cytokines has on this disease state. Serum FGF19, IL-6 and, TNF-α were measured in 52 IF patients at median age 6.0 years (IQR 2.2-13) after 10 months (4.1-39) on parenteral nutrition (PN). Thirty-nine patients underwent liver biopsies. In IF patients, FGF19 concentrations were lower and those of IL-6 and TNF-α higher compared to healthy matched controls (p ⩽ 0.001 for all). FGF19 concentrations were further decreased in patients without a remaining ileum [37 pg/ml (IQR 30-68) vs. 74 (35-135) p=0.028], and correlated with remaining ileum length (r = 0.333, p = 0.018) and markers of cholesterol synthesis (r = -0.552 to -0.643, p pediatric onset of IF, total or partial loss of ileum decreases serum FGF19 concentration corresponding to hepatic inflammation and fibrosis, along with increased cholesterol synthesis. In contrast, serum IL-6 increases during PN and may associate with concurrent cholestasis. These data suggests that FGF19 may contribute to the pathogenesis of IFALD. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  9. The ontogeny of pulsatile growth hormone secretion and its temporal relationship to the onset of puberty in the agonadal male rhesus monkey (Macaca mulatta).

    Science.gov (United States)

    Suter, K J

    2004-05-01

    The pubertal amplification of GH secretion in primates has been thought to reflect an increase in gonadal steroid hormones due to gonadotropin stimulation induced by hypothalamic GnRH release. Previous studies in agonadal, peripubertal, male rhesus monkeys have estimated the age of GnRH activation (defined as d 0) using analyses of nocturnal, pulsatile LH patterns derived from sequential blood samples. Using samples from these earlier studies, secretory patterns of GH were analyzed using Cluster at approximately 30-d intervals in the youngest prepubertal ages and at approximately 10- to 20-d intervals in the period immediately preceding and following the onset of puberty. Pulse frequency, amplitude, and mean GH increased significantly between early prepubertal ages (up to 30 d before d 0) and the late prepubertal period (between -20 d and d 0). Pulsatile GH activity increased earlier than pulsatile LH secretion in four of five animals. These findings support the conclusion that pulsatile GH secretion increases developmentally in the absence of gonadal steroids. Furthermore, the present observation that the developmental increase in GH secretion occurs earlier than previously reported is consistent with the possibility that GH itself either directly or indirectly participates in the pubertal reinitiation of GnRH pulse generator activity.

  10. Influence of lateral growth on the optical properties of GaN nanowires grown by hydride vapor phase epitaxy

    Science.gov (United States)

    Wu, Shaoteng; Wang, Liancheng; Yi, Xiaoyan; Liu, Zhiqiang; Wei, Tongbo; Yuan, Guodong; Wang, Junxi; Li, Jinmin

    2017-11-01

    GaN nanowires (NWs) are synthesized on Si (111) using vapor-liquid-solid hydride vapor phase epitaxy at low temperature (740-780 °C). We find that the flow rate of the GaCl (HCl) gas has a large impact on the NW lateral growth rate, which affects the NW morphology, axial growth rate, and optical property. Upon increasing the flow rate of GaCl, the uncatalyzed vapor solid lateral growth increases rapidly, leading to variations in NW morphology from wire-like to tower-like and rod-like. The photoluminescence spectrum shows a broad red luminescence (RL) at around 660 nm and a weak near-band-edge luminescence at around 400 nm when lateral growth is at a significant level. Furthermore, spatially resolved cathodoluminescence and high-resolution transmission electron microscopy observations confirmed that this RL originates from the defective lateral growth. Finally, by inhibiting the lateral growth, GaN NWs with a high aspect ratio and excellent crystal quality (no RL observed at around 660 nm) were successfully synthesized with a rapid growth rate of 170 μm/h.

  11. A generalized-growth model to characterize the early ascending phase of infectious disease outbreaks

    DEFF Research Database (Denmark)

    Viboud, Cecile; Simonsen, Lone; Chowell, Gerardo

    2016-01-01

    the importance of sub-exponential growth for forecasting purposes.Results: We applied the generalized-growth model to 20 infectious disease outbreaks representing a range of transmission routes. We uncovered epidemic profiles ranging from very slow growth (p = 0.14 for the Ebola outbreak in Bomi, Liberia (2014...... African Ebola epidemic provided a unique opportunity to explore how growth profiles vary by geography; analysis of the largest district-level outbreaks revealed substantial growth variations (mean p = 0.59, range: 0.14–0.97). The districts of Margibi in Liberia and Bombali and Bo in Sierra Leone had near...

  12. Crystal phase-based epitaxial growth of hybrid noble metal nanostructures on 4H/fcc Au nanowires

    Science.gov (United States)

    Lu, Qipeng; Wang, An-Liang; Gong, Yue; Hao, Wei; Cheng, Hongfei; Chen, Junze; Li, Bing; Yang, Nailiang; Niu, Wenxin; Wang, Jie; Yu, Yifu; Zhang, Xiao; Chen, Ye; Fan, Zhanxi; Wu, Xue-Jun; Chen, Jinping; Luo, Jun; Li, Shuzhou; Gu, Lin; Zhang, Hua

    2018-03-01

    Crystal-phase engineering offers opportunities for the rational design and synthesis of noble metal nanomaterials with unusual crystal phases that normally do not exist in bulk materials. However, it remains a challenge to use these materials as seeds to construct heterometallic nanostructures with desired crystal phases and morphologies for promising applications such as catalysis. Here, we report a strategy for the synthesis of binary and ternary hybrid noble metal nanostructures. Our synthesized crystal-phase heterostructured 4H/fcc Au nanowires enable the epitaxial growth of Ru nanorods on the 4H phase and fcc-twin boundary in Au nanowires, resulting in hybrid Au-Ru nanowires. Moreover, the method can be extended to the epitaxial growth of Rh, Ru-Rh and Ru-Pt nanorods on the 4H/fcc Au nanowires to form unique hybrid nanowires. Importantly, the Au-Ru hybrid nanowires with tunable compositions exhibit excellent electrocatalytic performance towards the hydrogen evolution reaction in alkaline media.

  13. A 4-D dataset for validation of crystal growth in a complex three-phase material, ice cream

    International Nuclear Information System (INIS)

    Rockett, P; Karagadde, S; Guo, E; Kingsley, M; Lee, P D; Bent, J; Hazekamp, J; Vila-Comamala, J

    2015-01-01

    Four dimensional (4D, or 3D plus time) X-ray tomographic imaging of phase changes in materials is quickly becoming an accepted tool for quantifying the development of microstructures to both inform and validate models. However, most of the systems studied have been relatively simple binary compositions with only two phases. In this study we present a quantitative dataset of the phase evolution in a complex three-phase material, ice cream. The microstructure of ice cream is an important parameter in terms of sensorial perception, and therefore quantification and modelling of the evolution of the microstructure with time and temperature is key to understanding its fabrication and storage. The microstructure consists of three phases, air cells, ice crystals, and unfrozen matrix. We perform in situ synchrotron X-ray imaging of ice cream samples using in-line phase contrast tomography, housed within a purpose built cold-stage (-40 to +20 o C) with finely controlled variation in specimen temperature. The size and distribution of ice crystals and air cells during programmed temperature cycling are determined using 3D quantification. The microstructural evolution of three-phase materials has many other important applications ranging from biological to structural and functional material, hence this dataset can act as a validation case for numerical investigations on faceted and non-faceted crystal growth in a range of materials. (paper)

  14. A 4-D dataset for validation of crystal growth in a complex three-phase material, ice cream

    Science.gov (United States)

    Rockett, P.; Karagadde, S.; Guo, E.; Bent, J.; Hazekamp, J.; Kingsley, M.; Vila-Comamala, J.; Lee, P. D.

    2015-06-01

    Four dimensional (4D, or 3D plus time) X-ray tomographic imaging of phase changes in materials is quickly becoming an accepted tool for quantifying the development of microstructures to both inform and validate models. However, most of the systems studied have been relatively simple binary compositions with only two phases. In this study we present a quantitative dataset of the phase evolution in a complex three-phase material, ice cream. The microstructure of ice cream is an important parameter in terms of sensorial perception, and therefore quantification and modelling of the evolution of the microstructure with time and temperature is key to understanding its fabrication and storage. The microstructure consists of three phases, air cells, ice crystals, and unfrozen matrix. We perform in situ synchrotron X-ray imaging of ice cream samples using in-line phase contrast tomography, housed within a purpose built cold-stage (-40 to +20oC) with finely controlled variation in specimen temperature. The size and distribution of ice crystals and air cells during programmed temperature cycling are determined using 3D quantification. The microstructural evolution of three-phase materials has many other important applications ranging from biological to structural and functional material, hence this dataset can act as a validation case for numerical investigations on faceted and non-faceted crystal growth in a range of materials.

  15. Multi-centre phase IV trial to investigate the immunogenicity of a new liquid formulation of recombinant human growth hormone in adults with growth hormone deficiency.

    Science.gov (United States)

    Johannsson, G; Nespithal, K; Plöckinger, U; Alam, V; McLean, M

    2018-02-27

    To investigate whether a new liquid formulation of recombinant human growth hormone (r-hGH) induces the production of binding antibodies (BAbs) in adults with congenital or adult-onset growth hormone deficiency (GHD). Men or women aged 19-65 years with adult growth hormone deficiency who were r-hGH-naïve or had stopped treatment ≥ 1 month before screening were treated with between 0.15 and 0.30 mg/day r-hGH liquid formulation for 39 weeks. The primary endpoint was the proportion of patients who developed BAbs at any time. Secondary endpoints were the proportion of patients with BAbs who became positive for neutralising antibodies, the effects on biomarkers of r-hGH exposure, safety, and adherence to treatment downloaded from the easypod™ connect software. Seventy-eight patients (61.5% men) with mean age 44.5 years (range 21-65) started and 68 (87.2%) completed the 39-week treatment period. 82.1% were treatment naïve; all were negative for BAbs to r-hGH at baseline. The median (interquartile range) duration of treatment [273 (267.0-277.0) days] was consistent with patients receiving the required doses, and mean treatment adherence measured using easypod™ connect was 89.3%. The proportion of patients who developed BAbs was 0% (95% confidence interval 0-4.68%) and biomarker profiles were consistent with exposure to r-hGH. 92.3% of patients reported ≥ 1 adverse event during treatment. Most events were mild or moderate and no new safety concerns were detected. The low immunogenicity profile of the liquid formulation was consistent with that for the freeze-dried formulation, and no new safety concerns were reported.

  16. Effects of laser energy fluence on the onset and growth of the Rayleigh–Taylor instabilities and its influence on the topography of the Fe thin film grown in pulsed laser deposition facility

    International Nuclear Information System (INIS)

    Mahmood, S.; Rawat, R. S.; Wang, Y.; Lee, S.; Tan, T. L.; Springham, S. V.; Lee, P.; Zakaullah, M.

    2012-01-01

    The effect of laser energy fluence on the onset and growth of Rayleigh–Taylor (RT) instabilities in laser induced Fe plasma is investigated using time-resolved fast gated imaging. The snow plow and shock wave models are fitted to the experimental results and used to estimate the ablation parameters and the density of gas atoms that interact with the ablated species. It is observed that RT instability develops during the interface deceleration stage and grows for a considerable time for higher laser energy fluence. The effects of RT instabilities formation on the surface topography of the Fe thin films grown in pulsed laser deposition system are investigated (i) using different laser energy fluences for the same wavelength of laser radiation and (ii) using different laser wavelengths keeping the energy fluence fixed. It is concluded that the deposition achieved under turbulent condition leads to less smooth deposition surfaces with bigger sized particle agglomerates or network.

  17. Aphid effects on rhizosphere microorganisms and microfauna depend more on barley growth phase than on soil fertilization

    DEFF Research Database (Denmark)

    Madsen, Mette Vestergård; Strandmark, Lisa Bjørnlund; Christensen, Søren

    2004-01-01

    bacteria and fungal feeding nematodes 1 week before spike emergence. Before spike emergence, aphids reduced belowground respiration in NP treatments. These findings strongly indicate that aphids reduced allocation of photoassimilates to roots and deposition of root exudates in the growth phase of the plant......This paper gives the first reports on aphid effects on rhizosphere organisms as influenced by soil nutrient status and plant development. Barley plants grown in pots fertilized with N but without P (N), with N and P (NP), or not fertilized (0) were sampled in the early growth phase (day 25), 1 week....... Contrary to this, 1 week after spike emergence numbers of bacteria, fungal feeding nematodes and Protozoa were higher in rhizospheres of plants subjected to aphids probably because aphids enhanced root mortality and root decomposition. Protozoa and bacterial feeding nematodes were stimulated at different...

  18. Hybrid liquid phase epitaxy processes for YBa{sub 2}Cu{sub 3}O{sub 7} film growth

    Energy Technology Data Exchange (ETDEWEB)

    Kursumovic, A [Department of Materials Science and Metallurgy, University of Cambridge, Pembroke Street, Cambridge CB2 3QZ (United Kingdom); Tomov, R I [Department of Materials Science and Metallurgy, University of Cambridge, Pembroke Street, Cambridge CB2 3QZ (United Kingdom); Huehne, R [Institut fuer Festkoerper-und Werkstoffforschung, Helmholtzstrasse 20, 01069 Dresden (Germany); MacManus-Driscoll, J L [Department of Materials Science and Metallurgy, University of Cambridge, Pembroke Street, Cambridge CB2 3QZ (United Kingdom); Glowacki, B A [Department of Materials Science and Metallurgy, University of Cambridge, Pembroke Street, Cambridge CB2 3QZ (United Kingdom); Evetts, J E [Department of Materials Science and Metallurgy, University of Cambridge, Pembroke Street, Cambridge CB2 3QZ (United Kingdom)

    2004-10-01

    A number of liquid phase epitaxy (LPE) related growth methods have been investigated. These hybrid-LPE processes enable high rate 'liquid assisted' growth of epitaxial YBa{sub 2}Cu{sub 3}O{sub 7} films without the many disadvantages of classical LPE. Growth occurs by diffusive transport of Y through a thin liquid flux layer. This layer may be pre-deposited onto the substrate by various means including vacuum and non-vacuum techniques, or deposited at the growth temperature. The composition of the liquid layer is maintained during film growth by feeding YBa{sub 2}Cu{sub 3}O{sub 7}, or the separate components, either from the vapour or by a powder route. Growth rates up to 10 nm s{sup -1} have been demonstrated. Deposition of c-axis oriented epitaxial YBa{sub 2}Cu{sub 3}O{sub 7} is reported on both seeded and non-seeded substrates; the process is tolerant of a high substrate mismatch. Films 1-2 {mu}m thick with T{sub c} {approx} 90K and a critical current density J{sub c}> 2 MA cm{sup -2} have been grown on a range of single crystal substrates as well as on buffered textured metallic tapes. The mechanism of nucleation and growth from a thin liquid layer is described within the general theoretical framework of crystal growth. Particular features of the growth are the short time constant for equilibration of transients in the deposition conditions, the wide range of relative supersaturation spanned by the process, and dominance of interface kinetic effects compared to volume diffusion in the liquid flux.

  19. Growth of single - crystals of Pb1-x Snx Te by vapor phase transport with the formation of a liquid/solid growth interface

    International Nuclear Information System (INIS)

    An, C.Y.; Bandeira, I.N.

    1985-01-01

    Due to segregation effects single-crystals of Pb 1-x Sn x Te growth by Bridgman techniques have an inhomogeneous composition profile. A vapor phase transport growth process has been developed in order to reduce convective flows. This is due to the very thin melt layer in front of the crystal, that makes convective flows small and solute mixing in the melt very low. By this process single-crystals with 60mm length by 15 mm diameter and a high degree of homogeneity have been grown. A process for determination of the exact composition profile by measurements of the crystal density, for isomorphous alloys of the type A 1-x B x , is also shown. (Author) [pt

  20. Liquid Solution Phase Epitaxial Growth of Al-doped f-SiC for LEDs

    DEFF Research Database (Denmark)

    Tang, Kai; Ma, Xiang; van der Eijk, Casper

    required for LPE is relatively inexpensive. The fundamental backgrounds for LPE growth of Al-doped 4H-SiC are first introduced and elaborated by new thermodynamic and crystal growth models. Based on theoretical analyses, the new designed experimental apparatus is then constructed. The experimental results...... are presented and discussed. Since operational temperature of LPE growth is much lower than that currently used in physical vapour transport (PVT) process, it is expected to save the energy consumption for SiC crystal growth....

  1. Alterations in transcript abundance of bovine oocytes recovered at growth and dominance phases of the first follicular wave

    Directory of Open Access Journals (Sweden)

    Kanitz Wilhelm

    2007-07-01

    Full Text Available Abstract Background Oocyte developmental competence is highly affected by the phase of ovarian follicular wave. Previous studies have shown that oocytes from subordinate follicles recovered at growth phase (day 3 after estrus are developmentally more competent than those recovered at dominance phase (day 7 after estrus. However, the molecular mechanisms associated with these differences are not well elucidated. Therefore, the objective of this study was to investigate transcript abundance of bovine oocytes retrieved from small follicles at growth and dominance phases of the first follicular wave and to identify candidate genes related to oocyte developmental competence using cDNA microarray. Results Comparative gene expression analysis of oocytes from growth and dominance phases and subsequent data analysis using Significant Analysis of Microarray (SAM revealed a total of 51 differentially regulated genes, including 36 with known function, 6 with unknown function and 9 novel transcripts. Real-time PCR has validated 10 transcripts revealed by microarray analysis and quantified 5 genes in cumulus cells derived from oocytes of both phases. The expression profile of 8 (80% transcripts (ANAXA2, FL396, S100A10, RPL24, PP, PTTG1, MSX1 and BMP15 was in agreement with microarray data. Transcript abundance of five candidate genes in relation to oocyte developmental competence was validated using Brilliant Cresyl Blue (BCB staining as an independent model. Furthermore, localization of mRNA and protein product of the candidate gene MSX1 in sections of ovarian follicles at days 0, 1, 3 and 7 of estrous cycle showed a clear fluorescent signal in both oocytes and cumulus cells with higher intensity in the former. Moreover, the protein product was detected in bovine oocytes and early cleavage embryos after fertilization with higher intensity around the nucleus. Conclusion This study has identified distinct sets of differentially regulated transcripts between

  2. Effect of gas flow on the selective area growth of gallium nitride via metal organic vapor phase epitaxy

    Science.gov (United States)

    Rodak, L. E.; Kasarla, K. R.; Korakakis, D.

    2007-08-01

    The effect of gas flow on the selective area growth (SAG) of gallium nitride (GaN) grown via metal organic vapor phase epitaxy (MOVPE) has been investigated. In this study, the SAG of GaN was carried out on a silicon dioxide striped pattern along the GaN direction. SAG was initiated with the striped pattern oriented parallel and normal to the incoming gas flow in a horizontal reactor. The orientation of the pattern did not impact cross section of the structure after re-growth as both orientations resulted in similar trapezoidal structures bounded by the (0 0 0 1) and {1 1 2¯ n} facets ( n≈1.7-2.2). However, the growth rates were shown to depend on the orientation of the pattern as the normally oriented samples exhibited enhanced vertical and cross-sectional growth rates compared to the parallel oriented samples. All growths occurred under identical conditions and therefore the difference in growth rates must be attributed to a difference in mass transport of species.

  3. Identifying the linear phase of the relativistic Kelvin-Helmholtz instability and measuring its growth rate via radiation.

    Science.gov (United States)

    Pausch, R; Bussmann, M; Huebl, A; Schramm, U; Steiniger, K; Widera, R; Debus, A

    2017-07-01

    For the relativistic Kelvin-Helmholtz instability (KHI), which occurs at shear interfaces between two plasma streams, we report results on the polarized radiation over all observation directions and frequencies emitted by the plasma electrons from ab initio kinetic simulations. We find the polarization of the radiation to provide a clear signature for distinguishing the linear phase of the KHI from its other phases. During the linear phase, we predict the growth rate of the KHI radiation power to match the growth rate of the KHI to a high degree. Our predictions are based on a model of the vortex dynamics, which describes the electron motion in the vicinity of the shear interface between the two streams. Albeit the complex and turbulent dynamics happening in the shear region, we find excellent agreement between our model and large-scale particle-in-cell simulations. Our findings pave the way for identifying the KHI linear regime and for measuring its growth rate in astrophysical jets observable on earth as well as in laboratory plasmas.

  4. Exposure to bisphenol A correlates with early-onset prostate cancer and promotes centrosome amplification and anchorage-independent growth in vitro.

    Directory of Open Access Journals (Sweden)

    Pheruza Tarapore

    Full Text Available Human exposure to bisphenol A (BPA is ubiquitous. Animal studies found that BPA contributes to development of prostate cancer, but human data are scarce. Our study examined the association between urinary BPA levels and Prostate cancer and assessed the effects of BPA on induction of centrosome abnormalities as an underlying mechanism promoting prostate carcinogenesis. The study, involving 60 urology patients, found higher levels of urinary BPA (creatinine-adjusted in Prostate cancer patients (5.74 µg/g [95% CI; 2.63, 12.51] than in non-Prostate cancer patients (1.43 µg/g [95% CI; 0.70, 2.88] (p = 0.012. The difference was even more significant in patients <65 years old. A trend toward a negative association between urinary BPA and serum PSA was observed in Prostate cancer patients but not in non-Prostate cancer patients. In vitro studies examined centrosomal abnormalities, microtubule nucleation, and anchorage-independent growth in four Prostate cancer cell lines (LNCaP, C4-2, 22Rv1, PC-3 and two immortalized normal prostate epithelial cell lines (NPrEC and RWPE-1. Exposure to low doses (0.01-100 nM of BPA increased the percentage of cells with centrosome amplification two- to eight-fold. Dose responses either peaked or reached the plateaus with 0.1 nM BPA exposure. This low dose also promoted microtubule nucleation and regrowth at centrosomes in RWPE-1 and enhanced anchorage-independent growth in C4-2. These findings suggest that urinary BPA level is an independent prognostic marker in Prostate cancer and that BPA exposure may lower serum PSA levels in Prostate cancer patients. Moreover, disruption of the centrosome duplication cycle by low-dose BPA may contribute to neoplastic transformation of the prostate.

  5. Trade-offs between microbial growth phases lead to frequency-dependent and non-transitive selection.

    Science.gov (United States)

    Manhart, Michael; Adkar, Bharat V; Shakhnovich, Eugene I

    2018-02-14

    Mutations in a microbial population can increase the frequency of a genotype not only by increasing its exponential growth rate, but also by decreasing its lag time or adjusting the yield (resource efficiency). The contribution of multiple life-history traits to selection is a critical question for evolutionary biology as we seek to predict the evolutionary fates of mutations. Here we use a model of microbial growth to show that there are two distinct components of selection corresponding to the growth and lag phases, while the yield modulates their relative importance. The model predicts rich population dynamics when there are trade-offs between phases: multiple strains can coexist or exhibit bistability due to frequency-dependent selection, and strains can engage in rock-paper-scissors interactions due to non-transitive selection. We characterize the environmental conditions and patterns of traits necessary to realize these phenomena, which we show to be readily accessible to experiments. Our results provide a theoretical framework for analysing high-throughput measurements of microbial growth traits, especially interpreting the pleiotropy and correlations between traits across mutants. This work also highlights the need for more comprehensive measurements of selection in simple microbial systems, where the concept of an ordinary fitness landscape breaks down. © 2018 The Author(s).

  6. Proteomic analysis of Clostridium thermocellum core metabolism: relative protein expression profiles and growth phase-dependent changes in protein expression

    Directory of Open Access Journals (Sweden)

    Rydzak Thomas

    2012-09-01

    Full Text Available Abstract Background Clostridium thermocellum produces H2 and ethanol, as well as CO2, acetate, formate, and lactate, directly from cellulosic biomass. It is therefore an attractive model for biofuel production via consolidated bioprocessing. Optimization of end-product yields and titres is crucial for making biofuel production economically feasible. Relative protein expression profiles may provide targets for metabolic engineering, while understanding changes in protein expression and metabolism in response to carbon limitation, pH, and growth phase may aid in reactor optimization. We performed shotgun 2D-HPLC-MS/MS on closed-batch cellobiose-grown exponential phase C. thermocellum cell-free extracts to determine relative protein expression profiles of core metabolic proteins involved carbohydrate utilization, energy conservation, and end-product synthesis. iTRAQ (isobaric tag for relative and absolute quantitation based protein quantitation was used to determine changes in core metabolic proteins in response to growth phase. Results Relative abundance profiles revealed differential levels of putative enzymes capable of catalyzing parallel pathways. The majority of proteins involved in pyruvate catabolism and end-product synthesis were detected with high abundance, with the exception of aldehyde dehydrogenase, ferredoxin-dependent Ech-type [NiFe]-hydrogenase, and RNF-type NADH:ferredoxin oxidoreductase. Using 4-plex 2D-HPLC-MS/MS, 24% of the 144 core metabolism proteins detected demonstrated moderate changes in expression during transition from exponential to stationary phase. Notably, proteins involved in pyruvate synthesis decreased in stationary phase, whereas proteins involved in glycogen metabolism, pyruvate catabolism, and end-product synthesis increased in stationary phase. Several proteins that may directly dictate end-product synthesis patterns, including pyruvate:ferredoxin oxidoreductases, alcohol dehydrogenases, and a putative

  7. Can xenon in water inhibit ice growth? Molecular dynamics of phase transitions in water-Xe system.

    Science.gov (United States)

    Artyukhov, Vasilii I; Pulver, Alexander Yu; Peregudov, Alex; Artyuhov, Igor

    2014-07-21

    Motivated by recent experiments showing the promise of noble gases as cryoprotectants, we perform molecular dynamics modeling of phase transitions in water with xenon under cooling. We follow the structure and dynamics of xenon water solution as a function of temperature. Homogeneous nucleation of clathrate hydrate phase is observed and characterized. As the temperature is further reduced we observe hints of dissociation of clathrate due to stronger hydrophobic hydration, pointing towards a possible instability of clathrate at cryogenic temperatures and conversion to an amorphous phase comprised of "xenon + hydration shell" Xe·(H2O)21.5 clusters. Simulations of ice-xenon solution interface in equilibrium and during ice growth reveal the effects of xenon on the ice-liquid interface, where adsorbed xenon causes roughening of ice surface but does not preferentially form clathrate. These results provide evidence against the ice-blocker mechanism of xenon cryoprotection.

  8. Optimal dose and timing of insulin Aspart to mimic first phase insulin response in patients with recently onset type 2 diabetes.

    Science.gov (United States)

    Gredal, C; Rosenfalck, A; Dejgaard, A; Hilsted, J

    2008-05-01

    To assess the optimal dose and timing of subcutaneous injection of insulin Aspart (IAsp) in relation to meal to mimic first phase insulin response in patients with recently diagnosed type 2 diabetes. Twenty patients were randomised in a double blind, double dummy design to four standard meal tests with pre-meal injection of insulin Aspart 0.08 IU/kg BW 30 min before the meal, insulin Aspart 0.04 IU/kg BW 30 or 15 min before the meal and placebo. All three insulin regimes significantly reduced postprandial glucose increment (area under the curve AUC(-30 to 240 min)) and peak plasma glucose increment (DeltaC(max)) compared with placebo. Postprandial glucose increment AUC(-30 to 240 min) but not DeltaC(max) was significantly lower with IAsp 0.08 IU/kg BW as compared to IAsp 0.04IU/kg BW, (pIAsp 0.08 IU/kg BW. No difference in postprandial glucose profile was demonstrated whether IAsp 0.04 IU/kg BW was administrated 15 or 30 min before mealtime. IAsp 0.04IU/kg BW injected subcutaneously 15 or 30 min before meal reduced the postprandial blood glucose increment without risk of hypoglycaemia in patients with recently diagnosed type 2 diabetes. Doubling of the IAsp dose significantly reduced the postprandial glucose increment but increased the risk of hypoglycaemia.

  9. Brucella melitensis global gene expression study provides novel information on growth phase-specific gene regulation with potential insights for understanding Brucella:host initial interactions

    Directory of Open Access Journals (Sweden)

    Garner Harold R

    2009-05-01

    Full Text Available Abstract Background Brucella spp. are the etiological agents of brucellosis, a zoonotic infectious disease that causes abortion in animals and chronic debilitating illness in humans. Natural Brucella infections occur primarily through an incompletely defined mechanism of adhesion to and penetration of mucosal epithelium. In this study, we characterized changes in genome-wide transcript abundance of the most and the least invasive growth phases of B. melitensis cultures to HeLa cells, as a preliminary approach for identifying candidate pathogen genes involved in invasion of epithelial cells. Results B. melitensis at the late logarithmic phase of growth are more invasive to HeLa cells than mid-logarithmic or stationary growth phases. Microarray analysis of B. melitensis gene expression identified 414 up- and 40 down-regulated genes in late-log growth phase (the most invasive culture compared to the stationary growth phase (the least invasive culture. As expected, the majority of up-regulated genes in late-log phase cultures were those associated with growth, including DNA replication, transcription, translation, intermediate metabolism, energy production and conversion, membrane transport, and biogenesis of the cell envelope and outer membrane; while the down-regulated genes were distributed among several functional categories. Conclusion This Brucella global expression profile study provides novel information on growth phase-specific gene expression. Further characterization of some genes found differentially expressed in the most invasive culture will likely bring new insights into the initial molecular interactions between Brucella and its host.

  10. Growth Hormone (GH) Retesting and Final Adult Height in Childhood-Onset GH Deficiency (CO-GHD): Experiences from King Chulalongkorn Memorial Hospital, Thailand.

    Science.gov (United States)

    Wacharasindhu, Suttipong; Aroonparkmongkol, Suphab; Sahakitrungrueng, Taninee; Supornsilchai, Vichit

    2015-06-01

    Evaluate GHstatus in CO-GHD subjects after completion of linear growth, and report the auxological outcomes of rhGH treatment. Twenty-four CO-GHD subjects (14 with IGHD and 10 with MPHD), treated with rhGH for a period of 6.6 ± 3.1 years were re-evaluated for their capacity of GH secretion by performing insulin tolerance test (ITT). Ht SDS at final height was compared with Ht SDS at the start of the treatment and MPH SDS. Thirty-eight percent (9 in 24) of CO-GHD subjects had normal GH secretion on retesting. All subjects were diagnosed as isolated GHD during childhood. In contrast, all MPHD subjects during childhood period had GH insufficiency on retesting. GH insufficient subjects had higher total cholesterol level than those with GH sufficiency (214 ± 51 vs. 1 74 ± 36 mg/mL, p = 0.03). rhGH treatment significantly increased Ht SDS of -2.0 ± 1.1 at the start of the treatment to -0.6 ± 1.3 at the end of the treatment (p GH retesting (p GH retesting is recommended in subjects with IGHD during the childhood period. However rhGH treatment can enhance the final height in both GH sufficient and insufficient subjects on retesting.

  11. Strategy to usher in the next phase of growth in the Indian IT industry

    Directory of Open Access Journals (Sweden)

    Narendra M. Agrawal

    2012-09-01

    Full Text Available While the Indian IT/ITeS sector has registered tremendous growth over the last two decades, the viability of the growth models adopted by the IT organisations is now in question. This article, in its first part, assesses the value pyramid of the Indian IT services and in examining the avenues of growth up the value chain, suggests that the industry’s involvement in inclusive growth and holistic development of society is imperative in the journey forward. A discussion with industry practitioners in the second part of the article throws light on the strategies and initiatives being taken in the industry to meet the challenges and opportunities going forward.

  12. GaN Bulk Growth and Epitaxy from Ca-Ga-N Solutions, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — The innovations proposed here are Ka-band (38 GHz) group III-nitride power FETs and the dislocation density reducing epitaxial growth methods (LPE) needed for their...

  13. Crystal Growth of New Radiation Detector Materials in Microgravity, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — RMD proposes to conduct a series of crystal growth experiments on the International Space Station in the SUBSA furnace inside the MSG glovebox to grow crystals of...

  14. Solution-phase epitaxial growth of quasi-monocrystalline cuprous oxide on metal nanowires

    NARCIS (Netherlands)

    Sciacca, Beniamino; Mann, Sander A.; Tichelaar, Frans D.; Zandbergen, Henny W.; Van Huis, Marijn A.; Garnett, Erik C.

    2014-01-01

    The epitaxial growth of monocrystalline semiconductors on metal nanostructures is interesting from both fundamental and applied perspectives. The realization of nanostructures with excellent interfaces and material properties that also have controlled optical resonances can be very challenging. Here

  15. Cell cycle phase-specific surface expression of nerve growth factor receptors TrkA and p75(NTR).

    Science.gov (United States)

    Urdiales, J L; Becker, E; Andrieu, M; Thomas, A; Jullien, J; van Grunsven, L A; Menut, S; Evan, G I; Martín-Zanca, D; Rudkin, B B

    1998-09-01

    Expression of the nerve growth factor (NGF) receptors TrkA and p75(NTR) was found to vary at the surface of PC12 cells in a cell cycle phase-specific manner. This was evidenced by using flow cytometric and microscopic analysis of cell populations labeled with antibodies to the extracellular domains of both receptors. Differential expression of these receptors also was evidenced by biotinylation of surface proteins and Western analysis, using antibodies specific for the extracellular domains of TrkA and p75(NTR). TrkA is expressed most strongly at the cell surface in M and early G1 phases, whereas p75(NTR) is expressed mainly in late G1, S, and G2 phases. This expression reflects the molecular and cellular responses to NGF in specific phases of the cell cycle; in the G1 phase NGF elicits both the anti-mitogenic effect, i.e., inhibition of the G1 to S transition, and the differentiation response whereas a survival effect is provoked elsewhere in the cell cycle. A model is proposed relating these responses to the surface expression of the two receptors. These observations open the way for novel approaches to the investigation of the mechanism of NGF signal transduction.

  16. Growth hormone (GH) provocative retesting of 108 young adults with childhood-onset GH deficiency and the diagnostic value of insulin-like growth factor I (IGF-I) and IGF-binding protein-3

    DEFF Research Database (Denmark)

    Juul, A; Kastrup, K W; Pedersen, S A

    1997-01-01

    controversy still exists. In adults, the diagnostic value of IGF-I and IGFBP-3 suspected of GHD has been reported in only a few studies. We performed a GH provocative test, using oral clonidine, in 108 patients who had previously been treated with GH during childhood (73 men and 35 women). Basal IGF.......e. 45% of patients treated with GH during childhood because of isolated GHD had a normal GH response when retested in adulthood. Multiple regression analysis revealed that peak GH levels were dependent on the degree of hypopituitarism, body mass index, and duration of disease. IGF-I levels were below -2...... determinations predict the outcome of a GH provocative test in adults suspected of GHD and believe that IGF-I as well as IGFBP-3 serum concentrations are valuable diagnostic parameters in the evaluation of GHD in adults with childhood-onset disease. We suggest that children who have been treated with GH should...

  17. Radiation stimulation during the early stationary growth phase in Synechococcus lividus and its correlation with photooxidative stress occurring before the stationary phase

    International Nuclear Information System (INIS)

    Conter, A.; Dupouy, D.; Vincent, C.; Planel, H.

    1987-01-01

    The effects of chronic gamma radiation at dose rates ranging from 0.058 mGy d-1 on growth rate calculated during the early stationary phase were studied. A stimulatory effect occurred for all doses and for all phases of the cells selected for use in the inoculation of the medium. During the same period, the rate of nucleic acid synthesis was increased in irradiated cultures compared to control cultures. The stimulating effect always occurred in cultures irradiated from the inoculation to the eighteenth day only. This result led us to conclude that the stimulation mechanism depended upon the events occurring at the end of the exponential phase in the deceleration period. Studies on cell metabolism showed that cells presented features of photooxidative stress in this period. Increases in superoxide dismutase, glutathione reductase and glucose-6-phosphate dehydrogenase were observed in irradiated cultures. It was assumed that irradiation at very low doses could help cells to better defend against photooxidative stress by increasing oxidants that activate the glucose metabolism and C5-sugars production and nucleic acid synthesis

  18. On-chip optical phase locking of single growth monolithically integrated Slotted Fabry Perot lasers.

    Science.gov (United States)

    Morrissey, P E; Cotter, W; Goulding, D; Kelleher, B; Osborne, S; Yang, H; O'Callaghan, J; Roycroft, B; Corbett, B; Peters, F H

    2013-07-15

    This work investigates the optical phase locking performance of Slotted Fabry Perot (SFP) lasers and develops an integrated variable phase locked system on chip for the first time to our knowledge using these lasers. Stable phase locking is demonstrated between two SFP lasers coupled on chip via a variable gain waveguide section. The two lasers are biased differently, one just above the threshold current of the device with the other at three times this value. The coupling between the lasers can be controlled using the variable gain section which can act as a variable optical attenuator or amplifier depending on bias. Using this, the width of the stable phase locking region on chip is shown to be variable.

  19. Phase-field Model for Interstitial Loop Growth Kinetics and Thermodynamic and Kinetic Models of Irradiated Fe-Cr Alloys

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yulan; Hu, Shenyang Y.; Sun, Xin; Khaleel, Mohammad A.

    2011-06-15

    Microstructure evolution kinetics in irradiated materials has strongly spatial correlation. For example, void and second phases prefer to nucleate and grow at pre-existing defects such as dislocations, grain boundaries, and cracks. Inhomogeneous microstructure evolution results in inhomogeneity of microstructure and thermo-mechanical properties. Therefore, the simulation capability for predicting three dimensional (3-D) microstructure evolution kinetics and its subsequent impact on material properties and performance is crucial for scientific design of advanced nuclear materials and optimal operation conditions in order to reduce uncertainty in operational and safety margins. Very recently the meso-scale phase-field (PF) method has been used to predict gas bubble evolution, void swelling, void lattice formation and void migration in irradiated materials,. Although most results of phase-field simulations are qualitative due to the lake of accurate thermodynamic and kinetic properties of defects, possible missing of important kinetic properties and processes, and the capability of current codes and computers for large time and length scale modeling, the simulations demonstrate that PF method is a promising simulation tool for predicting 3-D heterogeneous microstructure and property evolution, and providing microstructure evolution kinetics for higher scale level simulations of microstructure and property evolution such as mean field methods. This report consists of two parts. In part I, we will present a new phase-field model for predicting interstitial loop growth kinetics in irradiated materials. The effect of defect (vacancy/interstitial) generation, diffusion and recombination, sink strength, long-range elastic interaction, inhomogeneous and anisotropic mobility on microstructure evolution kinetics is taken into account in the model. The model is used to study the effect of elastic interaction on interstitial loop growth kinetics, the interstitial flux, and sink

  20. Growth Phase, Oxygen, Temperature and Starvation Affect the Development of Viable but Non-Culturable State of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Bin eWu

    2016-03-01

    Full Text Available AbstractVibrio cholerae can enter into a viable but non-culturable (VBNC state in order to survive in unfavourable environments. In this study, we studied the roles of five physicochemical and microbiological factors or states, namely, different strains, growth phases, oxygen, temperature, and starvation, on the development of VBNC of V. cholerae in artificial sea water (ASW. Different strains of the organism, the growth phase, and oxygen levels affected the progress of VBNC development. It was found that the VBNC state was induced faster in V. cholerae serogroup O1 classical biotype strain O395 than in O1 El Tor biotype strains C6706 and N16961. When cells in different growth phases were used for VBNC induction, stationary-phase cells lost their culturability more quickly than exponential-phase cells, while induction of a totally non-culturable state took longer to achieve for stationary-phase cells in all three strains, suggesting that heterogeneity of cells should be considered. Aeration strongly accelerated the loss of culturability. During the development of the VBNC state, the culturable cell count under aeration conditions was almost 106-fold lower than under oxygen-limited conditions for all three strains. The other two factors, temperature and nutrients-rich environment, may prevent the induction of VBNC cells. At 22°C or 37°C in ASW, most of the cells rapidly died and the culturable cell count reduced from about 108 CFU/mL to 106–105 CFU/mL. The total cell counts showed that cells that lost viability were decomposed, and the viable cell counts were the same as culturable cell counts, indicating that the cells did not reach the VBNC state. VBNC state development was blocked when ASW was supplied with Luria-Bertani broth (LB, but it was not affected in ASW with M9, suggesting that specific nutrients in LB may prevent the development of VBNC state. These results revealed that the five factors evaluated in this study had different

  1. Using Raman spectroscopy and chemometrics to identify the growth phase of Lactobacillus casei Zhang during batch culture at the single-cell level.

    Science.gov (United States)

    Ren, Yan; Ji, Yuetong; Teng, Lin; Zhang, Heping

    2017-12-23

    As microbial cultures are comprised of heterogeneous cells that differ according to their size and intracellular concentrations of DNA, proteins, and other constituents, the detailed identification and discrimination of the growth phases of bacterial populations in batch culture is challenging. Cell analysis is indispensable for quality control and cell enrichment. In this paper, we report the results of our investigation on the use of single-cell Raman spectrometry (SCRS) for real-time analysis and prediction of cells in different growth phases during batch culture of Lactobacillus (L.) casei Zhang. A targeted analysis of defined cell growth phases at the level of the single cell, including lag phase, log phase, and stationary phase, was facilitated by SCRS. Spectral shifts were identified in different states of cell growth that reflect biochemical changes specific to each cell growth phase. Raman peaks associated with DNA and RNA displayed a decrease in intensity over time, whereas protein-specific and lipid-specific Raman vibrations increased at different rates. Furthermore, a supervised classification model (Random Forest) was used to specify the lag phase, log phase, and stationary phase of cells based on SCRS, and a mean sensitivity of 90.7% and mean specificity of 90.8% were achieved. In addition, the correct cell type was predicted at an accuracy of approximately 91.2%. To conclude, Raman spectroscopy allows label-free, continuous monitoring of cell growth, which may facilitate more accurate estimates of the growth states of lactic acid bacterial populations during fermented batch culture in industry.

  2. Cost analysis of a growth guidance system compared with traditional and magnetically controlled growing rods for early-onset scoliosis: a US-based integrated health care delivery system perspective

    Directory of Open Access Journals (Sweden)

    Luhmann SJ

    2018-03-01

    Full Text Available Scott J Luhmann,1–3 Eoin M McAughey,4 Stacey J Ackerman,5 David B Bumpass,6 Richard E McCarthy6 1Department of Orthopaedic Surgery, Washington University School of Medicine, St. Louis, MO, USA; 2Department of Orthopaedic Surgery, St. Louis Shriners Hospital, St. Louis, MO, USA; 3Department of Orthopaedic Surgery, St. Louis Children’s Hospital, St. Louis, MO, USA; 4Covance Market Access Services Inc., London, UK; 5Covance Market Access Services Inc., San Diego, CA, USA; 6Department of Orthopaedic Surgery, University of Arkansas for Medical Sciences, Little Rock, AR, USA Purpose: Treating early-onset scoliosis (EOS with traditional growing rods (TGR is effective but requires periodic surgical lengthening, risking complications. Alternatives include magnetically controlled growing rods (MCGR that lengthen noninvasively and the growth guidance system (GGS, which obviate the need for active, distractive lengthenings. Previous studies have reported promising clinical effectiveness for GGS; however the direct medical costs of GGS compared to TGR and MCGR have not yet been explored. Methods: To estimate the cost of GGS compared with MCGR and TGR for EOS an economic model was developed from the perspective of a US integrated health care delivery system. Using dual-rod constructs, the model estimated the cumulative costs associated with initial implantation, rod lengthenings (TGR, MCGR, revisions due to device failure, surgical-site infections, device exchange, and final spinal fusion over a 6-year episode of care. Model parameters were from peer-reviewed, published literature. Medicare payments were used as a proxy for provider costs. Costs (2016 US$ were discounted 3% annually. Results: Over a 6-year episode of care, GGS was associated with fewer invasive surgeries per patient than TGR (GGS: 3.4; TGR: 14.4 and lower cumulative costs than MCGR and TGR, saving $25,226 vs TGR. Sensitivity analyses showed that results were sensitive to changes in

  3. Growth of ruby crystals by the heat exchanger method, phase 1: NSF small business innovation research

    Science.gov (United States)

    Schmid, F.; Khattak, C. P.

    1980-03-01

    Conditions for the growth of large, uniformly doped laser crystals by the heat exchanger method are explored. Determination of the melt point, selection of crucible material and establishment of furnace operating parameters are discussed. The melt point of ruby was found to be 2040 plus or minus 10 C. Molybdenum crucibles can be used to contain ruby in vacuum as well as under argon atmospheres at desired superheat temperatures over extended periods required for crystal growth. Thermodynamic analysis was conducted and vapor pressures of volatile species calculated. Experimentally, volatilization of chromium oxides was suppressed by using welded covers on crucibles and operating under an argon pressure in the furnace.

  4. Organelle-cytoskeleton relationships in fibroblasts: mitochondria, Golgi apparatus, and endoplasmic reticulum in phases of movement and growth

    DEFF Research Database (Denmark)

    Couchman, J R; Rees, D A

    1982-01-01

    previously - including the development of pronounced microfilament bundles and of stable and well-defined focal adhesions - and appears to be related to changes in the motility status of the cells rather than to alterations in growth or synthetic capability. Mitochondrial mobility is strongly reduced...... the phenotypic conversion, although the locomotory cells are characterized by a zone close to the leading lamella, which is completely free from these organelles. The form and distribution of the Golgi apparatus, but not the endoplasmic reticulum, was sensitive to microtubule disruption but was also shown...... to have direct functional associations with the centriolar region. The relative distributions of the three types of organelle during the phases of cell movements and cell growth, are consistent with their biochemical functions in cellular activity....

  5. Fabrication of selective-area growth InGaN LED by mixed-source hydride vapor-phase epitaxy

    Science.gov (United States)

    Bae, Sung Geun; Jeon, Injun; Jeon, Hunsoo; Kim, Kyoung Hwa; Yang, Min; Yi, Sam Nyung; Lee, Jae Hak; Ahn, Hyung Soo; Yu, Young Moon; Sawaki, Nobuhiko; Kim, Suck-Whan

    2018-01-01

    We prepared InGaN light-emitting diodes (LEDs) with the active layers grown from a mixed source of Ga–In–N materials on an n-type GaN substrate by a selective-area growth method and three fabrication steps: photolithography, epitaxial layer growth, and metallization. The preparation followed a previously developed experimental process using apparatus for mixed-source hydride vapor-phase epitaxy (HVPE), which consisted of a multi-graphite boat, for insulating against the high temperature and to control the growth rate of epilayers, filled with the mixed source on the inside and a radio-frequency (RF) heating coil for heating to a high temperature (T > 900 °C) and for easy control of temperature outside the source zone. Two types of LEDs were prepared, with In compositions of 11.0 and 6.0% in the InGaN active layer, and room-temperature electroluminescence measurements exhibited a main peak corresponding to the In composition at either 420 or 390 nm. The consecutive growth of InGaN LEDs by the mixed-source HVPE method provides a technique for the production of LEDs with a wide range of In compositions in the active layer.

  6. Epitaxial growth and new phase of single crystal Dy by molecular beam epitaxy

    International Nuclear Information System (INIS)

    Yang, Kai-Yueh; Homma, Hitoshi; Schuller, I.K.

    1987-09-01

    We have grown two novel epitaxial phases of dysprosium (Dy) on vanadium (V) by molecular beam epitaxy technique. Surface and bulk structures are studied by in-situ reflection high energy electron diffraction (RHEED) and x-ray diffraction techniques. The new hcp phases are ∼4% expanded uniformly in-plane (0001), and ∼9% and ∼4% expanded out of plane along the c-axes for non-interrupted and interrupted deposition case, respectively. We also observed (2 x 2), (3 x 3), and (4 x 4) Dy surface reconstruction patterns and a series of transitions as the Dy film thickness increases. 12 refs., 3 figs

  7. Radiation-induced p53 protein response in the A549 cell line is culture growth-phase dependent

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, N.F.; Gurule, D.M.; Carpenter, T.R.

    1995-12-01

    One role of the p53 tumor suppressor protein has been recently revealed. Kastan, M.B. reported that p53 protein accumulates in cells exposed to ionizing radiation. The accumulation of p53 protein is in response to DNA damage, most importantly double-strand breaks, that results from exposure to ionizing radiation. The rise in cellular p53 levels is necessary for an arrest in the G{sub 1} phase of the cell cycle to provide additional time for DNA repair. The p53 response has also been demonstrated to enhance PCNA-dependent repair. p53 is thus an important regulator of the cellular response to DNA-damaging radiation. From this data, it can be concluded that the magnitude of the p53 response is not dependent on the phase of culture growth.

  8. Liquid phase assisted grain growth in Cu2ZnSnS4 nanoparticle thin films by alkali element incorporation

    DEFF Research Database (Denmark)

    Engberg, Sara Lena Josefin; Canulescu, Stela; Schou, Jørgen

    2018-01-01

    were Zn-rich and Cu-poor, and no secondary phases except ZnS could be detected within the detection limit of the characterization tools used. Potassium was the most effective alkali metal to enhance grain growth, and resulted in films with a high photoluminescence signal and an optical band gap of 1.......43 eV. The alkali metals were introduced in the form of chloride salts, and a significant amount of Cl was detected in the final films, but could be removed in a quick water rinse....

  9. Crystal growth processes : The role of steps and of mass transfer in the fluid phase

    NARCIS (Netherlands)

    Janssen-Van Rosmalen, R.

    1977-01-01

    The step model introduced by Burton, Cabrera and Frank is known to give a good description of the surface processes, when growth spirals are available as a consequence of screw dislocations. Their model is based on an infinite sequence of equidistant steps. In the first part of the research

  10. Studying ice particle growth processes in mixed-phase clouds using spectral polarimetric radar measurements

    NARCIS (Netherlands)

    Pfitzenmaier, L.

    2018-01-01

    Clouds are a prominent part of the Earth hydrological cycle. In the mid latitudes, the ice phase of clouds is highly involved in the formation of precipitation. The ice particles in the clouds fall to earth either as snow flakes, in the winter month, or melting crystals that become rain drops. An

  11. Numerical analysis of interfacial growth and deformation in horizontal stratified two-phase flow by lattice Boltzmann method

    International Nuclear Information System (INIS)

    Ebihara, Ken-ichi

    2005-03-01

    paper, first, the validity and the usefulness of the lattice-gas model and the lattice Boltzmann method for the numerical analysis of two-phase flow are examined by applying the two-phase fluid model of these methods to the phenomena of the falling droplet and the rising bubble. Next, on the basis of the examination of its numerical results, the horizontal stratified two-phase flow, which is the fundamental and important flow and often observed in a practical situation, is simulated by use of the HCZ model that is the two-phase fluid model of the lattice Boltzmann method proposed by He, Chen, and Zhang. The HCZ model can simulate Rayleigh-Taylor instability which shows complex interfacial phenomena. It is verified that the simulated interfacial growth is subject to the Kelvin-Helmholtz instability theory and can reproduce the curve concerning the interfacial growth of the theoretical flow regime map proposed by Taitel and Dukler (T-D map). Furthermore, it is found that the interfacial growth in the channel with the narrow width needs more superficial flow velocity than that given by the T-D map. In the simulation of the droplet generation in the horizontal stratified two-phase flow, it is verified that the HCZ model can also reproduce the experimental correlation proposed by Ishii and Grolmes within the range of the distribution of experimental data. According to the results of this report, it is found that the HCZ model of the lattice Boltzmann method can simulate complex interfacial phenomena in the horizontal stratified two-phase flow and reproduce the theoretical flow regime map and the experimental correlation. Considering the application of this model to more practical two-phase flow, it is also seen that this model has some problems which have to be solved, such as practical density difference, thermal influence and so on. (author)

  12. Adult mortality or morbidity is not increased in childhood-onset growth hormone deficient patients who received pediatric GH treatment: an analysis of the Hypopituitary Control and Complications Study (HypoCCS).

    Science.gov (United States)

    Mo, Daojun; Hardin, Dana Sue; Erfurth, Eva Marie; Melmed, Shlomo

    2014-10-01

    The French Safety and Appropriateness of Growth Hormone treatments in Europe (SAGhE) cohort has raised concern of increased mortality risk during follow-up into adulthood in certain patients who had received growth hormone (GH) treatment during childhood. The Hypopituitary Control and Complications Study monitored mortality and morbidity of adult GH-deficient patients including those with childhood-onset GH deficiency (COGHD) who received GH treatment as children. Evaluate risk of mortality, cancer, myocardial infarction (MI) and stroke in a prospective observational study. COGHD patients [n = 1,204, including 389 diagnosed with idiopathic COGHD (ICOGHD)] had received pediatric GH treatment. Standardized mortality ratios (SMRs), and cancer standardized incidence ratios (SIRs) in patients without a prior cancer were estimated relative to reference populations. Crude incidence rates were estimated for MI and stroke. No increased mortality or cancer incidence was observed, as compared with reference populations, during a follow-up of 3.7 ± 3.3 years (mean ± SD). The overall SMR for COGHD was 1.14 [95 % confidence interval (CI) 0.55-2.10], and for ICOGHD, 0.33 (0.01-1.84). The overall cancer SIR for COGHD was 0.27 (0.01-1.50), and for ICOGHD, 0.00 (0.00-2.45). No incident case of MI was reported. The crude stroke incidence rate [181.3 per 100,000 person-years] in COGHD patients was consistent with the rates reported in reference populations. No incident case of stroke was identified in ICOGHD patients who are presumed to have no increased stroke risk factors. The results indicate no increased risk of mortality or incidence of cancer, stroke, or MI in adult GH-deficient patients who had previously received pediatric GH treatment.

  13. Control of nucleation and crystal growth of a silicate apatitic phase in a glassy matrix

    International Nuclear Information System (INIS)

    Ligny, D.; Caurant, D.; Bardez, I.; Dussossoy, J.L.; Loiseau, P.; Neuville, D.R.

    2004-01-01

    Nucleation and growth of crystal in an oxide glass was studied in a Si B Al Zr Nd Ca Na O system. The nucleation and growth process were monitored by thermal analysis and isothermal experiments. The effect of the network modifier was studied. Therefore for a Ca rich sample the crystallization is homogeneous in the bulk showing a slow increase of crystallinity as temperature increases. On the other hand, a Na rich sample undergoes several crystallization processes in the bulk or from the surface, leading to bigger crystals. The activation energy of the viscous flow and the glass transition are of same magnitude when that of crystallization is a lot smaller. Early diffusion of element is done with a mechanism different than the configurational rearrangements of the liquid sate. The global density and small size of the crystals within the Ca rich matrix confirmed that it would be a profitable waste form for minor actinides. (authors)

  14. Saccharomyces cerevisiae biofilm tolerance towards systemic antifungals depends on growth phase

    DEFF Research Database (Denmark)

    Bojsen, Rasmus Kenneth; Regenberg, Birgitte; Folkesson, Sven Anders

    2014-01-01

    used Saccharomyces cerevisiae as a model for drug susceptibility of yeast biofilms. Confocal laser scanning microscopy showed that S. cerevisiae and C. glabrata form similarly structured biofilms and that the viable cell numbers were significantly reduced by treatment of mature biofilms...... with amphotericin B but not voriconazole, flucytosine, or caspofungin. We showed that metabolic activity in yeast biofilm cells decreased with time, as visualized by FUN-1 staining, and mature, 48-hour biofilms contained cells with slow metabolism and limited growth. Time-kill studies showed that in exponentially...... growing planktonic cells, voriconazole had limited antifungal activity, flucytosine was fungistatic, caspofungin and amphotericin B were fungicidal. In growth-arrested cells, only amphotericin B had antifungal activity. Confocal microscopy and colony count viability assays revealed that the response...

  15. Crystal phase control in GaAs nanowires: opposing trends in the Ga- and As-limited growth regimes

    International Nuclear Information System (INIS)

    Lehmann, Sebastian; Jacobsson, Daniel; Dick, Kimberly A

    2015-01-01

    Here we demonstrate the existence of two distinct regimes for tuning crystal structure in GaAs nanowires from zinc blende to wurtzite using a single process parameter: V/III-ratio, or variation of the group V precursor flow. Extensive previous studies have shown that crystal structure is sensitive to V/III-ratio, and even that it is possible to change structure entirely using this single parameter. However, an open question has remained about whether the observed dependencies are related to growth technique or types of precursors used. Specifically, opposite trends have been reported for molecular beam epitaxy (MBE) and metal organic vapour phase epitaxy (MOVPE): while wurtzite GaAs growth is reported for high nominal V/III-ratio in MBE, zinc blende GaAs is formed in MOVPE under apparently the same parameter change (increasing precursor V/III-ratio). Here we show that these observations are not necessarily contradictory, as it may first appear, by providing a consolidated picture covering all regimes in one MOVPE growth machine only. More precisely, we observe wurtzite formation for medium nominal V/III-ratios with a critical sensitivity to the balance between Ga and As supply. Slight deviations from wurtzite conditions will result in zinc blende formation for either low V/III-ratio in the As-limited regime or high V/III-ratio in the Ga-limited regime. Our observations strongly indicate that the applied growth conditions are the crucial ingredients for crystal structure control in GaAs nanowires rather than the growth technique or precursors used. (fast track communication)

  16. B cell-derived transforming growth factor-β1 expression limits the induction phase of autoimmune neuroinflammation.

    Science.gov (United States)

    Bjarnadóttir, Kristbjörg; Benkhoucha, Mahdia; Merkler, Doron; Weber, Martin S; Payne, Natalie L; Bernard, Claude C A; Molnarfi, Nicolas; Lalive, Patrice H

    2016-10-06

    Studies in experimental autoimmune encephalomyelitis (EAE), a murine model of multiple sclerosis (MS), have shown that regulatory B cells modulate the course of the disease via the production of suppressive cytokines. While data indicate a role for transforming growth factor (TGF)-β1 expression in regulatory B cell functions, this mechanism has not yet been tested in autoimmune neuroinflammation. Transgenic mice deficient for TGF-β1 expression in B cells (B-TGF-β1 -/- ) were tested in EAE induced by recombinant mouse myelin oligodendrocyte glycoprotein (rmMOG). In this model, B-TGF-β1 -/- mice showed an earlier onset of neurologic impairment compared to their littermate controls. Exacerbated EAE susceptibility in B-TGF-β1 -/- mice was associated with augmented CNS T helper (Th)1/17 responses. Moreover, selective B cell TGF-β1-deficiency increased the frequencies and activation of myeloid dendritic cells, potent professional antigen-presenting cells (APCs), suggesting that B cell-derived TGF-β1 can constrain Th1/17 responses through inhibition of APC activity. Collectively our data suggest that B cells can down-regulate the function of APCs, and in turn encephalitogenic Th1/17 responses, via TGF-β1, findings that may be relevant to B cell-targeted therapies.

  17. Chlamydomonas reinhardtii: duration of its cell cycle and phases at growth rates affected by temperature

    Czech Academy of Sciences Publication Activity Database

    Vítová, Milada; Bišová, Kateřina; Hlavová, Monika; Kawano, S.; Zachleder, Vilém; Čížková, Mária

    2011-01-01

    Roč. 234, č. 2 (2011), s. 599-608 ISSN 0032-0935 R&D Projects: GA AV ČR IAA500200614; GA ČR GA525/09/0102; GA ČR GA204/09/0111 Institutional research plan: CEZ:AV0Z50200510 Keywords : Cell cycle phases * Cell division timing * Chlamydomonas Subject RIV: EE - Microbiology, Virology Impact factor: 3.000, year: 2011

  18. Chlamydomonas reinhardtii: duration of its cell cycle and phases at growth rates affected by light intensity

    Czech Academy of Sciences Publication Activity Database

    Vítová, Milada; Bišová, Kateřina; Umysová, Dáša; Hlavová, Monika; Kawano, S.; Zachleder, Vilém; Čížková, Mária

    2011-01-01

    Roč. 233, č. 1 (2011), s. 75-86 ISSN 0032-0935 R&D Projects: GA AV ČR IAA500200614; GA ČR GA525/09/0102; GA ČR GA204/09/0111 Institutional research plan: CEZ:AV0Z50200510 Keywords : Cell division timing * Cell cycle phases * Chlamydomonas Subject RIV: EE - Microbiology, Virology Impact factor: 3.000, year: 2011

  19. Single phase feeding of fishmeal and its influence on growth and ...

    African Journals Online (AJOL)

    Alimentation en phase unique à la farine de poisson et son influence sur la croissance et la carcasse des poulets de chair. Une étude de 63 jours a été réalisée à la station expérimentale de volailles de l'Université Abubakar Tafawa Balewa à Bauchi au Nigeria. Dans l'étude, cent quatre-vingt-douze (192) poussins de chair ...

  20. Investigation of partitionless growth of ɛ-Al60Sm11 phase in Al-10 at% Sm liquid

    Science.gov (United States)

    Sun, Yang; Ye, Zhuo; Zhang, Feng; Ding, Ze Jun; Wang, Cai-Zhuang; Kramer, Matthew J.; Ho, Kai-Ming

    2018-01-01

    Recent experiments on devitrification of Al90Sm10 amorphous alloys revealed an unusual polymorphic transformation to a complex cubic crystal structure called the ɛ-Al60Sm11 phase. Molecular dynamics simulations of the growth of the stoichiometric ɛ-phase seed in contact with an undercooled Al-10 at% Sm liquid are performed to elucidate the microscopic process of transformation. The as-grown crystal and undercooled liquid possess similar local order around Al atoms whereas a rigid network defined by the Sm sub-lattice develops during the growth. Using a template-cluster alignment method, we define an order parameter to characterize the structural evolution in the system. Estimates of the attachment rate is {R}{{a}}=8.70× {10}-4 Å-2 ns-1 and detachment rate is {R}{{d}}=3.83× {10}-4 Å-2 ns-1 at the interface between ɛ-Al60Sm11 and Al-10 at% Sm liquid at 800 K.

  1. Crystal growth and electronic structure of low-temperature phase SrMgF4

    International Nuclear Information System (INIS)

    Atuchin, Victor V.; Goloshumova, Alina A.; Isaenko, Ludmila I.; Jiang, Xingxing; Lobanov, Sergey I.; Zhang, Zhaoming; Lin, Zheshuai

    2016-01-01

    Using the vertical Bridgman method, the single crystal of low temperature phase SrMgF 4 is obtained. The crystal is in a very good optical quality with the size of 10×7×5 mm 3 . Detailed photoemission spectra of the element core levels are determined by a monochromatic AlKa (1486.6 eV) X-ray source. Moreover, the first-principles calculations are performed to investigate the electronic structure of SrMgF 4 . A good agreement between experimental and calculated results is achieved. It is demonstrated that almost all the electronic orbitals are strongly localized and the hybridization with the others is very small, but the Mg–F bonds covalency is relatively stronger than that of Sr–F bonds. - Graphical abstract: Large size of low-temperature phase SrMgF 4 crystal was obtained (right) and its electronic structure was investigated by X-ray photoelectron spectroscopy and first-principles calculation (left). - Highlights: • Large size single crystal of low-temperature phase SrMgF 4 is obtained. • Electronic structure of SrMgF 4 is measured by X-ray photoelectron spectroscopy. • Partial densities of states are determined by first-principles calculation. • Good agreement between experimental and calculated results is achieved. • Strong ionic characteristics of chemical bonds are exhibited in SrMgF 4 .

  2. Gas-Phase Growth of Heterostructures of Carbon Nanotubes and Bimetallic Nanowires

    Directory of Open Access Journals (Sweden)

    Whi Dong Kim

    2011-01-01

    Full Text Available A simple, inexpensive, and viable method for growing multiple heterostructured carbon nanotubes (CNTs over the entire surface of Ni-Al bimetallic nanowires (NWs in the gas phase was developed. Polymer-templated bimetallic nitrate NWs were produced by electrospinning in the first step, and subsequent calcination resulted in the formation of bimetallic oxide NWs by thermal decomposition. In the second step, free-floating bimetallic NWs were produced by spray pyrolysis in an environment containing hydrogen gas as a reducing gas. These NWs were continuously introduced into a thermal CVD reactor in order to grow CNTs in the gas phase. Scanning electron microscopy (SEM, transmission electron microscopy (TEM, and Raman spectrometry analyses revealed that the catalytic Ni sites exposed in the non-catalytic Al matrix over the entire surface of the bimetallic NWs were seeded to radially grow highly graphitized CNTs, which resembled “foxtail” structures. The grown CNTs were found to have a relatively uniform diameter of approximately 10±2 nm and 10 to 15 walls with a hollow core. The average length of the gas-phase-grown CNTs can be controlled between 100 and 1000 nm by adjusting the residence time of the free-floating bimetallic NWs in the thermal CVD reactor.

  3. Spectroscopic descriptors for dynamic changes of soluble microbial products from activated sludge at different biomass growth phases under prolonged starvation.

    Science.gov (United States)

    Maqbool, Tahir; Cho, Jinwoo; Hur, Jin

    2017-10-15

    In this study, the spectroscopic indices of soluble microbial products (SMP) were explored using absorption and fluorescence spectroscopy to identify different distinctive biomass growth phases (i.e., exponential phase, pseudo-endogenous phase, and endogenous phase) and to describe the microbial activity of activated sludge in a batch type bioreactor under prolonged starvation. The optical descriptors, including UV absorption at 254 nm (UVA254), spectral slope, absorbance slope index (ASI), biological index (BIX), humification index (HIX), and the ratio of tryptophan-like to humic-like components (C1/C2), were examined to describe the dynamic changes in SMP. These indices were mostly associated with dissolved organic carbon (DOC) of SMPs and specific oxygen uptake rate (SOUR). Among those, ASI was the most strongly correlated with the SOUR data for the pseudo-endogenous and the endogenous periods. Although the three microbial phases were well discriminated using the spectral slope, BIX, and the C1/C2 ratio, the C1/C2 ratio can be suggested as the most preferable indicator as it can also trace the changes of the relative abundance of proteins to humic-like substances in SMPs. The suggested spectroscopic descriptors were reasonably explained by the general trends of decreased large-sized biopolymer fractions (e.g., proteins) and increased humic substrates (HS) with starvation time, which were detected by size exclusion chromatography. This study provides a novel insight into the strong potential of using optical descriptors to easily probe microbial status in biological treatment systems. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Adult onset tic disorders

    OpenAIRE

    Chouinard, S.; Ford, B.

    2000-01-01

    BACKGROUND—Tic disorders presenting during adulthood have infrequently been described in the medical literature. Most reports depict adult onset secondary tic disorders caused by trauma, encephalitis, and other acquired conditions. Only rare reports describe idiopathic adult onset tic disorders, and most of these cases represent recurrent childhood tic disorders.
OBJECTIVE—To describe a large series of patients with tic disorders presenting during adulthood, to compare cl...

  5. Barley Leaf Area and Leaf Growth Rates Are Maximized during the Pre-Anthesis Phase

    Directory of Open Access Journals (Sweden)

    Ahmad M. Alqudah

    2015-04-01

    Full Text Available Leaf developmental traits are an important component of crop breeding in small-grain cereals. Surprisingly, little is known about the genetic basis for the differences in barley (Hordeum vulgare L. leaf development. The two barley row-type classes, i.e., two- and six-rowed, show clear-cut differences in leaf development. To quantify these differences and to measure the genetic component of the phenotypic variance for the leaf developmental differences in both row-type classes we investigated 32 representative spring barley accessions (14 two- and 18 six-rowed accessions under three independent growth conditions. Leaf mass area is lower in plants grown under greenhouse (GH conditions due to fewer, smaller, and lighter leaf blades per main culm compared to pot- and soil-grown field plants. Larger and heavier leaf blades of six-rowed barley correlate with higher main culm spike grain yield, spike dry weight, and harvest index; however, smaller leaf area (LA in two-rowed barley can be attributed to more spikes, tillers, and biological yield (aboveground parts. In general, leaf growth rate was significantly higher between awn primordium and tipping stages. Moderate to very high broad-sense heritabilities (0.67–0.90 were found under all growth conditions, indicating that these traits are predominantly genetically controlled. In addition, our data suggests that GH conditions are suitable for studying leaf developmental traits. Our results also demonstrated that LA impacts single plant yield and can be reconsidered in future breeding programs. Six-rowed spike 1 (Vrs1 is the major determinate of barley row-types, the differences in leaf development between two- and six-rowed barleys may be attributed to the regulation of Vrs1 in these two classes, which needs further testing.

  6. Influence of Sn Doping on Phase Transformation and Crystallite Growth of TiO2 Nanocrystals

    Directory of Open Access Journals (Sweden)

    Guozhu Fu

    2014-01-01

    Full Text Available Sn doped TiO2 nanocrystals were synthesized via a single-step hydrothermal method and the influences of Sn doping on TiO2 have been investigated. It is found that Sn doping not only facilitates the crystal transfer from anatase to rutile but also facilitates the morphology change from sphere to rod. The states of Sn were studied by XPS and the creation of oxygen vacancies by Sn doping is confirmed. Moreover, the HRTEM results suggest that Sn facilitates preferential growth of resulting nanocrystals along (110 axis, which results in the formation of rod-like rutile nanocrystals.

  7. The effect of growth phase on the surface properties of three oleaginous microalgae (Botryococcus sp. FACGB-762, Chlorella sp. XJ-445 and Desmodesmus bijugatus XJ-231).

    Science.gov (United States)

    Xia, Ling; Huang, Rong; Li, Yinta; Song, Shaoxian

    2017-01-01

    The effects of growth phase on the lipid content and surface properties of oleaginous microalgae Botryococcus sp. FACGB-762, Chlorella sp. XJ-445 and Desmodesmus bijugatus XJ-231 were investigated in this study. The results showed that throughout the growth phases, the lipid content of microalgae increased. The surface properties like particle size, the degree of hydrophobicity, and the total concentration of functional groups increased while net surface zeta potential decreased. The results suggested that the growth stage had significant influence not only on the lipid content but also on the surface characteristics. Moreover, the lipid content was significantly positively related to the concentration of hydroxyl functional groups in spite of algal strains or growth phases. These results provided a basis for further studies on the refinery process using oleaginous microalgae for biofuel production.

  8. Photosynthetic Entrainment of the Circadian Clock Facilitates Plant Growth under Environmental Fluctuations: Perspectives from an Integrated Model of Phase Oscillator and Phloem Transportation

    Directory of Open Access Journals (Sweden)

    Takayuki Ohara

    2017-10-01

    Full Text Available Plants need to avoid carbon starvation and resultant growth inhibition under fluctuating light environments to ensure optimal growth and reproduction. As diel patterns of carbon metabolism are influenced by the circadian clock, appropriate regulation of the clock is essential for plants to properly manage their carbon resources. For proper adjustment of the circadian phase, higher plants utilize environmental signals such as light or temperature and metabolic signals such as photosynthetic products; the importance of the latter as phase regulators has been recently elucidated. A mutant of Arabidopsis thaliana that is deficient in phase response to sugar has been shown, under fluctuating light conditions, to be unable to adjust starch turnover and to realize carbon homeostasis. Whereas, the effects of light entrainment on growth and survival of higher plants are well studied, the impact of phase regulation by sugar remains unknown. Here we show that endogenous sugar entrainment facilitates plant growth. We integrated two mathematical models, one describing the dynamics of carbon metabolism in A. thaliana source leaves and the other growth of sink tissues dependent on sucrose translocation from the source. The integrated model predicted that sugar-sensitive plants grow faster than sugar-insensitive plants under constant as well as changing photoperiod conditions. We found that sugar entrainment enables efficient carbon investment for growth by stabilizing sucrose supply to sink tissues. Our results highlight the importance of clock entrainment by both exogenous and endogenous signals for optimizing growth and increasing fitness.

  9. RETRACTED: High quality N-polar GaN two-dimensional growth on c-plane sapphire by metalorganic vapor phase epitaxy

    Science.gov (United States)

    Zhang, Yuantao; Dong, Xin; Li, Guoxing; Li, Wancheng; Zhang, Baolin; Du, Guotong

    2013-03-01

    We report the growth of atomically smooth N-polar GaN on c-plane sapphire by metalorganic vapor phase epitaxy. A two-step growth technique was adopted; low-temperature growth of GaN buffer before high-temperature GaN growth. The complete two-dimensional N-polar GaN growth process was recorded by in situ reflectance. The phase composition of the low-temperature GaN was examined by X-ray diffraction pole figure measurements. The thickness of the low-temperature GaN buffer dramatically affected the crystalline and electronic properties of the N-polar GaN. A very small full width at half maximum for the (0 0 0 2) X-ray rocking curve, 51 arcs, was obtained for 700-nm-thick N-polarity GaN by optimizing the buffer thickness.

  10. Catch-up growth during tocilizumab therapy for systemic juvenile idiopathic arthritis: results from a phase III trial.

    Science.gov (United States)

    De Benedetti, Fabrizio; Brunner, Hermine; Ruperto, Nicolino; Schneider, Rayfel; Xavier, Ricardo; Allen, Roger; Brown, Diane E; Chaitow, Jeffrey; Pardeo, Manuela; Espada, Graciela; Gerloni, Valeria; Myones, Barry L; Frane, James W; Wang, Jianmei; Lipman, Terri H; Bharucha, Kamal N; Martini, Alberto; Lovell, Daniel

    2015-03-01

    To investigate the impact of tocilizumab treatment on growth and growth-related laboratory parameters in patients with systemic juvenile idiopathic arthritis (JIA) enrolled in a phase III clinical trial. Patients with systemic JIA ages 2-17 years (n = 112) received tocilizumab in a 12-week, randomized, placebo-controlled period and a long-term open-label extension. Height velocity and standard deviation (SD) score; levels of insulin-like growth factor 1 (IGF-1), osteocalcin (OC), and C-telopeptide of type I collagen (CTX-I); and Juvenile Arthritis Disease Activity Score in 71 joints (JADAS-71) were measured in a post hoc analysis of 83 patients who never received growth hormone and did not reach Tanner stage 5 by the end of the first year of treatment. Patients had stunted growth at baseline (mean height SD score -2.2). During tocilizumab treatment, males (73%) and females (83%) experienced above-normal mean height velocities of 6.6 cm/year (P < 0.0001 versus World Health Organization norms). Mean height SD score increases during year 1 (0.29) and year 2 (0.31) were significant (both P < 0.0001). The mean SD score for IGF-1 levels increased significantly (-0.2 for year 1 and -0.1 for year 2 versus -1.0 at baseline; both P < 0.0001). Mean OC and CTX-I levels (both P < 0.0001) and the OC:CTX-I ratio (P = 0.014) significantly increased from baseline to year 2. In multiple regression analysis, first-year height velocity had a significant inverse relationship to JADAS-71 at year 1, age, mean glucocorticoid dosage during the year, and height SD score at baseline. Our findings indicate that during treatment with tocilizumab, patients with systemic JIA experience significant catch-up growth, normalization of IGF-1 levels, and bone balance improvement favoring bone formation. Copyright © 2015 by the American College of Rheumatology.

  11. Gas Phase Growth of Wurtzite ZnS Nanobelts on a Large Scale

    Directory of Open Access Journals (Sweden)

    Jing Wang

    2013-01-01

    Full Text Available We showed large-scale synthesis of ZnS nanobelts by simply thermal evaporation of ZnS powder in the presence of Au catalysts at 1020°C. Scanning electron microscope (SEM, transmission electron microscope (TEM, and X-ray diffraction (XRD analyses demonstrated that the as-obtained ZnS nanobelts possess hexagonal wurtzite structures. The nanobelts have lengths ranging from tens to hundreds of micrometers, thicknesses of tens of nanometers, and widths ranging from hundreds of nanometers to the order of micrometers. The growth process was proposed on the basis of known vapor-liquid-solid (VLS mechanism. Room temperature photoluminescence measurements showed that the as-synthesized ZnS nanostructures had a strong green emission bands at a wavelength of 427 nm, which can be attributed to deep-level emissions induced by defects or impurities.

  12. Crystal growth of phase matchable new organic nonlinear optical material for UV laser generation

    Science.gov (United States)

    Ramajothi, J.; Dhanuskodi, S.; Akkurt, Mehmet

    2008-04-01

    L-Histidinium tetrafluorosuccinate ( L-HFS), an organic nonlinear optical material has been synthesized and characterized by the elemental analysis, FT-IR, FT-NMR and X-ray diffraction studies. Solubility of L-HFS was found to be higher in water than ethanol. Single crystals with dimensions 10 mm × 6 mm × 3 mm were grown in an aqueous solution by the slow evaporation technique at 30 °C. The thermal stability of L-HFS has been analyzed by thermogravimetric and differential thermal analyses (TGA and DTA). The UV-vis spectral study reveals that the material has a wide optical transparency in the entire visible region with the lower cutoff wavelength at 235 nm. The phase matching condition was obtained by Kurtz powder second harmonic generation (SHG) efficiency test. The laser damage threshold of the grown crystal was measured using a Q-Switched Nd:YAG laser (1064 nm).

  13. Growth hormone (GH) provocative retesting of 108 young adults with childhood-onset GH deficiency and the diagnostic value of insulin-like growth factor I (IGF-I) and IGF-binding protein-3

    DEFF Research Database (Denmark)

    Juul, A; Kastrup, K W; Pedersen, S A

    1997-01-01

    Serum levels of total insulin-like growth factor I (IGF-I) and IGF-binding protein-3 (IGFBP-3) reflect the endogenous GH secretion in healthy children and exhibit little diurnal variation, which makes them good diagnostic markers for screening of GH deficiency (GHD) in short children, although some...... controversy still exists. In adults, the diagnostic value of IGF-I and IGFBP-3 suspected of GHD has been reported in only a few studies. We performed a GH provocative test, using oral clonidine, in 108 patients who had previously been treated with GH during childhood (73 men and 35 women). Basal IGF......-I and IGFBP-3 levels were compared to those in 1237 healthy controls (312 controls > 18 yr) as well as to peak GH levels. Seventy-nine patients had peak GH values below a cut-off value of 7.5 micrograms/L (34 with isolated GHD), whereas 29 patients had a normal GH response (28 with previous isolated GHD), i...

  14. Scalable solution-phase epitaxial growth of symmetry-mismatched heterostructures on two-dimensional crystal soft template.

    Science.gov (United States)

    Lin, Zhaoyang; Yin, Anxiang; Mao, Jun; Xia, Yi; Kempf, Nicholas; He, Qiyuan; Wang, Yiliu; Chen, Chih-Yen; Zhang, Yanliang; Ozolins, Vidvuds; Ren, Zhifeng; Huang, Yu; Duan, Xiangfeng

    2016-10-01

    Epitaxial heterostructures with precisely controlled composition and electronic modulation are of central importance for electronics, optoelectronics, thermoelectrics, and catalysis. In general, epitaxial material growth requires identical or nearly identical crystal structures with small misfit in lattice symmetry and parameters and is typically achieved by vapor-phase depositions in vacuum. We report a scalable solution-phase growth of symmetry-mismatched PbSe/Bi 2 Se 3 epitaxial heterostructures by using two-dimensional (2D) Bi 2 Se 3 nanoplates as soft templates. The dangling bond-free surface of 2D Bi 2 Se 3 nanoplates guides the growth of PbSe crystal without requiring a one-to-one match in the atomic structure, which exerts minimal restriction on the epitaxial layer. With a layered structure and weak van der Waals interlayer interaction, the interface layer in the 2D Bi 2 Se 3 nanoplates can deform to accommodate incoming layer, thus functioning as a soft template for symmetry-mismatched epitaxial growth of cubic PbSe crystal on rhombohedral Bi 2 Se 3 nanoplates. We show that a solution chemistry approach can be readily used for the synthesis of gram-scale PbSe/Bi 2 Se 3 epitaxial heterostructures, in which the square PbSe (001) layer forms on the trigonal/hexagonal (0001) plane of Bi 2 Se 3 nanoplates. We further show that the resulted PbSe/Bi 2 Se 3 heterostructures can be readily processed into bulk pellet with considerably suppressed thermal conductivity (0.30 W/m·K at room temperature) while retaining respectable electrical conductivity, together delivering a thermoelectric figure of merit ZT three times higher than that of the pristine Bi 2 Se 3 nanoplates at 575 K. Our study demonstrates a unique epitaxy mode enabled by the 2D nanocrystal soft template via an affordable and scalable solution chemistry approach. It opens up new opportunities for the creation of diverse epitaxial heterostructures with highly disparate structures and functions.

  15. A generalized theory of thin film growth

    Science.gov (United States)

    Du, Feng; Huang, Hanchen

    2018-03-01

    This paper reports a theory of thin film growth that is generalized for arbitrary incidence angle during physical vapor deposition in two dimensions. The accompanying kinetic Monte Carlo simulations serve as verification. A special theory already exists for thin film growth with zero incidence angle, and another theory also exists for nanorod growth with a glancing angle. The theory in this report serves as a bridge to describe the transition from thin film growth to nanorod growth. In particular, this theory gives two critical conditions in analytical form of critical coverage, ΘI and ΘII. The first critical condition defines the onset when crystal growth or step dynamics stops following the wedding cake model for thin film growth. The second critical condition defines the onset when multiple-layer surface steps form to enable nanorod growth. Further, this theory also reveals a critical incidence angle, below which nanorod growth is impossible. The critical coverages, together with the critical incidence angle, defines a phase diagram of thin growth versus nanorod growth.

  16. Shock-Driven Hydrodynamic Instability Growth Near Phase Boundaries and Material Property Transitions: Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Peralta, Pedro [Arizona State Univ., Tempe, AZ (United States); Fortin, Elizabeth [Arizona State Univ., Tempe, AZ (United States); Opie, Saul [Arizona State Univ., Tempe, AZ (United States); Gautam, Sudrishti [Arizona State Univ., Tempe, AZ (United States); Gopalakrishnan, Ashish [Arizona State Univ., Tempe, AZ (United States); Lynch, Jenna [Arizona State Univ., Tempe, AZ (United States); Chen, Yan [Arizona State Univ., Tempe, AZ (United States); Loomis, Eric [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-03-01

    Activities for this grant included: 1) Development of dynamic impact experiments to probe strength and phase transition influence on dynamic deformation, 2) development of modern strength and phase aware simulation capabilities, 3) and post-processing of experimental data with simulation and closed form analytical techniques. Two different dynamic experiments were developed to probe material strengths in solid metals (largely copper and iron in this effort). In the first experiment a flyer plate impacts a flat target with an opposite rippled surface that is partially supported by a weaker window material. Post mortem analysis of the target sample showed a strong and repeatable residual plastic deformation dependence on grain orientation. Yield strengths for strain rates near 105 s-1 and plastic strains near ~50% were estimated to be around 180 to 240 MPa, varying in this range with grain orientation. Unfortunately dynamic real-time measurements were difficult with this setup due to diagnostic laser scattering; hence, an additional experimental setup was developed to complement these results. In the second set of experiments a rippled surface was ablated by a controlled laser pulsed, which launched a rippled shock front to an opposite initially flat diagnostic surface that was monitored in real-time with spatially resolved velocimetry techniques, e.g., line VISAR in addition to Transient Imaging Displacement Interferometry (TIDI) displacement measurements. This setup limited the displacements at the diagnostic surface to a reasonable level for TIDI measurements (~ less than one micrometer). These experiments coupled with analytical and numerical solutions provided evidence that viscous and elastic deviatoric strength affect shock front perturbation evolution in clearly different ways. Particularly, normalized shock front perturbation amplitudes evolve with viscosity (η) and perturbation wavelength (λ) as η/λ, such that increasing viscosity

  17. Optimization of selective area growth of GaAs by low pressure organometallic vapor phase epitaxy for monolithic integrated circuits

    Science.gov (United States)

    Kanber, H.; Bar, S. X.; Norris, P. E.; Beckham, C.; Pacer, M.

    1994-02-01

    GaAs MESFET device structures have been grown on silicon nitride or silicon dioxide masked 50 and 76 mm GaAs substrates by low pressure organometallic vapor phase epitaxy. Very smooth, featureless morphology and 100 percent selectivity of GaAs islands have been achieved over a range of growth conditions. Optimization of the GaAs p-buffer of the field effect transistor structure has led to improved device performance, including increased breakdown voltage. Device characteristics of the 0.5 μm gate low noise metal semiconductor field-effect transistors fabricated on these islands show good performance and wafer to wafer reproducibility on the second device lot.

  18. In situ growth of IRMOF-3 combined with ionic liquids to prepare solid-phase microextraction fibers.

    Science.gov (United States)

    Zheng, Juan; Li, Siyan; Wang, Ying; Li, Lei; Su, Chengyong; Liu, Hong; Zhu, Fang; Jiang, Ruifen; Ouyang, Gangfeng

    2014-06-04

    A superior solid-phase microextraction (SPME) fiber-coating material, IRMOF-3@ILs/PDMS, was prepared by the in situ growth of IRMOF-3 onto stainless-steel wires and protection with ionic liquids (ILs) and polydimethylsiloxane (PDMS). The ILs can efficiently prevent the substantial cracking of IRMOF-3 caused by moisture, and a thin PDMS film can protect the IRMOF-3@ILs material to achieve a much better extraction efficiency as well as excellent resistance to high temperature and high humidity. This IRMOF-3@ILs/PDMS coating possessed a porous structure, a rough surface and an increased lifespan (by at least 100 times) compared with that of IRMOF-3. The coating was evaluated by analyzing four polycyclic aromatic hydrocarbons (PAHs) in water, and good precision (analysis of PAHs in rainwater by coupling it with gas chromatography-mass spectrometry (GC-MS). Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Synthesis, crystal growth and characterization of g-phase bismuth titanium oxide with gallium

    Directory of Open Access Journals (Sweden)

    Lobato A.R.

    2000-01-01

    Full Text Available Gallium solubility in the Bi12TiO20 (BTO matrix was investigated by solid state reaction synthesis and Bi12Ti(1-xGa xO20 (BTGaO single crystals were grown by Top Seeded Solution Growth (TSSG. We determined that it is possible to obtain a continuous solid solution from (xBi12TiO20: (1-xBi12[Ga0.7Bi0.3]O20 and that Ga replaces Ti in the BTO matrix giving Bi12Ti(1-xGa(xO20 up to x < 0.2. BTGaO single crystals grown with an excess of Bi2O3 were transparent, a bleaching effect was observed due to the presence of gallium in the crystalline sillenite structure and their lattice parameter was higher than for pure BTO. The results for BTGaO single crystals showed an increase in the optical activity from rho0 = 6.4° ± 0.3°/mm, for BTO, to rho0 = 9.7° ± 0.3°/mm, for BTGaO grown with x = 0.30 in the melt. The BTGaO crystal presented an activation energy value of 0.48 ± 0.02 eV for 100 °C <= T <= 300 °C.

  20. Methyl Sartortuoate Inhibits Colon Cancer Cell Growth by Inducing Apoptosis and G2/M-Phase Arrest.

    Science.gov (United States)

    Lan, Qiusheng; Li, Shoufeng; Lai, Wei; Xu, Heyang; Zhang, Yang; Zeng, Yujie; Lan, Wenjian; Chu, Zhonghua

    2015-08-17

    The potential anti-neoplastic activity of terpenoids is of continued interest. In this study, we investigate whether methyl sartortuoate, a terpenoid isolated from soft coral, induced cell cycle arrest and apoptosis in a human colon cancer cell line. Culture studies found that methyl sartortuoate inhibited colon cancer cell (LoVo and RKO) growth and caused apoptotic death in a concentration- and time-dependent manner, by activation of caspase-8, caspase-9, caspase-3, p53 and Bax, and inactivation of B-cell lymphoma 2 (Bcl-2) apoptosis regulating proteins. Methyl sartortuoate treatment led to reduced expression of cdc2 and up-regulated p21 and p53, suggesting that Methyl sartortuoate induced G2-M arrest through modulation of p53/p21/cdc2 pathways. Methyl sartortuoate also up-regulated phospho-JNK and phospho-p38 expression levels. This resulted in cell cycle arrest at the G2-M phase and apoptosis in LoVo and RKO cells. Treatment with the JNK inhibitor SP600125 and the p38 MAPK inhibitor SB203580 prevented methyl sartortuoate-induced apoptosis in LoVo cells. Moreover, methyl sartortuoate also prevented neoplasm growth in NOD-SCID nude mice inoculated with LoVo cells. Taken together, these findings suggest that methyl sartortuoate is capable of leading to activation of caspase-8, -9, -3, increasing p53 and Bax/Bcl-2 ratio apoptosis through MAPK-dependent apoptosis and results in G2-M phase arrest in LoVo and RKO cells. Thus, methyl sartortuoate may be a promising anticancer candidate.

  1. Late-Onset Asthma

    DEFF Research Database (Denmark)

    Ulrik, Charlotte Suppli

    2017-01-01

    the risk of systemic effects. However, most recommendations are based on extrapolation from findings in younger patients. Comorbidities are very common in patients with late-onset asthma and need to be taken into account in the management of the disease. In conclusion, late-onset asthma is poorly......Late-onset asthma is common, associated with poor outcome, underdiagnosed and undertreated, possibly due to the modifying effect of ageing on disease expression. Although the diagnostic work-up in elderly individuals suspected of having asthma follows the same steps as in younger individuals (case...... history and spirometry), it is important to acknowledge that elderly individuals are likely to have diminished bronchodilator reversibility and some degree of fixed airflow obstruction. Elderly individuals, therefore, often require further objective tests, including bronchial challenge testing...

  2. Investigating the Effect of Growth Phase on the Surface-Layer Associated Proteome of Lactobacillus acidophilus Using Quantitative Proteomics

    Directory of Open Access Journals (Sweden)

    Courtney Klotz

    2017-11-01

    Full Text Available Bacterial surface-layers (S-layers are semi-porous crystalline arrays that self-assemble to form the outermost layer of some cell envelopes. S-layers have been shown to act as scaffolding structures for the display of auxiliary proteins externally. These S-layer associated proteins have recently gained attention in probiotics due to their direct physical contact with the intestinal mucosa and potential role in cell proliferation, adhesion, and immunomodulation. A number of studies have attempted to catalog the S-layer associated proteome of Lactobacillus acidophilus NCFM under a single condition. However, due to the versatility of the cell surface, we chose to employ a multiplexing-based approach with the intention of accurately contrasting multiple conditions. In this study, a previously described lithium chloride isolation protocol was used to release proteins bound to the L. acidophilus S-layer during logarithmic and early stationary growth phases. Protein quantification values were obtained via TMT (tandem mass tag labeling combined with a triple-stage mass spectrometry (MS3 method. Results showed significant growth stage-dependent alterations to the surface-associated proteome while simultaneously highlighting the sensitivity and reproducibility of the technology. Thus, this study establishes a framework for quantifying condition-dependent changes to cell surface proteins that can easily be applied to other S-layer forming bacteria.

  3. Bi2(Sr, Ln)2CuOz (Ln = Nd, Sm) phases: stability, crystal growth and superconducting properties

    International Nuclear Information System (INIS)

    Faqir, H.; Kikuchi, M.; Syono, Y.; Mansori, M.; Satre, P.; Sebaoun, A.; Vacquier, G.

    2000-01-01

    Bi 2 (Sr,Ln) 2 CuO z (Ln = Nd, Sm) single crystals were successfully grown by a self-flux method from stoichiometric and (Bi, Cu)-rich melts. Thermal analysis and thermogravimetry were used to determine stability and the melting sequence of Bi 2 (Sr,Ln) 2 CuO z phases in air. As-grown crystals of the ideal Bi 2 (Sr,Ln) 2 CuO z phase, of dimensions 1x0.5x0.03 mm 3 , exhibit superconducting behaviour with critical temperature T c = 21 K for the Bi 1.9 Sr 1.6 Nd 0.6 CuO z crystal and Tc = 14 K for the Bi 1.8 Sr 1.6 Sm 0.6 CuO z crystal. The compositions of these crystals were homogeneous and close to the stoichiometric composition. We report on the growth of Bi 2 Sr 2-x Sm x CuO z single crystals of large dimensions 9x3x0.03 mm 3 using Bi 2 Sr 1.5 Sm 0.5 CuO z as precursor and Bi 2 CuO 4 as flux. (author)

  4. 3D microstructural evolution of primary recrystallization and grain growth in cold rolled single-phase aluminum alloys

    Science.gov (United States)

    Adam, Khaled; Zöllner, Dana; Field, David P.

    2018-04-01

    Modeling the microstructural evolution during recrystallization is a powerful tool for the profound understanding of alloy behavior and for use in optimizing engineering properties through annealing. In particular, the mechanical properties of metallic alloys are highly dependent upon evolved microstructure and texture from the softening process. In the present work, a Monte Carlo (MC) Potts model was used to model the primary recrystallization and grain growth in cold rolled single-phase Al alloy. The microstructural representation of two kinds of dislocation densities, statistically stored dislocations and geometrically necessary dislocations were quantified based on the ViscoPlastic Fast Fourier transform method. This representation was then introduced into the MC Potts model to identify the favorable sites for nucleation where orientation gradients and entanglements of dislocations are high. Additionally, in situ observations of non-isothermal microstructure evolution for single-phase aluminum alloy 1100 were made to validate the simulation. The influence of the texture inhomogeneity is analyzed from a theoretical point of view using an orientation distribution function for deformed and evolved texture.

  5. Comment on "Growth of covariant perturbations in the contracting phase of a bouncing universe"

    Science.gov (United States)

    Pinto-Neto, N.; Vitenti, S. D. P.

    2014-01-01

    A recent paper by Kumar (2012) (hereafter K12) claimed that in a contracting model, described by perturbations around a collapsing Friedmann model containing dust or radiation, the perturbations can grow in such a way that the linearity conditions would become invalid. This conclusion is not correct due to the following facts: first, it is claimed that the linearity conditions are not satisfied, but nowhere in K12 the amplitudes of the perturbations were in fact estimated. Therefore, without such estimates, the only possible conclusion from this work is the well-known fact that the perturbations indeed grow during contraction, which, per se, does not imply that the linearity conditions become invalid. Second, some evaluations of the linearity conditions are incorrect because third-order terms, instead of the appropriate second-order ones, are mistakenly compared with first-order terms, yielding artificially fast growing conditions. Finally, it is claimed that the results of K12 are in sharp contrast with the results of the paper by Vitenti and Pinto-Neto (2012) (hereafter VPN12), because the former was obtained in a gauge-invariant way. However, the author of K12 did not realize that the evolution of the perturbations were also calculated in a gauge-invariant way in VPN12, but some of the linearity conditions which are necessary to check cannot be expressed in terms of gauge-invariant quantities. In the present work, the incorrect or incomplete statements of K12 are clarified and completed, and it is shown that all other correct results of K12 were already present in VPN12, whose conclusions remain untouched, namely, that cosmological perturbations of quantum mechanical origin in a bouncing model can remain in the linear regime all along the contracting phase and at the bounce itself for a wide interval of energy scales of the bounce, ranging from the nucleosynthesis energy scale up to a few orders of magnitude below the Planck energy.

  6. Growth Phase-Dependent Proteomes of the Malaysian Isolated Lactococcus lactis Dairy Strain M4 Using Label-Free Qualitative Shotgun Proteomics Analysis

    Science.gov (United States)

    Yap, Theresa Wan Chen; Rabu, Amir; Abu Bakar, Farah Diba; Abdul Rahim, Raha; Mahadi, Nor Muhammad; Illias, Rosli Md.

    2014-01-01

    Lactococcus lactis is the most studied mesophilic fermentative lactic acid bacterium. It is used extensively in the food industry and plays a pivotal role as a cell factory and also as vaccine delivery platforms. The proteome of the Malaysian isolated L. lactis M4 dairy strain, obtained from the milk of locally bred cows, was studied to elucidate the physiological changes occurring between the growth phases of this bacterium. In this study, ultraperformance liquid chromatography nanoflow electrospray ionization tandem mass spectrometry (UPLC- nano-ESI-MSE) approach was used for qualitative proteomic analysis. A total of 100 and 121 proteins were identified from the midexponential and early stationary growth phases, respectively, of the L. lactis strain M4. During the exponential phase, the most important reaction was the generation of sufficient energy, whereas, in the early stationary phase, the metabolic energy pathways decreased and the biosynthesis of proteins became more important. Thus, the metabolism of the cells shifted from energy production in the exponential phase to the synthesis of macromolecules in the stationary phase. The resultant proteomes are essential in providing an improved view of the cellular machinery of L. lactis during the transition of growth phases and hence provide insight into various biotechnological applications. PMID:24982972

  7. Growth Phase-Dependent Proteomes of the Malaysian Isolated Lactococcus lactis Dairy Strain M4 Using Label-Free Qualitative Shotgun Proteomics Analysis

    Directory of Open Access Journals (Sweden)

    Theresa Wan Chen Yap

    2014-01-01

    Full Text Available Lactococcus lactis is the most studied mesophilic fermentative lactic acid bacterium. It is used extensively in the food industry and plays a pivotal role as a cell factory and also as vaccine delivery platforms. The proteome of the Malaysian isolated L. lactis M4 dairy strain, obtained from the milk of locally bred cows, was studied to elucidate the physiological changes occurring between the growth phases of this bacterium. In this study, ultraperformance liquid chromatography nanoflow electrospray ionization tandem mass spectrometry (UPLC- nano-ESI-MSE approach was used for qualitative proteomic analysis. A total of 100 and 121 proteins were identified from the midexponential and early stationary growth phases, respectively, of the L. lactis strain M4. During the exponential phase, the most important reaction was the generation of sufficient energy, whereas, in the early stationary phase, the metabolic energy pathways decreased and the biosynthesis of proteins became more important. Thus, the metabolism of the cells shifted from energy production in the exponential phase to the synthesis of macromolecules in the stationary phase. The resultant proteomes are essential in providing an improved view of the cellular machinery of L. lactis during the transition of growth phases and hence provide insight into various biotechnological applications.

  8. [46-OR] : Early and late onset preeclampsia versus small for gestational age risks in subsequent pregnancies

    NARCIS (Netherlands)

    Bernardes, Thomas P; Mol, Ben W; Ravelli, Anita C; van den Berg, Paul P; Stolk, Ronald P; Groen, Henk

    OBJECTIVES: Current literature suggests that early and late onset preeclampsia should be treated as distinct entities and that early onset preeclampsia shares pathophysiology aspects with intrauterine growth restriction. Our objective was to investigate whether 5th percentile small for gestational

  9. Suppression subtractive hybridization profiles of radial growth phase and metastatic melanoma cell lines reveal novel potential targets

    Directory of Open Access Journals (Sweden)

    Espreafico Enilza M

    2008-01-01

    Full Text Available Abstract Background Melanoma progression occurs through three major stages: radial growth phase (RGP, confined to the epidermis; vertical growth phase (VGP, when the tumor has invaded into the dermis; and metastasis. In this work, we used suppression subtractive hybridization (SSH to investigate the molecular signature of melanoma progression, by comparing a group of metastatic cell lines with an RGP-like cell line showing characteristics of early neoplastic lesions including expression of the metastasis suppressor KISS1, lack of αvβ3-integrin and low levels of RHOC. Methods Two subtracted cDNA collections were obtained, one (RGP library by subtracting the RGP cell line (WM1552C cDNA from a cDNA pool from four metastatic cell lines (WM9, WM852, 1205Lu and WM1617, and the other (Met library by the reverse subtraction. Clones were sequenced and annotated, and expression validation was done by Northern blot and RT-PCR. Gene Ontology annotation and searches in large-scale melanoma expression studies were done for the genes identified. Results We identified 367 clones from the RGP library and 386 from the Met library, of which 351 and 368, respectively, match human mRNA sequences, representing 288 and 217 annotated genes. We confirmed the differential expression of all genes selected for validation. In the Met library, we found an enrichment of genes in the growth factors/receptor, adhesion and motility categories whereas in the RGP library, enriched categories were nucleotide biosynthesis, DNA packing/repair, and macromolecular/vesicular trafficking. Interestingly, 19% of the genes from the RGP library map to chromosome 1 against 4% of the ones from Met library. Conclusion This study identifies two populations of genes differentially expressed between melanoma cell lines from two tumor stages and suggests that these sets of genes represent profiles of less aggressive versus metastatic melanomas. A search for expression profiles of melanoma in

  10. Suppression subtractive hybridization profiles of radial growth phase and metastatic melanoma cell lines reveal novel potential targets

    International Nuclear Information System (INIS)

    Sousa, Josane F; Espreafico, Enilza M

    2008-01-01

    Melanoma progression occurs through three major stages: radial growth phase (RGP), confined to the epidermis; vertical growth phase (VGP), when the tumor has invaded into the dermis; and metastasis. In this work, we used suppression subtractive hybridization (SSH) to investigate the molecular signature of melanoma progression, by comparing a group of metastatic cell lines with an RGP-like cell line showing characteristics of early neoplastic lesions including expression of the metastasis suppressor KISS1, lack of αvβ3-integrin and low levels of RHOC. Two subtracted cDNA collections were obtained, one (RGP library) by subtracting the RGP cell line (WM1552C) cDNA from a cDNA pool from four metastatic cell lines (WM9, WM852, 1205Lu and WM1617), and the other (Met library) by the reverse subtraction. Clones were sequenced and annotated, and expression validation was done by Northern blot and RT-PCR. Gene Ontology annotation and searches in large-scale melanoma expression studies were done for the genes identified. We identified 367 clones from the RGP library and 386 from the Met library, of which 351 and 368, respectively, match human mRNA sequences, representing 288 and 217 annotated genes. We confirmed the differential expression of all genes selected for validation. In the Met library, we found an enrichment of genes in the growth factors/receptor, adhesion and motility categories whereas in the RGP library, enriched categories were nucleotide biosynthesis, DNA packing/repair, and macromolecular/vesicular trafficking. Interestingly, 19% of the genes from the RGP library map to chromosome 1 against 4% of the ones from Met library. This study identifies two populations of genes differentially expressed between melanoma cell lines from two tumor stages and suggests that these sets of genes represent profiles of less aggressive versus metastatic melanomas. A search for expression profiles of melanoma in available expression study databases allowed us to point to a

  11. Growth of anatase and rutile phase TiO{sub 2} nanoparticles using pulsed laser ablation in liquid: Influence of surfactant addition and ablation time variation

    Energy Technology Data Exchange (ETDEWEB)

    Chaturvedi, Amita, E-mail: amita-chaturvedi@rrcat.gov.in [Laser Material Processing Division, Raja Ramanna Centre for Advanced Technology, Indore 452013, MP (India); Joshi, M.P. [Laser Material Processing Division, Raja Ramanna Centre for Advanced Technology, Indore 452013, MP (India); Homi Bhabha National Institute, Training School Complex, Anushakti Nagar, Mumbai – 400094 (India); Mondal, P.; Sinha, A.K.; Srivastava, A.K. [Indus Synchrotron Utilization Division, Raja Ramanna Centre for Advanced Technology, Indore 452013, MP (India)

    2017-02-28

    Highlights: • Ablations of Ti metal target were carried out in DI water and in 0.001 M SDS solution for different times using PLAL process. • Different characterization studies have been carried out to confirm the growth of TiO{sub 2} nanoparticles in both the liquid mediums. • Anatase phase TiO{sub 2} nanoparticles were obtained in DI water and rutile phase in 0.001 M SDS aqueous solution. • In surfactant solution, longer time ablation leads depletion of SDS molecules causes growth of anatase phase for 90 min. • Our studies confirmed the role of liquid ambience conditions variation over the different phase formations of nanoparticles. - Abstract: Titanium dioxide (TiO{sub 2}) nanoparticles were grown using nanosecond pulsed laser ablation of Ti target in DI water and in 0.001 M sodium dodecyl sulfate (SDS) surfactant aqueous solution. Growth was carried out with varying ablation times i. e. 30 min, 60 min and 90 min. The objective of our study was to investigate the influence of variations in liquid ambience conditions on the growth of the nanoparticles in a pulsed laser ablation in liquid (PLAL) process. Size, composition and optical properties of the grown TiO{sub 2} nanoparticles were investigated using transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), optical absorption, photoluminescence (PL) spectroscopy and X-ray diffraction (XRD) studies. The obtained nanoparticles of TiO{sub 2} were found almost spherical in shape and polycrystalline in nature in both the liquid mediums i.e. DI water and aqueous solution of surfactant. Nanoparticles number density was also found to increase with increasing ablation time in both the liquid mediums. However crystalline phase of the grown TiO{sub 2} nanoparticles differs with the change in liquid ambience conditions. Selected area electron diffraction (SAED), PL and XRD studies suggest that DI water ambience is favorable for the growth of anatase phase TiO{sub 2} nanoparticles for all

  12. Delayed sleep onset in depressed young people.

    Science.gov (United States)

    Glozier, Nicholas; O'Dea, Bridianne; McGorry, Patrick D; Pantelis, Christos; Amminger, Günter Paul; Hermens, Daniel F; Purcell, Rosemary; Scott, Elizabeth; Hickie, Ian B

    2014-02-08

    The circadian abnormality of delayed sleep phase has been suggested to characterise a subgroup of depressed young adults with different risk factors and course of illness. We aim to assess the prevalence and factors, particularly substance use, associated with such delay in a large help-seeking cohort of young people with mental health problems. From a consecutively recruited sample of 802 help-seeking young people, 305 (38%) had at least moderate depressive symptoms (QIDS-C16 >10), sleep data and did not have a chronic severe mental illness. Demographic and clinical characteristics were evaluated through self report and clinical interview. Delayed sleep phase was defined as a sleep onset between the hours of 02:00 a.m. - 06:00 a.m. and the characteristics of this group were compared to normal phase sleepers. Delayed sleep onset was reported amongst 18% (n = 56/305) of the depressed group compared to 11% of the non-depressed young people. Amongst the depressed group, delayed sleep onset was associated with tobacco, alcohol and cannabis misuse and short sleep duration (x̅: 5.8 hrs vs. x̅: 7.8 hrs). There were no differences in demographic factors, personality traits or symptoms. Tobacco smoking was very common: In logistic regression analyses only tobacco use (OR 2.28, 95% CI: 1.04 - 5.01) was associated with delayed sleep onset. There was no interaction with age. Delayed sleep onset was twice as common in depressed young people as the general population and young people with other mental health problems, and is a potential marker for a subgroup of mood disorders. Those with delayed sleep onset were not more severely depressed but had short sleep duration, a risk for chronic psychological ill health, and higher levels of tobacco use. Nicotine use was common in this group, has biological evidence as a sleep disrupter, and requires specifically addressing in this population.

  13. Measurements of fireball onset

    Science.gov (United States)

    Scheiner, Brett; Barnat, Edward V.; Baalrud, Scott D.; Hopkins, Matthew M.; Yee, Benjamin T.

    2018-04-01

    Laser-based measurements of the characteristic features of fireball onset and stabilization in response to a stepped voltage applied to an anode immersed in a low pressure (100 mTorr) helium afterglow are reported. These include spatial and temporal evolution of metastable species, electron density, and electric field magnitude as measured by planar laser induced fluorescence, laser-collision induced fluorescence, and laser-induced fluorescence-dip spectroscopy, respectively. These measurements are found to be in qualitative agreement with recent particle-in-cell simulations and theoretical models [Scheiner et al., Phys. Plasmas 24, 113520 (2017)]. The measurements validate the simulations and models in which fireball onset was predicted to follow from the trapping of electrons born from electron impact ionization within a potential well created by a buildup of ions in the sheath. The experimental measurements also demonstrate transient features following the onset that were not present in previous simulations. New simulation results are presented which demonstrate that these features are associated with the abruptness of the voltage step used to initiate fireball onset. An abrupt step in the anode bias causes rapid displacement of ions and an associated plasma potential response following the sheath and fireball expansion.

  14. Study on the nucleation and growth of Laves phase in a 10% Cr martensite ferritic steel after long-term aging

    International Nuclear Information System (INIS)

    Xu, Yuantao; Wang, Mingjia; Wang, Yan; Gu, Tao; Chen, Lei; Zhou, Xuan; Ma, Qian; Liu, Yuming; Huang, Jing

    2015-01-01

    Highlights: • Having used EBSD, SEM–BSE, and TEM techniques to investigate the nucleation and growth of Laves phase in the 10% Cr steel. • Most of Laves phases appear on grain boundaries with a misorientation angle of 40–60° and only a small amount of them at 3–10°. • Carbon atoms will segregate on the vicinity of phase interfaces between Laves phase and α-Fe during decomposition of M 23 C 6 carbides and formation of Laves phases. - Abstract: The nucleation and growth of Laves phase in a 10% Cr martensite ferritic steel after long-term aging have been investigated in this paper. Laves phase, (Fe, Cr) 2 (Mo, W), was observed after long-term (>750 h) aging at 650 °C. It is found that Laves phases prefer to locate at prior austenite grain boundaries and martensite lath boundaries, especially, most of them precipitate at grain boundaries with a misorientation angle of 40–60° and only a small amount of them at 3–10°. Moreover, the size of Laves phase at 40–60° grain boundaries is larger than that at 3–10° grain boundaries. In addition, some Laves phases are formed in the regions adjacent to M 23 C 6 particles, with increasing aging time they will gradually swallow the Cr-rich M 23 C 6 carbides in close vicinity, resulting in carbon atoms segregation on the vicinity of phase interfaces between Laves phase and α-Fe

  15. Combination therapy with sitagliptin and lansoprazole in patients with recent-onset type 1 diabetes (REPAIR-T1D): 12-month results of a multicentre, randomised, placebo-controlled, phase 2 trial.

    Science.gov (United States)

    Griffin, Kurt J; Thompson, Paul A; Gottschalk, Michael; Kyllo, Jennifer H; Rabinovitch, Alex

    2014-09-01

    Type 1 diabetes results from autoimmune destruction of pancreatic β cells. Findings from preclinical studies suggest that dipeptidyl peptidase-4 inhibitors and proton-pump inhibitors might enhance β-cell survival and regeneration. We postulated that sitagliptin and lansoprazole would preserve β-cell function in patients with recent-onset type 1 diabetes. We did a double-blind, placebo-controlled, phase 2 trial (REPAIR-T1D). Participants aged 11-36 years, diagnosed with type 1 diabetes within the past 6 months were recruited from Sanford Health Systems (Sioux Falls, SD, USA; Fargo, ND, USA), Children's Hospitals and Clinics of Minnesota (St Paul, MN, USA), and Rady Children's Hospital (San Diego, CA, USA). Participants were randomly assigned (2:1) to receive oral sitagliptin (100 mg for participants ≥18 years, 50 mg for those lansoprazole (60 mg for participants ≥18 years, 30 mg for those <18 years) or matched placebo for 12 months. Randomisation was done by a blocked randomisation process (blocks of three and six), with separate streams for younger (<18 years) and older (≥18 years) participants, and males and females. All participants and personnel remained masked until after the completion of the final 12 month visit, at which time data were unmasked to the analysis team. The primary endpoint was C-peptide response to a mixed meal challenge at 12 months measured as 2 h area under curve. Analysis was by intention to treat. This trial is registered with ClinicalTrials.gov, number NCT01155284. Between Sept 21, 2010, and May 29, 2012, 46 participants were randomly assigned to the treatment group and 22 to the placebo group; of whom 40 participants in the treatment group and 18 in the placebo group completed the 12-month treatment. At 12 months, the mean change in C-peptide area under curve was -229 pmol/L (95% CI -316 to -142) for the treatment group and -253 pmol/L (-383 to -123) for the placebo group; this difference was not significant (p=0·77). No

  16. Efficacy and safety of fast-acting insulin aspart in comparison with insulin aspart in type 1 diabetes (onset 1): A 52-week, randomized, treat-to-target, phase III trial.

    Science.gov (United States)

    Mathieu, Chantal; Bode, Bruce W; Franek, Edward; Philis-Tsimikas, Athena; Rose, Ludger; Graungaard, Tina; Birk Østerskov, Anne; Russell-Jones, David

    2018-01-08

    To compare the safety and efficacy of fast-acting insulin aspart (faster aspart) with conventional insulin aspart (IAsp) in adults with type 1 diabetes (T1D). onset 1 was a randomized, multicentre, treat-to-target, phase III, 52-week (initial 26 weeks + additional 26 weeks) trial conducted at 165 sites across 9 countries. Adults with T1D were randomly allocated to double-blind mealtime faster aspart or IAsp, each with once- or twice-daily insulin detemir. The primary endpoint, change in glycated haemoglobin (HbA1c) from baseline after the initial 26 weeks, has been reported previously. In the present paper, we report data from the full 52-week study period. Between August 2013 and June 2015, 381 participants were assigned to double-blind faster aspart and 380 participants to IAsp. After 52 weeks, estimated mean changes from baseline in HbA1c levels were -0.08% (faster aspart) and +0.01% (IAsp); estimated treatment difference significantly favoured faster aspart (-0.10% [95% confidence interval {CI} -0.19;-0.00]; P = .0424). Changes from baseline in 1-hour postprandial plasma glucose (PPG) increment (meal test; faster aspart -1.05 mmol/L; IAsp -0.14 mmol/L) also significantly favoured faster aspart (estimated treatment difference -0.91 mmol/L [95% CI -1.40;-0.43]; -16.48 mg/dL [95% CI -25.17;-7.80]; P = .0002). There was no difference in overall severe or blood glucose-confirmed hypoglycaemic episodes or treatment-emergent adverse events between treatments. At 52 weeks, overall glycaemic control had significantly improved with faster aspart vs IAsp, consistent with the 26-week study findings. Achieving an insulin profile closer to physiological insulin secretion with faster aspart translates into lower PPG and HbA1c levels compared with those achieved with IAsp in people with T1D. © 2018 The Authors. Diabetes, Obesity and Metabolism published by John Wiley & Sons Ltd.

  17. Pooled efficacy and safety of eslicarbazepine acetate as add-on treatment in patients with focal-onset seizures: Data from four double-blind placebo-controlled pivotal phase III clinical studies.

    Science.gov (United States)

    Elger, Christian; Koepp, Mathias; Trinka, Eugen; Villanueva, Vicente; Chaves, João; Ben-Menachen, Elinor; Kowacs, Pedro A; Gil-Nagel, António; Moreira, Joana; Gama, Helena; Rocha, José-Francisco; Soares-da-Silva, Patrício

    2017-12-01

    Pooled evaluation of the key efficacy and safety profile of eslicarbazepine acetate (ESL) added-on to stable antiepileptic therapy in adults with focal-onset seizures. Data from 1703 patients enrolled in four phase III double-blind, randomized, placebo-controlled studies were pooled and analyzed. Following a 2 week titration period, ESL was administered at 400 mg, 800 mg, and 1200 mg once-daily doses for 12 weeks (maintenance period). Pooled efficacy variable was standardized (/4 weeks) seizure frequency (SSF) analyzed over the maintenance period as reduction in absolute and relative SSF and proportion of responders (≥50% reduction in SSF). Pooled safety was analyzed by means of adverse events and clinical laboratory assessments. SSF was significantly reduced with ESL 800 mg (P ESL 800 mg and 37.8% for 1200 mg (placebo: 17.6%), and responder rate was 33.8% and 43.1% (placebo: 22.2%). ESL was more efficacious than placebo regardless of gender, geographical region, epilepsy duration, age at time of diagnosis, seizure type, and type of concomitant antiepileptic drugs (AED). Incidence of adverse events (AEs) and AEs leading to discontinuation was dose dependent. Most common AEs (>10% patients) were dizziness, somnolence, and nausea. The incidence of treatment-emergent AEs (dizziness, somnolence, ataxia, vomiting, and nausea) was lower in patients who began taking ESL 400 mg (followed by 400 mg increments to 800 or 1200 mg) than in those who began taking ESL 600 mg or 800 mg. Once-daily ESL 800 mg and 1200 mg showed consistent results across all efficacy and safety endpoints, independent of study population characteristics and type of concomitant AEDs. Treatment initiated with ESL 400 mg followed by 400 mg increments to 800 or 1200 mg provides optimal balance of efficacy and tolerability. © 2017 The Authors. CNS Neuroscience & Therapeutics Published by John Wiley & Sons Ltd.

  18. A first-in-man phase 1 trial for long-acting TransCon Growth Hormone.

    Science.gov (United States)

    Gilfoyle, David; Mortensen, Eva; Christoffersen, Eva Dam; Leff, Jonathan A; Beckert, Michael

    2018-04-01

    TransCon growth hormone (GH) is a sustained-release inactive prodrug consisting of unmodified GH transiently bound to an inert carrier molecule designed to release fully active GH over a one-week period. This was a first-in-man phase 1 randomized trial was to evaluate the safety, tolerability, immunogenicity, pharmacokinetics (PK), and pharmacodynamics (PD) of a single dose of TransCon GH as compared to equivalent doses of daily GH (Omnitrope) or placebo in healthy adults. Forty-four healthy male adults were randomized to 4 cohorts of 11 subjects, distributed in a 7:2:2 ratio (TransCon GH: Omnitrope: placebo). A single injection of 4 possible TransCon GH doses (i.e., 0.04, 0.08, 0.16, or 0.24mg GH/kg/wk) or two different Omnitrope doses (i.e., 0.08 or 0.16mg GH/kg/wk divided into 7 equal daily doses) were administered with subjects evaluated for adverse events, immunogenicity, and GH and insulin-like growth factor-1 (IGF-1) levels. TransCon GH was well tolerated; no serious adverse events occurred, no injection site reaction differences between TransCon GH, Omnitrope, or placebo were identified, no nodules or lipoatrophy were reported, and no anti-GH binding antibodies or ECG changes were detected. Overall, the exposure of GH (C max ) and IGF-1 (AUC 0-168h ) following administration of equivalent doses of TransCon GH and Omnitrope were similar. GH and IGF-1 kinetics showed a dose-proportional increase following a single SC administration of TransCon GH and indicated that the prodrug is suitable for weekly administration. These results support advancement of TransCon GH to pediatric and adult GHD trials. Clinical trial registration numbers: NCT01010425 (clinicaltrials.gov). Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Impact of ractopamine hydrochloride on growth, efficiency, and carcass traits of finishing pigs in a three-phase marketing strategy.

    Science.gov (United States)

    Gerlemann, G D; Allee, G L; Rincker, P J; Ritter, M J; Boler, D D; Carr, S N

    2014-03-01

    The objectives were to determine the effects of ractopamine hydrochloride (RAC) in a 3-phase marketing strategy. One thousand seven hundred forty pigs were used in 80 single-sex pens in 2 blocks. Each pen housed approximately 22 pigs. Sixteen percent of the total population of pigs was sold during the first marketing period, 18% was sold during the second marketing period, and the remaining 66% was sold during the third marketing period. Data were analyzed as a randomized complete block design of 2 treatments. Pigs in the second marketing group had greater growth performance indicators than pigs in the first marketing group. Over the entire feeding period, pigs fed RAC were 2.73 kg heavier (P marketing period carcasses from pigs fed RAC (89.73 kg) were 2.1% heavier (P = 0.04) and gained 0.19 kg/d more (P = 0.03) carcass weight than carcasses from pigs not fed RAC (87.89 kg). By the end of the second marketing period carcasses from pigs fed RAC (99.00 kg) were 3.1% heavier (P marketing period carcasses from pigs fed RAC (102.75 kg) were 3.7% heavier (P marketing period, but as duration increased differences diminished. Therefore, RAC can provide the expected growth performance benefits when included in the diet for up to 21 d, but HCW advantages continue to increase throughout the entire 35 d feeding period. Even though carcass benefits were not as evident in pigs sold during the first marketing period, advantages (particularly HCW) continued to increase with each marketing period.

  20. Cartography of methicillin-resistant S. aureus transcripts: detection, orientation and temporal expression during growth phase and stress conditions.

    Science.gov (United States)

    Beaume, Marie; Hernandez, David; Farinelli, Laurent; Deluen, Cécile; Linder, Patrick; Gaspin, Christine; Romby, Pascale; Schrenzel, Jacques; Francois, Patrice

    2010-05-20

    Staphylococcus aureus is a versatile bacterial opportunist responsible for a wide spectrum of infections. The severity of these infections is highly variable and depends on multiple parameters including the genome content of the bacterium as well as the condition of the infected host. Clinically and epidemiologically, S. aureus shows a particular capacity to survive and adapt to drastic environmental changes including the presence of numerous antimicrobial agents. Mechanisms triggering this adaptation remain largely unknown despite important research efforts. Most studies evaluating gene content have so far neglected to analyze the so-called intergenic regions as well as potential antisense RNA molecules. Using high-throughput sequencing technology, we performed an inventory of the whole transcriptome of S. aureus strain N315. In addition to the annotated transcription units, we identified more than 195 small transcribed regions, in the chromosome and the plasmid of S. aureus strain N315. The coding strand of each transcript was identified and structural analysis enabled classification of all discovered transcripts. RNA purified at four time-points during the growth phase of the bacterium allowed us to define the temporal expression of such transcripts. A selection of 26 transcripts of interest dispersed along the intergenic regions was assessed for expression changes in the presence of various stress conditions including pH, temperature, oxidative shocks and growth in a stringent medium. Most of these transcripts showed expression patterns specific for the defined stress conditions that we tested. These RNA molecules potentially represent important effectors of S. aureus adaptation and more generally could support some of the epidemiological characteristics of the bacterium.

  1. High growth rate GaN on 200 mm silicon by metal-organic vapor phase epitaxy for high electron mobility transistors

    Science.gov (United States)

    Charles, M.; Baines, Y.; Bavard, A.; Bouveyron, R.

    2018-02-01

    It is increasingly important to reduce the cycle time of epitaxial growth, in order to reduce the costs of device fabrication, especially for GaN based structures which typically have growth cycles of several hours. We have performed a comprehensive study using metal-organic vapor phase epitaxy (MOVPE) investigating the effects of changing GaN growth rates from 0.9 to 14.5 μm/h. Although there is no significant effect on the strain incorporated in the layers, we have seen changes in the surface morphology which can be related to the change in dislocation behaviour and surface diffusion effects. At the small scale, as seen by AFM, increased dislocation density for higher growth rates leads to increased pinning of growth terraces, resulting in more closely spaced terraces. At a larger scale of hundreds of μm observed by optical profiling, we have related the formation of grains to the rate of surface diffusion of adatoms using a random walk model, implying diffusion distances from 30 μm for the highest growth rates up to 100 μm for the lowest. The increased growth rate also increases the intrinsic carbon incorporation which can increase the breakdown voltage of GaN films. Despite an increased threading dislocation density, these very high growth rates of 14.5 μm/hr by MOVPE have been shown to be appealing for reducing epitaxial growth cycle times and therefore costs in High Electron Mobility Transistor (HEMT) structures.

  2. Biooxidation of n-octane by a recombinant Escherichia coli in a two-liquid-phase system: Effect of medium components on cell growth and alkane oxidation activity

    NARCIS (Netherlands)

    FAVREBULLE, O; Witholt, Bernard

    1992-01-01

    When Escherichia coli hosts are transformed with the alk genes, which encode the alkane oxidation pathway of Pseudomonas oleovorans, the recombinants are capable of converting alkanes to alkanoic acids during growth in two-liquid-phase (aqueous-organic) media. In such media, the cells grow on

  3. CTX-M-1 β-lactamase expression in Escherichia coli is dependent on cefotaxime concentration, growth phase and gene location

    DEFF Research Database (Denmark)

    Kjeldsen, Thea S. B.; Overgaard, Martin; Nielsen, Søren S.

    2015-01-01

    blaCTX-M-1 mRNA expression and CTX-M-1 protein levels were dependent on cefotaxime concentration, growth phase and gene location. These results provide insight into the expression of cephalosporin resistance in CTX-M-1-producing E. coli, improving our understanding of the relationship between ant...

  4. Elevated acetyl-CoA by amino acid recycling fuels microalgal neutral lipid accumulation in exponential growth phase for biofuel production.

    Science.gov (United States)

    Yao, Lina; Shen, Hui; Wang, Nan; Tatlay, Jaspaul; Li, Liang; Tan, Tin Wee; Lee, Yuan Kun

    2017-04-01

    Microalgal neutral lipids [mainly in the form of triacylglycerols (TAGs)], feasible substrates for biofuel, are typically accumulated during the stationary growth phase. To make microalgal biofuels economically competitive with fossil fuels, generating strains that trigger TAG accumulation from the exponential growth phase is a promising biological approach. The regulatory mechanisms to trigger TAG accumulation from the exponential growth phase (TAEP) are important to be uncovered for advancing economic feasibility. Through the inhibition of pyruvate dehydrogenase kinase by sodium dichloroacetate, acetyl-CoA level increased, resulting in TAEP in microalga Dunaliella tertiolecta. We further reported refilling of acetyl-CoA pool through branched-chain amino acid catabolism contributed to an overall sixfold TAEP with marginal compromise (4%) on growth in a TAG-rich D. tertiolecta mutant from targeted screening. Herein, a three-step α loop-integrated metabolic model is introduced to shed lights on the neutral lipid regulatory mechanism. This article provides novel approaches to compress lipid production phase and heightens lipid productivity and photosynthetic carbon capture via enhancing acetyl-CoA level, which would optimize renewable microalgal biofuel to fulfil the demanding fuel market. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  5. Impact of the growth phase on the activity of multidrug resistance pumps and membrane potential of S.cerevidiae: effect of pump overproduction and carbon source

    Czech Academy of Sciences Publication Activity Database

    Čadek, R.; Chládková, K.; Sigler, Karel; Gášková, D.

    2004-01-01

    Roč. 1665, - (2004), s. 111-117 ISSN 0005-2736 R&D Projects: GA AV ČR IBS5020202 Institutional research plan: CEZ:AV0Z5020903 Keywords : growth phases * s.cerevisiae * membrane potential Subject RIV: EE - Microbiology, Virology Impact factor: 3.441, year: 2004

  6. Growth-phase-dependent expression of the lipolytic system of Acinetobacter calcoaceticus BD413: cloning of a gene encoding one of the esterases

    NARCIS (Netherlands)

    KOK, R. G.; Christoffels, V. M.; VOSMAN, B.; Hellingwerf, K. J.

    1993-01-01

    Acinetobacter calcoaceticus BD413, when grown in batch culture in nutrient broth, produces both extracellular lipase activity and cell-bound esterase activity during and after the transition between exponential growth and the stationary phase. From a library of A. calcoaceticus DNA in Escherichia

  7. Experience of the Tocilizumab Application in Systemic Onset Juvenile Arthritis

    Directory of Open Access Journals (Sweden)

    A. V. Krasnopol’skaja

    2015-01-01

    Full Text Available The article provides information on the unfavourable course of systemic onset juvenile arthritis, resistant to immunosuppressive therapy with methotrexate in combination with cyclosporine, and pulse therapy with methylprednisolone and methotrexate. We describe the successful use of genetically engineered biological drug tocilizumab in the patient with systemic onset juvenile arthritis. After the first injection, pain was already significantly reduced; after the second, fever was relieved and non-steroid anti-inflammatory drugs were cancelled; after the third, lymphadenopathy and splenomegaly disappeared and the child’s functional activity improved significantly. After 12 months of treatment, an inactive phase of the disease was achieved, the joints’ kinetics (with the exception of the right hip were almost entirely restored and the patient’s quality of life had significantly improved. At the same time, metabolic disorders and changes in the cardiovascular system were reversed. This example demonstrated the high effectiveness of interleukin-6 antagonist tocilizumab in systemic arthritis, which allowed arresting joint affection as well as extra-articular manifestations of the disease, providing normal puberty, the restoration of growth and sexual development.

  8. Onset of nuclear boiling in forced convection (Method of detection)

    International Nuclear Information System (INIS)

    Rachedi, M.

    1986-01-01

    Local onset of boiling in any pressure water cooling systems, as a PWR for instance, can mean a possible dangerous mismatch between the produced heat and the cooling capabilities. Its consequences can lead to serious accidental conditions and a reliable technique to detect such a phenomenon is therefore of particular need. Most techniques used up to now rely basically on local measurements and assume therefore usually the previous knowledge of the actual hot or boiling spot. The method proposed here based on externally located accelerometers appears to be sensitive to the global behaviour of the mechanical structure and is therefore not particularly bound to any exact localization of the sensors. The vibrations produced in the mechanical structure of the heated assembly are measured by accelerometers placed on the external surfaces that are easily accessible. The onset of the boiling, the growth and condensation of the bubbles on the heated wall, induces a resonance in the structure and an excitation at its particular eigen frequencies. Distinctive peaks are clearly observed in the spectral density function calculated from the accelerometer signal as soon as bubbles are produced. The technique is shown to be very sensitive even at the earliest phase of boiling and quite independent on sensor position. A complete hydrodynamic analysis of the experimental channels have been performed in order to assess the validity of the method both in steady conditions and during rapid power transients

  9. Very Early-onset Schizophrenia with Secondary Onset Tic Disorder.

    Science.gov (United States)

    Telgote, Shilpa A; Pendharkar, Shreyas Shrikant; Kelkar, Amol D; Bhojane, Sachin

    2017-01-01

    Very early-onset schizophrenia (defined as an onset of psychosis before 13 years of age) is a rare and severe form of the disorder which is clinically and neurobiologically continuous with the adult-onset disorder. It is rarely reported tic disorder.

  10. Very early-onset schizophrenia with secondary onset tic disorder

    OpenAIRE

    Shilpa A Telgote; Shreyas Shrikant Pendharkar; Amol D Kelkar; Sachin Bhojane

    2017-01-01

    Very early-onset schizophrenia (defined as an onset of psychosis before 13 years of age) is a rare and severe form of the disorder which is clinically and neurobiologically continuous with the adult-onset disorder. It is rarely reported

  11. Effects of growth phase on the membrane lipid composition of the thaumarchaeon Nitrosopumilus maritimus and their implications for archaeal lipid distributions in the marine environment

    Science.gov (United States)

    Elling, Felix J.; Könneke, Martin; Lipp, Julius S.; Becker, Kevin W.; Gagen, Emma J.; Hinrichs, Kai-Uwe

    2014-09-01

    The characteristic glycerol dibiphytanyl glycerol tetraether membrane lipids (GDGTs) of marine ammonia-oxidizing archaea (AOA) are widely used as biomarkers for studying their occurrence and distribution in marine environments and for reconstructing past sea surface temperatures using the TEX86 index. Despite an increasing use of GDGT biomarkers in microbial ecology and paleoceanography, the physiological and environmental factors influencing lipid composition in AOA, in particular the cyclization of GDGTs, remain unconstrained. We investigated the effect of metabolic state on the composition of intact polar and core lipids and the resulting TEX86 paleothermometer in pure cultures of the marine AOA Nitrosopumilus maritimus as a function of growth phase. The cellular lipid content ranged from 0.9 to 1.9 fg cell-1 and increased during growth but was lower in the stationary phases, indicating changes in average cell size in response to metabolic status. The relative abundances of monoglycosidic GDGTs increased from 27% in early growth phase to 60% in late stationary phase, while monohydroxylated GDGTs increased only slightly. The proportions of characteristic hexose-phosphohexose GDGTs were up to 7-fold higher during growth than in stationary phase, suggesting that they are valuable biomarkers for the metabolically active fraction of AOA assemblages in the environment. Methoxy archaeol was identified as novel, genuine archaeal lipid of yet unknown function; it is one of the most abundant single compounds in the lipidome of N. maritimus. TEX86 values of individual intact GDGTs and total GDGTs differed substantially, were generally lower during early and late growth phases than in stationary phase, and did not reflect growth temperature. Consequently, our results strongly suggest that biosynthesis is at least partially responsible for the systematic offsets in TEX86 values between different intact polar GDGT classes observed previously in environmental samples

  12. Gallotannin imposes S phase arrest in breast cancer cells and suppresses the growth of triple-negative tumors in vivo.

    Science.gov (United States)

    Zhao, Tiejun; Sun, Qiang; del Rincon, Sonia V; Lovato, Amanda; Marques, Maud; Witcher, Michael

    2014-01-01

    Triple-negative breast cancers are associated with poor clinical outcomes and new therapeutic strategies are clearly needed. Gallotannin (Gltn) has been previously demonstrated to have potent anti-tumor properties against cholangiocarcinoma in mice, but little is known regarding its capacity to suppress tumor outgrowth in breast cancer models. We tested Gltn for potential growth inhibitory properties against a variety of breast cancer cell lines in vitro. In particular, triple-negative breast cancer cells display higher levels of sensitivity to Gltn. The loss of proliferative capacity in Gltn exposed cells is associated with slowed cell cycle progression and S phase arrest, dependent on Chk2 phosphorylation and further characterized by changes to proliferation related genes, such as cyclin D1 (CcnD1) as determined by Nanostring technology. Importantly, Gltn administered orally or via intraperitoneal (IP) injections greatly reduced tumor outgrowth of triple-negative breast cells from mammary fat pads without signs of toxicity. In conclusion, these data strongly suggest that Gltn represents a novel approach to treat triple-negative breast carcinomas.

  13. Gallotannin imposes S phase arrest in breast cancer cells and suppresses the growth of triple-negative tumors in vivo.

    Directory of Open Access Journals (Sweden)

    Tiejun Zhao

    Full Text Available Triple-negative breast cancers are associated with poor clinical outcomes and new therapeutic strategies are clearly needed. Gallotannin (Gltn has been previously demonstrated to have potent anti-tumor properties against cholangiocarcinoma in mice, but little is known regarding its capacity to suppress tumor outgrowth in breast cancer models. We tested Gltn for potential growth inhibitory properties against a variety of breast cancer cell lines in vitro. In particular, triple-negative breast cancer cells display higher levels of sensitivity to Gltn. The loss of proliferative capacity in Gltn exposed cells is associated with slowed cell cycle progression and S phase arrest, dependent on Chk2 phosphorylation and further characterized by changes to proliferation related genes, such as cyclin D1 (CcnD1 as determined by Nanostring technology. Importantly, Gltn administered orally or via intraperitoneal (IP injections greatly reduced tumor outgrowth of triple-negative breast cells from mammary fat pads without signs of toxicity. In conclusion, these data strongly suggest that Gltn represents a novel approach to treat triple-negative breast carcinomas.

  14. Growth and optical characteristics of Tm-doped AlGaN layer grown by organometallic vapor phase epitaxy

    Science.gov (United States)

    Takatsu, J.; Fuji, R.; Tatebayashi, J.; Timmerman, D.; Lesage, A.; Gregorkiewicz, T.; Fujiwara, Y.

    2018-04-01

    We report on the growth and optical properties of Tm-doped AlGaN layers by organometallic vapor phase epitaxy (OMVPE). The morphological and optical properties of Tm-doped GaN (GaN:Tm) and Tm-doped AlGaN (AlGaN:Tm) were investigated by Nomarski differential interference contrast microscopy and photoluminescence (PL) characterization. Nomarski images reveal an increase of surface roughness upon doping Tm into both GaN and AlGaN layers. The PL characterization of GaN:Tm shows emission in the near-infrared range originating from intra-4f shell transitions of Tm3+ ions. In contrast, AlGaN:Tm also exhibits blue light emission from Tm3+ ions. In that case, the wider band gap of the AlGaN host allows energy transfer to higher states of the Tm3+ ions. With time-resolved PL measurements, we could distinguish three types of luminescent sites of Tm3+ in the AlGaN:Tm layer, having different decay times. Our results confirm that Tm ions can be doped into GaN and AlGaN by OMVPE, and show potential for the fabrication of novel high-color-purity blue light emitting diodes.

  15. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  16. Photosynthetic capacity and water use efficiency in sugarcane genotypes subject to water deficit during early growth phase

    Directory of Open Access Journals (Sweden)

    Marcelo de Almeida Silva

    2013-10-01

    Full Text Available The objective of this study was to compare the gas exchange, photosynthetic capacity and water potential of sugarcane genotypes cultivated under water deficit conditions imposed during the initial growth phase. Experiments were performed in a greenhouse using two sugarcane genotypes namely: HoCP93-776 (drought susceptible and TCP02-4587 (drought tolerant. Sixty days after planting, two different water treatments were applied (i.e., with or without water deficit. At 0,30 and 60 days after the treatment, gas exchange variables were evaluated for their relationship with water use, intrinsic instantaneous water use efficiency and instantaneous carboxylation efficiency. The SPAD index, photosynthetic pigments, water potential and relative water content in the leaves were also analyzed. The genotype HoCP93-776 was more sensitive to drought treatment as indicated by the significantly lower values of SPAD index, photosynthetic pigments, water potential (Ψw and relative water content (RWC variables. The genotype TCP02-4587 had higher water potential, stomatal control efficiency, water use efficiency (WUE, intrinsic instantaneous water use efficiency (WUEintr, instantaneous carboxylation efficiency and photosynthetic capacity. The highest air vapor pressure deficit during the drought conditions could be due to the stomatal closing in the HoCP93-776, which contributed to its lower photosynthetic capacity.

  17. PEP3 overexpression shortens lag phase but does not alter growth rate in Saccharomyces cerevisiae exposed to acetic acid stress

    Science.gov (United States)

    Ding, Jun; Holzwarth, Garrett; Bradford, C. Samuel; Cooley, Ben; Yoshinaga, Allen S.; Patton-Vogt, Jana; Abeliovich, Hagai; Penner, Michael H.; Bakalinsky, Alan T.

    2017-01-01

    In fungi, two recognized mechanisms contribute to pH homeostasis: the plasma membrane proton-pumping ATPase that exports excess protons and the vacuolar proton-pumping ATPase (V-ATPase) that mediates vacuolar proton uptake. Here, we report that overexpression of PEP3 which encodes a component of the HOPS and CORVET complexes involved in vacuolar biogenesis, shortened lag phase in Saccharomyces cerevisiae exposed to acetic acid stress. By confocal microscopy, PEP3-overexpressing cells stained with the vacuolar membrane-specific dye, FM4-64 had more fragmented vacuoles than the wild-type control. The stained overexpression mutant was also found to exhibit about 3.6-fold more FM4-64 fluorescence than the wild-type control as determined by flow cytometry. While the vacuolar pH of the wild-type strain grown in the presence of 80 mM acetic acid was significantly higher than in the absence of added acid, no significant difference was observed in vacuolar pH of the overexpression strain grown either in the presence or absence of 80 mM acetic acid. Based on an indirect growth assay, the PEP3-overexpression strain exhibited higher V-ATPase activity. We hypothesize that PEP3 overexpression provides protection from acid stress by increasing vacuolar surface area and V-ATPase activity and, hence, proton-sequestering capacity. PMID:26051671

  18. PEP3 overexpression shortens lag phase but does not alter growth rate in Saccharomyces cerevisiae exposed to acetic acid stress.

    Science.gov (United States)

    Ding, Jun; Holzwarth, Garrett; Bradford, C Samuel; Cooley, Ben; Yoshinaga, Allen S; Patton-Vogt, Jana; Abeliovich, Hagai; Penner, Michael H; Bakalinsky, Alan T

    2015-10-01

    In fungi, two recognized mechanisms contribute to pH homeostasis: the plasma membrane proton-pumping ATPase that exports excess protons and the vacuolar proton-pumping ATPase (V-ATPase) that mediates vacuolar proton uptake. Here, we report that overexpression of PEP3 which encodes a component of the HOPS and CORVET complexes involved in vacuolar biogenesis, shortened lag phase in Saccharomyces cerevisiae exposed to acetic acid stress. By confocal microscopy, PEP3-overexpressing cells stained with the vacuolar membrane-specific dye, FM4-64 had more fragmented vacuoles than the wild-type control. The stained overexpression mutant was also found to exhibit about 3.6-fold more FM4-64 fluorescence than the wild-type control as determined by flow cytometry. While the vacuolar pH of the wild-type strain grown in the presence of 80 mM acetic acid was significantly higher than in the absence of added acid, no significant difference was observed in vacuolar pH of the overexpression strain grown either in the presence or absence of 80 mM acetic acid. Based on an indirect growth assay, the PEP3-overexpression strain exhibited higher V-ATPase activity. We hypothesize that PEP3 overexpression provides protection from acid stress by increasing vacuolar surface area and V-ATPase activity and, hence, proton-sequestering capacity.

  19. Study of Morphological, Phenological and Variation of Fruit Traits During Berry Growth Phases of QzlouzumGrapevine Cultivar

    Directory of Open Access Journals (Sweden)

    Hamed Doulati Baneh

    2017-02-01

    Full Text Available Introduction: Before a new vineyard construction, in addition to collecting detailed data on climate, soil and planting area, some other considerations like selection and understanding the principles of quality and quantity in terms of agronomic traits and physiological characteristics of the product should be made. Among grape varieties grown in anorchard, some self-fertile and male sterile cultivars (female physiological are present. Without suitable pollinating, varieties in the vineyard, is not accessible for semi-fertile or sterile ones with high quality and quantity and will notbe sufficient.Therefore the identification of sterile varieties, the best pollinizers and fruit growth and phenological stages is essential. Qzlouzum is one of commercial seeded cultivars in West Azerbaijan province whichis suitable for storage and delivering to domestic and foreign markets forout of season because of nice red color and thick skin and late ripening.These favorable properties for sale with high prices is also one of the otherbenefits that have led to the interest of the farmers every year to increase the acreage of the cultivation. Preliminary studies showed that Qzlouzum cultivar is a physiological female and needs cross pollination for fruitset. This study aimed to investigate the complete botanical characteristics, flower sexuality, pollen germination and determine the phenological stages (especially fruit growth stages. Materials and methods: Based on grape descriptor, morphological characters of 10 vines of Qzlouzum grape cultivar at different stages from bud break to dormancy was studied in Horticultural Research Station in 1390 in Urmia(Kahriz. To calculate the growing degree days (GDD, daily temperature above 10 ° C was obtained from the meteorological station of Agriculture faculty in Kahriz-Urmia. Pollen germination rate was tested in both liquid and solid growth medium. In order to study the changes in a number of qualitative and

  20. Selective crystal growth of polymorphs and crystal-to-crystal thermal phase transition of non-peripherally alkyl-substituted phthalocyanine and tetrabenzotriazaporphyrin

    Science.gov (United States)

    Ohmori, Masashi; Nakano, Chika; Fujii, Akihiko; Shimizu, Yo; Ozaki, Masanori

    2017-06-01

    Selective crystal growth of polymorphs and crystal-to-crystal thermal phase transition of non-peripherally alkyl-substituted macrocycle molecules, such as octapentylphthalocyanine (C5PcH2), octahexylphthalocyanine (C6PcH2), and octahexyltetrabenzotriazaporphyrin (C6TBTAPH2) have been investigated. Two types of single crystals, called α-type and β-type, were separately grown by controlling the recrystallization conditions, and the crystal structures were determined by single-crystal X-ray structure analysis. The irreversible crystal-to-crystal thermal phase transition from α-type to β-type were observed by the differential scanning calorimetry and temperature-controlled X-ray structure analysis. The selective crystal growth of the α-type or β-type and the irreversible crystal-to-crystal thermal phase transition have been discussed by taking the alkyl-substituent distribution into consideration.

  1. Neutron scattering study of the nucleation and growth process at the pressure-induced first-order phase transformation of RbI

    International Nuclear Information System (INIS)

    Hamaya, N.; Yamada, Y.; Axe, J.D.; Belanger, D.P.; Shapiro, S.M.

    1986-01-01

    We have studied the kinetics of the NaCl-CsCl phase transformation in RbI at room temperature (P/sub c/apeq23.5 kbar) and at temperatures down to 200 K by monitoring the time-dependent changes in neutron powder diffraction peaks. Within the interval of temperature studied, the rate of growth of the stable phase increases as ΔP = Vertical BarP-P/sub c/Vertical Bar is increased. The characteristic time of completion of transformation t 0 (P) at room temperature diverges as the pressure approaches P/sub c/ consistent with the form ΔP/sup -3/4/exp[B(ΔP) -2 ], predicted by classical theory. At room temperature the observed growth curves for various pressures display a nearly universal shape, consistent with the Kolmogorov model of nucleation and growth, when plotted against a scaled time parameter tau = t/t 0 (P). At 240 K the growth curves deviate from the universal shape increasingly with increasing ΔP. Moreover, within a single growth curve the deviation becomes more evident in the later stage of growth. These observations can be explained qualitatively by taking into account the effect of stress produced by the volume change associated with the transformation

  2. Dreaming during sleep onset and awakening.

    Science.gov (United States)

    Cicogna, P

    1994-06-01

    The aim of the present work was to investigate the characteristics of the dreaming during the beginning and the end of sleep, both phases being transitional between different states of consciousness (wakefulness vs sleep and vice versa). The hypothesis of an adaptive function of the mental activity in the two sleep phases is put forward to ensure a continuity of self-experience in the passage from one state of vigilance to another. 40 dream reports collected at sleep onset and at spontaneous morning awakening, when analysed, supported the hypothesis. Independently of the physiological sleep stage during which dreaming occurs, the results seem to highlight similarities rather than differences in dreaming which occurs during sleep onset and morning awakening.

  3. Energy Flow Exciting Field-Aligned Current at Substorm Expansion Onset

    Science.gov (United States)

    Ebihara, Y.; Tanaka, T.

    2017-12-01

    At substorm expansion onset, upward field-aligned currents (FACs) increase abruptly, and a large amount of electromagnetic energy starts to consume in the polar ionosphere. A question arises as to where the energy comes from. Based on the results obtained by the global magnetohydrodynamics simulation, we present energy flow and energy conversion associated with the upward FACs that manifest the onset. Our simulations show that the cusp/mantle region transmits electromagnetic energy to almost the entire region of the magnetosphere when the interplanetary magnetic field is southward. Integral curve of the Poynting flux shows a spiral moving toward the ionosphere, probably suggesting the pathway of electromagnetic energy from the cusp/mantle dynamo to the ionosphere. The near-Earth reconnection initiates three-dimensional redistribution of the magnetosphere. Flow shear in the near-Earth region results in the generation of the near-Earth dynamo and the onset FACs. The onset FACs are responsible to transport the electromagnetic energy toward the Earth. In the near-Earth region, the electromagnetic energy coming from the cusp/mantle dynamo is converted to the kinetic energy (known as bursty bulk flow) and the thermal energy (associated with high-pressure region in the inner magnetosphere). Then, they are converted to the electromagnetic energy associated with the onset FACs. A part of electromagnetic energy is stored in the lobe region during the growth phase. The release of the stored energy, together with the continuously supplied energy from the cusp/mantle dynamo, contributes to the energy supply to the ionosphere during the expansion phase.

  4. Adult-onset tic disorders

    NARCIS (Netherlands)

    Eapen, [No Value; Lees, AJ; Lakke, JPWF; Trimble, MR; Robertson, MM

    We report on 8 patients with adult-onset motor tics and vocalisations. Three had compulsive tendencies in childhood and 3 had a family history of tics or obsessive-compulsive behaviour. In comparison with DSM-classified, younger-onset Gilles de la Tourette syndrome, adult-onset tic disorders are

  5. Late onset globoid cell leukodystrophy.

    OpenAIRE

    Grewal, R P; Petronas, N; Barton, N W

    1991-01-01

    A 29 year old male with onset of globoid cell leukodystrophy at age 14 is described. This is the first case of enzymatically confirmed globoid cell leukodystrophy with onset of symptoms after the age of ten. This patient is unique because of the late onset and slow progression and extends the clinical spectrum of globoid cell leukodystrophy.

  6. Late onset globoid cell leukodystrophy.

    Science.gov (United States)

    Grewal, R P; Petronas, N; Barton, N W

    1991-11-01

    A 29 year old male with onset of globoid cell leukodystrophy at age 14 is described. This is the first case of enzymatically confirmed globoid cell leukodystrophy with onset of symptoms after the age of ten. This patient is unique because of the late onset and slow progression and extends the clinical spectrum of globoid cell leukodystrophy.

  7. TIGER HF radar study of sub-auroral plasma convection response to substorm onset

    Science.gov (United States)

    Makarevich, Roman

    The dual HF radars comprising the Tasman International Geophysical Environment Radar (TIGER) system often observe localized high-velocity F-region plasma flows (≥ 1500 m/s) in the midnight sector (20-02 MLT) at magnetic latitudes as low as 60 deg. The flow channels exhibit large variability in the latitudinal extent and electric field strength, and are similar to the subauroral polarization stream or SAPS, a plasma convection feature thought to be related to the polarization electric field due to the charge separation during substorm and storm development. In this study, the 2-D plasma drift velocity within the channel is derived for each of the two TIGER radars from the maximum velocities measured in all 16 radar beams within the latitudinally narrow channel, and the time variation of the subauroral electric field is examined near substorm onset. It is demonstrated that the flow channel often does not have a clear onset, rather it manifests differently in different phases of its evolution and can persist for at least two substorm cycles. During the growth phase the electric fields within the flow channel are difficult to distinguish from those of the background auroral convection but they start to increase near substorm onset and peak during the recovery phase, in contrast to what has been reported previously for auroral convection which peaks just before the substorm onset and falls sharply at the substorm onset. The response times to substorm onset range from -5 to +40 min and show some dependence on the substorm location with longer delays observed for substorms eastward of the radars' viewing area. The propagation velocity of the high-velocity region is also investigated by comparing the observations from the two closely-spaced TIGER radars. The observations are consistent with the notion that the polarization electric field is established with the energetic ions drifting westward and equatorward from the initial substorm injection. The ion injection front

  8. Gamelan Music Onset Detection based on Spectral Features

    Directory of Open Access Journals (Sweden)

    Yoyon Kusnendar Suprapto

    2013-03-01

    Full Text Available This research detects onsets of percussive instruments by examining the performance on the sound signals of gamelan instruments as one of traditional music instruments in Indonesia. Onset plays important role in determining musical rythmic structure, like beat, tempo, and is highly required in many applications of music information retrieval. There are four onset detection methods compared that employ spectral features, such as magnitude, phase, and the combination of both, which are phase slope (PS, weighted phase deviation (WPD, spectral flux (SF, and rectified complex domain (RCD. These features are extracted by representing the sound signals into time-frequency domain using overlapped Short-time Fourier Transform (STFT and varying the window length. Onset detection functions are processed through peak-picking using dynamic threshold. The results showed that by using suitable window length and parameter setting of dynamic threshold, F-measure which is greater than 0.80 can be obtained for certain methods.

  9. Alternating bursts of low energy ions and electrons near the substorm onset

    Energy Technology Data Exchange (ETDEWEB)

    Kozelova, T.V.; Kozelov, B.V. [Polar Geophysical Institute, Apatity, Murmansk region (Russian Federation); Lazutin, L.L. [Moscow State Univ. (Russian Federation). Scobeltsyn Insitute for Nuclear Physics, Russia Space Science Laboratory; Meredith, N. [Univ. College, London (United Kingdom). Mullard Space Science Laboratory; Danielides, M.A. [Oulu Univ. (Finland). Space Physics Group

    2006-07-01

    The substorm associated behavior of the low energy particles (30 eV-28.5 keV) near the earthward edge of the plasma sheet is examined using data from CRRES during the late growth and early expansion phases of a substorm on 12 March 1991 and their significance for the substorm onset mechanism is discussed. In this substorm, the CRRES was located on L {proportional_to}6.3 and {proportional_to}20 westward of the substorm onset and observed the sequence of the alternating bursts of the 0.633-9.6 keV ions occured 1-2 min before the (7.31-21.7 keV) electron bursts. The first ion burst happened 2 min before the substorm onset, at the moment of weak brightening of the most equatorial pre-breakup are near the latitude {proportional_to}62 . The alternation of the ion and electron bursts may be a signature of a drift-Alven ballooning instability on the inner edge of the plasma sheet near substorm onset.

  10. Alternating bursts of low energy ions and electrons near the substorm onset

    Directory of Open Access Journals (Sweden)

    T. V. Kozelova

    2006-08-01

    Full Text Available The substorm associated behavior of the low energy particles (30 eV–28.5 keV near the earthward edge of the plasma sheet is examined using data from CRRES during the late growth and early expansion phases of a substorm on 12 March 1991 and their significance for the substorm onset mechanism is discussed. In this substorm, the CRRES was located on L ~6.3 and ~20° westward of the substorm onset and observed the sequence of the alternating bursts of the low energy ions and electrons. The bursts of the 0.633–9.6 keV ions occurred 1–2 min before the (7.31–21.7 keV electron bursts. The first ion burst happened 2min before the substorm onset, at the moment of weak brightening of the most equatorial pre-breakup arc near the latitude ~62°. The alternation of the ion and electron bursts may be a signature of a drift-Alfvén ballooning instability on the inner edge of the plasma sheet near substorm onset.

  11. Controllable synthesis, growth mechanism and optical properties of the ZnSe quantum dots and nanoparticles with different crystalline phases

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Bo [Key Laboratory of Excited State Physics, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 3888 Eastern Nan-Hu Road, Changchun 130033 (China); Graduate School of the Chinese Academy of Sciences, Beijing 100049 (China); Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Yang, Jinghai, E-mail: jhyang1@jlnu.edu.cn [Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Cao, Jian; Yang, Lili; Gao, Ming; Wei, Maobin; Liu, Yang [Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Song, Hang [Key Laboratory of Excited State Physics, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 3888 Eastern Nan-Hu Road, Changchun 130033 (China)

    2013-03-15

    Graphical abstract: The ZnSe quantum dots (3.5 nm) with the wurtzite structure exhibited a strong near band-edge emission (NBE) peak centered at 422 nm. The zinc blende ZnSe nanoparticles (21 nm) exhibited near-band-edge luminescence peak centered at 472 nm. Highlights: ► The results of TEM showed that the ZnSe quantum dots were about 3.5 nm. ► The ZnSe quantum dots exhibited a near band-edge emission peak centered at 422 nm. ► The ZnSe nanoparticles exhibited near-band-edge luminescence peak centered at 472 nm. - Abstract: ZnSe precursors were prepared by a solvothermal method at 180 °C without any surface-active agents. ZnSe quantum dots and nanoparticles were obtained by annealing the precursors at 300 °C for 2 h in argon atmosphere. The ZnSe quantum dots were about 3.5 nm, while the ZnSe nanoparticles were about 21 nm, as observed using TEM. The growth mechanisms for the two samples were discussed; this proved that the high coordination ability of ethylenediamine to zinc played an important role in the final phase of the products. The ZnSe quantum dots with the wurtzite structure exhibited a strong near band-edge emission (NBE) peak centered at 422 nm, which was blue-shifted in comparison to that of the bulk ZnSe, which was mainly caused by the quantum confinement effect. However, the zinc blende ZnSe nanoparticles exhibited a near-band-edge luminescence peak centered at 472 nm.

  12. PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Pascual, Florencia; Soto-Cardalda, Aníbal; Carman, George M

    2013-12-13

    In the yeast Saccharomyces cerevisiae, the synthesis of phospholipids in the exponential phase of growth occurs at the expense of the storage lipid triacylglycerol. As exponential phase cells progress into the stationary phase, the synthesis of triacylglycerol occurs at the expense of phospholipids. Early work indicates a role of the phosphatidate phosphatase (PAP) in this metabolism; the enzyme produces the diacylglycerol needed for the synthesis of triacylglycerol and simultaneously controls the level of phosphatidate for the synthesis of phospholipids. Four genes (APP1, DPP1, LPP1, and PAH1) encode PAP activity in yeast, and it has been unclear which gene is responsible for the synthesis of triacylglycerol throughout growth. An analysis of lipid synthesis and composition, as well as PAP activity in various PAP mutant strains, showed the essential role of PAH1 in triacylglycerol synthesis throughout growth. Pah1p is a phosphorylated enzyme whose in vivo function is dependent on its dephosphorylation by the Nem1p-Spo7p protein phosphatase complex. nem1Δ mutant cells exhibited defects in triacylglycerol synthesis and lipid metabolism that mirrored those imparted by the pah1Δ mutation, substantiating the importance of Pah1p dephosphorylation throughout growth. An analysis of cells bearing PPAH1-lacZ and PPAH1-DPP1 reporter genes showed that PAH1 expression was induced throughout growth and that the induction in the stationary phase was stimulated by inositol supplementation. A mutant analysis indicated that the Ino2p/Ino4p/Opi1p regulatory circuit and transcription factors Gis1p and Rph1p mediated this regulation.

  13. The effect of growth phase on the lipid class, fatty acid and sterol composition in the marine dinoflagellate, Gymnodinium sp. in batch culture.

    Science.gov (United States)

    Mansour, Maged P; Volkman, John K; Blackburn, Susan I

    2003-05-01

    We have studied the effects of growth phase on the lipid composition in batch cultures of Gymnodinium sp. CS-380/3 over 43 days of culturing. The lipid content increased two fold, from late logarithmic (day 6) to linear growth phase (day 22) then decreased at stationary phase (day 43) while the lipid yield (mg l(-1)) increased 30-fold from day 6 to 30 mg l(-1) at day 43. Changes in fatty acid content mirrored those observed for the total lipid, while the sterol content continued to increase with culture age through to stationary phase. The largest changes occurred in the lipid classes, especially the polar lipids and triacylglycerols (oil). The proportion of triacylglycerols increased from 8% (of total lipids) at day 6 to 30% at day 43, with a concomitant decrease in the polar lipid fraction. The proportions of 16:0 and DHA [22:6(n-3)] increased while those of 18:5(n-3) and EPA [20:5(n-3)] decreased with increasing culture age. The proportion of the major sterol, dinosterol, decreased from 41% (day 6) to 29% (day 43), while the major dinostanol epimer (23R,24R) increased from 33% (day 6) to 38% (day 22). Despite small changes in the proportion of the main sterols, the same sterols were present at all stages of growth, indicating their value as a chemotaxonomic tool for distinguishing between strains within the same genus. Growth phase could be a useful variable for optimising the oil and DHA content with potential for aquaculture feeds and a source of DHA-rich oils for nutraceuticals.

  14. Early onset type 2 diabetes

    DEFF Research Database (Denmark)

    Bo, A; Thomsen, R W; Nielsen, J S

    2018-01-01

    AIM: To examine the association between early onset of type 2 diabetes (DM) and clinical and behavioural risk factors for later diabetes complications. METHODS: We conducted a cross-sectional study of 5115 persons with incident type 2 DM enrolled during 2010-2015 in the Danish Centre for Strategic...... Research in Type 2 Diabetes-cohort. We compared risk factors at time of diagnosis among those diagnosed at ≤45 years (early-onset) with diagnosis age 46-55, 56-65 (average-onset = reference), 66-75, and >75 years (late-onset). Prevalence ratios (PRs) were computed using Poisson regression. RESULTS: Poor...... was more frequent and meeting physical activity recommendations less likely in persons with early-onset type 2 DM. CONCLUSIONS: We found a clear age-gradient, with increasing prevalence of clinical and behavioural risk factors the younger the onset age of type 2 DM. Younger persons with early-onset type 2...

  15. A phase 2 trial of long-acting TransCon growth hormone in adult GH deficiency.

    Science.gov (United States)

    Höybye, Charlotte; Pfeiffer, Andreas F H; Ferone, Diego; Christiansen, Jens Sandahl; Gilfoyle, David; Christoffersen, Eva Dam; Mortensen, Eva; Leff, Jonathan A; Beckert, Michael

    2017-04-01

    TransCon growth hormone is a sustained-release human growth hormone prodrug under development in which unmodified growth hormone is transiently linked to a carrier molecule. It is intended as an alternative to daily growth hormone in the treatment of growth hormone deficiency. This was a multi-center, randomized, open-label, active-controlled trial designed to compare the safety (including tolerability and immunogenicity), pharmacokinetics and pharmacodynamics of three doses of weekly TransCon GH to daily growth hormone (Omnitrope). Thirty-seven adult males and females diagnosed with adult growth hormone deficiency and stable on growth hormone replacement therapy for at least 3 months were, following a wash-out period, randomized (regardless of their pre-study dose) to one of three TransCon GH doses (0.02, 0.04 and 0.08 mg GH/kg/week) or Omnitrope 0.04 mg GH/kg/week (divided into 7 equal daily doses) for 4 weeks. Main outcomes evaluated were adverse events, immunogenicity and growth hormone and insulin-like growth factor 1 levels. TransCon GH was well tolerated; fatigue and headache were the most frequent drug-related adverse events and reported in all groups. No lipoatrophy or nodule formation was reported. No anti-growth hormone-binding antibodies were detected. TransCon GH demonstrated a linear, dose-dependent increase in growth hormone exposure without accumulation. Growth hormone maximum serum concentration and insulin-like growth factor 1 exposure were similar after TransCon GH or Omnitrope administered at comparable doses. The results suggest that long-acting TransCon GH has a profile similar to daily growth hormone but with a more convenient dosing regimen. These findings support further TransCon GH development. © 2017 The authors.

  16. Adult-onset dystonia.

    Science.gov (United States)

    Evatt, Marian L; Freeman, Alan; Factor, Stewart

    2011-01-01

    Dystonia is defined as involuntary sustained muscle contractions producing twisting or squeezing movements and abnormal postures. The movements can be stereotyped and repetitive and they may vary in speed from rapid to slow; sustained contractions can result in fixed postures. Dystonic disorders are classified into primary and secondary forms. Several types of adult-onset primary dystonia have been identified but all share the characteristic that dystonia (including tremor) is the sole neurologic feature. The forms most commonly seen in neurological practice include cranial dystonia (blepharospasm, oromandibular and lingual dystonia and spasmodic dysphonia), cervical dystonia (also known as spasmodic torticollis) and writer's cramp. These are the disorders that benefit most from botulinum toxin injections. A general characteristic of dystonia is that the movements or postures may occur in relation to specific voluntary actions by the involved muscle groups (such as in writer's cramp). Dystonic contractions may occur in one body segment with movement of another (overflow dystonia). With progression, dystonia often becomes present at rest. Dystonic movements typically worsen with anxiety, heightened emotions, and fatigue, decrease with relaxation, and disappear during sleep. There may be diurnal fluctuations in the dystonia, which manifest as little or no involuntary movement in the morning followed by severe disabling dystonia in the afternoon and evening. Morning improvement (or honeymoon) is seen with several types of dystonia. Patients often discover maneuvers that reduce the dystonia and which involve sensory stimuli such as touching the chin lightly in cervical dystonia. These maneuvers are known as sensory tricks, or gestes antagonistes. This chapter focuses on adult-onset focal dystonias including cranial dystonia, cervical dystonia, and writer's cramp. The chapter begins with a review of the epidemiology of focal dystonias, followed by discussions of each

  17. Predictors of neonatal outcome in early-onset placental dysfunction

    NARCIS (Netherlands)

    Baschat, Ahmet A.; Cosmi, Erich; Bilardo, Catarina M.; Wolf, Hans; Berg, Christoph; Rigano, Serena; Germer, Ute; Moyano, Dolores; Turan, Sifa; Hartung, John; Bhide, Amarnath; Müller, Thomas; Bower, Sarah; Nicolaides, Kypros H.; Thilaganathan, Baskaran; Gembruch, Ulrich; Ferrazzi, Enrico; Hecher, Kurt; Galan, Henry L.; Harman, Chris R.

    2007-01-01

    To identify specific estimates and predictors of neonatal morbidity and mortality in early onset fetal growth restriction due to placental dysfunction. Prospective multicenter study of prenatally diagnosed growth-restricted liveborn neonates of less than 33 weeks of gestational age. Relationships

  18. The URICO-ICTUS study, a phase 3 study of combined treatment with uric acid and rtPA administered intravenously in acute ischaemic stroke patients within the first 4.5 h of onset of symptoms.

    Science.gov (United States)

    Amaro, Sergio; Cánovas, David; Castellanos, Mar; Gállego, Jaime; Martí-Fèbregas, Joan; Segura, Tomás; Chamorro, Angel

    2010-08-01

    Oxidative stress is a major contributor to brain damage in patients with ischaemic stroke. Uric acid (UA) is a potent endogenous antioxidant molecule. In experimental ischaemia in rats, the exogenous administration of uric acid is neuroprotective and enhances the effect of rtPA. Moreover, in acute stroke patients receiving rtPA within 3 h of stroke onset, the intravenous administration of uric acid is safe, prevents an early decline in uric acid levels and reduces an early increase in oxidative stress markers and in active matrix metalloproteinase nine levels. To determine whether the combined treatment with uric acid and rtPA is superior to rtPA alone in terms of clinical efficacy in acute ischaemic stroke patients treated within the first 4.5 h of onset of symptoms. Multicentre, interventional, randomised, double-blind and vehicle-controlled efficacy study with parallel assignment (1 : 1). Estimated enrolment: 420 patients over 3 years, starting in January 2010. Treatment arms included patients will receive a single intravenous infusion of 1 g of UA dissolved in a vehicle (500 ml of 0.1% lithium carbonate and 5% mannitol) (n=210) or vehicle alone (n=210). the study will include patients older than 18 years, treated with rtPA within the first 4.5 h of clinical onset and with a baseline National Institute of Health Stroke Scale score >6 and or =4 points of increase in the National Institute of Health Stroke Scale score).

  19. COMPARATIVE STUDY OF MATERNAL AND PERINATAL OUTCOME IN EARLY ONSET AND LATE ONSET PREECLAMPSIA

    Directory of Open Access Journals (Sweden)

    Sreedevi Atluri

    2017-01-01

    late onset group (p<0.001. High BMI values were noticed in late onset preeclampsia (LOP group compared to early onset preeclampsia (EOP (p<0.001. The maternal HELLP syndrome incidence, usage of number of anti-hypertensives, MgSO4 therapy, length of intensive care unit (ICU and hospital stay were statistically significant in early onset preeclampsia (EOP group. The incidences of intrauterine growth retardation (IUGR, oligohydramnios, abnormal uterine artery Doppler were significantly different between the groups. Low Apgar score at 5th min, increased requirement for neonatal intensive care unit (NICU stay, still births and perinatal mortality were significantly higher in early onset preeclampsia (EOP group. CONCLUSION This study confirms that early onset preeclampsia is more severe entity with adverse maternal and perinatal outcomes compared to late onset. The implication of these findings might lead to understanding of different pathophysiological mechanisms underlying these entities and the need for prevention, follow-up and early treatment to prevent adverse outcomes of preeclampsia.

  20. Reduction of threading dislocation density in SiGe epilayer on Si (0 0 1) by lateral growth liquid-phase epitaxy

    Science.gov (United States)

    O'Reilly, Andrew J.; Quitoriano, Nathaniel J.

    2018-02-01

    Si0.973Ge0.027 epilayers were grown on a Si (0 0 1) substrate by a lateral liquid-phase epitaxy (LLPE) technique. The lateral growth mechanism favoured the glide of misfit dislocations and inhibited the nucleation of new dislocations by maintaining the thickness less than the critical thicknesses for dislocation nucleation and greater than the critical thickness for glide. This promoted the formation of an array of long misfit dislocations parallel to the [1 1 0] growth direction and reduced the threading dislocation density to 103 cm-2, two orders of magnitude lower than the seed area with an isotropic misfit dislocation network.

  1. Early-Onset Dementia

    DEFF Research Database (Denmark)

    Konijnenberg, Elles; Fereshtehnejad, Seyed-Mohammad; Kate, Mara Ten

    2017-01-01

    BACKGROUND: Early-onset dementia (EOD) is a rare condition, with an often atypical clinical presentation, and it may therefore be challenging to diagnose. Specialized memory clinics vary in the type of patients seen, diagnostic procedures applied, and the pharmacological treatment given. The aim...... of this study was to investigate quality-of-care indicators in subjects with EOD from 3 tertiary memory clinics in 3 European countries. METHODS: We included 1325 newly diagnosed EOD patients, ages 65 years or younger, between January 1, 2007 and December 31, 2013, from the Danish Dementia Registry...... (Rigshospitalet, Copenhagen), the Swedish Dementia Registry ("SveDem", Karolinska University Hospital, Stockholm), and the Amsterdam Dementia Cohort (VU University Medical Center). RESULTS: The frequency of EOD among all dementia patients was significantly lower in Copenhagen (410, 20%) and Stockholm (284, 21...

  2. Altered hemodynamics and hyperuricemia accompany an elevated sFlt-1/PlGF ratio before the onset of early severe preeclampsia.

    LENUS (Irish Health Repository)

    Doherty, Anne

    2014-08-01

    Early identification of women at risk of developing early-onset severe preeclampsia (sPE) is a key objective in obstetrics. An elevated ratio of serum soluble fms-like tyrosine kinase (sFlt-1) to placenta-like growth factor (PlGF) (sFlt-1\\/PlGF ratio) precedes overt hypertension. The longitudinal relationship between this biomarker, maternal hemodynamics, and maternal serum uric acid during the pre-clinical phase is unknown.

  3. Early Onset Werner Syndrome

    Directory of Open Access Journals (Sweden)

    Berna İmge Aydoğan

    2015-09-01

    Full Text Available Werner syndrome (WS is a rare autosomal recessive adult-onset progeroid disorder characterized by the early onset of aged-appearance and age-related metabolic disorders. Symptoms of premature aging usually first develop in the second-third decades of life. We report a 27-year-old female who was admitted to our clinic at the age of eighteen with hyperglycemia. She was diagnosed with diabetes and type 4 dyslipidemia at the age of seven. In her family history, her parents were first cousins and she had three healthy brothers. On her first physical examination; she had bird-like face appearance, global hair loss, beaked nose, short stature and she was overweight. She had global hair loss with gray and thin hair. Hoarseness of voice and hyperkeratosis of skin were observed. She had bilateral cataracts and moderate sensorineural hearing loss. On psychiatric examination, borderline mental retardation was detected. She had severe insulin resistance and hypertriglyceridemia despite levothyroxine, gemfibrozil, omega-3 and intensive insulin treatment. Routine lipid apheresis was performed to lower the triglyceride levels reaching 5256 mg/dL. She also had focal segmental glomerulosclerosis, hepatosteatosis, osteoporosis and epilepsy. Disease was accompanied by several congenital deformities, such as Rathke’s cleft cyst, angiomyolipoma and femoral neck hypoplasia. WS is a rare genetic disorder characterized by multiple endocrine manifestations as well as soft tissue changes. We present a case of early disturbances that were diagnosed before typical clinical signs and symptoms. We propose that WS should be kept in mind when type 2 diabetes and hyperlipidemia are diagnosed early in childhood. Turk Jem 2015; 19: 99-104

  4. Sex dimorphism in growth.

    Science.gov (United States)

    Gasser, T; Sheehy, A; Molinari, L; Largo, R H

    2000-01-01

    While there is agreement that sex differences in height are small up to the onset of the pubertal spurt in girls, there has been some debate about the question of which, and to what extent, various growth phases contribute to the average adult sex difference of about 13 cm. There has been no consistent agreement between authors as to what extent this difference is due to the late onset of the pubertal spurt (PS) for boys and to what extent it is due to their more intense PS. In this paper, we investigate this question for the variables height, sitting and leg height, arm length, bihumeral and biiliac width. Biiliac width is a special case since both sexes have roughly the same adult size, but girls still have a shorter growing period. The gains for boys, when compared to girls, show a very different pattern across variables: for the legs, the additional growth due to the later spurt is responsible for most of the adult sex difference (64%). On the other hand, for bihumeral width and sitting height, the more intense PS contributes almost 50% to the adult sex difference. An analysis across variables indicates that increments from 1.5 to 6 years largely compensate for deviations in infant morphology from adult morphology.

  5. Protein and mRNA levels support the notion that a genetic regulatory circuit controls growth phases in E. coli populations

    Directory of Open Access Journals (Sweden)

    Agustino Martinez-Antonio

    2015-09-01

    Full Text Available Bacterial populations transition between growing and non-growing phases, based on nutrient availability and stresses conditions. The hallmark of a growing state is anabolism, including DNA replication and cell division. In contrast, bacteria in a growth-arrested state acquire a resistant physiology and diminished metabolism. However, there is little knowledge on how this transition occurs at the molecular level. Here, we provide new evidence that a multi-element genetic regulatory circuit might work to maintain genetic control among growth-phase transitions in Escherichia coli. This work contributes to the discovering of design principles behind the performance of biological functions, which could be of relevance on the new disciplines of biological engineering and synthetic biology.

  6. 2-DE based proteomic analysis of Saccharomyces cerevisiae wild and K+ transport-affected mutant (trk1,2) strains at the growth exponential and stationary phases.

    Science.gov (United States)

    Curto, Miguel; Valledor, Luis; Navarrete, Clara; Gutiérrez, Dolores; Sychrova, Hana; Ramos, José; Jorrin, Jesús

    2010-11-10

    By using a 2-DE based workflow, the proteome of wild and potassium transport mutant trk1,2 under optimal growth potassium concentration (50mM) has been analyzed. At the exponential and stationary phases, both strains showed similar growth, morphology potassium content, and Vmax of rubidium transport, the only difference found being the Km values for this potassium analogue transport, higher for the mutant (20mM) than for the wild (3-6mM) cells. Proteins were buffer-extracted, precipitated, solubilized, quantified, and subjected to 2-DE analysis in the 5-8 pH range. More differences in protein content (37-64mgg(-1) cell dry weight) and number of resolved spots (178-307) were found between growth phases than between strains. In all, 164 spots showed no differences between samples and a total of 105 were considered to be differential after ANOVA test. 171 proteins, corresponding to 71 unique gene products have been identified, this set being dominated by cytosolic species and glycolitic enzymes. The ranking of the more abundant spots revealed no differences between samples and indicated fermentative metabolism, and active cell wall biosynthesis, redox homeostasis, biosynthesis of amino acids, coenzymes, nucleotides, and RNA, and protein turnover, apart from cell division and growth. PCA analysis allowed the separation of growth phases (PC1 and 2) and strains at the stationary phase (PC3 and 4), but not at the exponential one. These results are also supported by clustering analysis. As a general tendency, a number of spots newly appeared at the stationary phase in wild type, and to a lesser extent, in the mutant. These up-accumulated spots corresponded to glycolitic enzymes, indicating a more active glucose catabolism, accompanied by an accumulation of methylglyoxal detoxification, and redox-homeostasis enzymes. Also, more extensive proteolysis was observed at the stationary phase with this resulting in an accumulation of low Mr protein species. Copyright © 2010

  7. Real-time observation of growth and orientation of Sm-Ba-Cu-O phases on a Sm-211 whisker substrate by high-temperature optical microscopy

    Czech Academy of Sciences Publication Activity Database

    Sun, J.L.; Huang, Y.B.; Cheng, L.; Yao, X.; Lai, Y.J.; Jirsa, Miloš

    2009-01-01

    Roč. 9, č. 2 (2009), 898-902 ISSN 1528-7483 R&D Projects: GA ČR GA202/08/0722 Institutional research plan: CEZ:AV0Z10100520 Keywords : high-temperature optical microscopy * growth and orientation of Sm-Ba-Cu-O phases * Sm-211 whisker substrate Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.162, year: 2009

  8. 3-D growth of a short fatigue crack within a polycrystalline microstructure studied using combined diffraction and phase-contrast X-ray tomography

    DEFF Research Database (Denmark)

    Herbig, M.; King, Andrew; Reischig, Peter

    2011-01-01

    X-ray diffraction contrast tomography is a recently developed, non-destructive synchrotron imaging technique which characterizes microstructure and grain orientation in polycrystalline materials in three dimensions. By combining it with propagation-based phase-contrast tomography it is possible...... beta titanium alloy Ti 21S that allows for visualization and analysis of the growth rate and crystallographic orientation of the fracture surface....

  9. Liquid Phase Epitaxial Growth of Al-doped f-SiC for White Light-Emitting Diodes

    DEFF Research Database (Denmark)

    Tang, Kai; Ma, Xiang; can der Eijk, Casper

    , the technological equipment required for LPE is relatively inexpensive. The fundamental backgrounds for LPE growth of Al-doped 6H-SiC are first introduced and elaborated by new thermodynamic and crystal growth models. Based on theoretical analyses, the new designed experimental apparatus is then constructed....... The experimental results are presented and discussed. Since operational temperature of LPE growth is much lower than that currently used in physical vapour transport (PVT) process, it is expected to save the energy consumption for SiC crystal growth....

  10. Fe-Al-Nb phase diagram investigation and directional growth of the (Fe, Al){sub 2}Nb-(Fe, Al, Nb){sub ss} eutectic system

    Energy Technology Data Exchange (ETDEWEB)

    Mota, M.A. [State University of Campinas, C.P. 6122, 13083-970 Campinas, SP (Brazil); Coelho, A.A. [State University of Campinas, C.P. 6122, 13083-970 Campinas, SP (Brazil); Bejarano, J.M.Z. [State University of Campinas, C.P. 6122, 13083-970 Campinas, SP (Brazil); Gama, S. [State University of Campinas, C.P. 6122, 13083-970 Campinas, SP (Brazil); Caram, R. [State University of Campinas, C.P. 6122, 13083-970 Campinas, SP (Brazil)]. E-mail: rcaram@fem.unicamp.br

    2005-08-16

    An attractive alternative method for the manufacture of high temperature structural materials may be achieved from a eutectic transformation found in the Fe-Al-Nb system, which generates the (Fe, Al){sub 2}Nb and (Fe, Al, Nb){sub ss} solid phases. Eutectic and off-eutectic samples from the Fe-Al-Nb system were prepared by arc melting under argon atmosphere, which were subsequently directionally solidified using a vertical Bridgman crystal growth unit. The ingots obtained were investigated using optical and electron scanning microscopy with the purpose to evaluate the effect of the growth condition on the microstructure. Primarily, the growth mode of the (Fe, Al){sub 2}Nb/(Fe, Al, Nb) eutectic was considered by examining off-eutectic samples. The solidification experiments carried out under different conditions revealed that the microstructure of this system is very sensitive to a growth rate variation. At a low growth rate, the eutectic microstructure was regular, even though several types of defects were found. As the growth rate was increased, a transition from lamellar to fibrous morphology was observed. Some aspects of this transition were also evaluated.

  11. Numerical Analysis of the Combined Influence of Accelerated Crucible Rotation and Dynamic Crucible Translation on Liquid Phase Diffusion Growth of SiGe

    Directory of Open Access Journals (Sweden)

    Mandeep Sekhon

    2016-09-01

    Full Text Available The effects of accelerated crucible rotation technique (ACRT and dynamic translation on liquid phase diffusion (LPD growth of SixGe1−x single crystals have been separately investigated numerically in earlier works and were found to have a very positive impact on the LPD growth process. Building upon these findings, in this paper, we study the consequences of imposing both ACRT and dynamic translation on this growth technique. Time-dependent, axisymmetric numerical simulations using moving grid approach have been carried out using finite volume code Ansys Fluent. Crucible translation effect is simulated using dynamic thermal boundary condition. Results are compared to the case in which this growth system is subjected to ACRT only. It is predicted that by combining ACRT with dynamic pulling, excellent axial compositional uniformity can be achieved and growth rate can be improved substantially without significantly compromising on the benefits of employing ACRT. The results show that it is advantageous to utilize the combination of ACRT and dynamic translation during LPD growth rather than using them independently for producing relatively uniform composition SixGe1−x single crystals in a shorter span of time.

  12. Effect of Production Phase on Growth, Enzyme Activities and Feed Selection of Broilers Raised on Vegetable Protein Diet

    Directory of Open Access Journals (Sweden)

    M. A. Hossain

    2014-11-01

    Full Text Available This study consisted of two experiments, conducted to assess the impact of phase at which vegetable protein (VP diets are introduced to broiler chicks, and preference of birds for diets based on soybean or canola meal (CM. Two hundred and ten day-old Cobb 500 chicks were randomly distributed into five dietary groups in the main experiment. One group was fed on animal protein (AP diet all through to 21 days of age; two other groups were started on AP diet for 7 days and then switched to diets containing soybean meal (AP-SBM or AP-CM, while two other diets (SBM-AP and CM-AP were started on one of the VP diets for 7 days and then switched to AP diet. A sub-experiment on thirty birds raised on a commercial diet to 7 days was used in a feed selection test to quantify the preference of birds for the diets containing mainly CM or SBM. Chicks were reared under similar care and management conditions and the diets were iso-caloric and iso-nitrogenous. Results of the main experiment showed that chicks on CM-AP diet ate more (p<0.05 than those on the other diets up to day 7. Body weight gain was highest (p<0.001 on the AP-SBM diet while birds on the CM-AP diet weighed the least at 7 d. Feed intake, body weight gain, feed conversion ratio, mortality, bone growth, visceral organ development, and activities of digestive enzymes were similar between the groups from hatch to 21 days of age. Results of the second sub-experiment showed that chicks preferred the CM-based diets to the SBM-based diets at 8 to 14 d (p<0.001 and 15 to 21 d (p<0.01 when given a choice. Overall, the birds were not affected by the nature of the starter diet although they tended to prefer the canola to soybean diets.

  13. Modeling Skill Growth and Decay in Edge Organizations: Near-Optimizing Knowledge and Power Flows (Phase Two)

    National Research Council Canada - National Science Library

    MacKinnon, Douglas J; Levitt, Raymond E; Nissen, Mark E

    2006-01-01

    .... We begin by reviewing Phase I research which explored how knowledge inventory flows through organizations, analogously to perishable, physical goods inventory in a supply chain, and uncovered useful...

  14. Influence of the interface on growth rates in AlN/GaN short period superlattices via metal organic vapor phase epitaxy

    Science.gov (United States)

    Rodak, L. E.; Korakakis, D.

    2011-11-01

    AlN/GaN short period superlattices are well suited for a number of applications including, but not limited to, digital alloys, intersubband devices, and emitters. In this work, AlN/GaN superlattices with periodicities ranging from 10 to 20 Å have been grown via metal organic vapor phase epitaxy in order to investigate the influence of the interface on the binary alloy growth rates. The GaN growth rate at the interface was observed to decrease with increasing GaN thickness while the AlN growth rate remained constant. This has been attributed to a decrease in the decomposition rate of GaN at the hetero-interface as seen in other III-V hetero-structures.

  15. Direct epitaxial growth of SrTiO{sub 3} on Si (001): Interface, crystallization and IR evidence of phase transition

    Energy Technology Data Exchange (ETDEWEB)

    Niu, G. [Institut des Nanotechnologies de Lyon (INL), Ecole Centrale de Lyon, 36 Avenue Guy de Collongue, 69134 Ecully (France); Peng, W.W. [Synchrotron SOLEIL, L' Orme des Merisiers, Saint-Aubin, BP 48, 91192 Gif-sur-Yvette (France); Saint-Girons, G.; Penuelas, J. [Institut des Nanotechnologies de Lyon (INL), Ecole Centrale de Lyon, 36 Avenue Guy de Collongue, 69134 Ecully (France); Roy, P.; Brubach, J.B. [Synchrotron SOLEIL, L' Orme des Merisiers, Saint-Aubin, BP 48, 91192 Gif-sur-Yvette (France); Maurice, J-L. [Unite Mixte de Physique CNRS/Thales Associee a l' Universite Paris Sud, Campus de Polytechnique, 1 Avenue A. Fresnel, 91767 Palaiseau (France); Hollinger, G. [Institut des Nanotechnologies de Lyon (INL), Ecole Centrale de Lyon, 36 Avenue Guy de Collongue, 69134 Ecully (France); Vilquin, B., E-mail: m.gooley@elsevier.com [Institut des Nanotechnologies de Lyon (INL), Ecole Centrale de Lyon, 36 Avenue Guy de Collongue, 69134 Ecully (France)

    2011-06-30

    The work reports the direct epitaxial growth of SrTiO{sub 3} on Si (001) substrate by molecular beam epitaxy. The impact of the growth temperature and the initial oxygen partial pressure on the heteroepitaxy is studied in detail using different in-situ and ex-situ characterization methods. The optimal growth condition has been identified as 360 deg. C with the initial oxygen partial pressure of 5 x 10{sup -8} Torr to achieve a high-quality single crystalline SrTiO{sub 3} film and a coherent interface between SrTiO{sub 3} and Si. The THz Infrared (IR) measurements show that the biaxial strained SrTiO{sub 3} commensurately grown on silicon undergoes a cubic-tetragonal phase transition.

  16. Organometallic vapor-phase epitaxy of high-quality Ga0.51In0.49P at high growth rates

    International Nuclear Information System (INIS)

    Cao, D.S.; Kimball, A.W.; Chen, G.S.; Fry, K.L.; Stringfellow, G.B.

    1989-01-01

    High-quality Ga 0.51 In 0.49 P, lattice-matched to GaAs, has been grown by atmospheric pressure organometallic vapor-phase epitaxy. The growth was performed at a temperature of 680 degree C and a growth rate of about 12 μm/h. The indium distribution coefficient was found to be unity at this growth temperature. At a V/III ratio of 148, the Ga 0.51 In 0.49 P epilayers had photoluminescence (PL) half-widths of 35 and 7.2 meV at 300 and 10 K, respectively, the best reported results to date. As the V/III ratio was changed from 94 to 240, the 300-K energy band gap measured by PL varied only from 1.897 to 1.912 eV, values close to that of Ga 0.51 In 0.49 P grown by liquid-phase epitaxy. An ordered arrangement of gallium and indium atoms on the column III sublattice with a Cu-Pt structure was observed in transmission electron diffraction patterns for all samples. Our results show that the phenomenon of changing energy band gap with varying V/III ratio does not occur at these high growth rates

  17. A retrospective study of late-onset bipolar disorder: A comparison with early and intermediate onset

    Directory of Open Access Journals (Sweden)

    Sandeep Grover

    2017-01-01

    Full Text Available Aim: To evaluate the sociodemographic, clinical, and treatment characteristics profile of late-onset (LO bipolar affective disorder (BPAD (onset ≥50 years and compare the patients with LO BPAD with early age of onset (10–25 years and intermediate age of onset (26–40 years BPAD for the demographic features, illness characteristics, and treatment characteristics. Methodology: In this retrospective study, data (demographic features, clinical characteristics, and treatment characteristics of 115 patients with LO BPAD (onset ≥50 years were extracted and were compared with 93 patients with intermediate-onset (IO (26–40 years and 130 patients with early-onset (EO (10–25 years BPAD groups. Results: Patients with LO BPAD differ from EO and IO BPAD in having higher rates of family history of mental disorders, higher rates of comorbid psychiatric disorders (especially substance use disorders and physical illnesses, higher rates of suicidal ideations, lower rates of suicidal attempts, higher rates of Type-II BPAD, lower prevalence of psychotic symptoms during the episodes, shorter interepisodic duration, higher use of combination of mood stabilizers and antidepressants, lower preference of lithium, higher preference for valproate, and lower use of benzodiazepines. In addition, patients with LO BPAD differed from those with EO BPAD in having higher rates of having a depressive-manic illness pattern, longer duration of depressive episodes, and lower number of manic episodes. Patients with LO BPAD differed significantly from IO BPAD in having lower number of episodes and more often use of antipsychotic monotherapy during the acute phase. Conclusions: LO BPAD differs from IO and EO BPAD on several of the clinical characteristics. Treatment preferences by the clinicians for LO BPAD also differ from EO and IO BPAD.

  18. Stoichiometry-, phase- and orientation-controlled growth of polycrystalline pyrite (FeS 2) thin films by MOCVD

    Science.gov (United States)

    Höpfner, C.; Ellmer, K.; Ennaoui, A.; Pettenkofer, C.; Fiechter, S.; Tributsch, H.

    1995-06-01

    The growth process of polycrystalline pyrite thin films employing low pressure metalorganic chemical vapor deposition (LP-MOCVD) in a vertical cold wall reactor has been investigated. Iron pentacarbonyl (IPC) and t-butyldisulfide (TBDS) were utilized as precursors. Study of the growth rate as a function of temperature reveals a kinetically controlled growth process with an activation energy of 73 kJ / mol over the temperature range from 250 to 400°C. From 500 to 630°C, the growth rate is mainly mass transport limited. Decomposition of the films into pyrrhotite (Fe 1 - xS) occurs at higher growth temperatures. The {S}/{Fe} ratio in the films has been controlled from 1.23 up to 2.03 by changing the TBDS partial pressure. With increasing deposition temperature, the crystallites in the films show the tendency to grow [100]-oriented on amorphous substrates at a growth rate of 2.5 Å / s. The grains show a preferential orientation in the [111] direction upon lowering the growth rate down to 0.3 Å / s. Temperatures above 550°C are beneficial in enhancing the grain size in the columnar structured films up to 1.0 μm.

  19. Stoichiometry-, phase- and orientation-controlled growth of polycrystalline pyrite (FeS{sub 2}) thin films by MOCVD

    Energy Technology Data Exchange (ETDEWEB)

    Hoepfner, C.; Ellmer, K.; Ennaoui, A.; Pettenkofer, C.; Fiechter, S.; Tributsch, H. [Hahn-Meitner-Institut Berlin, Abteilung Solare Energetik, Berlin (Germany)

    1995-06-01

    The growth process of polycrystalline pyrite thin films employing low pressure metalorganic chemical vapor deposition (LP-MOCVD) in a vertical cold wall reactor has been investigated. Iron pentacarbonyl (IPC) and t-butyldisulfide (TBDS) were utilized as precursors. Study of the growth rate as a function of temperature reveals a kinetically controlled growth process with an activation energy of 73 kJ/mol over the temperature range from 250 to 400C. From 500 to 630C, the growth rate is mainly mass transport limited. Decomposition of the films into pyrrhotite (Fe{sub 1-x}S) occurs at higher growth temperatures. The S/Fe ratio in the films has been controlled from 1.23 up to 2.03 by changing the TBDS partial pressure. With increasing deposition temperature, the crystallites in the films show the tendency to grow [100]-oriented on amorphous substrates at a growth rate of 2.5 A/s. The grains show a preferential orientation in the [111] direction upon lowering the growth rate down to 0.3 A/s. Temperatures above 550C are beneficial in enhancing the grain size in the columnar structured films up to 1.0 {mu}m

  20. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Patricia Hingston

    Full Text Available The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA profiling to characterize the bacterium's cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3× were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431 and magnitude (>1,000-fold of differentially expressed genes (>2-fold, p<0.05 in response to cold. A core set of 22 genes was upregulated at all growth phases, including nine genes required for branched-chain fatty acid (BCFA synthesis, the osmolyte transporter genes opuCBCD, and the internalin A and D genes. Genes suppressed at 4°C were largely associated with cobalamin (B12 biosynthesis or the production/export of cell wall components. Antisense transcription accounted for up to 1.6% of total mapped reads with higher levels (2.5× observed at 4°C than 20°C. The greatest number of upregulated antisense transcripts at 4°C occurred in early lag phase, however, at both temperatures, antisense expression levels were highest in late stationary-phase cells. Cold-induced FA membrane changes included a 15% increase in the proportion of BCFAs and a 15% transient increase in unsaturated FAs between lag and exponential phase. These increases probably reduced the membrane phase transition temperature until optimal levels of BCFAs could be produced. Collectively, this research provides new information regarding cold-induced membrane composition changes in L. monocytogenes, the growth-phase dependency of its cold

  1. RNA-Seq analysis of isolate- and growth phase-specific differences in the global transcriptomes of enteropathogenic Escherichia coli prototype isolates

    Science.gov (United States)

    Hazen, Tracy H.; Daugherty, Sean C.; Shetty, Amol; Mahurkar, Anup A.; White, Owen; Kaper, James B.; Rasko, David A.

    2015-01-01

    Enteropathogenic Escherichia coli (EPEC) are a leading cause of diarrheal illness among infants in developing countries. E. coli isolates classified as typical EPEC are identified by the presence of the locus of enterocyte effacement (LEE) and the bundle-forming pilus (BFP), and absence of the Shiga-toxin genes, while the atypical EPEC also encode LEE but do not encode BFP or Shiga-toxin. Comparative genomic analyses have demonstrated that EPEC isolates belong to diverse evolutionary lineages and possess lineage- and isolate-specific genomic content. To investigate whether this genomic diversity results in significant differences in global gene expression, we used an RNA sequencing (RNA-Seq) approach to characterize the global transcriptomes of the prototype typical EPEC isolates E2348/69, B171, C581-05, and the prototype atypical EPEC isolate E110019. The global transcriptomes were characterized during laboratory growth in two different media and three different growth phases, as well as during adherence of the EPEC isolates to human cells using in vitro tissue culture assays. Comparison of the global transcriptomes during these conditions was used to identify isolate- and growth phase-specific differences in EPEC gene expression. These analyses resulted in the identification of genes that encode proteins involved in survival and metabolism that were coordinately expressed with virulence factors. These findings demonstrate there are isolate- and growth phase-specific differences in the global transcriptomes of EPEC prototype isolates, and highlight the utility of comparative transcriptomics for identifying additional factors that are directly or indirectly involved in EPEC pathogenesis. PMID:26124752

  2. Adult-Onset Hypogonadism.

    Science.gov (United States)

    Khera, Mohit; Broderick, Gregory A; Carson, Culley C; Dobs, Adrian S; Faraday, Martha M; Goldstein, Irwin; Hakim, Lawrence S; Hellstrom, Wayne J G; Kacker, Ravi; Köhler, Tobias S; Mills, Jesse N; Miner, Martin; Sadeghi-Nejad, Hossein; Seftel, Allen D; Sharlip, Ira D; Winters, Stephen J; Burnett, Arthur L

    2016-07-01

    In August 2015, an expert colloquium commissioned by the Sexual Medicine Society of North America (SMSNA) convened in Washington, DC, to discuss the common clinical scenario of men who present with low testosterone (T) and associated signs and symptoms accompanied by low or normal gonadotropin levels. This syndrome is not classical primary (testicular failure) or secondary (pituitary or hypothalamic failure) hypogonadism because it may have elements of both presentations. The panel designated this syndrome adult-onset hypogonadism (AOH) because it occurs commonly in middle-age and older men. The SMSNA is a not-for-profit society established in 1994 to promote, encourage, and support the highest standards of practice, research, education, and ethics in the study of human sexual function and dysfunction. The panel consisted of 17 experts in men's health, sexual medicine, urology, endocrinology, and methodology. Participants declared potential conflicts of interest and were SMSNA members and nonmembers. The panel deliberated regarding a diagnostic process to document signs and symptoms of AOH, the rationale for T therapy, and a monitoring protocol for T-treated patients. The evaluation and management of hypogonadal syndromes have been addressed in recent publications (ie, the Endocrine Society, the American Urological Association, and the International Society for Sexual Medicine). The primary purpose of this document was to support health care professionals in the development of a deeper understanding of AOH, particularly in how it differs from classical primary and secondary hypogonadism, and to provide a conceptual framework to guide its diagnosis, treatment, and follow-up. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  3. UO2 Grain Growth: Developing Phase Field Models for Pore Dragging, Solute Dragging and Anisotropic Grain Boundary Energies

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, K. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Tonks, M. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Zhang, Y. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Biner, B. [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2016-09-28

    A detailed phase field model for the effect of pore drag on grain growth kinetics was implemented in MARMOT. The model takes into consideration both the curvature-driven grain boundary motion and pore migration by surface diffusion. As such, the model accounts for the interaction between pore and grain boundary kinetics, which tends to retard the grain growth process. Our 2D and 3D simulations demonstrate that the model capture all possible pore-grain boundary interactions proposed in theoretical models. For high enough surface mobility, the pores move along with the migrating boundary as a quasi-rigid-body, albeit hindering its migration rate compared to the pore-free case. For less mobile pores, the migrating boundary can separate from the pores. For the pore-controlled grain growth kinetics, the model predicts a strong dependence of the growth rate on the number of pores, pore size, and surface diffusivity in agreement with theroretical models. An evolution equation for the grain size that includes these parameters was derived and showed to agree well with numerical solution. It shows a smooth transition from boundary-controlled kinetics to pore-controlled kinetics as the surface diffusivity decreases or the number of pores or their size increases. This equation can be utilized in BISON to give accurate estimate for the grain size evolution. This will be accomplished in the near future. The effect of solute drag and anisotropy of grain boundary on grain growth will be investigated in future studies.

  4. Load environment of rail joint bars - phase I, effects of track parameters on rail joint stresses and crack growth.

    Science.gov (United States)

    2013-04-01

    The load environment of joint bars was assessed under a variety of loading and track conditions. Bending stresses, thermal stresses, and residual stresses were measured on commonly used joint bars. Crack growth rates from artificially induced cracks ...

  5. Plasticity in Vegetative Growth over Contrasted Growing Sites of an F1 Olive Tree Progeny during Its Juvenile Phase

    Science.gov (United States)

    Ben Sadok, Inès; Martinez, Sebastien; Moutier, Nathalie; Garcia, Gilbert; Leon, Lorenzo; Belaj, Angelina; De La Rosa, Raúl; Khadari, Bouchaib; Costes, Evelyne

    2015-01-01

    Climatic changes impact fruit tree growth and severely limit their production. Investigating the tree ability to cope with environmental variations is thus necessary to adapt breeding and management strategies in order to ensure sustainable production. In this study, we assessed the genetic parameters and genotype by environment interaction (GxE) during the early tree growth. One hundred and twenty olive seedlings derived from the cross ‘Olivière’ x ‘Arbequina’ were examined across two sites with contrasted environments, accounting for ontogenetic trends over three years. Models including the year of growth, branching order, environment, genotype effects, and their interactions were built with variance function and covariance structure of residuals when necessary. After selection of a model, broad sense heritabilities were estimated. Despite strong environmental effect on most traits, no GxE was found. Moreover, the internal structure of traits co-variation was similar in both sites. Ontogenetic growth variation, related to (i) the overall tree form and (ii) the growth and branching habit at growth unit scale, was not altered by the environment. Finally, a moderate to strong genetic control was identified for traits at the whole tree scale and at internode scale. Among all studied traits, the maximal internode length exhibited the highest heritability (H2 = 0.74). Considering the determinant role of this trait in tree architecture and its stability across environments, this study consolidates its relevance for breeding. PMID:26062090

  6. Plasticity in Vegetative Growth over Contrasted Growing Sites of an F1 Olive Tree Progeny during Its Juvenile Phase.

    Directory of Open Access Journals (Sweden)

    Inès Ben Sadok

    Full Text Available Climatic changes impact fruit tree growth and severely limit their production. Investigating the tree ability to cope with environmental variations is thus necessary to adapt breeding and management strategies in order to ensure sustainable production. In this study, we assessed the genetic parameters and genotype by environment interaction (GxE during the early tree growth. One hundred and twenty olive seedlings derived from the cross 'Olivière' x 'Arbequina' were examined across two sites with contrasted environments, accounting for ontogenetic trends over three years. Models including the year of growth, branching order, environment, genotype effects, and their interactions were built with variance function and covariance structure of residuals when necessary. After selection of a model, broad sense heritabilities were estimated. Despite strong environmental effect on most traits, no GxE was found. Moreover, the internal structure of traits co-variation was similar in both sites. Ontogenetic growth variation, related to (i the overall tree form and (ii the growth and branching habit at growth unit scale, was not altered by the environment. Finally, a moderate to strong genetic control was identified for traits at the whole tree scale and at internode scale. Among all studied traits, the maximal internode length exhibited the highest heritability (H2 = 0.74. Considering the determinant role of this trait in tree architecture and its stability across environments, this study consolidates its relevance for breeding.

  7. Plasticity in Vegetative Growth over Contrasted Growing Sites of an F1 Olive Tree Progeny during Its Juvenile Phase.

    Science.gov (United States)

    Ben Sadok, Inès; Martinez, Sebastien; Moutier, Nathalie; Garcia, Gilbert; Leon, Lorenzo; Belaj, Angelina; De La Rosa, Raúl; Khadari, Bouchaib; Costes, Evelyne

    2015-01-01

    Climatic changes impact fruit tree growth and severely limit their production. Investigating the tree ability to cope with environmental variations is thus necessary to adapt breeding and management strategies in order to ensure sustainable production. In this study, we assessed the genetic parameters and genotype by environment interaction (GxE) during the early tree growth. One hundred and twenty olive seedlings derived from the cross 'Olivière' x 'Arbequina' were examined across two sites with contrasted environments, accounting for ontogenetic trends over three years. Models including the year of growth, branching order, environment, genotype effects, and their interactions were built with variance function and covariance structure of residuals when necessary. After selection of a model, broad sense heritabilities were estimated. Despite strong environmental effect on most traits, no GxE was found. Moreover, the internal structure of traits co-variation was similar in both sites. Ontogenetic growth variation, related to (i) the overall tree form and (ii) the growth and branching habit at growth unit scale, was not altered by the environment. Finally, a moderate to strong genetic control was identified for traits at the whole tree scale and at internode scale. Among all studied traits, the maximal internode length exhibited the highest heritability (H2 = 0.74). Considering the determinant role of this trait in tree architecture and its stability across environments, this study consolidates its relevance for breeding.

  8. Can xenon in water inhibit ice growth? Molecular dynamics of phase transitions in water$-$Xe system

    OpenAIRE

    Artyukhov, Vasilii I.; Pulver, Alexander Yu.; Peregudov, Alex; Artyuhov, Igor

    2014-01-01

    Motivated by recent experiments showing the promise of noble gases as cryoprotectants, we perform molecular dynamics modeling of phase transitions in water with xenon under cooling. We study the structure and dynamics of xenon water solution as a function of temperature. Homogeneous nucleation of clathrate hydrate phase is observed and characterized. As the temperature is further reduced we observe hints of dissociation of clathrate due to stronger hydrophobic hydration, pointing towards a po...

  9. Growth kinetics of thin oxide layers; oxidation of Fe and Fe-N phases at room temperature

    NARCIS (Netherlands)

    Kooi, Bart J.; Somers, Marcel A.J.; Mittemeijer, Eric J.

    1996-01-01

    The evolution of iron-oxide layers at room temperature on pure polycrystalline α-Fe and on the Fe-N phases γ-Fe[N], γ'-Fe4N1-x and ε-Fe2N1-z was followed in situ with Auger-Electron Spectroscopy. The observed oxidation kinetics of the Fe and Fe-N phases were interpreted using a model considering

  10. Once-daily gastroretentive gabapentin for postherpetic neuralgia: integrated efficacy, time to onset of pain relief and safety analyses of data from two phase 3, multicenter, randomized, double-blind, placebo-controlled studies.

    Science.gov (United States)

    Rauck, Richard L; Irving, Gordon A; Wallace, Mark S; Vanhove, Geertrui F; Sweeney, Michael

    2013-08-01

    Treatment options for postherpetic neuralgia (PHN), a complication of herpes zoster, are commonly unsatisfactory and associated with adverse events. To evaluate the efficacy, onset of pain relief, and safety of gastroretentive gabapentin (G-GR) in patients with PHN. In two placebo-controlled studies, 357 patients with PHN were randomized to 1800mg G-GR and 364 patients were randomized to placebo taken with the evening meal. Patients underwent a two week titration, eight weeks of stable dosing, and one week of tapering. Efficacy assessments included change in average daily pain (ADP) score from baseline to Week 10, time to onset of pain relief, the proportion of patients feeling improved using the Patient Global Impression of Change, and the proportion of responders (≥30% pain reduction). At Week 10, patients randomized to G-GR reported greater reductions in ADP score compared with placebo (-37.0% vs. -29.1; P=0.0025). More G-GR patients felt improved compared with placebo (44% vs. 33%; P=0.003) and responded to treatment (54% vs. 41%; P=0.001). As early as Day 2, greater pain reductions were observed for the G-GR group compared with the placebo group (-6.6% vs. -1.6%; P=0.0017). The median time to a one point or greater reduction in ADP score was four days for G-GR and six days for placebo (P<0.0001). The most frequently reported adverse events were dizziness (G-GR, 11%; placebo, 2%) and somnolence (G-GR, 5%; placebo, 3%). PHN pain reduction after G-GR treatment can be observed as early as the second day of dosing and continues for at least 10 weeks. Copyright © 2013 U.S. Cancer Pain Relief Committee. Published by Elsevier Inc. All rights reserved.

  11. Prediction of Flow Effect on Crystal Growth of Semi-Crystalline Polymers Using a Multi-Scale Phase-Field Approach

    Directory of Open Access Journals (Sweden)

    Xiaodong Wang

    2017-11-01

    Full Text Available A multi-scale phase-field approach, which couples the mesoscopic crystallization with the microscopic orientation of chain segments and macroscopic viscoelastic melt flow, is proposed to study how the crystal growth of semi-crystalline polymers is affected by flows. To make the simulation feasible, we divide the problem into three parts. In the first part, a finitely extensible nonlinear elastic (FENE dumbbell model is used to simulate the flow induced molecular structure. In the second part, formulas for estimating the density, orientation and aspect ratio of nuclei upon the oriented molecular structure are derived. Finally, in the third part, a massive mathematical model that couples the phase-field, temperature field, flow field and orientation field is established to model the crystal growth with melt flow. Two-dimensional simulations are carried out for predicting the flow effect on the crystal growth of isotactic polystyrene under a plane Poiseuille flow. In solving the model, a semi-analytical method is adopted to avoid the numerical difficult of a “high Weissenberg number problem” in the first part, and an efficient fractional step method is used to reduce the computing complexity in the third part. The simulation results demonstrate that flow strongly affects the morphology of single crystal but does not bring a significant influence on the holistic morphology of bulk crystallization.

  12. Time Course Exo-Metabolomic Profiling in the Green Marine Macroalga Ulva (Chlorophyta for Identification of Growth Phase-Dependent Biomarkers

    Directory of Open Access Journals (Sweden)

    Taghreed Alsufyani

    2017-01-01

    Full Text Available The marine green macroalga Ulva (Chlorophyta lives in a mutualistic symbiosis with bacteria that influence growth, development, and morphogenesis. We surveyed changes in Ulva’s chemosphere, which was defined as a space where organisms interact with each other via compounds, such as infochemicals, nutrients, morphogens, and defense compounds. Thereby, Ulva mutabilis cooperates with bacteria, in particular, Roseovarius sp. strain MS2 and Maribacter sp. strain MS6 (formerly identified as Roseobacter sp. strain MS2 and Cytophaga sp. strain MS6. Without this accompanying microbial flora, U. mutabilis forms only callus-like colonies. However, upon addition of the two bacteria species, in effect forming a tripartite community, morphogenesis can be completely restored. Under this strictly standardized condition, bioactive and eco-physiologically-relevant marine natural products can be discovered. Solid phase extracted waterborne metabolites were analyzed using a metabolomics platform, facilitating gas chromatography-mass spectrometry (GC-MS and liquid chromatography-mass spectrometry (LC-MS analysis, combined with the necessary acquisition of biological metadata. Multivariate statistics of the GC-MS and LC-MS data revealed strong differences between Ulva’s growth phases, as well as between the axenic Ulva cultures and the tripartite community. Waterborne biomarkers, including glycerol, were identified as potential indicators for algal carbon source and bacterial-algal interactions. Furthermore, it was demonstrated that U. mutabilis releases glycerol that can be utilized for growth by Roseovarius sp. MS2.

  13. A phase 2 trial of long-acting TransCon growth hormone in adult GH deficiency

    DEFF Research Database (Denmark)

    Höybye, Charlotte; Pfeiffer, Andreas F H; Ferone, Diego

    2017-01-01

    -center, randomized, open-label, active-controlled trial designed to compare the safety (including tolerability and immunogenicity), pharmacokinetics, and pharmacodynamics of three doses of weekly TransCon GH to daily growth hormone (Omnitrope). Thirty-seven adult males or females diagnosed with adult growth hormone...... deficiency and stable on growth hormone replacement therapy for at least 3 months were, following a wash-out period, randomized (regardless of their pre-study dose) to one of three TransCon GH doses (0.02, 0.04, 0.08 mg GH/kg/week) or Omnitrope 0.04 mg GH/kg/week (divided into 7 equal daily doses) for 4...... weeks. Main outcomes evaluated were adverse events, immunogenicity, and growth hormone and insulin-like growth factor 1 levels. TransCon GH was well tolerated; fatigue and headache were the most frequent drug-related adverse events and reported in all groups. No lipoatrophy or nodule formation...

  14. Comparative evaluation of short-term biomarker response to treatment for growth hormone deficiency in Chinese children with growth hormone deficiency born small for or appropriate for gestational age: a randomized phase IV open-label study.

    Science.gov (United States)

    Lu, Wenli; Shen, Shuixian; Luo, Xiaoping; Gong, Chunxiu; Gu, Xuefan; Li, Yun; Du, Minlian; Jin, Runming; Zhou, Queena; Wang, Wei

    2013-04-01

    To compare the response between Chinese children with growth hormone deficiency (GHD) born either small for gestational age (SGA) or appropriate for gestational age (AGA) after 4 weeks of recombinant human growth hormone (r-hGH) therapy. This was a phase IV, open-label, multicenter, interventional study (NCT01187550). Prepubertal children with GHD received open-label treatment with daily r-hGH (0.033 mg/kg) for 4 weeks. Serum levels of insulin-like growth factor I (IGF-I) and insulin-like growth factor-binding protein 3 (IGFBP3), and metabolic markers (including fasting glucose, insulin, total cholesterol, and homeostasis model assessment of insulin resistance) were assessed at baseline and after 4 weeks of treatment, and were analyzed according to patient subgroup (SGA or AGA). A total of 205 children with GHD (mean age 10.4 years; 175 AGA, 30 SGA) were included in the analysis. Mean baseline serum IGF-I and IGFBP3 standard deviation scores (SDS) across the whole patient population were lower than the population norms (mean values: -2.1 SDS for IGF-I and -1.2 SDS for IGFBP3), with no significant differences between the two patient subgroups. After 4 weeks, IGF-I and IGFBP3 levels increased by 1.0 SDS (p < 0.001) and 0.34 SDS (p < 0.001), respectively, but no significant differences were found between the two patient subgroups for growth-related or metabolic markers. For children with GHD born SGA, IGF-I and IGFBP3 are short-term biomarkers of responsiveness to treatment with growth hormone, as for children with GHD born AGA.

  15. Solution-phase epitaxial growth of noble metal nanostructures on dispersible single-layer molybdenum disulfide nanosheets.

    Science.gov (United States)

    Huang, Xiao; Zeng, Zhiyuan; Bao, Shuyu; Wang, Mengfei; Qi, Xiaoying; Fan, Zhanxi; Zhang, Hua

    2013-02-05

    Compared with the conventional deposition techniques used for the epitaxial growth of metallic structures on a bulk substrate, wet-chemical synthesis based on the dispersible template offers several advantages, including relatively low cost, high throughput, and the capability to prepare metal nanostructures with controllable size and morphology. Here we demonstrate that the solution-processable two-dimensional MoS(2) nanosheet can be used to direct the epitaxial growth of Pd, Pt and Ag nanostructures at ambient conditions. These nanostructures show the major (111) and (101) orientations on the MoS(2)(001) surface. Importantly, the Pt-MoS(2) hybrid nanomaterials exhibit much higher electrocatalytic activity towards the hydrogen evolution reaction compared with the commercial Pt catalysts with the same Pt loading. We believe that nanosheet-templated epitaxial growth of nanostructures via wet-chemical reaction is a promising strategy towards the facile and high-yield production of novel functional materials.

  16. Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety.

    Science.gov (United States)

    Ido, Akio; Moriuchi, Akihiro; Numata, Masatsugu; Murayama, Toshinori; Teramukai, Satoshi; Marusawa, Hiroyuki; Yamaji, Naohisa; Setoyama, Hitoshi; Kim, Il-Deok; Chiba, Tsutomu; Higuchi, Shuji; Yokode, Masayuki; Fukushima, Masanori; Shimizu, Akira; Tsubouchi, Hirohito

    2011-05-08

    Hepatocyte growth factor (HGF) stimulates hepatocyte proliferation, and also acts as an anti-apoptotic factor. Therefore, HGF is a potential therapeutic agent for treatment of fatal liver diseases. We performed a translational medicine protocol with recombinant human HGF (rh-HGF), including a phase I/II study of patients with fulminant hepatitis (FH) or late-onset hepatic failure (LOHF), in order to examine the safety, pharmacokinetics, and clinical efficacy of this molecule. Potential adverse effects identified through preclinical safety tests with rh-HGF include a decrease in blood pressure (BP) and an increase in urinary excretion of albumin. Therefore, we further investigated the effect of rh-HGF on circulatory status and renal toxicity in preclinical animal studies. In a clinical trial, 20 patients with FH or LOHF were evaluated for participation in this clinical trial, and four patients were enrolled. Subjects received rh-HGF (0.6 mg/m2/day) intravenously for 12 to 14 days. We established an infusion method to avoid rapid BP reduction in miniature swine, and confirmed reversibility of renal toxicity in rats. Although administration of rh-HGF moderately decreased BP in the participating subjects, this BP reduction did not require cessation of rh-HGF or any vasopressor therapy; BP returned to resting levels after the completion of rh-HGF infusion. Repeated doses of rh-HGF did not induce renal toxicity, and severe adverse events were not observed. Two patients survived, however, there was no evidence that rh-HGF was effective for the treatment of FH or LOHF. Intravenous rh-HGF at a dose of 0.6 mg/m2 was well tolerated in patients with FH or LOHF; therefore, it is desirable to conduct further investigations to determine the efficacy of rh-HGF at an increased dose.

  17. Topical Recombinant Human Epidermal Growth Factor for Oral Mucositis Induced by Intensive Chemotherapy with Hematopoietic Stem Cell Transplantation: Final Analysis of a Randomized, Double-Blind, Placebo-Controlled, Phase 2 Trial.

    Directory of Open Access Journals (Sweden)

    Ji-Won Kim

    Full Text Available The aim of this study was to evaluate the efficacy and safety of recombinant human epidermal growth factor (rhEGF oral spray for oral mucositis (OM induced by intensive chemotherapy with hematopoietic stem cell transplantation. In this phase 2 study, patients were randomized to either rhEGF (50 microg/mL or placebo in a 1:1 ratio. The primary endpoint was incidence of National Cancer Institute (NCI grade ≥2 OM. A total of 138 patients were enrolled in this study. In the intention-to-treat analysis, rhEGF did not reduce the incidence of NCI grade ≥2 OM (p = 0.717 nor reduce its duration (p = 0.725. Secondary endpoints including the day of onset and duration of NCI grade ≥2 OM, the incidence of NCI grade ≥3 OM and its duration, and patient-reported quality of life were also similar between the two groups. In the per-protocol analysis, however, the duration of opioid analgesic use was shorter in the rhEGF group (p = 0.036, and recipients in the rhEGF group required a lower cumulative dose of opioid analgesics than those in the placebo group (p = 0.046, among patients with NCI grade ≥2 OM. Adverse events were mild and transient. This study found no evidence to suggest that rhEGF oral spray reduces the incidence of OM. However, further studies are needed to investigate the effect of rhEGF on OM-induced pain reduction after intensive chemotherapy.

  18. Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety

    Directory of Open Access Journals (Sweden)

    Setoyama Hitoshi

    2011-05-01

    Full Text Available Abstract Background Hepatocyte growth factor (HGF stimulates hepatocyte proliferation, and also acts as an anti-apoptotic factor. Therefore, HGF is a potential therapeutic agent for treatment of fatal liver diseases. We performed a translational medicine protocol with recombinant human HGF (rh-HGF, including a phase I/II study of patients with fulminant hepatitis (FH or late-onset hepatic failure (LOHF, in order to examine the safety, pharmacokinetics, and clinical efficacy of this molecule. Methods Potential adverse effects identified through preclinical safety tests with rh-HGF include a decrease in blood pressure (BP and an increase in urinary excretion of albumin. Therefore, we further investigated the effect of rh-HGF on circulatory status and renal toxicity in preclinical animal studies. In a clinical trial, 20 patients with FH or LOHF were evaluated for participation in this clinical trial, and four patients were enrolled. Subjects received rh-HGF (0.6 mg/m2/day intravenously for 12 to 14 days. Results We established an infusion method to avoid rapid BP reduction in miniature swine, and confirmed reversibility of renal toxicity in rats. Although administration of rh-HGF moderately decreased BP in the participating subjects, this BP reduction did not require cessation of rh-HGF or any vasopressor therapy; BP returned to resting levels after the completion of rh-HGF infusion. Repeated doses of rh-HGF did not induce renal toxicity, and severe adverse events were not observed. Two patients survived, however, there was no evidence that rh-HGF was effective for the treatment of FH or LOHF. Conclusions Intravenous rh-HGF at a dose of 0.6 mg/m2 was well tolerated in patients with FH or LOHF; therefore, it is desirable to conduct further investigations to determine the efficacy of rh-HGF at an increased dose.

  19. Cell surface acid-base properties of the cyanobacterium Synechococcus: Influences of nitrogen source, growth phase and N:P ratios

    Science.gov (United States)

    Liu, Yuxia; Alessi, D. S.; Owttrim, G. W.; Kenney, J. P. L.; Zhou, Qixing; Lalonde, S. V.; Konhauser, K. O.

    2016-08-01

    The distribution of many trace metals in the oceans is controlled by biological uptake. Recently, Liu et al. (2015) demonstrated the propensity for a marine cyanobacterium to adsorb cadmium from seawater, suggesting that cell surface reactivity might also play an important role in the cycling of metals in the oceans. However, it remains unclear how variations in cyanobacterial growth rates and nutrient supply might affect the chemical properties of their cellular surfaces. In this study we used potentiometric titrations and Fourier Transform Infrared (FT-IR) spectrometry to profile the key metabolic changes and surface chemical responses of a Synechococcus strain, PCC 7002, during different growth regimes. This included testing various nitrogen (N) to phosphorous (P) ratios (both nitrogen and phosphorous dependent), nitrogen sources (nitrate, ammonium and urea) and growth stages (exponential, stationary, and death phase). FT-IR spectroscopy showed that varying the growth substrates on which Synechococcus cells were cultured resulted in differences in either the type or abundance of cellular exudates produced or a change in the cell wall components. Potentiometric titration data were modeled using three distinct proton binding sites, with resulting pKa values for cells of the various growth conditions in the ranges of 4.96-5.51 (pKa1), 6.67-7.42 (pKa2) and 8.13-9.95 (pKa3). According to previous spectroscopic studies, these pKa ranges are consistent with carboxyl, phosphoryl, and amine groups, respectively. Comparisons between the titration data (for the cell surface) and FT-IR spectra (for the average cellular changes) generally indicate (1) that the nitrogen source is a greater determinant of ligand concentration than growth phase, and (2) that phosphorus limitation has a greater impact on Synechococcus cellular and extracellular properties than does nitrogen limitation. Taken together, these techniques indicate that nutritional quality during cell growth can

  20. Phase transitions in tumor growth: IV relationship between metabolic rate and fractal dimension of human tumor cells

    Science.gov (United States)

    Betancourt-Mar, J. A.; Llanos-Pérez, J. A.; Cocho, G.; Mansilla, R.; Martin, R. R.; Montero, S.; Nieto-Villar, J. M.

    2017-05-01

    By the use of thermodynamics formalism of irreversible processes, complex systems theory and systems biology, it is derived a relationship between the production of entropy per unit time, the fractal dimension and the tumor growth rate for human tumors cells. The thermodynamics framework developed demonstrates that, the dissipation function is a Landau potential and also the Lyapunov function of the dynamical behavior of tumor growth, which indicate the directional character, stability and robustness of the phenomenon. The entropy production rate may be used as a quantitative index of the metastatic potential of tumors. The current theoretical framework will hopefully provide a better understanding of cancer and contribute to improvements in cancer treatment.

  1. LH pulse frequency and the emergence and growth of ovarian antral follicular waves in the ewe during the luteal phase of the estrous cycle

    Directory of Open Access Journals (Sweden)

    Rawlings Norman C

    2009-07-01

    Full Text Available Abstract Background In the ewe, ovarian antral follicles emerge or grow from a pool of 2–3 mm follicles in a wave like pattern, reaching greater than or equal to 5 mm in diameter before regression or ovulation. There are 3 or 4 such follicular waves during each estrous cycle. Each wave is preceded by a peak in serum FSH concentrations. The role of pulsatile LH in ovarian antral follicular emergence and growth is unclear; therefore, the purpose of the present study was to further define this role. Methods Ewes (n = 7 were given 200 ng of GnRH (IV every hour for 96 h from Day 7 of the estrous cycle, to increase LH pulse frequency. Controls (n = 6 received saline. In a second study, ewes (n = 6 received subcutaneous progesterone-releasing implants for 10 days starting on Day 4 of the cycle, to decrease LH pulse frequency. Controls (n = 6 underwent sham surgery. Daily transrectal ovarian ultrasonography and blood sampling was performed on all ewes from the day of estrus to the day of ovulation at the end of the cycle of the study. At appropriate times, additional blood samples were taken every 12 minutes for 6 h and 36 min or 6 h in studies 1 and 2 respectively. Results The largest follicle of the follicular wave growing when GnRH treatment started, grew to a larger diameter than the equivalent wave in control ewes (P Conclusion We concluded that waves of ovarian follicular growth can occur at LH pulse frequencies lower than those seen in the luteal phase of the estrous cycle but frequencies seen in the follicular phase, when applied during the mid-luteal phase, in the presence of progesterone, do enhance follicular growth to resemble an ovulatory follicle, blocking the emergence of the next wave.

  2. Vapor phase epitaxial growth of FeS sub 2 pyrite and evaluation of the carrier collection in liquid-junction solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Ennaoui, A.; Schlichthoerl, G.; Fiechter, S.; Tributsch, H. (Hahn-Meitner-Inst., Abt. Solare Energetik und Materialforschung, Berlin (Germany))

    1992-01-01

    Photoactive epitaxial layers of FeS{sub 2} were grown using bromine as a transport agent and a simple closed ampoule technique. The substrates used were (100)-oriented slices of natural pyrite 1 mm thick. A vapor-liquid-solid (VLS) growth mechanism was elucidated by means of optical microscopy. Macrosteps, terrace surfaces and protuberances are often accompanied with the presence of liquid FeBr{sub 3} droplets. In the absence of a liquid phase growth hillocks are found. Localized photovoltaic response for the evaluation of carrier collection using a scanning laser spot system has been used to effectively locate and characterize non-uniformities present in the epitaxial thin films. (orig.).

  3. The effect of growth phase and medium on the use of the firefly adenosine triphosphate (ATP) assay for the quantitation of bacteria

    Science.gov (United States)

    Bush, V. N.; Picciolo, G. L.; Chappelle, E. W.

    1975-01-01

    Luciferase assay for adenosine triphosphate (ATP) was used as a rapid method to determine the number of bacteria in a urine sample after nonbacterial components were removed. Accurate cellular ATP values, determined when bacteria were grown in an environment similar to that in which they were found, were necessary for the calculation of bacterial titer in urine. Cellular ATP values vary depending on the extraction method, the cell growth phase, and cell growth conditions. ATP per cell values of stationary E. coli grown in urine were two times greater than ATP per cell values of cells grown in trypticase soy broth. Glucose and urea were examined as possible components responsible for the cellular ATP variation.

  4. Phase-field modelling of β(Ti) solidification in Ti-45at.%Al: columnar dendrite growth at various gravity levels

    Science.gov (United States)

    Viardin, A.; Berger, R.; Sturz, L.; Apel, M.; Hecht, U.

    2016-03-01

    The effect of solutal convection on the solidification of γ titanium aluminides, specifically on β(Ti) dendrite growth, is not well known. With the aim of supporting directional solidification experiments under hyper-gravity using a large diameter centrifuge, 2D-phase field simulations of β(Ti) dendrite growth have been performed for the binary alloy Ti-45at.%Al and various gravity scenarios. Both, the direction and magnitude of the gravity vector were varied systematically in order to reveal the subtle interplay between the convective flow pattern and mushy zone characteristics. In this presentation, gravity effects are discussed for early dendrite growth. For selected cases the evolution on longer timescales is also analyse of and oscillatory modes leading to dynamically stable steady state growth are outlined. In a dedicated simulation series forced flow is superimposed, as to mimic thermally driven fluid flow expected to establish on the macroscopic scale (sample size) in the centrifugal experiments. Above a certain threshold this flow turns dominant and precludes solutally driven convective effects.

  5. In situ X-ray investigation of changing barrier growth temperatures on InGaN single quantum wells in metal-organic vapor phase epitaxy

    International Nuclear Information System (INIS)

    Ju, Guangxu; Honda, Yoshio; Tabuchi, Masao; Takeda, Yoshikazu; Amano, Hiroshi

    2014-01-01

    The effects of GaN quantum barriers with changing growth temperatures on the interfacial characteristics of GaN/InGaN single quantum well (SQW) grown on GaN templates by metalorganic vapour phase epitaxy were in situ investigated by X-ray crystal truncation rod (CTR) scattering and X-ray reflectivity measurements at growth temperature using a laboratory level X-ray diffractometer. Comparing the curve-fitting results of X-ray CTR scattering spectra obtained at growth temperature with that at room temperature, the In x Ga 1-x N with indium composition less than 0.11 was stabile of the indium distribution at the interface during the whole growth processes. By using several monolayers thickness GaN capping layer to protect the InGaN well layer within temperature-ramping process, the interfacial structure of the GaN/InGaN SQW was drastically improved on the basis of the curve-fitting results of X-ray CTR scattering spectra, and the narrow full width at half-maximum and strong luminous intensity were observed in room temperature photoluminescence spectra

  6. Degenerate seaweed to tilted dendrite transition and their growth dynamics in directional solidification of non-axially oriented crystals: a phase-field study

    Science.gov (United States)

    Xing, Hui; Dong, Xianglei; Wu, Hongjing; Hao, Guanhua; Wang, Jianyuan; Chen, Changle; Jin, Kexin

    2016-05-01

    We report the results of a phase-field study of degenerate seaweed to tilted dendrite transition and their growth dynamics during directional solidification of a binary alloy. Morphological selection maps in the planes of (G, Vp) and (ε4, Vp) show that lower pulling velocity, weaker anisotropic strength and higher thermal gradient can enhance the formation of the degenerate seaweed. The tip undercooling shows oscillations in seaweed growth, but it keeps at a constant value in dendritic growth. The M-S instability on the tips and the surface tension anisotropy of the solid-liquid interface are responsible for the formation of the degenerate seaweed. It is evidenced that the place where the interfacial instability occurs determines the morphological transition. The transient transition from degenerate seaweed to tilted dendrite shows that dendrites are dynamically preferred over seaweed. For the tilted dendritic arrays with a large tilted angle, primary spacing is investigated by comparing predicted results with the classical scaling power law, and the growth direction is found to be less sensitive to the pulling velocity and the primary spacing. Furthermore, the effect of the initial interface wavelength on the morphological transition is investigated to perform the history dependence of morphological selection.

  7. Growth of Cd0.96Zn0.04Te single crystals by vapor phase gas transport method

    Directory of Open Access Journals (Sweden)

    S. H. Tabatabai Yazdi

    2006-03-01

    Full Text Available   Cd0.96Zn0.04Te crystals were grown using vapor phase gas transport method (VPGT. The results show that dendritic crystals with grain size up to 3.5 mm can be grown with this technique. X-ray diffraction and Laue back-reflection patterns show that dendritic crystals are single-phase, whose single crystal grains are randomly oriented with respect to the gas-transport axis. Electrical measurements, carried out using Van der Pauw method, show that the as-grown crystals have resistivity of about 104 Ω cm and n-type conductivity.

  8. Increase of vitamin D2 by UV-B exposure during the growth phase of white button mushroom (Agaricus bisporus)

    DEFF Research Database (Denmark)

    Kristensen, Hanne; Rosenqvist, Eva S. K.; Jakobsen, Jette

    2012-01-01

    Background: Mushrooms are the only non-animal food source of vitamin D. Wild mushrooms have naturally high vitamin D2 content, and cultivated mushrooms produce vitamin D2 from ergosterol when exposed to supplementary UV-B during the post-harvest phase. Objectives: This study investigated the effe......Background: Mushrooms are the only non-animal food source of vitamin D. Wild mushrooms have naturally high vitamin D2 content, and cultivated mushrooms produce vitamin D2 from ergosterol when exposed to supplementary UV-B during the post-harvest phase. Objectives: This study investigated...

  9. The influence of microscopic and macroscopic non-stoichiometry on interfacial planarity during the solid-phase epitaxial growth of amorphized GaAs

    Energy Technology Data Exchange (ETDEWEB)

    Belay, K.B.; Ridgway, M.C.; Llewellyn, D.J. [Australian National Univ., Canberra, ACT (Australia). Dept. of Physics

    1996-12-31

    The influence of microscopic and macroscopic non-stoichiometry on the Solid-Phase Epitaxial Growth of GaAs has been studied. Ion implantation has been employed to produce microscopic non-stoichiometry via Ga and As implants and macroscopic non-stoichiometry via Ga or As implants. In-situ Time Resolved Reflectivity and Transmission Electron Microscopy and ex-situ Rutherford Backscattering Spectroscopy and Channeling have been used to investigate the regrowth of amorphized GaAs layers. As non-stoichiometry shifts from microscopic to macroscopic the interface loses its planar nature and subsequently gets rougher. 7 refs., 3 figs.

  10. On a reduction in cracking upon the growth of AlN on Si substrates by hydride vapor-phase epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Sharofidinov, Sh. Sh., E-mail: shukrillo71@mail.ru; Nikolaev, V. I.; Smirnov, A. N.; Chikiryaka, A. V.; Nikitina, I. P. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Odnoblyudov, M. A. [St. Petersburg State Polytechnic University (Russian Federation); Bugrov, V. E. [St. Petersburg National Research University of Information Technologies, Mechanics and Optics (Russian Federation); Romanov, A. E. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation)

    2016-04-15

    The main problem of the epitaxial growth of thick AlN layers on a Si substrate consists in the formation of cracks, which complicates the application of structures of this kind in the fabrication of semiconductor devices. The possibility of obtaining crack-free AlN layers with a thickness exceeding 1 μm and a mirror- smooth surface by hydride vapor-phase epitaxy is demonstrated. The properties of the layers are studied by X-diffraction analysis, optical and scanning electron microscopy, and Raman spectroscopy.

  11. Damage growth in aerospace composites

    CERN Document Server

    2015-01-01

    This book presents novel methods for the simulation of damage evolution in aerospace composites that will assist in predicting damage onset and growth and thus foster less conservative designs which realize the promised economic benefits of composite materials. The presented integrated numerical/experimental methodologies are capable of taking into account the presence of damage and its evolution in composite structures from the early phases of the design (conceptual design) through to the detailed finite element method analysis and verification phase. The book is based on the GARTEUR Research Project AG-32, which ran from 2007 to 2012, and documents the main results of that project. In addition, the state of the art in European projects on damage evolution in composites is reviewed. While the high specific strength and stiffness of composite materials make them suitable for aerospace structures, their sensitivity to damage means that designing with composites is a challenging task. The new approaches describ...

  12. Nerve growth factor-induced accumulation of PC12 cells expressing cyclin D1: evidence for a G1 phase block.

    Science.gov (United States)

    van Grunsven, L A; Thomas, A; Urdiales, J L; Machenaud, S; Choler, P; Durand, I; Rudkin, B B

    1996-02-15

    The anti-proliferative effect of nerve growth factor (NGF) on the rat pheochromocytoma cell line PC12 has been previously shown to be accompanied by the accumulation of cells in either the G1 phase with a 2c DNA content, or with a 4c DNA content characteristic for G2/M, as evidenced by flow cytometric analysis of DNA distribution using propidium iodide. Herein, these apparently conflicting results are clarified. The present studies indicate that a simple DNA distribution profile obtained by this technique can confound interpretation of the biological effects of NGF on cell-cycle distribution due to the presence of tetraploid cells. Using cyclin D1 and incorporation of bromodeoxyuridine as markers of respectively, G1 and S phase, we show that PC12 cultures can have a considerable amount of tetraploid cells which, when in the G1 phase, have a 4c DNA content and express cyclin D1. During exposure to NGF, this population increases, reflecting the accumulation of cells in the G1 phase of the cell cycle. The data presented, support the possibility that events affecting the expression or action of G1 regulatory proteins may be involved in the molecular mechanism of the anti-mitogenic effect of NGF.

  13. Phase I study of transforming growth factor-beta 3 mouthwashes for prevention of chemotherapy-induced mucositis

    NARCIS (Netherlands)

    Wymenga, ANM; van der Graaf, WTA; Hofstra, LS; Spijkervet, FKL; Timens, W; Timmer-Bosscha, H; Sluiter, WJ; van Buuren, AHJAW; Mulder, NH; de Vries, EGE

    The purpose of this study was to establish the safety and tolerability of recombinant transforming growth factor-beta 3 (TGF-beta 3; CGP 46614) mouthwashes intended for prevention of chemotherapy-induced mucositis. Local effects were especially analyzed by objective and subjective measurements of

  14. Bacterial growth during the early phase of infection determines the severity of experimental Escherichia coli mastitis in dairy cows

    NARCIS (Netherlands)

    Kornalijnslijper, J.E.; Daemen, A.; Werven, van T.; Niewold, T.A.; Rutten, V.; Noordhuizen-Stassen, E.N.

    2004-01-01

    The aim of this study was to investigate the importance of bacterial growth for the severity of experimental Escherichia coli mastitis, indirectly expressed as the area under the curve of bacterial counts in milk over time. The association of pre-infusion somatic cell count and post-infusion influx

  15. SHORT-ROOT and SCARECROW regulate leaf growth in Arabidopsis by stimulating S-phase progression of the cell cycle.

    NARCIS (Netherlands)

    S. Dhondt; F. Coppens; F. de Winter; K. Swarup; R.M.H. Merks (Roeland); D. Inze; M.J. Bennett; G.T.S. Beemster

    2010-01-01

    htmlabstractSHORT-ROOT (SHR) and SCARECROW (SCR) are required for stem cell maintenance in the Arabidopsis (Arabidopsis thaliana) root meristem, ensuring its indeterminate growth. Mutation of SHR and SCR genes results in disorganization of the quiescent center and loss of stem cell activity,

  16. Growth Rate Determination through Automated TEM Image Analysis : Crystallization Studies of Doped SbTe Phase-Change Thin Films

    NARCIS (Netherlands)

    Oosthoek, Jasper L. M.; Kooi, Bart J.; De Hosson, Jeff T. M.; Wolters, Rob A. M.; Gravesteijn, Dirk J.; Attenborough, Karen

    A computer-controlled procedure is outlined here that first determines the position of the amorphous-crystalline interface in an image. Subsequently, from a time series of these images, the velocity of the crystal growth front is quantified. The procedure presented here can be useful for a wide

  17. Growth rate determination through automated TEM image analysis: crystallization studies of doped SbTe phase-change thin films

    NARCIS (Netherlands)

    Oosthoek, Jasper L.M.; Kooi, B.J.; de Hosson, Jeff T.M.; Wolters, Robertus A.M.; Gravesteijn, Dirk J; Gravesteijn, Dirk J.; Attenborough, Karen

    2010-01-01

    A computer-controlled procedure is outlined here that first determines the position of the amorphous-crystalline interface in an image. Subsequently, from a time series of these images, the velocity of the crystal growth front is quantified. The procedure presented here can be useful for a wide

  18. Seasonal and life-phase related differences in growth in Scarus ferrugineus on a southern Red Sea fringing reef

    NARCIS (Netherlands)

    Afeworki, Y.; Videler, J. J.; Berhane, Y. H.; Bruggemann, J. H.

    Temporal trends in growth of the rusty parrotfish Scarus ferrugineus were studied on a southern Red Sea fringing reef that experiences seasonal changes in environmental conditions and benthic algal resources. Length increment data from tagging and recapture were compared among periods and sexes and

  19. Investigating late-onset ADHD

    DEFF Research Database (Denmark)

    Cooper, Miriam; Hammerton, Gemma; Collishaw, Stephan

    2018-01-01

    BACKGROUND: Adult ADHD has been assumed to be a continuation of childhood-onset ADHD. However, recent studies have identified individuals with ADHD in adulthood who have not had ADHD in childhood. Whether or not these individuals have a 'typical' neurodevelopmental profile is not clear. METHODS: We...... tested two explanations for the emergence of apparent late-onset ADHD symptomatology using the ALSPAC epidemiological cohort, by grouping individuals according to their scores on the Strengths and Difficulties Questionnaire (SDQ) hyperactivity subscale at ages 12 and 17 years. First, we tested whether...... some of those with apparent late-onset ADHD symptoms had been potentially misclassified on the basis of earlier SDQ hyperactivity scores (ages 7, 8 and 9 years) or of subthreshold symptoms at age 12 years. Second, we investigated the possibility that those with 'genuine' late-onset ADHD symptoms had...

  20. Effect of benzalkonium chloride on viability and energy metabolism in exponential- and stationary-growth-phase cells of Listeria monocytogenes

    NARCIS (Netherlands)

    Luppens, S.B.I.; Abee, T.; Oosterom, J.

    2001-01-01

    The difference in killing exponential- and stationary-phase cells of Listeria monocytogenes by benzalkonium chloride (BAC) was investigated by plate counting and linked to relevant bioenergetic parameters. At a low concentration of BAC (8 mg liter-1), a similar reduction in viable cell numbers was

  1. In situ growth of capping-free magnetic iron oxide nanoparticles on liquid-phase exfoliated graphene

    NARCIS (Netherlands)

    Tsoufis, T.; Syrgiannis, Z.; Akhtar, N.; Prato, M.; Katsaros, F.; Sideratou, Z.; Kouloumpis, A.; Gournis, D.; Rudolf, P.

    2015-01-01

    We report a facile approach for the in situ synthesis of very small iron oxide nanoparticles on the surface of high-quality graphene sheets. Our synthetic strategy involved the direct, liquid-phase exfoliation of highly crystalline graphite (avoiding any oxidation treatment) and the subsequent

  2. The liquid phase epitaxy method for the construction of oriented ZIF-8 thin films with controlled growth on functionalized surfaces

    KAUST Repository

    Shekhah, Osama

    2013-01-01

    Highly-oriented ZIF-8 thin films with controllable thickness were grown on an -OH-functionalized Au substrate using the liquid phase epitaxy method at room temperature, as evidenced by SEM and PXRD. The adsorption-desorption properties of the resulting ZIF-8 thin film were investigated for various VOCs using the QCM technique. © The Royal Society of Chemistry 2013.

  3. A comparison of pubertal maturity and growth.

    Science.gov (United States)

    Gasser, Theo; Molinari, Luciano; Largo, Remo

    2013-07-01

    Growth and pubertal development have each been studied in detail, but rarely in conjunction. The study aim was to determine what somatic and pubertal development have in common and how they differ and to quantify the association between milestones for growth and for pubertal development (in terms of pubic hair and genitalia/breast, Age of Peak Testes Velocity, APTV and menarche) in relation both to chronological (CA) and bone age (RUS). The data analysed are from the 1st Zurich Longitudinal Growth Study, with 120 boys and 112 girls with almost complete data from birth to adulthood. Variability of pubertal milestones was somewhat reduced in terms of RUS, in particular in later phases. Pubic hair phase PH2 appeared ∼1 year after the onset of the pubertal spurt. Around the age of maximal deceleration (T9) an adult-like appearance of pubic hair, genitalia and breasts was reached in most cases. APTV occurred close to T8. Correlations were large between milestones for growth and PH stages and also with menarche or APTV. A successful modelling of testis growth led to a new pubertal milestone, APTV. The high correlations between the phenomenologically different domains "linear growth" and "pubertal development", and the high correlations between RUS and linear growth previously established allow the conclusion that these different domains develop along similar biological mechanisms, which are steered mainly by genetic factors.

  4. Juvenile-onset hypothyroidism in a dog

    International Nuclear Information System (INIS)

    Greco, D.S.; Peterson, M.E.; Cho, D.Y.; Markovits, J.E.

    1985-01-01

    Juvenile-onset hypothyroidism was diagnosed in an adult mixed-breed dog examined because of quadraparesis. Unusual clinical signs attributable to juvenile-onset or congenital hypothyroidism included disproportionate dwarfism; enlarged, protruding tongue; mental dullness; and retention of a 'puppy' coat, which was soft and fluffy, without guard hairs. Radiography of the vertebral column and long bones revealed multiple areas of delayed epiphyseal closure and epiphyseal dysgenesis. Myelography demonstrated several intervertebral disk protrusions in the cervical and lumbar regions. Hypothyroidism was confirmed on the basis of a low basal serum thyroxine concentration that failed to increase after the administration of thyroid stimulating hormone. Other laboratory abnormalities included nonregenerative, normocytic, normochromic anemia; mild hypercalcemia; and an impaired growth hormone (GH) secretory response after xylazine administration. At necropsy, the thyroid gland was small and weighed only 0.2g. Microscopic examination of the thyroid gland revealed a loss of glandular tissue, which was replaced by adipose tissue along its periphery. Gross or microscopic abnormalities were not noted in the pituitary gland, and immunohistochemical staining of the pituitary gland revealed a normal number of GH-containing acidophils. This suggests that primary hypothyroidism may result in an impaired secretion of growth hormone, and that pituitary dwarfism or GH deficiency may be difficult to differentiate from hypothyroid dwarfism on the basis of provocative GH testing alone

  5. AtLSG1-2 Regulates Leaf Growth by Affecting Cell Proliferation and the Onset of Endoreduplication and Synergistically Interacts with AtNMD3 during Cell Proliferation Process

    KAUST Repository

    Zhao, Huayan

    2017-03-10

    AtLSG1-2 is a circularly permuted GTPase required for ribosome biogenesis and recently shown to be involved in early leaf development, although it was unclear how AtLSG1-2 affects leaf growth. Here, we found that atlsg1-2 mutants had reduced leaf size as a result of decreased cell size and cell number. Leaf kinematic analysis and CYCB1;1

  6. Entrepreneurship in the knowledge-intensive sector: Influential factors at the start-up and early growth phase

    DEFF Research Database (Denmark)

    Madsen, Henning; Neergaard, Helle; Fisker, Sannie

    The importance of SMEs for economic growth and employment has long been recognised, although the entrepreneurial activity in SMEs has not been understood all that well. In the light of this, a better understanding of entrepreneurs and their local environment might be helpful, since these are usua......The importance of SMEs for economic growth and employment has long been recognised, although the entrepreneurial activity in SMEs has not been understood all that well. In the light of this, a better understanding of entrepreneurs and their local environment might be helpful, since...... these are usually key factors in the discovery and exploitation of new opportunities. In order to research this situation into more details, a framework taking into account aspects of social, human and financial capita has been developed. Therefore, the purpose of this paper is to address the influence...

  7. Organelle-cytoskeleton relationships in fibroblasts: mitochondria, Golgi apparatus, and endoplasmic reticulum in phases of movement and growth

    DEFF Research Database (Denmark)

    Couchman, J R; Rees, D A

    1982-01-01

    . As the fibroblasts cease locomotion and adapt to growth, however, the mitochondria become dispersed through the cytoplasm and clearly codistributed with the microtubules and centrioles but not with microfilament bundles or 10 nm filaments. This rearrangement occurs in concert with the other changes we have shown...... previously - including the development of pronounced microfilament bundles and of stable and well-defined focal adhesions - and appears to be related to changes in the motility status of the cells rather than to alterations in growth or synthetic capability. Mitochondrial mobility is strongly reduced...... by the actions of both colchicine and dihydrocytochalasin B showing that orientation and translocation depend on a co-ordinate interaction of microtubules and microfilamentous meshwork around the centrioles as origin. The Golgi apparatus and endoplasmic reticulum do not rearrange dramatically during...

  8. Influence of the volume-contact area ratio on the growth behavior of the Cu-Sn intermetallic phase

    Science.gov (United States)

    Giddaluri, Venkatakamakshi Supraja

    Solder Joints play a very important role in electronic packaging industry by serving as mechanical support and provides integrity to the device. The increasing demand for high performance, environmental and economic feasibility and miniaturization led to the development of high density interconnects. With the reduction in the size/standoff height of the solder reliability issues in the surface mount assemblies and packaging structures under various rigorous environments are becoming significant. One of the most important impact factors that affect the solder joint reliability is the growth rate IMC formed between the solder and substrate with reduction in joint size. IMC formation is required to ensure good bonding and connectivity of the device in packaging. However excess IMC growth rate is detrimental to the device from mechanical aspects due to its brittle nature. Thus there is a need to study effect the IMC growth rate behavior with the solder joint size/standoff height. In this present study, two solder joints of different standoff heights and same composition (pure Sn solder) are used subjected to reflow process at 270°C for 1--7 min to study solid liquid interfacial reaction on joint size and the same experiment is repeated with SAC alloy of composition (96.5% Sn, 3.0% Ag, 0.5% Cu) to investigate the effect of joint size and initial copper concentration on IMC growth rate. The IMC thickness of the Sn 15microm solder joint at 1 min and 7 min is found to be 1.52microm and 2.86microm respectively while that of Sn 150microm solder joint is 1.31microm and 3.16 microm. The thickness is high in low standoff height sample at the early stage of reaction with decrease in IMC growth rate as the time of reflow increases. In case of 25microm SAC alloy solder joint the IMC thickness from 1 and 7 min is found to be 2.1microm and 3.5microm while that of 250microm SAC alloy solder joint its 1.43microm and3.235microm. Similar trend is observed but the IMC thickness is more

  9. PIXE and RBS investigation of growth phases of ultra-thin chemical bath deposited CdS films

    International Nuclear Information System (INIS)

    Duncan, P.C.; Hinckley, S.; Gluszak, E.A.; Dytlewski, N.

    2002-01-01

    Polycrystalline CdS films, with thicknesses typically 20-180 nm, have been chemically deposited on glass substrates using an ammonia-cadmium-thiourea reaction solution. Film elemental composition, thickness and microstructure have been examined using proton-induced X-ray emission, Rutherford backscattering and atomic force microscopy. Analysis indicates that the stability of the deposition temperature plays a critical role in CdS film growth and composition. Films deposited with high temperature stability (60±0.5 deg. C) show a consistent 1:1 Cd:S atomic ratio for all stages of film growth, and have good substrate adhesion. Films deposited with lower temperature stability (60±4 deg. C) show initial high S concentrations, followed by a rapid increase in Cd concentration, until a final 1.2:1 Cd:S ratio is achieved. A mechanism is proposed to explain this difference in film composition and properties

  10. Linking atmospheric synoptic transport, cloud phase, surface energy fluxes, and sea-ice growth: observations of midwinter SHEBA conditions

    Science.gov (United States)

    Persson, P. Ola G.; Shupe, Matthew D.; Perovich, Don; Solomon, Amy

    2017-08-01

    Observations from the Surface Heat Budget of the Arctic Ocean (SHEBA) project are used to describe a sequence of events linking midwinter long-range advection of atmospheric heat and moisture into the Arctic Basin, formation of supercooled liquid water clouds, enhancement of net surface energy fluxes through increased downwelling longwave radiation, and reduction in near-surface conductive heat flux loss due to a warming of the surface, thereby leading to a reduction in sea-ice bottom growth. The analyses provide details of two events during Jan. 1-12, 1998, one entering the Arctic through Fram Strait and the other from northeast Siberia; winter statistics extend the results. Both deep, precipitating frontal clouds and post-frontal stratocumulus clouds impact the surface radiation and energy budget. Cloud liquid water, occurring preferentially in stratocumulus clouds extending into the base of the inversion, provides the strongest impact on surface radiation and hence modulates the surface forcing, as found previously. The observations suggest a minimum water vapor threshold, likely case dependent, for producing liquid water clouds. Through responses to the radiative forcing and surface warming, this cloud liquid water also modulates the turbulent and conductive heat fluxes, and produces a thermal wave penetrating into the sea ice. About 20-33 % of the observed variations of bottom ice growth can be directly linked to variations in surface conductive heat flux, with retarded ice growth occurring several days after these moisture plumes reduce the surface conductive heat flux. This sequence of events modulate pack-ice wintertime environmental conditions and total ice growth, and has implications for the annual sea-ice evolution, especially for the current conditions of extensive thinner ice.

  11. Modelling of biofilm growth and its influence on CO2 and water (two-phase) flow in porous media

    OpenAIRE

    Ebigbo, Anozie

    2009-01-01

    Bacterial biofilms are groups of microbial cells attached to surfaces and to each other. Cells in a biofilm are protected from adverse external conditions. In natural environments, this attached mode of growth is more successful than the suspended mode, and a major portion of microbial activity takes place at surfaces. In porous media, biofilms are used as bioreactors (e.g, in wastewater treatment) and as biobarriers (e.g., in enhanced oil recovery). They are also used in the containment and ...

  12. The exposure of nonsmoking and smoking mothers to environmental tobacco smoke during different gestational phases and fetal growth

    Czech Academy of Sciences Publication Activity Database

    Dejmek, Jan; Solanský, I.; Peterková, Kateřina; Šrám, Radim

    2002-01-01

    Roč. 110, č. 6 (2002), s. 601-606 ISSN 0091-6765 R&D Projects: GA MŽP SI/340/1/97; GA MŽP SI/340/2/00 Institutional research plan: CEZ:AV0Z5039906 Keywords : active smoking * passive smoking * fetal growth Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 3.452, year: 2002

  13. Growth of a Copper-Gold Alloy Phase by Bulk Copper Electrodeposition on Gold Investigated by In Situ STM

    DEFF Research Database (Denmark)

    Andersen, Jens Enevold Thaulov; Møller, Per

    1995-01-01

    the potential in the double-layer charging region from 500 to -100 mV and back to 500 mV at a sweep rate of 1 mV/s in an acidified copper sulfate electrolyte (0.01M H2SO4, 0.01M CuSO4, and Millipore water). After completion of the first cycle the gold surface had recrystallized and nuclei of an alloy phase were...... in peak potential for the anodic current transient from E = 20 mV to E = -2 mV was observed after completion of four subsequent cycles of copper electrodeposition/dissolution. The shift is suggested to be equal to the change in potential of the working electrode owing to the formation of the alloy phase....

  14. The novel mutation K87E in ribosomal protein S12 enhances protein synthesis activity during the late growth phase in Escherichia coli.

    Science.gov (United States)

    Hosaka, T; Tamehiro, N; Chumpolkulwong, N; Hori-Takemoto, C; Shirouzu, M; Yokoyama, S; Ochi, K

    2004-04-01

    Resistance to streptomycin in bacterial cells often results from a mutation in the rpsL gene that encodes the ribosomal protein S12. We found that a particular rpsL mutation (K87E), newly identified in Escherichia coli, causes aberrant protein synthesis activity late in the growth phase. While protein synthesis decreased with age in cells in the wild-type strain, it was sustained at a high level in the mutant, as determined using living cells. This was confirmed using an in vitro protein synthesis system with poly(U) and natural mRNAs (GFP mRNA and CAT mRNA). Other classical rpsL mutations (K42N and K42T) tested did not show such an effect, indicating that this novel characteristic is typical of ribosomes bearing the K87E mutant form of S12, although the K87E mutation conferred the streptomycin resistance and error-restrictive phenotypes also seen with the K42N and K42T mutations. The K87E (but not K42N or K42T) mutant ribosomes exhibited increased stability of the 70S complex in the presence of low concentrations of magnesium. We propose that the aberrant activation of protein synthesis at the late growth phase is caused by the increased stability of the ribosome.

  15. Gingival crevicular fluid alkaline phosphatase activity in relation to pubertal growth spurt and dental maturation: A multiple regression study

    OpenAIRE

    Perinetti, G.; Contardo, L.

    2016-01-01

    Introduction: The identification of the onset of the pubertal growth spurt has major clinical implications when dealing with orthodontic treatment in growing subjects. Aim: Through multivariate methods, this study evaluated possible relationships between the gingival crevicular fluid (GCF) alkaline phosphatase (ALP) activity and pubertal growth spurt and dentition phase. Materials and methods: One hundred healthy growing subjects (62 females, 38 males; mean age, 11.5±2.4 years) were enr...

  16. Differential expression of myogenic regulatory factor MyoD in pacu skeletal muscle (Piaractus mesopotamicus Holmberg 1887: Serrasalminae, Characidae, Teleostei) during juvenile and adult growth phases.

    Science.gov (United States)

    de Almeida, Fernanda Losi Alves; Carvalho, Robson Francisco; Pinhal, Danillo; Padovani, Carlos Roberto; Martins, Cesar; Dal Pai-Silva, Maeli

    2008-12-01

    Skeletal muscle is the edible part of the fish. It grows by hypertrophy and hyperplasia, events regulated by differential expression of myogenic regulatory factors (MRFs). The study of muscle growth mechanisms in fish is very important in fish farming development. Pacu (Piaractus mesopotamicus) is one of the most important food species farmed in Brazil and has been extensively used in Brazilian aquaculture programs. The aim of this study was to analyze hyperplasia and hypertrophy and the MRF MyoD expression pattern in skeletal muscle of pacu (P. mesopotamicus) during juvenile and adult growth stages. Juvenile (n=5) and adult (n=5) fish were anaesthetized, sacrificed, and weight (g) and total length (cm) determined. White dorsal region muscle samples were collected and immersed in liquid nitrogen. Transverse sections (10 microm thick) were stained with Haematoxilin-Eosin (HE) for morphological and morphometric analysis. Smallest fiber diameter from 100 muscle fibers per animal was calculated in each growth phase. These fibers were grouped into three classes (50 microm) to evaluate hypertrophy and hyperplasia in white skeletal muscle. MyoD gene expression was determined by semi-quantitative RT-PCR. PCR products were cloned and sequenced. Juvenile and adult pacu skeletal muscle had similar morphology. The large number of <20 microm diameter muscle fibers observed in juvenile fish confirms active hyperplasia. In adult fish, most fibers were over 50 microm diameter and denote more intense muscle fiber hypertrophy. The MyoD mRNA level in juveniles was higher than in adults. A consensus partial sequence for MyoD gene (338 base pairs) was obtained. The Pacu MyoD nucleotide sequence displayed high similarity among several vertebrates, including teleosts. The differential MyoD gene expression observed in pacu white muscle is possibly related to differences in growth patterns during the phases analyzed, with hyperplasia predominant in juveniles and hypertrophy in adult fish

  17. Fundamentals of MOF Thin Film Growth via Liquid-Phase Epitaxy: Investigating the Initiation of Deposition and the Influence of Temperature.

    Science.gov (United States)

    Ohnsorg, Monica L; Beaudoin, Christopher K; Anderson, Mary E

    2015-06-09

    Thin films can integrate the versatility and great potential found in the emerging field of metal-organic frameworks directly into device architectures. For fabrication of smart interfaces containing surface-anchored metal-organic frameworks, it is important to understand how the foundational layers form to create the interface between the underlying substrate and porous framework. Herein, the formation and morphology of the first ten cycles of film deposition are investigated for the well-studied HKUST-1 system. Effects of processing variables, such as deposition temperature and substrate quality, are studied. Sequences of scanning probe microscopy images collected after cycles of alternating solution-phase deposition reveal the formation of a discontinuous surface with nucleating and growing crystallites consistent with a Volmer-Weber growth mechanism. Quantitative image analysis determines surface roughness and surface coverage as a function of deposition cycles, producing insight regarding growth and structure of foundational film layers. For carboxylic acid terminated self-assembled monolayers on gold, preferred crystal orientation is influenced by deposition temperature with crystal growth along [100] observed at 25 °C and [111] favored at 50 °C. This difference in crystal orientation results in reduced surface roughness and increased surface coverage at 50 °C. To properly fabricate and fully determine the potential of this material for industrial applications, fundamental understanding of film formation is crucial.

  18. Misinterpretation of Gram Stain from the Stationary Growth Phase of Positive Blood Cultures forBrucellaandAcinetobacterSpecies.

    Science.gov (United States)

    Bazzi, Ali M; Al-Tawfiq, Jaffar A; Rabaan, Ali A

    2017-01-01

    Acinetobacter baumannii and Brucella species are Gram-negative organisms that are vulnerable to misinterpretation as Gram-positive or Gram-variable in blood cultures. We assess the random errors in gram stain interpretation to reduce the likelihood of such errors and therefore patient harm. Aerobic and anaerobic blood cultures from two patients in an acute care facility in Saudi Arabia were subjected to preliminary Gram-staining. In case 1, VITEK-2 Anaerobe Identification, repeat Gram staining from a blood agar plate, Remel BactiDrop™ Oxidase test, Urea Agar urease test and real-time PCR were used to confirm presence of Brucella and absence of Coryneform species. In case 2, repeat Gram- staining from the plate and the vials, VITEK-2 Gram-Negative Identification, real-time PCR and subculture on to Columbia agar, blood agar, and MacConkey agar were carried out to identify A. baumannii . In case 1, initially pleomorphic Gram-positive bacteria were identified. Coryneform species were suspected. Tiny growth was observed after 24 h on blood agar plates, and good growth by 48 h. Presence of Brucella species was ultimately confirmed. In case 2, preliminary Gram-stain results suggested giant Gram-positive oval cocci. Further testing over 18-24 h identified A. baumannii . Oxidase test from the plate and urease test from the culture vial is recommended after apparent identification of pleomorphic Gram-positive bacilli from blood culture, once tiny growth is observed, to distinguish Brucella from Corynebacterium species. If giant Gram-positive oval cocci are indicated by preliminary Gram-staining, it is recommended that the Gram stain be repeated from the plate after 4-6 h, or culture should be tested in Triple Sugar Iron (TSI) medium and the Gram stain repeated after 2-4 h incubation.

  19. Effect of Various Lengths of Single Phase Starvation on Compensatory Growth in Rainbow Trout under Summer Conditions (Oncorhynchus mykiss)

    OpenAIRE

    Sevgili, Hüseyin; Hoşsu, * Belgin; Emre, Yılmaz; Kanyılmaz, Mahir

    2013-01-01

    This study was conducted to determine the effects of various lengths of starvation periods on following compensatory growth (CG) in rainbow trout under summer conditions (18.1°C and day length of 12.5-14.5 hours). Five treatments with triplicate tanks were as follows: control (C) fed to satiation over 84 days; one (S1), two (S2), three (S3), and four (S4) weeks of starvation; and then refeeding for the remaining eight weeks of the experiment. Starvation periods induced hyperphagia during refe...

  20. Nurse’s A-Phase Material Enhance Adhesion, Growth and Differentiation of Human Bone Marrow-Derived Stromal Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Ruben Rabadan-Ros

    2017-03-01

    Full Text Available The purpose of this study was to evaluate the bioactivity and cell response of a well-characterized Nurse’s A-phase (7CaO·P2O5·2SiO2 ceramic and its effect compared to a control (tissue culture polystyrene-TCPS on the adhesion, viability, proliferation, and osteogenic differentiation of ahMSCs in vitro. Cell proliferation (Alamar Blue Assay, Alizarin Red-S (AR-s staining, alkaline phosphatase (ALP activity, osteocalcin (OCN, and collagen I (Col I were evaluated. Also, field emission scanning electron microscopy (FESEM images were acquired in order to visualise the cells and the topography of the material. The proliferation of cells growing in a direct contact with the material was slower at early stages of the study because of the new environmental conditions. However, the entire surface was colonized after 28 days of culture in growth medium (GM. Osteoblastic differentiation markers were significantly enhanced in cells growing on Nurse’s A phase ceramic and cultured with osteogenic medium (OM, probably due to the role of silica to stimulate the differentiation of ahMSCs. Moreover, calcium nodules were formed under the influence of ceramic material. Therefore, it is predicted that Nurse’s A-phase ceramic would present high biocompatibility and osteoinductive properties and would be a good candidate to be used as a biomaterial for bone tissue engineering.

  1. Safety and durability of effect of contralateral-eye administration of AAV2 gene therapy in patients with childhood-onset blindness caused by RPE65 mutations: a follow-on phase 1 trial.

    Science.gov (United States)

    Bennett, Jean; Wellman, Jennifer; Marshall, Kathleen A; McCague, Sarah; Ashtari, Manzar; DiStefano-Pappas, Julie; Elci, Okan U; Chung, Daniel C; Sun, Junwei; Wright, J Fraser; Cross, Dominique R; Aravand, Puya; Cyckowski, Laura L; Bennicelli, Jeannette L; Mingozzi, Federico; Auricchio, Alberto; Pierce, Eric A; Ruggiero, Jason; Leroy, Bart P; Simonelli, Francesca; High, Katherine A; Maguire, Albert M

    2016-08-13

    Safety and efficacy have been shown in a phase 1 dose-escalation study involving a unilateral subretinal injection of a recombinant adeno-associated virus (AAV) vector containing the RPE65 gene (AAV2-hRPE65v2) in individuals with inherited retinal dystrophy caused by RPE65 mutations. This finding, along with the bilateral nature of the disease and intended use in treatment, prompted us to determine the safety of administration of AAV2-hRPE65v2 to the contralateral eye in patients enrolled in the phase 1 study. In this follow-on phase 1 trial, one dose of AAV2-hRPE65v2 (1.5 × 10(11) vector genomes) in a total volume of 300 μL was subretinally injected into the contralateral, previously uninjected, eyes of 11 children and adults (aged 11-46 years at second administration) with inherited retinal dystrophy caused by RPE65 mutations, 1.71-4.58 years after the initial subretinal injection. We assessed safety, immune response, retinal and visual function, functional vision, and activation of the visual cortex from baseline until 3 year follow-up, with observations ongoing. This study is registered with ClinicalTrials.gov, number NCT01208389. No adverse events related to the AAV were reported, and those related to the procedure were mostly mild (dellen formation in three patients and cataracts in two). One patient developed bacterial endophthalmitis and was excluded from analyses. We noted improvements in efficacy outcomes in most patients without significant immunogenicity. Compared with baseline, pooled analysis of ten participants showed improvements in mean mobility and full-field light sensitivity in the injected eye by day 30 that persisted to year 3 (mobility p=0.0003, white light full-field sensitivity p0.49 for all time-points compared with baseline). To our knowledge, AAV2-hRPE65v2 is the first successful gene therapy administered to the contralateral eye. The results highlight the use of several outcome measures and help to delineate the variables that

  2. Temperature and water stress during conditioning and incubation phase affecting Orobanche crenata seed germination and radicle growth

    Directory of Open Access Journals (Sweden)

    JUAN eMORAL

    2015-06-01

    Full Text Available Orobanche crenata is a holoparasitic plant that is potentially devastating to crop yield of legume species. Soil temperature and humidity are known to affect seed germination, however, the extent of their influence on germination and radicle growth of those of O. crenata is largely unknown. In this work, we studied the effects of temperature, water potential (Ψt and the type of water stress (matric or osmotic on O. crenata seeds during conditioning and incubation periods. We found that seeds germinated between 5 and 30ºC during both periods, with a maximum around 20ºC. Germination increased with increasing Ψt from -1.2 to 0 MPa during conditioning and incubation periods. Likewise, seed germination increased logarithmically with length of conditioning period until 40 days. The impact of the type of water stress on seed germination was similar, although the radicle growth of seeds under osmotic stress was lower than under matric stress, what could explain the lowest infestation of Orobanche spp. in regions characterized by saline soil. The data in this study will be useful to forecast infection of host roots by O. crenata.

  3. Temperature and water stress during conditioning and incubation phase affecting Orobanche crenata seed germination and radicle growth.

    Science.gov (United States)

    Moral, Juan; Lozano-Baena, María Dolores; Rubiales, Diego

    2015-01-01

    Orobanche crenata is a holoparasitic plant that is potentially devastating to crop yield of legume species. Soil temperature and humidity are known to affect seed germination, however, the extent of their influence on germination and radicle growth of those of O. crenata is largely unknown. In this work, we studied the effects of temperature, water potential (Ψt) and the type of water stress (matric or osmotic) on O. crenata seeds during conditioning and incubation periods. We found that seeds germinated between 5 and 30°C during both periods, with a maximum around 20°C. Germination increased with increasing Ψt from -1.2 to 0 MPa during conditioning and incubation periods. Likewise, seed germination increased logarithmically with length of conditioning period until 40 days. The impact of the type of water stress on seed germination was similar, although the radicle growth of seeds under osmotic stress was lower than under matric stress, what could explain the lowest infestation of Orobanche sp. in regions characterized by saline soil. The data in this study will be useful to forecast infection of host roots by O. crenata.

  4. STAT5 Activation in the Dermal Papilla Is Important for Hair Follicle Growth Phase Induction.

    Science.gov (United States)

    Legrand, Julien M D; Roy, Edwige; Ellis, Jonathan J; Francois, Mathias; Brooks, Andrew J; Khosrotehrani, Kiarash

    2016-09-01

    Hair follicles are skin appendages that undergo periods of growth (anagen), regression (catagen), and rest (telogen) regulated by their mesenchymal component, the dermal papilla (DP). On the basis of the reports of its specific expression in the DP, we investigated signal transducer and activator of transcription (STAT5) activation during hair development and cycling. STAT5 activation in the DP began in late catagen, reaching a peak in early anagen before disappearing for the rest of the cycle. This was confirmed by the expression profile of suppressor of cytokine signaling 2, a STAT5 target in the DP. This pattern of expression starts after the first postnatal hair cycle. Quantification of hair cycling using the Flash canonical Wnt signaling in vivo bioluminescence reporter found that conditional knockout of STAT5A/B in the DP targeted through Cre-recombinase under the control of the Sox18 promoter resulted in delayed anagen entry compared with control. Microarray analysis of STAT5 deletion versus control revealed key changes in tumor necrosis factor-α, Wnt, and fibroblast growth factor ligands, known for their role in inducing anagen entry. We conclude that STAT5 activation acts as a mesenchymal switch to trigger natural anagen entry in postdevelopmental hair follicle cycling. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Effects of selection for fast growth on survival rate during grow-out phase in giant freshwater prawn (Macrobrachium rosenbergii).

    Science.gov (United States)

    Vu, Nguyen Thanh; Trong, Trinh Quoc; Nguyen, Nguyen Hong

    2017-06-21

    Correlated genetic response in survival to selection for high growth has not been reported in giant freshwater prawn (GFP) (Macrobrachium rosenbergii). The main aim of this study was to measure genetic changes and estimate heritability for this character (survival rate) and its genetic associations with body traits in a GFP population selected over eight generations from 2008 to 2015. Statistical analyses were conducted on 106,696 data records, using threshold logistic mixed model. The estimated heritability for survival was 0.14 ± 0.04 and significant. Genetic associations of survival with body traits (weight, length and width) were weak, with the estimates of genetic correlations between the traits close to zero. Realised genetic changes in survival, calculated as the difference in estimated breeding values between the selection line and control group within the same generation, was in positive direction but the estimates were not significantly different from zero regardless of the expression unit used either in actual unit of measurement or genetic standard deviation unit. On the other hand, communal testing of stocks in the latest generation, namely G7 (2015), showed that the selection line had 18% higher survival rate than progeny of the wild prawns originated from Mekong river. This result suggests that inadvertent changes in survival occurred during domestication-selection. It is concluded that selection for high growth had no significant effect on survival in the present population of M. rosenbergii.

  6. Critical issues for homoepitaxial GaN growth by molecular beam epitaxy on hydride vapor-phase epitaxy-grown GaN substrates

    Science.gov (United States)

    Storm, D. F.; Hardy, M. T.; Katzer, D. S.; Nepal, N.; Downey, B. P.; Meyer, D. J.; McConkie, Thomas O.; Zhou, Lin; Smith, David J.

    2016-12-01

    While the heteroepitaxial growth of gallium nitride-based materials and devices on substrates such as SiC, sapphire, and Si has been well-documented, the lack of a cost-effective source of bulk GaN crystals has hindered similar progress on homoepitaxy. Nevertheless, freestanding GaN wafers are becoming more widely available, and there is great interest in growing GaN films and devices on bulk GaN substrates, in order to take advantage of the greatly reduced density of threading dislocations, particularly for vertical devices. However, homoepitaxial GaN growth is far from a trivial task due to the reactivity and different chemical sensitivities of N-polar (0001) and Ga-polar (0001) GaN surfaces, which can affect the microstructure and concentrations of impurities in homoepitaxial GaN layers. In order to achieve high quality, high purity homoepitaxial GaN, it is necessary to investigate the effect of the ex situ wet chemical clean, the use of in situ cleaning procedures, the sensitivity of the GaN surface to thermal decomposition, and the effect of growth temperature. We review the current understanding of these issues with a focus on homoepitaxial growth of GaN by molecular beam epitaxy (MBE) on c-plane surfaces of freestanding GaN substrates grown by hydride vapor phase epitaxy (HVPE), as HVPE-grown substrates are most widely available. We demonstrate methods for obtaining homoepitaxial GaN layers by plasma-assisted MBE in which no additional threading dislocations are generated from the regrowth interface and impurity concentrations are greatly reduced.

  7. Is an onset vortex important for monsoon onset over Kerala?

    Digital Repository Service at National Institute of Oceanography (India)

    RameshKumar, M.R.; Sankar, S.; Reason, C.

    two independent SST data sets. The role of SST, convection, integrated columnar water vapour and the low-level jet in the setting up of the monsoon onset over Kerala (MOK) is examined. It is found that the MOV which forms over the SEAS region upsets...

  8. The 13C/12C fractionation by microbial cells immobilized on a solid-phase carrier during the growth on glucose

    Science.gov (United States)

    Zyakun, Anatoly; Kochetkov, Vladimir

    2010-05-01

    Problem. In microbiological ecology, the level of basal СО2 respiration and the potential of microbial activity defined as substrate-induced respiration (SIR) are used as criteria of the metabolic state of soil microbiota. The peculiar feature of glucose metabolism in soil is its utilization by microbial cells immobilized on soil particles as a solid-phase carrier. The efficiency of substrate utilization and СО2 production in such cases depend on the rate of microorganisms' growth and colonization of the solid-phase carrier surface, where the substrate is located. The products of microbial metabolism are supposed to inherit the substrate isotope composition correct to the isotopic effects accompanying substrate utilization and metabolic transformations. However, all experiments in carbon isotope fractionation during microbial utilization of glucose as a substrate have been carried out with microorganisms growing in liquid media. Objective: Study of the kinetics of glucose utilization as a test substrate during the growth of soil microorganisms immobilized on a solid-phase carrier and ascertainment of peculiarities of the formation of carbon isotope composition of produced metabolic СО2. The objects of research were Pseudomonas aureofaciens BS1393(pBS216) (culture A) and Rhodococcus sp. 3-30 (culture B) as representatives of pseudomonades and rhodococci, which occur in the soils of different genesis and are of defining value in development and implementation of biotechnological schemes for degradation of toxic organic pollutants in the environment. Results and discussion. The cultures under study had different rates of growth on glucose. Specific rates of СО2 production during the growth of cultures A and B on glucose were 0.34 (± 0.05) and 0.078 (± 0.01) μg С-СО2 h-1, respectively. The lag periods of culture (A and B) growth were about 4.3 and 26 h, respectively. Comparison of the lag periods of these representatives of pseudomonades and rhodococci

  9. Effects of AlN nucleation layers on the growth of AlN films using high temperature hydride vapor phase epitaxy

    International Nuclear Information System (INIS)

    Balaji, M.; Claudel, A.; Fellmann, V.; Gélard, I.; Blanquet, E.; Boichot, R.; Pierret, A.

    2012-01-01

    Highlights: ► Growth of AlN Nucleation layers and its effect on high temperature AlN films quality were investigated. ► AlN nucleation layers stabilizes the epitaxial growth of AlN and improves the surface morphology of AlN films. ► Increasing growth temperature of AlN NLs as well as AlN films improves the structural quality and limits the formation of cracks. - Abstract: AlN layers were grown on c-plane sapphire substrates with AlN nucleation layers (NLs) using high temperature hydride vapor phase epitaxy (HT-HVPE). Insertion of low temperature NLs, as those typically used in MOVPE process, prior to the high temperature AlN (HT-AlN) layers has been investigated. The NLs surface morphology was studied by atomic force microscopy (AFM) and NLs thickness was measured by X-ray reflectivity. Increasing nucleation layer deposition temperature from 650 to 850 °C has been found to promote the growth of c-oriented epitaxial HT-AlN layers instead of polycrystalline layers. The growth of polycrystalline layers has been related to the formation of dis-oriented crystallites. The density of such disoriented crystallites has been found to decrease while increasing NLs deposition temperature. The HT-AlN layers have been characterized by X-ray diffraction θ − 2θ scan and (0 0 0 2) rocking curve measurement, Raman and photoluminescence spectroscopies, AFM and field emission scanning electron microscopy. Increasing the growth temperature of HT-AlN layers from 1200 to 1400 °C using a NL grown at 850 °C improves the structural quality as well as the surface morphology. As a matter of fact, full-width at half-maximum (FWHM) of 0 0 0 2 reflections was improved from 1900 to 864 arcsec for 1200 °C and 1400 °C, respectively. Related RMS roughness also found to decrease from 10 to 5.6 nm.

  10. The Masters of Colegio Mayor de la Seda of Valencia in a phase of manufacturing growth (1686-1755

    Directory of Open Access Journals (Sweden)

    Ricardo Franch Benavent

    2014-04-01

    Full Text Available This paper studies the 2.077 new masters who entered in the «colegio del arte mayor de la seda de Valencia» between 1686 and 1755, and reveals the complexity of the evolution experienced by the corporation. Its closure in favor of the craft collective that occurred in response to the difficulties of the seventeenth century was not definitive, since the manufacturing growth at the end of the century favored the admission of candidates from more diverse origin. The increase of fiscal pressure and the influence of mercantilist policy adopted by the monarchy after the end of the War of the Spanish Succession contributed to a new closure of the corporation as to the stricter enforcement of the productive regulation, producing difficulties in the modernization of the Valencian silk industry.

  11. Activity of toluene-degrading Pseudomonas putida in the early growth phase of a biofilm for waste gas treatment

    DEFF Research Database (Denmark)

    Pedersen, A.R.; Møller, S.; Molin, S.

    1997-01-01

    the increase of active biomass and polymers was linear. In order to investigate the toluene degradation, various toluene degraders from the multispecies biofilm were isolated, and a Pseudomonas putida was chosen as a representative of the toluene-degrading population. A specific rRNA oligonucleotide probe...... was used to follow the toluene-degrading P. putida in the multispecies biofilm in the filter by means of number and cellular rRNA content. P. putida appeared to detach from the biofilm during the first three days of growth, after which P. putida was found at a constant level of 10% of the active biomass...... in the biofilm. Based on the rRNA content, the in situ activity was estimated to be reduced to 20% of cells grown at maximum conditions in batch culture. The toluene degraded by P. putida was estimated to be a minor part (11%) of the overall toluene degradation. (C) 1997 John Wiley & Sons, Inc....

  12. MOVPE growth of quaternary (Al,Ga,In)N for UV optoelectronics[Metal Organic Vapor Phase Epitaxy, Ultraviolet

    Energy Technology Data Exchange (ETDEWEB)

    Han, J.; Figiel, J.J.; Petersen, G.A.; Myers, S.M.; Crawford, M.H.; Banas, M.A.; Hearne, S.J.

    2000-07-01

    The authors report the growth and characterization of quaternary AlGaInN. A comparison of photoluminescence (PL), high-resolution x-ray diffraction (XRD), and Rutherford backscattering spectrometry (RBS) characterizations enables one to explore the contours of constant-PL peak energy and lattice parameter as functions of the quaternary compositions. The observation of room temperature PL emission at 351 nm (with 20% Al and 5% In) renders initial evidence that the quaternary could be used to provide confinement for GaInN (and possibly GaN). AlGaInN/GaInN MQW heterostructures have been grown; both XRD and PL measurements suggest the possibility of incorporating this quaternary into optoelectronic devices.

  13. LH pulse frequency and the emergence and growth of ovarian antral follicular waves in the ewe during the luteal phase of the estrous cycle

    Science.gov (United States)

    Seekallu, Srinivas V; Toosi, Behzad M; Rawlings, Norman C

    2009-01-01

    Background In the ewe, ovarian antral follicles emerge or grow from a pool of 2–3 mm follicles in a wave like pattern, reaching greater than or equal to 5 mm in diameter before regression or ovulation. There are 3 or 4 such follicular waves during each estrous cycle. Each wave is preceded by a peak in serum FSH concentrations. The role of pulsatile LH in ovarian antral follicular emergence and growth is unclear; therefore, the purpose of the present study was to further define this role. Methods Ewes (n = 7) were given 200 ng of GnRH (IV) every hour for 96 h from Day 7 of the estrous cycle, to increase LH pulse frequency. Controls (n = 6) received saline. In a second study, ewes (n = 6) received subcutaneous progesterone-releasing implants for 10 days starting on Day 4 of the cycle, to decrease LH pulse frequency. Controls (n = 6) underwent sham surgery. Daily transrectal ovarian ultrasonography and blood sampling was performed on all ewes from the day of estrus to the day of ovulation at the end of the cycle of the study. At appropriate times, additional blood samples were taken every 12 minutes for 6 h and 36 min or 6 h in studies 1 and 2 respectively. Results The largest follicle of the follicular wave growing when GnRH treatment started, grew to a larger diameter than the equivalent wave in control ewes (P ewes (P ewes, suppressed a peak in serum concentrations of FSH, causing a follicular wave to be missed. Treatment with progesterone decreased the frequency of LH pulses but did not have any influence on serum FSH concentrations or follicular waves. Conclusion We concluded that waves of ovarian follicular growth can occur at LH pulse frequencies lower than those seen in the luteal phase of the estrous cycle but frequencies seen in the follicular phase, when applied during the mid-luteal phase, in the presence of progesterone, do enhance follicular growth to resemble an ovulatory follicle, blocking the emergence of the next wave. PMID:19638235

  14. Lithium tantalate single crystal for pyroelectricity-based laser energy-meter: growth, application and phase transition study

    International Nuclear Information System (INIS)

    Bhaumik, Indranil; Ganesamoorthy, S.; Bhatt, R.; Karnal, A.K.; Gupta, P.K.

    2009-01-01

    Single crystals of lithium tantalate have been grown. Dielectric-spectroscopy study reveals phase transition in congruent lithium tantalate (CLT) single crystal is diffusive and frequency dependent in contrast to that in near stoichiometric lithium tantalate where it is sharper. The ac conductivity measurements show that the conductivity is lower for 0.5Mg-SLT as compared to 1.0Mg-SLT. This is explained in terms of a Li-vacancy model. Calculation of activation energy from the lnσ vs. 1000/T plot reveals that hopping of Li + ions becomes difficult for 0.5 Mg-SLT. The pyroelectric response of CLT for pulsed Nd:YAG laser output has been tested. (author)

  15. The effect of phase front deformation on the growth of the filamentation instability in laser–plasma interactions

    International Nuclear Information System (INIS)

    Higson, E; Norreys, P A; Trines, R; Bingham, R; Lancaster, K L; Jiang, J; Davies, J R

    2013-01-01

    Laser pulses of 0.9 kJ/1 ns/1053 nm were focused onto low-Z plastic targets in both spherical and planar geometry. The uniformity of the resulting plasma production was studied using x-ray pinhole imaging. Evidence is provided suggesting that thermal filamentation starts to occur for irradiances on the target of Iλ 2 ⩾ 10 14 W cm −2 μm 2 , even on deployment of phase plates to improve the focal spot spatial uniformity. The experiments are supported by both analytical modelling and two-dimensional particle-in-cell simulations. The implications for the applications of laser–plasma interactions that require high degrees of uniform irradiation are discussed. (paper)

  16. Nutrition and growth

    Energy Technology Data Exchange (ETDEWEB)

    Forbes, G.B.

    1977-07-01

    Longitudinal growth data on children who developed obesity during childhood reveal a distinct tendency for height gain to accelerate coincident with or after the onset of excessive weight gain. The magnitude of the relative height increment is related to the degree of overweight. Overnutrition accelerates growth, just as undernutrition retards it.

  17. Gingival crevicular fluid alkaline phosphatase activity in relation to pubertal growth spurt and dental maturation: A multiple regression study

    Directory of Open Access Journals (Sweden)

    Perinetti, G.

    2016-04-01

    Full Text Available Introduction: The identification of the onset of the pubertal growth spurt has major clinical implications when dealing with orthodontic treatment in growing subjects. Aim: Through multivariate methods, this study evaluated possible relationships between the gingival crevicular fluid (GCF alkaline phosphatase (ALP activity and pubertal growth spurt and dentition phase. Materials and methods: One hundred healthy growing subjects (62 females, 38 males; mean age, 11.5±2.4 years were enrolled into this doubleblind, prospective, cross-sectional-design study. Phases of skeletal maturation (pre - pubertal, pubertal, post - pubertal was assessed using the cervical vertebral maturation method. Samples of GCF for the ALP activity determination were collected at the mesial and distal sites of the mandibular central incisors. The phases of the dentition were recorded as intermediate mixed, late mixed, or permanent. A multinomial multiple logistic regression model was used to assess relationships of the enzymatic activity to growth phases and dentition phases. Results: The GCF ALP activity was greater in the pubertal growth phase as compared to the pre - pubertal and post - pubertal growth phases. Significant adjusted odds ratios for the GCF ALP activity for the pre - pubertal and post - pubertal subjects, in relation to the pubertal group, were 0.76 and 0.84, respectively. No significant correlations were seen for the dentition phase. Conclusions: The GCF ALP activity is a valid candidate as a non - invasive biomarker for the identification of the pubertal growth spurt irrespective of the dentition phase.

  18. Late onset startle induced tics

    NARCIS (Netherlands)

    Tijssen, M. A.; Brown, P.; Morris, H. R.; Lees, A.

    1999-01-01

    Three cases of late onset Gilles de la Tourette's syndrome are presented. The motor tics were mainly induced by an unexpected startling stimulus, but the startle reflex was not exaggerated. The tics developed after physical trauma or a period of undue emotional stress. Reflex tics may occur in

  19. Late onset startle induced tics

    NARCIS (Netherlands)

    Tijssen, MAJ; Brown, P; Morris, HR; Lees, A

    1999-01-01

    Three cases of late onset Gilles de la Tourette's syndrome are presented. The motor ties were mainly induced by an unexpected startling stimulus, but the startle reflex was not exaggerated. The ties developed after physical trauma or a period of undue emotional stress. Reflex ties may occur in

  20. and late onset Alzheimer's disease

    African Journals Online (AJOL)

    Yomi

    2012-03-15

    Mar 15, 2012 ... Alzheimer's disease (AD) is a prevalent disorder and the most common cause of dementia in elderly populations. Genetic and environmental factors together play a role in developing late onset. Alzheimer's disease (LOAD). According to the recent published papers, ACE is one of the candidate.

  1. Catalyst-free growth of millimeter-long topological insulator Bi₂Se₃ nanoribbons and the observation of the π-Berry phase.

    Science.gov (United States)

    Fang, L; Jia, Y; Miller, D J; Latimer, M L; Xiao, Z L; Welp, U; Crabtree, G W; Kwok, W-K

    2012-12-12

    We report the growth of single-crystalline Bi(2)Se(3) nanoribbons with lengths up to several millimeters via a catalyst-free physical vapor deposition method. Scanning transmission electron microscopy analysis reveals that the nanoribbons grow along the (112̅0) direction. We obtain a detailed characterization of the electronic structure of the Bi(2)Se(3) nanoribbons from measurements of Shubnikov-de Haas (SdH) quantum oscillations. Angular dependent magneto-transport measurements reveal a dominant two-dimensional contribution originating from surface states. The catalyst-free synthesis yields high-purity nanocrystals enabling the observation of a large number of SdH oscillation periods and allowing for an accurate determination of the π-Berry phase, one of the key features of Dirac fermions in topological insulators. The long-length nanoribbons open the possibility for fabricating multiple nanoelectronic devices on a single nanoribbon.

  2. Crystal growth and phase diagram of 112-type iron pnictide superconductor Ca1-y La y Fe1-x Ni x As2

    Science.gov (United States)

    Xie, Tao; Gong, Dongliang; Zhang, Wenliang; Gu, Yanhong; Huesges, Zita; Chen, Dongfeng; Liu, Yuntao; Hao, Lijie; Meng, Siqin; Lu, Zhilun; Li, Shiliang; Luo, Huiqian

    2017-09-01

    We report a systematic crystal growth and characterization of Ca1-y La y Fe1-x Ni x As2, the newly discovered 112-type iron-based superconductor. After substituting Fe by a small amount of Ni, bulk superconductivity is successfully obtained in high-quality single crystals sized up to 6 mm. Resistivity measurements indicate common features for transport properties in this 112-type iron pnictide, suggest strong scattering from chemical dopants. Together with the superconducting transition temperature T c , and the Néel temperature T N determined by the elastic neutron scattering, we sketch a three-dimensional phase diagram in the combination of both Ni and La dopings.

  3. In situ growth of capping-free magnetic iron oxide nanoparticles on liquid-phase exfoliated graphene

    Science.gov (United States)

    Tsoufis, T.; Syrgiannis, Z.; Akhtar, N.; Prato, M.; Katsaros, F.; Sideratou, Z.; Kouloumpis, A.; Gournis, D.; Rudolf, P.

    2015-05-01

    We report a facile approach for the in situ synthesis of very small iron oxide nanoparticles on the surface of high-quality graphene sheets. Our synthetic strategy involved the direct, liquid-phase exfoliation of highly crystalline graphite (avoiding any oxidation treatment) and the subsequent chemical functionalization of the graphene sheets via the well-established 1,3-dipolar cycloaddition reaction. The resulting graphene derivatives were employed for the immobilization of the nanoparticle precursor (Fe cations) at the introduced organic groups by a modified wet-impregnation method, followed by interaction with acetic acid vapours. The final graphene-iron oxide hybrid material was achieved by heating (calcination) in an inert atmosphere. Characterization by X-ray diffraction, transmission electron and atomic force microscopy, Raman and X-ray photoelectron spectroscopy gave evidence for the formation of rather small (magnetite-rich nanoparticles which were evenly distributed on the surface of few-layer (nanoparticles, the hybrid material showed a superparamagnetic behaviour at room temperature.We report a facile approach for the in situ synthesis of very small iron oxide nanoparticles on the surface of high-quality graphene sheets. Our synthetic strategy involved the direct, liquid-phase exfoliation of highly crystalline graphite (avoiding any oxidation treatment) and the subsequent chemical functionalization of the graphene sheets via the well-established 1,3-dipolar cycloaddition reaction. The resulting graphene derivatives were employed for the immobilization of the nanoparticle precursor (Fe cations) at the introduced organic groups by a modified wet-impregnation method, followed by interaction with acetic acid vapours. The final graphene-iron oxide hybrid material was achieved by heating (calcination) in an inert atmosphere. Characterization by X-ray diffraction, transmission electron and atomic force microscopy, Raman and X-ray photoelectron spectroscopy

  4. Growth models fitted to Dipturus chilensis length-at-age-data support a two phase growth Modelos de crecimiento ajustados a datos de largo a la edad de Dipturus chilensis confirman un crecimiento en dos fases

    Directory of Open Access Journals (Sweden)

    MARINA I AVERSA

    2011-03-01

    Full Text Available Age and growth for the beaked skate was estimated from bands in the vertebral centra of 689 individuals obtained from incidental catches of the Argentine hake (Merluccius hubbsi fishery. Age bias plots and indices of precision indicated that ageing method was precise and unbiased (% CV = 3 % PA = 82.09 %. Edge and marginal increment analysis of the vertebrae support the hypothesis of annual band pair deposition. Three growth models were fitted to length-at-age and the two-phase growth model produced the best fit. This feature has never been described before for D. chilensis and can be related to changes in energy allocation and the shift from juvenile to adult phase. The unrealistic biological estimates of the von Bertalanffy growth model illustrates the importance of fitting alternative models to the data. Female beaked skates reached greater size in length (L∝ as well as in disc width (L∝ = 138.2 cm; DW∝ = 92.46 cm and have lower growth rate (k = 0.08 yr-1 than males (L∝ = 106.7 cm; DW∝ = 74.52 cm; k = 0.121 yr-1. This study provides basic information on age and growth for the beaked skate, D. chilensis, which were previously not available for its south Atlantic range of distribution.La edad y el crecimiento de la raya picuda fue estimado a partir de las bandas en los cuerpos vertebrales de 689 individuos obtenidos de las capturas incidentales de la pesquería de merluza argentina (Merluccius hubbsi. Gráficos de sesgos y el análisis de precisión indicaron que el método utilizado para la determinación de la edad es preciso y no sesgado (% CV = 3 % PA = 82.09 %. El análisis del tipo de borde e incremento marginal vertebral confirmó la hipótesis del depósito anual de un par de bandas. Se ajustaron tres modelos de crecimiento a los datos de largo a la edad y el modelo de dos fases produjo el mejor ajuste. Esta característica nunca antes fue descripta para Dipturus chilensis y podría relacionarse con un cambio en la cuota de

  5. The Course of Parturition Affects Piglet Condition at Birth and Survival and Growth through the Nursery Phase.

    Science.gov (United States)

    Langendijk, Pieter; Fleuren, Marleen; van Hees, Hubèrt; van Kempen, Theo

    2018-04-24

    The aim of this study was to relate the course of parturition to the condition of piglets at birth, based on umbilical cord blood acid-base values, and relate the condition at birth to neonatal survival and performance up to 10 weeks of life. Data were collected from 37 spontaneous unassisted parturitions, and neonatal performance was based on observations of 516 piglets. Stillbirth rate increased from 2% in the first piglets, to 17% in piglets born 13th in the litter or later. This was aggravated in sows with longer than average stage II of parturition. Umbilical cord blood values also reflected the effect of birth order, with pH decreasing and lactate increasing in the course of parturition. Interestingly, sows that had a long expulsion stage of parturition also took longer to give birth to the first four piglets (r = 0.74), suggesting that sows with complicated parturition were already experiencing problems at the start of expulsion of piglets. Piglets with signs of asphyxia, based on umbilical blood lactate higher than 4.46 mmol/L, were slower to start suckling, had a higher risk of neonatal mortality, and had a slower growth rate over the first 10 weeks of life.

  6. Growth Mechanism and Luminescent Properties of Amorphous SiOx Structures via Phase Equilibrium in Binary System.

    Science.gov (United States)

    Jin, Changhyun; Hwang, Seon Jae; Cho, Myeong Soo; Choi, Sun-Woo; Na, Han Gil; Park, Suyoung; Park, Sungsik; Noh, Youngwook; Jeong, Hakyung; Lee, Dongjin

    2016-08-01

    Balloon whisk-like and flower-like SiOx tubes with well-dispersed Sn and joining countless SiOx loops together induce intense luminescence characteristics in substrate materials. Our synthetic technique called "direct substrate growth" is based on pre-contamination of the surroundings without the intended catalyst and source powders. The kind of supporting material and pressure of the inlet gases determine a series of differently functionalized tube loops, i.e., the number, length, thickness, and cylindrical profile. SiOx tube loops commonly twist and split to best suppress the total energy. Photoluminescence and confocal laser measurements based on quantum confinement effect of the embedded Sn nanoparticles in the SiOx tube found substantially intense emissions throughout the visible range. These new concepts related to the synthetic approach, pre-pollution, transitional morphology, and permeable nanoparticles should facilitate progress in nanoscience with regard to tuning the dimensions of micro-/nanostructure preparations and the functionalization of customized applications.

  7. The German energy policy as a consequence of Fukushima. The scientific discussion between nuclear phase-out and economic growth

    International Nuclear Information System (INIS)

    Radtke, Joerg

    2013-01-01

    The book on the German energy policy as a consequence includes the following contributions: The German energy turnaround - scientific contributions. The energy turnaround in Germany - issue of interdisciplinary science. The transformation of the energy systems as social and technical challenge, - on the need of integrating energy research. Transformations and transformation blockades in the German energy system. The German energy turnaround in the context of international best practice. Energy turnaround also in Japan? - The chances of a nuclear phase-out. Possibilities and limits of public participation for the realization of an energy turnaround. Public energy in Germany - a model for participation? A plea for a comprehensive analysis of the energy turnaround in relation to the omnipresent crisis. Challenges and development in the German energy industry - consequences of the increasing percentage of renewable energies on the costs and the security of supply. Research funding and innovation promotion in the area of selected renewable energies. The economic chances of an energy turnaround. The need of appropriate monetary boundary conditions for the energy turnaround and the possibilities of an organization. The human factor in the context of the energy turnaround - environmental-psychological research approaches. The legal contribution to the energy turnaround. Vulnerability and resilience of energy systems. Geography of renewable energies -spatial constraints of a sustainable energy system. Critics and alternatives: The German energy turnaround that is no turnaround.

  8. Growth behaviors and biocidal properties of titanium dioxide films depending on nucleation duration in liquid phase deposition

    Science.gov (United States)

    Park, Sohyeon; Park, Joohee; Heo, Jiwoong; Hong, Bo Young; Hong, Jinkee

    2017-12-01

    Liquid phase deposition (LPD), which is a method to directly form a titanium dioxide (TiO2) film on a substrate, is the most practical method for applying TiO2 films to medical devices because it is performed at lower temperatures than other methods. The TiO2 films to be applied to medical devices should offer excellent antibacterial effect, but should be stable to normal cells and have appropriate strength. In this research, we observed that the size, shape, and density of TiO2 particles varied with the nucleation duration in LPD and confirmed that these results caused changes in several properties including the mechanical properties, cytotoxicity and antibacterial effect of TiO2 films. From the analysis of these results, we established the conditions for the preparation of TiO2 films that are suitable for medical devices and suggest a new approach to the study of TiO2 films prepared by LPD.

  9. Relationship between thrombophilic disorders and type of severe early-onset hypertensive disorder of pregnancy

    NARCIS (Netherlands)

    Ganzevoort, Wessel; Rep, Annelies; de Vries, Johanna Ip; Bonsel, Gouke J.; Wolf, Hans; Petra-Investigators, For The

    2007-01-01

    OBJECTIVE: To determine whether specific subtypes of early-onset hypertensive disorders of pregnancy (haemolysis, elevated liver enzymes, low platelets [HELLP] syndrome; severe preeclampsia; eclampsia; and fetal growth restriction) differ in increased prevalences of thrombophilic disorders. DESIGN:

  10. Densidade de estocagem de juvenis de tambaqui durante a recria em tanques-rede Stocking density of tambaqui juveniles during second growth phase in cages

    Directory of Open Access Journals (Sweden)

    Franmir Rodrigues Brandão

    2004-04-01

    Full Text Available O objetivo deste trabalho foi determinar a densidade de estocagem mais adequada para a fase de recria de juvenis de tambaqui (Colossoma macropomum em tanque-rede. Foram utilizados 12 tanques-rede de 1 m³ cada, com peixes distribuídos nas densidades de 200, 300, 400 e 500 peixes/m³ em três repetições. Os peixes foram alimentados seis vezes por semana em três refeições diárias com ração comercial com 36% de proteína bruta, durante 60 dias. Foram analisados o crescimento em peso e em comprimento, o coeficiente de variação do comprimento, a taxa de crescimento específico e a glicose sanguínea aos 30 e 60 dias de criação. Ao final do experimento, foram analisados os seguintes parâmetros de produtividade: sobrevivência, conversão alimentar aparente, ganho de peso e produção por área. Os parâmetros físico-químicos da água foram avaliados a cada sete dias. O crescimento em peso e em comprimento, aos 60 dias, foi maior na densidade de 200 peixes/m³ do que na de 500 peixes/m³. O coeficiente de variação, a taxa de crescimento específico e a glicose não diferiram entre as densidades aos 30 e 60 dias. A sobrevivência final, a conversão alimentar aparente e o ganho de peso foram iguais em todas as densidades. A produção por área foi significativamente maior nas duas maiores densidades. Os resultados indicaram que a densidade de 400 peixes/m³ é a mais adequada para recria de juvenis de tambaqui em tanque-rede.The objective of this work was to determine the adequate stocking density to second growth phase of tambaqui (Colossoma macropomum juveniles in cage. Twelve cages of 1 m³ were used to stock fish in four different densities, with three replicate: 200, 300, 400 and 500 fish/m³. Fish were fed with commercial diets with 36% of crude protein six times a week, in three daily meals during 60 days. The growth in weight and in length, coefficient of variation of length, specific growth rate and glucose were analyzed at

  11. Nanoselective area growth of GaN by metalorganic vapor phase epitaxy on 4H-SiC using epitaxial graphene as a mask

    Energy Technology Data Exchange (ETDEWEB)

    Puybaret, Renaud; Jordan, Matthew B.; Voss, Paul L.; Ougazzaden, Abdallah, E-mail: aougazza@georgiatech-metz.fr [School of Electrical and Computer Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States); CNRS UMI 2958, Georgia Institute of Technology, 2 Rue Marconi, 57070 Metz (France); Patriarche, Gilles [CNRS, Laboratoire de Photonique et de Nanostructures, Route de Nozay, 91460 Marcoussis (France); Sundaram, Suresh; El Gmili, Youssef [CNRS UMI 2958, Georgia Institute of Technology, 2 Rue Marconi, 57070 Metz (France); Salvestrini, Jean-Paul [Université de Lorraine, CentraleSupélec, LMOPS, EA4423, 57070 Metz (France); Heer, Walt A. de [School of Physics, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States); Berger, Claire [School of Physics, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States); CNRS, Institut Néel, BP166, 38042 Grenoble Cedex 9 (France)

    2016-03-07

    We report the growth of high-quality triangular GaN nanomesas, 30-nm thick, on the C-face of 4H-SiC using nanoselective area growth (NSAG) with patterned epitaxial graphene grown on SiC as an embedded mask. NSAG alleviates the problems of defects in heteroepitaxy, and the high mobility graphene film could readily provide the back low-dissipative electrode in GaN-based optoelectronic devices. A 5–8 graphene-layer film is first grown on the C-face of 4H-SiC by confinement-controlled sublimation of silicon carbide. Graphene is then patterned and arrays of 75-nm-wide openings are etched in graphene revealing the SiC substrate. A 30-nm-thick GaN is subsequently grown by metal organic vapor phase epitaxy. GaN nanomesas grow epitaxially with perfect selectivity on SiC, in the openings patterned through graphene. The up-or-down orientation of the mesas on SiC, their triangular faceting, and cross-sectional scanning transmission electron microscopy show that they are biphasic. The core is a zinc blende monocrystal surrounded with single-crystal wurtzite. The GaN crystalline nanomesas have no threading dislocations or V-pits. This NSAG process potentially leads to integration of high-quality III-nitrides on the wafer scalable epitaxial graphene/silicon carbide platform.

  12. In vitro susceptibility of amphotericin-B, voriconazole and caspofungin against Candida guilliermondii biofilms, isolated from dentals units water pipes, under different growth phases.

    Science.gov (United States)

    Mazari, W; Boucherit-Otmani, Z; Boucherit, K

    2015-03-01

    The dental units water pipes are a favorable medium for biofilms formation because of the small diameter of the pipe and the duration of water stagnation, but the question which arises is the nature of the biofilms which are formed inside? This article gives a progress report on the nature of this microbial contamination and precisely the fungal biofilms formation by examining their susceptibility to antifungal agents under different growth phases. Sixteen samples of dental units water pipes were taken from public dental clinic and from stomatology unit at the university hospital of Tlemcen (Algeria). The isolated strains were identified by the conventional mycological methods and were analyzed to determine their minimal concentrations inhibiting their growth (planktonic and sessile forms) using three antifungal agents. Five strains type Candida guilliermondii were identified and analyzed for their resistance to antifungal agents. Antifungal susceptibility testing demonstrated the sensitivity of all planktonic Candida guilliermondii cells against amphotericin-B, voriconzole and caspofungin but the sessile cells of these strains revealed a less susceptibility to antifungal agents and even a resistance when the biofilm made mature. Several types of yeast contaminated the dental units water pipes and especially Candida guilliermondii that was the most founded. This specie was susceptible to antifungal agents under planctonic forms and resistance where the biofilm made mature. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  13. Intracoronary basic fibroblast growth factor (FGF-2) in patients with severe ischemic heart disease: results of a phase I open-label dose escalation study.

    Science.gov (United States)

    Laham, R J; Chronos, N A; Pike, M; Leimbach, M E; Udelson, J E; Pearlman, J D; Pettigrew, R I; Whitehouse, M J; Yoshizawa, C; Simons, M

    2000-12-01

    Evaluate the safety, tolerability and preliminary efficacy of intracoronary (IC) basic fibroblast growth factor (bFGF, FGF-2). FGF-2 is a heparin-binding growth factor capable of inducing functionally significant angiogenesis in animal models of myocardial ischemia. Phase I, open-label dose-escalation study of FGF-2 administered as a single 20-min infusion in patients with ischemic heart disease not amenable to treatment with CABG or PTCA. Fifty-two patients enrolled in this study received IC FGF-2 (0.33 to 48 microg/kg). Hypotension was dose-dependent and dose-limiting, with 36 microg/kg being the maximally tolerated dose. Four patients died and four patients had non-Q-wave myocardial infarctions. Laboratory parameters and retinal examinations showed mild and mainly transient changes during the 6-month follow-up. There was an improvement in quality of life as assessed by Seattle Angina Questionnaire and improvement in exercise tolerance as assessed by treadmill exercise testing (510+/-24 s at baseline, 561+/-26 s at day 29 [p = 0.023], 609+/-26 s at day 57 (p Preliminary evidence of efficacy is tempered by the open-label uncontrolled design of the study.

  14. Seasonal patterns in growth, blood consumption, and effects on hosts by parasitic-phase sea lampreys in the Great Lakes: an individual-based model approach

    Science.gov (United States)

    Madenjian, Charles P.; Cochran, Philip A.; Bergstedt, Roger A.

    2003-01-01

    An individual-based model (IBM) was developed for sea lamprey (Petromyzon marinus) populations in the Laurentian Great Lakes. The IBM was then calibrated to observed growth, by season, for sea lampreys in northern Lake Huron under two different water temperature regimes: a regime experienced by Seneca-strain lake trout (Salvelinus namaycush) and a regime experienced by Marquettestrain lake trout. Modeling results indicated that seasonal blood consumption under the Seneca regime was very similar to that under the Marquette regime. Simulated mortality of lake trout directly due to blood removal by sea lampreys occurred at nearly twice the rate during August and September under the Marquette regime than under the Seneca regime. However, cumulative sea lamprey-induced mortality on lake trout over the entire duration of the sea lamprey's parasitic phase was only 7% higher for the Marquette regime compared with the Seneca regime. Thus, these modeling results indicated that the strain composition of the host (lake trout) population was not important in determining total number of lake trout deaths or total blood consumption attributable to the sea lamprey population, given the sea lamprey growth pattern. Regardless of water temperature regime, both blood consumption rate by sea lampreys and rate of sea lamprey-induced mortality on lake trout peaked in late October. Elevated blood consumption in late October appeared to be unrelated to changes in water temperature. The IBM approach should prove useful in optimizing control of sea lampreys in the Laurentian Great Lakes.

  15. Aqueous phase synthesis of upconversion nanocrystals through layer-by-layer epitaxial growth for in vivo X-ray computed tomography

    KAUST