Functional Group Analysis.

Science.gov (United States)

Smith, Walter T., Jr.; Patterson, John M.

1984-01-01

Literature on analytical methods related to the functional groups of 17 chemical compounds is reviewed. These compounds include acids, acid azides, alcohols, aldehydes, ketones, amino acids, aromatic hydrocarbons, carbodiimides, carbohydrates, ethers, nitro compounds, nitrosamines, organometallic compounds, peroxides, phenols, silicon compounds,…

Biological response to purification and acid functionalization of carbon nanotubes

Science.gov (United States)

Figarol, Agathe; Pourchez, Jérémie; Boudard, Delphine; Forest, Valérie; Tulliani, Jean-Marc; Lecompte, Jean-Pierre; Cottier, Michèle; Bernache-Assollant, Didier; Grosseau, Philippe

2014-07-01

Acid functionalization has been considered as an easy way to enhance the dispersion and biodegradation of carbon nanotubes (CNT). However, inconsistencies between toxicity studies of acid functionalized CNT remain unexplained. This could be due to a joint effect of the main physicochemical modifications resulting from an acid functionalization: addition of surface acid groups and purification from catalytic metallic impurities. In this study, the impact on CNT biotoxicity of these two physiochemical features was assessed separately. The in vitro biological response of RAW 264.7 macrophages was evaluated after exposure to 15-240 µg mL-1 of two types of multi-walled CNT. For each type of CNT (small: 20 nm diameter, and big: 90 nm diameter), three different surface chemical properties were studied (total of six CNT samples): pristine, acid functionalized and desorbed. Desorbed CNT were purified by the acid functionalization but presented a very low amount of surface acid groups due to a thermal treatment under vacuum. A Janus effect of acid functionalization with two opposite impacts is highlighted. The CNT purification decreased the overall toxicity, while the surface acid groups intensified it when present at a specific threshold. These acid groups especially amplified the pro-inflammatory response. The threshold mechanism which seemed to regulate the impact of acid groups should be further studied to determine its value and potential link to the other physicochemical state of the CNT. The results suggest that, for a safer-design approach, the benefit-risk balance of an acid functionalization has to be considered, depending on the CNT primary state of purification. Further research should be conducted in this direction.

Renormalization Group Functional Equations

CERN Document Server

Curtright, Thomas L

2011-01-01

Functional conjugation methods are used to analyze the global structure of various renormalization group trajectories. With minimal assumptions, the methods produce continuous flows from step-scaling {\\sigma} functions, and lead to exact functional relations for the local flow {\\beta} functions, whose solutions may have novel, exotic features, including multiple branches. As a result, fixed points of {\\sigma} are sometimes not true fixed points under continuous changes in scale, and zeroes of {\\beta} do not necessarily signal fixed points of the flow, but instead may only indicate turning points of the trajectories.

An error-related negativity potential investigation of response monitoring function in individuals with Internet addiction disorder

Directory of Open Access Journals (Sweden)

Zhenhe eZhou

2013-09-01

Full Text Available Internet addiction disorder (IAD is an impulse disorder or at least related to impulse control disorder. Deficits in executive functioning, including response monitoring, have been proposed as a hallmark feature of impulse control disorders. The error-related negativity (ERN reflects individual’s ability to monitor behavior. Since IAD belongs to a compulsive-impulsive spectrum disorder, theoretically, it should present response monitoring functional deficit characteristics of some disorders, such as substance dependence, ADHD or alcohol abuse, testing with an Erikson flanker task. Up to now, no studies on response monitoring functional deficit in IAD were reported. The purpose of the present study was to examine whether IAD displays response monitoring functional deficit characteristics in a modified Erikson flanker task.23 subjects were recruited as IAD group. 23 matched age, gender and education healthy persons were recruited as control group. All participants completed the modified Erikson flanker task while measured with event-related potentials (ERPs. IAD group made more total error rates than did controls (P < 0.01; Reactive times for total error responses in IAD group were shorter than did controls (P < 0.01. The mean ERN amplitudes of total error response conditions at frontal electrode sites and at central electrode sites of IAD group were reduced compared with control group (all P < 0.01. These results revealed that IAD displays response monitoring functional deficit characteristics and shares ERN characteristics of compulsive-impulsive spectrum disorder.

Organic Functional Group Playing Card Deck

Science.gov (United States)

Welsh, Michael J.

2003-04-01

The recognition and identification of organic functional groups, while essential for chemistry and biology majors, is also very useful for non-science majors in the study of molecules in art and life. In order to make this task more palatable for the non-science major (art and communications students), the images of a traditional playing deck of cards (heart, spade, diamond, and club) have been replaced with four representations of common organic functional groups. The hierarchy rules for naming two groups in a molecule is loosely incorporated to represent the sequence (King, Queen, Jack, ?, Ace) of the deck. Students practice recognizing and identifying organic groups by playing simple card games of "Old Maid" and "Go Fish". To play games like "Poker" or "Gin", a student must not only recognize the functional groups, but also master a naming hierarchy for the organic groups.

Methodological substantiation of the professional functions of Responsible persons of pharmaceutical and hospital institutions

Directory of Open Access Journals (Sweden)

N. O. Vetiutneva

2018-03-01

Full Text Available The aim of the work is the content analysis and methodological justification of the professional functions of the Responsible persons for quality assurance of medicines in pharmaceutical and hospital institutions. Materials and methods. The following research methods were used: system and comparative analysis, generalization, systematization, graphic modeling, observation. Research materials: normative legal acts, normative documents, recommendations of international organizations, information of wholesale and retail pharmaceutical companies, pharmaceutical and hospital institutions, professional non-governmental organizations, placed on official web-sites and collected in the process of direct observation. Results. The personnel and qualification aspects of professional activity of Responsible persons of pharmaceutical and hospital institutions were discussed. On the basis of analysis of the modern legal and regulatory framework, a general list of professional functions of the Responsible persons of health care institutions had been formed. The content analysis and comparison of the number of the functions of Responsible persons performed in health care institutions of different types is carried out. The new functions of the Responsible persons of health care institutions are considered. The managerial nature of the professional functions of the Responsible persons and the expediency of their complementing with the leadership functions are substantiated. On the basis of international management standards, requirements of GPP and GPEP, systematization of the functions of the Responsible persons of health care institutions in the groups and subgroups was performed. Conclusions. The generalization and systematization of the professional functions of the Responsible persons of health care institutions had been carried out for five classification groups of functions, namely: leadership, planning, organizational, control and information, of which the

Sub-grouping and sub-functionalization of the RIFIN multi-copy protein family

Directory of Open Access Journals (Sweden)

Sonnhammer Erik L

2008-01-01

Full Text Available Abstract Background Parasitic protozoans possess many multicopy gene families which have central roles in parasite survival and virulence. The number and variability of members of these gene families often make it difficult to predict possible functions of the encoded proteins. The families of extra-cellular proteins that are exposed to a host immune response have been driven via immune selection to become antigenically variant, and thereby avoid immune recognition while maintaining protein function to establish a chronic infection. Results We have combined phylogenetic and function shift analyses to study the evolution of the RIFIN proteins, which are antigenically variant and are encoded by the largest multicopy gene family in Plasmodium falciparum. We show that this family can be subdivided into two major groups that we named A- and B-RIFIN proteins. This suggested sub-grouping is supported by a recently published study that showed that, despite the presence of the Plasmodium export (PEXEL motif in all RIFIN variants, proteins from each group have different cellular localizations during the intraerythrocytic life cycle of the parasite. In the present study we show that function shift analysis, a novel technique to predict functional divergence between sub-groups of a protein family, indicates that RIFINs have undergone neo- or sub-functionalization. Conclusion These results question the general trend of clustering large antigenically variant protein groups into homogenous families. Assigning functions to protein families requires their subdivision into meaningful groups such as we have shown for the RIFIN protein family. Using phylogenetic and function shift analysis methods, we identify new directions for the investigation of this broad and complex group of proteins.

Functional Group Imaging by Adhesion AFM

NARCIS (Netherlands)

Berger, C.E.H.; Berger, C.E.H.; van der Werf, Kees; Kooyman, R.P.H.; de Grooth, B.G.; Greve, Jan

1995-01-01

Recently developed adhesion atomic force microscopy was used as a technique to map the spatial arrangement of chemical functional groups at a surface with a lateral resolution of 20 nm. The ratio of the adhesion forces for different functional groups can be compared with values determined from the

Functionalized carbon nanotubes containing isocyanate groups

International Nuclear Information System (INIS)

Zhao Chungui; Ji Lijun; Liu Huiju; Hu Guangjun; Zhang Shimin; Yang Mingshu; Yang Zhenzhong

2004-01-01

Functionalized carbon nanotubes containing isocyanate groups can extend the nanotube chemistry, and may promote their many potential applications such as in polymer composites and coatings. This paper describes a facile method to prepare functionalized carbon nanotubes containing highly reactive isocyanate groups on its surface via the reaction between toluene 2,4-diisocyanate and carboxylated carbon nanotubes. Fourier-transformed infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS) confirmed that reactive isocyanate groups were covalently attached to carbon nanotubes. The content of isocyanate groups were determined by chemical titration and thermogravimetric analysis (TGA)

Statistical Analysis of Human Body Movement and Group Interactions in Response to Music

Science.gov (United States)

Desmet, Frank; Leman, Marc; Lesaffre, Micheline; de Bruyn, Leen

Quantification of time series that relate to physiological data is challenging for empirical music research. Up to now, most studies have focused on time-dependent responses of individual subjects in controlled environments. However, little is known about time-dependent responses of between-subject interactions in an ecological context. This paper provides new findings on the statistical analysis of group synchronicity in response to musical stimuli. Different statistical techniques were applied to time-dependent data obtained from an experiment on embodied listening in individual and group settings. Analysis of inter group synchronicity are described. Dynamic Time Warping (DTW) and Cross Correlation Function (CCF) were found to be valid methods to estimate group coherence of the resulting movements. It was found that synchronicity of movements between individuals (human-human interactions) increases significantly in the social context. Moreover, Analysis of Variance (ANOVA) revealed that the type of music is the predominant factor in both the individual and the social context.

Special functions and the theory of group representations

CERN Document Server

Vilenkin, N Ja

1968-01-01

A standard scheme for a relation between special functions and group representation theory is the following: certain classes of special functions are interpreted as matrix elements of irreducible representations of a certain Lie group, and then properties of special functions are related to (and derived from) simple well-known facts of representation theory. The book combines the majority of known results in this direction. In particular, the author describes connections between the exponential functions and the additive group of real numbers (Fourier analysis), Legendre and Jacobi polynomials and representations of the group SU(2), and the hypergeometric function and representations of the group SL(2,R), as well as many other classes of special functions.

The acidic functional groups of humic acid

Energy Technology Data Exchange (ETDEWEB)

Shanxiang, Li; Shuhe, Sun; Zhai Zongxi, Wu Qihu

1983-09-01

The acidic functional groups content, pK value, DELTAH and DELTAS of humic acid (HA) and nitro-humic acid (NHA) were determined by potentiometry, conductometry and calorimetric titration. The thermodynamic parameters of carboxylic groups and phenolic hydroxyl groups of humic acid are similar to that of simple hydroxy-benzoic acid. The configuration sites of acidic functional groups in humic acid from different coals are different. The carbonyl groups on aromatic rings are probably ortho to phenolic -OH for HA and NHA extracted from Huangxian's brown coal and Japanese lignite, while those from Lingshi's weathered coal are not. The weak -COOH groups of the latter possess higher chemical activity. The -COOH content in HA increases, phenolic -OH group decreases and the chemical acidity of acidic functional groups increases when HA is oxidized by nitric acid. (14 refs.)

A minimalist functional group (MFG) approach for surrogate fuel formulation

KAUST Repository

Abdul Jameel, Abdul Gani

2018-03-20

. The present MFG approach supports existing literature demonstrating that key functional groups are responsible for the occurrence of complex combustion properties. The functional group approach offers a method of understanding the combustion properties of complex mixtures in a manner which is independent, yet complementary, to detailed chemical kinetic models. The MFG approach may be readily extended to formulate surrogates for other complex fuels.

A minimalist functional group (MFG) approach for surrogate fuel formulation

KAUST Repository

Abdul Jameel, Abdul Gani; Naser, Nimal; Issayev, Gani; Touitou, Jamal; Ghosh, Manik Kumer; Emwas, Abdul-Hamid M.; Farooq, Aamir; Dooley, Stephen; Sarathy, Mani

2018-01-01

. The present MFG approach supports existing literature demonstrating that key functional groups are responsible for the occurrence of complex combustion properties. The functional group approach offers a method of understanding the combustion properties of complex mixtures in a manner which is independent, yet complementary, to detailed chemical kinetic models. The MFG approach may be readily extended to formulate surrogates for other complex fuels.

Growth functions for some uniformly amenable groups

Directory of Open Access Journals (Sweden)

Dronka Janusz

2017-04-01

Full Text Available We present a simple constructive proof of the fact that every abelian discrete group is uniformly amenable. We improve the growth function obtained earlier and find the optimal growth function in a particular case. We also compute a growth function for some non-abelian uniformly amenable group.

Thermal regulation of functional groups in running water ecosystems. Progress report, 1974--1975

International Nuclear Information System (INIS)

Cummins, K.W.; Klug, M.J.

1975-01-01

Upper and lower thermal limits and temperature dependent growth were determined for a number of organisms (or populations) representing various functional groups of stream ecosystems (microconsumers, producers, and macroconsumers, shredders, collectors, scrapers, and predators). Although temperature functions as an overall control parameter, organic substrate (microconsumers) and inorganic nutrients (microconsumers and producers), light (producers) and food quality (macroconsumers) can modify thermal responses. Stream microorganisms typically grow below their thermal optima, community composition being determined by those that can manage the maximum growth at a given temperature utilizing a given organic substrate. Producers in first to third order streams are generally light limited (although nutrient availability is also important). Food quality, primarily a function of microbial biomass in the case of detritivores. can compensate for temperature dependent growth in non-predator macroinvertebrate functional groups. (U.S.)

Wigner functions from the two-dimensional wavelet group.

Science.gov (United States)

Ali, S T; Krasowska, A E; Murenzi, R

2000-12-01

Following a general procedure developed previously [Ann. Henri Poincaré 1, 685 (2000)], here we construct Wigner functions on a phase space related to the similitude group in two dimensions. Since the group space in this case is topologically homeomorphic to the phase space in question, the Wigner functions so constructed may also be considered as being functions on the group space itself. Previously the similitude group was used to construct wavelets for two-dimensional image analysis; we discuss here the connection between the wavelet transform and the Wigner function.

Relating Functional Groups to the Periodic Table

Science.gov (United States)

Struyf, Jef

2009-01-01

An introduction to organic chemistry functional groups and their ionic variants is presented. Functional groups are ordered by the position of their specific (hetero) atom in the periodic table. Lewis structures are compared with their corresponding condensed formulas. (Contains 5 tables.)

Executive functioning complaints and escitalopram treatment response in late-life depression.

Science.gov (United States)

Manning, Kevin J; Alexopoulos, George S; Banerjee, Samprit; Morimoto, Sarah Shizuko; Seirup, Joanna K; Klimstra, Sibel A; Yuen, Genevieve; Kanellopoulos, Theodora; Gunning-Dixon, Faith

2015-05-01

Executive dysfunction may play a key role in the pathophysiology of late-life depression. Executive dysfunction can be assessed with cognitive tests and subjective report of difficulties with executive skills. The present study investigated the association between subjective report of executive functioning complaints and time to escitalopram treatment response in older adults with major depressive disorder (MDD). 100 older adults with MDD (58 with executive functioning complaints and 42 without executive functioning complaints) completed a 12-week trial of escitalopram. Treatment response over 12 weeks, as measured by repeated Hamilton Depression Rating Scale scores, was compared for adults with and without executive complaints using mixed-effects modeling. Mixed effects analysis revealed a significant group × time interaction, F(1, 523.34) = 6.00, p = 0.01. Depressed older adults who reported executive functioning complaints at baseline demonstrated a slower response to escitalopram treatment than those without executive functioning complaints. Self-report of executive functioning difficulties may be a useful prognostic indicator for subsequent speed of response to antidepressant medication. Copyright © 2015 American Association for Geriatric Psychiatry. Published by Elsevier Inc. All rights reserved.

Do seedling functional groups reflect ecological strategies of woody plant species in Caatinga?

Directory of Open Access Journals (Sweden)

Tatiane Gomes Calaça Menezes

2017-11-01

Full Text Available ABSTRACT It is assumed that morphological traits of seedlings reflect different strategies in response to environmental conditions. The ecological significance of this has been widely documented in rainforests, where habitat structure and species interactions play an important role in community assembly. However, in seasonally dry ecosystems, where environmental filtering is expected to strongly influence community structure, this relationship is poorly understood. We investigated this relationship between functional groups of seedlings and life history traits and tested whether functional group predicts the ecological strategies employed by woody species to deal with the stressful conditions in seasonally dry ecosystems. Seedling functional groups, life history traits and traits that reflect ecological strategies for occupying seasonally dry environments were described for twenty-six plant species. Seedlings of species from the Caatinga vegetation exhibited a functional profile different from that observed in rainforests ecosystems. Phanerocotylar-epigeal seedlings were the most frequently observed groups, and had the largest range of ecological strategies related to dealing with seasonally dry environments, while phanerocotylar-hypogeal-reserve seedlings exhibited an increase in frequency with seasonality. We discuss these results in relation to those observed in other tropical forests and their ecological significance in seasonally dry environments.

MACKLIB-IV: a library of nuclear response functions generated with the MACK-IV computer program from ENDF/B-IV

International Nuclear Information System (INIS)

Gohar, Y.; Abdou, M.A.

1978-03-01

MACKLIB-IV employs the CTR energy group structure of 171 neutron groups and 36 gamma groups. A retrieval computer program is included with the library to permit collapsing into any other energy group structure. The library is in the new format of the ''MACK-Activity Table'' which uses a fixed position for each specific response function. This permits the user when employing the library with present transport codes to obtain directly the nuclear responses (e.g. the total nuclear heating) summed for all isotopes and integrated over any geometrical volume. The response functions included in the library are neutron kerma factor, gamma kerma factor, gas production and tritium-breeding functions, and all important reaction cross sections. Pertinent information about the library and a graphical display of six response functions for all materials in the library are given

Silsesquioxane nanoparticles with reactive internal functional groups

Energy Technology Data Exchange (ETDEWEB)

Brozek, Eric M . [University of Utah, Department of Chemistry (United States); Washton, Nancy M.; Mueller, Karl T. [Environmental Molecular Sciences Laboratory (United States); Zharov, Ilya, E-mail: i.zharov@utah.edu [University of Utah, Department of Chemistry (United States)

2017-02-15

A series of silsesquioxane nanoparticles containing reactive internal organic functionalities throughout the entire particle body have been synthesized using a surfactant-free method with organosilanes as the sole precursors and a base catalyst. The organic functional groups incorporated are vinyl, allyl, mercapto, cyanoethyl, and cyanopropyl groups. The sizes and morphologies of the particles were characterized using SEM and nitrogen adsorption, while the compositions were confirmed using TGA, FT-IR, solid state NMR, and elemental analysis. The accessibility and reactivity of the functional groups inside the particles were demonstrated by performing bromination and reduction reactions in the interior of the particles.

Cooperative catalysis by silica-supported organic functional groups

OpenAIRE

Margelefsky, Eric L.; Zeidan, Ryan K.; Davis, Mark E.

2008-01-01

Hybrid inorganic–organic materials comprising organic functional groups tethered from silica surfaces are versatile, heterogeneous catalysts. Recent advances have led to the preparation of silica materials containing multiple, different functional groups that can show cooperative catalysis; that is, these functional groups can act together to provide catalytic activity and selectivity superior to what can be obtained from either monofunctional materials or homogeneous catalysts. This tutorial...

Effect of saline iontophoresis on skin barrier function and cutaneous irritation in four ethnic groups.

Science.gov (United States)

Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I

2000-08-01

The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.

Affirmation, acknowledgment of in-group responsibility, group-based guilt, and support for reparative measures.

Science.gov (United States)

Cehajić-Clancy, Sabina; Effron, Daniel A; Halperin, Eran; Liberman, Varda; Ross, Lee D

2011-08-01

Three studies, 2 conducted in Israel and 1 conducted in Bosnia and Herzegovina, demonstrated that affirming a positive aspect of the self can increase one's willingness to acknowledge in-group responsibility for wrongdoing against others, express feelings of group-based guilt, and consequently provide greater support for reparation policies. By contrast, affirming one's group, although similarly boosting feelings of pride, failed to increase willingness to acknowledge and redress in-group wrongdoing. Studies 2 and 3 demonstrated the mediating role of group-based guilt. That is, increased acknowledgment of in-group responsibility for out-group victimization produced increased feelings of guilt, which in turn increased support for reparation policies to the victimized group. Theoretical and applied implications are discussed.

Item response theory at subject- and group-level

NARCIS (Netherlands)

Tobi, Hilde

1990-01-01

This paper reviews the literature about item response models for the subject level and aggregated level (group level). Group-level item response models (IRMs) are used in the United States in large-scale assessment programs such as the National Assessment of Educational Progress and the California

Stepwise Analysis of Differential Item Functioning Based on Multiple-Group Partial Credit Model.

Science.gov (United States)

Muraki, Eiji

1999-01-01

Extended an Item Response Theory (IRT) method for detection of differential item functioning to the partial credit model and applied the method to simulated data using a stepwise procedure. Then applied the stepwise DIF analysis based on the multiple-group partial credit model to writing trend data from the National Assessment of Educational…

Resting state functional connectivity predicts neurofeedback response

Directory of Open Access Journals (Sweden)

Dustin eScheinost

2014-09-01

Full Text Available Tailoring treatments to the specific needs and biology of individual patients – personalized medicine – requires delineation of reliable predictors of response. Unfortunately, these have been slow to emerge, especially in neuropsychiatric disorders. We have recently described a real-time functional magnetic resonance imaging (rt-fMRI neurofeedback protocol that can reduce contamination-related anxiety, a prominent symptom of many cases of obsessive-compulsive disorder (OCD. Individual response to this intervention is variable. Here we used patterns of brain functional connectivity, as measured by baseline resting-state fMRI (rs-fMRI, to predict improvements in contamination anxiety after neurofeedback training. Activity of a region of the orbitofrontal cortex (OFC and anterior prefrontal cortex, Brodmann area (BA 10, associated with contamination anxiety in each subject was measured in real time and presented as a neurofeedback signal, permitting subjects to learn to modulate this target brain region. We have previously reported both enhanced OFC/BA 10 control and improved anxiety in a group of subclinically anxious subjects after neurofeedback. Five individuals with contamination-related OCD who underwent the same protocol also showed improved clinical symptomatology. In both groups, these behavioral improvements were strongly correlated with baseline whole-brain connectivity in the OFC/BA 10, computed from rs-fMRI collected several days prior to neurofeedback training. These pilot data suggest that rs-fMRI can be used to identify individuals likely to benefit from rt-fMRI neurofeedback training to control contamination anxiety.

Introduction to the nonequilibrium functional renormalization group

International Nuclear Information System (INIS)

Berges, J.; Mesterházy, D.

2012-01-01

In these lectures we introduce the functional renormalization group out of equilibrium. While in thermal equilibrium typically a Euclidean formulation is adequate, nonequilibrium properties require real-time descriptions. For quantum systems specified by a given density matrix at initial time, a generating functional for real-time correlation functions can be written down using the Schwinger-Keldysh closed time path. This can be used to construct a nonequilibrium functional renormalization group along similar lines as for Euclidean field theories in thermal equilibrium. Important differences include the absence of a fluctuation-dissipation relation for general out-of-equilibrium situations. The nonequilibrium renormalization group takes on a particularly simple form at a fixed point, where the corresponding scale-invariant system becomes independent of the details of the initial density matrix. We discuss some basic examples, for which we derive a hierarchy of fixed point solutions with increasing complexity from vacuum and thermal equilibrium to nonequilibrium. The latter solutions are then associated to the phenomenon of turbulence in quantum field theory.

Determination of Germination Response to Temperature and Water Potential for a Wide Range of Cover Crop Species and Related Functional Groups.

Science.gov (United States)

Tribouillois, Hélène; Dürr, Carolyne; Demilly, Didier; Wagner, Marie-Hélène; Justes, Eric

2016-01-01

A wide range of species can be sown as cover crops during fallow periods to provide various ecosystem services. Plant establishment is a key stage, especially when sowing occurs in summer with high soil temperatures and low water availability. The aim of this study was to determine the response of germination to temperature and water potential for diverse cover crop species. Based on these characteristics, we developed contrasting functional groups that group species with the same germination ability, which may be useful to adapt species choice to climatic sowing conditions. Germination of 36 different species from six botanical families was measured in the laboratory at eight temperatures ranging from 4.5-43°C and at four water potentials. Final germination percentages, germination rate, cardinal temperatures, base temperature and base water potential were calculated for each species. Optimal temperatures varied from 21.3-37.2°C, maximum temperatures at which the species could germinate varied from 27.7-43.0°C and base water potentials varied from -0.1 to -2.6 MPa. Most cover crops were adapted to summer sowing with a relatively high mean optimal temperature for germination, but some Fabaceae species were more sensitive to high temperatures. Species mainly from Poaceae and Brassicaceae were the most resistant to water deficit and germinated under a low base water potential. Species were classified, independent of family, according to their ability to germinate under a range of temperatures and according to their base water potential in order to group species by functional germination groups. These groups may help in choosing the most adapted cover crop species to sow based on climatic conditions in order to favor plant establishment and the services provided by cover crops during fallow periods. Our data can also be useful as germination parameters in crop models to simulate the emergence of cover crops under different pedoclimatic conditions and crop

Examining Multiple Sources of Differential Item Functioning on the Clinician & Group CAHPS® Survey

Science.gov (United States)

Rodriguez, Hector P; Crane, Paul K

2011-01-01

Objective To evaluate psychometric properties of a widely used patient experience survey. Data Sources English-language responses to the Clinician & Group Consumer Assessment of Healthcare Providers and Systems (CG-CAHPS®) survey (n = 12,244) from a 2008 quality improvement initiative involving eight southern California medical groups. Methods We used an iterative hybrid ordinal logistic regression/item response theory differential item functioning (DIF) algorithm to identify items with DIF related to patient sociodemographic characteristics, duration of the physician–patient relationship, number of physician visits, and self-rated physical and mental health. We accounted for all sources of DIF and determined its cumulative impact. Principal Findings The upper end of the CG-CAHPS® performance range is measured with low precision. With sensitive settings, some items were found to have DIF. However, overall DIF impact was negligible, as 0.14 percent of participants had salient DIF impact. Latinos who spoke predominantly English at home had the highest prevalence of salient DIF impact at 0.26 percent. Conclusions The CG-CAHPS® functions similarly across commercially insured respondents from diverse backgrounds. Consequently, previously documented racial and ethnic group differences likely reflect true differences rather than measurement bias. The impact of low precision at the upper end of the scale should be clarified. PMID:22092021

Functional renormalization group and Kohn-Sham scheme in density functional theory

Science.gov (United States)

Liang, Haozhao; Niu, Yifei; Hatsuda, Tetsuo

2018-04-01

Deriving accurate energy density functional is one of the central problems in condensed matter physics, nuclear physics, and quantum chemistry. We propose a novel method to deduce the energy density functional by combining the idea of the functional renormalization group and the Kohn-Sham scheme in density functional theory. The key idea is to solve the renormalization group flow for the effective action decomposed into the mean-field part and the correlation part. Also, we propose a simple practical method to quantify the uncertainty associated with the truncation of the correlation part. By taking the φ4 theory in zero dimension as a benchmark, we demonstrate that our method shows extremely fast convergence to the exact result even for the highly strong coupling regime.

Conceptual DFT: the chemical relevance of higher response functions.

Science.gov (United States)

Geerlings, P; De Proft, F

2008-06-07

In recent years conceptual density functional theory offered a perspective for the interpretation/prediction of experimental/theoretical reactivity data on the basis of a series of response functions to perturbations in the number of electrons and/or external potential. This approach has enabled the sharp definition and computation, from first principles, of a series of well-known but sometimes vaguely defined chemical concepts such as electronegativity and hardness. In this contribution, a short overview of the shortcomings of the simplest, first order response functions is illustrated leading to a description of chemical bonding in a covalent interaction in terms of interacting atoms or groups, governed by electrostatics with the tendency to polarize bonds on the basis of electronegativity differences. The second order approach, well known until now, introduces the hardness/softness and Fukui function concepts related to polarizability and frontier MO theory, respectively. The introduction of polarizability/softness is also considered in a historical perspective in which polarizability was, with some exceptions, mainly put forward in non covalent interactions. A particular series of response functions, arising when the changes in the external potential are solely provoked by changes in nuclear configurations (the "R-analogues") are also systematically considered. The main part of the contribution is devoted to third order response functions which, at first sight, may be expected not to yield chemically significant information, as turns out to be for the hyperhardness. A counterexample is the dual descriptor and its R analogue, the initial hardness response, which turns out to yield a firm basis to regain the Woodward-Hoffmann rules for pericyclic reactions based on a density-only basis, i.e. without involving the phase, sign, symmetry of the wavefunction. Even the second order nonlinear response functions are shown possibly to bear interesting information, e

Effectiveness of light paths coupled with personal emergency response systems in preventing functional decline among the elderly

Directory of Open Access Journals (Sweden)

Florent Lachal

2016-08-01

Full Text Available Introduction: The elderly population is at high risk of functional decline, which will induce significant costs due to long-term care. Dependency could be delayed by preventing one of its major determinants: falls. Light paths coupled with personal emergency response systems could prevent the functional decline through fall prevention. Methods: This study aimed to evaluate the effectiveness of light paths coupled with personal emergency response systems on the functional decline in an elderly population living at home. It is a secondary analysis on data from a previous cohort. In all, 190 older adults (aged 65 years or more living at home participated. Participants in the exposed group were equipped with home-based technologies: light paths coupled with personal emergency response systems. The participants’ functional status was assessed using the Functional Autonomy Measurement System scale at baseline (T0 and at the end of the study (T12-month. Baseline characteristics were evaluated by a comprehensive geriatric assessment. Results: After 1 year, 43% of the unexposed group had functional decline versus 16% of the exposed group. Light paths coupled with personal emergency response systems were significantly associated with a decrease in the functional decline (Δ Functional Autonomy Measurement System ⩾ 5 at home (odds ratio = 0.24, 95% confidence interval (0.11–0.54, p = 0.002. Discussion: This study suggests that light paths coupled with personal emergency response systems prevent the functional decline over 12 months. This result may encourage the prescription and use of home-based technologies to postpone dependency and institutionalization, but they need a larger cost-effectiveness study to demonstrate the efficiency of these technologies.

Bronchodilator response of advanced lung function parameters depending on COPD severity

Directory of Open Access Journals (Sweden)

Jarenbäck L

2016-11-01

Full Text Available Linnea Jarenbäck,1 Göran Eriksson,1 Stefan Peterson,2 Jaro Ankerst,1 Leif Bjermer,1 Ellen Tufvesson1 1Respiratory Medicine and Allergology, Department of Clinical Sciences Lund, Lund University, 2Regional Cancer Center South, Skåne University Hospital, Lund, Sweden Background: COPD is defined as partly irreversible airflow obstruction. The response pattern of bronchodilators has not been followed in advanced lung function parameters. Purpose: The aim of this study was to investigate bronchodilator response pattern in advanced lung function parameters in a continuous fashion along forced expiratory volume in 1 second (FEV1 percent predicted (%p in COPD patients and controls. Patients and methods: Eighty-one smokers/ex-smokers (41 controls and 40 COPD performed spirometry, body plethysmography, impulse oscillometry and single-breath helium dilution carbon monoxide diffusion at baseline, after salbutamol inhalation and then after an additional inhalation of ipratropium. Results: Most pulmonary function parameters showed a linear increase in response to decreased FEV1%p. The subjects were divided into groups of FEV1%p <65 and >65, and the findings from continuous analysis were verified. The exceptions to this linear response were inspiratory capacity (IC, forced vital capacity (FVC, FEV1/FVC and expiratory resistance (Rex, which showed a segmented response relationship to FEV1%p. IC and FVC, with break points (BP of 57 and 58 FEV1%p respectively, showed no response above, but an incresed slope below the BP. In addition, in patients with FEV1%p <65 and >65, response of FEV1%p did not correlate to response of volume parameters. Conclusion: Response of several advanced lung function parameters differs depending on patients’ baseline FEV1%p, and specifically response of volume parameters is most pronounced in COPD patients with FEV1%p <65. Volume and resistance responses do not follow the flow response measured with FEV1 and may thus be used as a

Functional response of cerebral blood flow induced by somatosensory stimulation in rats with subarachnoid hemorrhage

Science.gov (United States)

Li, Zhiguo; Huang, Qin; Liu, Peng; Li, Pengcheng; Ma, Lianting; Lu, Jinling

2015-09-01

Subarachnoid hemorrhage (SAH) is often accompanied by cerebral vasospasm (CVS), which is the phenomenon of narrowing of large cerebral arteries, and then can produce delayed ischemic neurological deficit (DIND) such as lateralized sensory dysfunction. CVS was regarded as a major contributor to DIND in patients with SAH. However, therapy for preventing vasospasm after SAH to improve the outcomes may not work all the time. It is important to find answers to the relationship between CVS and DIND after SAH. How local cerebral blood flow (CBF) is regulated during functional activation after SAH still remains poorly understood, whereas, the regulation of CBF may play an important role in weakening the impact of CVS on cortex function. Therefore, it is worthwhile to evaluate the functional response of CBF in the activated cortex in an SAH animal model. Most evaluation of the effect of SAH is presently carried out by neurological behavioral scales. The functional imaging of cortical activation during sensory stimulation may help to reflect the function of the somatosensory cortex more locally than the behavioral scales do. We investigated the functional response of CBF in the somatosensory cortex induced by an electrical stimulation to contralateral forepaw via laser speckle imaging in a rat SAH model. Nineteen Sprague-Dawley rats from two groups (control group, n=10 and SAH group, n=9) were studied. SAH was induced in rats by double injection of autologous blood into the cisterna magna after CSF aspiration. The same surgical procedure was applied in the control group without CSF aspiration or blood injection. Significant CVS was found in the SAH group. Meanwhile, we observed a delayed peak of CBF response in rats with SAH compared with those in the control group, whereas no significant difference was found in magnitude, duration, and areas under curve of relative CBF changes between the two groups. The results suggest that the regulation function of local CBF during

Taxonomic and functional responses to fire and post-fire management of a Mediterranean hymenoptera community.

Science.gov (United States)

Mateos, Eduardo; Santos, Xavier; Pujade-Villar, Juli

2011-11-01

Fire is one of the commonest disturbances worldwide, transforming habitat structure and affecting ecosystem functioning. Understanding how species respond to such environmental disturbances is a major conservation goal that should be monitored using functionally and taxonomically diverse groups such as Hymenoptera. In this respect, we have analyzed the taxonomic and functional response to fire and post-fire management of a Hymenoptera community from a Mediterranean protected area. Thus, Hymenoptera were sampled at fifteen sites located in three burnt areas submitted to different post-fire practices, as well as at five sites located in peripheral unburnt pine forest. A total of 4882 specimens belonging to 33 families, which were classified into six feeding groups according to their dietary preferences, were collected. ANOVA and Redundancy Analyses showed a taxonomic and functional response to fire as all burnt areas had more Hymenoptera families, different community composition and higher numbers of parasitoids than the unburnt area. Taxonomic differences were also found between burnt areas in terms of the response of Hymenoptera to post-fire management. In general the number of parasitoids was positively correlated to the number of potential host arthropods. Parasitoids are recognized to be sensitive to habitat changes, thus highlighting their value for monitoring the functional responses of organisms to habitat disturbance. The taxonomic and functional responses of Hymenoptera suggest that some pine-forest fires can enhance habitat heterogeneity and arthropod diversity, hence increasing interspecific interactions such as those established by parasitoids and their hosts.

Taxonomic and Functional Responses to Fire and Post-Fire Management of a Mediterranean Hymenoptera Community

Science.gov (United States)

Mateos, Eduardo; Santos, Xavier; Pujade-Villar, Juli

2011-11-01

Fire is one of the commonest disturbances worldwide, transforming habitat structure and affecting ecosystem functioning. Understanding how species respond to such environmental disturbances is a major conservation goal that should be monitored using functionally and taxonomically diverse groups such as Hymenoptera. In this respect, we have analyzed the taxonomic and functional response to fire and post-fire management of a Hymenoptera community from a Mediterranean protected area. Thus, Hymenoptera were sampled at fifteen sites located in three burnt areas submitted to different post-fire practices, as well as at five sites located in peripheral unburnt pine forest. A total of 4882 specimens belonging to 33 families, which were classified into six feeding groups according to their dietary preferences, were collected. ANOVA and Redundancy Analyses showed a taxonomic and functional response to fire as all burnt areas had more Hymenoptera families, different community composition and higher numbers of parasitoids than the unburnt area. Taxonomic differences were also found between burnt areas in terms of the response of Hymenoptera to post-fire management. In general the number of parasitoids was positively correlated to the number of potential host arthropods. Parasitoids are recognized to be sensitive to habitat changes, thus highlighting their value for monitoring the functional responses of organisms to habitat disturbance. The taxonomic and functional responses of Hymenoptera suggest that some pine-forest fires can enhance habitat heterogeneity and arthropod diversity, hence increasing interspecific interactions such as those established by parasitoids and their hosts.

Functionalized TiO2 nanoparticle containing isocyanate groups

International Nuclear Information System (INIS)

Ou, Baoli; Li, Duxin; Liu, Qingquan; Zhou, Zhihua; Liao, Bo

2012-01-01

Functionalized TiO 2 nanoparticle containing isocyanate groups can extend the TiO 2 nanoparticle chemistry, and may promote their many potential applications such as in polymer composites and coatings. This paper describes a facile method to prepare functionalized TiO 2 nanoparticle with highly reactive isocyanate groups on its surface, via the reaction between toluene-2, 4-diisocyanate (TDI) and hydroxyl on TiO 2 nanoparticle surface. The main effect factors on the reaction of TiO 2 with TDI were studied by determining the reaction extent of hydroxyl groups on TiO 2 surface. Fourier-transformed infrared spectroscopy (FTIR) and thermogravimetric analysis (TGA) confirmed that reactive isocyanate groups were covalently attached to the TiO 2 nanoparticle surface. The dispersion of the TDI-functionalized TiO 2 nanoparticle was studied by transmission electron microscopy (TEM). Owing to the TDI molecules covalently bonded on TiO 2 nanoparticle surface, it was established that the TiO 2 nanoparticle can be uniformly dispersed in toluene, thus indicating that this functionalization method can prevent TiO 2 nanoparticle from agglomerating. -- Highlights: ► TiO 2 nanoparticle was functionalized with toluene-2, 4-diisocyanate. ► Functionalized TiO 2 nanoparticle can be uniformly dispersed in xylene. ► Compatibility of TiO 2 nanoparticle and organic solvent is significantly improved. ► TiO 2 containing isocyanate groups can extend the TiO 2 nanoparticle chemistry.

Invariance group of the Finster metric function

International Nuclear Information System (INIS)

Asanov, G.S.

1985-01-01

An invariance group of the Finsler metric function is introduced and studied that directly generalized the respective concept (a group of Euclidean rolations) of the Rieman geometry. A sequential description of the isotopic invariance of physical fields on the base of the Finsler geometry is possible in terms of this group

Magnetic susceptibility of functional groups

International Nuclear Information System (INIS)

Herr, T.; Ferraro, M.B.; Contreras, R.H.

1990-01-01

Proceeding with a series of works where new criteria are applied to the the calculation of the contribution of molecular fragments to certain properties, results are presented for a group of 1-X-benzenes and 1-X-naphtalenes for the magnetic susceptibility constant. Both the diamagnetic and paramagnetic parts are taken into account. To reduce the problems associated with the Gauge dependence originated in the approximations made, Gauge independent atomic orbitals (GIAO) orbitals are used in the atomic orbital basis. Results are discussed in terms of functional groups. (Author). 17 refs., 1 fig., 3 tabs

Functional groups grafted nonwoven fabrics for blood filtration-The effects of functional groups and wettability on the adhesion of leukocyte and platelet

Energy Technology Data Exchange (ETDEWEB)

Yang Chao [State Key Lab of Metal Matrix Composites, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240 (China); Cao Ye [Institute of Blood Transfusion, Chinese Academy of Medical Sciences and Peking Union Medical College, Chengdu 610081 (China); Sun Kang, E-mail: ksun@sjtu.edu.cn [State Key Lab of Metal Matrix Composites, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240 (China); Liu Jiaxin; Wang Hong [Institute of Blood Transfusion, Chinese Academy of Medical Sciences and Peking Union Medical College, Chengdu 610081 (China)

2011-01-15

In this work, the effects of grafted functional groups and surface wettability on the adhesion of leukocyte and platelet were investigated by the method of blood filtration. The filter materials, poly(butylene terephthalate) nonwoven fabrics bearing different functional groups including hydroxyl (OH), carboxyl (COOH), sulfonic acid group (SO{sub 3}H) and zwitterionic sulfobetaine group ({sup +}N((CH{sub 3}){sub 2})(CH{sub 2}){sub 3}SO{sub 3}{sup Circled-Minus }) with controllable wettability were prepared by UV radiation grafting vinyl monomers with these functional groups. Our results emphasized that both surface functional groups and surface wettability had significant effects on the adhesion of leukocyte and platelet. In the case of filter materials with the same wettability, leukocytes adhering to filter materials decreased in the order: the surface bearing OH only > the surface bearing both OH and COOH > the surface bearing sulfobetaine group > the surface bearing SO{sub 3}H, while platelets adhering to filter materials decreased as the following order: the surface bearing SO{sub 3}H > the surface bearing both OH and COOH > the surface bearing OH only > the surface bearing sulfobetaine group. As the wettability of filter materials increased, both leukocyte and platelet adhesion to filter materials declined, except that leukocyte adhesion to the surface bearing OH only remained unchanged.

Response Inhibition Function of Obsessive-Compulsive Patients with Obsessive-Compulsive Personality Disorder

Directory of Open Access Journals (Sweden)

Hui Lei

2017-06-01

Full Text Available Objective: To explore the effect of comorbid obsessive-compulsive personality disorder (OCPD on response inhibition functions in patients with obsessive-compulsive disorder (OCD. Methods: Forty-five obsessive-compulsive patients with obsessive-compulsive personality disorder (OCD + OCPD, 42 obsessive-compulsive patients without obsessive-compulsive personality disorder (OCD - OCPD and 54 healthy volunteers were selected for the stop-signal task. Results: Obsessive-compulsive patients with obsessive-compulsive personality disorder had a higher score of depression and anxiety and more severe obsessive-compulsive symptoms than that of obsessive-compulsive patients without obsessive-compulsive personality disorder. The two groups of obsessive-compulsive patients of had a greater stop-signal reaction time (SSRT during the inhibition process than the healthy volunteers of the control group (OCD + OCPD: 221.45 ± 31.78; OCD - OCPD: 218.36 ± 31.78; Controls: 199.29 ± 22.80; p < 0.05. However, no significant difference was found between the two groups of obsessive-compulsive patients. Conclusion: The findings show that the comorbid obsessive-compulsive personality disorder has no effect on response inhibition function of obsessive-compulsive patients.

A conceptual basis to encode and detect organic functional groups in XML.

Science.gov (United States)

Sankar, Punnaivanam; Krief, Alain; Vijayasarathi, Durairaj

2013-06-01

A conceptual basis to define and detect organic functional groups is developed. The basic model of a functional group is termed as a primary functional group and is characterized by a group center composed of one or more group center atoms bonded to terminal atoms and skeletal carbon atoms. The generic group center patterns are identified from the structures of known functional groups. Accordingly, a chemical ontology 'Font' is developed to organize the existing functional groups as well as the new ones to be defined by the chemists. The basic model is extended to accommodate various combinations of primary functional groups as functional group assemblies. A concept of skeletal group is proposed to define the characteristic groups composed of only carbon atoms to be regarded as equivalent to functional groups. The combination of primary functional groups with skeletal groups is categorized as skeletal group assembly. In order to make the model suitable for reaction modeling purpose, a Graphical User Interface (GUI) is developed to define the functional groups and to encode in XML format appropriate to detect them in chemical structures. The system is capable of detecting multiple instances of primary functional groups as well as the overlapping poly-functional groups as the respective assemblies. Copyright © 2013 Elsevier Inc. All rights reserved.

Kernel regression with functional response

OpenAIRE

Ferraty, Frédéric; Laksaci, Ali; Tadj, Amel; Vieu, Philippe

2011-01-01

We consider kernel regression estimate when both the response variable and the explanatory one are functional. The rates of uniform almost complete convergence are stated as function of the small ball probability of the predictor and as function of the entropy of the set on which uniformity is obtained.

Radiological emergency response - a functional approach

International Nuclear Information System (INIS)

Chowdhury, P.

1998-01-01

The state of Louisiana's radiological emergency response programme is based on the federal guidance 'Criteria for Preparation and Evaluation of Radiological Emergency Response Plans and Preparedness in Support of Nuclear Power Plants' (NUREG-0654, FEMA-REP-1 Rev. 1). Over the past 14 years, the planning and implementation of response capabilities became more organized and efficient; the training programme has strengthened considerably; co-ordination with all participating agencies has assumed a more co-operative role, and as a result, a fairly well integrated response planning has evolved. Recently, a more 'functional' approach is being adopted to maximize the programme's efficiency not only for nuclear power plant emergency response, but radiological emergency response as a whole. First, several broad-based 'components' are identified; clusters of 'nodes' are generated for each component; these 'nodes' may be divided into 'sub-nodes' which will contain some 'attributes'; 'relational bonds' among the 'attributes' will exist. When executed, the process begins and continues with the 'nodes' assuming a functional and dynamic role based on the nature and characteristics of the 'attributes'. The typical response based on stand-alone elements is thus eliminated, the overlapping of functions is avoided, and a well structured and efficient organization is produced, that is essential for today's complex nature of emergency response. (author)

Fermi-edge singularity and the functional renormalization group

Science.gov (United States)

Kugler, Fabian B.; von Delft, Jan

2018-05-01

We study the Fermi-edge singularity, describing the response of a degenerate electron system to optical excitation, in the framework of the functional renormalization group (fRG). Results for the (interband) particle-hole susceptibility from various implementations of fRG (one- and two-particle-irreducible, multi-channel Hubbard–Stratonovich, flowing susceptibility) are compared to the summation of all leading logarithmic (log) diagrams, achieved by a (first-order) solution of the parquet equations. For the (zero-dimensional) special case of the x-ray-edge singularity, we show that the leading log formula can be analytically reproduced in a consistent way from a truncated, one-loop fRG flow. However, reviewing the underlying diagrammatic structure, we show that this derivation relies on fortuitous partial cancellations special to the form of and accuracy applied to the x-ray-edge singularity and does not generalize.

Subgroups of class groups of algebraic quadratic function fields

International Nuclear Information System (INIS)

Wang Kunpeng; Zhang Xianke

2001-09-01

Ideal class groups H(K) of algebraic quadratic function fields K are studied, by using mainly the theory of continued fractions of algebraic functions. Properties of such continued fractions are discussed first. Then a necessary and sufficient condition is given for the class group H(K) to contain a cyclic subgroup of any order n, this criterion condition holds true for both real and imaginary fields K. Furthermore, several series of function fields K, including real, inertia imaginary, as well as ramified imaginary quadratic function fields, are given, and their class groups H(K) are proved to contain cyclic subgroups of order n. (author)

Plant species and functional group combinations affect green roof ecosystem functions.

Science.gov (United States)

Lundholm, Jeremy; Macivor, J Scott; Macdougall, Zachary; Ranalli, Melissa

2010-03-12

Green roofs perform ecosystem services such as summer roof temperature reduction and stormwater capture that directly contribute to lower building energy use and potential economic savings. These services are in turn related to ecosystem functions performed by the vegetation layer such as radiation reflection and transpiration, but little work has examined the role of plant species composition and diversity in improving these functions. We used a replicated modular extensive (shallow growing- medium) green roof system planted with monocultures or mixtures containing one, three or five life-forms, to quantify two ecosystem services: summer roof cooling and water capture. We also measured the related ecosystem properties/processes of albedo, evapotranspiration, and the mean and temporal variability of aboveground biomass over four months. Mixtures containing three or five life-form groups, simultaneously optimized several green roof ecosystem functions, outperforming monocultures and single life-form groups, but there was much variation in performance depending on which life-forms were present in the three life-form mixtures. Some mixtures outperformed the best monocultures for water capture, evapotranspiration, and an index combining both water capture and temperature reductions. Combinations of tall forbs, grasses and succulents simultaneously optimized a range of ecosystem performance measures, thus the main benefit of including all three groups was not to maximize any single process but to perform a variety of functions well. Ecosystem services from green roofs can be improved by planting certain life-form groups in combination, directly contributing to climate change mitigation and adaptation strategies. The strong performance by certain mixtures of life-forms, especially tall forbs, grasses and succulents, warrants further investigation into niche complementarity or facilitation as mechanisms governing biodiversity-ecosystem functioning relationships in green

Psychophysiological Responses to Group Exercise Training Sessions: Does Exercise Intensity Matter?

Directory of Open Access Journals (Sweden)

Matteo Vandoni

Full Text Available Group exercise training programs were introduced as a strategy for improving health and fitness and potentially reducing dropout rates. This study examined the psychophysiological responses to group exercise training sessions. Twenty-seven adults completed two group exercise training sessions of moderate and vigorous exercise intensities in a random and counterbalanced order. The %HRR and the exertional and arousal responses to vigorous session were higher than those during the moderate session (p<0.05. Consequently, the affective responses to vigorous session were less pleasant than those during moderate session (p<0.05. These results suggest that the psychophysiological responses to group exercise training sessions are intensity-dependent. From an adherence perspective, interventionists are encouraged to emphasize group exercise training sessions at a moderate intensity to maximize affective responses and to minimize exertional responses, which in turn may positively affect future exercise behavior.

Evaluation of group electronegativities and hardness (softness) of group 14 elements and containing functional groups through density functional theory and correlation with NMR spectra data

International Nuclear Information System (INIS)

Vivas-Reyes, R.; Aria, A.

2008-01-01

Quantum Chemical calculations for group 14 elements of Periodic Table (C, Si, Ge, Sn, Pb) and their functional groups have been carried out using Density Functional Theory (DFT) based reactivity descriptors such as group electronegativities, hardness and softness. DFT calculations were performed for a large series of tetra coordinated Sn compounds of the CH 3 SnRR'X type, where X is a halogen and R and R' are alkyl, halogenated alkyl, alkoxy, or alkyl thio groups. The results were interpreted in terms of calculated electronegativity and hardness of the SnRR'X groups, applying a methodology previously developed by Geerlings and coworkers (J. Phys. Chem. 1993, 97, 1826). These calculations allowed to see the regularities concerning the influence of the nature of organic groups RR' and inorganic group X on electronegativities and hardness of the SnRR'X groups; in this case, it was found a very good correlation between the electronegativity of the fragment and experimental 119 Sn chemical shifts, a property that sensitively reflects the change in the valence electronic structure of molecules. This work was complemented with the study of some compounds of the EX and ER types, where E= C, Si, Ge, Sn and R= CH 3 , H, which was performed to study the influence that the central atom has on the electronegativity and hardness of molecules, or whether these properties are mainly affected for the type of ligand bound to the central atom. All these calculations were performed using the B3PW91 functional together with the 6-3 1 1 + + G basis set level for H, C, Si, Ge, F, Cl and Br atoms and the 3-21G for Sn and I atoms. (author)

Evaluation of group electronegativities and hardness (softness) of group 14 elements and containing functional groups through density functional theory and correlation with NMR spectra data

Energy Technology Data Exchange (ETDEWEB)

Vivas-Reyes, R.; Aria, A. [Universidad de Cartagena, Cartagena (Colombia). Facultad de Ciencias Naturales y Exactas. Grupo de Quimica Cuantica y Computacional]. E-mail: rvivasr@unicartagena.edu.co

2008-07-01

Quantum Chemical calculations for group 14 elements of Periodic Table (C, Si, Ge, Sn, Pb) and their functional groups have been carried out using Density Functional Theory (DFT) based reactivity descriptors such as group electronegativities, hardness and softness. DFT calculations were performed for a large series of tetra coordinated Sn compounds of the CH{sub 3}SnRR'X type, where X is a halogen and R and R' are alkyl, halogenated alkyl, alkoxy, or alkyl thio groups. The results were interpreted in terms of calculated electronegativity and hardness of the SnRR'X groups, applying a methodology previously developed by Geerlings and coworkers (J. Phys. Chem. 1993, 97, 1826). These calculations allowed to see the regularities concerning the influence of the nature of organic groups RR' and inorganic group X on electronegativities and hardness of the SnRR'X groups; in this case, it was found a very good correlation between the electronegativity of the fragment and experimental {sup 119}Sn chemical shifts, a property that sensitively reflects the change in the valence electronic structure of molecules. This work was complemented with the study of some compounds of the EX and ER types, where E= C, Si, Ge, Sn and R= CH{sub 3}, H, which was performed to study the influence that the central atom has on the electronegativity and hardness of molecules, or whether these properties are mainly affected for the type of ligand bound to the central atom. All these calculations were performed using the B3PW91 functional together with the 6-3 1 1 + + G basis set level for H, C, Si, Ge, F, Cl and Br atoms and the 3-21G for Sn and I atoms. (author)

The influence of percutaneous nephrolithotomy on human systemic stress response, SIRS and renal function.

Science.gov (United States)

Shen, Pengfei; Wei, Wuran; Yang, Xiaochun; Zeng, Hao; Li, Xiong; Yang, Jie; Wang, Jia; Huang, Jiaoti

2010-10-01

The objective of this study is to investigate the influences of percutaneous nephrolithotomy (PNL) and open surgery nephrolithotomy on the systemic stress response, SIRS and renal function. Forty patients with kidney calculi were enrolled in the study. Twenty cases were randomized to the PNL group and the other twenty cases to the open surgery group. Levels of C-reactive protein (CRP), interleukin-6(IL-6), β(2)-microglobulin (β(2)-MG), respiration rate, heart rate, body temperature and white blood cell counts were examined. CRP and IL-6 were measured in all patients pre-operatively and on post-operative days 1, 3 and 6, respectively. There was significant difference in their pre- and post-operation levels (P PNL group and 12 cases in open surgery group; there was significant difference between the two groups (P 0.05). Urine β(2)-MG levels were also measured. There was significant difference between pre- and the first day post-PNL (P PNL (P > 0.05). There was significant difference between pre- and first and third day post-open surgery (P 0.05). There was significant difference between two groups at the first, third and sixth days (P PNL group and open surgery group to some extent. The degree of stress response of PNL is lower than that of open surgery, proving the advantages of PNL with reference to serum immunology. There were cases in both the groups with SIRS, but the degree of SIRS in PNL group was lesser than the other group. Both the groups have no obvious effect on glomerular filtration function after operation and have effect on renal tubular reabsorption in the early stage after operation; but the recovery of the PNL group is faster than the open surgery group. It is thus shown that PNL is much safer and more feasible and has lesser effect on renal function.

Clinical responsiveness of self-report functional assessment measures for children with juvenile idiopathic arthritis undergoing intraarticular corticosteroid injections.

Science.gov (United States)

Brown, G Ted; Wright, F Virginia; Lang, Bianca A; Birdi, Nina; Oen, Kim; Stephens, Derek; McComas, Joan; Feldman, Brian M

2005-12-15

The Childhood Health Assessment Questionnaire (CHAQ), Juvenile Arthritis Functional Assessment Report (JAFAR), and Juvenile Arthritis Functional Status Index (JASI) are widely used functional measures for juvenile idiopathic arthritis (JIA) that differ in content, format, and completion time. We compared the responsiveness and child-parent agreement of the JAFAR, CHAQ, and JASI in a prospective, multicenter study. Children and adolescents from 5 rheumatology centers were enrolled. Subjects were about to undergo therapy (intraarticular corticosteroid injections [IAS] and methotrexate or hip surgery (MTX/hip]) expected to produce a functional improvement. All subjects were studied before the intervention and at 6 weeks and 6 months posttreatment. At each study visit, the 3 measures were administered in randomized, balanced order to both parents and children. A total of 92 subjects (mean age 12.8 years) were enrolled in the study, 74 of which were in the IAS group. The responsiveness of all 3 measures was moderate to strong. The standardized response mean at 6 weeks for the IAS group on the JAFAR, CHAQ, and JASI was 0.41 (95% confidence interval [95% CI] 0.18, 0.64), 0.70 (95% CI 0.47, 0.93), and 0.36 (95% CI 0.13, 0.59), respectively. The CHAQ was somewhat more responsive to change at 6 weeks (IAS group: relative efficiency 0.34 [JAFAR], 0.27 [JASI]), but less responsive at 6 months (MTX/hip group: relative efficiency 5.1 [JAFAR], 3.9 [JASI]). All 3 questionnaires showed acceptable parent-child agreement, and overall, there were few differences between the 3 questionnaires. The functional outcome measures currently used for JIA are all adequately responsive for use in trials or in the clinic setting. The choice of which measure to use should therefore be based on the time available for completion, the intended clinical/research use, and the depth of content required.

Surface modification influencing adsorption of red wine constituents: The role of functional groups

Science.gov (United States)

Mierczynska-Vasilev, Agnieszka; Smith, Paul A.

2016-11-01

The adsorption of wine constituents at solid surfaces is important in applications such as filtration and membrane fouling, binding to tanks and fittings and interactions with processing aids such as bentonite. The interaction of wine constituents with surfaces is mediated through adsorbed wine components, where the type of constituents, amount, orientation, and conformation are of consequence for the surface response. This study examines the effect of surface chemical functionalities on the adsorption of red wine constituents. Plasma-polymerized films rich in amine, carboxyl, hydroxyl, formyl and methyl functional groups were generated on solid substrates whereas, glycidyltrimethylammonium chloride was covalently attached to allylamine plasma-polymer modified surface and poly(sodium styrenesulfonate) was electrostatically adsorbed to an amine plasma-polymerized surface. The surface chemical functionalities were characterized by X-ray photoelectron spectroscopy. The ability of different substrates to adsorb red wine constituents was evaluated by quartz crystal microbalance and atomic force microscopy. The results showed that substrates modified with -SO3H and -COOH groups can adsorb more of the wine nitrogen-containing compounds whereas -NH2 and -NR3 groups encourage carbon-containing compounds adsorption. Red wine constituents after filtration were adsorbed in higher extend on -NR3 and -CHO surfaces. The -OH modified surfaces had the lowest ability to absorb wine components.

NaI(Tl) response functions

International Nuclear Information System (INIS)

Vega C, H. R.; Ortiz R, J. M.; Benites R, J. L.; De Leon M, H. A.

2015-09-01

The response functions of a NaI(Tl) detector have been estimated using Monte Carlo methods. Response functions were calculated for monoenergetic photon sources (0.05 to 3 MeV). Responses were calculated for point-like sources and for sources distributed in Portland cement cylinders. The responses were used to calculate the efficiency functions in term of photon energy. Commonly, sources used for calibration are point-like, and eventually sources to be measured have different features. In order to use the calibrated sources corrections due to solid angle, self-absorption and scattering, must be carried out. However, some of these corrections are not easy to perform. In this work, the calculated responses were used to estimate the detector efficiency of point-like sources, and sources distributed in Portland type cement. Samples of Portland paste were prepared and were exposed to photoneutrons produced by a 15 MV linac. Some of the elements in the cement were activated producing γ-emitting radionuclides that were measured with a NaI(Tl) gamma-ray spectrometer, that was calibrated with point-like sources. In order to determine the specific activity in the induced radioisotopes calculated efficiencies were used to make corrections due to the differences between the solid angle, photon absorption and photon scattering in the point-like calibration sources and the sources distributed in cement. During the interaction between photoneutrons and the cement samples three radioisotopes were induced: 56 Mn, 24 Na, and 28 Al. (Author)

NaI(Tl) response functions

Energy Technology Data Exchange (ETDEWEB)

Vega C, H. R.; Ortiz R, J. M. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Benites R, J. L. [Centro Estatal de Cancerologia de Nayarit, Calz. de la Cruz 118 Sur, Tepic, Nayarit (Mexico); De Leon M, H. A., E-mail: fermineutron@yahoo.com.mx [Instituto Tecnologico de Aguascalientes, Av. Adolfo Lopez Mateos 1801 Ote., 20155 Aguascalientes, Ags. (Mexico)

2015-09-15

The response functions of a NaI(Tl) detector have been estimated using Monte Carlo methods. Response functions were calculated for monoenergetic photon sources (0.05 to 3 MeV). Responses were calculated for point-like sources and for sources distributed in Portland cement cylinders. The responses were used to calculate the efficiency functions in term of photon energy. Commonly, sources used for calibration are point-like, and eventually sources to be measured have different features. In order to use the calibrated sources corrections due to solid angle, self-absorption and scattering, must be carried out. However, some of these corrections are not easy to perform. In this work, the calculated responses were used to estimate the detector efficiency of point-like sources, and sources distributed in Portland type cement. Samples of Portland paste were prepared and were exposed to photoneutrons produced by a 15 MV linac. Some of the elements in the cement were activated producing γ-emitting radionuclides that were measured with a NaI(Tl) gamma-ray spectrometer, that was calibrated with point-like sources. In order to determine the specific activity in the induced radioisotopes calculated efficiencies were used to make corrections due to the differences between the solid angle, photon absorption and photon scattering in the point-like calibration sources and the sources distributed in cement. During the interaction between photoneutrons and the cement samples three radioisotopes were induced: {sup 56}Mn, {sup 24}Na, and {sup 28}Al. (Author)

Heightened cortisol response to exercise challenge in women with functional hypothalamic amenorrhea.

Science.gov (United States)

Sanders, Kristen M; Kawwass, Jennifer F; Loucks, Tammy; Berga, Sarah L

2018-02-01

Functional hypothalamic amenorrhea is characterized by anovulation caused by reduced gonadotropin-releasing hormone drive and is associated with hypercortisolemia that has been linked to heightened hypothalamic-pituitary-adrenal reactivity to common psychological and metabolic challenges. We hypothesized that women with functional hypothalamic amenorrhea would display greater cortisol responses to exercise challenge than ovulatory women with eumenorrhea. We completed a cross-sectional comparison of 9 women with functional hypothalamic amenorrhea and 11 women with eumenorrhea who were of reproductive age, who weighed 90-110% ideal body weight, who did not exercise excessively, and who had no formal psychiatric diagnosis. Subjects completed a 20-minute submaximal exercise challenge using a cycle ergometer in a research exercise laboratory. Heart rate and circulatory cortisol, glucose, and lactate were measured at 10-minute intervals before, during, and after the exercise challenge. Baseline (t= -10 minutes) cortisol, glucose, lactate, and heart rate were comparable between groups. Glucose levels rose modestly during exercise by 2.9% in women with eumenorrhea (P=.4) but declined by 10.6% in functional hypothalamic amenorrhea (P<.03). The nadir in glucose levels in functional hypothalamic amenorrhea occurred at the end of the 20-minute exercise challenge (t= +20 min). Lactate levels rose comparably in both groups (P<.01). Heart rate increased significantly with exercise in both groups (P<.01), but the increase was smaller in subjects with functional hypothalamic amenorrhea (P<.01). Cortisol levels increased during the exercise challenge in both groups (P<.01) and peaked 10 minutes after the exercise ended (t= +30 min). At peak, subjects with functional hypothalamic amenorrhea displayed higher cortisol levels (147±22 [standard error of the mean] ng/mL) than women with eumenorrhea (96±12 ng/mL; P=.05). The mean percent increase over baseline was 62% in women with

Local and linear chemical reactivity response functions at finite temperature in density functional theory

International Nuclear Information System (INIS)

Franco-Pérez, Marco; Ayers, Paul W.; Gázquez, José L.; Vela, Alberto

2015-01-01

We explore the local and nonlocal response functions of the grand canonical potential density functional at nonzero temperature. In analogy to the zero-temperature treatment, local (e.g., the average electron density and the local softness) and nonlocal (e.g., the softness kernel) intrinsic response functions are defined as partial derivatives of the grand canonical potential with respect to its thermodynamic variables (i.e., the chemical potential of the electron reservoir and the external potential generated by the atomic nuclei). To define the local and nonlocal response functions of the electron density (e.g., the Fukui function, the linear density response function, and the dual descriptor), we differentiate with respect to the average electron number and the external potential. The well-known mathematical relationships between the intrinsic response functions and the electron-density responses are generalized to nonzero temperature, and we prove that in the zero-temperature limit, our results recover well-known identities from the density functional theory of chemical reactivity. Specific working equations and numerical results are provided for the 3-state ensemble model

The effect of continuous grouping of pigs in large groups on stress response and haematological parameters

DEFF Research Database (Denmark)

Damgaard, Birthe Marie; Studnitz, Merete; Jensen, Karin Hjelholt

2009-01-01

The consequences of an ‘all in-all out' static group of uniform age vs. a continuously dynamic group with litter introduction and exit every third week were examined with respect to stress response and haematological parameters in large groups of 60 pigs. The experiment included a total of 480 pigs...... from weaning at the age of 4 weeks to the age of 18 weeks after weaning. Limited differences were found in stress and haematological parameters between pigs in dynamic and static groups. The cortisol response to the stress test was increasing with the duration of the stress test in pigs from...... the dynamic group while it was decreasing in the static group. The health condition and the growth performance were reduced in the dynamic groups compared with the static groups. In the dynamic groups the haematological parameters indicated an activation of the immune system characterised by an increased...

Pattern analysis of defecography in patients with chronic functional constipation: is it predictable for the responsiveness of biofeedback therapy?

Energy Technology Data Exchange (ETDEWEB)

Yang, Hye Rin; Kim, Ah Young; Hong, Seong Sook; Byun, Jae Ho; Myung Seung Jae; Ha, Hyun Kwon [University of Ulsan of Medicine, Seoul (Korea, Republic of)

2005-08-15

To determine of pattern analysis of defecography can predict the responsiveness of biofeedback therapy in patients with chronic functional constipation. Over a two-year period, 104 patients with chronic functional constipation underwent defecography and biofeedback therapy. Two blinded readers analyzed the defecographic findings and classified them into six types; I = normal defecation, II = hypertonic lower anal sphincter (poor anal opening due to a persistent contraction of the lower anal sphincter), III dyskinetic puborectal sling (inadequate laxity of the puborectal sling), IV spastic pelvic floor syndrome (persistent contraction of both the puborectal sling and the lower and sphincter), V unclassified (including paradoxical contraction of the anal sphincter), VI anatomical obstruction. In addition, the degree of rectal contraction during defecation was scored (grade 0 to 3). After biofeedback therapy, the differences in the defecography patterns or rectal contraction between the two groups, the responsive or non-responsive group, were analyzed. The defecograms revealed that the type IV of the spastic pelvic floor syndrome was most common (50 of 104 patients, 48%), followed by II (21/104, 20%), III (12/104, 11.5%), V (9/104, 9%) and VI (12/104, 11.5%). Biofeedback therapy showed a therapeutic response in 71 out of 104 patients (68%) but failed in 33 patients (32%). However, there were no significant differences in the defecographic pattern between the responsive and non-responsive groups ({rho} = 0.630). The defecograms revealed contractions in 78 patients (75%) and moderate to vigorous contractions (more than grade 2) in 66 patients. Most of the biofeedback-responsive group showed rectal contractions (66 of 71 patients, 93%, {rho} < 0.001). In patients with chronic functional constipation, there was no significant difference in the morphological patterns of the defecogram between the responsive and non-responsive biofeedback groups. However, the presence of

Pattern analysis of defecography in patients with chronic functional constipation: is it predictable for the responsiveness of biofeedback therapy?

International Nuclear Information System (INIS)

Yang, Hye Rin; Kim, Ah Young; Hong, Seong Sook; Byun, Jae Ho; Myung Seung Jae; Ha, Hyun Kwon

2005-01-01

To determine of pattern analysis of defecography can predict the responsiveness of biofeedback therapy in patients with chronic functional constipation. Over a two-year period, 104 patients with chronic functional constipation underwent defecography and biofeedback therapy. Two blinded readers analyzed the defecographic findings and classified them into six types; I = normal defecation, II = hypertonic lower anal sphincter (poor anal opening due to a persistent contraction of the lower anal sphincter), III dyskinetic puborectal sling (inadequate laxity of the puborectal sling), IV spastic pelvic floor syndrome (persistent contraction of both the puborectal sling and the lower and sphincter), V unclassified (including paradoxical contraction of the anal sphincter), VI anatomical obstruction. In addition, the degree of rectal contraction during defecation was scored (grade 0 to 3). After biofeedback therapy, the differences in the defecography patterns or rectal contraction between the two groups, the responsive or non-responsive group, were analyzed. The defecograms revealed that the type IV of the spastic pelvic floor syndrome was most common (50 of 104 patients, 48%), followed by II (21/104, 20%), III (12/104, 11.5%), V (9/104, 9%) and VI (12/104, 11.5%). Biofeedback therapy showed a therapeutic response in 71 out of 104 patients (68%) but failed in 33 patients (32%). However, there were no significant differences in the defecographic pattern between the responsive and non-responsive groups (ρ = 0.630). The defecograms revealed contractions in 78 patients (75%) and moderate to vigorous contractions (more than grade 2) in 66 patients. Most of the biofeedback-responsive group showed rectal contractions (66 of 71 patients, 93%, ρ < 0.001). In patients with chronic functional constipation, there was no significant difference in the morphological patterns of the defecogram between the responsive and non-responsive biofeedback groups. However, the presence of rectal

Hormonal, metabolic and cardiovascular responses to hypoglycaemia in Type 1 (insulin-dependent) diabetes with and without residual B cell function

DEFF Research Database (Denmark)

Madsbad, S; Hilsted, J; Krarup, T

1982-01-01

Hormonal, metabolic and cardiovascular responses to insulin induced hypoglycaemia were investigated in seven Type 1 (insulin-dependent) diabetic patients with residual B cell function, eight Type 1 diabetic patients without B cell function and six healthy subjects. No differences were found between...... the diabetic groups regarding nadir of glucose and rate of recovery to normoglycaemia. The patients with residual B cell function had a glucagon response to hypoglycaemia which was close to that of normal subjects. In patients without B cell function, the glucagon response to hypoglycaemia was present, albeit...... significantly smaller than in the patients with preserved B cell function (0.025 ng/ml, range 0.007-0.042 versus 0.054 ng/ml, range 0.029-0.087). The group without B cell function had signs of an exaggerated rate of lipolysis and ketogenesis compared with the patients with B cell function and the normal...

Predator-dependent functional response in wolves: from food limitation to surplus killing.

Science.gov (United States)

Zimmermann, Barbara; Sand, Håkan; Wabakken, Petter; Liberg, Olof; Andreassen, Harry Peter

2015-01-01

The functional response of a predator describes the change in per capita kill rate to changes in prey density. This response can be influenced by predator densities, giving a predator-dependent functional response. In social carnivores which defend a territory, kill rates also depend on the individual energetic requirements of group members and their contribution to the kill rate. This study aims to provide empirical data for the functional response of wolves Canis lupus to the highly managed moose Alces alces population in Scandinavia. We explored prey and predator dependence, and how the functional response relates to the energetic requirements of wolf packs. Winter kill rates of GPS-collared wolves and densities of cervids were estimated for a total of 22 study periods in 15 wolf territories. The adult wolves were identified as the individuals responsible for providing kills to the wolf pack, while pups could be described as inept hunters. The predator-dependent, asymptotic functional response models (i.e. Hassell-Varley type II and Crowley-Martin) performed best among a set of 23 competing linear, asymptotic and sigmoid models. Small wolf packs acquired >3 times as much moose biomass as required to sustain their field metabolic rate (FMR), even at relatively low moose abundances. Large packs (6-9 wolves) acquired less biomass than required in territories with low moose abundance. We suggest the surplus killing by small packs is a result of an optimal foraging strategy to consume only the most nutritious parts of easy accessible prey while avoiding the risk of being detected by humans. Food limitation may have a stabilizing effect on pack size in wolves, as supported by the observed negative relationship between body weight of pups and pack size. © 2014 The Authors. Journal of Animal Ecology published by John Wiley & Sons Ltd on behalf of British Ecological Society.

Group functioning of a collaborative family research team.

Science.gov (United States)

Johnson, S K; Halm, M A; Titler, M G; Craft, M; Kleiber, C; Montgomery, L A; Nicholson, A; Buckwalter, K; Cram, E

1993-07-01

Collaborative research teams are an attractive means of conducting nursing research in the clinical setting because of the many opportunities that collaboration can supply. These opportunities include a chance to: (1) network with other nurses who have similar interests, (2) share knowledge and expertise for designing clinical studies that directly affect daily practice, (3) develop instruments, (4) write grant proposals, (5) collect and analyze data, and (6) prepare manuscripts for publication. The effectiveness of research teams, however, is strongly influenced by group functioning. This article describes the functioning of a collaborative family interventions research team of nursing faculty members and CNSs at a large Midwestern university setting. The formation of the group and membership characteristics are described, along with strategies used to identify the research focus and individual and group goals. Aspects related to the influence of the group on members and the internal operations of the group are also addressed. Future strategies to be explored will focus on the size of the group and joint authorship issues. The authors also set forth a number of recommendations for development of collaborative research groups.

Psychophysiological Responses to Group Exercise Training Sessions: Does Exercise Intensity Matter?

Science.gov (United States)

Vandoni, Matteo; Codrons, Erwan; Marin, Luca; Correale, Luca; Bigliassi, Marcelo; Buzzachera, Cosme Franklim

2016-01-01

Group exercise training programs were introduced as a strategy for improving health and fitness and potentially reducing dropout rates. This study examined the psychophysiological responses to group exercise training sessions. Twenty-seven adults completed two group exercise training sessions of moderate and vigorous exercise intensities in a random and counterbalanced order. The %HRR and the exertional and arousal responses to vigorous session were higher than those during the moderate session (psession were less pleasant than those during moderate session (ptraining sessions are intensity-dependent. From an adherence perspective, interventionists are encouraged to emphasize group exercise training sessions at a moderate intensity to maximize affective responses and to minimize exertional responses, which in turn may positively affect future exercise behavior.

rTMS neuromodulation improves electrocortical functional measures of information processing and behavioral responses in autism

Directory of Open Access Journals (Sweden)

Estate M Sokhadze

2014-08-01

Full Text Available Objectives: Reports in autism spectrum disorders (ASD of a minicolumnopathy with consequent deficits of lateral inhibition help explain observed behavioral and executive dysfunctions. We propose that neuromodulation based on rTMS will enhance lateral inhibition through activation of inhibitory double bouquet interneurons and will be accompanied by improvements in the prefrontal executive functions. Methods: The current study used ERPs in a visual oddball task with illusory figures. We compared clinical, behavioral and electrocortical outcomes in 2 groups of children with autism (TMS, wait-list group [WTL]. We predicted that 18 session long course in autistic patients will have better behavioral and ERP outcomes as compared to age- and IQ-matched wait-list group. We used 18 sessions of 1Hz rTMS applied over the dorso-lateral prefrontal cortex in 27 individuals with ASD diagnosis. The WTL group was comprised of 27 age-matched ASD subjects. Results: Post-TMS evaluations showed decreased irritability and hyperactivity and decreased stereotypic behaviors. Following rTMS we found decreased amplitude and prolonged latency in the fronto-central ERPs to non-targets in the TMS group. These ERP changes along with increased centro-parietal ERPs to targets are indicative of more efficient processing of information post-TMS. Another finding was increased magnitude of error-related negativity (ERN during commission errors. We calculated normative post-error reaction time (RT slowing response in both groups and found that rTMS was accompanied by post-error RT slowing and higher accuracy of responses, whereas the WTL group kept on showing typical for ASD post-error RT speeding and had higher error rate. Conclusion: Results from our study indicate that rTMS improves executive functioning in ASD as evidenced by normalization of ERP responses and behavioral reactions during executive function test, and also by improvements in clinical behavioral evaluations.

Calculating the knowledge-based similarity of functional groups using crystallographic data

Science.gov (United States)

Watson, Paul; Willett, Peter; Gillet, Valerie J.; Verdonk, Marcel L.

2001-09-01

A knowledge-based method for calculating the similarity of functional groups is described and validated. The method is based on experimental information derived from small molecule crystal structures. These data are used in the form of scatterplots that show the likelihood of a non-bonded interaction being formed between functional group A (the `central group') and functional group B (the `contact group' or `probe'). The scatterplots are converted into three-dimensional maps that show the propensity of the probe at different positions around the central group. Here we describe how to calculate the similarity of a pair of central groups based on these maps. The similarity method is validated using bioisosteric functional group pairs identified in the Bioster database and Relibase. The Bioster database is a critical compilation of thousands of bioisosteric molecule pairs, including drugs, enzyme inhibitors and agrochemicals. Relibase is an object-oriented database containing structural data about protein-ligand interactions. The distributions of the similarities of the bioisosteric functional group pairs are compared with similarities for all the possible pairs in IsoStar, and are found to be significantly different. Enrichment factors are also calculated showing the similarity method is statistically significantly better than random in predicting bioisosteric functional group pairs.

Temperature response functions (G-functions) for single pile heat exchangers

International Nuclear Information System (INIS)

Loveridge, Fleur; Powrie, William

2013-01-01

Foundation piles used as heat exchangers as part of a ground energy system have the potential to reduce energy use and carbon dioxide emissions from new buildings. However, current design approaches for pile heat exchangers are based on methods developed for boreholes which have a different geometry, with a much larger aspect (length to diameter) ratio. Current methods also neglect the transient behaviour of the pile concrete, instead assuming a steady state resistance for design purposes. As piles have a much larger volume of concrete than boreholes, this neglects the significant potential for heat storage within the pile. To overcome these shortcomings this paper presents new pile temperature response functions (G-functions) which are designed to reflect typical geometries of pile heat exchangers and include the transient response of the pile concrete. Owing to the larger number of pile sizes and pipe configurations which are possible with pile heat exchangers it is not feasible to developed a single unified G-function and instead upper and lower bound solutions are provided for different aspects ratios. - Highlights: • We present new temperature response functions for pile heat exchangers. • The functions include transient heat transfer within the pile concrete. • Application of the functions reduces the resulting calculated temperature ranges. • Greater energy efficiency is possible by accounting for heat storage in the pile

Aspects of the functional renormalisation group

International Nuclear Information System (INIS)

Pawlowski, Jan M.

2007-01-01

We discuss structural aspects of the functional renormalisation group. Flows for a general class of correlation functions are derived, and it is shown how symmetry relations of the underlying theory are lifted to the regularised theory. A simple equation for the flow of these relations is provided. The setting includes general flows in the presence of composite operators and their relation to standard flows, an important example being NPI quantities. We discuss optimisation and derive a functional optimisation criterion. Applications deal with the interrelation between functional flows and the quantum equations of motion, general Dyson-Schwinger equations. We discuss the combined use of these functional equations as well as outlining the construction of practical renormalisation schemes, also valid in the presence of composite operators. Furthermore, the formalism is used to derive various representations of modified symmetry relations in gauge theories, as well as to discuss gauge-invariant flows. We close with the construction and analysis of truncation schemes in view of practical optimisation

Influence of functional groups on charge transport in molecular junctions

DEFF Research Database (Denmark)

Mowbray, Duncan; Jones, Glenn; Thygesen, Kristian Sommer

2008-01-01

Using density functional theory (DFT), we analyze the influence of five classes of functional groups, as exemplified by NO2, OCH3, CH3, CCl3, and I, on the transport properties of a 1,4-benzenedithiolate (BDT) and 1,4-benzenediamine (BDA) molecular junction with gold electrodes. Our analysis...... demonstrates how ideas from functional group chemistry may be used to engineer a molecule's transport properties, as was shown experimentally and using a semiempirical model for BDA [Nano Lett. 7, 502 (2007)]. In particular, we show that the qualitative change in conductance due to a given functional group can...... be predicted from its known electronic effect (whether it is sigma/pi donating/withdrawing). However, the influence of functional groups on a molecule's conductance is very weak, as was also found in the BDA experiments. The calculated DFT conductances for the BDA species are five times larger than...

Differential responses of soil bacteria, fungi, archaea and protists to plant species richness and plant functional group identity

NARCIS (Netherlands)

Dassen, S.; Cortois, R.; Martens, Henk; De Hollander, M.; Kowalchuk, G.A.; van der Putten, W.H.; De Deyn, G.B.

2017-01-01

Plants are known to influence belowground microbial community structure along their roots, but the impacts of plant species richness and plant functional group (FG) identity on microbial communities in the bulk soil are still not well understood. Here, we used 454-pyrosequencing to analyse the soil

Sum rules in the response function method

International Nuclear Information System (INIS)

Takayanagi, Kazuo

1990-01-01

Sum rules in the response function method are studied in detail. A sum rule can be obtained theoretically by integrating the imaginary part of the response function over the excitation energy with a corresponding energy weight. Generally, the response function is calculated perturbatively in terms of the residual interaction, and the expansion can be described by diagrammatic methods. In this paper, we present a classification of the diagrams so as to clarify which diagram has what contribution to which sum rule. This will allow us to get insight into the contributions to the sum rules of all the processes expressed by Goldstone diagrams. (orig.)

Group-ICA model order highlights patterns of functional brain connectivity

Directory of Open Access Journals (Sweden)

Ahmed eAbou Elseoud

2011-06-01

Full Text Available Resting-state networks (RSNs can be reliably and reproducibly detected using independent component analysis (ICA at both individual subject and group levels. Altering ICA dimensionality (model order estimation can have a significant impact on the spatial characteristics of the RSNs as well as their parcellation into sub-networks. Recent evidence from several neuroimaging studies suggests that the human brain has a modular hierarchical organization which resembles the hierarchy depicted by different ICA model orders. We hypothesized that functional connectivity between-group differences measured with ICA might be affected by model order selection. We investigated differences in functional connectivity using so-called dual-regression as a function of ICA model order in a group of unmedicated seasonal affective disorder (SAD patients compared to normal healthy controls. The results showed that the detected disease-related differences in functional connectivity alter as a function of ICA model order. The volume of between-group differences altered significantly as a function of ICA model order reaching maximum at model order 70 (which seems to be an optimal point that conveys the largest between-group difference then stabilized afterwards. Our results show that fine-grained RSNs enable better detection of detailed disease-related functional connectivity changes. However, high model orders show an increased risk of false positives that needs to be overcome. Our findings suggest that multilevel ICA exploration of functional connectivity enables optimization of sensitivity to brain disorders.

Surface modification influencing adsorption of red wine constituents: The role of functional groups

Energy Technology Data Exchange (ETDEWEB)

Mierczynska-Vasilev, Agnieszka, E-mail: agnieszka.mierczynska-vasilev@awri.com.au; Smith, Paul A., E-mail: paul.smith@awri.com.au

2016-11-15

Highlights: • Chemical surface composition affects behaviour of wine adsorption. • SO{sub 3}H and COOH groups adsorb more of the wine nitrogen-containing compounds. • NH{sub 2} and NR{sub 3} groups encourage carbon-containing compounds adsorption. • Red wine constituents after filtration adsorbed more on NR{sub 3} and CHO surfaces. - Abstract: The adsorption of wine constituents at solid surfaces is important in applications such as filtration and membrane fouling, binding to tanks and fittings and interactions with processing aids such as bentonite. The interaction of wine constituents with surfaces is mediated through adsorbed wine components, where the type of constituents, amount, orientation, and conformation are of consequence for the surface response. This study examines the effect of surface chemical functionalities on the adsorption of red wine constituents. Plasma-polymerized films rich in amine, carboxyl, hydroxyl, formyl and methyl functional groups were generated on solid substrates whereas, glycidyltrimethylammonium chloride was covalently attached to allylamine plasma-polymer modified surface and poly(sodium styrenesulfonate) was electrostatically adsorbed to an amine plasma-polymerized surface. The surface chemical functionalities were characterized by X-ray photoelectron spectroscopy. The ability of different substrates to adsorb red wine constituents was evaluated by quartz crystal microbalance and atomic force microscopy. The results showed that substrates modified with −SO{sub 3}H and –COOH groups can adsorb more of the wine nitrogen-containing compounds whereas −NH{sub 2} and −NR{sub 3} groups encourage carbon-containing compounds adsorption. Red wine constituents after filtration were adsorbed in higher extend on −NR{sub 3} and –CHO surfaces. The –OH modified surfaces had the lowest ability to absorb wine components.

Surface modification influencing adsorption of red wine constituents: The role of functional groups

International Nuclear Information System (INIS)

Mierczynska-Vasilev, Agnieszka; Smith, Paul A.

2016-01-01

Highlights: • Chemical surface composition affects behaviour of wine adsorption. • SO_3H and COOH groups adsorb more of the wine nitrogen-containing compounds. • NH_2 and NR_3 groups encourage carbon-containing compounds adsorption. • Red wine constituents after filtration adsorbed more on NR_3 and CHO surfaces. - Abstract: The adsorption of wine constituents at solid surfaces is important in applications such as filtration and membrane fouling, binding to tanks and fittings and interactions with processing aids such as bentonite. The interaction of wine constituents with surfaces is mediated through adsorbed wine components, where the type of constituents, amount, orientation, and conformation are of consequence for the surface response. This study examines the effect of surface chemical functionalities on the adsorption of red wine constituents. Plasma-polymerized films rich in amine, carboxyl, hydroxyl, formyl and methyl functional groups were generated on solid substrates whereas, glycidyltrimethylammonium chloride was covalently attached to allylamine plasma-polymer modified surface and poly(sodium styrenesulfonate) was electrostatically adsorbed to an amine plasma-polymerized surface. The surface chemical functionalities were characterized by X-ray photoelectron spectroscopy. The ability of different substrates to adsorb red wine constituents was evaluated by quartz crystal microbalance and atomic force microscopy. The results showed that substrates modified with −SO_3H and –COOH groups can adsorb more of the wine nitrogen-containing compounds whereas −NH_2 and −NR_3 groups encourage carbon-containing compounds adsorption. Red wine constituents after filtration were adsorbed in higher extend on −NR_3 and –CHO surfaces. The –OH modified surfaces had the lowest ability to absorb wine components.

An investigation of the functional groups on the surface of activated carbons

Directory of Open Access Journals (Sweden)

MARYTE DERVINYTE

2004-05-01

Full Text Available Activated carbons were produced in the laboratory from wood using a 20-run Plackett–Burman experimental design for 19 factors. The obtained batches of activated carbon were analysed by potentiometric titration and FTIR spectroscopy to determine the surface functional groups. The results obtained by potentiometric titration displayed the distribution of individual acidity constants of those groups in the pK range. Considering this parameter, the surface functional groups were divided into carboxyl, lactone and phenol. The linear regression equations reflecting the influence of each operation used for the synthesis on the amount of these functional groups in the obtained activated carbons were generated. The FTIR spectra were used in parallel for the evaluation of the amount and the type of the surface functional groups. Relationships between the two data sets obtained by potentiometric titration and FTIR spectroscopy were evaluated by correlation analysis. It was established that the amount of surface functional groups determined by potentiometric titration positively correlates with the intensity of the peaks of hydrophilic functional groups in the FTIR spectra. At the same time, the negative correlation between potentiometrically determined amount of surface functional groups and the intensity of peaks of hydrophobic functional groups was observed. Most probably, these non-polar formations can take part in the interaction of carbon surface with H+/OH- ions and diminish the strength of existent functional groups.

ARES: automated response function code. Users manual

International Nuclear Information System (INIS)

Maung, T.; Reynolds, G.M.

1981-06-01

This ARES user's manual provides detailed instructions for a general understanding of the Automated Response Function Code and gives step by step instructions for using the complete code package on a HP-1000 system. This code is designed to calculate response functions of NaI gamma-ray detectors, with cylindrical or rectangular geometries

Functional group quantification of polymer nanomembranes with soft x-rays

Science.gov (United States)

Sunday, Daniel F.; Chan, Edwin P.; Orski, Sara V.; Nieuwendaal, Ryan C.; Stafford, Christopher M.

2018-03-01

Polyamide nanomembranes are at the heart of water desalination, a process which plays a critical role in clean water production. Improving their efficiency requires a better understanding of the relationship between chemistry, network structure, and performance but few techniques afford compositional information in ultrathin films (reference materials to establish quantitative relationships between changes in the optical constants and functional group density, and then use the results to evaluate the functional group concentrations of polyamide nanomembranes. We demonstrate that the difference in the amide carbonyl and carboxylic acid group concentrations can be used to calculate the crosslink density, which is shown to vary significantly across three different polyamide chemistries. A clear relationship is established between the functional group density and the permselectivity (α ), indicating that more densely crosslinked materials result in a higher α of the nanomembranes. Finally, measurements on a polyamide/poly(acrylic acid) bilayer demonstrate the ability of this approach to quantify depth-dependent functional group concentrations in thin films.

Functional group diversity is key to Southern Ocean benthic carbon pathways.

Directory of Open Access Journals (Sweden)

David K A Barnes

Full Text Available High latitude benthos are globally important in terms of accumulation and storage of ocean carbon, and the feedback this is likely to have on regional warming. Understanding this ecosystem service is important but difficult because of complex taxonomic diversity, history and geography of benthic biomass. Using South Georgia as a model location (where the history and geography of benthic biology is relatively well studied we investigated whether the composition of functional groups were critical to benthic accumulation, immobilization and burial pathway to sequestration-and also aid their study through simplification of identification. We reclassified [1], [2] morphotype and carbon mass data to 13 functional groups, for each sample of 32 sites around the South Georgia continental shelf. We investigated the influence on carbon accumulation, immobilization and sequestration estimate by multiple factors including the compositions of functional groups. Functional groups showed high diversity within and between sites, and within and between habitat types. Carbon storage was not linked to a functional group in particular but accumulation and immobilization increased with the number of functional groups present and the presence of hard substrata. Functional groups were also important to carbon burial rate, which increased with the presence of mixed (hard and soft substrata. Functional groups showed high surrogacy for taxonomic composition and were useful for examining contrasting habitat categorization. Functional groups not only aid marine carbon storage investigation by reducing time and the need for team size and speciality, but also important to benthic carbon pathways per se. There is a distinct geography to seabed carbon storage; seabed boulder-fields are hotspots of carbon accumulation and immobilization, whilst the interface between such boulder-fields and sediments are key places for burial and sequestration.

Response functions of free mass gravitational wave antennas

Science.gov (United States)

Estabrook, F. B.

1985-01-01

The work of Gursel, Linsay, Spero, Saulson, Whitcomb and Weiss (1984) on the response of a free-mass interferometric antenna is extended. Starting from first principles, the earlier work derived the response of a 2-arm gravitational wave antenna to plane polarized gravitational waves. Equivalent formulas (generalized slightly to allow for arbitrary elliptical polarization) are obtained by a simple differencing of the '3-pulse' Doppler response functions of two 1-arm antennas. A '4-pulse' response function is found, with quite complicated angular dependences for arbitrary incident polarization. The differencing method can as readily be used to write exact response functions ('3n+1 pulse') for antennas having multiple passes or more arms.

Functionalization of graphene and grafting of temperature-responsive surfaces from graphene by ATRP 'on water'

Energy Technology Data Exchange (ETDEWEB)

Ren Lulu; Huang Shu; Zhang Chao; Wang Ruiyu [Fudan University, State Key Laboratory of Molecular Engineering of Polymers, Department of Macromolecular Science (China); Tjiu, Weng Weei [Institute of Materials Research and Engineering, Agency for Science, Technology and Research (A-STAR) (Singapore); Liu Tianxi, E-mail: txliu@fudan.edu.cn [Fudan University, State Key Laboratory of Molecular Engineering of Polymers, Department of Macromolecular Science (China)

2012-06-15

Water-dispersible graphene with temperature-responsive surfaces has successfully been synthesized by grafting poly(N-isopropylacrylamide) (PNIPAM) from graphene via surface-initiated atom transfer radical polymerization (ATRP). First, graphene surfaces are functionalized with aminophenol groups by diazonium reaction on water. Subsequently, bromoisobutyrate groups are covalently attached to the phenol-functionalized graphene (G-OH) surface by esterification of 2-bromoisobutyrate with the hydroxyl groups, forming bromoisobutyrate-functionalized graphene (G-Br). Finally, PNIPAM is then grafted from G-Br via ATRP. Data from Raman spectroscopy, {sup 1}H NMR, and transmission electron microscopy (TEM) confirm that PNIPAM chains grow from graphene by ATRP. Thermogravimetric analysis shows that the amount of PNIPAM grown from the graphene increases with the increase of monomer ratios. TEM images also show that functionalized polymer structures (PNIPAM cluster or agglutination) on graphene sheets can be well tuned by controlled polymerization. The obtained graphene-PNIPAM (G-PNIPAM) composite has PNIPAM surface which is highly sensitive to the temperature change. This temperature-responsive and water-dispersible G-PNIPAM composite may find potential applications in environmental devices as well as controlled release drug delivery.

Feminism and group psychotherapy: an ethical responsibility.

Science.gov (United States)

Lazerson, J

1992-10-01

In response to Martin Lakin's (1991) IJGP article, "Some Ethical Issues in Feminist-Oriented Therapy Groups for Women," this article examines recent developments in feminist theory and proposes that a feminist perspective is both ethical and can make significant contributions to the practice of group psychotherapy. The overview of feminist theory focuses on (1) the importance of the social context, (2) contributions and challenges to psychoanalytic and developmental theory, (3) attention to power relations, (4) the connection between the personal and political, and (5) recognition and integration of diversity and difference. Clinical examples illustrate ways in which male and female group therapists can take a feminist perspective and become "ethical advocates."

Spectral functions and transport coefficients from the functional renormalization group

Energy Technology Data Exchange (ETDEWEB)

Tripolt, Ralf-Arno

2015-06-03

In this thesis we present a new method to obtain real-time quantities like spectral functions and transport coefficients at finite temperature and density using the Functional Renormalization Group approach. Our non-perturbative method is thermodynamically consistent, symmetry preserving and based on an analytic continuation from imaginary to real time on the level of the flow equations. We demonstrate the applicability of this method by calculating mesonic spectral functions as well as the shear viscosity for the quark-meson model. In particular, results are presented for the pion and sigma spectral function at finite temperature and chemical potential, with a focus on the regime near the critical endpoint in the phase diagram of the quark-meson model. Moreover, the different time-like and space-like processes, which give rise to a complex structure of the spectral functions, are discussed. Finally, based on the momentum dependence of the spectral functions, we calculate the shear viscosity and the shear viscosity to entropy density ratio using the corresponding Green-Kubo formula.

Social skills group training in high-functioning autism: A qualitative responder study.

Science.gov (United States)

Choque Olsson, Nora; Rautio, Daniel; Asztalos, Jenny; Stoetzer, Ulrich; Bölte, Sven

2016-11-01

Systematic reviews show some evidence for the efficacy of group-based social skills group training in children and adolescents with autism spectrum disorder, but more rigorous research is needed to endorse generalizability. In addition, little is known about the perspectives of autistic individuals participating in social skills group training. Using a qualitative approach, the objective of this study was to examine experiences and opinions about social skills group training of children and adolescents with higher functioning autism spectrum disorder and their parents following participation in a manualized social skills group training ("KONTAKT"). Within an ongoing randomized controlled clinical trial (NCT01854346) and based on outcome data from the Social Responsiveness Scale, six high responders and five low-to-non-responders to social skills group training and one parent of each child (N = 22) were deep interviewed. Interestingly, both high responders and low-to-non-responders (and their parents) reported improvements in social communication and related skills (e.g. awareness of own difficulties, self-confidence, independence in everyday life) and overall treatment satisfaction, although more positive intervention experiences were expressed by responders. These findings highlight the added value of collecting verbal data in addition to quantitative data in a comprehensive evaluation of social skills group training. © The Author(s) 2016.

Fish functional groups in a tropical wetland of the Yucatan Peninsula, Mexico

Directory of Open Access Journals (Sweden)

Fernando Córdova-Tapia

Full Text Available ABSTRACT The characterization of species' functional traits is a major step in the understanding and description of communities in natural habitats. The classification of species into functional groups is a useful tool to identify redundancy and uniqueness. We studied the fish community of a pristine freshwater wetland in the Sian Ka'an Biosphere Reserve by analysing two multidimensional functions: food acquisition and locomotion. We investigated changes in the functional group structure between habitats (permanent and temporary pools and seasons (dry and wet. Six functional groups with different ecological characteristics were detected, two of which had high functional redundancy and three of them were represented by single species with unique ecological functions. In permanent pools during the dry season, functional group richness and diversity were lower, while evenness was higher. During the wet season, all functional groups were detected and similar functional group structure was found between habitats. These results suggest an effect of environmental filtering during the dry season and niche complementarity during the wet season.

Radiological emergency response - a functional approach

International Nuclear Information System (INIS)

Chowdhury, Prosanta

1997-01-01

The radiological emergency response program in the State of Louisiana is discussed. The improved approach intends to maximize the efficiency for both nuclear power plant and radiological emergency response as a whole. Several broad-based components are identified: cluster of 'nodes' are generated for each component; these 'nodes' may be divided into 'sub-nodes' which will contain some 'attributes'; 'relational bonds' among the 'attributes' will exist. When executed, the process begins and continues with the 'nodes' assuming a functional and dynamic role based on the nature and characteristics of the 'attributes'. The typical response based on stand-alone elements is eliminated; overlapping of functions is avoided, and is produced a well-structure and efficient organization

Thermal-nutritional regulation of functional groups in running water ecosystems. Technical progress report, October 1, 1978-November 1, 1980

Energy Technology Data Exchange (ETDEWEB)

Cummins, K.W.

1980-11-01

The research encompassed three general areas: (1) characterization of stream macroinvertebrate functional feeding groups (shredders, collectors, scrapers, and predators) based on morphological and behavioral adaptations and food-source-specific growth responses of selected species; (2) demonstration of the relative importance of temperature and food quality (in which maximum quality is defined as that producing the most growth) in controlling growth rate and survivorship of stream functional groups; and (3) derivation and refinement of conceptual and quantitative models of stream ecosystem structure and function, with particular emphasis on detrital processing. Verification of the functional group concept as a tool for assessing and predicting is reflected in alterations of the relative dominance of various functional groups. Food quality can strongly influence the growth rates of shredders, collectors and scrapers and override the effects of temperature in a number of cases. Gathering collectors may select food particles by size (or at least be restricted to a limited portion of the total range available) but representative species do not appear to select for quality.

AGE STRUCTURE OR FUNCTIONAL RESPONSE? RECONCILING ...

African Journals Online (AJOL)

... surplus production that differ from traditional single-species management models. ... Specifically, while the ECOSIM “Arena” functional response and the von ... as a proxy for age structure rather than as a function of predator/prey behaviour, ...

Subtle cytotoxicity and genotoxicity differences in superparamagnetic iron oxide nanoparticles coated with various functional groups

Directory of Open Access Journals (Sweden)

Hong SC

2011-12-01

, and DNA stability in L-929 fibroblasts were determined by water-soluble tetrazolium, 2',7'-dichlorodihydrofluorescein, lactate dehydrogenase, and comet assays, respectively. Our toxicological observations suggest that the functional groups and sizes of SPIONs are critical determinants of cellular responses, degrees of cytotoxicity and genotoxicity, and potential mechanisms of toxicity. Nanoparticles with various surface modifications and of different sizes induced slight, but possibly meaningful, changes in cell cytotoxicity and genotoxicity, which would be significantly valuable in further studies of bioconjugation and cell interaction for drug delivery, cell culture, and cancer-targeting applications.Keywords: superparamagnetic iron oxide nanoparticles, surface functional groups, cytotoxicity, genotoxicity

Unique transcriptomic response to sepsis is observed among patients of different age groups.

Science.gov (United States)

Raymond, Steven L; López, María Cecilia; Baker, Henry V; Larson, Shawn D; Efron, Philip A; Sweeney, Timothy E; Khatri, Purvesh; Moldawer, Lyle L; Wynn, James L

2017-01-01

Sepsis is a major cause of morbidity and mortality, especially at the extremes of age. To understand the human age-specific transcriptomic response to sepsis, a multi-cohort, pooled analysis was conducted on adults, children, infants, and neonates with and without sepsis. Nine public whole-blood gene expression datasets (636 patients) were employed. Age impacted the transcriptomic host response to sepsis. Gene expression from septic neonates and adults was more dissimilar whereas infants and children were more similar. Neonates showed reductions in inflammatory recognition and signaling pathways compared to all other age groups. Likewise, adults demonstrated decreased pathogen sensing, inflammation, and myeloid cell function, as compared to children. This may help to explain the increased incidence of sepsis-related organ failure and death in adults. The number of dysregulated genes in septic patients was proportional to age and significantly differed among septic adults, children, infants, and neonates. Overall, children manifested a greater transcriptomic intensity to sepsis as compared to the other age groups. The transcriptomic magnitude for adults and neonates was dramatically reduced as compared to children and infants. These findings suggest that the transcriptomic response to sepsis is age-dependent, and diagnostic and therapeutic efforts to identify and treat sepsis will have to consider age as an important variable.

Enhanced prefrontal function with pharmacotherapy on a response inhibition task in adolescent bipolar disorder.

Science.gov (United States)

Pavuluri, Mani N; Passarotti, Alessandra M; Harral, Erin M; Sweeney, John A

2010-11-01

The aim of the current study is to determine whether pharmacotherapy normalizes cognitive circuitry function supporting voluntary behavioral inhibition in adolescent bipolar disorder. Healthy controls and unmedicated patients with DSM-IV adolescent bipolar disorder in manic, mixed, or hypomanic episodes were matched on demographics and IQ (n = 13 per group; mean age = 14.4 ± 2.4 years). Functional magnetic resonance imaging studies were performed at baseline and after 14 weeks, during which time patients with adolescent bipolar disorder were treated initially with second-generation antipsychotics (SGAs) followed by lamotrigine monotherapy. The primary outcome measure was a Response Inhibition Task, which involved a planned motor response, already "on the way" to execution, that had to be voluntarily inhibited by the subjects in the trials in which a stop signal was presented. There were 6 blocks, each with a predominant rate of either "go" or "stop" trials. The study was conducted from June 2006 through July 2009. All patients showed significant improvement (P adolescent bipolar disorder group than in healthy controls. Increased ventrolateral prefrontal cortex function was related to clinical treatment response. Treatment with SGAs followed by lamotrigine monotherapy enhanced prefrontal and temporal lobe activity during a Response Inhibition Task demonstrating the reversal of disorder-relevant neural circuitry dysfunction in patients with adolescent bipolar disorder. Patient performance was not slowed down with this treatment regimen. clinicaltrials.gov Identifier: NCT00176228. © Copyright 2010 Physicians Postgraduate Press, Inc.

Implement the medical group revenue function. Create competitive advantage.

Science.gov (United States)

Colucci, C

1998-01-01

This article shows medical groups how they can employ new financial management and information technology techniques to safeguard their revenue and income streams. These managerial techniques stem from the application of the medical group revenue function, which is defined herein. This article also describes how the medical group revenue function can be used to create value by employing a database and a decision support system. Finally, the article describes how the decision support system can be used to create competitive advantage. Through the wise use of internally generated information, medical groups can negotiate better contract terms, improve their operations, cut their costs, embark on capital investment programs and improve market share. As medical groups gain market power by improving in these areas, they will be more attractive to potential strategic allies, payers and investment bankers.

Radiological emergency response - a functional approach

Energy Technology Data Exchange (ETDEWEB)

Chowdhury, Prosanta [Louisiana Radiation Protection Div., Baton Rouge, LA (United States)

1997-12-31

The radiological emergency response program in the State of Louisiana is discussed. The improved approach intends to maximize the efficiency for both nuclear power plant and radiological emergency response as a whole. Several broad-based components are identified: cluster of `nodes` are generated for each component; these `nodes` may be divided into `sub-nodes` which will contain some `attributes`; `relational bonds` among the `attributes` will exist. When executed, the process begins and continues with the `nodes` assuming a functional and dynamic role based on the nature and characteristics of the `attributes`. The typical response based on stand-alone elements is eliminated; overlapping of functions is avoided, and is produced a well-structure and efficient organization 1 ref., 6 figs.; e-mail: prosanta at deq.state.la.us

Functional brain response to food images in successful adolescent weight losers compared with normal-weight and overweight controls.

Science.gov (United States)

Jensen, Chad D; Kirwan, C Brock

2015-03-01

Research conducted with adults suggests that successful weight losers demonstrate greater activation in brain regions associated with executive control in response to viewing high-energy foods. No previous studies have examined these associations in adolescents. Functional neuroimaging was used to assess brain response to food images among groups of overweight (OW), normal-weight (NW), and successful weight-losing (SWL) adolescents. Eleven SWL, 12 NW, and 11 OW participants underwent functional magnetic resonance imaging while viewing images of high- and low-energy foods. When viewing high-energy food images, SWLs demonstrated greater activation in the dorsolateral prefrontal cortex (DLPFC) compared with OW and NW controls. Compared with NW and SWL groups, OW individuals demonstrated greater activation in the ventral striatum and anterior cingulate in response to food images. Adolescent SWLs demonstrated greater neural activation in the DLPFC compared with OW/NW controls when viewing high-energy food stimuli, which may indicate enhanced executive control. OW individuals' brain responses to food stimuli may indicate greater reward incentive processes than either SWL or NW groups. © 2015 The Obesity Society.

Nonlinear optical and optical limiting properties of fullerene, multi-walled carbon nanotubes, graphene and their derivatives with oxygen-containing functional groups

International Nuclear Information System (INIS)

Zhang, Xiao-Liang; Li, Xiao-Chun; Liu, Zhi-Bo; Yan, Xiao-Qing; Tian, Jian-Guo; Chen, Yong-Sheng

2015-01-01

Nonlinear optical properties (NLO) and optical limiting effect of fullerene (C 60 ), multi-walled carbon nanotubes (MWNTs), reduced graphene oxide (RGO) and their oxygenated derivatives were investigated by open-aperture Z-scan technique with nanosecond pulses at 532 nm. C 60 functionalized by oxygen-containing functional groups exhibits weaker NLO properties than that of pristine C 60 . Graphene oxide (GO) with many oxygen-containing functional groups also shows weaker NLO properties than that of RGO. That can be attributed to the disruption of conjugative structures of C 60 and graphene by oxygen-containing functional groups. However, MWNTs and their oxygenated derivatives exhibit comparable NLO properties due to the small weight ratio of these oxygen-containing groups. To investigate the correlation between structures and NLO response for these carbon nanomaterials with different dimensions, nonlinear scattered signal spectra versus input fluence were also measured. (paper)

Prediction of functional sites in proteins using conserved functional group analysis.

Science.gov (United States)

Innis, C Axel; Anand, A Prem; Sowdhamini, R

2004-04-02

A detailed knowledge of a protein's functional site is an absolute prerequisite for understanding its mode of action at the molecular level. However, the rapid pace at which sequence and structural information is being accumulated for proteins greatly exceeds our ability to determine their biochemical roles experimentally. As a result, computational methods are required which allow for the efficient processing of the evolutionary information contained in this wealth of data, in particular that related to the nature and location of functionally important sites and residues. The method presented here, referred to as conserved functional group (CFG) analysis, relies on a simplified representation of the chemical groups found in amino acid side-chains to identify functional sites from a single protein structure and a number of its sequence homologues. We show that CFG analysis can fully or partially predict the location of functional sites in approximately 96% of the 470 cases tested and that, unlike other methods available, it is able to tolerate wide variations in sequence identity. In addition, we discuss its potential in a structural genomics context, where automation, scalability and efficiency are critical, and an increasing number of protein structures are determined with no prior knowledge of function. This is exemplified by our analysis of the hypothetical protein Ydde_Ecoli, whose structure was recently solved by members of the North East Structural Genomics consortium. Although the proposed active site for this protein needs to be validated experimentally, this example illustrates the scope of CFG analysis as a general tool for the identification of residues likely to play an important role in a protein's biochemical function. Thus, our method offers a convenient solution to rapidly and automatically process the vast amounts of data that are beginning to emerge from structural genomics projects.

Differential symptomatology and functioning in borderline personality disorder across age groups.

Science.gov (United States)

Frías, Álvaro; Palma, Carol; Solves, Laia; Martínez, Bárbara; Salvador, Ana

2017-12-01

There is increasing research aimed at addressing whether patients with borderline personality disorder (BPD) may exhibit variations in symptomatology and functioning according to their chronological age. The current study consisted of 169 outpatients diagnosed with BPD, who were divided into four age groups as follows: 16-25 years (n = 41), 26-35 years (n = 43), 36-45 years (n = 45), and 46 and more years (n = 40). Age groups were compared for symptomatology, normal personality traits, psychiatric comorbidities, functioning, and treatment-related features. The younger group had significantly higher levels of physical/verbal aggression and suicide attempts relative to the older group. Conversely, the older group had significantly greater severity of somatization, depression, and anxiety symptoms. In addition, the older group showed significantly greater functional impairment overall and across physical/psychological domains, specifically when compared to the younger group. Overall, these findings may suggest that age-related symptoms should be considered when diagnosing BPD. Also, functional impairments should be the target interventions for older BPD patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Observations of Adolescent Peer Group Interactions as a Function of Within- and Between-Group Centrality Status

Science.gov (United States)

Ellis, Wendy E.; Dumas, Tara M.; Mahdy, Jasmine C.; Wolfe, David A.

2012-01-01

Observations of adolescent (n = 258; M age = 15.45) peer group triads (n = 86) were analyzed to identify conversation and interaction styles as a function of within-group and between-group centrality status. Group members' discussions about hypothetical dilemmas were coded for agreements, disagreements, commands, and opinions. Interactions during…

Behavioral responses in structured populations pave the way to group optimality.

Science.gov (United States)

Akçay, Erol; Van Cleve, Jeremy

2012-02-01

An unresolved controversy regarding social behaviors is exemplified when natural selection might lead to behaviors that maximize fitness at the social-group level but are costly at the individual level. Except for the special case of groups of clones, we do not have a general understanding of how and when group-optimal behaviors evolve, especially when the behaviors in question are flexible. To address this question, we develop a general model that integrates behavioral plasticity in social interactions with the action of natural selection in structured populations. We find that group-optimal behaviors can evolve, even without clonal groups, if individuals exhibit appropriate behavioral responses to each other's actions. The evolution of such behavioral responses, in turn, is predicated on the nature of the proximate behavioral mechanisms. We model a particular class of proximate mechanisms, prosocial preferences, and find that such preferences evolve to sustain maximum group benefit under certain levels of relatedness and certain ecological conditions. Thus, our model demonstrates the fundamental interplay between behavioral responses and relatedness in determining the course of social evolution. We also highlight the crucial role of proximate mechanisms such as prosocial preferences in the evolution of behavioral responses and in facilitating evolutionary transitions in individuality.

Semiclassical theory for the nuclear response function

International Nuclear Information System (INIS)

Stroth, U.

1986-01-01

In the first part of this thesis it was demonstrated how on a semiclassical base a RPA theory is developed and applied to electron scattering. It was shown in which fields of nuclear physics this semiclassical theory can be applied and how it is to be understood. In this connection we dedicated an extensive discussion to the Fermi gas model. From the free response function we calculated the RPA response with a finite-range residual interaction which we completely antisymmetrize. In the second part of this thesis we studied with our theory (e,e') data for the separated response functions. (orig./HSI) [de

Fanconi anemia group A and C double-mutant mice: functional evidence for a multi-protein Fanconi anemia complex.

Science.gov (United States)

Noll, Meenakshi; Battaile, Kevin P; Bateman, Raynard; Lax, Timothy P; Rathbun, Keany; Reifsteck, Carol; Bagby, Grover; Finegold, Milton; Olson, Susan; Grompe, Markus

2002-07-01

Fanconi anemia (FA) is a genetically heterogeneous disorder associated with defects in at least eight genes. The biochemical function(s) of the FA proteins are unknown, but together they define the FA pathway, which is involved in cellular responses to DNA damage and in other cellular processes. It is currently unknown whether all FA proteins are involved in controlling a single function or whether some of the FA proteins have additional roles. The aim of this study was 1) to determine whether the FA group A and group C genes have identical or partially distinct functions, and 2) to have a better model for human FA. We generated mice with a targeted mutation in fanca and crossed them with fancc disrupted animals. Several phenotypes including sensitivity to DNA cross linkers and ionizing radiation, hematopoietic colony growth, and germ cell loss were analyzed in fanca-/-, fancc-/-, fanca/fancc double -/-, and controls. Fibroblast cells and hematopoietic precursors from fanca/fancc double-mutant mice were not more sensitive to MMC than those of either single mutant. fanca/fancc double mutants had no evidence for an additive phenotype at the cellular or organismal level. These results support a model where both FANCA and FANCC are part of a multi-protein nuclear FA complex with identical function in cellular responses to DNA damage and germ cell survival.

Functional and structural responses to marine urbanisation

Science.gov (United States)

Mayer-Pinto, M.; Cole, V. J.; Johnston, E. L.; Bugnot, A.; Hurst, H.; Airoldi, L.; Glasby, T. M.; Dafforn, K. A.

2018-01-01

Urban areas have broad ecological footprints with complex impacts on natural systems. In coastal areas, growing populations are advancing their urban footprint into the ocean through the construction of seawalls and other built infrastructure. While we have some understanding of how urbanisation might drive functional change in terrestrial ecosystems, coastal systems have been largely overlooked. This study is one of the first to directly assess how changes in diversity relate to changes in ecosystem properties and functions (e.g. productivity, filtration rates) of artificial and natural habitats in one of the largest urbanised estuaries in the world, Sydney Harbour. We complemented our surveys with an extensive literature search. We found large and important differences in the community structure and function between artificial and natural coastal habitats. However, differences in diversity and abundance of organisms do not necessarily match observed functional changes. The abundance and composition of important functional groups differed among habitats with rocky shores having 40% and 70% more grazers than seawalls or pilings, respectively. In contrast, scavengers were approximately 8 times more abundant on seawalls than on pilings or rocky shores and algae were more diverse on natural rocky shores and seawalls than on pilings. Our results confirm previous findings in the literature. Oysters were more abundant on pilings than on rocky shores, but were also smaller. Interestingly, these differences in oyster populations did not affect in situ filtration rates between habitats. Seawalls were the most invaded habitats while pilings supported greater secondary productivity than other habitats. This study highlights the complexity of the diversity-function relationship and responses to ocean sprawl in coastal systems. Importantly, we showed that functional properties should be considered independently from structural change if we are to design and manage artificial

β2-adrenergic receptor-mediated negative regulation of group 2 innate lymphoid cell responses.

Science.gov (United States)

Moriyama, Saya; Brestoff, Jonathan R; Flamar, Anne-Laure; Moeller, Jesper B; Klose, Christoph S N; Rankin, Lucille C; Yudanin, Naomi A; Monticelli, Laurel A; Putzel, Gregory Garbès; Rodewald, Hans-Reimer; Artis, David

2018-03-02

The type 2 inflammatory response is induced by various environmental and infectious stimuli. Although recent studies identified group 2 innate lymphoid cells (ILC2s) as potent sources of type 2 cytokines, the molecular pathways controlling ILC2 responses are incompletely defined. Here we demonstrate that murine ILC2s express the β 2 -adrenergic receptor (β 2 AR) and colocalize with adrenergic neurons in the intestine. β 2 AR deficiency resulted in exaggerated ILC2 responses and type 2 inflammation in intestinal and lung tissues. Conversely, β 2 AR agonist treatment was associated with impaired ILC2 responses and reduced inflammation in vivo. Mechanistically, we demonstrate that the β 2 AR pathway is a cell-intrinsic negative regulator of ILC2 responses through inhibition of cell proliferation and effector function. Collectively, these data provide the first evidence of a neuronal-derived regulatory circuit that limits ILC2-dependent type 2 inflammation. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Longitudinal and transverse quasielastic response functions of light nuclei

International Nuclear Information System (INIS)

Carlson, J.; Jourdan, J.; Sick, I.; Schiavilla, R.

2002-01-01

The 3 He and 4 He longitudinal and transverse response functions are determined from an analysis of the world data on quasielastic inclusive electron scattering. The corresponding Euclidean response functions are derived and compared to those calculated with Green's function Monte Carlo methods, using realistic interactions and currents. Large contributions associated with two-body currents are found, particularly in the 4 He transverse response, in agreement with data. The contributions of the two-body charge and current operators in the 3 He, 4 He, and 6 Li response functions are also studied via sum-rule techniques. A semiquantitative explanation for the observed systematics in the excess of transverse quasielastic strength, as function of mass number and momentum transfer, is provided. Finally, a number of model studies with simplified interactions, currents, and wave functions are carried out to elucidate the role played, in the full calculation, by tensor interactions and correlations

Global biodiversity, stoichiometry and ecosystem function responses to human-induced C-N-P imbalances.

Science.gov (United States)

Carnicer, Jofre; Sardans, Jordi; Stefanescu, Constantí; Ubach, Andreu; Bartrons, Mireia; Asensio, Dolores; Peñuelas, Josep

2015-01-01

Global change analyses usually consider biodiversity as a global asset that needs to be preserved. Biodiversity is frequently analysed mainly as a response variable affected by diverse environmental drivers. However, recent studies highlight that gradients of biodiversity are associated with gradual changes in the distribution of key dominant functional groups characterized by distinctive traits and stoichiometry, which in turn often define the rates of ecosystem processes and nutrient cycling. Moreover, pervasive links have been reported between biodiversity, food web structure, ecosystem function and species stoichiometry. Here we review current global stoichiometric gradients and how future distributional shifts in key functional groups may in turn influence basic ecosystem functions (production, nutrient cycling, decomposition) and therefore could exert a feedback effect on stoichiometric gradients. The C-N-P stoichiometry of most primary producers (phytoplankton, algae, plants) has been linked to functional trait continua (i.e. to major axes of phenotypic variation observed in inter-specific analyses of multiple traits). In contrast, the C-N-P stoichiometry of higher-level consumers remains less precisely quantified in many taxonomic groups. We show that significant links are observed between trait continua across trophic levels. In spite of recent advances, the future reciprocal feedbacks between key functional groups, biodiversity and ecosystem functions remain largely uncertain. The reported evidence, however, highlights the key role of stoichiometric traits and suggests the need of a progressive shift towards an ecosystemic and stoichiometric perspective in global biodiversity analyses. Copyright © 2014 Elsevier GmbH. All rights reserved.

Executive function in different groups of university students

OpenAIRE

Prosen, Simona; Smrtnik Vitulić, Helena

2015-01-01

The present study analyses the executive function (EF) skills of 369 students of primary education (n = 116), preschool education (n = 72), social pedagogy (n = 54), and biology (n = 128). It explores how the different groups of students use selected executive skills and whether there are any differences between the groups in this respect. Eleven EF skills were self-assessed using the Executive Skills Questionnaire for Students (Dawson & Guare, 2010). All of the groups of students experien...

The role of ZIP transporters and group F bZIP transcription factors in the Zn-deficiency response of wheat (Triticum aestivum).

Science.gov (United States)

Evens, Nicholas P; Buchner, Peter; Williams, Lorraine E; Hawkesford, Malcolm J

2017-10-01

Understanding the molecular basis of zinc (Zn) uptake and transport in staple cereal crops is critical for improving both Zn content and tolerance to low-Zn soils. This study demonstrates the importance of group F bZIP transcription factors and ZIP transporters in responses to Zn deficiency in wheat (Triticum aestivum). Seven group F TabZIP genes and 14 ZIPs with homeologs were identified in hexaploid wheat. Promoter analysis revealed the presence of Zn-deficiency-response elements (ZDREs) in a number of the ZIPs. Functional complementation of the zrt1/zrt2 yeast mutant by TaZIP3, -6, -7, -9 and -13 supported an ability to transport Zn. Group F TabZIPs contain the group-defining cysteine-histidine-rich motifs, which are the predicted binding site of Zn 2+ in the Zn-deficiency response. Conservation of these motifs varied between the TabZIPs suggesting that individual TabZIPs may have specific roles in the wheat Zn-homeostatic network. Increased expression in response to low Zn levels was observed for several of the wheat ZIPs and bZIPs; this varied temporally and spatially suggesting specific functions in the response mechanism. The ability of the group F TabZIPs to bind to specific ZDREs in the promoters of TaZIPs indicates a conserved mechanism in monocots and dicots in responding to Zn deficiency. In support of this, TabZIPF1-7DL and TabZIPF4-7AL afforded a strong level of rescue to the Arabidopsis hypersensitive bzip19 bzip23 double mutant under Zn deficiency. These results provide a greater understanding of Zn-homeostatic mechanisms in wheat, demonstrating an expanded repertoire of group F bZIP transcription factors, adding to the complexity of Zn homeostasis. © 2017 The Authors The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

Autoimmune Response Confers Decreased Cardiac Function in ...

African Journals Online (AJOL)

inflammatory response; rather, autoimmune response would keep affecting decreased heart function in. RHD patients who ... untreated children. Nearly 30 - 45 % of the affected children could ..... Technology Department of Anhui Province (PR.

Synthesis, radiometric determination of functional groups, complexation

International Nuclear Information System (INIS)

Pompe, S.; Bubner, M.; Schmeide, K.; Heise, K.H.; Bernhard, G.; Nitsche, H.

2000-01-01

The interaction behavior of humic acids with uranium(VI) and the influence of humic substances on the migration behavior of uranium was investigated. A main focus of this work was the synthesis of four different humic acid model substances and their characterization and comparison to the natural humic acid from Aldrich. A radiometric method for the determination of humic acid functional groups was applied in addition to conventional methods for the determination of the functionality of humic acids. The humic acid model substances show functional and structural properties comparable to natural humic acids. Modified humic acids with blocked phenolic OH were synthesized to determine the influence of phenolic OH groups on the complexation behavior of humic acids. A synthesis method for 14 C-labeled humic acids with high specific activity was developed. The complexation behavior of synthetic and natural humic acids with uranium(VI) was investigated by X-ray absorption spectroscopy, laser-induced fluorescence spectroscopy and FTIR spectroscopy. The synthetic model substances show an interaction behavior with uranium(VI) that is comparable to natural humic acids. This points to the fact that the synthetic humic acids simulate the functionality of their natural analogues very well. For the first time the influence of phenolic OH groups on the complexation behavior of humic acids was investigated by applying a modified humic acid with blocked phenolic OH groups. The formation of a uranyl hydroxy humate complex was identified by laserspectroscopic investigations of the complexation of Aldrich humic acid with uranium(VI) at pH 7. The migration behavior of uranium in a sandy aquifer system rich is humic substances was investigated in column experiments. A part of uranium migrates non-retarded through the sediment, bound to humic colloids. The uranium migration behavior is strongly influenced by the kinetically controlled interaction processes of uranium with the humic colloids

Model parameters for representative wetland plant functional groups

Science.gov (United States)

Williams, Amber S.; Kiniry, James R.; Mushet, David M.; Smith, Loren M.; McMurry, Scott T.; Attebury, Kelly; Lang, Megan; McCarty, Gregory W.; Shaffer, Jill A.; Effland, William R.; Johnson, Mari-Vaughn V.

2017-01-01

Wetlands provide a wide variety of ecosystem services including water quality remediation, biodiversity refugia, groundwater recharge, and floodwater storage. Realistic estimation of ecosystem service benefits associated with wetlands requires reasonable simulation of the hydrology of each site and realistic simulation of the upland and wetland plant growth cycles. Objectives of this study were to quantify leaf area index (LAI), light extinction coefficient (k), and plant nitrogen (N), phosphorus (P), and potassium (K) concentrations in natural stands of representative plant species for some major plant functional groups in the United States. Functional groups in this study were based on these parameters and plant growth types to enable process-based modeling. We collected data at four locations representing some of the main wetland regions of the United States. At each site, we collected on-the-ground measurements of fraction of light intercepted, LAI, and dry matter within the 2013–2015 growing seasons. Maximum LAI and k variables showed noticeable variations among sites and years, while overall averages and functional group averages give useful estimates for multisite simulation modeling. Variation within each species gives an indication of what can be expected in such natural ecosystems. For P and K, the concentrations from highest to lowest were spikerush (Eleocharis macrostachya), reed canary grass (Phalaris arundinacea), smartweed (Polygonum spp.), cattail (Typha spp.), and hardstem bulrush (Schoenoplectus acutus). Spikerush had the highest N concentration, followed by smartweed, bulrush, reed canary grass, and then cattail. These parameters will be useful for the actual wetland species measured and for the wetland plant functional groups they represent. These parameters and the associated process-based models offer promise as valuable tools for evaluating environmental benefits of wetlands and for evaluating impacts of various agronomic practices in

Renormalization group, principle of invariance and functional automodelity

International Nuclear Information System (INIS)

Shirkov, D.V.

1981-01-01

There exists a remarkable identity of functional equations describing the property of functional automodelity in diverse branches of physics: renormalization group equations in quantum field theory, functional equations of the invariance principle of the one-dimensional transport theory and some others. The origin of this identity is investigated. It is shown that the structure of these equations reflects the simple and general property of transitivity with respect to the way of fixatio of initial on effective degrees of freedom [ru

Response functions of superfluid neutron matter

Energy Technology Data Exchange (ETDEWEB)

Keller, Jochen; Sedrakian, Armen [Institut fuer Theoretische Physik, Goethe Universitaet, 60438 Frankfurt/Main (Germany)

2011-07-01

We investigate the response of pair-correlated neutron matter under conditions relevant to neutron stars to external weak probes and compute its neutrino emissivity in vector and axialvector channels. To derive the response functions we sum up an infinite chain of particle-hole ladder diagrams within finite-temperature Green's function theory. The polarization tensor of matter is evaluated in the limit of small momentum transfers. The calculated neutrino emission via the weak neutral current processes of pair-breaking and recombination of Cooper-pairs in neutron stars causes a cooling of their baryonic interior, and represents an important mechanism for the thermal evolution of the star within a certain time domain.

Resolving Microzooplankton Functional Groups In A Size-Structured Planktonic Model

Science.gov (United States)

Taniguchi, D.; Dutkiewicz, S.; Follows, M. J.; Jahn, O.; Menden-Deuer, S.

2016-02-01

Microzooplankton are important marine grazers, often consuming a large fraction of primary productivity. They consist of a great diversity of organisms with different behaviors, characteristics, and rates. This functional diversity, and its consequences, are not currently reflected in large-scale ocean ecological simulations. How should these organisms be represented, and what are the implications for their biogeography? We develop a size-structured, trait-based model to characterize a diversity of microzooplankton functional groups. We compile and examine size-based laboratory data on the traits, revealing some patterns with size and functional group that we interpret with mechanistic theory. Fitting the model to the data provides parameterizations of key rates and properties, which we employ in a numerical ocean model. The diversity of grazing preference, rates, and trophic strategies enables the coexistence of different functional groups of micro-grazers under various environmental conditions, and the model produces testable predictions of the biogeography.

Power and status within small groups: An analysis of students' verbal and nonverbal behavior and responses to one another

Science.gov (United States)

Morris, Lynnae Carol

The purpose of this research has been to determine the influence of verbal and nonverbal behavior on power and status within small groups. The interactions which took place within five small groups of students in a middle school spatial reasoning elective were analyzed. Verbal responses to requests for help were analyzed using sequential analysis techniques. Results indicated that the identity of the student asking a question or requesting help in some form or another is a better predictor of whether he/she will receive help than the type of questions he/she asks. Nonverbal behavior was analyzed for social gestures, body language, and shifts in possession of tools. Each nonverbal act was coded as either "positive" (encouraging participation) or "negative" (discouraging participation); and, the researchers found that in groups in which there was unequal participation and less "help" provided among peers (according to the verbal analysis results) there tended to be more "negative" nonverbal behavior demonstrated than in groups in which "shared talk time" and "helping behavior" were common characteristics of the norm. The combined results from the analyses of the verbal and nonverbal behavior of students within small groups were then reviewed through the conflict, power, status perspective of small group interactions in order to determine some common characteristics of high functioning (collaborative) and low functioning (non-collaborative) groups. Some common characteristics of the higher functioning groups include: few instances of conflict, shared "talk time" and decision making, inclusive leadership, frequent use of encouraging social gestures and body language, and more sharing of tools than seizing. Some shared traits among the lower functioning groups include: frequent occurrences of interpersonal conflict, a focus on process (rather than content), persuasive or alienating leadership, unequal participation and power, frequent use of discouraging social gestures

Unique determination of the effective potential in terms of renormalization group functions

International Nuclear Information System (INIS)

Chishtie, F. A.; Hanif, T.; McKeon, D. G. C.; Steele, T. G.

2008-01-01

The perturbative effective potential V in the massless λφ 4 model with a global O(N) symmetry is uniquely determined to all orders by the renormalization group functions alone when the Coleman-Weinberg renormalization condition (d 4 V/dφ 4 )| φ=μ =λ is used, where μ represents the renormalization scale. Systematic methods are developed to express the n-loop effective potential in the Coleman-Weinberg scheme in terms of the known n-loop minimal-subtraction (MS) renormalization group functions. Moreover, it also proves possible to sum the leading- and subsequent-to-leading-logarithm contributions to V. An essential element of this analysis is a conversion of the renormalization group functions in the Coleman-Weinberg scheme to the renormalization group functions in the MS scheme. As an example, the explicit five-loop effective potential is obtained from the known five-loop MS renormalization group functions and we explicitly sum the leading-logarithm, next-to-leading-logarithm, and further subleading-logarithm contributions to V. Extensions of these results to massless scalar QED are also presented. Because massless scalar QED has two couplings, conversion of the renormalization group functions from the MS scheme to the Coleman-Weinberg scheme requires the use of multiscale renormalization group methods.

Direct quantification of negatively charged functional groups on membrane surfaces

KAUST Repository

Tiraferri, Alberto

2012-02-01

Surface charge plays an important role in membrane-based separations of particulates, macromolecules, and dissolved ionic species. In this study, we present two experimental methods to determine the concentration of negatively charged functional groups at the surface of dense polymeric membranes. Both techniques consist of associating the membrane surface moieties with chemical probes, followed by quantification of the bound probes. Uranyl acetate and toluidine blue O dye, which interact with the membrane functional groups via complexation and electrostatic interaction, respectively, were used as probes. The amount of associated probes was quantified using liquid scintillation counting for uranium atoms and visible light spectroscopy for the toluidine blue dye. The techniques were validated using self-assembled monolayers of alkanethiols with known amounts of charged moieties. The surface density of negatively charged functional groups of hand-cast thin-film composite polyamide membranes, as well as commercial cellulose triacetate and polyamide membranes, was quantified under various conditions. Using both techniques, we measured a negatively charged functional group density of 20-30nm -2 for the hand-cast thin-film composite membranes. The ionization behavior of the membrane functional groups, determined from measurements with toluidine blue at varying pH, was consistent with published data for thin-film composite polyamide membranes. Similarly, the measured charge densities on commercial membranes were in general agreement with previous investigations. The relative simplicity of the two methods makes them a useful tool for quantifying the surface charge concentration of a variety of surfaces, including separation membranes. © 2011 Elsevier B.V.

Silicon Drift Detector response function for PIXE spectra fitting

Science.gov (United States)

Calzolai, G.; Tapinassi, S.; Chiari, M.; Giannoni, M.; Nava, S.; Pazzi, G.; Lucarelli, F.

2018-02-01

The correct determination of the X-ray peak areas in PIXE spectra by fitting with a computer program depends crucially on accurate parameterization of the detector peak response function. In the Guelph PIXE software package, GUPIXWin, one of the most used PIXE spectra analysis code, the response of a semiconductor detector to monochromatic X-ray radiation is described by a linear combination of several analytical functions: a Gaussian profile for the X-ray line itself, and additional tail contributions (exponential tails and step functions) on the low-energy side of the X-ray line to describe incomplete charge collection effects. The literature on the spectral response of silicon X-ray detectors for PIXE applications is rather scarce, in particular data for Silicon Drift Detectors (SDD) and for a large range of X-ray energies are missing. Using a set of analytical functions, the SDD response functions were satisfactorily reproduced for the X-ray energy range 1-15 keV. The behaviour of the parameters involved in the SDD tailing functions with X-ray energy is described by simple polynomial functions, which permit an easy implementation in PIXE spectra fitting codes.

Item response theory analyses of the Delis-Kaplan Executive Function System card sorting subtest.

Science.gov (United States)

Spencer, Mercedes; Cho, Sun-Joo; Cutting, Laurie E

2018-02-02

In the current study, we examined the dimensionality of the 16-item Card Sorting subtest of the Delis-Kaplan Executive Functioning System assessment in a sample of 264 native English-speaking children between the ages of 9 and 15 years. We also tested for measurement invariance for these items across age and gender groups using item response theory (IRT). Results of the exploratory factor analysis indicated that a two-factor model that distinguished between verbal and perceptual items provided the best fit to the data. Although the items demonstrated measurement invariance across age groups, measurement invariance was violated for gender groups, with two items demonstrating differential item functioning for males and females. Multigroup analysis using all 16 items indicated that the items were more effective for individuals whose IRT scale scores were relatively high. A single-group explanatory IRT model using 14 non-differential item functioning items showed that for perceptual ability, females scored higher than males and that scores increased with age for both males and females; for verbal ability, the observed increase in scores across age differed for males and females. The implications of these findings are discussed.

The impact of 3D and 2D TV watching on neurophysiological responses and cognitive functioning in adults.

Science.gov (United States)

Jeong, Hyun-Ghang; Ko, Young-Hoon; Han, Changsu; Oh, So-Young; Park, Kun Woo; Kim, Taehee; Ko, Deokwon

2015-12-01

Watching three-dimensional television (3D TV) may strain the eyes. However, other potential harmful effects of 3D TV watching have been rarely investigated. The current study examined the impact of 3D TV watching on neurophysiological responses and cognitive functioning as compared with two-dimensional TV (2D TV) watching. A total of 72 individuals were randomly assigned to either a 3D TV watching group or a 2D TV watching group. Electroencephalography (EEG) was used to measure neurophysiological responses, and computerized neurocognitive tests were conducted immediately before and after TV watching. The Simulator Sickness Questionnaire (SSQ) was used to assess visual discomfort. There was a significant change in visual discomfort between the two groups (SSQ score at baseline: 2.28 ± 3.05 for the 3D TV group and 3.69 ± 3.49 for the 2D TV group; SSQ score after watching TV: 4.6 ± 3.35 for the 3D TV group and 4.03 ± 3.47 for the 2D TV group), and this change was greater for the 3D TV watching group (P = 0.025). However, 3D TV watching did not have a differential impact on EEG responses. Furthermore, there were no significant differences between the groups in terms of changes in cognitive performance, except for a subtle difference in backward digit span performance. Our findings suggest that 3D TV watching is as safe as 2D TV watching in terms of neurophysiological responses and cognitive functioning. Potential harmful effects of TV viewing might be similar regardless of whether 3D or 2D TV is viewed. © The Author 2015. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.

Plant functional group classifications and a generalized hierarchical ...

African Journals Online (AJOL)

Yomi

2010-12-27

Dec 27, 2010 ... functional traits ranging from the molecular to the biospherical level, and operating on ... Many researchers have discussed landscape dynamics ... concept groups plant species into distinct clusters accor- ..... simulations. Ecol.

Data on synthesis and thermo-mechanical properties of stimuli-responsive rubber materials bearing pendant anthracene groups.

Science.gov (United States)

Manhart, Jakob; Ayalur-Karunakaran, Santhosh; Radl, Simone; Oesterreicher, Andreas; Moser, Andreas; Ganser, Christian; Teichert, Christian; Pinter, Gerald; Kern, Wolfgang; Griesser, Thomas; Schlögl, Sandra

2016-12-01

The photo-reversible [4πs+4πs] cycloaddition reaction of pendant anthracene moieties represents a convenient strategy to impart wavelength dependent properties into hydrogenated carboxylated nitrile butadiene rubber (HXNBR) networks. The present article provides the 1 H NMR data on the reaction kinetics of the side chain functionalization of HXNBR. 2-(Anthracene-9-yl)oxirane with reactive epoxy groups is covalently attached to the polymer side chain of HXNBR via ring opening reaction between the epoxy and the carboxylic groups. Along with the identification, 1 H NMR data on the quantification of the attached functional groups are shown in dependence on reaction time and concentration of 2-(anthracene-9-yl)oxirane. Changes in the modification yield are reflected in the mechanical properties and DMA data of photo-responsive elastomers are illustrated in dependence on the number of attached anthracene groups. DMA curves over repeated cycles of UV induced crosslinking ( λ >300 nm) and UV induced cleavage ( λ =254 nm) are further depicted, demonstrating the photo-reversibility of the thermo-mechanical properties. Interpretation and discussion of the data are provided in "Design and application of photo-reversible elastomer networks by using the [4πs+4πs] cycloaddition reaction of pendant anthracene groups" (Manhart et al., 2016) [1].

Plant-soil feedbacks: role of plant functional group and plant traits

NARCIS (Netherlands)

Cortois, R.; Schröder-Georgi, T.; Weigelt, A.; van der Putten, W.H.; De Deyn, G.B.

2016-01-01

Plant-soil feedback (PSF), plant trait and functional group concepts advanced our understanding of plant community dynamics, but how they are interlinked is poorly known. To test how plant functional groups (FGs: graminoids, small herbs, tall herbs, legumes) and plant traits relate to PSF, we grew

Evaluation of response function of moderating-type neutron detector and application to environmental neutron measurement

International Nuclear Information System (INIS)

Kosako, Toshiso; Nakamura, Takashi; Iwai, Satoshi; Katsuki, Shinji; Kamata, Masashi.

1983-08-01

The energy-dependent response function of a multi-cylinder moderating-type BF 3 counter, so-called Bonner counter, was calculated by the time-dependent multi-group Monte Carlo code, TMMCR. The calculated response function was evaluated experimentally for neutron energy below about 50 keV down to epithermal energy by the time-of-flight method combining with a large lead pile at the Nuclear Engineering Research Laboratory, University of Tokyo and also above 50 keV by using the monoenergetic neutron standard field a t the Electrotechnical Laboratory. The time delay in the polyethylene moderator of the Bonner counter due to multiple collisions with hydrogen was analyzed by the TMMCR code and used for the time-spectrum analysis of the time-of-flight measurement. The response function obtained by these two experiments showed good agreement with the calculated results. This Bonner counter having a response function evaluated from thermal to MeV energy range was used for spectrometry and dosimetry of environmental neutrons around some nuclear facilities. The neutron spectra and dose measured in the environment around a 252 Cf fission source, fast neutron source reactor and electron synchrotron were all in good agreement with the calculated results and the measured results with other neutron detectors. (author)

Dynamic response function and large-amplitude dissipative collective motion

International Nuclear Information System (INIS)

Wu Xizhen; Zhuo Yizhong; Li Zhuxia; Sakata, Fumihiko.

1993-05-01

Aiming at exploring microscopic dynamics responsible for the dissipative large-amplitude collective motion, the dynamic response and correlation functions are introduced within the general theory of nuclear coupled-master equations. The theory is based on the microscopic theory of nuclear collective dynamics which has been developed within the time-dependent Hartree-Fock (TDHF) theory for disclosing complex structure of the TDHF-manifold. A systematic numerical method for calculating the dynamic response and correlation functions is proposed. By performing numerical calculation for a simple model Hamiltonian, it is pointed out that the dynamic response function gives an important information in understanding the large-amplitude dissipative collective motion which is described by an ensemble of trajectories within the TDHF-manifold. (author)

An -OH group functionalized MOF for ratiometric Fe3+ sensing

Science.gov (United States)

Xu, Hui; Dong, Yingying; Wu, Yuhang; Ren, Wenjing; Zhao, Tao; Wang, Shunli; Gao, Junkuo

2018-02-01

Iron is one of the most important elements in the biochemical processes in all living system, both deficiency or excess of iron will lead to metabolism disorder diseases. However, Fe3+ is one of the most efficient fluorescence quenchers among the transition-metal ions because of its paramagnetic nature. The realization of Fe3+ ratiometric and self-calibrated fluorescent sensor is highly-challenging. We synthesized a novel luminescent -OH functionalized EuOHBDC (Eu2(OH-BDC)3, OH-BDC=2-hydroxyterephthalic acid) by hydrothermal reaction and in situ ligand synthesis, and used it as a rare ratiomatric luminescent sensor for Fe3+ ions. The -OH functional group facilitates both electron transfer and binding interaction between EuOHBDC and Fe3+, which lead to luminescent quenching of ligand-based emission while enhancement of a new peak emission, and thus enables ratiometric detection of Fe3+. The relative fluorescent intensity ratio (I375/I427) increased linearly with increasing Fe3+ concentration in the 10-50 μM range with 1.17 μM (65 ppb) detection limit. The EuOHBDC also shows excellent selectivity towards different metal ions, particularly can discriminate Fe3+ and Fe2+ through different luminescent responses. This result clearly demonstrates the superiority of -OH functionalized MOF for Fe3+ detection, which can contribute to develop high performance luminescent probe for detection of metal ions in environmental and biomedical applications.

Functional Group Analysis for Diesel-like Mixing-Controlled Compression Ignition Combustion Blendstocks

Energy Technology Data Exchange (ETDEWEB)

Gaspar, Daniel J.; McCormick, Robert L.; Polikarpov, Evgueni; Fioroni, Gina; George, Anthe; Albrecht, Karl O.

2016-12-30

This report addresses the suitability of hydrocarbon and oxygenate functional groups for use as a diesel-like fuel blending component in an advanced, mixing-controlled, compression ignition combustion engine. The functional groups are chosen from those that could be derived from a biomass feedstock, and represent a full range of chemistries. This first systematic analysis of functional groups will be of value to all who are pursuing new bio-blendstocks for diesel-like fuels.

Do Quercus ilex woodlands undergo abrupt non-linear functional changes in response to human disturbance along a climatic gradient?

Science.gov (United States)

Bochet, Esther; García-Fayos, Patricio; José Molina, Maria; Moreno de las Heras, Mariano; Espigares, Tíscar; Nicolau, Jose Manuel; Monleon, Vicente

2017-04-01

Theoretical models predict that drylands are particularly prone to suffer critical transitions with abrupt non-linear changes in their structure and functions as a result of the existing complex interactions between climatic fluctuations and human disturbances. However, so far, few studies provide empirical data to validate these models. We aim at determining how holm oak (Quercus ilex) woodlands undergo changes in their functions in response to human disturbance along an aridity gradient (from semi-arid to sub-humid conditions), in eastern Spain. For that purpose, we used (a) remote-sensing estimations of precipitation-use-efficiency (PUE) from enhanced vegetation index (EVI) observations performed in 231x231 m plots of the Moderate Resolution Imaging Spectroradiometer (MODIS); (b) biological and chemical soil parameter determinations (extracellular soil enzyme activity, soil respiration, nutrient cycling processes) from soil sampled in the same plots; (c) vegetation parameter determinations (ratio of functional groups) from vegetation surveys performed in the same plots. We analyzed and compared the shape of the functional change (in terms of PUE and soil and vegetation parameters) in response to human disturbance intensity for our holm oak sites along the aridity gradient. Overall, our results evidenced important differences in the shape of the functional change in response to human disturbance between climatic conditions. Semi-arid areas experienced a more accelerated non-linear decrease with an increasing disturbance intensity than sub-humid ones. The proportion of functional groups (herbaceous vs. woody cover) played a relevant role in the shape of the functional response of the holm oak sites to human disturbance.

Investigating the LGBTQ Responsive Model for Supervision of Group Work

Science.gov (United States)

Luke, Melissa; Goodrich, Kristopher M.

2013-01-01

This article reports an investigation of the LGBTQ Responsive Model for Supervision of Group Work, a trans-theoretical supervisory framework to address the needs of lesbian, gay, bisexual, transgender, and questioning (LGBTQ) persons (Goodrich & Luke, 2011). Findings partially supported applicability of the LGBTQ Responsive Model for Supervision…

Wetting transitions: A functional renormalization-group approach

International Nuclear Information System (INIS)

Fisher, D.S.; Huse, D.A.

1985-01-01

A linear functional renormalization group is introduced as a framework in which to treat various wetting transitions of films on substrates. A unified treatment of the wetting transition in three dimensions with short-range interactions is given. The results of Brezin, Halperin, and Leibler in their three different regimes are reproduced along with new results on the multicritical behavior connecting the various regimes. In addition, the critical behavior as the coexistence curve is approached at complete wetting is analyzed. Wetting in the presence of long-range substrate-film interactions that fall off as power laws is also studied. The possible effects of the nonlinear terms in the renormalization group are examined briefly and it appears that they do not alter the critical behavior found using the truncated linear renormalization group

Challenging emotional prejudice by changing self-concept: priming independent self-construal reduces racial in-group bias in neural responses to other's pain.

Science.gov (United States)

Wang, Chenbo; Wu, Bing; Liu, Yi; Wu, Xinhuai; Han, Shihui

2015-09-01

Humans show stronger empathy for in-group compared with out-group members' suffering and help in-group members more than out-group members. Moreover, the in-group bias in empathy and parochial altruism tend to be more salient in collectivistic than individualistic cultures. This work tested the hypothesis that modifying self-construals, which differentiate between collectivistic and individualistic cultural orientations, affects in-group bias in empathy for perceived own-race vs other-race pain. By scanning adults using functional magnetic resonance imaging, we found stronger neural activities in the mid-cingulate, left insula and supplementary motor area (SMA) in response to racial in-group compared with out-group members' pain after participants had been primed with interdependent self-construals. However, the racial in-group bias in neural responses to others' pain in the left SMA, mid-cingulate cortex and insula was significantly reduced by priming independent self-construals. Our findings suggest that shifting an individual's self-construal leads to changes of his/her racial in-group bias in neural responses to others' suffering. © The Author (2015). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Coping responses as predictors of psychosocial functioning ...

African Journals Online (AJOL)

... West Haven-Yale Multidimensional Pain Inventory and the Coping Responses Inventory – Adult Form. The prevalence of the use of Avoidance and Approach Coping, and the relationship between these responses and psychosocial functioning (Pain Severity, Interference, Support, Life Control, and Affective Distress) were ...

Lack of Knowledge Sharing Amongst Institutions in Denmark Responsible for Vulnerable Groups

DEFF Research Database (Denmark)

Bojsen, Ann Kristina Mikkelsen

they share their knowledge about risk and policy management. In order to protect vulnerable groups such as children, disabled, sick and elderly people, we need to learn more about the general risk understanding and sharing of such according to region, responsibility, common events and hazards....... This information is needed to protect against future unintentional and intentional hazards and compare those with the institutional responsibilities. Risk understanding and knowledge sharing among professionals with responsibility for vulnerable groups can be a crucial tool for handling everyday threats as well......Lack of Knowledge Sharing Amongst Institutions in Denmark Responsible for Vulnerable Groups Ann Bojsen, Senior Lecturer Emergency and Risk Management Department, Metropolitan University College, Copenhagen, Denmark Even though understanding risk and how it is enacted is regarded as a crucial step...

Different pain responses to chronic and acute pain in various ethnic/racial groups.

Science.gov (United States)

Rahavard, Behnoosh B; Candido, Kenneth D; Knezevic, Nebojsa Nick

2017-09-01

Our goal in this study was to review the similarities and differences among ethnic groups and their respective responses to acute and chronic clinically related and experimentally induced pain. In this review, the PUBMED and Google-Scholar databases were searched to analyze articles that have assessed the variations in both acute and chronic pain responses among different ethnic/racial groups. According to the results from 42 reviewed articles, significant differences exist among ethnic-racial groups for pain prevalence as well as responses to acute and chronic pain. Compared with Caucasians, other ethnic groups are more susceptible to acute pain responses to nociceptive stimulation and to the development of long-term chronic pain. These differences need to be addressed and assessed more extensively in the future in order to minimize the pain management disparities among various ethnic-racial groups and also to improve the relationship between pain management providers and their patients.

Responses of Crop Pests and Natural Enemies to Wildflower Borders Depends on Functional Group.

Science.gov (United States)

McCabe, Ellie; Loeb, Gregory; Grab, Heather

2017-07-25

Increased homogeneity of agricultural landscapes in the last century has led to a loss of biodiversity and ecosystem services. However, management practices such as wildflower borders offer supplementary resources to many beneficial arthropods. There is evidence that these borders can increase beneficial arthropod abundance, including natural enemies of many pests. However, this increase in local habitat diversity can also have effects on pest populations, and these effects are not well-studied. In this study, we investigated how wildflower borders affect both natural enemies and pests within an adjacent strawberry crop. Significantly more predators were captured in strawberry plantings with wildflower borders versus plantings without wildflowers, but this effect depended on sampling method. Overall, herbivore populations were lower in plots with a wildflower border; however, responses to wildflower borders varied across specific pest groups. Densities of Lygus lineolaris (Tarnished Plant Bug), a generalist pest, increased significantly in plots that had a border, while Stelidota geminata (Strawberry Sap Beetle) decreased in strawberry fields with a wildflower border. These results suggest that wildflower borders may support the control of some pest insects; however, if the pest is a generalist and can utilize the resources of the wildflower patch, their populations may increase within the crop.

Development of Biomimetic and Functionally Responsive Surfaces

Science.gov (United States)

Anastasiadis, Spiros H.

2010-03-01

Controlling the surface morphology of solids and manufacturing of functional surfaces with special responsive properties has been the subject of intense research. We report a methodology for creating multifunctionally responsive surfaces by irradiating silicon wafers with femtosecond laser pulses and subsequently coating them with different types of functional conformal coatings. Such surfaces exhibit controlled dual-scale roughness at the micro- and the nano-scale, which mimics the hierarchical morphology of water repellent natural surfaces. When a simple alkylsilane coating is utilized, highly water repellent surfaces are produced that quantitatively compare to those of the Lotus leaf. When a polymer brush is ``grafted from" these surfaces based on a pH-sensitive polymer, the surfaces can alter their behavior from super-hydrophilic (after immersion in a low pH buffer) to super-hydrophobic and water-repellent (following immersion to a high pH buffer). We quantify the water repellency of such responsive systems by drop elasticity measurements whereas we demonstrate that the water repellent state of such surface requires appropriate hydrophobicity of the functionalizing polymer. When a photo-responsive azobenzene-type polymer is deposited, a dynamic optical control of the wetting properties is obtained and the surface can be switched from super-hydrophilic (following UV irradiation) to hydrophobic (following green irradiation). In all the above cases we show that the principal effect of roughness is to cause amplification of the response to the different external stimuli.

Response function of spin-isospin nuclear excitations

International Nuclear Information System (INIS)

Salvetti, A.R.

1986-01-01

The selected aspects of spin-isospir nuclear excitations are studied. The spreading width of M/ states in even Ca isotopes for the purpose of trying to understand the missing strenght specially in 44 Ca, was estimated. The doorway calculation, was used, considering the level of complexity next to the independent particle M/ state. Using a nuclear matter context, the system response function to a spin-isospin probe and verify how the response function behaves for free fermions and in the ring approximation was studied. Higher correlations to polarization propagation such as the induced interaction and self-energy corrections was introduced. The dopping of colletive effects by such collisions terms was verified. It was investigate how to estimate the short range term of the effective interaction in the spin-isospin channel and the possibility of detecting a difference between these short range terms in the longitudinal and the transverse channel, for understanding the absence of pior condensation precursor states and negative results in a recent attempt to detect differences between longitudinal and transverse response functions one naively expects theoretically. (author) [pt

34 CFR 75.129 - Legal responsibilities of each member of the group.

Science.gov (United States)

2010-07-01

... 34 Education 1 2010-07-01 2010-07-01 false Legal responsibilities of each member of the group. 75.129 Section 75.129 Education Office of the Secretary, Department of Education DIRECT GRANT PROGRAMS How To Apply for a Grant Group Applications § 75.129 Legal responsibilities of each member of the...

Item Response Theory at Subject- and Group-Level. Research Report 90-1.

Science.gov (United States)

Tobi, Hilde

This paper reviews the literature about item response models for the subject level and aggregated level (group level). Group-level item response models (IRMs) are used in the United States in large-scale assessment programs such as the National Assessment of Educational Progress and the California Assessment Program. In the Netherlands, these…

Parameterization of Leaf-Level Gas Exchange for Plant Functional Groups From Amazonian Seasonal Tropical Rain Forest

Science.gov (United States)

Domingues, T. F.; Berry, J. A.; Ometto, J. P.; Martinelli, L. A.; Ehleringer, J. R.

2004-12-01

Plant communities exert strong influence over the magnitude of carbon and water cycling through ecosystems by controlling photosynthetic gas exchange and respiratory processes. Leaf-level gas exchange fluxes result from a combination of physiological properties, such as carboxylation capacity, respiration rates and hydraulic conductivity, interacting with environmental drivers such as water and light availability, leaf-to-air vapor pressure deficit, and temperature. Carbon balance models concerned with ecosystem-scale responses have as a common feature the description of eco-physiological properties of vegetation. Here we focus on the parameterization of ecophysiological gas-exchange properties of plant functional groups from a pristine Amazonian seasonally dry tropical rain forest ecosystem (FLONA-Tapajós, Santarém, PA, Brazil). The parameters were specific leaf weight, leaf nitrogen content, leaf carbon isotope ratio, maximum photosynthetic assimilation rate, photosynthetic carboxylation capacity, dark respiration rates, and stomatal conductance to water vapor. Our plant functional groupings were lianas at the top of the canopy, trees at the top of the canopy, mid-canopy trees and undestory trees. Within the functional groups, we found no evidence that leaves acclimated to seasonal changes in precipitation. However, there were life-form dependent distinctions when a combination of parameters was included. Top-canopy lianas were statistically different from top-canopy trees for leaf carbon isotope ratio, maximum photosynthetic assimilation rate, and stomatal conductance to water vapor, suggesting that lianas are more conservative in the use of water, causing a stomatal limitation on photosynthetic assimilation. Top-canopy, mid canopy and understory groupings were distinct for specific leaf weight, leaf nitrogen content, leaf carbon isotope ratio, maximum photosynthetic assimilation rate, and photosynthetic carboxylation capacity. The recognition that plant

Functional response of a near-surface soil microbial community to a simulated underground CO2 storage leak.

Science.gov (United States)

Morales, Sergio E; Holben, William E

2013-01-01

Understanding the impacts of leaks from geologic carbon sequestration, also known as carbon capture and storage, is key to developing effective strategies for carbon dioxide (CO2) emissions management and mitigation of potential negative effects. Here, we provide the first report on the potential effects of leaks from carbon capture and storage sites on microbial functional groups in surface and near-surface soils. Using a simulated subsurface CO2 storage leak scenario, we demonstrate how CO2 flow upward through the soil column altered both the abundance (DNA) and activity (mRNA) of microbial functional groups mediating carbon and nitrogen transformations. These microbial responses were found to be seasonally dependent and correlated to shifts in atmospheric conditions. While both DNA and mRNA levels were affected by elevated CO2, they did not react equally, suggesting two separate mechanisms for soil microbial community response to high CO2 levels. The results did not always agree with previous studies on elevated atmospheric (rather than subsurface) CO2 using FACE (Free-Air CO2 Enrichment) systems, suggesting that microbial community response to CO2 seepage from the subsurface might differ from its response to atmospheric CO2 increases.

Discretization of four types of Weyl group orbit functions

International Nuclear Information System (INIS)

Hrivnák, Jiří

2013-01-01

The discrete Fourier calculus of the four families of special functions, called C–, S–, S s – and S l -functions, is summarized. Functions from each of the four families of special functions are discretely orthogonal over a certain finite set of points. The generalizations of discrete cosine and sine transforms of one variable — the discrete S s – and S l -transforms of the group F 4 — are considered in detail required for their exploitation in discrete Fourier spectral methods. The continuous interpolations, induced by the discrete expansions, are presented

Dominance Weighted Social Choice Functions for Group Recommendations

Directory of Open Access Journals (Sweden)

Silvia ROSSI

2015-12-01

Full Text Available In travel domains, decision support systems provide support to tourists in the planning of their vacation. In particular, when the number of possible Points of Interest (POI to visit is large, the system should help tourists providing recommendations on the POI that could be more interesting for them. Since traveling is, usually, an activity that involves small groups of people, the system should take simultaneously into account the preferences of each group's member. At the same time, it also should model possible intra-group relationships, which can have an impact in the group decision-making process. In this paper, we model this problem as a multi-agent aggregation of preferences by using weighted social choice functions, whereas such weights are automatically evaluated by analyzing the interactions of the group's members on Online Social Networks.

Effects of methotrexate combined with hydroxychloroquine sulfate and prednisone acetate on inflammatory response, immune function and liver and renal function in patients with systemic lupus erythematosus

Directory of Open Access Journals (Sweden)

Jiang-Li Xia

2017-11-01

Full Text Available Objective: To investigate the effects of methotrexate and hydroxychloroquine sulfate and prednisone on inflammatory response, immune function, liver and renal function in patients with systemic lupus erythematosus (SLE. Methods: A total of 80 cases of SLE patients according to the random data table were divided into the control group (n=40 and observation group (n=40, the control group were treated with hydroxychloroquine sulfate and prednisone treatment, on the basis of treatment of the control group, patients in the observation group in the control group were treated with methotrexate, the levels of inflammatory factors, immune function, liver and kidney function indexes in the two groups between the before treatment and after treatment were compared. Results: Comparison of the levels before treatment, the difference of the CRP, WBC, ESR, IgA, IgG, complement C3, complement C4, ALT, AST, SCr and BUN levels were not statistically significant. After treatment, the levels of CRP, ESR, IgA, IgG, ALT, AST, SCr and BUN in the observation group were significantly lower than those in the control group, and the difference was statistically significant. The levels of WBC and complement C4 in the observation group [(5.18±1.08伊10 9 /L, (0.22±0.05 g/L] were significantly higher than those in the control group [(4.51±0.52伊10 9 /L, (0.18±0.03 g/L], and there was no significant difference in the level of complement C3 between the two groups after treatment. Conclusion: Methotrexate combined with hydroxychloroquine sulfate and prednisone for the treatment of SLE can effectively reduce inflammation, improve immune function, has little effect on kidney function, high safety, which has an important clinical value.

Differential responses of soil bacteria, fungi, archaea and protists to plant species richness and plant functional group identity.

Science.gov (United States)

Dassen, Sigrid; Cortois, Roeland; Martens, Henk; de Hollander, Mattias; Kowalchuk, George A; van der Putten, Wim H; De Deyn, Gerlinde B

2017-08-01

Plants are known to influence belowground microbial community structure along their roots, but the impacts of plant species richness and plant functional group (FG) identity on microbial communities in the bulk soil are still not well understood. Here, we used 454-pyrosequencing to analyse the soil microbial community composition in a long-term biodiversity experiment at Jena, Germany. We examined responses of bacteria, fungi, archaea, and protists to plant species richness (communities varying from 1 to 60 sown species) and plant FG identity (grasses, legumes, small herbs, tall herbs) in bulk soil. We hypothesized that plant species richness and FG identity would alter microbial community composition and have a positive impact on microbial species richness. Plant species richness had a marginal positive effect on the richness of fungi, but we observed no such effect on bacteria, archaea and protists. Plant species richness also did not have a large impact on microbial community composition. Rather, abiotic soil properties partially explained the community composition of bacteria, fungi, arbuscular mycorrhizal fungi (AMF), archaea and protists. Plant FG richness did not impact microbial community composition; however, plant FG identity was more effective. Bacterial richness was highest in legume plots and lowest in small herb plots, and AMF and archaeal community composition in legume plant communities was distinct from that in communities composed of other plant FGs. We conclude that soil microbial community composition in bulk soil is influenced more by changes in plant FG composition and abiotic soil properties, than by changes in plant species richness per se. © 2017 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Quantitative determination of acidic groups in functionalized graphene by direct titration

Czech Academy of Sciences Publication Activity Database

Ederer, J.; Janoš, P.; Ecorchard, Petra; Štengl, Václav; Bělčická, Zuzana; Šťastný, Martin; Pop-Georgievski, Ognen; Dohnal, V.

2016-01-01

Roč. 103, JUN (2016), s. 44-53 ISSN 1381-5148 R&D Projects: GA ČR(CZ) GA14-05146S Institutional support: RVO:61388980 ; RVO:61389013 Keywords : Acid-base titration * Carboxylic functional groups * Graphene oxide * Phenolic functional groups * Proton-binding model Subject RIV: CA - Inorganic Chemistry ; CD - Macromolecular Chemistry (UMCH-V) Impact factor: 3.151, year: 2016

Chief Business Officers' Functions: Responsibilities and Importance.

Science.gov (United States)

Calver, Richard A.; Vogler, Daniel E.

1985-01-01

Reports on a survey of 177 chief business officers of public community colleges regarding their responsibilities and the importance they assigned to various role functions. Highlights findings concerning the perceived importance of fiscal/financial duties; endowments as a job function; role in shared planning; and personal attention given to…

Dissecting stimulus-response binding effects: Grouping by color separately impacts integration and retrieval processes.

Science.gov (United States)

Laub, Ruth; Frings, Christian; Moeller, Birte

2018-04-23

In selection tasks, target and distractor features can be encoded together with the response into the same short-lived memory trace, or event file (see Hommel, 2004), leading to bindings between stimulus and response features. The repetition of a stored target or distractor feature can lead to the retrieval of the entire episode, including the response-so-called "binding effects." Binding effects due to distractor repetition are stronger for grouped than for nongrouped target and distractor stimulus configurations. Modulation of either of two mechanisms that lead to the observed binding effects might be responsible here: Grouping may influence either stimulus-response integration or stimulus-response retrieval. In the present study we investigated the influences of grouping on both mechanisms independently. In two experiments, target and distractor letters were grouped (or nongrouped) via color (dis)similarity separately during integration and retrieval. Grouping by color similarity affected integration and retrieval mechanisms independently and in different ways. Color dissimilarity enhanced distractor-based retrieval, whereas color similarity enhanced distractor integration. We concluded that stimulus grouping is relevant for binding effects, but that the mechanisms that contribute to binding effects should be carefully separated.

Data on synthesis and thermo-mechanical properties of stimuli-responsive rubber materials bearing pendant anthracene groups

Directory of Open Access Journals (Sweden)

Jakob Manhart

2016-12-01

Full Text Available The photo-reversible [4πs+4πs] cycloaddition reaction of pendant anthracene moieties represents a convenient strategy to impart wavelength dependent properties into hydrogenated carboxylated nitrile butadiene rubber (HXNBR networks. The present article provides the 1H NMR data on the reaction kinetics of the side chain functionalization of HXNBR. 2-(Anthracene-9-yloxirane with reactive epoxy groups is covalently attached to the polymer side chain of HXNBR via ring opening reaction between the epoxy and the carboxylic groups. Along with the identification, 1H NMR data on the quantification of the attached functional groups are shown in dependence on reaction time and concentration of 2-(anthracene-9-yloxirane. Changes in the modification yield are reflected in the mechanical properties and DMA data of photo-responsive elastomers are illustrated in dependence on the number of attached anthracene groups. DMA curves over repeated cycles of UV induced crosslinking (λ>300 nm and UV induced cleavage (λ=254 nm are further depicted, demonstrating the photo-reversibility of the thermo-mechanical properties. Interpretation and discussion of the data are provided in “Design and application of photo-reversible elastomer networks by using the [4πs+4πs] cycloaddition reaction of pendant anthracene groups” (Manhart et al., 2016 [1].

Differential item functioning magnitude and impact measures from item response theory models.

Science.gov (United States)

Kleinman, Marjorie; Teresi, Jeanne A

2016-01-01

Measures of magnitude and impact of differential item functioning (DIF) at the item and scale level, respectively are presented and reviewed in this paper. Most measures are based on item response theory models. Magnitude refers to item level effect sizes, whereas impact refers to differences between groups at the scale score level. Reviewed are magnitude measures based on group differences in the expected item scores and impact measures based on differences in the expected scale scores. The similarities among these indices are demonstrated. Various software packages are described that provide magnitude and impact measures, and new software presented that computes all of the available statistics conveniently in one program with explanations of their relationships to one another.

Polarization response functions and the (/rvec e/,e'/rvec p/) reaction

International Nuclear Information System (INIS)

Picklesimer, A.; Van Orden, J.W.

1988-01-01

The first comprehensive study of the full set of eighteen response functions relevant to the (/rvec e/,e'/rvec p/) reaction is presented. Benchmark analytical features and limiting cases of the response functions are described. Numerical predictions contrasting nonrelativistic and relativistic (Dirac) dynamics and on- and off- shell final state interaction effects are presented. Basic physical characteristics and dependences of the response functions are identified. The outlook for future experimental studies of the (/rvec e/,e'/rvec p/) polarization response functions is discussed. 56 refs., 5 figs., 1 tab

Wigner functions for a class of semi-direct product groups

International Nuclear Information System (INIS)

Krasowska, Anna E; Ali, S Twareque

2003-01-01

Following a general method proposed earlier, we construct here Wigner functions defined on coadjoint orbits of a class of semidirect product groups. The groups in question are such that their unitary duals consist purely of representations from the discrete series and each unitary irreducible representation is associated with a coadjoint orbit. The set of all coadjoint orbits (hence UIRs) is finite and their union is dense in the dual of the Lie algebra. The simple structure of the groups and the orbits enables us to compute the various quantities appearing in the definition of the Wigner function explicitly. A large number of examples, with potential use in image analysis, is worked out

Nonperturbative renormalization-group approach preserving the momentum dependence of correlation functions

Science.gov (United States)

Rose, F.; Dupuis, N.

2018-05-01

We present an approximation scheme of the nonperturbative renormalization group that preserves the momentum dependence of correlation functions. This approximation scheme can be seen as a simple improvement of the local potential approximation (LPA) where the derivative terms in the effective action are promoted to arbitrary momentum-dependent functions. As in the LPA, the only field dependence comes from the effective potential, which allows us to solve the renormalization-group equations at a relatively modest numerical cost (as compared, e.g., to the Blaizot-Mendéz-Galain-Wschebor approximation scheme). As an application we consider the two-dimensional quantum O(N ) model at zero temperature. We discuss not only the two-point correlation function but also higher-order correlation functions such as the scalar susceptibility (which allows for an investigation of the "Higgs" amplitude mode) and the conductivity. In particular, we show how, using Padé approximants to perform the analytic continuation i ωn→ω +i 0+ of imaginary frequency correlation functions χ (i ωn) computed numerically from the renormalization-group equations, one can obtain spectral functions in the real-frequency domain.

Characterization of the equine skeletal muscle transcriptome identifies novel functional responses to exercise training.

LENUS (Irish Health Repository)

McGivney, Beatrice A

2010-01-01

BACKGROUND: Digital gene expression profiling was used to characterize the assembly of genes expressed in equine skeletal muscle and to identify the subset of genes that were differentially expressed following a ten-month period of exercise training. The study cohort comprised seven Thoroughbred racehorses from a single training yard. Skeletal muscle biopsies were collected at rest from the gluteus medius at two time points: T(1) - untrained, (9 +\\/- 0.5 months old) and T(2) - trained (20 +\\/- 0.7 months old). RESULTS: The most abundant mRNA transcripts in the muscle transcriptome were those involved in muscle contraction, aerobic respiration and mitochondrial function. A previously unreported over-representation of genes related to RNA processing, the stress response and proteolysis was observed. Following training 92 tags were differentially expressed of which 74 were annotated. Sixteen genes showed increased expression, including the mitochondrial genes ACADVL, MRPS21 and SLC25A29 encoded by the nuclear genome. Among the 58 genes with decreased expression, MSTN, a negative regulator of muscle growth, had the greatest decrease.Functional analysis of all expressed genes using FatiScan revealed an asymmetric distribution of 482 Gene Ontology (GO) groups and 18 KEGG pathways. Functional groups displaying highly significant (P < 0.0001) increased expression included mitochondrion, oxidative phosphorylation and fatty acid metabolism while functional groups with decreased expression were mainly associated with structural genes and included the sarcoplasm, laminin complex and cytoskeleton. CONCLUSION: Exercise training in Thoroughbred racehorses results in coordinate changes in the gene expression of functional groups of genes related to metabolism, oxidative phosphorylation and muscle structure.

Evolution of Functional Groups during Pyrolysis Oil Upgrading

Energy Technology Data Exchange (ETDEWEB)

Stankovikj, Filip [Department; Tran, Chi-Cong [Department; Kaliaguine, Serge [Department; Olarte, Mariefel V. [Pacific Northwest National Laboratory, Richland, Washington 99354, United States; Garcia-Perez, Manuel [Department

2017-07-14

In this paper, we examine the evolution of functional groups (carbonyl, carboxyl, phenol, and hydroxyl) during stabilization at 100–200 °C of two typical wood derived pyrolysis oils from BTG and Amaron in a batch reactor over Ru/C catalyst for 4h. An aqueous and an oily phase were obtained. The content of functional groups in both phases were analyzed by GC/MS, 31P-NMR, 1H-NMR, elemental analysis, KF titration, carbonyl groups by Faix, Folin – Ciocalteu method and UV-Fluorescence. The consumption of hydrogen was between 0.007 and 0.016 g/g oil, and 0.001-0.020 g of CH4/g of oil, 0.005-0.016 g of CO2/g oil and 0.03-0.10 g H2O/g oil were formed. The content of carbonyl, hydroxyl, and carboxyl groups in the volatile GC-MS detectable fraction decreased (80, 65, and ~70% respectively), while their behavior in the total oil and hence in the non-volatile fraction was more complex. The carbonyl groups initially decreased having minimum at ~125-150°C and then increased, while the hydroxyl groups had reversed trend. This might be explained by initial hydrogenation of the carbonyl groups to form hydroxyls, followed by continued dehydration reactions at higher temperatures that may increase their content. The 31P-NMR was on the limit of its sensitivity for the carboxylic groups to precisely detect changes in the non-volatile fraction, however the more precise titration method showed that the concentration of carboxylic groups in the non-volatile fraction remains constant with increased stabilization temperature. The UV-Fluorescence results show that repolymerization increases with temperature. ATR-FTIR method coupled with deconvolution of the region between 1490 and 1850 cm-1 showed to be a good tool for following the changes in carbonyl groups and phenols of the stabilized pyrolysis oils. The deconvolution of the IR bands around 1050 and 1260 cm-1 correlated very well with the changes in the 31P-NMR silent O groups (likely ethers). Most of the H2O formation could be

Modifications of chemical functional groups of Pandanus amaryllifolius Roxb and its effect towards biosorption of heavy metals

Energy Technology Data Exchange (ETDEWEB)

Abdullah, Mohd Zamri, E-mail: zamriab@petronas.com.my; Ismail, Siti Salwa [Chemical Engineering Department, Universiti Teknologi PETRONAS, 31750 Bandar Seri Iskandar, Perak (Malaysia)

2015-07-22

The utilization of non-living biomass as an alternative biosorbent for heavy metal removal has gain a tremendous consideration through the years. Pandanus amaryllifolius Roxb or pandan leaves, which is widely used as food additives in the South East Asia region, has been selected for its viability in the said effort due to the presence of chemical functional groups on its cellular network that enables the sorption to occur. In order to elucidate the possible mechanisms participated during the heavy metal removal process, the biosorbent undergone a series of modification techniques to alter the chemical functional groups present on its constituent. From the outcome of the chemically-modified biosorbent being subjected to the contact with metal cations, nitrogen- and oxygen-containing groups present on the biosorbent are believed to be responsible for the metal uptake to occur through complexation mechanism. Modifying amine groups causes 14% reduction of Cu(II) uptake, whereas removing protein element increases the uptake to 26% as compared to the unmodified biosorbent. Also, scanning electron micrographs further suggested that the adsorption mechanism could perform in parallel, as attributed to the evidence of porous structure throughout the biosorbent fibrous nature.

Modifications of chemical functional groups of Pandanus amaryllifolius Roxb and its effect towards biosorption of heavy metals

International Nuclear Information System (INIS)

Abdullah, Mohd Zamri; Ismail, Siti Salwa

2015-01-01

The utilization of non-living biomass as an alternative biosorbent for heavy metal removal has gain a tremendous consideration through the years. Pandanus amaryllifolius Roxb or pandan leaves, which is widely used as food additives in the South East Asia region, has been selected for its viability in the said effort due to the presence of chemical functional groups on its cellular network that enables the sorption to occur. In order to elucidate the possible mechanisms participated during the heavy metal removal process, the biosorbent undergone a series of modification techniques to alter the chemical functional groups present on its constituent. From the outcome of the chemically-modified biosorbent being subjected to the contact with metal cations, nitrogen- and oxygen-containing groups present on the biosorbent are believed to be responsible for the metal uptake to occur through complexation mechanism. Modifying amine groups causes 14% reduction of Cu(II) uptake, whereas removing protein element increases the uptake to 26% as compared to the unmodified biosorbent. Also, scanning electron micrographs further suggested that the adsorption mechanism could perform in parallel, as attributed to the evidence of porous structure throughout the biosorbent fibrous nature

Response variance in functional maps: neural darwinism revisited.

Directory of Open Access Journals (Sweden)

Hirokazu Takahashi

Full Text Available The mechanisms by which functional maps and map plasticity contribute to cortical computation remain controversial. Recent studies have revisited the theory of neural Darwinism to interpret the learning-induced map plasticity and neuronal heterogeneity observed in the cortex. Here, we hypothesize that the Darwinian principle provides a substrate to explain the relationship between neuron heterogeneity and cortical functional maps. We demonstrate in the rat auditory cortex that the degree of response variance is closely correlated with the size of its representational area. Further, we show that the response variance within a given population is altered through training. These results suggest that larger representational areas may help to accommodate heterogeneous populations of neurons. Thus, functional maps and map plasticity are likely to play essential roles in Darwinian computation, serving as effective, but not absolutely necessary, structures to generate diverse response properties within a neural population.

Response variance in functional maps: neural darwinism revisited.

Science.gov (United States)

Takahashi, Hirokazu; Yokota, Ryo; Kanzaki, Ryohei

2013-01-01

The mechanisms by which functional maps and map plasticity contribute to cortical computation remain controversial. Recent studies have revisited the theory of neural Darwinism to interpret the learning-induced map plasticity and neuronal heterogeneity observed in the cortex. Here, we hypothesize that the Darwinian principle provides a substrate to explain the relationship between neuron heterogeneity and cortical functional maps. We demonstrate in the rat auditory cortex that the degree of response variance is closely correlated with the size of its representational area. Further, we show that the response variance within a given population is altered through training. These results suggest that larger representational areas may help to accommodate heterogeneous populations of neurons. Thus, functional maps and map plasticity are likely to play essential roles in Darwinian computation, serving as effective, but not absolutely necessary, structures to generate diverse response properties within a neural population.

Overview on the Surface Functionalization Mechanism and Determination of Surface Functional Groups of Plasma Treated Carbon Nanotubes.

Science.gov (United States)

Saka, Cafer

2018-01-02

The use of carbon materials for many applications is due to the unique diversity of structures and properties ranging from chemical bonds between the carbon atoms of the materials to nanostructures, crystallite alignment, and microstructures. Carbon nanotubes and other nanoscale carbonaceous materials draw much attention due to their physical and chemical properties, such as high strength, high resistance to corrosion, electrical and thermal conductivity, stability and a qualified adsorbent. Carbon-based nanomaterials, which have a relatively large specific area and layered structure, can be used as an adsorbent for efficient removal of organic and inorganic contaminants. However, one of the biggest obstacles to the development of carbon-based nanomaterials adsorbents is insolubility and the lack of functional groups on the surface. There are several approaches to introduce functional groups on carbon nanotubes. One of these approaches, plasma applications, now has an important place in the creation of surface functional groups as a flexible, fast, and environmentally friendly method. This review focuses on recent information concerning the surface functionalization and modification of plasma treated carbon nanotube. This review considers the surface properties, advantages, and disadvantages of plasma-applied carbon nanotubes. It also examines the reaction mechanisms involved in the functional groups on the surface.

Effect of functional groups on thermal conductivity of graphene/paraffin nanocomposite

Energy Technology Data Exchange (ETDEWEB)

Zabihi, Zabiholah; Araghi, Houshang, E-mail: araghi@aut.ac.ir

2016-11-25

In this paper, thermal conductivity of graphene/paraffin nanocomposite using micromechanical model has been studied. The behavior of thermal conductivity of nanocomposite as a function of volume fraction of graphene is studied. Then is shown that as the interfacial thermal resistance at the graphene–paraffin interface decreases, the thermal conductivity of nanocomposite increases. In order to reduce the interfacial thermal resistance, functional groups in the interface between graphene and paraffin are used. It can be observed that using functional groups of hydrogen, methyl and phenyl in the interface of nanocomposite, contributes to the improvement of the thermal conductivity. Moreover, as the rate of coverage of the surface of graphene with functional groups of H, CH{sub 3} and C{sub 6}H{sub 5} increases, the thermal conductivity of nanocomposite improves. - Highlights: • Thermal conductivity nanocomposite exhibit nonlinear behavior with volume faction. • Phenyl is better to form the thermal conductivity network in paraffin. • The thickness of interfacial layer can be obtained 12.75 nm.

Variation of phytoplankton functional groups modulated by hydraulic controls in Hongze Lake, China.

Science.gov (United States)

Tian, Chang; Pei, Haiyan; Hu, Wenrong; Hao, Daping; Doblin, Martina A; Ren, Ying; Wei, Jielin; Feng, Yawei

2015-11-01

Hongze Lake is a large, shallow, polymictic, eutrophic lake in the eastern China. Phytoplankton functional groups in this lake were investigated from March 2011 to February 2013, and a comparison was made between the eastern, western, and northern regions. The lake shows strong fluctuations in water level caused by monsoon rains and regular hydraulic controls. By application of the phytoplankton functional group approach, this study aims to investigate the spatial and temporal dynamics and analyze their influencing factors. Altogether, 18 functional groups of phytoplankton were identified, encompassing 187 species. In order to seek the best variable describing the phytoplankton functional group distribution, 14 of the groups were analyzed in detail using redundancy analysis. Due to the turbid condition of the lake, the dominant functional groups were those tolerant of low light. The predominant functional groups in the annual succession were D (Cyclotella spp. and Synedra acus), T (Planctonema lauterbornii), P (Fragilaria crotonensis), X1 (Chlorella vulgaris and Chlorella pyrenoidosa), C (Cyclotella meneghiniana and Cyclotella ocellata), and Y (Cryptomonas erosa). An opposite relationship between water level and the biomass of predominant groups was observed in the present study. Water level fluctuations, caused by monsoonal climate and artificial drawdown, were significant factors influencing phytoplankton succession in Hongze Lake, since they alter the hydrological conditions and influence light and nutrient availability. The clearly demonstrated factors, which significantly influence phytoplankton dynamics in Hongze Lake, will help government manage the large shallow lakes with frequent water level fluctuations.

Functional diversity of benthic ciliate communities in response to environmental gradients in a wetland of Yangtze Estuary, China.

Science.gov (United States)

Xu, Yuan; Fan, Xinpeng; Warren, Alan; Zhang, Liquan; Xu, Henglong

2018-02-01

Researches on the functional diversity of benthic ecosystems have mainly focused on macrofauna, and studies on functional structure of ciliate communities have been based only on trophic- or size-groups. Current research was carried out on the changing patterns of classical and functional diversity of benthic ciliates in response to environmental gradients at three sites in a wetland in Yangtze Estuary. The results showed that changes of environmental factors (e.g. salinity, sediment grain size and hydrodynamic conditions) in the Yangtze Estuary induce variability in species composition and functional trait distribution. Furthermore, increased species richness and diversity did not lead to significant changes in functional diversity due to functional redundancy. However, salt water intrusion of Yangtze Estuary during the dry season could cause reduced functional diversity of ciliate communities. Current study provides the first insight into the functional diversity of ciliate communities in response to environmental gradients. Copyright © 2018 Elsevier Ltd. All rights reserved.

Application of macrobenthos functional groups to estimate the ecosystem health in a semi-enclosed bay.

Science.gov (United States)

Peng, Shitao; Zhou, Ran; Qin, Xuebo; Shi, Honghua; Ding, Dewen

2013-09-15

In this study, the functional group concept was first applied to evaluate the ecosystem health of Bohai Bay. Macrobenthos functional groups were defined according to feeding types and divided into five groups: a carnivorous group (CA), omnivorous group (OM), planktivorous group (PL), herbivorous group (HE), and detritivorous group (DE). Groups CA, DE, OM, and PL were identified, but the HE group was absent from Bohai Bay. Group DE was dominant during the study periods. The ecosystem health was assessed using a functional group evenness index. The functional group evenness values of most sampling stations were less than 0.40, indicating that the ecosystem health was deteriorated in Bohai Bay. Such deterioration could be attributed to land reclamation, industrial and sewage effluents, oil pollution, and hypersaline water discharge. This study demonstrates that the functional group concept can be applied to ecosystem health assessment in a semi-enclosed bay. Copyright © 2013 Elsevier Ltd. All rights reserved.

Amnestic mild cognitive impairment: functional MR imaging study of response in posterior cingulate cortex and adjacent precuneus during problem-solving tasks.

Science.gov (United States)

Jin, Guangwei; Li, Kuncheng; Hu, Yingying; Qin, Yulin; Wang, Xiangqing; Xiang, Jie; Yang, Yanhui; Lu, Jie; Zhong, Ning

2011-11-01

To compare the blood oxygen level-dependent (BOLD) response, measured with functional magnetic resonance (MR) imaging, in the posterior cingulate cortex (PCC) and adjacent precuneus regions between healthy control subjects and patients with amnestic mild cognitive impairment (MCI) during problem-solving tasks. This study was approved by the institutional review board. Each subject provided written informed consent. Thirteen patients with amnestic MCI and 13 age- and sex-matched healthy control subjects participated in the study. The functional magnetic resonance (MR) imaging tasks were simplified 4 × 4-grid number placement puzzles that were divided into a simple task (using the row rule or the column rule to solve the puzzle) and a complex task (using both the row and column rules to solve the puzzle). Behavioral results and functional imaging results between the healthy control group and the amnestic MCI group were analyzed. The accuracy for the complex task in the healthy control group was significantly higher than that in the amnestic MCI group (P < .05). The healthy control group exhibited a deactivated BOLD signal intensity (SI) change in the bilateral PCC and adjacent precuneus regions during the complex task, whereas the amnestic MCI group showed activation. The positive linear correlations between the BOLD SI change in bilateral PCC and adjacent precuneus regions and in bilateral hippocampi in the amnestic MCI group were significant (P < .001), while in the healthy control group, they were not (P ≥ .23). These findings suggest that an altered BOLD response in amnestic MCI patients during complex tasks might be related to a decline in problem-solving ability and to memory impairment and, thus, may indicate a compensatory response to memory impairment. RSNA, 2011

Tree regeneration response to the group selection method in southern Indiana

Science.gov (United States)

Dale R. Weigel; George R. Parker

1997-01-01

Tree regeneration response following the use of the group selection method was studied within 36 group openings on the Naval Surface Warfare Center, Crane Division in south central Indiana. Two different aspects and three time periods since cutting were examined. The objectives were to determine whether aspect, age, species group, location within the opening, or their...

Physicians Mutual Aid Group: A Response to AIDS-Related Burnout.

Science.gov (United States)

Garside, Bruce

1993-01-01

Describes origins and functioning of physician's mutual aid group for physicians providing primary care to people with Acquired Immune Deficiency Syndrome (AIDS). Offers suggestions related to overcoming resistance physicians might have to participating in such a group and reviews modalities that were helpful in facilitating participants' ability…

[Effect of obesity on pulmonary function in asthmatic children of different age groups].

Science.gov (United States)

Xu, Xiao-Wen; Huang, Ying; Wang, Jian; Zhang, Xue-Li; Liang, Fan-Mei; Luo, Rong

2017-05-01

To study the effect of obesity on pulmonary function in newly diagnosed asthmatic children of different age groups. Two hundred and ninety-four children with newly diagnosed asthma were classified into preschool-age (age (6 to 12.5 years) groups. They were then classified into obese, overweight, and normal-weight subgroups based on their body mass index (BMI). All the children underwent pulmonary function tests, including large airway function tests [forced vital capacity (FVC%) and forced expiratory volume in one second (FEV1%)] and small airway function tests [maximal expiratory flow at 25% of vital capacity (MEF25%), maximal expiratory flow at 50% of vital capacity (MEF50%), and maximal expiratory flow at 75% of vital capacity (MEF75%)]. The school-age group showed lower FEV1%, MEF25%, and MEF50% than the preschool-age group (Page group had lower FEV1%, MEF25%, and MEF50% compared with their counterparts in the preschool-age group (Page group showed lower FVC% and MEF50% than those in the preschool-age group. However, all the pulmonary function parameters showed no significant differences between the obese children in the preschool-age and school-age groups. In the preschool-age group, FVC%, FEV1%, and MEF75% of the obese children were lower than those of the normal-weight children. In the school-age group, only FVC% and FEV1% showed differences between the obese and normal-weight children (Page in children with asthma, and the effect is more obvious in those of preschool age.

Can ammonia tolerance amongst lichen functional groups be explained by physiological responses?

Science.gov (United States)

Munzi, S; Cruz, C; Branquinho, C; Pinho, P; Leith, I D; Sheppard, L J

2014-04-01

Ammonia (NH3) empirical critical levels for Europe were re-evaluated in 2009, based mainly on the ecological responses of lichen communities without acknowledging the physiological differences between oligotrophic and nitrophytic species. Here, we compare a nitrogen sensitive lichen (Evernia prunastri) with a nitrogen tolerant one (Xanthoria parietina), focussing on their physiological response (Fv/Fm) to short-term NH3 exposure and their frequency of occurrence along an NH3 field gradient. Both frequency and Fv/Fm of E. prunastri decreased abruptly above 3 μg m(-3) NH3 suggesting direct adverse effects of NH3 on its photosynthetic performance. By contrast, X. parietina increased its frequency with NH3, despite showing decreased capacity of photosystem II above 50 μg m(-3) NH3, suggesting that the ecological success of X. parietina at ammonia-rich sites might be related to indirect effects of increased nitrogen (NH3) availability. These results highlight the need to establish NH3 critical levels based on oligotrophic lichen species. Copyright © 2014 Elsevier Ltd. All rights reserved.

Response efficiency during functional communication training: effects of effort on response allocation.

OpenAIRE

Richman, D M; Wacker, D P; Winborn, L

2001-01-01

An analogue functional analysis revealed that the problem behavior of a young child with developmental delays was maintained by positive reinforcement. A concurrent-schedule procedure was then used to vary the amount of effort required to emit mands. Results suggested that response effort can be an important variable when developing effective functional communication training programs.

A Response to "Social Privilege, Social Justice, and Group Counseling: An Inquiry"

Science.gov (United States)

Holcomb-McCoy, Cheryl

2008-01-01

This response discusses the importance of "privilege talk" and relates the concept of privilege to group counseling research. The impact of "colorblindness" on the dynamics of groups is discussed. The importance of understanding social privilege and its influence on counseling groups is emphasized.

Pulmonary function responses to ozone in smokers with a limited smoking history

International Nuclear Information System (INIS)

Bates, Melissa L.; Brenza, Timothy M.; Ben-Jebria, Abdellaziz; Bascom, Rebecca; Eldridge, Marlowe W.; Ultman, James S.

2014-01-01

In non-smokers, ozone (O 3 ) inhalation causes decreases in forced expiratory volume (FEV 1 ) and dead space (V D ) and increases the slope of the alveolar plateau (S N ). We previously described a population of smokers with a limited smoking history that had enhanced responsiveness to brief O 3 boluses and aimed to determine if responsiveness to continuous exposure was also enhanced. Thirty smokers (19 M, 11 F, 24 ± 4 years, 6 ± 4 total years smoking,4 ± 2 packs/week) and 30 non-smokers (17 M, 13 F, 25 ± 6 years) exercised for 1 h on a cycle ergometer while breathing 0.30 ppm O 3 . Smokers and non-smokers were equally responsive in terms of FEV 1 (− 9.5 ± 1.8% vs − 8.7 ± 1.9%). Smokers alone were responsive in terms of V D (− 6.1 ± 1.2%) and S N (9.1 ± 3.4%). There was no difference in total delivered dose. Dead space ventilation (V D /V T ) was not initially different between the two groups, but increased in the non-smokers (16.4 ± 2.8%) during the exposure, suggesting that the inhaled dose may be distributed more peripherally in smokers. We also conclude that these cigarette smokers retain their airway responsiveness to O 3 and, uniquely, experience changes in V D that lead to heterogeneity in airway morphometry and an increase in S N . - Highlights: • We previously found lung function responses to O 3 bolus exposure in smokers. • Here, we describe their responsiveness to continuous O 3 exposure with exercise. • Spirometry and capnography were used to assess pulmonary function changes. • Enhanced bronchoconstriction in smokers increases parenchymal delivery of O 3

Pulmonary function responses to ozone in smokers with a limited smoking history

Energy Technology Data Exchange (ETDEWEB)

Bates, Melissa L., E-mail: mlbates@pediatrics.wisc.edu [Interdisciplinary Graduate Degree Program in Physiology, Pennsylvania State University, University Park, PA 16802 (United States); Department of Pediatrics, Critical Care Division, University of Wisconsin School of Medicine and Public Health, Madison, WI 53792 (United States); John Rankin Laboratory of Pulmonary Medicine, University of Wisconsin School of Medicine and Public Health, Madison, WI 53792 (United States); Brenza, Timothy M. [Department of Chemical Engineering, Pennsylvania State University, University Park, PA 16802 (United States); Ben-Jebria, Abdellaziz [Interdisciplinary Graduate Degree Program in Physiology, Pennsylvania State University, University Park, PA 16802 (United States); Department of Chemical Engineering, Pennsylvania State University, University Park, PA 16802 (United States); Bascom, Rebecca [Division of Pulmonary, Allergy and Critical Care Medicine, Penn State College of Medicine, Hershey, PA 17033 (United States); Eldridge, Marlowe W. [Department of Pediatrics, Critical Care Division, University of Wisconsin School of Medicine and Public Health, Madison, WI 53792 (United States); John Rankin Laboratory of Pulmonary Medicine, University of Wisconsin School of Medicine and Public Health, Madison, WI 53792 (United States); Department of Kinesiology, University of Wisconsin-Madison, Madison, WI 53792 (United States); Department of Bioengineering, University of Wisconsin-Madison, Madison, WI 53792 (United States); Ultman, James S. [Interdisciplinary Graduate Degree Program in Physiology, Pennsylvania State University, University Park, PA 16802 (United States); Department of Chemical Engineering, Pennsylvania State University, University Park, PA 16802 (United States)

2014-07-01

In non-smokers, ozone (O{sub 3}) inhalation causes decreases in forced expiratory volume (FEV{sub 1}) and dead space (V{sub D}) and increases the slope of the alveolar plateau (S{sub N}). We previously described a population of smokers with a limited smoking history that had enhanced responsiveness to brief O{sub 3} boluses and aimed to determine if responsiveness to continuous exposure was also enhanced. Thirty smokers (19 M, 11 F, 24 ± 4 years, 6 ± 4 total years smoking,4 ± 2 packs/week) and 30 non-smokers (17 M, 13 F, 25 ± 6 years) exercised for 1 h on a cycle ergometer while breathing 0.30 ppm O{sub 3}. Smokers and non-smokers were equally responsive in terms of FEV{sub 1} (− 9.5 ± 1.8% vs − 8.7 ± 1.9%). Smokers alone were responsive in terms of V{sub D} (− 6.1 ± 1.2%) and S{sub N} (9.1 ± 3.4%). There was no difference in total delivered dose. Dead space ventilation (V{sub D}/V{sub T}) was not initially different between the two groups, but increased in the non-smokers (16.4 ± 2.8%) during the exposure, suggesting that the inhaled dose may be distributed more peripherally in smokers. We also conclude that these cigarette smokers retain their airway responsiveness to O{sub 3} and, uniquely, experience changes in V{sub D} that lead to heterogeneity in airway morphometry and an increase in S{sub N}. - Highlights: • We previously found lung function responses to O{sub 3} bolus exposure in smokers. • Here, we describe their responsiveness to continuous O{sub 3} exposure with exercise. • Spirometry and capnography were used to assess pulmonary function changes. • Enhanced bronchoconstriction in smokers increases parenchymal delivery of O{sub 3}.

Maturation of Sensori-Motor Functional Responses in the Preterm Brain.

Science.gov (United States)

Allievi, Alessandro G; Arichi, Tomoki; Tusor, Nora; Kimpton, Jessica; Arulkumaran, Sophie; Counsell, Serena J; Edwards, A David; Burdet, Etienne

2016-01-01

Preterm birth engenders an increased risk of conditions like cerebral palsy and therefore this time may be crucial for the brain's developing sensori-motor system. However, little is known about how cortical sensori-motor function matures at this time, whether development is influenced by experience, and about its role in spontaneous motor behavior. We aimed to systematically characterize spatial and temporal maturation of sensori-motor functional brain activity across this period using functional MRI and a custom-made robotic stimulation device. We studied 57 infants aged from 30 + 2 to 43 + 2 weeks postmenstrual age. Following both induced and spontaneous right wrist movements, we saw consistent positive blood oxygen level-dependent functional responses in the contralateral (left) primary somatosensory and motor cortices. In addition, we saw a maturational trend toward faster, higher amplitude, and more spatially dispersed functional responses; and increasing integration of the ipsilateral hemisphere and sensori-motor associative areas. We also found that interhemispheric functional connectivity was significantly related to ex-utero exposure, suggesting the influence of experience-dependent mechanisms. At term equivalent age, we saw a decrease in both response amplitude and interhemispheric functional connectivity, and an increase in spatial specificity, culminating in the establishment of a sensori-motor functional response similar to that seen in adults. © The Author 2015. Published by Oxford University Press.

Restoration using Azolla imbricata increases nitrogen functional bacterial groups and genes in soil.

Science.gov (United States)

Lu, Xiao-Ming; Lu, Peng-Zhen; Yang, Ke

2017-05-01

Microbial groups are major factors that influence soil function. Currently, there is a lack of studies on microbial functional groups. Although soil microorganisms play an important role in the nitrogen cycle, systematic studies of the effects of environmental factors on microbial populations in relation to key metabolic processes in the nitrogen cycle are seldom reported. In this study, we conducted a systematic analysis of the changes in nitrogen functional groups in mandarin orange garden soil treated with Azolla imbricata. The structures of the major functional bacterial groups and the functional gene abundances involved in key processes of the soil nitrogen cycle were analyzed using high-throughput sequencing (HTS) and quantitative real-time PCR, respectively. The results indicated that returning A. imbricata had an important influence on the composition of soil nitrogen functional bacterial communities. Treatment with A. imbricata increased the diversity of the nitrogen functional bacteria. The abundances of nitrogen functional genes were significantly higher in the treated soil compared with the control soil. Both the diversity of the major nitrogen functional bacteria (nifH bacteria, nirK bacteria, and narG bacteria) and the abundances of nitrogen functional genes in the soil showed significant positive correlations with the soil pH, the organic carbon content, available nitrogen, available phosphorus, and NH 4 + -N and NO 3 - -N contents. Treatment with 12.5 kg fresh A. imbricata per mandarin orange tree was effective to improve the quality of the mandarin orange garden soil. This study analyzed the mechanism of the changes in functional bacterial groups and genes involved in key metabolic processes of the nitrogen cycle in soil treated by A. imbricata.

Functional Roles of Syk in Macrophage-Mediated Inflammatory Responses

Science.gov (United States)

Yi, Young-Su; Son, Young-Jin; Ryou, Chongsuk; Sung, Gi-Ho; Kim, Jong-Hoon; Cho, Jae Youl

2014-01-01

Inflammation is a series of complex biological responses to protect the host from pathogen invasion. Chronic inflammation is considered a major cause of diseases, such as various types of inflammatory/autoimmune diseases and cancers. Spleen tyrosine kinase (Syk) was initially found to be highly expressed in hematopoietic cells and has been known to play crucial roles in adaptive immune responses. However, recent studies have reported that Syk is also involved in other biological functions, especially in innate immune responses. Although Syk has been extensively studied in adaptive immune responses, numerous studies have recently presented evidence that Syk has critical functions in macrophage-mediated inflammatory responses and is closely related to innate immune response. This review describes the characteristics of Syk-mediated signaling pathways, summarizes the recent findings supporting the crucial roles of Syk in macrophage-mediated inflammatory responses and diseases, and discusses Syk-targeted drug development for the therapy of inflammatory diseases. PMID:25045209

Functional Roles of Syk in Macrophage-Mediated Inflammatory Responses

Directory of Open Access Journals (Sweden)

Young-Su Yi

2014-01-01

Full Text Available Inflammation is a series of complex biological responses to protect the host from pathogen invasion. Chronic inflammation is considered a major cause of diseases, such as various types of inflammatory/autoimmune diseases and cancers. Spleen tyrosine kinase (Syk was initially found to be highly expressed in hematopoietic cells and has been known to play crucial roles in adaptive immune responses. However, recent studies have reported that Syk is also involved in other biological functions, especially in innate immune responses. Although Syk has been extensively studied in adaptive immune responses, numerous studies have recently presented evidence that Syk has critical functions in macrophage-mediated inflammatory responses and is closely related to innate immune response. This review describes the characteristics of Syk-mediated signaling pathways, summarizes the recent findings supporting the crucial roles of Syk in macrophage-mediated inflammatory responses and diseases, and discusses Syk-targeted drug development for the therapy of inflammatory diseases.

Development of one-energy group, two-dimensional, frequency dependent detector adjoint function based on the nodal method

International Nuclear Information System (INIS)

Khericha, Soli T.

2000-01-01

One-energy group, two-dimensional computer code was developed to calculate the response of a detector to a vibrating absorber in a reactor core. A concept of local/global components, based on the frequency dependent detector adjoint function, and a nodalization technique were utilized. The frequency dependent detector adjoint functions presented by complex equations were expanded into real and imaginary parts. In the nodalization technique, the flux is expanded into polynomials about the center point of each node. The phase angle and the magnitude of the one-energy group detector adjoint function were calculated for a detector located in the center of a 200x200 cm reactor using a two-dimensional nodalization technique, the computer code EXTERMINATOR, and the analytical solution. The purpose of this research was to investigate the applicability of a polynomial nodal model technique to the calculations of the real and the imaginary parts of the detector adjoint function for one-energy group two-dimensional polynomial nodal model technique. From the results as discussed earlier, it is concluded that the nodal model technique can be used to calculate the detector adjoint function and the phase angle. Using the computer code developed for nodal model technique, the magnitude of one energy group frequency dependent detector adjoint function and the phase angle were calculated for the detector located in the center of a 200x200 cm homogenous reactor. The real part of the detector adjoint function was compared with the results obtained from the EXTERMINATOR computer code as well as the analytical solution based on a double sine series expansion using the classical Green's Function solution. The values were found to be less than 1% greater at 20 cm away from the source region and about 3% greater closer to the source compared to the values obtained from the analytical solution and the EXTERMINATOR code. The currents at the node interface matched within 1% of the average

Functional Group of Spiders in Cultivated Landscape Dominated by Paddy Fields in West Java, Indonesia

Directory of Open Access Journals (Sweden)

I WAYAN SUANA

2009-03-01

Full Text Available Distribution of spiders in all colonized environments is limited by biotic and abiotic factors requiring adaptations with respect to, for example microhabitat choice and hunting behavior. These two factors were frequently used to group spiders into functional groups. In this study our objectives were to (i group of genera of spiders into functional group based on their microhabitat specificity, hunting behavior, and daily activity; and (ii compare the number and composition of functional group of spider at each habitat type and period of paddy growth. The study was conducted at a landscape dominated by paddy fields in Cianjur Watershed for a period of 9 months. Four different habitat types (paddy, vegetable, non-crop, and mixed garden, were sampled using five trapping techniques (pitfall traps, farmcop suction, sweep netting, yellow-pan traps, and sticky traps. The Unweighted Pair-Group Average and the Euclidean Distances were used to generate dendrogram of functional group of spider. We found 14 functional groups of spider at genus level. The number of functional group of spider at four habitat types was differing, but the composition was similar, because all habitats were closed to each other. Habitat structure diversity and disturbance level influenced the number of functional group of spider. Different architecture of vegetation and availability of differ prey during paddy growth, causing the composition of functional group of spider in each period of paddy growth was changed, although its number was unchanged.

Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

Science.gov (United States)

Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

2009-05-01

Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.

Effects of chemical functional groups on elemental mercury adsorption on carbonaceous surfaces

Energy Technology Data Exchange (ETDEWEB)

Liu Jing, E-mail: liujing27@mail.hust.edu.cn [State Key Laboratory of Coal Combustion, Huazhong University of Science and Technology, Wuhan 430074 (China); Cheney, Marcos A. [Department of Natural Sciences, University of Maryland Eastern Shore, Princess Anne, MD 21853 (United States); Wu Fan; Li Meng [State Key Laboratory of Coal Combustion, Huazhong University of Science and Technology, Wuhan 430074 (China)

2011-02-15

A systematic theoretical study using density functional theory is performed to provide molecular-level understanding of the effects of chemical functional groups on mercury adsorption on carbonaceous surfaces. The zigzag and armchair edges were used in modeling the carbonaceous surfaces to simulate different adsorption sites. The edge atoms on the upper side of the models are unsaturated to simulate active sites. All calculations (optimizations, energies, and frequencies) were made at B3PW91 density functional theory level, using RCEP60VDZ basis set for mercury and 6-31G(d) pople basis set for other atoms. The results indicate that the embedding of halogen atom can increase the activity of its neighboring site which in turn increases the adsorption capacity of the carbonaceous surface for Hg{sup 0}. The adsorption belongs to chemisorptions, which is in good agreement with the experimental results. For the effects of oxygen functional groups, lactone, carbonyl and semiquinone favor Hg{sup 0} adsorption because they increase the neighboring site's activity for mercury adsorption. On the contrary, phenol and carboxyl functional groups show a physisorption of Hg{sup 0}, and reduce Hg capture. This result can explain the seemingly conflicting experimental results reported in the literature concerning the influence of oxygen functional groups on mercury adsorption on carbonaceous surface.

Immunotherapy Response Assessment in Neuro-Oncology (iRANO): A Report of the RANO Working Group

Science.gov (United States)

Okada, Hideho; Weller, Michael; Huang, Raymond; Finocchiaro, Gaetano; Gilbert, Mark R.; Wick, Wolfgang; Ellingson, Benjamin M.; Hashimoto, Naoya; Pollack, Ian F.; Brandes, Alba A.; Franceschi, Enrico; Herold-Mende, Christel; Nayak, Lakshmi; Panigrahy, Ashok; Pope, Whitney B.; Prins, Robert; Sampson, John H.; Wen, Patrick Y.; Reardon, David A.

2015-01-01

Immunotherapy represents a promising area of therapy among neuro-oncology patients. However, early phase studies reveal unique challenges associated with assessment of radiological changes reflecting delayed responses or therapy-induced inflammation. Clinical benefit, including long-term survival and tumor regression, can still occur following initial apparent progression or appearance of new lesions. Refinement of response assessment criteria for neuro-oncology patients undergoing immunotherapy is therefore warranted. A multinational and multidisciplinary panel of neuro-oncology immunotherapy experts describes immunotherapy response assessment for neuro-oncology (iRANO) criteria that are based on guidance for determination of tumor progression outlined by the immune-related response criteria (irRC) and the response assessment in neuro-oncology (RANO) working group. Among patients who demonstrate imaging findings meeting RANO criteria for progressive disease (PD) within six months of initiating immunotherapy including the development of new lesions, confirmation of radiographic progression on follow-up imaging is recommended provided that the patient is not significantly worse clinically. The proposed criteria also include guidelines for use of corticosteroids. The role of advanced imaging techniques and measurement of clinical benefit endpoints including neurologic and immunologic functions are reviewed. The iRANO guidelines put forth herein will evolve successively to improve their utility as further experience from immunotherapy trials in neuro-oncology accumulate. PMID:26545842

Wigner functions for noncommutative quantum mechanics: A group representation based construction

Energy Technology Data Exchange (ETDEWEB)

Chowdhury, S. Hasibul Hassan, E-mail: shhchowdhury@gmail.com [Chern Institute of Mathematics, Nankai University, Tianjin 300071 (China); Department of Mathematics and Statistics, Concordia University, Montréal, Québec H3G 1M8 (Canada); Ali, S. Twareque, E-mail: twareque.ali@concordia.ca [Department of Mathematics and Statistics, Concordia University, Montréal, Québec H3G 1M8 (Canada)

2015-12-15

This paper is devoted to the construction and analysis of the Wigner functions for noncommutative quantum mechanics, their marginal distributions, and star-products, following a technique developed earlier, viz, using the unitary irreducible representations of the group G{sub NC}, which is the three fold central extension of the Abelian group of ℝ{sup 4}. These representations have been exhaustively studied in earlier papers. The group G{sub NC} is identified with the kinematical symmetry group of noncommutative quantum mechanics of a system with two degrees of freedom. The Wigner functions studied here reflect different levels of non-commutativity—both the operators of position and those of momentum not commuting, the position operators not commuting and finally, the case of standard quantum mechanics, obeying the canonical commutation relations only.

Adaptive Feeding behavior and functional responses in pelagic copepods

DEFF Research Database (Denmark)

Kiørboe, Thomas; Saiz, Enrico; Tiselius, Peter

2018-01-01

Zooplankton may modify their feeding behavior in response to prey availability and presence of predators with implications to populations of both predators and prey. Optimal foraging theory predicts that such responses result in a type II functional response for passive foragers and a type III re...

Science in Emergency Response at CDC: Structure and Functions.

Science.gov (United States)

Iskander, John; Rose, Dale A; Ghiya, Neelam D

2017-09-01

Recent high-profile activations of the US Centers for Disease Control and Prevention (CDC) Emergency Operations Center (EOC) include responses to the West African Ebola and Zika virus epidemics. Within the EOC, emergency responses are organized according to the Incident Management System, which provides a standardized structure and chain of command, regardless of whether the EOC activation occurs in response to an outbreak, natural disaster, or other type of public health emergency. By embedding key scientific roles, such as the associate director for science, and functions within a Scientific Response Section, the current CDC emergency response structure ensures that both urgent and important science issues receive needed attention. Key functions during emergency responses include internal coordination of scientific work, data management, information dissemination, and scientific publication. We describe a case example involving the ongoing Zika virus response that demonstrates how the scientific response structure can be used to rapidly produce high-quality science needed to answer urgent public health questions and guide policy. Within the context of emergency response, longer-term priorities at CDC include both streamlining administrative requirements and funding mechanisms for scientific research.

Nest Digging by Leaf-Cutting Ants: Effect of Group Size and Functional Structures

Directory of Open Access Journals (Sweden)

Roberto da Silva Camargo

2012-01-01

Full Text Available Leaf-cutting ant workers dig underground chambers, for housing their symbiotic fungus, interconnected by a vast quantity of tunnels whose function is to permit the entrance of food (leaves, gaseous exchanges, and movement of workers, offspring, and the queen. Digging is a task executed by a group of workers, but little is known about the group effect and group-constructed functional structures. Thus, we analyzed the structures formed by worker groups (5, 10, 20, and 40 individuals of the leaf-cutting ant, Atta sexdens rubropilosa, for 2 days of excavation. The digging arena was the same for the 4 groups, with each group corresponding to a different density. Our results verified a pattern of tunneling by the workers, but no chamber was constructed. The group effect is well known, since the 40-worker group dug significantly more than the groups of 5, 10, and 20. These groups did not differ statistically from each other. Analysis of load/worker verified that workers of the smallest group carried the greatest load. Our paper demonstrates the group effect on the digging of nests, namely, that excavation is proportional to group size, but without emergence of a functional structure such as a chamber.

Impulse-response analysis of monetary policy – Visegád group countries case

Directory of Open Access Journals (Sweden)

Kateřina Myšková

2013-01-01

Full Text Available In this paper, we focus on comparability of monetary policies of Visegrád group countries (V4. Main objective of central banks function in V4 countries lies in maintaining price stability. For this purpose, inflation targeting regime is realized in a medium-term focus in V4, which means that there is a certain lag between monetary policy operation and its influence on an inflation target. Central bank does not have a direct impact on its ultimate goals. Therefore, any monetary policy analysis and assumption of its effectiveness comes out from an essential existence of a working transmission mechanism. Thus, changes in settings of monetary policy instruments have to be able to inflict causal changes on intermediary markets and via these markets on target markets. This situation can be modeled by the vector autoregressive (VAR model with suitable variables. Our main task is to compare a relationship between VAR model responses to predefined impulses for all V4 pairs. We use calibration technique for this purpose. Specifically, we will utilize one-dimensional calibration model with a linear calibration function for deriving unknown parameters. Moreover, we will test a significance of estimated parameters. We distinguish between model parameters for before-crisis- and during-crisis- data, because we suppose that financial crisis affects VAR model parameters significantly. Different responses in each country can mean the inability of the common monetary policy for V4 at present.

Linear density response function in the projector augmented wave method

DEFF Research Database (Denmark)

Yan, Jun; Mortensen, Jens Jørgen; Jacobsen, Karsten Wedel

2011-01-01

We present an implementation of the linear density response function within the projector-augmented wave method with applications to the linear optical and dielectric properties of both solids, surfaces, and interfaces. The response function is represented in plane waves while the single...... functions of Si, C, SiC, AlP, and GaAs compare well with previous calculations. While optical properties of semiconductors, in particular excitonic effects, are generally not well described by ALDA, we obtain excellent agreement with experiments for the surface loss function of graphene and the Mg(0001...

32 CFR 352a.4 - Responsibilities and functions.

Science.gov (United States)

2010-07-01

...) ORGANIZATIONAL CHARTERS DEFENSE FINANCE AND ACCOUNTING SERVICE (DFAS) § 352a.4 Responsibilities and functions. (a) The Director, Defense Finance and Accounting Service (DFAS), is the principal DoD executive for finance and accounting requirements, systems, and functions identified in DoD Directive 5118.3, 1 and...

The functional response of a generalist predator.

Directory of Open Access Journals (Sweden)

Sophie Smout

Full Text Available BACKGROUND: Predators can have profound impacts on the dynamics of their prey that depend on how predator consumption is affected by prey density (the predator's functional response. Consumption by a generalist predator is expected to depend on the densities of all its major prey species (its multispecies functional response, or MSFR, but most studies of generalists have focussed on their functional response to only one prey species. METHODOLOGY AND PRINCIPAL FINDINGS: Using Bayesian methods, we fit an MSFR to field data from an avian predator (the hen harrier Circus cyaneus feeding on three different prey species. We use a simple graphical approach to show that ignoring the effects of alternative prey can give a misleading impression of the predator's effect on the prey of interest. For example, in our system, a "predator pit" for one prey species only occurs when the availability of other prey species is low. CONCLUSIONS AND SIGNIFICANCE: The Bayesian approach is effective in fitting the MSFR model to field data. It allows flexibility in modelling over-dispersion, incorporates additional biological information into the parameter priors, and generates estimates of uncertainty in the model's predictions. These features of robustness and data efficiency make our approach ideal for the study of long-lived predators, for which data may be sparse and management/conservation priorities pressing.

Computing the effective action with the functional renormalization group

Energy Technology Data Exchange (ETDEWEB)

Codello, Alessandro [CP3-Origins and the Danish IAS University of Southern Denmark, Odense (Denmark); Percacci, Roberto [SISSA, Trieste (Italy); INFN, Sezione di Trieste, Trieste (Italy); Rachwal, Leslaw [Fudan University, Department of Physics, Center for Field Theory and Particle Physics, Shanghai (China); Tonero, Alberto [ICTP-SAIFR and IFT, Sao Paulo (Brazil)

2016-04-15

The ''exact'' or ''functional'' renormalization group equation describes the renormalization group flow of the effective average action Γ{sub k}. The ordinary effective action Γ{sub 0} can be obtained by integrating the flow equation from an ultraviolet scale k = Λ down to k = 0. We give several examples of such calculations at one-loop, both in renormalizable and in effective field theories. We reproduce the four-point scattering amplitude in the case of a real scalar field theory with quartic potential and in the case of the pion chiral Lagrangian. In the case of gauge theories, we reproduce the vacuum polarization of QED and of Yang-Mills theory. We also compute the two-point functions for scalars and gravitons in the effective field theory of scalar fields minimally coupled to gravity. (orig.)

Biogeographical boundaries, functional group structure and diversity of Rocky Shore communities along the Argentinean coast.

Directory of Open Access Journals (Sweden)

Evie A Wieters

Full Text Available We investigate the extent to which functional structure and spatial variability of intertidal communities coincide with major biogeographical boundaries, areas where extensive compositional changes in the biota are observed over a limited geographic extension. We then investigate whether spatial variation in the biomass of functional groups, over geographic (10's km and local (10's m scales, could be associated to species diversity within and among these groups. Functional community structure expressed as abundance (density, cover and biomass and composition of major functional groups was quantified through field surveys at 20 rocky intertidal shores spanning six degrees of latitude along the southwest Atlantic coast of Argentina and extending across the boundaries between the Argentinean and Magellanic Provinces. Patterns of abundance of individual functional groups were not uniformly matched with biogeographical regions. Only ephemeral algae showed an abrupt geographical discontinuity coincident with changes in biogeographic boundaries, and this was limited to the mid intertidal zone. We identified 3-4 main 'groups' of sites in terms of the total and relative abundance of the major functional groups, but these did not coincide with biogeographical boundaries, nor did they follow latitudinal arrangement. Thus, processes that determine the functional structure of these intertidal communities are insensitive to biogeographical boundaries. Over both geographical and local spatial scales, and for most functional groups and tidal levels, increases in species richness within the functional group was significantly associated to increased total biomass and reduced spatial variability of the group. These results suggest that species belonging to the same functional group are sufficiently uncorrelated over space (i.e. metres and site-to-site to stabilize patterns of biomass variability and, in this manner, provide a buffer, or "insurance", against

How groups cope with collective responsibility for ecological problems: Symbolic coping and collective emotions.

Science.gov (United States)

Caillaud, Sabine; Bonnot, Virginie; Ratiu, Eugenia; Krauth-Gruber, Silvia

2016-06-01

This study explores the way groups cope with collective responsibility for ecological problems. The social representations approach was adopted, and the collective symbolic coping model was used as a frame of analysis, integrating collective emotions to enhance the understanding of coping processes. The original feature of this study is that the analysis is at group level. Seven focus groups were conducted with French students. An original use of focus groups was proposed: Discussions were structured to induce feelings of collective responsibility and enable observation of how groups cope with such feelings at various levels (social knowledge; social identities; group dynamics). Two analyses were conducted: Qualitative analysis of participants' use of various kinds of knowledge, social categories and the group dynamics, and lexicometric analysis to reveal how emotions varied during the different discussion phases. Results showed that groups' emotional states moved from negative to positive: They used specific social categories and resorted to shared stereotypes to cope with collective responsibility and maintain the integrity of their worldview. Only then did debate become possible again; it was anchored in the nature-culture dichotomy such that groups switched from group-based to system-based emotions. © 2015 The British Psychological Society.

Evaluation of the detector response function digital conventional radiology

International Nuclear Information System (INIS)

Arino Gil, A.; Hernandez Rodriguez, J.; Mateos Salvador, P.; Rodriguez Lopez, B.; Font Gelabert, J. C.

2013-01-01

The objective of this work is to obtain the response function that relates the air kerma at the entrance of the detector and pixel value, for a series of digital detectors of conventional Radiology model Optimus DigitalDiagnost Philips () and 6000 Definium General Electric. From the set of measurements is obtained a response function for each reference type of detector, and compared with those published in the literature for these teams. (Author)

Morphological and functional diversity of primary producers group in savannas

International Nuclear Information System (INIS)

Medina, E.

1996-01-01

The meaning of biological diversity for the operation and stability of natural ecosystems is matter of great theoretical and practical interest. The appearance and permanency of species in a given atmosphere indicates its capacity to compete with other species with similar habit and requirements, and to accumulate the resources that allow its reproduction. On the other hand, the coexistence of similar species in the same ecosystem allows to wonder if ever biological redundancy exists, that is to say, if several species coexist with the same function inside the ecosystem, so that the disappearance of one of them would not have biological significant consequences. A strategy to simplify the analysis of relationships between biodiversity and ecosystems operation is by grouping species with similar function, called functional groups. In this work the the primary producers functional group is analyzed, essentially superiors plants, in a savannas ecosystems. The analysis establishes that the gives the primary producers group is heterogeneous and complex, so much morphological as functionally: 1) the structural complexity and diversity forms of life in an savannas ecosystem are associated with the stratified exploitation of resources over (light) and under the floor (nourishment and water). Changes in diversity that affect the system structure will probably also affect its operations. 2 )Very similar morphological species can differ physiologically up to constitute production units with contrasting nutritional requirements. The echo-physiologic analysis of this differentiation can explain the habitat preferences that are naturally observed. 3) The long-time permanency of rare species, of low frequency, show the inability of dominant species to capture all the available resources. 4) The primary producers and the floor microorganisms have strong interactions. Changes in the community composition can generate significant changes in other community. These biotic interactions

Interpersonal distance regulates functional grouping tendencies of agents in team sports.

Science.gov (United States)

Passos, Pedro; Milho, João; Fonseca, Sofia; Borges, João; Araújo, Duarte; Davids, Keith

2011-01-01

The authors examined whether, similar to collective agent behaviors in complex, biological systems (e.g., schools of fish and colonies of ants), performers in team sports displayed functional coordination tendencies, based on local interaction rules during performance. To investigate this issue, they used videogrammetry and digitizing procedures to observe interpersonal interactions in common 4 versus 2 + 2 subphases of the team sport of rugby union, involving 16 participants aged between 16 and 17 years of age. They observed pattern-forming dynamics in attacking subunits (n = 4 players) attempting to penetrate 2 defensive lines (n = 2 players in each). Data showed that within each attacking subunit, the 4 players displayed emergent functional grouping tendencies that differed between the 2 defensive lines. Results confirmed that grouping tendencies in attacking subunits of team games are sensitive to different task constraints, such as relative positioning to nearest defenders. It was concluded that running correlations were particularly useful for measuring the level of interpersonal coordination in functional grouping tendencies within attacking subunits.

Toward a standardized structural-functional group connectome in MNI space.

Science.gov (United States)

Horn, Andreas; Blankenburg, Felix

2016-01-01

The analysis of the structural architecture of the human brain in terms of connectivity between its subregions has provided profound insights into its underlying functional organization and has coined the concept of the "connectome", a structural description of the elements forming the human brain and the connections among them. Here, as a proof of concept, we introduce a novel group connectome in standard space based on a large sample of 169 subjects from the Enhanced Nathan Kline Institute-Rockland Sample (eNKI-RS). Whole brain structural connectomes of each subject were estimated with a global tracking approach, and the resulting fiber tracts were warped into standard stereotactic (MNI) space using DARTEL. Employing this group connectome, the results of published tracking studies (i.e., the JHU white matter and Oxford thalamic connectivity atlas) could be largely reproduced directly within MNI space. In a second analysis, a study that examined structural connectivity between regions of a functional network, namely the default mode network, was reproduced. Voxel-wise structural centrality was then calculated and compared to others' findings. Furthermore, including additional resting-state fMRI data from the same subjects, structural and functional connectivity matrices between approximately forty thousand nodes of the brain were calculated. This was done to estimate structure-function agreement indices of voxel-wise whole brain connectivity. Taken together, the combination of a novel whole brain fiber tracking approach and an advanced normalization method led to a group connectome that allowed (at least heuristically) performing fiber tracking directly within MNI space. Such an approach may be used for various purposes like the analysis of structural connectivity and modeling experiments that aim at studying the structure-function relationship of the human connectome. Moreover, it may even represent a first step toward a standard DTI template of the human brain

Functional Groups Quantification of Chondritic Organics by XANES Spectroscopy

Science.gov (United States)

Le Guillou, C.; Bernard, S.

2017-07-01

We have developed a new method to quantify the functional group concentration of organics using STXM-XANES. Applied to IOM and in situ FIB sections measurement, it reveals a lower aromaticity than expected from previous NMR results (35% vs. 60%).

ARES: automated response function code. Users manual. [HPGAM and LSQVM

Energy Technology Data Exchange (ETDEWEB)

Maung, T.; Reynolds, G.M.

1981-06-01

This ARES user's manual provides detailed instructions for a general understanding of the Automated Response Function Code and gives step by step instructions for using the complete code package on a HP-1000 system. This code is designed to calculate response functions of NaI gamma-ray detectors, with cylindrical or rectangular geometries.

The Effectiveness of Transactional Analysis Group-counseling on the Improvement of Couples’ Family Functioning

Directory of Open Access Journals (Sweden)

Ghorban Ali Yahyaee

2015-06-01

Full Text Available Background & Aims of the Study: Family functioning is among the most important factors ensuring the mental health of family members. Disorder or disturbance in family functioning would cause many psychological problems for family members. Current study intended to examine the effectiveness of transactional analysis group counseling on the improvement of couple's family functioning. Materials & Methods: The design of the study is as semi experimental research with pretest and posttest with follow up and control group. Statistical population consists all couples referring to the psychological and counseling centers of Rasht city in 2012. Samples were selected at first by available sampling method and after completing family assessment  device, and obtaining score for enter to research, were placement using random sampling method in two experimental and control groups (N = 8 couples per group. The experimental group participated in 12 sessions of group counseling based on transactional analysis and control group received no intervention. The gathered data were analyzed using covariance analysis. Results: The results show that there are significant differences between the pre-test and post test scores of the experimental group. This difference is significant at the level of 0.05. Therefore it seems that transactional group therapy improved the dimensions of family functioning in couples. Conclusions: The results indicated that transactional analysis group counseling can improve the family functioning and use this approach to working with couples is recommended.

Incorporating social groups' responses in a descriptive model for second- and higher-order impact identification

International Nuclear Information System (INIS)

Sutheerawatthana, Pitch; Minato, Takayuki

2010-01-01

The response of a social group is a missing element in the formal impact assessment model. Previous discussion of the involvement of social groups in an intervention has mainly focused on the formation of the intervention. This article discusses the involvement of social groups in a different way. A descriptive model is proposed by incorporating a social group's response into the concept of second- and higher-order effects. The model is developed based on a cause-effect relationship through the observation of phenomena in case studies. The model clarifies the process by which social groups interact with a lower-order effect and then generate a higher-order effect in an iterative manner. This study classifies social groups' responses into three forms-opposing, modifying, and advantage-taking action-and places them in six pathways. The model is expected to be used as an analytical tool for investigating and identifying impacts in the planning stage and as a framework for monitoring social groups' responses during the implementation stage of a policy, plan, program, or project (PPPPs).

Functional neural networks underlying response inhibition in adolescents and adults.

Science.gov (United States)

Stevens, Michael C; Kiehl, Kent A; Pearlson, Godfrey D; Calhoun, Vince D

2007-07-19

This study provides the first description of neural network dynamics associated with response inhibition in healthy adolescents and adults. Functional and effective connectivity analyses of whole brain hemodynamic activity elicited during performance of a Go/No-Go task were used to identify functionally integrated neural networks and characterize their causal interactions. Three response inhibition circuits formed a hierarchical, inter-dependent system wherein thalamic modulation of input to premotor cortex by fronto-striatal regions led to response suppression. Adolescents differed from adults in the degree of network engagement, regional fronto-striatal-thalamic connectivity, and network dynamics. We identify and characterize several age-related differences in the function of neural circuits that are associated with behavioral performance changes across adolescent development.

Functional weight-bearing mobilization after Achilles tendon rupture enhances early healing response: a single-blinded randomized controlled trial.

Science.gov (United States)

Valkering, Kars P; Aufwerber, Susanna; Ranuccio, Francesco; Lunini, Enricomaria; Edman, Gunnar; Ackermann, Paul W

2017-06-01

Functional weight-bearing mobilization may improve repair of Achilles tendon rupture (ATR), but the underlying mechanisms and outcome were unknown. We hypothesized that functional weight-bearing mobilization by means of increased metabolism could improve both early and long-term healing. In this prospective randomized controlled trial, patients with acute ATR were randomized to either direct post-operative functional weight-bearing mobilization (n = 27) in an orthosis or to non-weight-bearing (n = 29) plaster cast immobilization. During the first two post-operative weeks, 15°-30° of plantar flexion was allowed and encouraged in the functional weight-bearing mobilization group. At 2 weeks, patients in the non-weight-bearing cast immobilization group received a stiff orthosis, while the functional weight-bearing mobilization group continued with increased range of motion. At 6 weeks, all patients discontinued immobilization. At 2 weeks, healing metabolites and markers of procollagen type I (PINP) and III (PIIINP) were examined using microdialysis. At 6 and 12 months, functional outcome using heel-rise test was assessed. Healing tendons of both groups exhibited increased levels of metabolites glutamate, lactate, pyruvate, and of PIIINP (all p bearing mobilization group demonstrated significantly higher concentrations of glutamate compared to the non-weight-bearing cast immobilization group (p = 0.045).The upregulated glutamate levels were significantly correlated with the concentrations of PINP (r = 0.5, p = 0.002) as well as with improved functional outcome at 6 months (r = 0.4; p = 0.014). Heel-rise tests at 6 and 12 months did not display any differences between the two groups. Functional weight-bearing mobilization enhanced the early healing response of ATR. In addition, early ankle range of motion was improved without the risk of Achilles tendon elongation and without altering long-term functional outcome. The relationship between

Density functional theory study the effects of oxygen-containing functional groups on oxygen molecules and oxygen atoms adsorbed on carbonaceous materials.

Science.gov (United States)

Qi, Xuejun; Song, Wenwu; Shi, Jianwei

2017-01-01

Density functional theory was used to study the effects of different types of oxygen-containing functional groups on the adsorption of oxygen molecules and single active oxygen atoms on carbonaceous materials. During gasification or combustion reactions of carbonaceous materials, oxygen-containing functional groups such as hydroxyl(-OH), carbonyl(-CO), quinone(-O), and carboxyl(-COOH) are often present on the edge of graphite and can affect graphite's chemical properties. When oxygen-containing functional groups appear on a graphite surface, the oxygen molecules are strongly adsorbed onto the surface to form a four-member ring structure. At the same time, the O-O bond is greatly weakened and easily broken. The adsorption energy value indicates that the adsorption of oxygen molecules changes from physisorption to chemisorption for oxygen-containing functional groups on the edge of a graphite surface. In addition, our results indicate that the adsorption energy depends on the type of oxygen-containing functional group. When a single active oxygen atom is adsorbed on the bridge site of graphite, it gives rise to a stable epoxy structure. Epoxy can cause deformation of the graphite lattice due to the transition of graphite from sp2 to sp3 after the addition of an oxygen atom. For quinone group on the edge of graphite, oxygen atoms react with carbon atoms to form the precursor of CO2. Similarly, the single active oxygen atoms of carbonyl groups can interact with edge carbon atoms to form the precursor of CO2. The results show that oxygen-containing functional groups on graphite surfaces enhance the activity of graphite, which promotes adsorption on the graphite surface.

Functional group composition of ambient and source organic aerosols determined by tandem mass spectrometry

Energy Technology Data Exchange (ETDEWEB)

Dron, J.; El Haddad, I.; Temime-Roussel, B.; Wortham, H.; Marchand, N. [Univ Aix Marseille, CNRS, Lab Chim Provence, Equipe Instrumentat and React Atmospher, UMR 6264, F-13331 Marseille 3 (France); Jaffrezo, J.L. [Univ Grenoble 1, CNRS, UMR 5183, Lab Glaciol and Geophys Environm, F-38402 St Martin Dheres (France)

2010-07-01

The functional group composition of various organic aerosols (OA) is investigated using a recently developed analytical approach based on atmospheric pressure chemical ionisation-tandem mass spectrometry (APCIMS/MS). The determinations of three functional groups contents are performed quantitatively by neutral loss (carboxylic and carbonyl groups, R-COOH and R-CO-R' respectively) and precursor ion (nitro groups, R-NO{sub 2}) scanning modes of a tandem mass spectrometer. Major organic aerosol sources are studied: vehicular emission and wood combustion for primary aerosol sources; and a secondary organic aerosol (SOA) produced through photooxidation of o-xylene. The results reveal significant differences in the functional group contents of these source aerosols. The laboratory generated SOA is dominated by carbonyls while carboxylics are preponderate in the wood combustion particles. On the other hand, vehicular emissions are characterised by a strong nitro content. The total amount of the three functional groups accounts for 1.7% (vehicular) to 13.5% (o-xylene photooxidation) of the organic carbon. Diagnostic functional group ratios are then used to tentatively discriminate sources of particles collected in an urban background environment located in an Alpine valley (Chamonix, France) during a strong winter pollution event. The three functional groups under study account for a total functionalization rate of 2.2 to 3.8% of the organic carbon in this ambient aerosol, which is also dominated by carboxylic moieties. In this particular case study of a deep alpine valley during winter, we show that the nitro- and carbonyl-to-carboxylic diagnostic ratios can be a useful tool to discriminate sources. In these conditions, the total OA concentrations are highly dominated by wood combustion OA. This result is confirmed by an organic markers source apportionment approach which assess a wood burning organic carbon contribution of about 60%. Finally, examples of functional

Diagnostics for Linear Models With Functional Responses

OpenAIRE

Xu, Hongquan; Shen, Qing

2005-01-01

Linear models where the response is a function and the predictors are vectors are useful in analyzing data from designed experiments and other situations with functional observations. Residual analysis and diagnostics are considered for such models. Studentized residuals are defined and their properties are studied. Chi-square quantile-quantile plots are proposed to check the assumption of Gaussian error process and outliers. Jackknife residuals and an associated test are proposed to det...

Detecting the Subtle Shape Differences in Hemodynamic Responses at the Group Level

Directory of Open Access Journals (Sweden)

Gang eChen

2015-10-01

Full Text Available The nature of the hemodynamic response (HDR is still not fully understood due to the multifaceted processes involved. Aside from the overall amplitude, the response may vary across cognitive states, tasks, brain regions, and subjects with respect to characteristics such as rise and fall speed, peak duration, undershoot shape, and overall duration. Here we demonstrate that the fixed-shape or adjusted-shape methods may fail to detect some shape subtleties. In contrast, the estimated-shape method (ESM through multiple basis functions can provide the opportunity to identify some subtle shape differences and achieve higher statistical power at both individual and group levels. Previously, some dimension reduction approaches focused on the peak magnitude, or made inferences based on the area under the curve or interaction, which can lead to potential misidentifications. By adopting a generic framework of multivariate modeling (MVM, we showcase a hybrid approach that is validated by simulations and real data. Unlike the few analyses that were limited to main effect, two- or three-way interactions, we extend the approach to an inclusive platform that is more adaptable than the conventional GLM, achieving a practical equipoise among representation, false positive control, statistical power, and modeling flexibility.

Impedance function of a group of vertical piles

International Nuclear Information System (INIS)

Wolf, J.P.; Arx, G.A. von

1978-01-01

Impedance and transfer functions of a group of vertical piles located in any desired configuration in plan in a horizontally stratified soil layer are derived. Hysteretic and radiation damping are accounted for. The method separates the piles and the soil, introducing unknown interaction forces. The total flexibility matrix of the soil is constructed, superposing the (complex) flexibility coefficients caused by the interaction forces of a single pile only. The dependence of the impedance and transfer functions on the oscllating frequency for foundations with different numbers of piles is investigated. Pile-soil-pile interaction is shown to be very important for all modes of vibration. The procedure is used in the seismic analysis of a reactor building. (Author)

Response functions for crystals and surfaces, with applications to surface scattering

International Nuclear Information System (INIS)

Barker, J.A.; Steele, W.A.

1978-01-01

A general solution of the equations of forced motion of a harmonic crystal or other vibrating system with arbitrary time-dependent forces acting on the atoms is given. The solution is given in terms of dynamical 'response functions', for which expressions in terms of the normal mode frequencies and eigenvectors (polarization vectors) are given. Numerical calculations of the response functions are described for (111) and (100) surfaces of face-centered cubic crystals interacting with Lennard-Jones 6-12 potentials, and the qualitative features of the surface and bulk response functions are discussed. The use of these functions in problems of atomic scattering from surface is outlined, and convenient parametrized forms for this application are given. (Auth.)

Antibody Responses with Fc-Mediated Functions after Vaccination of HIV-Infected Subjects with Trivalent Influenza Vaccine

DEFF Research Database (Denmark)

Kristensen, Anne B; Lay, William N; Ana-Sosa-Batiz, Fernanda

2016-01-01

to immunize this at-risk group. IMPORTANCE: Infection with HIV is associated with increasing disease severity following influenza infections, and annual influenza vaccinations are recommended for this target group. However, HIV-infected individuals respond relatively poorly to vaccination compared to healthy......This study seeks to assess the ability of seasonal trivalent inactivated influenza vaccine (TIV) to induce nonneutralizing antibodies (Abs) with Fc-mediated functions in HIV-uninfected and HIV-infected subjects. Functional influenza-specific Ab responses were studied in 30 HIV-negative and 27 HIV......-positive subjects immunized against seasonal influenza. All 57 subjects received the 2015 TIV. Fc-mediated antihemagglutinin (anti-HA) Ab activity was measured in plasma before and 4 weeks after vaccination using Fc-receptor-binding assays, NK cell activation assays, and phagocytosis assays. At baseline, the HIV...

Tuning of electronic properties and dynamical stability of graphene oxide with different functional groups

Science.gov (United States)

Dabhi, Shweta D.; Jha, Prafulla K.

2017-09-01

The structural, electronic and vibrational properties of graphene oxide (GO) with varying proportion of epoxy and hydroxyl functional groups have been studied using density functional theory. The functional groups and oxygen density have an obvious influence on the electronic and vibrational properties. The dependence of band gap on associated functional groups and oxygen density shows a possibility of tuning the band gap of graphene by varying the functional groups as well as oxidation level. The absorption of high oxygen content in graphene leads to the gap opening and resulting in a transition from semimetal to semiconductor. Phonon dispersion curves show no imaginary frequency or no softening of any phonon mode throughout the Brillouin zone which confirms the dynamical stability of all considered GO models. Different groups and different oxygen density result into the varying characteristics of phonon modes. The computed results show good agreement with the experimental observations. Our results present interesting possibilities for engineering the electronic properties of graphene and GO and impact the fabrication of new electronics.

Nonthermal fixed points and the functional renormalization group

International Nuclear Information System (INIS)

Berges, Juergen; Hoffmeister, Gabriele

2009-01-01

Nonthermal fixed points represent basic properties of quantum field theories, in addition to vacuum or thermal equilibrium fixed points. The functional renormalization group on a closed real-time path provides a common framework for their description. For the example of an O(N) symmetric scalar theory it reveals a hierarchy of fixed point solutions, with increasing complexity from vacuum and thermal equilibrium to nonequilibrium

Electric organ discharge diversity in the genus Gymnotus: anatomo-functional groups and electrogenic mechanisms.

Science.gov (United States)

Rodríguez-Cattáneo, A; Aguilera, P; Cilleruelo, E; Crampton, W G R; Caputi, A A

2013-04-15

Previous studies describe six factors accounting for interspecific diversity of electric organ discharge (EOD) waveforms in Gymnotus. At the cellular level, three factors determine the locally generated waveforms: (1) electrocyte geometry and channel repertoire; (2) the localization of synaptic contacts on electrocyte surfaces; and (3) electric activity of electromotor axons preceding the discharge of electrocytes. At the organismic level, three factors determine the integration of the EOD as a behavioral unit: (4) the distribution of different types of electrocytes and specialized passive tissue forming the electric organ (EO); (5) the neural mechanisms of electrocyte discharge coordination; and (6) post-effector mechanisms. Here, we reconfirm the importance of the first five of these factors based on comparative studies of a wider diversity of Gymnotus than previously investigated. Additionally, we report a hitherto unseen aspect of EOD diversity in Gymnotus. The central region of the EO (which has the largest weight on the conspecific-received field) usually exhibits a negative-positive-negative pattern where the delay between the early negative and positive peaks (determined by neural coordination mechanisms) matches the delay between the positive and late negative peaks (determined by electrocyte responsiveness). Because delays between peaks typically determine the peak power frequency, this matching implies a co-evolution of neural and myogenic coordination mechanisms in determining the spectral specificity of the intraspecific communication channel. Finally, we define four functional species groups based on EO/EOD structure. The first three exhibit a heterogeneous EO in which doubly innervated electrocytes are responsible for a main triphasic complex. Group I species exhibit a characteristic cephalic extension of the EO. Group II species exhibit an early positive component of putative neural origin, and strong EO auto-excitability. Group III species exhibit

Facile fabrication of siloxane @ poly (methylacrylic acid) core-shell microparticles with different functional groups

Energy Technology Data Exchange (ETDEWEB)

Zhao, Zheng-Bai; Tai, Li; Zhang, Da-Ming; Jiang, Yong, E-mail: yj@seu.edu.cn [Southeast University, School of Chemistry and Chemical Engineering (China)

2017-02-15

Siloxane @ poly (methylacrylic acid) core-shell microparticles with functional groups were prepared by a facile hydrolysis-condensation method in this work. Three different silane coupling agents 3-methacryloxypropyltrimethoxysilane (MPS), 3-triethoxysilylpropylamine (APTES), and 3-glycidoxypropyltrimethoxysilane (GPTMS) were added along with tetraethoxysilane (TEOS) into the polymethylacrylic acid (PMAA) microparticle ethanol dispersion to form the Si@PMAA core-shell microparticles with different functional groups. The core-shell structure and the surface special functional groups of the resulting microparticles were measured by transmission electron microscopy and FTIR. The sizes of these core-shell microparticles were about 350–400 nm. The corresponding preparation conditions and mechanism were discussed in detail. This hydrolysis-condensation method also could be used to functionalize other microparticles which contain active groups on the surface. Meanwhile, the Si@PMAA core-shell microparticles with carbon-carbon double bonds and amino groups have further been applied to prepare hydrophobic coatings.

Facile fabrication of siloxane @ poly (methylacrylic acid) core-shell microparticles with different functional groups

International Nuclear Information System (INIS)

Zhao, Zheng-Bai; Tai, Li; Zhang, Da-Ming; Jiang, Yong

2017-01-01

Siloxane @ poly (methylacrylic acid) core-shell microparticles with functional groups were prepared by a facile hydrolysis-condensation method in this work. Three different silane coupling agents 3-methacryloxypropyltrimethoxysilane (MPS), 3-triethoxysilylpropylamine (APTES), and 3-glycidoxypropyltrimethoxysilane (GPTMS) were added along with tetraethoxysilane (TEOS) into the polymethylacrylic acid (PMAA) microparticle ethanol dispersion to form the Si@PMAA core-shell microparticles with different functional groups. The core-shell structure and the surface special functional groups of the resulting microparticles were measured by transmission electron microscopy and FTIR. The sizes of these core-shell microparticles were about 350–400 nm. The corresponding preparation conditions and mechanism were discussed in detail. This hydrolysis-condensation method also could be used to functionalize other microparticles which contain active groups on the surface. Meanwhile, the Si@PMAA core-shell microparticles with carbon-carbon double bonds and amino groups have further been applied to prepare hydrophobic coatings.

Response functions for infinite fermion systems with velocity dependent interactions

International Nuclear Information System (INIS)

Garcia-Recio, C.; Salcedo, L.L.; Navarro, J.; Nguyen Van Giai

1991-01-01

Response functions of infinite Fermi systems are studied in the framework of the self-consistent Random Phase Approximation. Starting from an effective interaction with velocity and density dependence, or equivalently from a local energy density functional, algebraic expressions for the RPA response function are derived. Simple formulae for the energy-weighted and polarizability sum rules are obtained. The method is illustrated by applications to nuclear matter and liquid 3 He. In nuclear matter, it is shown that existing Skyrme interactions give spin-isospin response functions close to those calculated with finite range interactions. The different renormalization of longitudinal and transverse Coulomb sum rules in nuclear matter is discussed. In 3 He, the low-lying collective spin oscillation can be well described in a wide range of momenta with a Skyrme-type interaction if the relevant Landau parameters are fitted. For the high-lying density oscillation, the introduction of a finite range term in the energy functional improves considerably the agreement with the data. (author) 54 refs., 19 figs., 4 tabs

Frequency response functions for nonlinear convergent systems

NARCIS (Netherlands)

Pavlov, A.V.; Wouw, van de N.; Nijmeijer, H.

2007-01-01

Convergent systems constitute a practically important class of nonlinear systems that extends the class of asymptotically stable linear time-invariant systems. In this note, we extend frequency response functions defined for linear systems to nonlinear convergent systems. Such nonlinear frequency

Measurement and simulation of neutron response function of organic liquid scintillator detector

International Nuclear Information System (INIS)

Gohil, M.; Banerjee, K.; Bhattacharya, S.; Bhattacharya, C.; Kundu, S.; Rana, T.K.; Mukherjee, G.; Meena, J.K.; Pandey, R.; Pai, H.; Ghosh, T.K.; Dey, A.; Mukhopadhyay, S.; Pandit, D.; Pal, S.; Banerjee, S.R.; Bandhopadhyay, T.

2012-01-01

Response functions of monoenergetic neutrons at various energies, corresponding to a measured neutron energy spectrum have been extracted. The experimental response functions for neutron energies in the range of ∼2-20 MeV have been compared with the respective GEANT4 predictions. It has been found that, there is some discrepancy between the experimental and the GEANT4 simulated neutron response functions at lower pulse height regions, which increases with the increase of neutron energy. This might be due to the incompleteness of the physics processes used in the present GEANT4 simulations. In particular, higher order reaction processes which become more significant at higher energies should be properly taken into account in the calculation of response function.

Intermittent fasting could ameliorate cognitive function against distress by regulation of inflammatory response pathway

Directory of Open Access Journals (Sweden)

Marjan Shojaie

2017-11-01

Full Text Available Undesirable and desirable effects of stressors on the body are assigned to distress and eustress, respectively. Immune system and brain are the most susceptible parts to stressful conditions, whereas long-lasting alterations in putative immune proteins involved in tension such as corticosterone (CORT, interleukin 6 (IL-6, and tumor necrosis factor-alpha (TNF-α can impact learning and memory. Intermittent fasting (IF is a repeated regular cycle of dietary restriction with well-known beneficial properties on the body. The aim of this study was to identify the eustress effects of IF on cognitive function by assessing the critical inflammatory factors in chronic distress. Forty male mice were divided into four groups (n = 10/group. Distress and control normally received food and water, whereas IF and IF with distress groups were daily deprived of food and water for two hours. In the second week, the electrical foot shock was induced to distress and IF with distress groups. Finally, the cognitive functions of all mice were evaluated by Barnes maze, their blood samples were taken to determine the plasma level of CORT, IL-6 and TNF-α, and the removed brain and adrenal glands were weighed in the third week. A significant gain in plasma level of CORT, IL-6 and TNF-α with a considerable brain hypotrophy and adrenal hypertrophy was found in distress group, whereas IF caused a remarkable reduction of the plasma inflammatory factors, especially in IF with distress mice (P ≤ 0.05. In conclusion, IF could improve cognitive function and preserve the brain against distress by regulation of inflammatory response pathway.

Intermittent fasting could ameliorate cognitive function against distress by regulation of inflammatory response pathway.

Science.gov (United States)

Shojaie, Marjan; Ghanbari, Farzane; Shojaie, Nasrin

2017-11-01

Undesirable and desirable effects of stressors on the body are assigned to distress and eustress, respectively. Immune system and brain are the most susceptible parts to stressful conditions, whereas long-lasting alterations in putative immune proteins involved in tension such as corticosterone (CORT), interleukin 6 (IL-6), and tumor necrosis factor-alpha (TNF-α) can impact learning and memory. Intermittent fasting (IF) is a repeated regular cycle of dietary restriction with well-known beneficial properties on the body. The aim of this study was to identify the eustress effects of IF on cognitive function by assessing the critical inflammatory factors in chronic distress. Forty male mice were divided into four groups (n = 10/group). Distress and control normally received food and water, whereas IF and IF with distress groups were daily deprived of food and water for two hours. In the second week, the electrical foot shock was induced to distress and IF with distress groups. Finally, the cognitive functions of all mice were evaluated by Barnes maze, their blood samples were taken to determine the plasma level of CORT, IL-6 and TNF-α, and the removed brain and adrenal glands were weighed in the third week. A significant gain in plasma level of CORT, IL-6 and TNF-α with a considerable brain hypotrophy and adrenal hypertrophy was found in distress group, whereas IF caused a remarkable reduction of the plasma inflammatory factors, especially in IF with distress mice ( P  ≤ 0.05). In conclusion, IF could improve cognitive function and preserve the brain against distress by regulation of inflammatory response pathway.

Development of the Parent Responses to School Functioning Questionnaire.

Science.gov (United States)

Barber Garcia, Brittany N; Gray, Laura S; Simons, Laura E; Logan, Deirdre E

2017-10-01

Parents play an important role in supporting school functioning in youth with chronic pain, but no validated tools exists to assess parental responses to child and adolescent pain behaviors in the school context. Such a tool would be useful in identifying targets of change to reduce pain-related school impairment. The goal of this study was to develop and preliminarily validate the Parent Responses to School Functioning Questionnaire (PRSF), a parent self-report measure of this construct. After initial expert review and pilot testing, the measure was administered to 418 parents of children (ages 6-17 years) seen for initial multidisciplinary chronic pain clinic evaluation. The final 16-item PRSF showed evidence of good internal consistency (α = .82) and 2-week test-retest reliability (intraclass correlation coefficient = .87). Criterion validity was demonstrated by significant correlations with school absence rates and overall school functioning, and construct validity was demonstrated by correlations with general parental responses to pain. Three subscales emerged capturing parents' personal distress, parents' level of distrust of the school, and parents' expectations and behaviors related to their child's management of challenging school situations. These results provide preliminary support for the PRSF as a psychometrically sound tool to assess parents' responses to child pain in the school setting. The 16-item PRSF measures parental responses to their child's chronic pain in the school context. The clinically useful measure can inform interventions aimed reducing functional disability in children with chronic pain by enhancing parents' ability to respond adaptively to child pain behaviors. Copyright © 2017 American Pain Society. Published by Elsevier Inc. All rights reserved.

Functional group composition of ambient and source organic aerosols determined by tandem mass spectrometry

Directory of Open Access Journals (Sweden)

J. Dron

2010-08-01

Full Text Available The functional group composition of various organic aerosols (OA is investigated using a recently developed analytical approach based on atmospheric pressure chemical ionisation-tandem mass spectrometry (APCI-MS/MS. The determinations of three functional groups contents are performed quantitatively by neutral loss (carboxylic and carbonyl groups, R-COOH and R-CO-R´ respectively and precursor ion (nitro groups, R-NO₂ scanning modes of a tandem mass spectrometer. Major organic aerosol sources are studied: vehicular emission and wood combustion for primary aerosol sources; and a secondary organic aerosol (SOA produced through photooxidation of o-xylene. The results reveal significant differences in the functional group contents of these source aerosols. The laboratory generated SOA is dominated by carbonyls while carboxylics are preponderate in the wood combustion particles. On the other hand, vehicular emissions are characterised by a strong nitro content. The total amount of the three functional groups accounts for 1.7% (vehicular to 13.5% (o-xylene photooxidation of the organic carbon. Diagnostic functional group ratios are then used to tentatively discriminate sources of particles collected in an urban background environment located in an Alpine valley (Chamonix, France during a strong winter pollution event. The three functional groups under study account for a total functionalisation rate of 2.2 to 3.8% of the organic carbon in this ambient aerosol, which is also dominated by carboxylic moieties. In this particular case study of a deep alpine valley during winter, we show that the nitro- and carbonyl-to-carboxylic diagnostic ratios can be a useful tool to discriminate sources. In these conditions, the total OA concentrations are highly dominated by wood combustion OA. This result is confirmed by an organic markers source apportionment approach which assess a wood burning organic carbon contribution of about 60

The response of electrostatic probes via the λ-function

DEFF Research Database (Denmark)

Rerup, T.O.; Crichton, George C; McAllister, Iain Wilson

1994-01-01

The response of an electrostatic probe is examined with reference to a planar spacer. The study involves the numerical calculation of the probe λ-function, from which response-related characteristic parameters can be derived. These parameters enable the probe detection sensitivity and spatial...

Psychosocial functioning in patients with treatment-resistant depression after group cognitive behavioral therapy

Directory of Open Access Journals (Sweden)

Kunisato Yoshihiko

2010-03-01

Full Text Available Abstract Background Although patients with Treatment Resistant Depression (TRD often have impaired social functioning, few studies have investigated the effectiveness of psychosocial treatment for these patients. We examined whether adding group cognitive behavioral therapy (group-CBT to medication would improve both the depressive symptoms and the social functioning of patient with mild TRD, and whether any improvements would be maintained over one year. Methods Forty-three patients with TRD were treated with 12 weekly sessions of group-CBT. Patients were assessed with the Global Assessment of Functioning scale (GAF, the 36-item Short-Form Health Survey (SF-36, the Hamilton Rating Scale for Depression (HRSD, the Dysfunctional Attitudes Scale (DAS, and the Automatic Thought Questionnaire-Revised (ATQ-R at baseline, at the termination of treatment, and at the 12-month follow-up. Results Thirty-eight patients completed treatment; five dropped out. For the patients who completed treatment, post-treatment scores on the GAF and SF-36 were significantly higher than baseline scores. Scores on the HRSD, DAS, and ATQ-R were significantly lower after the treatment. Thus patients improved on all measurements of psychosocial functioning and mood symptoms. Twenty patients participated in the 12-month follow-up. Their improvements for psychosocial functioning, depressive symptoms, and dysfunctional cognitions were sustained at 12 months following the completion of group-CBT. Conclusions These findings suggest a positive effect that the addition of cognitive behavioural group therapy to medication on depressive symptoms and social functioning of mildly depressed patients, showing treatment resistance.

Ecosystem functional response across precipitation extremes in a sagebrush steppe.

Science.gov (United States)

Tredennick, Andrew T; Kleinhesselink, Andrew R; Taylor, J Bret; Adler, Peter B

2018-01-01

Precipitation is predicted to become more variable in the western United States, meaning years of above and below average precipitation will become more common. Periods of extreme precipitation are major drivers of interannual variability in ecosystem functioning in water limited communities, but how ecosystems respond to these extremes over the long-term may shift with precipitation means and variances. Long-term changes in ecosystem functional response could reflect compensatory changes in species composition or species reaching physiological thresholds at extreme precipitation levels. We conducted a five year precipitation manipulation experiment in a sagebrush steppe ecosystem in Idaho, United States. We used drought and irrigation treatments (approximately 50% decrease/increase) to investigate whether ecosystem functional response remains consistent under sustained high or low precipitation. We recorded data on aboveground net primary productivity (ANPP), species abundance, and soil moisture. We fit a generalized linear mixed effects model to determine if the relationship between ANPP and soil moisture differed among treatments. We used nonmetric multidimensional scaling to quantify community composition over the five years. Ecosystem functional response, defined as the relationship between soil moisture and ANPP, was similar among irrigation and control treatments, but the drought treatment had a greater slope than the control treatment. However, all estimates for the effect of soil moisture on ANPP overlapped zero, indicating the relationship is weak and uncertain regardless of treatment. There was also large spatial variation in ANPP within-years, which contributes to the uncertainty of the soil moisture effect. Plant community composition was remarkably stable over the course of the experiment and did not differ among treatments. Despite some evidence that ecosystem functional response became more sensitive under sustained drought conditions, the response

Functionally unidimensional item response models for multivariate binary data

DEFF Research Database (Denmark)

Ip, Edward; Molenberghs, Geert; Chen, Shyh-Huei

2013-01-01

The problem of fitting unidimensional item response models to potentially multidimensional data has been extensively studied. The focus of this article is on response data that have a strong dimension but also contain minor nuisance dimensions. Fitting a unidimensional model to such multidimensio......The problem of fitting unidimensional item response models to potentially multidimensional data has been extensively studied. The focus of this article is on response data that have a strong dimension but also contain minor nuisance dimensions. Fitting a unidimensional model...... to such multidimensional data is believed to result in ability estimates that represent a combination of the major and minor dimensions. We conjecture that the underlying dimension for the fitted unidimensional model, which we call the functional dimension, represents a nonlinear projection. In this article we investigate...... tool. An example regarding a construct of desire for physical competency is used to illustrate the functional unidimensional approach....

Optical response from functionalized atomically thin nanomaterials

Energy Technology Data Exchange (ETDEWEB)

Malic, Ermin; Berghaeuser, Gunnar; Feierabend, Maja [Department of Physics, Chalmers University of Technology, Gothenburg (Sweden); Knorr, Andreas [Institut fuer Theoretische Physik, Technische Universitaet Berlin (Germany)

2017-10-15

Chemical functionalization of atomically thin nanostructures presents a promising strategy to create new hybrid nanomaterials with remarkable and externally controllable properties. Here, we review our research in the field of theoretical modeling of carbon nanotubes, graphene, and transition metal dichalcogenides located in molecular dipole fields. In particular, we provide a microscopic view on the change of the optical response of these technologically promising nanomaterials due to the presence of photo-active spiropyran molecules. The feature article presents a review of recent theoretical work providing microscopic view on the optical response of chemically functionalized carbon nanotubes, graphene, and monolayered transition metal dichalcogenides. In particular, we propose a novel sensor mechanism based on the molecule-induced activation of dark excitons. This results in a pronounced additional peak presenting an unambiguous optical fingerprint for the attached molecules. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Classification of ion mobility spectra by functional groups using neural networks

Science.gov (United States)

Bell, S.; Nazarov, E.; Wang, Y. F.; Eiceman, G. A.

1999-01-01

Neural networks were trained using whole ion mobility spectra from a standardized database of 3137 spectra for 204 chemicals at various concentrations. Performance of the network was measured by the success of classification into ten chemical classes. Eleven stages for evaluation of spectra and of spectral pre-processing were employed and minimums established for response thresholds and spectral purity. After optimization of the database, network, and pre-processing routines, the fraction of successful classifications by functional group was 0.91 throughout a range of concentrations. Network classification relied on a combination of features, including drift times, number of peaks, relative intensities, and other factors apparently including peak shape. The network was opportunistic, exploiting different features within different chemical classes. Application of neural networks in a two-tier design where chemicals were first identified by class and then individually eliminated all but one false positive out of 161 test spectra. These findings establish that ion mobility spectra, even with low resolution instrumentation, contain sufficient detail to permit the development of automated identification systems.

Matrix intensification alters avian functional group composition in adjacent rainforest fragments.

Directory of Open Access Journals (Sweden)

Justus P Deikumah

Full Text Available Conversion of farmland land-use matrices to surface mining is an increasing threat to the habitat quality of forest remnants and their constituent biota, with consequences for ecosystem functionality. We evaluated the effects of matrix type on bird community composition and the abundance and evenness within avian functional groups in south-west Ghana. We hypothesized that surface mining near remnants may result in a shift in functional composition of avifaunal communities, potentially disrupting ecological processes within tropical forest ecosystems. Matrix intensification and proximity to the remnant edge strongly influenced the abundance of members of several functional guilds. Obligate frugivores, strict terrestrial insectivores, lower and upper strata birds, and insect gleaners were most negatively affected by adjacent mining matrices, suggesting certain ecosystem processes such as seed dispersal may be disrupted by landscape change in this region. Evenness of these functional guilds was also lower in remnants adjacent to surface mining, regardless of the distance from remnant edge, with the exception of strict terrestrial insectivores. These shifts suggest matrix intensification can influence avian functional group composition and related ecosystem-level processes in adjacent forest remnants. The management of matrix habitat quality near and within mine concessions is important for improving efforts to preserveavian biodiversity in landscapes undergoing intensification such as through increased surface mining.

Effects of Delayed Enteral Nutrition on Inflammatory Responses and Immune Function Competence in Critically Ill Patients with Prolonged Fasting.

Science.gov (United States)

Xi, Fengchan; Li, Ning; Geng, Yanxia; Gao, Tao; Zhang, Juanjuan; Jun, Tanshan; Lin, Zhiliang; Li, Weiqin; Zhu, Weiming; Yu, Wenkui; Li, Jieshou

2014-05-01

Although different studies suggest that early enteral nutrition (EEN) has benefits in reducing infectious complications, there is no data that addresses whether delayed enteral nutrition (EN) is detrimental and if it may have effects on inflammatory responses and immune function. Forty-five critically ill patients with long fasting were randomly allocated in two groups according to the type of nutritional support. The first group included patients assuming a standard enteral nutrition (EN, n = 22) and the second group assuming a parenteral nutrition (PN, n = 23). The daily nutritional amount was 25 kcal (105 kJ)/kg for all patients. The inflammatory markers white blood cells (WBC), C-reactive protein (CRP), TNF-α, IL-1-β, IL-6, IL-4, IL- 10 and the immune T-lymphocyte sub-populations CD3+, CD4+, CD8+, and HLA-DR+ were evaluated at day 1, and after 2, 3 and 7 days. IL-4, IL-10, CD3+, CD4+, CD8+ and the CD4+/CD8+ ratio were not statistically different between the two groups. WBC and TNF-α in EN patients were higher than those in PN after 3 and 7 days (P fasting increased systemic inflammatory responses, whereas EN could modify immune function, therefore reducing hospital stay and costs.

Ultracold atoms and the Functional Renormalization Group

International Nuclear Information System (INIS)

Boettcher, Igor; Pawlowski, Jan M.; Diehl, Sebastian

2012-01-01

We give a self-contained introduction to the physics of ultracold atoms using functional integral techniques. Based on a consideration of the relevant length scales, we derive the universal effective low energy Hamiltonian describing ultracold alkali atoms. We then introduce the concept of the effective action, which generalizes the classical action principle to full quantum status and provides an intuitive and versatile tool for practical calculations. This framework is applied to weakly interacting degenerate bosons and fermions in the spatial continuum. In particular, we discuss the related BEC and BCS quantum condensation mechanisms. We then turn to the BCS-BEC crossover, which interpolates between both phenomena, and which is realized experimentally in the vicinity of a Feshbach resonance. For its description, we introduce the Functional Renormalization Group approach. After a general discussion of the method in the cold atoms context, we present a detailed and pedagogical application to the crossover problem. This not only provides the physical mechanism underlying this phenomenon. More generally, it also reveals how the renormalization group can be used as a tool to capture physics at all scales, from few-body scattering on microscopic scales, through the finite temperature phase diagram governed by many-body length scales, up to critical phenomena dictating long distance physics at the phase transition. The presentation aims to equip students at the beginning PhD level with knowledge on key physical phenomena and flexible tools for their description, and should enable to embark upon practical calculations in this field.

The visibility function and its effect on the observed characteristics of sunspot groups. 1

International Nuclear Information System (INIS)

Kopecky, M.; Kuklin, G.V.; Starkova, I.P.

1985-01-01

The paper is an introductory study to a series dealing with the visibility function, the function of foreshortening of sunspot group areas, and with the effect of these functions on the results of the statistical processing of observations, which has to be taken into account in interpreting the results. A ''diagram of observational conditions'' is described, which enables a number of statistical problems of sunspot groups on the rotating Sun to be solved by computer modelling or by graphical methods. Examples are given of the use of this diagram in studying the distribution of the observed lifetime of sunspot groups with a given actual lifetime, of the decrease in the number of sunspot groups towards the limb of the solar disc, of the east-west asymmetry of sunspot group appearance and disappearance. (author)

Semi-classical calculation of the spin-isospin response functions

International Nuclear Information System (INIS)

Chanfray, G.

1987-03-01

We present a semi-classical calculation of the nuclear response functions beyond the Thomas-Fermi approximation. We apply our formalism to the spin-isospin responses and show that the surface peaked h/2π corrections considerably decrease the ratio longitudinal/transverse as obtained through hadronic probes

Stimulus-response functions of single avian olfactory bulb neurones.

Science.gov (United States)

McKeegan, Dorothy E F; Demmers, Theodorus G M; Wathes, Christopher M; Jones, R Bryan; Gentle, Michael J

2002-10-25

This study investigated olfactory processing in a functional context by examining the responses of single avian olfactory bulb neurones to two biologically important gases over relevant concentration ranges. Recordings of extracellular spike activity were made from 80 single units in the left olfactory bulb of 11 anaesthetised, freely breathing adult hens (Gallus domesticus). The units were spontaneously active, exhibiting widely variable firing rates (0.07-47.28 spikes/s) and variable temporal firing patterns. Single units were tested for their response to an ascending concentration series of either ammonia (2.5-100 ppm) or hydrogen sulphide (1-50 ppm), delivered directly to the olfactory epithelium. Stimulation with a calibrated gas delivery system resulted in modification of spontaneous activity causing either inhibition (47% of units) or excitation (53%) of firing. For ammonia, 20 of the 35 units tested exhibited a response, while for hydrogen sulphide, 25 of the 45 units tested were responsive. Approximate response thresholds for ammonia (median threshold 3.75 ppm (range 2.5-60 ppm, n=20)) and hydrogen sulphide (median threshold 1 ppm (range 1-10 ppm, n=25)) were determined with most units exhibiting thresholds near the lower end of these ranges. Stimulus response curves were constructed for 23 units; 16 (the most complete) were subjected to a linear regression analysis to determine whether they were best fitted by a linear, log or power function. No single function provided the best fit for all the curves (seven were linear, eight were log, one was power). These findings show that avian units respond to changes in stimulus concentration in a manner generally consistent with reported responses in mammalian olfactory bulb neurones. However, this study illustrates a level of fine-tuning to small step changes in concentration (<5 ppm) not previously demonstrated in vertebrate single olfactory bulb neurones.

Pattern classification and recognition of invertebrate functional groups using self-organizing neural networks.

Science.gov (United States)

Zhang, WenJun

2007-07-01

Self-organizing neural networks can be used to mimic non-linear systems. The main objective of this study is to make pattern classification and recognition on sampling information using two self-organizing neural network models. Invertebrate functional groups sampled in the irrigated rice field were classified and recognized using one-dimensional self-organizing map and self-organizing competitive learning neural networks. Comparisons between neural network models, distance (similarity) measures, and number of neurons were conducted. The results showed that self-organizing map and self-organizing competitive learning neural network models were effective in pattern classification and recognition of sampling information. Overall the performance of one-dimensional self-organizing map neural network was better than self-organizing competitive learning neural network. The number of neurons could determine the number of classes in the classification. Different neural network models with various distance (similarity) measures yielded similar classifications. Some differences, dependent upon the specific network structure, would be found. The pattern of an unrecognized functional group was recognized with the self-organizing neural network. A relative consistent classification indicated that the following invertebrate functional groups, terrestrial blood sucker; terrestrial flyer; tourist (nonpredatory species with no known functional role other than as prey in ecosystem); gall former; collector (gather, deposit feeder); predator and parasitoid; leaf miner; idiobiont (acarine ectoparasitoid), were classified into the same group, and the following invertebrate functional groups, external plant feeder; terrestrial crawler, walker, jumper or hunter; neustonic (water surface) swimmer (semi-aquatic), were classified into another group. It was concluded that reliable conclusions could be drawn from comparisons of different neural network models that use different distance

Correlation of Th17 cell function with the inflammatory response and apoptosis in the course of prostatitis

Directory of Open Access Journals (Sweden)

Yue Liu

2017-08-01

Full Text Available Objective: To study the correlation of Th17 cell function with the inflammatory response and apoptosis in the course of prostatitis. Methods: A total of 128 patients with chronic prostatitis who were treated in our hospital between January 2015 and December 2016 were collected, and 50 healthy men who received physical examination in our hospital during the same period were selected as normal control group. The differences in Th17 cell ratio and IL-17 levels in peripheral blood, inflammatory factor levels in serum, and apoptosis gene expression in prostatic fluid were compared between the two groups. Pearson test was used to assess the correlation of Th17 cell function in peripheral blood with inflammation and apoptosis in patients with chronic prostatitis. Results: Th17 cell ratio and IL-17 level in peripheral blood of observation group were higher than those of normal control group; inflammatory factors IL- 1β, IL-2, IL-8, TNF-α and M-CSF levels in serum were higher than those of normal control group; apoptosis gene BAX mRNA in prostatic fluid was higher than that of control group while anti-apoptosis genes Bcl-2, livin and hPEBP4 mRNA expression were lower than those of normal control group. Pearson test showed that Th17 cell ratio and IL-17 level in peripheral blood of patients with chronic prostatitis were positively correlated with IL-1β, IL-2, IL-8, TNF-α and M-CSF levels in serum as well as BAX mRNA expression in prostatic fluid, and negatively correlated with Bcl-2, livin and hPEBP4 mRNA expression in prostatic fluid. Conclusion: There is Th17 cell hyperfunction in patients with chronic prostatitis, and it is an important cause of the systemic inflammatory response and prostate cell apoptosis aggravation.

Membrane-localized ubiquitin ligase ATL15 functions in sugar-responsive growth regulation in Arabidopsis.

Science.gov (United States)

Aoyama, Shoki; Terada, Saki; Sanagi, Miho; Hasegawa, Yoko; Lu, Yu; Morita, Yoshie; Chiba, Yukako; Sato, Takeo; Yamaguchi, Junji

2017-09-09

Ubiquitin ligases play important roles in regulating various cellular processes by modulating the protein function of specific ubiquitination targets. The Arabidopsis Tóxicos en Levadura (ATL) family is a group of plant-specific RING-type ubiquitin ligases that localize to membranes via their N-terminal transmembrane-like domains. To date, 91 ATL isoforms have been identified in the Arabidopsis genome, with several ATLs reported to be involved in regulating plant responses to environmental stresses. However, the functions of most ATLs remain unknown. This study, involving transcriptome database analysis, identifies ATL15 as a sugar responsive ATL gene in Arabidopsis. ATL15 expression was rapidly down-regulated in the presence of sugar. The ATL15 protein showed ubiquitin ligase activity in vitro and localized to plasma membrane and endomembrane compartments. Further genetic analyses demonstrated that the atl15 knockout mutants are insensitive to high glucose concentrations, whereas ATL15 overexpression depresses plant growth. In addition, endogenous glucose and starch amounts were reciprocally affected in the atl15 knockout mutants and the ATL15 overexpressors. These results suggest that ATL15 protein plays a significant role as a membrane-localized ubiquitin ligase that regulates sugar-responsive plant growth in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.

Magneto-Sensitive Adsorbents Modified by Functional Nitrogen-Containing Groups

Science.gov (United States)

Melnyk, Inna V.; Gdula, Karolina; Dąbrowski, Andrzej; Zub, Yuriy L.

2016-02-01

In order to obtain amino-functionalized silica materials with magnetic core, one-step synthesis was carried out. Several materials, differ in number and structure of amino groups, were synthesized on the basis of sol-gel method. The synthesized materials were examined by several analytical techniques. The presence and content of amino groups were measured by using Diffuse Reflectance Infrared Fourier Transform (DRIFT) spectroscopy and acid-base titration, respectively. Specific surface areas were measured by nitrogen/adsorption desorption isotherms. It was proved that sol-gel approach leads to obtain materials with high content of amino groups built into their surfaces (in the range 1.6-2.7 mmol/g). As-obtained materials were tested as potential adsorbents for copper(II) ions. The received maximum adsorption capacities were in the range 0.4-0.7 mmol/g.

Optimal hemodynamic response model for functional near-infrared spectroscopy

Directory of Open Access Journals (Sweden)

Muhammad Ahmad Kamran

2015-06-01

Full Text Available Functional near-infrared spectroscopy (fNIRS is an emerging non-invasive brain imaging technique and measures brain activities by means of near-infrared light of 650-950 nm wavelengths. The cortical hemodynamic response (HR differs in attributes at different brain regions and on repetition of trials, even if the experimental paradigm is kept exactly the same. Therefore, an HR model that can estimate such variations in the response is the objective of this research. The canonical hemodynamic response function (cHRF is modeled by using two Gamma functions with six unknown parameters. The HRF model is supposed to be linear combination of HRF, baseline and physiological noises (amplitudes and frequencies of physiological noises are supposed to be unknown. An objective function is developed as a square of the residuals with constraints on twelve free parameters. The formulated problem is solved by using an iterative optimization algorithm to estimate the unknown parameters in the model. Inter-subject variations in HRF and physiological noises have been estimated for better cortical functional maps. The accuracy of the algorithm has been verified using ten real and fifteen simulated data sets. Ten healthy subjects participated in the experiment and their HRF for finger-tapping tasks have been estimated and analyzed. The statistical significance of the estimated activity strength parameters has been verified by employing statistical analysis, i.e., (t-value >tcritical and p-value < 0.05.

Optimal hemodynamic response model for functional near-infrared spectroscopy.

Science.gov (United States)

Kamran, Muhammad A; Jeong, Myung Yung; Mannan, Malik M N

2015-01-01

Functional near-infrared spectroscopy (fNIRS) is an emerging non-invasive brain imaging technique and measures brain activities by means of near-infrared light of 650-950 nm wavelengths. The cortical hemodynamic response (HR) differs in attributes at different brain regions and on repetition of trials, even if the experimental paradigm is kept exactly the same. Therefore, an HR model that can estimate such variations in the response is the objective of this research. The canonical hemodynamic response function (cHRF) is modeled by two Gamma functions with six unknown parameters (four of them to model the shape and other two to scale and baseline respectively). The HRF model is supposed to be a linear combination of HRF, baseline, and physiological noises (amplitudes and frequencies of physiological noises are supposed to be unknown). An objective function is developed as a square of the residuals with constraints on 12 free parameters. The formulated problem is solved by using an iterative optimization algorithm to estimate the unknown parameters in the model. Inter-subject variations in HRF and physiological noises have been estimated for better cortical functional maps. The accuracy of the algorithm has been verified using 10 real and 15 simulated data sets. Ten healthy subjects participated in the experiment and their HRF for finger-tapping tasks have been estimated and analyzed. The statistical significance of the estimated activity strength parameters has been verified by employing statistical analysis (i.e., t-value > t critical and p-value < 0.05).

The therapeutic factor inventory-8: Using item response theory to create a brief scale for continuous process monitoring for group psychotherapy.

Science.gov (United States)

Tasca, Giorgio A; Cabrera, Christine; Kristjansson, Elizabeth; MacNair-Semands, Rebecca; Joyce, Anthony S; Ogrodniczuk, John S

2016-01-01

We tested a very brief version of the 23-item Therapeutic Factors Inventory-Short Form (TFI-S), and describe the use of Item Response Theory (IRT) for the purpose of developing short and reliable scales for group psychotherapy. Group therapy patients (N = 578) completed the TFI-S on one occasion, and their data were used for the IRT analysis. Of those, 304 completed the TFI-S and other measures on more than one occasion to assess sensitivity to change, concurrent, and predictive validity of the brief version. Results suggest that the new TFI-8 is a brief, reliable, and valid measure of a higher-order group therapeutic factor. The TFI-8 may be used for continuous process measurement and feedback to improve the functioning of therapy groups.

Intramuscular administration of a synthetic CpG-oligodeoxynucleotide modulates functional responses of neutrophils of neonatal foals.

Directory of Open Access Journals (Sweden)

Noah D Cohen

Full Text Available Neutrophils play an important role in protecting against infection. Foals have age-dependent deficiencies in neutrophil function that may contribute to their predisposition to infection. Thus, we investigated the ability of a CpG-ODN formulated with Emulsigen to modulate functional responses of neutrophils in neonatal foals. Eighteen foals were randomly assigned to receive either a CpG-ODN with Emulsigen (N = 9 or saline intramuscularly at ages 1 and 7 days. At ages 1, 3, 9, 14, and 28, blood was collected and neutrophils were isolated from each foal. Neutrophils were assessed for basal and Rhodococcus equi-stimulated mRNA expression of the cytokines interferon-γ (IFN-γ, interleukin (IL-4, IL-6, and IL-8 using real-time PCR, degranulation by quantifying the amount of β-D glucuronidase activity, and reactive oxygen species (ROS generation using flow cytometry. In vivo administration of the CpG-ODN formulation on days 1 and 7 resulted in significantly (P<0.05 increased IFN-γ mRNA expression by foal neutrophils on days 3, 9, and 14. Degranulation was significantly (P<0.05 lower for foals in the CpG-ODN-treated group than the control group at days 3 and 14, but not at other days. No effect of treatment on ROS generation was detected. These results indicate that CpG-ODN administration to foals might improve innate and adaptive immune responses that could protect foals against infectious diseases and possibly improve responses to vaccination.

Validating the UNICEF/Washington Group Child Functioning Module for Fijian schools to identify seeing, hearing and walking difficulties.

Science.gov (United States)

Sprunt, Beth; Hoq, Monsurul; Sharma, Umesh; Marella, Manjula

2017-09-20

This study investigated the seeing, hearing and walking questions of the UNICEF/Washington Group Child Functioning Module and the inter-rater reliability between teachers and parents as proxy respondents. Cross-sectional diagnostic accuracy study, two-gate design with representative sampling, comparing Module responses to reference standard assessments for 472 primary aged students in Fiji. Receiver operating characteristic curves were constructed to determine the area under the curve and optimal cut-off points. Areas under the curves ranged from 0.823 to 0.889 indicating "good" diagnostic accuracy. Inter-rater reliability between parent and teacher responses was "good" to "excellent". The optimal cut-off determined by the Youden Index was "some difficulty" however a wide spread of impairment levels were found in this category with most children either having none or substantial impairments. The diagnostic accuracy of the Module seeing, hearing and walking questions appears acceptable with either parents or teachers as proxy respondents. For education systems, use of the cut-off "some difficulty" with accompanying clinical assessment may be important to capture children who require services and learning supports and avoid potentially misleading categorization. Given the high proportion of the sample from special schools research is required to further test the Module in mainstream schools. Implications for rehabilitation Identification of children who are at risk of disability in Fiji is important to enable planning, monitoring and evaluating access to quality inclusive education. The UNICEF/Washington Group Child Functioning Module appears to be a practical and effective tool that can be used by teachers to identify children at risk of disability. Children identified on the UNICEF/Washington Group Child Functioning Module as having "some difficulty" or higher levels of difficulty in relation to vision, hearing or walking should be referred for further assessment

Outcomes of Left Ventricular Function According to Treatment Response for a Patent Ductus Arteriosus in Preterm Infants.

Science.gov (United States)

Kang, Soo Jung; Cho, Young Sun; Hwang, Seo Jung; Kim, Hyo Jin

2017-12-01

To evaluate the outcomes of left ventricular (LV) function according to treatment response for a hemodynamically significant patent ductus arteriosus (hsPDA) in preterm infants. Echocardiograms of 21 preterm infants born at gestational age closure (ligation group) and 6 experienced successful pharmacological closure (medication group). Six preterm infants without hsPDA (no-hsPDA group) were studied as controls. LV peak longitudinal systolic strain (ε) of each infant was retrospectively obtained from echocardiograms using velocity vector imaging, along with neonatal outcomes. Pharmacological closures were attempted at postnatal day 2-3. In the ligation group, the median postnatal age at ligation was 20 days. In the ligation group, LV peak longitudinal systolic ε was significantly decreased at term-equivalent age compared to the other groups. Between the medication and no-hsPDA groups, LV peak longitudinal systolic ε did not differ significantly. Among the neonatal outcomes, infants who experienced necrotizing enterocolitis (NEC) showed significantly decreased LV peak longitudinal systolic ε compared to the infants who did not experience NEC . We speculate that in preterm infants with an hsPDA, in cases of medical treatment failure, early PDA ligation at less than 20 days of postnatal age would be beneficial for preserving LV systolic function.

Functional group, biomass, and climate change effects on ecological drought in semiarid grasslands

Science.gov (United States)

Wilson, Scott D.; Schlaepfer, Daniel R.; Bradford, John B.; Lauenroth, William K.; Duniway, Michael C.; Hall, Sonia A.; Jamiyansharav, Khishigbayar; Jia, Gensuo; Lkhagva, Ariuntsetseg; Munson, Seth M.; Pyke, David A.; Tietjen, Britta

2018-01-01

Water relations in plant communities are influenced both by contrasting functional groups (grasses, shrubs) and by climate change via complex effects on interception, uptake and transpiration. We modelled the effects of functional group replacement and biomass increase, both of which can be outcomes of invasion and vegetation management, and climate change on ecological drought (soil water potential below which photosynthesis stops) in 340 semiarid grassland sites over 30‐year periods. Relative to control vegetation (climate and site‐determined mixes of functional groups), the frequency and duration of drought were increased by shrubs and decreased by annual grasses. The rankings of shrubs, control vegetation, and annual grasses in terms of drought effects were generally consistent in current and future climates, suggesting that current differences among functional groups on drought effects predict future differences. Climate change accompanied by experimentally‐increased biomass (i.e. the effects of invasions that increase community biomass, or management that increases productivity through fertilization or respite from grazing) increased drought frequency and duration, and advanced drought onset. Our results suggest that the replacement of perennial temperate semiarid grasslands by shrubs, or increased biomass, can increase ecological drought both in current and future climates.

Functional MRI of food-induced brain responses

NARCIS (Netherlands)

Smeets, P.A.M.

2006-01-01

The ultimate goal of this research was to find central biomarkers of satiety, i.e., physiological measures in the brain that relate to subjectively rated appetite, actual food intake, or both. This thesis describes the changes in brain activity in response to food stimuli as measured by functional

Computational screening of functional groups for capture of toxic industrial chemicals in porous materials.

Science.gov (United States)

Kim, Ki Chul; Fairen-Jimenez, David; Snurr, Randall Q

2017-12-06

A thermodynamic analysis using quantum chemical methods was carried out to identify optimal functional group candidates that can be included in metal-organic frameworks and activated carbons for the selective capture of toxic industrial chemicals (TICs) in humid air. We calculated the binding energies of 14 critical TICs plus water with a series of 10 functional groups attached to a naphthalene ring model. Using vibrational calculations, the free energies of adsorption were calculated in addition to the binding energies. Our results show that, in these systems, the binding energies and free energies follow similar trends. We identified copper(i) carboxylate as the optimal functional group (among those studied) for the selective binding of the majority of the TICs in humid air, and this functional group exhibits especially strong binding for sulfuric acid. Further thermodynamic analysis shows that the presence of water weakens the binding strength of sulfuric acid with the copper carboxylate group. Our calculations predict that functionalization of aromatic rings would be detrimental to selective capture of COCl 2 , CO 2 , and Cl 2 under humid conditions. Finally, we found that forming an ionic complex, H 3 O + HSO 4 - , between H 2 SO 4 and H 2 O via proton transfer is not favorable on copper carboxylate.

Modeling phytoplankton community in reservoirs. A comparison between taxonomic and functional groups-based models.

Science.gov (United States)

Di Maggio, Jimena; Fernández, Carolina; Parodi, Elisa R; Diaz, M Soledad; Estrada, Vanina

2016-01-01

In this paper we address the formulation of two mechanistic water quality models that differ in the way the phytoplankton community is described. We carry out parameter estimation subject to differential-algebraic constraints and validation for each model and comparison between models performance. The first approach aggregates phytoplankton species based on their phylogenetic characteristics (Taxonomic group model) and the second one, on their morpho-functional properties following Reynolds' classification (Functional group model). The latter approach takes into account tolerance and sensitivity to environmental conditions. The constrained parameter estimation problems are formulated within an equation oriented framework, with a maximum likelihood objective function. The study site is Paso de las Piedras Reservoir (Argentina), which supplies water for consumption for 450,000 population. Numerical results show that phytoplankton morpho-functional groups more closely represent each species growth requirements within the group. Each model performance is quantitatively assessed by three diagnostic measures. Parameter estimation results for seasonal dynamics of the phytoplankton community and main biogeochemical variables for a one-year time horizon are presented and compared for both models, showing the functional group model enhanced performance. Finally, we explore increasing nutrient loading scenarios and predict their effect on phytoplankton dynamics throughout a one-year time horizon. Copyright © 2015 Elsevier Ltd. All rights reserved.

Adsorption of volatile sulphur compounds onto modified activated carbons: Effect of oxygen functional groups

International Nuclear Information System (INIS)

Vega, Esther; Lemus, Jesús; Anfruns, Alba; Gonzalez-Olmos, Rafael; Palomar, José; Martin, María J.

2013-01-01

Highlights: • HNO 3 oxidation incorporates a higher amount of functionalities than O 3 oxidation. • The loss of porosity is compensated by the massive incorporation of oxygen groups. • HNO 3 oxidation increases OH groups in AC and the ETM and DMS adsorption capacities. • The oxygen functional groups in the AC surface did not affect the DMDS adsorption. • COSMO-RS predicts the important role of OH groups for VSC adsorption. -- Abstract: The effect of physical and chemical properties of activated carbon (AC) on the adsorption of ethyl mercaptan, dimethyl sulphide and dimethyl disulphide was investigated by treating a commercial AC with nitric acid and ozone. The chemical properties of ACs were characterised by temperature programme desorption and X-ray photoelectron spectroscopy. AC treated with nitric acid presented a larger amount of oxygen functional groups than materials oxidised with ozone. This enrichment allowed a significant improvement on adsorption capacities for ethyl mercaptan and dimethyl sulphide but not for dimethyl disulphide. In order to gain a deeper knowledge on the effect of the surface chemistry of AC on the adsorption of volatile sulphur compounds, the quantum-chemical COSMO-RS method was used to simulate the interactions between AC surface groups and the studied volatile sulphur compounds. In agreement with experimental data, this model predicted a greater affinity of dimethyl disulphide towards AC, unaffected by the incorporation of oxygen functional groups in the surface. Moreover, the model pointed out to an increase of the adsorption capacity of AC by the incorporation of hydroxyl functional groups in the case of ethyl mercaptan and dimethyl sulphide due to the hydrogen bond interactions

Adsorption of volatile sulphur compounds onto modified activated carbons: Effect of oxygen functional groups

Energy Technology Data Exchange (ETDEWEB)

Vega, Esther, E-mail: esther@lequia.udg.cat [LEQUIA, Institute of the Environment, University of Girona, Campus Montilivi, Girona, Catalonia E-17071 (Spain); Lemus, Jesús [Universidad de Madrid, Sección de Ingeniería Química, Cantoblanco, Madrid E-28049 (Spain); Anfruns, Alba; Gonzalez-Olmos, Rafael [LEQUIA, Institute of the Environment, University of Girona, Campus Montilivi, Girona, Catalonia E-17071 (Spain); Palomar, José [Universidad de Madrid, Sección de Ingeniería Química, Cantoblanco, Madrid E-28049 (Spain); Martin, María J. [LEQUIA, Institute of the Environment, University of Girona, Campus Montilivi, Girona, Catalonia E-17071 (Spain)

2013-08-15

Highlights: • HNO{sub 3} oxidation incorporates a higher amount of functionalities than O{sub 3} oxidation. • The loss of porosity is compensated by the massive incorporation of oxygen groups. • HNO{sub 3} oxidation increases OH groups in AC and the ETM and DMS adsorption capacities. • The oxygen functional groups in the AC surface did not affect the DMDS adsorption. • COSMO-RS predicts the important role of OH groups for VSC adsorption. -- Abstract: The effect of physical and chemical properties of activated carbon (AC) on the adsorption of ethyl mercaptan, dimethyl sulphide and dimethyl disulphide was investigated by treating a commercial AC with nitric acid and ozone. The chemical properties of ACs were characterised by temperature programme desorption and X-ray photoelectron spectroscopy. AC treated with nitric acid presented a larger amount of oxygen functional groups than materials oxidised with ozone. This enrichment allowed a significant improvement on adsorption capacities for ethyl mercaptan and dimethyl sulphide but not for dimethyl disulphide. In order to gain a deeper knowledge on the effect of the surface chemistry of AC on the adsorption of volatile sulphur compounds, the quantum-chemical COSMO-RS method was used to simulate the interactions between AC surface groups and the studied volatile sulphur compounds. In agreement with experimental data, this model predicted a greater affinity of dimethyl disulphide towards AC, unaffected by the incorporation of oxygen functional groups in the surface. Moreover, the model pointed out to an increase of the adsorption capacity of AC by the incorporation of hydroxyl functional groups in the case of ethyl mercaptan and dimethyl sulphide due to the hydrogen bond interactions.

Functional Responses and Resilience of Boreal Forest Ecosystem after Reduction of Deer Density

Science.gov (United States)

Bachand, Marianne; Pellerin, Stéphanie; Moretti, Marco; Aubin, Isabelle; Tremblay, Jean-Pierre; Côté, Steeve D.; Poulin, Monique

2014-01-01

The functional trait-based approach is increasingly used to predict responses of ecological communities to disturbances, but most studies target a single taxonomic group. Here, we assessed the resilience of a forest ecosystem to an overabundant herbivore population by assessing changes in 19 functional traits for plant, 13 traits for ground beetle and 16 traits for songbird communities after six years of controlled browsing on Anticosti Island (Quebec, Canada). Our results indicated that plants were more responsive to 6 years of reduced browsing pressure than ground beetles and songbirds. However, co-inertia analysis revealed that ground beetle communities responded in a similar way than plant communities with stronger relationships between plant and ground beetle traits at reduced deer density, a pattern not detected between plant and songbird. High deer density favored plants species that reproduce vegetatively and with abiotic pollination and seed dispersal, traits implying little interaction with animal. On the other hand, traits found at reduced deer density mostly involved trophic interaction. For example, plants in this treatment had fleshy fruits and large seeds dispersed by birds or other animals whereas ground beetle species were carnivorous. Overall, our results suggest that plant communities recovered some functional components to overabundant herbivore populations, since most traits associated with undisturbed forests were reestablished after six years of deer reduction. The re-establishment of functional plant communities with traits involving trophic interaction induces changes in the ground-beetle trait community, but forest structure remains likely insufficiently heterogeneous to shift the songbird trait community within six years. PMID:24587362

Functional responses and resilience of boreal forest ecosystem after reduction of deer density.

Directory of Open Access Journals (Sweden)

Marianne Bachand

Full Text Available The functional trait-based approach is increasingly used to predict responses of ecological communities to disturbances, but most studies target a single taxonomic group. Here, we assessed the resilience of a forest ecosystem to an overabundant herbivore population by assessing changes in 19 functional traits for plant, 13 traits for ground beetle and 16 traits for songbird communities after six years of controlled browsing on Anticosti Island (Quebec, Canada. Our results indicated that plants were more responsive to 6 years of reduced browsing pressure than ground beetles and songbirds. However, co-inertia analysis revealed that ground beetle communities responded in a similar way than plant communities with stronger relationships between plant and ground beetle traits at reduced deer density, a pattern not detected between plant and songbird. High deer density favored plants species that reproduce vegetatively and with abiotic pollination and seed dispersal, traits implying little interaction with animal. On the other hand, traits found at reduced deer density mostly involved trophic interaction. For example, plants in this treatment had fleshy fruits and large seeds dispersed by birds or other animals whereas ground beetle species were carnivorous. Overall, our results suggest that plant communities recovered some functional components to overabundant herbivore populations, since most traits associated with undisturbed forests were reestablished after six years of deer reduction. The re-establishment of functional plant communities with traits involving trophic interaction induces changes in the ground-beetle trait community, but forest structure remains likely insufficiently heterogeneous to shift the songbird trait community within six years.

New Dimensions in Microbial Ecology—Functional Genes in Studies to Unravel the Biodiversity and Role of Functional Microbial Groups in the Environment

Science.gov (United States)

Imhoff, Johannes F.

2016-01-01

During the past decades, tremendous advances have been made in the possibilities to study the diversity of microbial communities in the environment. The development of methods to study these communities on the basis of 16S rRNA gene sequences analysis was a first step into the molecular analysis of environmental communities and the study of biodiversity in natural habitats. A new dimension in this field was reached with the introduction of functional genes of ecological importance and the establishment of genetic tools to study the diversity of functional microbial groups and their responses to environmental factors. Functional gene approaches are excellent tools to study the diversity of a particular function and to demonstrate changes in the composition of prokaryote communities contributing to this function. The phylogeny of many functional genes largely correlates with that of the 16S rRNA gene, and microbial species may be identified on the basis of functional gene sequences. Functional genes are perfectly suited to link culture-based microbiological work with environmental molecular genetic studies. In this review, the development of functional gene studies in environmental microbiology is highlighted with examples of genes relevant for important ecophysiological functions. Examples are presented for bacterial photosynthesis and two types of anoxygenic phototrophic bacteria, with genes of the Fenna-Matthews-Olson-protein (fmoA) as target for the green sulfur bacteria and of two reaction center proteins (pufLM) for the phototrophic purple bacteria, with genes of adenosine-5′phosphosulfate (APS) reductase (aprA), sulfate thioesterase (soxB) and dissimilatory sulfite reductase (dsrAB) for sulfur oxidizing and sulfate reducing bacteria, with genes of ammonia monooxygenase (amoA) for nitrifying/ammonia-oxidizing bacteria, with genes of particulate nitrate reductase and nitrite reductases (narH/G, nirS, nirK) for denitrifying bacteria and with genes of methane

New Dimensions in Microbial Ecology—Functional Genes in Studies to Unravel the Biodiversity and Role of Functional Microbial Groups in the Environment

Directory of Open Access Journals (Sweden)

Johannes F. Imhoff

2016-05-01

Full Text Available During the past decades, tremendous advances have been made in the possibilities to study the diversity of microbial communities in the environment. The development of methods to study these communities on the basis of 16S rRNA gene sequences analysis was a first step into the molecular analysis of environmental communities and the study of biodiversity in natural habitats. A new dimension in this field was reached with the introduction of functional genes of ecological importance and the establishment of genetic tools to study the diversity of functional microbial groups and their responses to environmental factors. Functional gene approaches are excellent tools to study the diversity of a particular function and to demonstrate changes in the composition of prokaryote communities contributing to this function. The phylogeny of many functional genes largely correlates with that of the 16S rRNA gene, and microbial species may be identified on the basis of functional gene sequences. Functional genes are perfectly suited to link culture-based microbiological work with environmental molecular genetic studies. In this review, the development of functional gene studies in environmental microbiology is highlighted with examples of genes relevant for important ecophysiological functions. Examples are presented for bacterial photosynthesis and two types of anoxygenic phototrophic bacteria, with genes of the Fenna-Matthews-Olson-protein (fmoA as target for the green sulfur bacteria and of two reaction center proteins (pufLM for the phototrophic purple bacteria, with genes of adenosine-5′phosphosulfate (APS reductase (aprA, sulfate thioesterase (soxB and dissimilatory sulfite reductase (dsrAB for sulfur oxidizing and sulfate reducing bacteria, with genes of ammonia monooxygenase (amoA for nitrifying/ammonia-oxidizing bacteria, with genes of particulate nitrate reductase and nitrite reductases (narH/G, nirS, nirK for denitrifying bacteria and with genes

Functional outcomes of inpatient rehabilitation in very elderly patients with stroke: differences across three age groups.

Science.gov (United States)

Mutai, Hitoshi; Furukawa, Tomomi; Wakabayashi, Ayumi; Suzuki, Akihito; Hanihara, Tokiji

2018-05-01

Background As the population continues to age rapidly, clarifying the factors affecting the prognosis in very elderly stroke patients is essential to enhance the quality of their rehabilitation. Objectives To compare the functional recovery of elderly stroke patients classified into three age groups and to identify the predictors of functional recovery in the very elderly following acute inpatient rehabilitation. Methods Observational study: We collected data on 461 stroke patients in the neurology and neurosurgery ward and classified them into three age groups (65-74, 75-84, and ≥ 85 years). Functional recovery was compared among groups using the functional independence measure (FIM) at discharge and ADL recovery rate was compared using the Montebello rehabilitation factor score (MRFS). Multiple regression analysis was used to identify and compare the factors associated with functional recovery in each age group. Results Functional recovery in the ≥ 85 years group was lower than that in other age groups. Factors associated with activities of daily living (ADL) status (FIM at discharge) in the ≥ 85 years group were premorbid dependence (β = -0.183, p = 0.011), motor paralysis (β = -0.238, p = 0.001), and cognitive function (β = 0.586, p age increased. Factors associated with ADL recovery rates (MRFS) in the ≥ 85 years group were non-paretic limb function (β = -0.294, p = 0.004) and cognitive function (β = 0.201, p = 0.047). Conclusions This study identified the factors associated with functional recovery among very elderly stroke patients. Effective forms of rehabilitation for very elderly stroke patients that take these factors into consideration need to be investigated.

A mathematical function for the description of nutrient-response curve.

Directory of Open Access Journals (Sweden)

Hamed Ahmadi

Full Text Available Several mathematical equations have been proposed to modeling nutrient-response curve for animal and human justified on the goodness of fit and/or on the biological mechanism. In this paper, a functional form of a generalized quantitative model based on Rayleigh distribution principle for description of nutrient-response phenomena is derived. The three parameters governing the curve a has biological interpretation, b may be used to calculate reliable estimates of nutrient response relationships, and c provide the basis for deriving relationships between nutrient and physiological responses. The new function was successfully applied to fit the nutritional data obtained from 6 experiments including a wide range of nutrients and responses. An evaluation and comparison were also done based simulated data sets to check the suitability of new model and four-parameter logistic model for describing nutrient responses. This study indicates the usefulness and wide applicability of the new introduced, simple and flexible model when applied as a quantitative approach to characterizing nutrient-response curve. This new mathematical way to describe nutritional-response data, with some useful biological interpretations, has potential to be used as an alternative approach in modeling nutritional responses curve to estimate nutrient efficiency and requirements.

Bias Errors due to Leakage Effects When Estimating Frequency Response Functions

Directory of Open Access Journals (Sweden)

Andreas Josefsson

2012-01-01

Full Text Available Frequency response functions are often utilized to characterize a system's dynamic response. For a wide range of engineering applications, it is desirable to determine frequency response functions for a system under stochastic excitation. In practice, the measurement data is contaminated by noise and some form of averaging is needed in order to obtain a consistent estimator. With Welch's method, the discrete Fourier transform is used and the data is segmented into smaller blocks so that averaging can be performed when estimating the spectrum. However, this segmentation introduces leakage effects. As a result, the estimated frequency response function suffers from both systematic (bias and random errors due to leakage. In this paper the bias error in the H1 and H2-estimate is studied and a new method is proposed to derive an approximate expression for the relative bias error at the resonance frequency with different window functions. The method is based on using a sum of real exponentials to describe the window's deterministic autocorrelation function. Simple expressions are derived for a rectangular window and a Hanning window. The theoretical expressions are verified with numerical simulations and a very good agreement is found between the results from the proposed bias expressions and the empirical results.

Chronopharmacological effects of growth hormone on the executive function and oxidative stress response in rats.

Science.gov (United States)

Ferrari, Carlos K B; França, Eduardo L; Monteiro, Luciane A; Santos, Bruno L; Pereira-Junior, Alfredo; Honorio-França, Adenilda C

2017-01-01

To investigate the chronopharmacological effects of growth hormone on executive function and the oxidative stress response in rats. Fifty male Wistar rats (36-40 weeks old) had ad libitum access to water and food and were separated into four groups: diurnal control, nocturnal control, diurnal GH-treated, and nocturnal GH-treated animals. Levels of Cu, Zn superoxide dismutase (Cu, Zn-SOD), and superoxide release by spleen macrophages were evaluated. For memory testing, adaptation and walking in an open field platform was used. GH-treated animals demonstrated better performance in exploratory and spatial open-field tests. The latency time in both GH-treated groups was significantly lower compared with the latency time of the control groups. The diurnal GH treatment did not stimulate superoxide release but increased the CuZn-SOD enzyme levels. The nocturnal GH treatment did not influence the superoxide release and CuZn-SOD concentration. GH treatment also resulted in heart atrophy and lung hypertrophy. Growth hormone treatment improved the performance of executive functions at the cost of oxidative stress triggering, and this effect was dependent on the circadian period of hormone administration. However, GH treatment caused damaging effects such as lung hypertrophy and heart atrophy.

Not all group hypnotic suggestibility scales are created equal: individual differences in behavioral and subjective responses.

Science.gov (United States)

Barnes, Sean M; Lynn, Steven Jay; Pekala, Ronald J

2009-03-01

To examine the influence of hypnotic suggestibility testing as a source of individual differences in hypnotic responsiveness, we compared behavioral and subjective responses on three scales of hypnotic suggestibility: The Harvard Group Scale of Hypnotic Susceptibility, Form A (HGSHS: A; Shor, R. E., Orne, E. C. (1962). Harvard Group Scale of Hypnotic Susceptibility. Berlin: Consulting Psychologists Press); the Carleton University Responsiveness to Suggestion Scale (CURSS; Spanos, N. P., Radtke, H. L., Hodgins, D. C., Stam, H. J., Bertrand, L. D. (1983b). The Carleton University Responsiveness to Suggestion Scale: Normative data and psychometric properties. Psychological Reports, 53, 523-535); and the Group Scale of Hypnotic Ability (GSHA; Hawkins, R., Wenzel, L. (1999). The Group Scale of Hypnotic Ability and response booklet. Australian Journal of Clinical and Experimental Hypnosis, 27, 20-31). Behavioral and subjective responses to the CURSS were significantly different than those on the HGSHS: A and GSHA. More participants were classified as "low suggestible" on the CURSS and they reported subjective experiences more similar to everyday mentation. Attitudes and expectancies of participants who received the GSHA were less predictive of responding, but rates of responding and subjective experiences were similar on the GSHA and the HGSHS: A. Discussion focuses on implications for the use of group hypnotic suggestibility scales.

Aging and response conflict solution: behavioural and functional connectivity changes.

Science.gov (United States)

Langner, Robert; Cieslik, Edna C; Behrwind, Simone D; Roski, Christian; Caspers, Svenja; Amunts, Katrin; Eickhoff, Simon B

2015-01-01

Healthy aging has been found associated with less efficient response conflict solution, but the cognitive and neural mechanisms have remained elusive. In a two-experiment study, we first examined the behavioural consequences of this putative age-related decline for conflicts induced by spatial stimulus-response incompatibility. We then used resting-state functional magnetic resonance imaging data from a large, independent sample of adults (n = 399; 18-85 years) to investigate age differences in functional connectivity between the nodes of a network previously found associated with incompatibility-induced response conflicts in the very same paradigm. As expected, overcoming interference from conflicting response tendencies took longer in older adults, even after accounting for potential mediator variables (general response speed and accuracy, motor speed, visuomotor coordination ability, and cognitive flexibility). Experiment 2 revealed selective age-related decreases in functional connectivity between bilateral anterior insula, pre-supplementary motor area, and right dorsolateral prefrontal cortex. Importantly, these age effects persisted after controlling for regional grey-matter atrophy assessed by voxel-based morphometry. Meta-analytic functional profiling using the BrainMap database showed these age-sensitive nodes to be more strongly linked to highly abstract cognition, as compared with the remaining network nodes, which were more strongly linked to action-related processing. These findings indicate changes in interregional coupling with age among task-relevant network nodes that are not specifically associated with conflict resolution per se. Rather, our behavioural and neural data jointly suggest that healthy aging is associated with difficulties in properly activating non-dominant but relevant task schemata necessary to exert efficient cognitive control over action.

Characterization of Genotoxic Response to 15 Multiwalled Carbon Nanotubes with Variable Physicochemical Properties Including Surface Functionalizations in the FE1-Muta(TM) Mouse Lung Epithelial Cell Line

DEFF Research Database (Denmark)

Jackson, Petra; Kling, Kirsten; Jensen, Keld Alstrup

2015-01-01

Carbon nanotubes vary greatly in physicochemical properties. We compared cytotoxic and genotoxic response to 15 multiwalled carbon nanotubes (MWCNT) with varying physicochemical properties to identify drivers of toxic responses. The studied MWCNT included OECD Working Party on Manufactured...... Nanomaterials (WPMN) (NM-401, NM-402, and NM-403), materials (NRCWE-026 and MWCNT-XNRI-7), and three sets of surface-modified MWCNT grouped by physical characteristics (thin, thick, and short I-III, respectively). Each Groups I-III included pristine, hydroxylated and carboxylated MWCNT. Group III also included...... an amino-functionalized MWCNT. The level of surface functionalization of the MWCNT was low. The level and type of elemental impurities of the MWCNT varied by...

Development of NRESP98 Monte Carlo codes for the calculation of neutron response functions of neutron detectors. Calculation of the response function of spherical BF{sub 3} proportional counter

Energy Technology Data Exchange (ETDEWEB)

Hashimoto, M.; Saito, K.; Ando, H. [Power Reactor and Nuclear Fuel Development Corp., Oarai, Ibaraki (Japan). Oarai Engineering Center

1998-05-01

The method to calculate the response function of spherical BF{sub 3} proportional counter, which is commonly used as neutron dose rate meter and neutron spectrometer with multi moderator system, is developed. As the calculation code for evaluating the response function, the existing code series NRESP, the Monte Carlo code for the calculation of response function of neutron detectors, is selected. However, the application scope of the existing NRESP is restricted, the NRESP98 is tuned as generally applicable code, with expansion of the geometrical condition, the applicable element, etc. The NRESP98 is tested with the response function of the spherical BF{sub 3} proportional counter. Including the effect of the distribution of amplification factor, the detailed evaluation of the charged particle transportation and the effect of the statistical distribution, the result of NRESP98 calculation fit the experience within {+-}10%. (author)

Defining planktonic protist functional groups on mechanisms for energy and nutrient acquisition

DEFF Research Database (Denmark)

Mitra, Aditee; Flynn, Kevin J.; Tillmann, Urban

2016-01-01

Arranging organisms into functional groups aids ecological research by grouping organisms (irrespective of phylogenetic origin) that interact with environmental factors in similar ways. Planktonic protists traditionally have been split between photoautotrophic “phytoplankton” and phagotrophic...... “microzooplankton”. However, there is a growing recognition of the importance of mixotrophy in euphotic aquatic systems, where many protists often combine photoautotrophic and phagotrophic modes of nutrition. Such organisms do not align with the traditional dichotomy of phytoplankton and microzooplankton...... for phototrophy, and (iv) non-constitutive mixotrophs (NCMs) that acquire their phototrophic capacity by ingesting specific (SNCM) or general non-specific (GNCM) prey. For the first time, we incorporate these functional groups within a foodweb structure and show, using model outputs, that there is scope...

A note on monotonicity of item response functions for ordered polytomous item response theory models.

Science.gov (United States)

Kang, Hyeon-Ah; Su, Ya-Hui; Chang, Hua-Hua

2018-03-08

A monotone relationship between a true score (τ) and a latent trait level (θ) has been a key assumption for many psychometric applications. The monotonicity property in dichotomous response models is evident as a result of a transformation via a test characteristic curve. Monotonicity in polytomous models, in contrast, is not immediately obvious because item response functions are determined by a set of response category curves, which are conceivably non-monotonic in θ. The purpose of the present note is to demonstrate strict monotonicity in ordered polytomous item response models. Five models that are widely used in operational assessments are considered for proof: the generalized partial credit model (Muraki, 1992, Applied Psychological Measurement, 16, 159), the nominal model (Bock, 1972, Psychometrika, 37, 29), the partial credit model (Masters, 1982, Psychometrika, 47, 147), the rating scale model (Andrich, 1978, Psychometrika, 43, 561), and the graded response model (Samejima, 1972, A general model for free-response data (Psychometric Monograph no. 18). Psychometric Society, Richmond). The study asserts that the item response functions in these models strictly increase in θ and thus there exists strict monotonicity between τ and θ under certain specified conditions. This conclusion validates the practice of customarily using τ in place of θ in applied settings and provides theoretical grounds for one-to-one transformations between the two scales. © 2018 The British Psychological Society.

Modification of response functions of cat visual cortical cells by spatially congruent perturbing stimuli.

Science.gov (United States)

Kabara, J F; Bonds, A B

2001-12-01

Responses of cat striate cortical cells to a drifting sinusoidal grating were modified by the superimposition of a second, perturbing grating (PG) that did not excite the cell when presented alone. One consequence of the presence of a PG was a shift in the tuning curves. The orientation tuning of all 41 cells exposed to a PG and the spatial frequency tuning of 83% of the 23 cells exposed to a PG showed statistically significant dislocations of both the response function peak and center of mass from their single grating values. As found in earlier reports, the presence of PGs suppressed responsiveness. However, reductions measured at the single grating optimum orientation or spatial frequency were on average 1.3 times greater than the suppression found at the peak of the response function modified by the presence of the PG. Much of the loss in response seen at the single grating optimum is thus a result of a shift in the tuning function rather than outright suppression. On average orientation shifts were repulsive and proportional (approximately 0.10 deg/deg) to the angle between the perturbing stimulus and the optimum single grating orientation. Shifts in the spatial frequency response function were both attractive and repulsive, resulting in an overall average of zero. For both simple and complex cells, PGs generally broadened orientation response function bandwidths. Similarly, complex cell spatial frequency response function bandwidths broadened. Simple cell spatial frequency response functions usually did not change, and those that did broadened only 4% on average. These data support the hypothesis that additional sinusoidal components in compound stimuli retune cells' response functions for orientation and spatial frequency.

Polyester textile functionalization through incorporation of pH/thermo-responsive microgels. Part II: polyester functionalization and characterization

NARCIS (Netherlands)

Glampedaki, P.; Calvimontes, A.; Dutschk, Victoria; Warmoeskerken, Marinus

2012-01-01

A new approach to functionalize the surface of polyester textiles is described in this study. Functionalization was achieved by incorporating pH/temperature-responsive polyelectrolyte microgels into the textile surface layer using UV irradiation. The aim of functionalization was to regulate

Carboxylic acid functional group analysis using constant neutral loss scanning-mass spectrometry

Energy Technology Data Exchange (ETDEWEB)

Dron, Julien [Laboratoire de Chimie et Environnement, Marseille Universites (case 29), 3 place Victor Hugo, 13331 Marseille Cedex 3 (France)], E-mail: julien.dron@up.univ-mrs.fr; Eyglunent, Gregory; Temime-Roussel, Brice; Marchand, Nicolas; Wortham, Henri [Laboratoire de Chimie et Environnement, Marseille Universites (case 29), 3 place Victor Hugo, 13331 Marseille Cedex 3 (France)

2007-12-12

The present study describes the development of a new analytical technique for the functional group determination of the carboxylic moiety using atmospheric pressure chemical ionization-mass spectrometry (APCI-MS/MS) operated in the constant neutral loss scanning (CNLS) mode. Carboxylic groups were first derivatized into their corresponding methyl esters by reacting with BF{sub 3}/methanol mix and the reaction mixture was then directly injected into the APCI chamber. The loss of methanol (m/z = 32 amu) resulting from the fragmentation of the protonated methyl esters was then monitored. Applying this method together with a statistical approach to reference mixtures containing 31 different carboxylic acids at randomly calculated concentrations demonstrated its suitability for quantitative functional group measurements with relative standard deviations below 15% and a detection limit of 0.005 mmol L{sup -1}. Its applicability to environmental matrices was also shown through the determination of carboxylic acid concentrations inside atmospheric aerosol samples. To the best of our knowledge, it is the first time that the tandem mass spectrometry was successfully applied to functional group analysis, offering great perspectives in the characterization of complex mixtures which are prevailing in the field of environmental analysis as well as in the understanding of the chemical processes occurring in these matrices.

Carboxylic acid functional group analysis using constant neutral loss scanning-mass spectrometry

International Nuclear Information System (INIS)

Dron, Julien; Eyglunent, Gregory; Temime-Roussel, Brice; Marchand, Nicolas; Wortham, Henri

2007-01-01

The present study describes the development of a new analytical technique for the functional group determination of the carboxylic moiety using atmospheric pressure chemical ionization-mass spectrometry (APCI-MS/MS) operated in the constant neutral loss scanning (CNLS) mode. Carboxylic groups were first derivatized into their corresponding methyl esters by reacting with BF 3 /methanol mix and the reaction mixture was then directly injected into the APCI chamber. The loss of methanol (m/z = 32 amu) resulting from the fragmentation of the protonated methyl esters was then monitored. Applying this method together with a statistical approach to reference mixtures containing 31 different carboxylic acids at randomly calculated concentrations demonstrated its suitability for quantitative functional group measurements with relative standard deviations below 15% and a detection limit of 0.005 mmol L -1 . Its applicability to environmental matrices was also shown through the determination of carboxylic acid concentrations inside atmospheric aerosol samples. To the best of our knowledge, it is the first time that the tandem mass spectrometry was successfully applied to functional group analysis, offering great perspectives in the characterization of complex mixtures which are prevailing in the field of environmental analysis as well as in the understanding of the chemical processes occurring in these matrices

Highly identified power-holders feel responsible: The interplay between social identification and social power within groups.

Science.gov (United States)

Scholl, Annika; Sassenberg, Kai; Ellemers, Naomi; Scheepers, Daan; de Wit, Frank

2018-01-01

Power relations affect dynamics within groups. Power-holders' decisions not only determine their personal outcomes, but also the outcomes of others in the group that they control. Yet, power-holders often tend to overlook this responsibility to take care of collective interests. The present research investigated how social identification - with the group to which both the powerful and the powerless belong - alters perceived responsibility among power-holders (and the powerless). Combining research on social power and social identity, we argue that power-holders perceive more responsibility than the powerless when strongly (rather than when weakly) identifying with the group. A study among leaders and an experiment supported this, highlighting that although power-holders are often primarily concerned about personal outcomes, they do feel responsible for considering others' interests when these others are included in the (social) self. © 2017 The British Psychological Society.

Group Theory of Wannier Functions Providing the Basis for a Deeper Understanding of Magnetism and Superconductivity

Directory of Open Access Journals (Sweden)

Ekkehard Krüger

2015-05-01

Full Text Available The paper presents the group theory of optimally-localized and symmetry-adapted Wannier functions in a crystal of any given space group G or magnetic group M. Provided that the calculated band structure of the considered material is given and that the symmetry of the Bloch functions at all of the points of symmetry in the Brillouin zone is known, the paper details whether or not the Bloch functions of particular energy bands can be unitarily transformed into optimally-localized Wannier functions symmetry-adapted to the space group G, to the magnetic group M or to a subgroup of G or M. In this context, the paper considers usual, as well as spin-dependent Wannier functions, the latter representing the most general definition of Wannier functions. The presented group theory is a review of the theory published by one of the authors (Ekkehard Krüger in several former papers and is independent of any physical model of magnetism or superconductivity. However, it is suggested to interpret the special symmetry of the optimally-localized Wannier functions in the framework of a nonadiabatic extension of the Heisenberg model, the nonadiabatic Heisenberg model. On the basis of the symmetry of the Wannier functions, this model of strongly-correlated localized electrons makes clear predictions of whether or not the system can possess superconducting or magnetic eigenstates.

Transcription Factor Functional Protein-Protein Interactions in Plant Defense Responses

Directory of Open Access Journals (Sweden)

Murilo S. Alves

2014-03-01

Full Text Available Responses to biotic stress in plants lead to dramatic reprogramming of gene expression, favoring stress responses at the expense of normal cellular functions. Transcription factors are master regulators of gene expression at the transcriptional level, and controlling the activity of these factors alters the transcriptome of the plant, leading to metabolic and phenotypic changes in response to stress. The functional analysis of interactions between transcription factors and other proteins is very important for elucidating the role of these transcriptional regulators in different signaling cascades. In this review, we present an overview of protein-protein interactions for the six major families of transcription factors involved in plant defense: basic leucine zipper containing domain proteins (bZIP, amino-acid sequence WRKYGQK (WRKY, myelocytomatosis related proteins (MYC, myeloblastosis related proteins (MYB, APETALA2/ ETHYLENE-RESPONSIVE ELEMENT BINDING FACTORS (AP2/EREBP and no apical meristem (NAM, Arabidopsis transcription activation factor (ATAF, and cup-shaped cotyledon (CUC (NAC. We describe the interaction partners of these transcription factors as molecular responses during pathogen attack and the key components of signal transduction pathways that take place during plant defense responses. These interactions determine the activation or repression of response pathways and are crucial to understanding the regulatory networks that modulate plant defense responses.

Antenatal hypoxia induces programming of reduced arterial blood pressure response in female rat offspring: role of ovarian function.

Directory of Open Access Journals (Sweden)

DaLiao Xiao

Full Text Available In utero exposure to adverse environmental factors increases the risk of cardiovascular disease in adulthood. The present study tested the hypothesis that antenatal hypoxia causes a gender-dependent programming of altered arterial blood pressure response (BP in adult offspring. Time-dated pregnant rats were divided into normoxic and hypoxic (10.5% O2 from days 15 to 21 of gestation groups. The experiments were conducted in adult offspring. Antenatal hypoxia caused intrauterine growth restriction, and resulted in a gender-dependent increase Angiotensin II (Ang II-induced BP response in male offspring, but significant decrease in BP response in female offspring. The baroreflex sensitivity was not significantly altered. Consistent with the reduced blood pressure response, antenatal hypoxia significantly decreased Ang II-induced arterial vasoconstriction in female offspring. Ovariectomy had no significant effect in control animals, but significantly increased Ang II-induced maximal BP response in prenatally hypoxic animals and eliminated the difference of BP response between the two groups. Estrogen replacement in ovariectomized animals significantly decreased the BP response to angiotensin II I only in control, but not in hypoxic animals. The result suggests complex programming mechanisms of antenatal hypoxia in regulation of ovary function. Hypoxia-mediated ovary dysfunction results in the phenotype of reduced vascular contractility and BP response in female adult offspring.

Group Analysis in FieldTrip of Time-Frequency Responses: A Pipeline for Reproducibility at Every Step of Processing, Going From Individual Sensor Space Representations to an Across-Group Source Space Representation

Directory of Open Access Journals (Sweden)

Lau M. Andersen

2018-05-01

Full Text Available An important aim of an analysis pipeline for magnetoencephalographic (MEG data is that it allows for the researcher spending maximal effort on making the statistical comparisons that will answer his or her questions. The example question being answered here is whether the so-called beta rebound differs between novel and repeated stimulations. Two analyses are presented: going from individual sensor space representations to, respectively, an across-group sensor space representation and an across-group source space representation. The data analyzed are neural responses to tactile stimulations of the right index finger in a group of 20 healthy participants acquired from an Elekta Neuromag System. The processing steps covered for the first analysis are MaxFiltering the raw data, defining, preprocessing and epoching the data, cleaning the data, finding and removing independent components related to eye blinks, eye movements and heart beats, calculating participants' individual evoked responses by averaging over epoched data and subsequently removing the average response from single epochs, calculating a time-frequency representation and baselining it with non-stimulation trials and finally calculating a grand average, an across-group sensor space representation. The second analysis starts from the grand average sensor space representation and after identification of the beta rebound the neural origin is imaged using beamformer source reconstruction. This analysis covers reading in co-registered magnetic resonance images, segmenting the data, creating a volume conductor, creating a forward model, cutting out MEG data of interest in the time and frequency domains, getting Fourier transforms and estimating source activity with a beamformer model where power is expressed relative to MEG data measured during periods of non-stimulation. Finally, morphing the source estimates onto a common template and performing group-level statistics on the data are

Effect of nalbuphine preemptive analgesia combined with ropivacaine local infiltration on postoperative incision pain, stress response and immune function in children

Directory of Open Access Journals (Sweden)

Yu Yang

2017-10-01

Full Text Available Objective: To study the effect of nalbuphine preemptive analgesia combined with ropivacaine local infiltration on postoperative incision pain, stress response and immune function in children. Methods: Children who received selective laparotomy in Mianyang Central Hospital between August 2015 and August 2017 were selected and randomly divided into control group, nalbuphine group (N group, ropivacaine group (R group and nalbuphine + ropivacaine group (N+R group. The levels of pain and stress-related mediators in serum and the levels of immune cells in peripheral blood were detected before operation and 24 h after operation. Results: 24 h after operation, serum Cor, NE, MDA, SP, PGE2, BK, NPY, TNF-α, IL-6 and IL-10 levels of four groups of children were significantly higher than those before operation while serum SOD and CAT levels as well as peripheral blood CD3+, CD4+ and CD8+T cell levels were significantly lower than those before operation; serum Cor, NE, MDA, SP, PGE2, BK, NPY, TNF-α, IL-6 and IL-10 levels of N group, R group and N+R group were significantly lower than those of control group while serum SOD and CAT levels as well as peripheral blood CD3+, CD4+ and CD8+T cell levels were significantly higher than those of control group; serum Cor, NE, MDA, SP, PGE2, BK, NPY, TNF-α, IL-6 and IL-10 levels of N+R group were significantly lower than those of N group and R group while serum SOD and CAT levels as well as peripheral blood CD3+, CD4+ and CD8+T cell levels were significantly higher than those of N group and R group. Conclusion: Nalbuphine preemptive analgesia combined with ropivacaine local infiltration can reduce the postoperative incision pain and stress response and improve the immune function in children.

The electrochemical signature of functionalized single-walled carbon nanotubes bearing electroactive groups

International Nuclear Information System (INIS)

Le Floch, Fabien; Thuaire, Aurelie; Simonato, Jean-Pierre; Bidan, Gerard

2009-01-01

We report the modification and characterization of single-walled carbon nanotubes (SWCNTs) in view of molecular sensing applications. We found that ultrasonicated SWCNTs present sticking properties that make them adhere on electrode surfaces. This allows excellent characterization of SWCNTs by cyclic voltammetry (CV) before and after chemical functionalization with diazonium salts bearing electroactive groups. Bare SWCNTs presented distinct invariant shapes in CV, used as control curves, in comparison with functionalized SWCNTs for which specific signatures corresponding to the presence of grafted molecules were identified. According to the electronic substituents in the para position of the diazonium salts, divergent behaviours were observed for the grafting reactions. Diazonium salts having electrowithdrawing groups could be grafted without electrochemical induction whereas those bearing electron donating groups required a cathodic potential to generate the formation of the radical species.

The electrochemical signature of functionalized single-walled carbon nanotubes bearing electroactive groups

Energy Technology Data Exchange (ETDEWEB)

Le Floch, Fabien; Thuaire, Aurelie; Simonato, Jean-Pierre [LITEN/DTNM/LCRE, CEA-Grenoble 17 rue des Martyrs, 38054 Grenoble cedex 9 (France); Bidan, Gerard [INAC/DIR, CEA-Grenoble 17 rue des Martyrs, 38054 Grenoble cedex 9 (France)], E-mail: jean-pierre.simonato@cea.fr

2009-04-08

We report the modification and characterization of single-walled carbon nanotubes (SWCNTs) in view of molecular sensing applications. We found that ultrasonicated SWCNTs present sticking properties that make them adhere on electrode surfaces. This allows excellent characterization of SWCNTs by cyclic voltammetry (CV) before and after chemical functionalization with diazonium salts bearing electroactive groups. Bare SWCNTs presented distinct invariant shapes in CV, used as control curves, in comparison with functionalized SWCNTs for which specific signatures corresponding to the presence of grafted molecules were identified. According to the electronic substituents in the para position of the diazonium salts, divergent behaviours were observed for the grafting reactions. Diazonium salts having electrowithdrawing groups could be grafted without electrochemical induction whereas those bearing electron donating groups required a cathodic potential to generate the formation of the radical species.

Response matrix method for neutron transport in reactor lattices using group symmetry properties

International Nuclear Information System (INIS)

Mund, E.H.

1991-01-01

This paper describes a response matrix method for the approximate solution of one-velocity, multi-dimensional transport problems in reactor lattices, with isotropic neutron scattering. The transport equation is solved on a homogeneous cell by using a Petrov-Galerkin technique based on a set of trial and test functions (including polynomials and exponential functions) closely related to transport problems in infinite media. The number of non-zero elements of the response matrices reduces to a minimum when the symmetry properties of the cell are included ab initio in the span of the basis functions. To include these properties, use is made of projection operations which are performed very efficiently on symbolic manipulation programs. Numerical results of model problems in square geometry show a good agreement with reference solutions

Response function of a p type - HPGe detector

International Nuclear Information System (INIS)

Lopez-Pino, Neivy; Cabral, Fatima Padilla; D'Alessandro, Katia; Maidana, Nora Lia; Vanin, Vito Roberto

2011-01-01

The response function of a HPGe detector depends on Ge crystal dimensions and dead layers thicknesses; most of them are not given by the manufacturers or change with detector damage from neutrons or contact with the atmosphere and therefore must be experimentally determined. The response function is obtained by a Monte-Carlo simulation procedure based on the Ge crystal characteristics. In this work, a p-type coaxial HPGe detector with 30% efficiency, manufactured in 1989, was investigated. The crystal radius and length and the inner hole dimensions were obtained scanning the capsule both in the radial and axial directions using 4 mm collimated beams from 137 Cs, 207 Bi point sources placed on a x-y table in steps of 2,00 mm. These dimensions were estimated comparing the experimental peak areas with those obtained by simulation using several hole configurations. In a similar procedure, the frontal dead layer thickness was determined using 2 mm collimated beams of the 59 keV gamma-rays from 241 Am and 81 keV from 133 Ba sources hitting the detector at 90 deg and 45 deg with respect to the capsule surface. The Monte Carlo detector model included, besides the crystal, hole and capsules sizes, the Ge dead-layers. The obtained spectra were folded with a gaussian resolution function to account for electronic noise. The comparison of simulated and experimental response functions for 4 mm collimated beams of 60 Co, 137 Cs, and 207 Bi points sources placed at distances of 7, 11 and 17 cm from the detector end cap showed relative deviations of about 10% in general and below 10% in the peak. The frontal dead layer thickness determined by our procedure was different from that specified by the detector manufacturer. (author)

Evaluation of spectral zeta-functions with the renormalization group

International Nuclear Information System (INIS)

Boettcher, Stefan; Li, Shanshan

2017-01-01

We evaluate spectral zeta-functions of certain network Laplacians that can be treated exactly with the renormalization group. As specific examples we consider a class of Hanoi networks and those hierarchical networks obtained by the Migdal–Kadanoff bond moving scheme from regular lattices. As possible applications of these results we mention quantum search algorithms as well as synchronization, which we discuss in more detail. (paper)

Significance of Joint Features Derived from the Modified Group Delay Function in Speech Processing

Directory of Open Access Journals (Sweden)

Murthy Hema A

2007-01-01

Full Text Available This paper investigates the significance of combining cepstral features derived from the modified group delay function and from the short-time spectral magnitude like the MFCC. The conventional group delay function fails to capture the resonant structure and the dynamic range of the speech spectrum primarily due to pitch periodicity effects. The group delay function is modified to suppress these spikes and to restore the dynamic range of the speech spectrum. Cepstral features are derived from the modified group delay function, which are called the modified group delay feature (MODGDF. The complementarity and robustness of the MODGDF when compared to the MFCC are also analyzed using spectral reconstruction techniques. Combination of several spectral magnitude-based features and the MODGDF using feature fusion and likelihood combination is described. These features are then used for three speech processing tasks, namely, syllable, speaker, and language recognition. Results indicate that combining MODGDF with MFCC at the feature level gives significant improvements for speech recognition tasks in noise. Combining the MODGDF and the spectral magnitude-based features gives a significant increase in recognition performance of 11% at best, while combining any two features derived from the spectral magnitude does not give any significant improvement.

Surface functional groups in capacitive deionization with porous carbon electrodes

Science.gov (United States)

Hemmatifar, Ali; Oyarzun, Diego I.; Palko, James W.; Hawks, Steven A.; Stadermann, Michael; Santiago, Juan G.; Stanford Microfluidics Lab Team; Lawrence Livermore National Lab Team

2017-11-01

Capacitive deionization (CDI) is a promising technology for removal of toxic ions and salt from water. In CDI, an applied potential of about 1 V to pairs of porous electrodes (e.g. activated carbon) induces ion electromigration and electrostatic adsorption at electrode surfaces. Immobile surface functional groups play a critical role in the type and capacity of ion adsorption, and this can dramatically change desalination performance. We here use models and experiments to study weak electrolyte surface groups which protonate and/or depropotante based on their acid/base dissociation constants and local pore pH. Net chemical surface charge and differential capacitance can thus vary during CDI operation. In this work, we present a CDI model based on weak electrolyte acid/base equilibria theory. Our model incorporates preferential cation (anion) adsorption for activated carbon with acidic (basic) surface groups. We validated our model with experiments on custom built CDI cells with a variety of functionalizations. To this end, we varied electrolyte pH and measured adsorption of individual anionic and cationic ions using inductively coupled plasma mass spectrometry (ICP-MS) and ion chromatography (IC) techniques. Our model shows good agreement with experiments and provides a framework useful in the design of CDI control schemes.

Staying on Task: Age-Related Changes in the Relationship Between Executive Functioning and Response Time Consistency.

Science.gov (United States)

Vasquez, Brandon P; Binns, Malcolm A; Anderson, Nicole D

2016-03-01

Little is known about the relationship of executive functioning with age-related increases in response time (RT) distribution indices (intraindividual standard deviation [ISD], and ex-Gaussian parameters mu, sigma, tau). The goals of this study were to (a) replicate findings of age-related changes in response time distribution indices during an engaging touch-screen RT task and (b) investigate age-related changes in the relationship between executive functioning and RT distribution indices. Healthy adults (24 young [aged 18-30], 24 young-old [aged 65-74], and 24 old-old [aged 75-85]) completed a touch-screen attention task and a battery of neuropsychological tests. The relationships between RT performance and executive functions were examined with structural equation modeling (SEM). ISD, mu, and tau, but not sigma, increased with age. SEM revealed tau as the most salient RT index associated with neuropsychological measures of executive functioning. Further analysis demonstrated that correlations between tau and a weighted executive function composite were significant only in the old-old group. Our results replicate findings of greater RT inconsistency in older adults and reveal that executive functioning is related to tau in adults aged 75-85. These results support literature identifying tau as a marker of cognitive control, which deteriorates in old age. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Functional response to cholinesterase inhibitor therapy in a naturalistic Alzheimer’s disease cohort

Directory of Open Access Journals (Sweden)

Wattmo Carina

2012-11-01

Full Text Available Abstract Background Activities of daily living (ADL are an essential part of the diagnostic criteria for Alzheimer’s disease (AD. A decline in ADL affects independent living and has a strong negative impact on caregiver burden. Functional response to cholinesterase inhibitor (ChEI treatment and factors that might influence this response in naturalistic AD patients need investigating. The aim of this study was to identify the socio-demographic and clinical factors that affect the functional response after 6 months of ChEI therapy. Methods This prospective, non-randomised, multicentre study in a routine clinical setting included 784 AD patients treated with donepezil, rivastigmine or galantamine. At baseline and after 6 months of treatment, patients were assessed using several rating scales, including the Instrumental Activities of Daily Living (IADL scale, Physical Self-Maintenance Scale (PSMS and Mini-Mental State Examination (MMSE. Demographic and clinical characteristics were investigated at baseline. The functional response and the relationships of potential predictors were analysed using general linear models. Results After 6 months of ChEI treatment, 49% and 74% of patients showed improvement/no change in IADL and in PSMS score, respectively. The improved/unchanged patients exhibited better cognitive status at baseline; regarding improved/unchanged PSMS, patients were younger and used fewer anti-depressants. A more positive functional response to ChEI was observed in younger individuals or among those having the interaction effect of better preserved cognition and lower ADL ability. Patients with fewer concomitant medications or those using NSAIDs/acetylsalicylic acid showed a better PSMS response. Conclusions Critical characteristics that may influence the functional response to ChEI in AD were identified. Some predictors differed from those previously shown to affect cognitive response, e.g., lower cognitive ability and older age

Responsiveness of the OARSI-OMERACT osteoarthritis pain and function measures

DEFF Research Database (Denmark)

Bond, M; Davis, A; Lohmander, Stefan

2012-01-01

To assess the responsiveness of the Intermittent and Constant Osteoarthritis Pain (ICOAP) measure, Hip Disability and Osteoarthritis Outcome Score Physical Function Short Form (HOOS-PS), and the Knee Disability and Osteoarthritis Outcome Score Physical Function Short Form (KOOS-PS) in a pharmacol...

Diameter growth performance of tree functional groups in Puerto Rican secondary tropical forests

Directory of Open Access Journals (Sweden)

Patricia Adame

2014-04-01

Full Text Available Aim of study: Understanding the factors that control tree growth in successional stands is particularly important for quantifying the carbon sequestration potential and timber yield of secondary tropical forests. Understanding the factors that control tree growth in successional stands is particularly important for quantifying the carbon sequestration potential and timber yield of secondary tropical forests. Yet, the high species diversity of mixed tropical forests, including many uncommon species, hinders the development of species-specific diameter growth models.Area of study: In these analyses, we grouped 82 species from secondary forests distributed across 93 permanent plots on the island of Puerto Rico.Material and Methods: Species were classified according to regeneration strategy and adult height into six functional groups. This classification allowed us to develop a robust diameter growth model using growth data collected from 1980-1990. We used mixed linear model regression to analyze tree diameter growth as a function of individual tree characteristics, stand structure, functional group and site factors.Main results: The proportion of variance in diameter growth explained by the model was 15.1%, ranging from 7.9 to 21.7%. Diameter at breast height, stem density and functional group were the most important predictors of tree growth in Puerto Rican secondary forest. Site factors such as soil and topography failed to predict diameter growth.Keywords: Caribbean forests; growth model; tropical forest succession; Puerto Rico.

Which subtype of functional dyspepsia patients responses better to acupuncture? A retrospective analysis of a randomized controlled trial.

Science.gov (United States)

Ma, Tingting; Zeng, Fang; Li, Ying; Wang, Chieh-Mei; Tian, Xiaoping; Yu, Shuyuan; Zhao, Ling; Wu, Xi; Yang, Min; Wang, Dejun; Liang, Fanrong

2015-01-01

Whether subgroups of functional dyspepsia (FD) should be treated with different approaches is controversially discussed in research. As our previous study has demonstrated the effect of acupuncture in FD treatment, we now further analyze the therapeutic effect of acupuncture in the treatment of postprandial distress syndrome (PDS) and epigastric pain syndrome (EPS). A retrospective analysis was conducted in 465 eligible PDS patients and 241 EPS patients. 4 acupuncture groups (group A: specific acupoints along the stomach meridian; group B: non-specific acupoints along the stomach meridian; group C: alarm and transport acupoints; group D: specific acupoints along the gallbladder meridian) were compared with a non-acupoint sham acupuncture group and an itopride group. The patients were treated in 5 consecutive sessions per week for 4 weeks and were followed-up for 12 weeks afterwards. Primary outcome of the study was defined as response rate and symptom improvement as measured by the Symptom Index of Dyspepsia, while secondary outcome was designated as improvement in quality of life (QoL) as determined by the Nepean Dyspepsia Index. Symptoms of dyspepsia and QoL were improved from baseline in all groups. In EPS patients, no statistically significant differences could be observed in response rate (p = 0.239) and symptoms improvement (p = 0.344 for epigastric pain; p = 0.465 for epigastric burning). In contrast, PDS patients of the acupuncture group A showed higher response rate (53.2% vs. 19.7%, pitopride group. FD patients with PDS responded better to the acupuncture therapies, especially at the specific acupoints along the stomach meridian. The positive therapeutic effect of acupuncture on PDS was correlated with the improvement in postprandial fullness. ClinicalTrial.gov NCT00599677. © 2015 S. Karger GmbH, Freiburg.

A predator-prey model with a holling type I functional response including a predator mutual interference

Science.gov (United States)

Seo, G.; DeAngelis, D.L.

2011-01-01

The most widely used functional response in describing predator-prey relationships is the Holling type II functional response, where per capita predation is a smooth, increasing, and saturating function of prey density. Beddington and DeAngelis modified the Holling type II response to include interference of predators that increases with predator density. Here we introduce a predator-interference term into a Holling type I functional response. We explain the ecological rationale for the response and note that the phase plane configuration of the predator and prey isoclines differs greatly from that of the Beddington-DeAngelis response; for example, in having three possible interior equilibria rather than one. In fact, this new functional response seems to be quite unique. We used analytical and numerical methods to show that the resulting system shows a much richer dynamical behavior than the Beddington-DeAngelis response, or other typically used functional responses. For example, cyclic-fold, saddle-fold, homoclinic saddle connection, and multiple crossing bifurcations can all occur. We then use a smooth approximation to the Holling type I functional response with predator mutual interference to show that these dynamical properties do not result from the lack of smoothness, but rather from subtle differences in the functional responses. ?? 2011 Springer Science+Business Media, LLC.

A generalized Wigner function for quantum systems with the SU(2) dynamical symmetry group

International Nuclear Information System (INIS)

Klimov, A B; Romero, J L

2008-01-01

We introduce a Wigner-like quasidistribution function to describe quantum systems with the SU(2) dynamic symmetry group. This function is defined in a three-dimensional group manifold and can be used to represent the states defined in several SU(2) invariant subspaces. The explicit differential Moyal-like form of the star product is found and analyzed in the semiclassical limit

Competing failure analysis in phased-mission systems with multiple functional dependence groups

International Nuclear Information System (INIS)

Wang, Chaonan; Xing, Liudong; Peng, Rui; Pan, Zhusheng

2017-01-01

A phased-mission system (PMS) involves multiple, consecutive, non-overlapping phases of operation. The system structure function and component failure behavior in a PMS can change from phase to phase, posing big challenges to the system reliability analysis. Further complicating the problem is the functional dependence (FDEP) behavior where the failure of certain component(s) causes other component(s) to become unusable or inaccessible or isolated. Previous studies have shown that FDEP can cause competitions between failure propagation and failure isolation in the time domain. While such competing failure effects have been well addressed in single-phase systems, only little work has focused on PMSs with a restrictive assumption that a single FDEP group exists in one phase of the mission. Many practical systems (e.g., computer systems and networks), however may involve multiple FDEP groups during the mission. Moreover, different FDEP groups can be dependent due to sharing some common components; they may appear in a single phase or multiple phases. This paper makes new contributions by modeling and analyzing reliability of PMSs subject to multiple FDEP groups through a Markov chain-based methodology. Propagated failures with both global and selective effects are considered. Four case studies are presented to demonstrate application of the proposed method. - Highlights: • Reliability of phased-mission systems subject to competing failure propagation and isolation effects is modeled. • Multiple independent or dependent functional dependence groups are considered. • Propagated failures with global effects and selective effects are studied. • Four case studies demonstrate generality and application of the proposed Markov-based method.

A Systematic Review of Group Social Skills Interventions, and Meta-analysis of Outcomes, for Children with High Functioning ASD.

Science.gov (United States)

Wolstencroft, J; Robinson, L; Srinivasan, R; Kerry, E; Mandy, W; Skuse, D

2018-07-01

Group social skills interventions (GSSIs) are a commonly offered treatment for children with high functioning ASD. We critically evaluated GSSI randomised controlled trials for those aged 6-25 years. Our meta-analysis of outcomes emphasised internal validity, thus was restricted to trials that used the parent-report social responsiveness scale (SRS) or the social skills rating system (SSRS). Large positive effect sizes were found for the SRS total score, plus the social communication and restricted interests and repetitive behaviours subscales. The SSRS social skills subscale improved with moderate effect size. Moderator analysis of the SRS showed that GSSIs that include parent-groups, and are of greater duration or intensity, obtained larger effect sizes. We recommend future trials distinguish gains in children's social knowledge from social performance.

Thermo-responsive polymer-functionalized mesoporous carbon for controlled drug release

Energy Technology Data Exchange (ETDEWEB)

Zhu Shenmin, E-mail: smzhu@sjtu.edu.cn [State Key Laboratory of Metal Matrix Composites, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240 (China); Chen Chenxin [State Key Laboratory of Metal Matrix Composites, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240 (China); Chen Zhixin [Faculty of Engineering, University of Wollongong, Wollongong, NSW 2522 (Australia); Liu Xinye; Li Yao; Shi Yang; Zhang Di [State Key Laboratory of Metal Matrix Composites, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240 (China)

2011-03-15

Research highlights: {yields} A responsive drug delivery system based on poly(N-isopropyl acrylamide) (PNIPAM) functionalized ordered mesoporous carbon (CMK-3) is developed. {yields} A combination of surface modification of CMK-3 and in situ internal polymerization of PNIPAM was used. {yields} The system exhibited a pronounced transition at around 20-25 deg. C. - Abstract: A novel responsive drug delivery system based on poly(N-isopropyl acrylamide) (PNIPAM) functionalized ordered mesoporous carbon (CMK-3) is developed. The polymer-functionalized CMK-3 was obtained by a combination of simple surface modification of CMK-3 and in situ internal polymerization of PNIPAM. The formation of the PNIPAM inside the CMK-3 was confirmed by thermal gravimetric analysis, Fourier transform-infrared spectroscopy, scanning and transmission electron microscopy and N{sub 2} adsorption/desorption measurements. Controlled drug release tests through the porous network of the PNIPAM functionalized CMK-3 were carried out by measuring the uptake and release of ibuprofen in vitro. The release profiles exhibited a pronounced transition at around 20-25 deg. C. This thermo-sensitive release property of this delivery system was further confirmed by temperature-variable hydrogen nuclear magnetic resonance analysis. The internal PNIPAM layers acted as a storage gate as well as a release switch in response to the stimuli of environment.

Glycaemic responses to liquid food supplements among three Asian ethnic groups.

Science.gov (United States)

Tey, Siew Ling; Van Helvoort, Ardy; Henry, Christiani Jeyakumar

2016-12-01

A limited number of studies have compared the glycaemic index (GI) and glycaemic responses (GR) to solid foods between Caucasians and Asians. These studies have demonstrated that Asians have greater GI and GR values for solid foods than Caucasians. However, no study has compared the GI and GR to liquids among various Asian ethnic groups. A total of forty-eight males and females (16 Chinese, 16 Indians, and 16 Malay) took part in this randomised, crossover study. Glycaemic response to the reference food (glucose beverage) was measured on three occasions, and GR to three liquids were measured on one occasion each. Liquids with different macronutrient ratio's and carbohydrate types were chosen to be able to evaluate the response to products with different GIs. Blood glucose concentrations were measured in duplicate at baseline (-5 and 0 min) and once at 15, 30, 45, 60, 90, and 120 min after the commencement of beverage consumption. There were statistically significant differences in GI and GR between the three liquids (P Chinese vs. Indian vs. Malay). The GR for three different types of liquid nutritional supplements did not differ between the three main ethnic groups in Asia. It appears that the GI of liquid food derived from one Asian ethnicity can be applicable to other Asian populations.

Effects of Plant Functional Group Loss on Soil Microbial Community and Litter Decomposition in a Steppe Vegetation.

Science.gov (United States)

Xiao, Chunwang; Zhou, Yong; Su, Jiaqi; Yang, Fan

2017-01-01

Globally, many terrestrial ecosystems are experiencing a rapid loss of biodiversity. Continued improvements in our understanding of interrelationships between plant diversity and soil microbes are critical to address the concern over the consequences of the decline in biodiversity on ecosystem functioning and services. By removing forbs, or grasses, or, to an extreme scenario, both forbs and grasses in a steppe vegetation in Inner Mongolia, we studied how plant functional group (PFG) loss affects soil microbial community composition using phospholipid fatty acid analysis (PLFA) and litter decomposition using a litter-bag method. PFG loss significantly decreased above- and below-ground plant biomass, soil microbial biomass carbon (SMBC) and nitrogen (SMBN), but had no effect on the ratio of SMBC to SMBN. Although the ratio of fungal to bacterial PLFAs remained unaffected, PFG loss significantly reduced the amount of bacterial, fungal, and total PLFAs. PFG loss decreased litter monthly mass loss and decay constant, and such decrease was significant when both forbs and grasses were removed. Our results provide robust evidence that PFG loss in grassland ecosystem can lead to a rapid response of soil microbial activity which may affect litter decomposition and soil nutrient cycling, suggesting that the assessment of plant-microbe interactions in soils is an integral component of ecosystem response to biodiversity loss.

Susceptibility of functional impairment scales to noncredible responses in the clinical evaluation of adult ADHD.

Science.gov (United States)

Fuermaier, Anselm B M; Tucha, Oliver; Koerts, Janneke; Butzbach, Marah; Weisbrod, Matthias; Aschenbrenner, Steffen; Tucha, Lara

2018-05-01

A growing body of research questions the reliance of symptom self-reports in the clinical evaluation of attention-deficit/hyperactivity disorder (ADHD) in adulthood. A recent study suggested that also impairment reports are vulnerable to noncredible responses, as derived from a simulation design using a global functional impairment scale. The present study aims to add evidence to this issue, by using an ADHD specific impairment scale in a simulation design on large samples. Impairment ratings on the Weiss Functional Impairment Rating Scale (WFIRS) of 62 patients with ADHD were compared to 142 healthy individuals who were instructed to show normal behavior. Furthermore, impairment ratings of patients with ADHD were compared to ratings of 330 healthy individuals who were randomly assigned to one of four simulation conditions that were instructed to complete the scale as if they had ADHD. Patients with ADHD reported higher levels of impairment than the healthy control group in all domains of life. Furthermore, individuals instructed to feign ADHD indicated higher levels of impairments in most domains of life compared to control participants and genuine patients with ADHD. The group differences between individuals feigning ADHD and individuals with genuine ADHD, however, were only small to moderate. Further analyses revealed that the WFRIS was not useful to successfully differentiate genuine from feigned ADHD. The present study confirms the conclusion that self-reported impairments are susceptible to noncredible responses and should be used with caution in the clinical evaluation of adult ADHD.

Determination of surface functional groups on mechanochemically activated carbon cloth by Boehm method

Directory of Open Access Journals (Sweden)

Đukić Anđelka B.

2014-01-01

Full Text Available In order to improve sorption properties of activated carbon cloth that can be used for wastewater purification, mechanochemical activation was performed in both inert and air atmosphere. Boehm method was used to follow the changes in the number and types of surface groups induced by mechanical milling. The number of the base groups of 0,2493 mmol/g is significantly smaller than the total amount of acidic functional groups, 2,5093 mmol/g. Among the acidic groups present on the surface, the most represented are phenolic groups (2.3846 mmol/g , ie . > 95 % , the carboxylic groups are present far less (0.1173 mmol /g, ie. 4.5 %, while the presence of the lactone group on the surface of ACC is negligible (0.0074 mmol/g ie. under 0.3 %. Mechanochemical activation lead to an increase in the number of acidic and basic groups on the surface of the ACC. The milling in inert atmosphere has dominant effect with respect to the changes in the total number of basic functional groups (compared to milling in an air atmosphere: the number of basic groups of the ACC was 0.8153 mmol/g milled under argon, 0.7933 mmol/g in the air; the number of acidic groups is 2.9807 mmol/g for a sample milled under argon and 3.5313 mmol/g for one milled in the air.

Small functional groups for controlled differentiation of hydrogel-encapsulated human mesenchymal stem cells

Science.gov (United States)

Benoit, Danielle S. W.; Schwartz, Michael P.; Durney, Andrew R.; Anseth, Kristi S.

2008-10-01

Cell-matrix interactions have critical roles in regeneration, development and disease. The work presented here demonstrates that encapsulated human mesenchymal stem cells (hMSCs) can be induced to differentiate down osteogenic and adipogenic pathways by controlling their three-dimensional environment using tethered small-molecule chemical functional groups. Hydrogels were formed using sufficiently low concentrations of tether molecules to maintain constant physical characteristics, encapsulation of hMSCs in three dimensions prevented changes in cell morphology, and hMSCs were shown to differentiate in normal growth media, indicating that the small-molecule functional groups induced differentiation. To our knowledge, this is the first example where synthetic matrices are shown to control induction of multiple hMSC lineages purely through interactions with small-molecule chemical functional groups tethered to the hydrogel material. Strategies using simple chemistry to control complex biological processes would be particularly powerful as they could make production of therapeutic materials simpler, cheaper and more easily controlled.

The Use of Hydrograph Analysis and Impulse Response Functions to Improve Understanding of Groundwater Flooding: A Case Study from the Chalk Aquifer, United Kingdom.

Science.gov (United States)

Ascott, M.; Bloomfield, J.; Macdonald, D.; Marchant, B.; McKenzie, A.

2017-12-01

The Cretaceous Chalk, the most important aquifer in the United Kingdom (UK) for public water supply, underlies many large cities in southern and eastern England including parts of London, however, it is prone to groundwater flooding. We have developed a new approach to analyse the spatio-temporal extent of groundwater flooding using statistical analysis of groundwater level hydrographs and impulse response functions (IRFs) applied to a major Chalk groundwater flooding event in the UK during winter 2013/14. Using monthly groundwater levels for 26 boreholes in the Chalk and a new standardised index for groundwater flooding, we have: estimated standardised series; grouped them using k-means cluster analysis; and, cross-correlated the cluster centroids with the Standardised Precipitation Index accumulated over time intervals between 1 and 60 months. This analysis reveals two spatially coherent groups of standardised hydrographs which respond to precipitation over different timescales. We estimate IRF models of the groundwater level response to effective precipitation for three boreholes in each group. The IRF models support the SPI analysis showing different response functions between the two groups. If we apply identical effective precipitation inputs to each of the IRF models we see differences between the hydrographs from each group. It is proposed that these differences are due to the intrinsic, hydrogeological properties of the Chalk and of overlying relatively low permeability superficial deposits. Consequently, it is concluded that the overarching controls on groundwater flood response are a complex combination of antecedent conditions, rainfall and catchment hydrogeological properties. These controls should be taken into consideration when anticipating and managing future groundwater flood events.

Fitting of transfer functions to frequency response measurements

International Nuclear Information System (INIS)

Moret, J.M.

1994-12-01

An algorithm for approximating a given complex frequency response with a rational function of two polynomials with real coefficients is presented, together with its extension to distributed parameter systems, the corresponding error analysis and its application to a real case. (author) 5 figs., 4 refs

Chronopharmacological effects of growth hormone on the executive function and oxidative stress response in rats

Directory of Open Access Journals (Sweden)

Carlos K B Ferrari

2017-01-01

Full Text Available Objective(s: to investigate the chronopharmacological effects of growth hormone on executive function and the oxidative stress response in rats. Materials and Methods: Fifty male Wistar rats (36-40 weeks old had ad libitum access to water and food and were separated into four groups: diurnal control, nocturnal control, diurnal GH-treated, and nocturnal GH-treated animals. Levels of Cu, Zn superoxide dismutase (Cu,Zn-SOD, and superoxide release by spleen macrophages were evaluated. For memory testing, adaptation and walking in an open field platform was used. GH-treated animals demonstrated better performance in exploratory and spatial open-field tests. Results: The latency time in both GH-treated groups was significantly lower compared with the latency time of the control groups. The diurnal GH treatment did not stimulate superoxide release but increased the CuZn-SOD enzyme levels. The nocturnal GH treatment did not influence the superoxide release and CuZn-SOD concentration. GH treatment also resulted in heart atrophy and lung hypertrophy. Conclusion: Growth hormone treatment improved the performance of executive functions at the cost of oxidative stress triggering, and this effect was dependent on the circadian period of hormone administration. However, GH treatment caused damaging effects such as lung hypertrophy and heart atrophy.

The determination of frequency response function of the RSG Gas by laplace transform analysis

International Nuclear Information System (INIS)

Tukiran, S.; Surian, P.; Jujuratisbela, U.

1997-01-01

The response function of the RSG-GAS reactor system to the reactivity perturbations is necessary to be analyzed due to the interrelation with reliability and safety of reactor operation. the response depends on the power frequency response function H(s), while H(s) depends on the zero power frequency response function Z(s) and dynamic power coefficient of reactivity Kp(s) determination of the frequency response function of the RSG-GAS reactor was done by Fourier transform analysis method. Z(s) was obtained by fourier transform of P(t) and Cj(t) became P(S) and Cj(s) in point kinetic equations. Second order of simpson rule was used for completion of its numerical integration. then. LYMPR (Laplace transform for multipurpose reactor) code was made with fortran 77 computer language in vax 8550 system. the LTMPR code is able to determine the frequency response function and period-reactivity relation of RSG-GAS reactor by rod drop method. Profile of power as rod drop, zero power (without reactivity feedback) was used for determination frequency response of RSG-GAS reactor. The results of calculations are in a good agreement with experiment result, so the LTMPR code can be used for analysis response frequency of the RSG-GAS reactor

ABO blood group is associated with response to inhaled nitric oxide in neonates with respiratory failure.

Directory of Open Access Journals (Sweden)

George T El-Ferzli

Full Text Available Inhaled nitric oxide (iNO reduces death or need for extracorporeal membrane oxygenation (ECMO in infants with persistent pulmonary hypertension of the newborn (PPHN. However, the response to iNO is variable and only 50-60% of infants demonstrate a response to iNO. It is not known why only some infants respond to iNO. Adults and children with blood groups B or AB do not respond as well to iNO as those with blood groups O/A.To determine if blood group was associated with iNO response in newborn infants, a retrospective medical record review was done of infants admitted to a regional NICU from 2002-9 with a diagnosis of PPHN. Data were collected during the first twelve hours post-initiation of treatment. Of 86 infants diagnosed with PPHN, 23 infants had blood group A [18 received iNO], 21 had group B [18 with iNO], 40 had group O [36 with iNO], and 2 had group AB [both received iNO]. Change in PaO(2/FiO(2 was less in infants with blood group A, of whom less than half were responders (ΔPaO(2/FiO(2>20% at 12 h versus 90% of infants with either O or B. Race, sex, birth weight, gestational age, Apgar scores at 1 and 5 minutes, and baseline PaO(2/FiO(2 were similar among groups. Outcomes including need for ECMO, death, length of ventilatory support, length of iNO use, and hospital stay were statistically not different by blood groups.Our results indicate that blood group influences iNO response in neonates. We hypothesize that either there is genetic linkage of the ABO gene locus with vasoregulatory genes, or that blood group antigens directly affect vascular reactivity.

Functional renormalization group approach to interacting three-dimensional Weyl semimetals

Science.gov (United States)

Sharma, Anand; Scammell, Arthur; Krieg, Jan; Kopietz, Peter

2018-03-01

We investigate the effect of long-range Coulomb interaction on the quasiparticle properties and the dielectric function of clean three-dimensional Weyl semimetals at zero temperature using a functional renormalization group (FRG) approach. The Coulomb interaction is represented via a bosonic Hubbard-Stratonovich field which couples to the fermionic density. We derive truncated FRG flow equations for the fermionic and bosonic self-energies and for the three-legged vertices with two fermionic and one bosonic external legs. We consider two different cutoff schemes—cutoff in fermionic or bosonic propagators—in order to calculate the renormalized quasiparticle velocity and the dielectric function for an arbitrary number of Weyl nodes and the interaction strength. If we approximate the dielectric function by its static limit, our results for the velocity and the dielectric function are in good agreement with that of A. A. Abrikosov and S. D. Beneslavskiĭ [Sov. Phys. JETP 32, 699 (1971)] exhibiting slowly varying logarithmic momentum dependence for small momenta. We extend their result for an arbitrary number of Weyl nodes and finite frequency by evaluating the renormalized velocity in the presence of dynamic screening and calculate the wave function renormalization.

Functional renormalization group approach to the two dimensional Bose gas

Energy Technology Data Exchange (ETDEWEB)

Sinner, A; Kopietz, P [Institut fuer Theoretische Physik, Universitaet Frankfurt, Max-von-Laue Strasse 1, 60438 Frankfurt (Germany); Hasselmann, N [International Center for Condensed Matter Physics, Universidade de BrasIlia, Caixa Postal 04667, 70910-900 BrasIlia, DF (Brazil)], E-mail: hasselma@itp.uni-frankfurt.de, E-mail: sinner@itp.uni-frankfurt.de

2009-02-01

We investigate the small frequency and momentum structure of the weakly interacting Bose gas in two dimensions using a functional renormalization group approach. The flow equations are derived within a derivative approximation of the effective action up to second order in spatial and temporal variables and investigated numerically. The truncation we employ is based on the perturbative structure of the theory and is well described as a renormalization group enhanced perturbation theory. It allows to calculate corrections to the Bogoliubov spectrum and to investigate the damping of quasiparticles. Our approach allows to circumvent the divergences which plague the usual perturbative approach.

Controlled surface functionalization of silica-coated magnetic nanoparticles with terminal amino and carboxyl groups

International Nuclear Information System (INIS)

Kralj, Slavko; Drofenik, Miha; Makovec, Darko

2011-01-01

General and versatile methods for the functionalization of superparamagnetic, silica-coated, maghemite nanoparticles by surface amino and/or carboxyl groups have been established. The nanoparticles were synthesized using co-precipitation from aqueous solutions and coated with a thin layer of silica using the hydrolysis and condensation of tetraethoxysilane (TEOS). For the amino functionalization, 3-(2-aminoethylamino)propylmethyldimethoxysilane (APMS) was grafted onto the nanoparticle surfaces in their aqueous suspensions. The grafting process was followed by measurements of the ζ-potential and a determination of the concentration of the surface amino groups with conductometric titrations. The surface concentration of the amino groups could be varied by increasing the amount of APMS in the grafting process up to approximately 2.3 –NH 2 groups per nm 2 . The carboxyl functionalization was obtained in two ways: (i) by a ring-opening linker elongation reaction of the surface amines at the functionalized nanoparticles with succinic anhydride (SA) in non-aqueous medium, and (ii) by reacting the APMS and SA first, followed by grafting of the carboxyl-terminated reagent onto the nanoparticle surfaces. Using the first method, the SA only reacted with the terminal primary amino groups (–NH 2 ) of the surface-grafted APMS molecules. Infra-red spectroscopy (ATR FTIR) and mass spectrometry (HRMS) showed that the second method enables the bonding of up to two SA molecules per one APMS molecule, since the SA reacted with both the primary (–NH 2 ) and secondary amino (–NH–) groups of the APMS molecule. When using both methods, the ratio between the surface amino and carboxyl groups can be controlled.

How Do Politicians Attribute Bureaucratic Responsibility for Performance? Negativity Bias and Interest Group Advocacy

DEFF Research Database (Denmark)

Nielsen, Poul A.; Moynihan, Donald P.

2017-01-01

Voters reward or punish politicians by deeming them responsible for positive and negative outcomes, but how, in turn, do politicians attribute responsibility to those who actually deliver public services? Inattention to this question renders incomplete current perspectives on democratic processes...... to attribute causal responsibility to bureaucratic leaders, but only in cases of low performance, suggesting a negativity bias in public sector responsibility attribution processes. Additionally, we offer evidence that interest group advocates influence how elected officials use performance information...... to attribute responsibility, but contingent on ideological alignment....

Effects of group exercise on functional abilities: Differences between physically active and physically inactive women.

Science.gov (United States)

Cokorilo, Nebojsa; Mikalacki, Milena; Satara, Goran; Cvetkovic, Milan; Marinkovic, Dragan; Zvekic-Svorcan, Jelena; Obradovic, Borislav

2018-03-30

Aerobic exercises to music can have a positive effect on functional and motor skills of an exerciser, their health, as well as an aesthetic and socio-psychological component. The objective of this study was to determine the effects of reactive exercising in a group on functional capabilities in physically active and physically inactive women. A prospective study included 64 healthy women aged 40-60 years. The sample was divided into the experimental group (n= 36), i.e. physically active women who have been engaged in recreational group exercises at the Faculty of Sport and Physical Education, University of Novi Sad, Serbia, and the control group (n= 28), which consisted of physically inactive women. All the participants were monitored using the same protocol before and after the implementation of the research. All women had their height, weight, body mass index measured as well as spiroergometric parameters determined according to the Bruce protocol. A univariate analysis of variance has shown that there is a statistically significant difference between the experimental group and the control group in maximum speed, the total duration of the test, relative oxygen consumption, absolute oxygen consumption and ventilation during the final measurement. After the training intervention, the experimental group showed improvements in all the parameters analyzed compared with pretest values. The recreational group exercise model significantly improves aerobic capacity and functioning of the cardiovascular system. Therefore, it is essential for women to be involved more in any form of recreational group exercising in order to improve functional capacity and health.

Response of Korean pine's functional traits to geography and climate.

Directory of Open Access Journals (Sweden)

Yichen Dong

Full Text Available This study analyzed the characteristics of Korean pine (Pinus koraiensis functional trait responses to geographic and climatic factors in the eastern region of Northeast China (41°-48°N and the linear relationships among Korean pine functional traits, to explore this species' adaptability and ecological regulation strategies under different environmental conditions. Korean pine samples were collected from eight sites located at different latitudes, and the following factors were determined for each site: geographic factors-latitude, longitude, and altitude; temperature factors-mean annual temperature (MAT, growth season mean temperature (GST, and mean temperature of the coldest month (MTCM; and moisture factors-annual precipitation (AP, growth season precipitation (GSP, and potential evapotranspiration (PET. The Korean pine functional traits examined were specific leaf area (SLA, leaf thickness (LT, leaf dry matter content (LDMC, specific root length (SRL, leaf nitrogen content (LNC, leaf phosphorus content (LPC, root nitrogen content (RNC, and root phosphorus content (RPC. The results showed that Korean pine functional traits were significantly correlated to latitude, altitude, GST, MTCM, AP, GSP, and PET. Among the Korean pine functional traits, SLA showed significant linear relationships with LT, LDMC, LNC, LPC, and RPC, and LT showed significant linear relationships with LDMC, SRL, LNC, LPC, RNC, and RPC; the linear relationships between LNC, LPC, RNC, and RPC were also significant. In conclusion, Korean pine functional trait responses to latitude resulted in its adaptation to geographic and climatic factors. The main limiting factors were precipitation and evapotranspiration, followed by altitude, latitude, GST, and MTCM. The impacts of longitude and MAT were not obvious. Changes in precipitation and temperature were most responsible for the close correlation among Korean pine functional traits, reflecting its adaption to habitat

Study on response function of CdTe detector

Energy Technology Data Exchange (ETDEWEB)

Kim, Hyunduk; Cho, Gyuseong [Department of Nuclear and Quantum Engineering, Korea Advanced Institute of Science and Technology, Daejeon 305-701 (Korea, Republic of); Kang, Bo-Sun [Department of Radiological Science, Catholic University of Daegu, Kyoungsan, Kyoungbuk 712-702 (Korea, Republic of)], E-mail: bskang@cu.ac.kr

2009-10-21

So far the origin of the mechanism of light emission in the sonoluminescence has not elucidated whether it is due to blackbody radiation or bremsstrahlung. The final goal of our study is measuring X-ray energy spectrum using high-sensitivity cadmium telluride (CdTe) detector in order to obtain information for understanding sonoluminescence phenomena. However, the scope of this report is the measurement of X-ray spectrum using a high-resolution CdTe detector and determination of CdTe detector response function to obtain the corrected spectrum from measured soft X-ray source spectrum. In general, the measured spectrum was distorted by the characteristics of CdTe detector. Monte Carlo simulation code, MCNP, was used to obtain the reference response function of the CdTe detector. The X-ray spectra of {sup 57}Co, {sup 133}Ba, and {sup 241}Am were obtained by a 4x4x1.0(t) mm{sup 3} CdTe detector at room temperature.

Utility Function for modeling Group Multicriteria Decision Making problems as games

OpenAIRE

Alexandre Bevilacqua Leoneti

2016-01-01

To assist in the decision making process, several multicriteria methods have been proposed. However, the existing methods assume a single decision-maker and do not consider decision under risk, which is better addressed by Game Theory. Hence, the aim of this research is to propose a Utility Function that makes it possible to model Group Multicriteria Decision Making problems as games. The advantage of using Game Theory for solving Group Multicriteria Decision Making problems is to evaluate th...

Responses of bat social groups to roost loss: More questions than answers

Science.gov (United States)

Silvis, Alexander; Abaid, Nicole; Ford, W. Mark; Britzke, Eric R.; Ortega, Jorge

2016-01-01

Though characterization of, and understanding determinants of, social structure in bats is increasing, little is known about how bat social groups respond to disturbance resulting in roost loss. Given that many species of bats roost in ephemeral or transitory resources such as plants, it is clear that bat social groups can tolerate some level of roost loss. Understanding responses of bat social groups to roost loss can provide insight into social structure that have applied conservation use. Herein, we review the existing literature on the effects of disturbance on bat social groups, and present a parameterizable agent-based model that can be used to explore the relationships among roost dynamics, population dynamics, and social behavior.

Evaluation of functionality and biological response of the multilayer flow modulator in porcine animal models.

Science.gov (United States)

Sultan, Sherif; Kavanagh, Edel P; Hynes, Niamh; Diethrich, Edward B

2016-02-01

This study outlines the use of non-aneurysmal porcine animal models to study device functionality and biological response of the Multilayer Flow Modulator (MFM) (Cardiatis, Isnes, Belgium), with an emphasis on preclinical device functionality and biological response characteristics in an otherwise healthy aorta. Twelve animals were implanted with the study device in the abdominal aorta, in 6 animals for 1 month and 6 animals for 6 months. Upon completion of the study period, each animal underwent a necropsy to examine how the implanted device had affected the artery and surrounding tissue. Neointima and stenosis formation were recorded via morphometry, and endothelialization via histopathological analysis. The MFM devices were delivered to their respective implantation sites without difficulty. Six of the implanted stents were oversized with percentages ranging from 2.6% to 18.8%. Statistical analysis was carried out and showed no significance between the regular sized stent group and oversized stent group for neointimal area (P=0.17), neointimal thickness (P=0.17), and percentage area stenosis (P=0.65). Histopathological findings showed in most areas flattened endothelium like cells lined the luminal surface of the neointima. Scanning electron microscopy also showed the devices were well tolerated, inciting only a minimal neointimal covering and little fibrin or platelet deposition. Neointimal thickness of 239.7±55.6 μm and 318.3±130.4 μm, and percentage area stenosis of 9.6±2.6% and 12.6±5% were recorded at 1 and 6 months respectively. No statistical differences were found between these results. The MFM devices were delivered to their respective implantation sites without difficulty and incited little neointimal and stenosis formation in the aorta, affirming its functionality and biocompatibility.

Nuclear Safety: Our Overriding Priority. EDF Group Report 2015 in response to FTSE4Good Nuclear Criteria

International Nuclear Information System (INIS)

Maillart, H.

2015-01-01

EDF is the world's leading nuclear operator with 74.8 GW of installed capacity in France, the United Kingdom and the United States, an EPR under construction in France, and 2 EPRs under construction in China through TNPJVC (EDF 30%), a joint venture with CGNPC. As such, EDF acts at all stages in the life of its power plants (design, construction, operation, decommissioning) to: - ensure rigorous operation of facilities; - prevent all incidents and accidents; - reduce the impact of any incidents or accidents that might nevertheless occur. The main safety measures were published in a single document in 2015 setting out the Group's nuclear safety policy. Each nuclear operating company inside the Group acts in compliance with the legal obligations and regulations specific to its host country. Each company works to ensure and continuously improve its safety performance with its own methods, skills and values. The EDF Group respects national differences. At the same time it frames common principles to deliver the highest level of incident prevention and protection of the public, workers and the environment. This policy applies to new projects (overall architecture, design and construction) and all existing plants (operation, maintenance, waste management, decommissioning and engineering). The Group works closely with its industrial partners to deliver these objectives. Each company is responsible for the proper operation of its nuclear activities, and delegates responsibilities appropriately to each level of management or operation. The Group guarantees the allocation of resources needed to ensure nuclear safety. An in-house independent nuclear safety function is in place at power plant level, company level and Group level. Each has a duty to alert senior management of inappropriate or inadequate line management response. Nuclear safety is the absolute priority for the EDF Group at every stage of the plant life-cycle. Each company is responsible for ensuring that its

Comparison of dose response functions for EBT3 model GafChromic™ film dosimetry system.

Science.gov (United States)

Aldelaijan, Saad; Devic, Slobodan

2018-05-01

Different dose response functions of EBT3 model GafChromic™ film dosimetry system have been compared in terms of sensitivity as well as uncertainty vs. error analysis. We also made an assessment of the necessity of scanning film pieces before and after irradiation. Pieces of EBT3 film model were irradiated to different dose values in Solid Water (SW) phantom. Based on images scanned in both reflection and transmission mode before and after irradiation, twelve different response functions were calculated. For every response function, a reference radiochromic film dosimetry system was established by generating calibration curve and by performing the error vs. uncertainty analysis. Response functions using pixel values from the green channel demonstrated the highest sensitivity in both transmission and reflection mode. All functions were successfully fitted with rational functional form, and provided an overall one-sigma uncertainty of better than 2% for doses above 2 Gy. Use of pre-scanned images to calculate response functions resulted in negligible improvement in dose measurement accuracy. Although reflection scanning mode provides higher sensitivity and could lead to a more widespread use of radiochromic film dosimetry, it has fairly limited dose range and slightly increased uncertainty when compared to transmission scan based response functions. Double-scanning technique, either in transmission or reflection mode, shows negligible improvement in dose accuracy as well as a negligible increase in dose uncertainty. Normalized pixel value of the images scanned in transmission mode shows linear response in a dose range of up to 11 Gy. Copyright © 2018 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

Functional Associations by Response Overlap (FARO, a functional genomics approach matching gene expression phenotypes.

Directory of Open Access Journals (Sweden)

Henrik Bjørn Nielsen

2007-08-01

Full Text Available The systematic comparison of transcriptional responses of organisms is a powerful tool in functional genomics. For example, mutants may be characterized by comparing their transcript profiles to those obtained in other experiments querying the effects on gene expression of many experimental factors including treatments, mutations and pathogen infections. Similarly, drugs may be discovered by the relationship between the transcript profiles effectuated or impacted by a candidate drug and by the target disease. The integration of such data enables systems biology to predict the interplay between experimental factors affecting a biological system. Unfortunately, direct comparisons of gene expression profiles obtained in independent, publicly available microarray experiments are typically compromised by substantial, experiment-specific biases. Here we suggest a novel yet conceptually simple approach for deriving 'Functional Association(s by Response Overlap' (FARO between microarray gene expression studies. The transcriptional response is defined by the set of differentially expressed genes independent from the magnitude or direction of the change. This approach overcomes the limited comparability between studies that is typical for methods that rely on correlation in gene expression. We apply FARO to a compendium of 242 diverse Arabidopsis microarray experimental factors, including phyto-hormones, stresses and pathogens, growth conditions/stages, tissue types and mutants. We also use FARO to confirm and further delineate the functions of Arabidopsis MAP kinase 4 in disease and stress responses. Furthermore, we find that a large, well-defined set of genes responds in opposing directions to different stress conditions and predict the effects of different stress combinations. This demonstrates the usefulness of our approach for exploiting public microarray data to derive biologically meaningful associations between experimental factors. Finally, our

Assessment of exposure-response functions for rocket-emission toxicants

National Research Council Canada - National Science Library

Subcommittee on Rocket-Emission Toxicants, National Research Council

... aborted launch that results in a rocket being destroyed near the ground. Assessment of Exposure-Response Functions for Rocket-Emmission Toxicants evaluates the model and the data used for three rocket emission toxicants...

Consistent Individual Differences Drive Collective Behavior and Group Functioning of Schooling Fish.

Science.gov (United States)

Jolles, Jolle W; Boogert, Neeltje J; Sridhar, Vivek H; Couzin, Iain D; Manica, Andrea

2017-09-25

The ubiquity of consistent inter-individual differences in behavior ("animal personalities") [1, 2] suggests that they might play a fundamental role in driving the movements and functioning of animal groups [3, 4], including their collective decision-making, foraging performance, and predator avoidance. Despite increasing evidence that highlights their importance [5-16], we still lack a unified mechanistic framework to explain and to predict how consistent inter-individual differences may drive collective behavior. Here we investigate how the structure, leadership, movement dynamics, and foraging performance of groups can emerge from inter-individual differences by high-resolution tracking of known behavioral types in free-swimming stickleback (Gasterosteus aculeatus) shoals. We show that individual's propensity to stay near others, measured by a classic "sociability" assay, was negatively linked to swim speed across a range of contexts, and predicted spatial positioning and leadership within groups as well as differences in structure and movement dynamics between groups. In turn, this trait, together with individual's exploratory tendency, measured by a classic "boldness" assay, explained individual and group foraging performance. These effects of consistent individual differences on group-level states emerged naturally from a generic model of self-organizing groups composed of individuals differing in speed and goal-orientedness. Our study provides experimental and theoretical evidence for a simple mechanism to explain the emergence of collective behavior from consistent individual differences, including variation in the structure, leadership, movement dynamics, and functional capabilities of groups, across social and ecological scales. In addition, we demonstrate individual performance is conditional on group composition, indicating how social selection may drive behavioral differentiation between individuals. Copyright © 2017 The Author(s). Published by

Ordered self-assembled monolayers terminated with different chemical functional groups direct neural stem cell linage behaviours

International Nuclear Information System (INIS)

Yao, Shenglian; Liu, Xi; He, Jin; Wang, Xiumei; Wang, Ying; Cui, Fu-Zhai

2016-01-01

Neural stem cells (NSCs) have been a promising candidate for stem cell-based nerve tissue regeneration. Therefore, the design of idea biomaterials that deliver precise regulatory signals to control stem cell fate is currently a crucial issue that depends on a profound understanding of the interactions between NSCs with the surrounding micro-environment. In this work, self-assembled monolayers of alkanethiols on gold with different chemical groups, including hydroxyl (−OH), amino (−NH 2 ), carboxyl (−COOH) and methyl (−CH 3 ), were used as a simple model to study the effects of surface chemistry on NSC fate decisions. Contact angle measurement and x-ray photoelectron spectroscopy (XPS) examination implied that all types of alkanethiols self-assembled on gold into a close-packed phase structure with similar molecular densities. In this study, we evaluated NSC adhesion, migration and differentiation in response to different chemical functional groups cultured under serum-free conditions. Our studies showed that NSCs exhibited certain phenotypes with extreme sensitivity to surface chemical groups. Compared with other functional groups, the SAMs with hydroxyl end-groups provided the best micro-environment in promoting NSC migration and maintaining an undifferentiated or neuronal differentiation state.  −NH 2 surfaces directed neural stem cells into astrocytic lineages, while NSCs on  −COOH and  −CH 3 surfaces had a similar potency to differentiate into three nerve lineages. To further investigate the possible signaling pathway, the gene expression of integrin β1 and β4 were examined. The results indicated that a high expression of β1 integrin would probably have a tight correlation with the expression of nestin, which implied the stemness of NSCs, while β4 integrin seemed to correspond to the differentiated NSCs. The results presented here give useful information for the future design of biomaterials to regulate the preservation

How Cultural Differences Affect Written and Oral Communication: The Case of Peer Response Groups.

Science.gov (United States)

Nelson, Gayle L.

1997-01-01

Peer response groups contribute to students' effectiveness as writers in any field, but cultural differences in communication affect interactions within the group. Culture-based dimensions on which communication may differ include individualism/collectivism, power distance, concept of "face," and communication style. Recommendations are…

The neural response properties and cortical organization of a rapidly adapting muscle sensory group response that overlaps with the frequencies that elicit the kinesthetic illusion.

Science.gov (United States)

Marasco, Paul D; Bourbeau, Dennis J; Shell, Courtney E; Granja-Vazquez, Rafael; Ina, Jason G

2017-01-01

Kinesthesia is the sense of limb movement. It is fundamental to efficient motor control, yet its neurophysiological components remain poorly understood. The contributions of primary muscle spindles and cutaneous afferents to the kinesthetic sense have been well studied; however, potential contributions from muscle sensory group responses that are different than the muscle spindles have not been ruled out. Electrophysiological recordings in peripheral nerves and brains of male Sprague Dawley rats with a degloved forelimb preparation provide evidence of a rapidly adapting muscle sensory group response that overlaps with vibratory inputs known to generate illusionary perceptions of limb movement in humans (kinesthetic illusion). This group was characteristically distinct from type Ia muscle spindle fibers, the receptor historically attributed to limb movement sensation, suggesting that type Ia muscle spindle fibers may not be the sole carrier of kinesthetic information. The sensory-neural structure of muscles is complex and there are a number of possible sources for this response group; with Golgi tendon organs being the most likely candidate. The rapidly adapting muscle sensory group response projected to proprioceptive brain regions, the rodent homolog of cortical area 3a and the second somatosensory area (S2), with similar adaption and frequency response profiles between the brain and peripheral nerves. Their representational organization was muscle-specific (myocentric) and magnified for proximal and multi-articulate limb joints. Projection to proprioceptive brain areas, myocentric representational magnification of muscles prone to movement error, overlap with illusionary vibrational input, and resonant frequencies of volitional motor unit contraction suggest that this group response may be involved with limb movement processing.

Group or ungroup - moose behavioural response to recolonization of wolves.

Science.gov (United States)

Månsson, Johan; Prima, Marie-Caroline; Nicholson, Kerry L; Wikenros, Camilla; Sand, Håkan

2017-01-01

Predation risk is a primary motivator for prey to congregate in larger groups. A large group can be beneficial to detect predators, share predation risk among individuals and cause confusion for an attacking predator. However, forming large groups also has disadvantages like higher detection and attack rates of predators or interspecific competition. With the current recolonization of wolves ( Canis lupus ) in Scandinavia, we studied whether moose ( Alces alces ) respond by changing grouping behaviour as an anti-predatory strategy and that this change should be related to the duration of wolf presence within the local moose population. In particular, as females with calves are most vulnerable to predation risk, they should be more likely to alter behaviour. To study grouping behaviour, we used aerial observations of moose ( n  = 1335, where each observation included one or several moose) inside and outside wolf territories. Moose mostly stayed solitary or in small groups (82% of the observations consisted of less than three adult moose), and this behavior was independent of wolf presence. The results did not provide unequivocal support for our main hypothesis of an overall change in grouping behaviour in the moose population in response to wolf presence. Other variables such as moose density, snow depth and adult sex ratio of the group were overall more influential on grouping behaviour. However, the results showed a sex specific difference in social grouping in relation to wolf presence where males tended to form larger groups inside as compared to outside wolf territories. For male moose, population- and environmentally related variables were also important for the pattern of grouping. The results did not give support for that wolf recolonization has resulted in an overall change in moose grouping behaviour. If indeed wolf-induced effects do exist, they may be difficult to discern because the effects from moose population and environmental factors may be

Acidic surface functional groups and mineral elements in Lakra coal (Sindh, Pakistan)

International Nuclear Information System (INIS)

Saeed, K.; Ishaq, M.; Ahjmad, I.; Shakirullah, M.; Haider, S.

2010-01-01

Surface acidity of virgin coal (Lakra Sindh, Pakistan) and variously extracted/leached coal samples with HNO/sub 3/ NaOH, and KMnO/sub 4/, were investigated by aqueous potentiometric titration employing KOH as a titrant. The titration curve of virgin coal showed that its surface might contain carboxylic, carbonyl, phenolic and other weak acidic functional groups such as enols and C-H bond. The titration curves of leached coal samples showed inflections at pH 4-11, being not similar the inflections of carboxylic groups. This inflection might be given by functional groups like CO/sub 2/, phenolic, enols and C-H. Mineral matter such as Fe, K, Zn, Mn and Ni were determined in the ash of coal by atomic absorption spectrophotometer and was found that Fe (3104 micro g/g) in the highest and Ni (36.05 micro g/g) in the lowest quantity is present in virgin coal sample. (author)

BDNF genotype interacts with motor-function to influence rehabilitation responsiveness post-stroke

Directory of Open Access Journals (Sweden)

Christine T Shiner

2016-05-01

Full Text Available Background. Persistent motor impairment is common but highly heterogeneous post-stroke. Genetic polymorphisms, including those identified on the brain derived neurotrophic factor (BDNF and apolipoprotein E (APOE genes, may contribute to this variability by limiting the capacity for use-dependent neuroplasticity, and hence rehabilitation responsiveness.Objective. To determine whether BDNF and APOE genotypes influence motor improvement facilitated by post-stroke upper-limb rehabilitation. Methods. BDNF Val66Met and APOE isoform genotypes were determined using leukocyte DNA for 55 community-dwelling patients 2-123 months post-stroke. All patients completed a dose-matched upper-limb rehabilitation program of either Wii-based Movement Therapy or Constraint-induced Movement Therapy. Upper-limb motor-function was assessed pre- and post-therapy using a suite of functional measures. Results. Motor-function improved for all patients post-therapy, with no difference between therapy groups. In the pooled data, there was no significant effect of BDNF or APOE genotype on motor-function at baseline, or following the intervention. However, a significant interaction between the level of residual motor-function and BDNF genotype was identified (p=0.029, whereby post-therapy improvement was significantly less for Met allele carriers with moderate and high, but not low motor-function. There was no significant association between APOE genotype and therapy outcomes. Conclusions. This study identified a novel interaction between the BDNF Val66Met polymorphism, motor-function status and the magnitude of improvement with rehabilitation in chronic stroke. This polymorphism does not preclude, but may reduce, the magnitude of motor improvement with therapy, particularly for patients with higher but not lower residual motor-function. BDNF genotype should be considered in the design and interpretation of clinical trials.

Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

Science.gov (United States)

Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

2016-07-01

A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The transfer function model for dynamic response of wet cooling coils

International Nuclear Information System (INIS)

Yao Ye; Liu Shiqing

2008-01-01

This paper mainly concerned about the dynamic response model of wet cooling coils that is developed by the Laplace transform method. The theoretic equations are firstly established based on the theory of energy conservation. Then, the transfer functions on the transient responses of wet cooling coils have been deduced using the method of Laplace transform. The transfer functions reveal the dynamic relationships between the inlet variables and the outlet ones of the cooling coils. Partial-fraction method and Newton-Raphson method are both used in the inversion of the transfer functions from the s-domain to τ-domain. To make the dynamic model of wet cooling coils more adaptive, RBFNN method is employed to determine the coefficients of heat and mass transfer. Experiments have been done and manifested that the coefficients of heat and mass transfer by RBFNN will be of great value to the validity of the transient response model of wet cooling coils in this study

Functional renormalization group approach to the Yang-Lee edge singularity

Energy Technology Data Exchange (ETDEWEB)

An, X. [Department of Physics, University of Illinois at Chicago,845 W. Taylor St., Chicago, IL 60607 (United States); Mesterházy, D. [Albert Einstein Center for Fundamental Physics, University of Bern,Sidlerstrasse 5, 3012 Bern (Switzerland); Stephanov, M.A. [Department of Physics, University of Illinois at Chicago,845 W. Taylor St., Chicago, IL 60607 (United States)

2016-07-08

We determine the scaling properties of the Yang-Lee edge singularity as described by a one-component scalar field theory with imaginary cubic coupling, using the nonperturbative functional renormalization group in 3≤d≤6 Euclidean dimensions. We find very good agreement with high-temperature series data in d=3 dimensions and compare our results to recent estimates of critical exponents obtained with the four-loop ϵ=6−d expansion and the conformal bootstrap. The relevance of operator insertions at the corresponding fixed point of the RG β functions is discussed and we estimate the error associated with O(∂{sup 4}) truncations of the scale-dependent effective action.

Effects of Surface Charge and Functional Groups on the Adsorption and Binding Forms of Cu and Cd on Roots of indica and japonica Rice Cultivars

Directory of Open Access Journals (Sweden)

Zhao-Dong Liu

2017-08-01

Full Text Available This work was designed to understand the mechanisms of adsorption of copper (Cu and cadmium (Cd on roots of indica and japonica varieties of rice. Six varieties each of indica and japonica rice were grown in hydroponics and the chemical properties of the root surface were analyzed, including surface charges and functional groups (-COO- groups as measured by the streaming potential and attenuated total reflectance-Fourier transform infrared spectroscopy (ATR-FTIR. Binding forms of heavy metals adsorbed on rice roots were identified using sequential extraction methods. In rice roots exposed to Cu and Cd solutions, Cu existed mainly in both exchangeable and complexed forms, whereas Cd existed mainly in the exchangeable form. The amounts of exchangeable Cu and Cd and total adsorbed metal cations on the roots of indica varieties were significantly greater than those on the roots of japonica varieties, and the higher negative charges and the larger number of functional groups on the roots of indica varieties were responsible for their higher adsorption capacity and greater binding strength for Cu and Cd. Surface charge and functional groups on roots play an important role in the adsorption of Cu and Cd on the rice roots.

The Effect of Functional Roles on Group Efficiency : Using Multilevel Modeling and Content Analysis to Investigate Computer-Supported Collaboration in Small Groups

NARCIS (Netherlands)

Strijbos, J.W.; Martens, R.L.; Jochems, W.M.G.; Broers, N.J.

2004-01-01

The usefulness of roles to support small group performance can often be read; however, their effect is rarely empirically assessed. This article reports the effects of functional roles on group performance, efficiency, and collaboration during computer-supported collaborative learning. A comparison

Thermal regulation of functional groups in running water ecosystems. Progress report, October 1, 1975--June 30, 1976

Energy Technology Data Exchange (ETDEWEB)

Cummins, K.W.; Klug, M.J.

1976-07-01

Progress is reported on the following research projects: characterization of functional groups of running water organisms, particularly macroconsumers; studies on relationship of functional groups to qualitative and quantitative characteristics of organic inputs to stream ecosystems; studies on relationship of functional groups to thermal regimes; and dimensioning the control of feeding and growth by temperature and food quality and quantity and determining the extent of compensatory action of each. (HLW)

Functional Associations by Response Overlap (FARO), a functional genomics approach matching gene expression phenotypes

DEFF Research Database (Denmark)

Nielsen, Henrik Bjørn; Mundy, J.; Willenbrock, Hanni

2007-01-01

The systematic comparison of transcriptional responses of organisms is a powerful tool in functional genomics. For example, mutants may be characterized by comparing their transcript profiles to those obtained in other experiments querying the effects on gene expression of many experimental facto...

Final technical report. Can microbial functional traits predict the response and resilience of decomposition to global change?

Energy Technology Data Exchange (ETDEWEB)

Allison, Steven D. [Univ. of California, Irvine, CA (United States)

2015-09-24

The role of specific micro-organisms in the carbon cycle, and their responses to environmental change, are unknown in most ecosystems. This knowledge gap limits scientists’ ability to predict how important ecosystem processes, like soil carbon storage and loss, will change with climate and other environmental factors. The investigators addressed this knowledge gap by transplanting microbial communities from different environments into new environments and measuring the response of community composition and carbon cycling over time. Using state-of-the-art sequencing techniques, computational tools, and nanotechnology, the investigators showed that microbial communities on decomposing plant material shift dramatically with natural and experimentally-imposed drought. Microbial communities also shifted in response to added nitrogen, but the effects were smaller. These changes had implications for carbon cycling, with lower rates of carbon loss under drought conditions, and changes in the efficiency of decomposition with nitrogen addition. Even when transplanted into the same conditions, microbial communities from different environments remained distinct in composition and functioning for up to one year. Changes in functioning were related to differences in enzyme gene content across different microbial groups. Computational approaches developed for this project allowed the conclusions to be tested more broadly in other ecosystems, and new computer models will facilitate the prediction of microbial traits and functioning across environments. The data and models resulting from this project benefit the public by improving the ability to predict how microbial communities and carbon cycling functions respond to climate change, nutrient enrichment, and other large-scale environmental changes.

Decreased prefrontal functional brain response during memory testing in women with Cushing's syndrome in remission.

Science.gov (United States)

Ragnarsson, Oskar; Stomby, Andreas; Dahlqvist, Per; Evang, Johan A; Ryberg, Mats; Olsson, Tommy; Bollerslev, Jens; Nyberg, Lars; Johannsson, Gudmundur

2017-08-01

Neurocognitive dysfunction is an important feature of Cushing's syndrome (CS). Our hypothesis was that patients with CS in remission have decreased functional brain responses in the prefrontal cortex and hippocampus during memory testing. In this cross-sectional study we included 19 women previously treated for CS and 19 controls matched for age, gender, and education. The median remission time was 7 (IQR 6-10) years. Brain activity was studied with functional magnetic resonance imaging during episodic- and working-memory tasks. The primary regions of interest were the prefrontal cortex and the hippocampus. A voxel-wise comparison of functional brain responses in patients and controls was performed. During episodic-memory encoding, patients displayed lower functional brain responses in the left and right prefrontal gyrus (pright inferior occipital gyrus (pbrain responses in the left posterior hippocampus in patients (p=0.05). During episodic-memory retrieval, the patients displayed lower functional brain responses in several brain areas with the most predominant difference in the right prefrontal cortex (pbrain response during a more complex working memory task compared with a simpler one. In conclusion, women with CS in long-term remission have reduced functional brain responses during episodic and working memory testing. This observation extends previous findings showing long-term adverse effects of severe hypercortisolaemia on brain function. Copyright © 2017 Elsevier Ltd. All rights reserved.

Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with covalently-bound hexafluoroisopropanol groups

Energy Technology Data Exchange (ETDEWEB)

Fifield, Leonard S.; Grate, Jay W.

2010-06-01

Fluorinated hydrogen-bond acidic groups are directly attached to the backbone of single walled carbon nanotubes (SWCNTs) without the introduction of intermediate electron donating surface groups. Hexafluoroalcohol functional groups are exceptionally strong hydrogen bond acids, and are added to the nanotube surface using the aryl diazonium approach to create hydrogen-bond acidic carbon nanotube (CNT) surfaces. These groups can promote strong hydrogen-bonding interactions with matrix materials in composites or with molecular species to be concentrated and sensed. In the latter case, this newly developed material is expected to find useful application in chemical sensors and in CNT-based preconcentrator devices for the detection of pesticides, chemical warfare agents and explosives.

Multidisciplinary team functioning.

Science.gov (United States)

Kovitz, K E; Dougan, P; Riese, R; Brummitt, J R

1984-01-01

This paper advocates the need to move beyond interdisciplinary team composition as a minimum criterion for multidisciplinary functioning in child abuse treatment. Recent developments within the field reflect the practice of shared professional responsibility for detection, case management and treatment. Adherence to this particular model for intervention requires cooperative service planning and implementation as task related functions. Implicitly, this model also carries the potential to incorporate the supportive functioning essential to effective group process. However, explicit attention to the dynamics and process of small groups has been neglected in prescriptive accounts of multidisciplinary child abuse team organization. The present paper therefore focuses upon the maintenance and enhancement aspects of multidisciplinary group functioning. First, the development and philosophy of service for the Alberta Children's Hospital Child Abuse Program are reviewed. Second, composition of the team, it's mandate for service, and the population it serves are briefly described. Third, the conceptual framework within which the program functions is outlined. Strategies for effective group functioning are presented and the difficulties encountered with this model are highlighted. Finally, recommendations are offered for planning and implementing a multidisciplinary child abuse team and for maintaining its effective group functioning.

Functional significance of the electrocorticographic auditory responses in the premotor cortex

Directory of Open Access Journals (Sweden)

Kazuyo eTanji

2015-03-01

Full Text Available Other than well-known motor activities in the precentral gyrus, functional magnetic resonance imaging (fMRI studies have found that the ventral part of the precentral gyrus is activated in response to linguistic auditory stimuli. It has been proposed that the premotor cortex in the precentral gyrus is responsible for the comprehension of speech, but the precise function of this area is still debated because patients with frontal lesions that include the precentral gyrus do not exhibit disturbances in speech comprehension. We report on a patient who underwent resection of the tumor in the precentral gyrus with electrocorticographic recordings while she performed the verb generation task during awake brain craniotomy. Consistent with previous fMRI studies, high-gamma band auditory activity was observed in the precentral gyrus. Due to the location of the tumor, the patient underwent resection of the auditory responsive precentral area which resulted in the post-operative expression of a characteristic articulatory disturbance known as apraxia of speech (AOS. The language function of the patient was otherwise preserved and she exhibited intact comprehension of both spoken and written language. The present findings demonstrated that a lesion restricted to the ventral precentral gyrus is sufficient for the expression of AOS and suggest that the auditory-responsive area plays an important role in the execution of fluent speech rather than the comprehension of speech. These findings also confirm that the function of the premotor area is predominantly motor in nature and its sensory responses is more consistent with the ‘sensory theory of speech production’, in which it was proposed that sensory representations are used to guide motor-articulatory processes.

The AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response

Science.gov (United States)

Asano, Tomoya; Yasuda, Michiko; Nakashita, Hideo; Kimura, Makoto; Yamaguchi1, Kazuo

2008-01-01

Phytopathogenic Fusarium species produce the trichothecene family of phytotoxins, which function as a virulence factor during infection of plants. Trichothecenes are classifiable into four major groups by their chemical structures. Recently, the AtNFXL1 gene was reported as a type A trichothecene T-2 toxin-inducible gene. The AtNFXL1 gene encodes a putative transcription factor with similarity to the human transcription repressor NF-X1. The atnfxl1 mutant exhibited hypersensitivity phenotype to T-2 toxin but not to type B deoxynivalenol (DON) in comparison with wild type when Arabidopsis thaliana grew on agar medium containing trichothecenes. The absence or presence of a carbonyl group at the C8 position distinguishes type A and type B. Growth defect by another type A trichothecene diacetoxyscirpenol (DAS), was weakly enhanced in the atnfxl1 mutant. Diacetoxyscirpenol is distinguishable from T-2 toxin only by the absence of an isovaleryl group at the C8 position. Correspondingly, the AtNFXL1 promoter activity was apparently induced in T-2 toxin-treated and DAS-treated plants. In contrast, DON failed to induce the AtNFXL1 promoter activity. Consequently, the AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response in Arabidopsis. In addition, the C8 position of trichothecenes might be closely related to the function of AtNFXL1 gene. PMID:19704430

A Novel Group-Fused Sparse Partial Correlation Method for Simultaneous Estimation of Functional Networks in Group Comparison Studies.

Science.gov (United States)

Liang, Xiaoyun; Vaughan, David N; Connelly, Alan; Calamante, Fernando

2018-05-01

The conventional way to estimate functional networks is primarily based on Pearson correlation along with classic Fisher Z test. In general, networks are usually calculated at the individual-level and subsequently aggregated to obtain group-level networks. However, such estimated networks are inevitably affected by the inherent large inter-subject variability. A joint graphical model with Stability Selection (JGMSS) method was recently shown to effectively reduce inter-subject variability, mainly caused by confounding variations, by simultaneously estimating individual-level networks from a group. However, its benefits might be compromised when two groups are being compared, given that JGMSS is blinded to other groups when it is applied to estimate networks from a given group. We propose a novel method for robustly estimating networks from two groups by using group-fused multiple graphical-lasso combined with stability selection, named GMGLASS. Specifically, by simultaneously estimating similar within-group networks and between-group difference, it is possible to address inter-subject variability of estimated individual networks inherently related with existing methods such as Fisher Z test, and issues related to JGMSS ignoring between-group information in group comparisons. To evaluate the performance of GMGLASS in terms of a few key network metrics, as well as to compare with JGMSS and Fisher Z test, they are applied to both simulated and in vivo data. As a method aiming for group comparison studies, our study involves two groups for each case, i.e., normal control and patient groups; for in vivo data, we focus on a group of patients with right mesial temporal lobe epilepsy.

Exploring excited eigenstates of many-body systems using the functional renormalization group

Science.gov (United States)

Klöckner, Christian; Kennes, Dante Marvin; Karrasch, Christoph

2018-05-01

We introduce approximate, functional renormalization group based schemes to obtain correlation functions in pure excited eigenstates of large fermionic many-body systems at arbitrary energies. The algorithms are thoroughly benchmarked and their strengths and shortcomings are documented using a one-dimensional interacting tight-binding chain as a prototypical testbed. We study two "toy applications" from the world of Luttinger liquid physics: the survival of power laws in lowly excited states as well as the spectral function of high-energy "block" excitations, which feature several single-particle Fermi edges.

The neural response properties and cortical organization of a rapidly adapting muscle sensory group response that overlaps with the frequencies that elicit the kinesthetic illusion.

Directory of Open Access Journals (Sweden)

Paul D Marasco

Full Text Available Kinesthesia is the sense of limb movement. It is fundamental to efficient motor control, yet its neurophysiological components remain poorly understood. The contributions of primary muscle spindles and cutaneous afferents to the kinesthetic sense have been well studied; however, potential contributions from muscle sensory group responses that are different than the muscle spindles have not been ruled out. Electrophysiological recordings in peripheral nerves and brains of male Sprague Dawley rats with a degloved forelimb preparation provide evidence of a rapidly adapting muscle sensory group response that overlaps with vibratory inputs known to generate illusionary perceptions of limb movement in humans (kinesthetic illusion. This group was characteristically distinct from type Ia muscle spindle fibers, the receptor historically attributed to limb movement sensation, suggesting that type Ia muscle spindle fibers may not be the sole carrier of kinesthetic information. The sensory-neural structure of muscles is complex and there are a number of possible sources for this response group; with Golgi tendon organs being the most likely candidate. The rapidly adapting muscle sensory group response projected to proprioceptive brain regions, the rodent homolog of cortical area 3a and the second somatosensory area (S2, with similar adaption and frequency response profiles between the brain and peripheral nerves. Their representational organization was muscle-specific (myocentric and magnified for proximal and multi-articulate limb joints. Projection to proprioceptive brain areas, myocentric representational magnification of muscles prone to movement error, overlap with illusionary vibrational input, and resonant frequencies of volitional motor unit contraction suggest that this group response may be involved with limb movement processing.

Identification of bovine leukemia virus tax function associated with host cell transcription, signaling, stress response and immune response pathway by microarray-based gene expression analysis

Directory of Open Access Journals (Sweden)

Arainga Mariluz

2012-03-01

Full Text Available Abstract Background Bovine leukemia virus (BLV is associated with enzootic bovine leukosis and is closely related to human T-cell leukemia virus type I. The Tax protein of BLV is a transcriptional activator of viral replication and a key contributor to oncogenic potential. We previously identified interesting mutant forms of Tax with elevated (TaxD247G or reduced (TaxS240P transactivation effects on BLV replication and propagation. However, the effects of these mutations on functions other than transcriptional activation are unknown. In this study, to identify genes that play a role in the cascade of signal events regulated by wild-type and mutant Tax proteins, we used a large-scale host cell gene-profiling approach. Results Using a microarray containing approximately 18,400 human mRNA transcripts, we found several alterations after the expression of Tax proteins in genes involved in many cellular functions such as transcription, signal transduction, cell growth, apoptosis, stress response, and immune response, indicating that Tax protein has multiple biological effects on various cellular environments. We also found that TaxD247G strongly regulated more genes involved in transcription, signal transduction, and cell growth functions, contrary to TaxS240P, which regulated fewer genes. In addition, the expression of genes related to stress response significantly increased in the presence of TaxS240P as compared to wild-type Tax and TaxD247G. By contrast, the largest group of downregulated genes was related to immune response, and the majority of these genes belonged to the interferon family. However, no significant difference in the expression level of downregulated genes was observed among the Tax proteins. Finally, the expression of important cellular factors obtained from the human microarray results were validated at the RNA and protein levels by real-time quantitative reverse transcription-polymerase chain reaction and western blotting

Functional criteria for emergency response facilities. Technical report (final)

International Nuclear Information System (INIS)

1981-02-01

This report describes the facilities and systems to be used by nuclear power plant licensees to improve responses to emergency situations. The facilities include the Technical Support Center (TSC), Onsite Operational Support Center (OSC), and Nearsite Emergency Operations Facility (EOF), as well as a brief discussion of the emergency response function of the control room. The data systems described are the Safety Parameter Display System (SPDS) and Nuclear Data Link (NDL). Together, these facilities and systems make up the total Emergency Response Facilities (ERFs). Licensees should follow the guidance provided both in this report and in NUREG-0654 (FEMA-REP-1), Revision 1, for design and implementation of the ERFs

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

[Spatiotemporal succession of algae functional groups and the influence of environment change in a deep-water reservoir].

Science.gov (United States)

Lu, Jin-Suo; Hu, Ya-Pan

2013-07-01

Algae functional group has become an important theory and method of algae research in recent years. In order to explore the spatiotemporal succession of algae functional groups and the influence of environment change, water samples were collected in August, 2011 from a deep-water reservoir in Northwest China. The research combined the methods of on-line monitoring and laboratory analysis. The results showed that there were 10 functional groups of algae in the reservoir. They were designated as B, D, P, X1, X3, F, G, J, L(M) and MP. Wherein, the groups B, P, F, X1, MP, D and J were comparatively common functional groups, and the groups X3, G and L(M) were less common. The populations of groups B, D, P, X1 and X3 were larger than those of the others. Besides, the analysis of changes in the environment factors suggested that temperature was the most important factor influencing the spatiotemporal succession of algae functional groups. The strategy of algal growth followed the law: R/CR in spring --> CR/C in late spring and early summer C/CR/R/CS/S in late summer and early autumn --> CR/R in late autumn and winter. The purpose of this article is to provide theoretical support for water withdrawal safety in deep-water reservoirs.

Forest ecotone response to climate change: sensitivity to temperature response functional forms

Energy Technology Data Exchange (ETDEWEB)

Loehle, C. [National Council for Air and Stream Improvement, Naperville, IL (United States)

2000-10-01

Past simulation studies have been in general agreement that climatic change could have adverse effects on forests, including geographic range shrinkages, conversion to grassland, and catastrophic forest decline or dieback. Some other recent studies, however, concluded that this agreement is generally based on parabolic temperature response rather than functional responses or data, and may therefore exaggerate dieback effects. This paper proposes a new model of temperature response that is based on a trade-off between cold tolerance and growth rate. In this model, the growth rate increases at first, and then levels off with increasing growing degree-days. Species from more southern regions have a higher minimum temperature and a faster maximum height growth rate. It is argued that faster growth rates of southern types lead to their competitive superiority in warmer environments and that such temperature response should produce less dieback and slower rates of change than the more common parabolic response model. Theoretical justification of this model is provided, followed by application of the model to a simulated ecotone under a warming scenario. Results of the study based on the proposed asymptotic model showed no dieback and only a gradual ecotone movement north, suggesting that ecotone shifts will, in fact, take many hundreds to thousands of years, with the result that species will not face the risk of extinction. 56 refs., 1 tab., 8 figs.

Influence of intestinal early enteral nutrition therapy on intestinal barrier function and immune response of patients with radiation enteritis

International Nuclear Information System (INIS)

Liu Guohui; Kang Xin; Chen Gong; Wang Guangyi

2012-01-01

Objective: To investigate the influence of early enteral nutrition therapy on the intestinal barrier function and immune response of the patients with radiation enteritis (ER) so as to find a relatively simple and effective method to treat RE. Methods: Fifty-six patients with radiation enteritis (RE) diagnosed by colonoscopy, X-rays, and pathology were randomly divided into 2 equal groups: experimental group undergoing enteral nutrition therapy, and control group undergoing conventional therapy only. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Five cases from the experimental group and 5 cases from the control group underwent second-time operation because of incomplete intestinal obstruction, intestinal stenosis, or recurrent tumor respectively. The biopsy specimens of the terminal ileum or distal descending colon taken during the first and second operations underwent pathological examination. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Results: There were no significant differences in the intestinal function and blood immunological indices between these 2 groups. The levels of DAO, D-lactic acid, and endotoxin,and the L/M ratio 11 days after admission of the experiment group were all significantly lower than those of the control group (t=2.568, 2.427, 2.143, 2.443, P<0.05), and all those indices 21 days after admission of the experiment group were all much more significantly lower in comparison with the control group (t=6.019, 12.834, 7.837, 7.997, P<0.01). The levels of IgG, IgM, and IgA, and CD4/CD8 ratio 11 days after admission of the experimental group were all significantly higher than

The spin polarized linear response from density functional theory: Theory and application to atoms

Energy Technology Data Exchange (ETDEWEB)

Fias, Stijn, E-mail: sfias@vub.ac.be; Boisdenghien, Zino; De Proft, Frank; Geerlings, Paul [General Chemistry (ALGC), Vrije Universiteit Brussel (Free University Brussels – VUB), Pleinlaan 2, 1050 Brussels (Belgium)

2014-11-14

Within the context of spin polarized conceptual density functional theory, the spin polarized linear response functions are introduced both in the [N, N{sub s}] and [N{sub α}, N{sub β}] representations. The mathematical relations between the spin polarized linear response functions in both representations are examined and an analytical expression for the spin polarized linear response functions in the [N{sub α}, N{sub β}] representation is derived. The spin polarized linear response functions were calculated for all atoms up to and including argon. To simplify the plotting of our results, we integrated χ(r, r′) to a quantity χ(r, r{sup ′}), circumventing the θ and ϕ dependence. This allows us to plot and to investigate the periodicity throughout the first three rows in the periodic table within the two different representations. For the first time, χ{sub αβ}(r, r{sup ′}), χ{sub βα}(r, r{sup ′}), and χ{sub SS}(r, r{sup ′}) plots have been calculated and discussed. By integration of the spin polarized linear response functions, different components to the polarisability, α{sub αα}, α{sub αβ}, α{sub βα}, and α{sub ββ} have been calculated.

Response function of a moving contact line

Science.gov (United States)

Perrin, H.; Belardinelli, D.; Sbragaglia, M.; Andreotti, B.

2018-04-01

The hydrodynamics of a liquid-vapor interface in contact with a heterogeneous surface is largely impacted by the presence of defects at the smaller scales. Such defects introduce morphological disturbances on the contact line and ultimately determine the force exerted on the wedge of liquid in contact with the surface. From the mathematical point of view, defects introduce perturbation modes, whose space-time evolution is governed by the interfacial hydrodynamic equations of the contact line. In this paper we derive the response function of the contact line to such generic perturbations. The contact line response may be used to design simplified one-dimensional time-dependent models accounting for the complexity of interfacial flows coupled to nanoscale defects, yet offering a more tractable mathematical framework to explore contact line motion through a disordered energy landscape.

Differences in functional activity between boys with pure oppositional defiant disorder and controls during a response inhibition task: a preliminary study.

Science.gov (United States)

Zhu, Yan; Ying, Kui; Wang, Ji; Su, Linyan; Chen, Jingyuan; Lin, Fan; Cai, Dongyang; Zhou, Ming; Wu, Daxing; Guo, Courtney; Wang, Shi

2014-12-01

Functional Magnetic Resonance Imaging (fMRI) of inhibitory control has only been investigated in patients with attention deficit hyperactivity disorder (ADHD) and conduct disorder (CD). The objective of this study was to investigate the differences of functional areas associated with inhibitory control between boys with pure oppositional defiant disorder (ODD) and controls during a response inhibition task using functional magnetic resonance imaging (fMRI). Eleven boys with pure ODD and ten control boys, aged 10 to 12, performed a GoStop response inhibition task in this study. The task has a series of "go" trials to establish a pre-potent response tendency and a number of "stop" trials to test subjects' ability to withhold their responses. During the GoStop task, greater activation in the dorsolateral parts of the bilateral inferior frontal gyrus, left middle frontal gyrus (lMFG) and right superior frontal gyrus (rSFG) activation was seen in the ODD boys. Additionally, reduced activation in regions of the right inferior frontal gyrus (rIFG) was seen in the ODD boys in comparison with the control group. The results may suggest that the higher activation in areas adjacent to the rIFG could be the cause of reduced activation in the rIFG; although this is speculative and requires additional supporting evidence. The findings further suggest that ODD is a less pronounced functional disorder compared to ADHD and CD.

Thermo-responsive cell culture carrier: Effects on macrophage functionality and detachment efficiency.

Science.gov (United States)

Rennert, Knut; Nitschke, Mirko; Wallert, Maria; Keune, Natalie; Raasch, Martin; Lorkowski, Stefan; Mosig, Alexander S

2017-01-01

Harvesting cultivated macrophages for tissue engineering purposes by enzymatic digestion of cell adhesion molecules can potentially result in unintended activation, altered function, or behavior of these cells. Thermo-responsive polymer is a promising tool that allows for gentle macrophage detachment without artificial activation prior to subculture within engineered tissue constructs. We therefore characterized different species of thermo-responsive polymers for their suitability as cell substrate and to mediate gentle macrophage detachment by temperature shift. Primary human monocyte- and THP-1-derived macrophages were cultured on thermo-responsive polymers and characterized for phagocytosis and cytokine secretion in response to lipopolysaccharide stimulation. We found that both cell types differentially respond in dependence of culture and stimulation on thermo-responsive polymers. In contrast to THP-1 macrophages, primary monocyte-derived macrophages showed no signs of impaired viability, artificial activation, or altered functionality due to culture on thermo-responsive polymers compared to conventional cell culture. Our study demonstrates that along with commercially available UpCell carriers, two other thermo-responsive polymers based on poly(vinyl methyl ether) blends are attractive candidates for differentiation and gentle detachment of primary monocyte-derived macrophages. In summary, we observed similar functionality and viability of primary monocyte-derived macrophages cultured on thermo-responsive polymers compared to standard cell culture surfaces. While this first generation of custom-made thermo-responsive polymers does not yet outperform standard culture approaches, our results are very promising and provide the basis for exploiting the unique advantages offered by custom-made thermo-responsive polymers to further improve macrophage culture and recovery in the future, including the covalent binding of signaling molecules and the reduction of

A new approach to evaluate the response functions for conical and cylindrical collimators

International Nuclear Information System (INIS)

Gigante, G.E.

1989-01-01

A new approach to the evaluation of the conical collimator response function is shown. The basic collimator formulae are reviewed. The collimator response function has been found in a very easy way. An approximate solution has been introduced. Studying the response of a measuring system, the use of this approximation strongly reduces the complexity of the relations to be used; therefore it would provide a useful starting point for a Monte Carlo calculation. The errors introduced are less than 10%. Approximate relations that allow the evaluation of the response of conical and cylindrical collimators to plane and line sources are also given. (orig.)

Community responses to communication campaigns for influenza A (H1N1: a focus group study