WorldWideScience

Sample records for group protein bmi-1

  1. Expression of Bmi-1 is a prognostic marker in bladder cancer

    Directory of Open Access Journals (Sweden)

    Xu Li-Hua

    2009-02-01

    Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.

  2. Expression of Bmi-1 is a prognostic marker in bladder cancer

    International Nuclear Information System (INIS)

    Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing

    2009-01-01

    The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer

  3. Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

    Directory of Open Access Journals (Sweden)

    Katarzyna Taran

    2016-02-01

    Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

  4. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  5. BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.

    Science.gov (United States)

    Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan

    2006-01-01

    Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.

  6. Attenuation of doxorubicin-induced cardiotoxicity by esculetin through modulation of Bmi-1 expression.

    Science.gov (United States)

    Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan

    2017-09-01

    The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.

  7. The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

    Science.gov (United States)

    Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

    2016-01-01

    The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

  8. BMI trajectory groups in veterans of the Iraq and Afghanistan wars.

    Science.gov (United States)

    Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally

    2011-09-01

    The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.

  9. Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.

    Directory of Open Access Journals (Sweden)

    Shunsuke Nakamura

    Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.

  10. Recombinant TAT-BMI-1 fusion protein induces ex vivo expansion of human umbilical cord blood-derived hematopoietic stem cells.

    Science.gov (United States)

    Codispoti, Bruna; Rinaldo, Nicola; Chiarella, Emanuela; Lupia, Michela; Spoleti, Cristina Barbara; Marafioti, Maria Grazia; Aloisio, Annamaria; Scicchitano, Stefania; Giordano, Marco; Nappo, Giovanna; Lucchino, Valeria; Moore, Malcolm A S; Zhou, Pengbo; Mesuraca, Maria; Bond, Heather Mandy; Morrone, Giovanni

    2017-07-04

    Transplantation of hematopoietic stem cells (HSCs) is a well-established therapeutic approach for numerous disorders. HSCs are typically derived from bone marrow or peripheral blood after cytokine-induced mobilization. Umbilical cord blood (CB) represents an appealing alternative HSC source, but the small amounts of the individual CB units have limited its applications. The availability of strategies for safe ex vivo expansion of CB-derived HSCs (CB-HSCs) may allow to extend the use of these cells in adult patients and to avoid the risk of insufficient engraftment or delayed hematopoietic recovery.Here we describe a system for the ex vivo expansion of CB-HSCs based on their transient exposure to a recombinant TAT-BMI-1 chimeric protein. BMI-1 belongs to the Polycomb family of epigenetic modifiers and is recognized as a central regulator of HSC self-renewal. Recombinant TAT-BMI-1 produced in bacteria was able to enter the target cells via the HIV TAT-derived protein transduction peptide covalently attached to BMI-1, and conserved its biological activity. Treatment of CB-CD34+ cells for 3 days with repeated addition of 10 nM purified TAT-BMI-1 significantly enhanced total cell expansion as well as that of primitive hematopoietic progenitors in culture. Importantly, TAT-BMI-1-treated CB-CD34+ cells displayed a consistently higher rate of multi-lineage long-term repopulating activity in primary and secondary xenotransplants in immunocompromised mice. Thus, recombinant TAT-BMI-1 may represent a novel, effective reagent for ex vivo expansion of CB-HSC for therapeutic purposes.

  11. Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency

    Directory of Open Access Journals (Sweden)

    Anthony Flamier

    2018-05-01

    Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.

  12. The Role of BMI1 in CRPC

    Science.gov (United States)

    2016-10-01

    we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

  13. Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua

    2010-01-01

    Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis

  14. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  15. Bmi-1: At the crossroads of physiological and pathological biology

    Science.gov (United States)

    Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar

    2015-01-01

    Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339

  16. Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion

    Directory of Open Access Journals (Sweden)

    Lowell Evan Michael

    2008-12-01

    Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.

  17. BMI-1, a promising therapeutic target for human cancer

    Science.gov (United States)

    WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN

    2015-01-01

    BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537

  18. Reciprocal expression of Bmi1 and Mel-18 is associated with functioning of primitive hematopoietic cells.

    Science.gov (United States)

    Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao

    2009-07-01

    The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.

  19. Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

    Science.gov (United States)

    Lu, You-Wei; Li, Jin; Guo, Wei-Jian

    2010-11-08

    The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

  20. miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

    2015-01-02

    Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

  1. EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer

    NARCIS (Netherlands)

    Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten

    2008-01-01

    Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that

  2. Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.

    Science.gov (United States)

    Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio

    2015-10-26

    The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in

  3. Analysis list: BMI1 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie

  4. Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

    Science.gov (United States)

    Liu, Jiaguo; Luo, Bin; Zhao, Meng

    2017-01-01

    Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

  5. Expression of Bmi-1, P16, and CD44v6 in Uterine Cervical Carcinoma and Its Clinical Significance

    International Nuclear Information System (INIS)

    Weng, Mei-ying; Li, Lin; Feng, Shu-ying; Hong, Shun-jia

    2012-01-01

    Bmi-1, a putative proto-oncogene, is a core member of the polycomb gene family, which is expressed in many human tumors. The p16 protein negatively regulated cell proliferation, whereas CD44v6 is associated with proliferation as an important protein. Additionally, CD44v6 is an important nuclear antigen closely correlated to tumor metastasis. The present study aims to investigate the expression and significance of Bmi-1, p16, and CD44v6 in uterine cervical carcinoma (UCC). A total of 62 UCC, 30 cervical neoplasic, and 20 normal cervical mucosal tissues were used in the current study. The expression of Bmi-1, p16, and CD44v6 in these tissues was determined using immunohistochemical assay. The relationships among the expression of these indices, the clinicopathologic features of UCC, and the survival rate of UCC patients were also discussed. The correlation between Bmi-1 protein expression and p16 or CD44v6 protein in UCC was analyzed. The expression of Bmi-1, p16, and CD44v6 was significantly high in cervical carcinoma compared with that in the cervical neoplasia and normal colorectal mucosa (P<0.05). The over-expression of Bmi-1 protein in UCC was apparently related to the distant metastasis (P<0.01) and the tumor, nodes and metastasis-classification, i.e. the TNM staging, World Health Organization (P<0.05). Nevertheless, the positive expression of p16 protein in UCC was not significantly associated with the clinicopathologic features (P>0.05). The Kaplan–Meier survival analysis showed that the over-expression of Bmi-1 significantly decreased the survival rate of UCC patients (P<0.05). A strong correlation indicated that there was statistical significance between the expression of Bmi-1 and CD44V6 proteins in UCC (r=0.419, P=0.001). The over-expression of Bmi-1 and CD44v6 protein closely correlate to the tumorigenesis, metastasis, and prognosis of UCC. Bmi-1 and CD44v6 may be used to predict the prognosis of cervical carcinoma. Bmi-1 may indirectly regulate the

  6. Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.

    Science.gov (United States)

    Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K

    2010-12-16

    Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared

  7. PPARγ gene polymorphism, C-reactive protein level, BMI and periodontitis in post-menopausal Japanese women.

    Science.gov (United States)

    Wang, Yangming; Sugita, Noriko; Yoshihara, Akihiro; Iwasaki, Masanori; Miyazaki, Hideo; Nakamura, Kazutoshi; Yoshie, Hiromasa

    2016-03-01

    Several studies have reported inconsistent results regarding the association between the PPARγPro12Ala polymorphism and obesity. Obese individuals had higher C-reactive protein (CRP) levels compared with those of normal weight, and PPARγ activation could significantly reduce serum high-sensitive CRP level. We have previously suggested that the Pro12Ala polymorphism represents a susceptibility factor for periodontitis, which is a known risk factor for increased CRP level. The aim was to investigate associations between PPARγ gene polymorphism, serum CRP level, BMI and/or periodontitis among post-menopausal Japanese women. The final sample in this study comprised 359 post-menopausal Japanese women. Periodontal parameters, including PD, CAL and BOP, were measured per tooth. PPARγPro12Ala genotype was determined by PCR-RFLP. Hs-CRP value was measured by a latex nephelometry assay. No significant differences in age, BMI or periodontal parameters were found between the genotypes. The percentages of sites with PD ≥ 4 mm were significantly higher among the hsCRP ≥ 1 mg/l group than the hsCRP periodontitis, serum CRP level or BMI in post-menopausal Japanese women. However, serum hsCRP level correlated with periodontitis in Ala allele carriers, and with BMI in non-carriers. © 2014 John Wiley & Sons A/S and The Gerodontology Society. Published by John Wiley & Sons Ltd.

  8. BMI-1 suppression increases the radiosensitivity of oesophageal carcinoma via the PI3K/Akt signaling pathway.

    Science.gov (United States)

    Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai

    2018-02-01

    B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of

  9. Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.

    Science.gov (United States)

    Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori

    2017-04-01

    We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  10. Overexpression of microRNA-132 enhances the radiosensitivity of cervical cancer cells by down-regulating Bmi-1.

    Science.gov (United States)

    Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan

    2017-10-06

    We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.

  11. Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.

    Science.gov (United States)

    Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S

    2018-01-01

    Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.

  12. The Role of BMI1 in CRPC

    Science.gov (United States)

    2017-10-01

    that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA

  13. Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

    Science.gov (United States)

    Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

    2017-12-01

    This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

  14. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Science.gov (United States)

    Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

    2015-01-01

    BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  15. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Directory of Open Access Journals (Sweden)

    Mehdi Hayat Shahi

    Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  16. [Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

    Science.gov (United States)

    Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

    2014-06-01

    To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

  17. Lineage specific expression of Polycomb Group Proteins in human embryonic stem cells in vitro.

    Science.gov (United States)

    Pethe, Prasad; Pursani, Varsha; Bhartiya, Deepa

    2015-05-01

    Human embryonic (hES) stem cells are an excellent model to study lineage specification and differentiation into various cell types. Differentiation necessitates repression of specific genes not required for a particular lineage. Polycomb Group (PcG) proteins are key histone modifiers, whose primary function is gene repression. PcG proteins form complexes called Polycomb Repressive Complexes (PRCs), which catalyze histone modifications such as H2AK119ub1, H3K27me3, and H3K9me3. PcG proteins play a crucial role during differentiation of stem cells. The expression of PcG transcripts during differentiation of hES cells into endoderm, mesoderm, and ectoderm lineage is yet to be shown. In-house derived hES cell line KIND1 was differentiated into endoderm, mesoderm, and ectoderm lineages; followed by characterization using RT-PCR for HNF4A, CDX2, MEF2C, TBX5, SOX1, and MAP2. qRT-PCR and western blotting was performed to compare expression of PcG transcripts and proteins across all the three lineages. We observed that cells differentiated into endoderm showed upregulation of RING1B, BMI1, EZH2, and EED transcripts. Mesoderm differentiation was characterized by significant downregulation of all PcG transcripts during later stages. BMI1 and RING1B were upregulated while EZH2, SUZ12, and EED remained low during ectoderm differentiation. Western blotting also showed distinct expression of BMI1 and EZH2 during differentiation into three germ layers. Our study shows that hES cells differentiating into endoderm, mesoderm, and ectoderm lineages show distinct PcG expression profile at transcript and protein level. © 2015 International Federation for Cell Biology.

  18. MicroRNA-128 suppresses paclitaxel-resistant lung cancer by inhibiting MUC1-C and BMI-1 in cancer stem cells.

    Science.gov (United States)

    Koh, Hyebin; Park, Hyeri; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Ghosh, Mrinmoy; Gera, Meeta; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Park, Yang Ho; Kwon, Taeho; Jeong, Dong Kee

    2017-12-15

    The existence of cancer stem cells (CSCs) is the main reason for failure of cancer treatment caused by drug resistance. Therefore, eradicating cancers by targeting CSCs remains a significant challenge. In the present study, because of the important role of BMI-1 proto-oncogene, polycomb ring finger (BMI-1) and C-terminal Mucin1 (MUC1-C) in tumor growth and maintenance of CSCs, we aimed to confirm that microRNA miR-128, as an inhibitor of BMI-1 and MUC1-C, could effectively suppress paclitaxel (PTX)-resistant lung cancer stem cells. We showed that CSCs have significantly higher expression levels of BMI-1, MUC1-C, stemness proteins, signaling factors, and higher malignancy compared with normal tumor cells. After transfection with miR-128, the BMI-1 and MUC1-C levels in CSCs were suppressed. When miR-128 was stably expressed in PTX-resistant lung cancer stem cells, the cells showed decreased proliferation, metastasis, self-renewal, migration, invasive ability, clonogenicity, and tumorigenicity in vitro and in vivo and increased apoptosis compared with miR-NC (negative control) CSCs. Furthermore, miR-128 effectively decreased the levels of β-catenin and intracellular signaling pathway-related factors in CSCs. MiR-128 also decreased the luciferase activity of MUC1 reporter constructs and reduced the levels of transmembrane MUC1-C and BMI-1. These results suggested miR-128 as an attractive therapeutic strategy for PTX-resistant lung cancer via inhibition of BMI-1 and MUC1-C.

  19. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  20. CD133 and BMI1 expressions and its prognostic role in primary ...

    Indian Academy of Sciences (India)

    This study aimed to analyse the expression of CD133 mRNA and its correlations ... CD133 mRNA and BMI1 protein expression could independently predict the glioblastoma .... treatment at the National Institute of Mental Health and Neu- .... Low. 16 (76.2). High. 53 mutations of which 38 were exonic and 15 were intronic.

  1. Sexual Orientation Disparities in BMI among US Adolescents and Young Adults in Three Race/Ethnicity Groups

    Directory of Open Access Journals (Sweden)

    Sabra L. Katz-Wise

    2014-01-01

    Full Text Available Obesity is a key public health issue for US youth. Previous research with primarily white samples of youth has indicated that sexual minority females have higher body mass index (BMI and sexual minority males have lower BMI than their same-gender heterosexual counterparts, with sexual orientation differences in males increasing across adolescence. This research explored whether gender and sexual orientation differences in BMI exist in nonwhite racial/ethnic groups. Using data from Waves I–IV (1995–2009 of the US National Longitudinal Study of Adolescent Health (N = 13,306, ages 11–34 years, we examined associations between sexual orientation and BMI (kg/m2 over time, using longitudinal linear regression models, stratified by gender and race/ethnicity. Data were analyzed in 2013. Among males, heterosexual individuals showed greater one-year BMI gains than gay males across all race/ethnicity groups. Among females, white and Latina bisexual individuals had higher BMI than same-race/ethnicity heterosexual individuals regardless of age; there were no sexual orientation differences in black/African Americans. Sexual orientation disparities in BMI are a public health concern across race/ethnicity groups. Interventions addressing unhealthy weight gain in youth must be relevant for all sexual orientations and race/ethnicities.

  2. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    International Nuclear Information System (INIS)

    Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng

    2012-01-01

    The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic

  3. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    Directory of Open Access Journals (Sweden)

    Jiang Lili

    2012-09-01

    Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF

  4. Lower C-reactive protein and IL-6 associated with vegetarian diets are mediated by BMI.

    Science.gov (United States)

    Jaceldo-Siegl, K; Haddad, E; Knutsen, S; Fan, J; Lloren, J; Bellinger, D; Fraser, G E

    2018-03-13

    The mechanism by which vegetarian diets are associated with less inflammation is not clear. We investigated the role of BMI as a mediator in the relationship between vegetarian diet and concentrations of C-reactive protein (CRP), and the cytokines IL-6, IL-10 and TNF-α. We used data from participants of the Adventist Health Study 2 (AHS-2) Calibration (n = 893) and Biological Manifestations of Religion (n = 478) sub-studies. Vegetarian diet variations were determined based on reported intake of animal products assessed by FFQ. Combining all participants, the proportion of non-vegetarians (NVs), partial vegetarians (PVs), lacto-ovo vegetarians (LOVs), and strict vegetarians (SVs) was 44%, 16%, 31%, and 9%, respectively. NV and PV participants were older than other dietary groups, and non-vegetarians had the highest BMI. Mediation analyses supported the mediating effect of BMI in associations of vegetarian diet with CRP (p vegetarian diet and the biomarkers IL-10 and TNF-α. A direct pathway was significant only in the association between strict vegetarians and CRP (p = 0.017). The lower CRP and IL-6 concentrations among vegetarians may be mediated by BMI. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

  5. Bmi-1 expression modulates non-small cell lung cancer progression

    Science.gov (United States)

    Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua

    2015-01-01

    Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371

  6. Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma

    International Nuclear Information System (INIS)

    Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S

    2014-01-01

    Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC

  7. Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

    NARCIS (Netherlands)

    Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

    2008-01-01

    Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

  8. Group-based developmental BMI trajectories, polycystic ovary syndrome, and gestational diabetes: a community-based longitudinal study.

    Science.gov (United States)

    Kakoly, Nadira Sultana; Earnest, Arul; Moran, Lisa J; Teede, Helena J; Joham, Anju E

    2017-11-06

    Obesity is common in young women, increasing insulin resistance (IR) and worsening pregnancy complications, including gestational diabetes (GDM). Women with polycystic ovary syndrome (PCOS) are commonly obese, which aggravates the severity of PCOS clinical expression. Relationships between these common insulin-resistant conditions, however, remain unclear. We conducted a secondary analysis of the Australian Longitudinal Study on Women's Health (ALSWH) database, including data from 8009 women aged 18-36 years across six surveys. We used latent-curve growth modelling to identify distinct body mass index (BMI) trajectories and multinomial logistic regression to explore sociodemographic and health variables characterizing BMI group membership. Logistic regression was used to assess independent risk of GDM. A total of 662 women (8.29%, 95% CI 7.68-8.89) reported PCOS. Three distinct BMI trajectories emerged, namely low stable (LSG) (63.8%), defined as an average trajectory remaining at ~25 kg/m 2 ; moderately rising (MRG) (28.8%), a curvilinear trajectory commencing in a healthy BMI and terminating in the overweight range; and high-rising (HRG) (7.4%), a curvilinear trajectory starting and terminating in the obese range. A high BMI in early reproductive life predicted membership in higher trajectories. The HRG BMI trajectory was independently associated with GDM (OR 2.50, 95% CI 1.80-3.48) and was a stronger correlate than PCOS (OR 1.89, 95% CI 1.41-2.54), maternal age, socioeconomic status, or parity. Our results suggest heterogeneity in BMI change among Australian women of reproductive age, with and without PCOS. Reducing early adult life weight represents an ideal opportunity to intervene at an early stage of reproductive life and decreases the risk of long-term metabolic complications such as GDM.

  9. [In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

    Science.gov (United States)

    Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

    2018-03-28

    To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

  10. Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

    Science.gov (United States)

    Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

    2016-01-01

    Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

  11. p38 MAPK-Mediated Bmi-1 Down-Regulation and Defective Proliferation in ATM-Deficient Neural Stem Cells Can Be Restored by Akt Activation

    Science.gov (United States)

    Kim, Jeesun; Hwangbo, Jeon; Wong, Paul K. Y.

    2011-01-01

    A-T (ataxia telangiectasia) is a genetic disease caused by a mutation in the Atm (A-T mutated) gene that leads to neurodegeneration. Despite an increase in the numbers of studies in this area in recent years, the mechanisms underlying neurodegeneration in human A-T are still poorly understood. Previous studies demonstrated that neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm -/- mouse brains show defective self-renewal and proliferation, which is accompanied by activation of chronic p38 mitogen-activated protein kinase (MAPK) and a lower level of the polycomb protein Bmi-1. However, the mechanism underlying Bmi-1 down-regulation and its relevance to defective proliferation in Atm-/- NSCs remained unclear. Here, we show that over-expression of Bmi-1 increases self-renewal and proliferation of Atm-/- NSCs to normal, indicating that defective proliferation in Atm-/- NSCs is a consequence of down-regulation of Bmi-1. We also demonstrate that epidermal growth factor (EGF)-induced Akt phosphorylation renders Bmi-1 resistant to the proteasomal degradation, leading to its stabilization and accumulation in the nucleus. However, inhibition of the Akt-dependent Bmi-1 stabilizing process by p38 MAPK signaling reduces the levels of Bmi-1. Treatment of the Atm-/- NSCs with a specific p38 MAPK inhibitor SB203580 extended Bmi-1 posttranscriptional turnover and H2A ubiquitination in Atm-/- NSCs. Our observations demonstrate the molecular basis underlying the impairment of self-renewal and proliferation in Atm-/- NSCs through the p38 MAPK-Akt-Bmi-1-p21 signaling pathway. PMID:21305053

  12. MK3 modulation affects BMI1-dependent and independent cell cycle check-points.

    Directory of Open Access Journals (Sweden)

    Peggy Prickaerts

    Full Text Available Although the MK3 gene was originally found deleted in some cancers, it is highly expressed in others. The relevance of MK3 for oncogenesis is currently not clear. We recently reported that MK3 controls ERK activity via a negative feedback mechanism. This prompted us to investigate a potential role for MK3 in cell proliferation. We here show that overexpression of MK3 induces a proliferative arrest in normal diploid human fibroblasts, characterized by enhanced expression of replication stress- and senescence-associated markers. Surprisingly, MK3 depletion evokes similar senescence characteristics in the fibroblast model. We previously identified MK3 as a binding partner of Polycomb Repressive Complex 1 (PRC1 proteins. In the current study we show that MK3 overexpression results in reduced cellular EZH2 levels and concomitant loss of epigenetic H3K27me3-marking and PRC1/chromatin-occupation at the CDKN2A/INK4A locus. In agreement with this, the PRC1 oncoprotein BMI1, but not the PCR2 protein EZH2, bypasses MK3-induced senescence in fibroblasts and suppresses P16INK4A expression. In contrast, BMI1 does not rescue the MK3 loss-of-function phenotype, suggesting the involvement of multiple different checkpoints in gain and loss of MK3 function. Notably, MK3 ablation enhances proliferation in two different cancer cells. Finally, the fibroblast model was used to evaluate the effect of potential tumorigenic MK3 driver-mutations on cell proliferation and M/SAPK signaling imbalance. Taken together, our findings support a role for MK3 in control of proliferation and replicative life-span, in part through concerted action with BMI1, and suggest that the effect of MK3 modulation or mutation on M/SAPK signaling and, ultimately, proliferation, is cell context-dependent.

  13. Neurodevelopmental problems and extremes in BMI

    Directory of Open Access Journals (Sweden)

    Nóra Kerekes

    2015-07-01

    Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than

  14. ERD-based online brain-machine interfaces (BMI) in the context of neurorehabilitation: optimizing BMI learning and performance.

    Science.gov (United States)

    Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G

    2011-10-01

    Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.

  15. BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.

    Science.gov (United States)

    Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian

    2010-02-21

    The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.

  16. Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis

    Science.gov (United States)

    Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin

    2014-01-01

    Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658

  17. BMI and BMI SDS in childhood: annual increments and conditional change

    OpenAIRE

    Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt

    2016-01-01

    Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...

  18. The associations of Bmi-1 with progression of glomerular chronic kidney disease
.

    Science.gov (United States)

    Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren

    2018-02-01

    Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings.
.

  19. Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients

    Directory of Open Access Journals (Sweden)

    Xiaodong Li

    2016-11-01

    Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.

  20. BMI and BMI SDS in childhood: annual increments and conditional change.

    Science.gov (United States)

    Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt

    2017-02-01

    Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.

  1. Associations of maternal macronutrient intake during pregnancy with infant BMI peak characteristics and childhood BMI.

    Science.gov (United States)

    Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng

    2017-03-01

    Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT

  2. Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.

  3. Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma

    Directory of Open Access Journals (Sweden)

    Sara Badodi

    2017-12-01

    Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin

  4. GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.

    Directory of Open Access Journals (Sweden)

    Bart A Westerman

    Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.

  5. The effect of obesity on inflammatory markers in patients with PCOS: a BMI-matched case-control study.

    Science.gov (United States)

    Keskin Kurt, Raziye; Okyay, Ayşe Güler; Hakverdi, Ali Ulvi; Gungoren, Arif; Dolapcioglu, Kenan Serdar; Karateke, Atilla; Dogan, Mustafa Ozcil

    2014-08-01

    Previous studies have shown increased inflammatory activity in patients with polycystic ovary syndrome (PCOS); however, it remains uncertain whether this increased inflammatory activity is a consequence of the disorder itself or of the accompanying obesity. We therefore aimed to test the inflammatory marker levels in obese and lean patients with PCOS by using two separate control groups with matching body mass index (BMI). A total of 120 women in reproductive age with (n = 62) and without (n = 60) PCOS were recruited for the study. Patients with PCOS were divided into two groups as obese (n = 32) and lean (n = 30) PCOS groups according to BMI. Two BMI-matched control groups were created. Furthermore, high sensitive CRP protein (hsCRP), neutrophils, lymphocytes, white blood cell count (WBC) and neutrophil to lymphocyte ratio (NLR) were evaluated with complete blood count. The hsCRP (5.5 ± 0.8 vs. 3.1 ± 0.7, p PCOS compared to the control group while lymphocyte count was lower (1.71 ± 0.65 vs. 1.98 ± 0.39, p = 0.008). Similarly, both obese and lean patients with PCOS had higher levels of hsCRP, neutrophils, leukocytes and NLR ratios compared to BMI-matched controls. The correlation analysis revealed a moderate correlation between NLR and hsCRP (r 0.459, p lean and obese patients with PCOS have increased inflammatory markers compared to BMI-matched control groups indicating that the inflammation seen in PCOS might be related with the presence of the disorder rather than with obesity.

  6. File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

  7. File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

  8. File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

  9. File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

  10. BMI and Lifetime Changes in BMI and Cancer Mortality Risk

    Science.gov (United States)

    Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.

    2015-01-01

    Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129

  11. Community-Specific BMI Cutoff Points for South Indian Females

    Directory of Open Access Journals (Sweden)

    K. B. Kishore Mohan

    2011-01-01

    Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.

  12. Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?

    Science.gov (United States)

    Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J

    2017-05-01

    We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.

  13. MiR-218-targeting-Bmi-1 mediates the suppressive effect of 1,6,7-trihydroxyxanthone on liver cancer cells.

    Science.gov (United States)

    Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang

    2015-01-01

    Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.

  14. File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

  15. File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

  16. File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

  17. File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

  18. The Predictive Factors for Diabetic Remission in Chinese Patients with BMI > 30 kg/m2 and BMI < 30 kg/m2 Are Different.

    Science.gov (United States)

    Liang, Hui; Cao, Qing; Liu, Huan; Guan, Wei; Wong, Claudia; Tong, Daniel

    2018-01-15

    Roux-en-Y gastric bypass has been proven to be beneficial for patients with obesity and type 2 diabetes mellitus (T2DM). In less-obese patient (BMI 30-35 kg/m 2 ), surgical treatment is indicated when medication fails to control the T2DM. Asian develops diabetes at a lower BMI. For lower-BMI patients, the rate of diabetes amelioration varies significantly with patients of higher BMI after surgical treatment. The factors that contribute to the post-operative diabetes response rate in lower-BMI patients have not been elucidated. Between 2010 and 2014, a total of 144 patients who underwent gastric bypass for the treatment of T2DM were included for study. Patients were divided into two groups for subgroup analysis, namely BMI > 30 kg/m 2 and BMI BMI group (BMI > 30 kg/m 2 ) was 80% (n = 90) whereas for the lower BMI (BMI BMI group, low HbA1c and high fasting C-peptide are predictive factors whereas for lower-BMI group, along with elevated C-peptide level, disease duration is the positive predictive factor for DM remission. Patients with BMI > 30 kg/m 2 and those with BMI BMI patients while duration of diabetes is for high-low-BMI patients. C-peptide is a predictor of remission in both groups. Further large-scale studies are required to define the predictors of diabetes remission after gastric bypass in low- and high-BMI patients.

  19. File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

  20. File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

  1. File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

  2. Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons.

    Directory of Open Access Journals (Sweden)

    Mohamed Abdouh

    Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.

  3. Anabolic sensitivity of postprandial muscle protein synthesis to the ingestion of a protein-dense food is reduced in overweight and obese young adults.

    Science.gov (United States)

    Beals, Joseph W; Sukiennik, Richard A; Nallabelli, Julian; Emmons, Russell S; van Vliet, Stephan; Young, Justin R; Ulanov, Alexander V; Li, Zhong; Paluska, Scott A; De Lisio, Michael; Burd, Nicholas A

    2016-10-01

    Excess body fat diminishes muscle protein synthesis rates in response to hyperinsulinemic-hyperaminoacidemic clamps. However, muscle protein synthetic responses after the ingestion of a protein-dense food source across a range of body mass indexes (BMIs) have not been compared. We compared the myofibrillar protein synthetic response and underlying nutrient-sensing mechanisms after the ingestion of lean pork between obese, overweight, and healthy-weight adults. Ten healthy-weight [HW; BMI (in kg/m 2 ): 22.7 ± 0.4], 10 overweight (OW; BMI: 27.1 ± 0.5), and 10 obese (OB; BMI: 35.9 ± 1.3) adults received primed continuous l-[ring- 13 C 6 ]phenylalanine infusions. Blood and muscle biopsy samples were collected before and after the ingestion of 170 g pork (36 g protein and 3 g fat) to assess skeletal muscle anabolic signaling, amino acid transporters [large neutral and small neutral amino acid transporters (LAT1, SNAT2) and CD98], and myofibrillar protein synthesis. At baseline, OW and OB groups showed greater relative amounts of mammalian target of rapamycin complex 1 (mTORC1) protein than the HW group. Pork ingestion increased mTORC1 phosphorylation only in the HW group (P = 0.001). LAT1 and SNAT2 protein content increased during the postprandial period in all groups (time effect, P anabolic signals, that reduces muscle sensitivity to food ingestion. This trial was registered at clinicaltrials.gov as NCT02613767. © 2016 American Society for Nutrition.

  4. Ethnicity influences BMI as evaluated from reported serum lipid values in Inuit and non-Inuit: raised upper limit of BMI in Inuit?

    Science.gov (United States)

    Noahsen, Paneeraq; Andersen, Stig

    2013-01-01

    To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.

  5. BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

    Science.gov (United States)

    Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

    2017-12-01

    Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

  6. Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice

    NARCIS (Netherlands)

    Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M

    2005-01-01

    The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We

  7. BMI Group-Related Differences in Physical Fitness and Physical Activity in Preschool-Age Children: A Cross-Sectional Analysis

    Science.gov (United States)

    Niederer, Iris; Kriemler, Susi; Zahner, Lukas; Burgi, Flavia; Ebenegger, Vincent; Marques- Vidal, Pedro; Puder, Jardena J.

    2012-01-01

    In the Ballabeina study, we investigated age- and BMI-group-related differences in aerobic fitness (20 m shuttle run), agility (obstacle course), dynamic (balance beam) and static balance (balance platform), and physical activity (PA, accelerometers) in 613 children (M age = 5.1 years, SD = 0.6). Normal weight (NW) children performed better than…

  8. p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells

    Science.gov (United States)

    Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah

    2015-01-01

    Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797

  9. Bmi1 overexpression in the cerebellar granule cell lineage of mice affects cell proliferation and survival without initiating medulloblastoma formation

    Directory of Open Access Journals (Sweden)

    Hourinaz Behesti

    2013-01-01

    BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.

  10. SSX2 is a novel DNA-binding protein that antagonizes polycomb group body formation and gene repression

    DEFF Research Database (Denmark)

    Gjerstorff, Morten Frier; Relster, Mette Marie; Greve, Katrine Buch Viden

    2014-01-01

    Polycomb group (PcG) complexes regulate cellular identity through epigenetic programming of chromatin. Here, we show that SSX2, a germline-specific protein ectopically expressed in melanoma and other types of human cancers, is a chromatin-associated protein that antagonizes BMI1 and EZH2 PcG body...... formation and derepresses PcG target genes. SSX2 further negatively regulates the level of the PcG-associated histone mark H3K27me3 in melanoma cells, and there is a clear inverse correlation between SSX2/3 expression and H3K27me3 in spermatogenesis. However, SSX2 does not affect the overall composition...

  11. Energy and Protein Supplementation Does Not Affect Protein and Amino Acid Kinetics or Pregnancy Outcomes in Underweight Indian Women.

    Science.gov (United States)

    Dwarkanath, Pratibha; Hsu, Jean W; Tang, Grace J; Anand, Pauline; Thomas, Tinku; Thomas, Annamma; Sheela, C N; Kurpad, Anura V; Jahoor, Farook

    2016-02-01

    In India, the prevalence of low birth weight is high in women with a low body mass index (BMI), suggesting that underweight women are not capable of providing adequate energy and protein for fetal growth. Furthermore, as pregnancy progresses, there is increased need to provide methyl groups for methylation reactions associated with the synthesis of new proteins and, unlike normal-BMI American women, low-BMI Indian women are unable to increase methionine transmethylation and remethylation rates as pregnancy progresses from trimester 1 to 3. This also negatively influences birth weight. The aim was to determine the effect of dietary supplementation with energy and protein from 12 ± 1 wk of gestation to time of delivery compared with no supplement on pregnancy outcomes, protein kinetics, and the fluxes of the methyl group donors serine and glycine. Protein kinetics and serine and glycine fluxes were measured by using standard stable isotope tracer methods in the fasting and postprandial states in 24 pregnant women aged 22.9 ± 0.7 y with low BMIs [BMI (in kg/m(2)) ≤18.5] at 12 ± 1 wk (trimester 1) and 30 ± 1 wk (trimester 3) of gestation. After the first measurement, subjects were randomly assigned to either receive the supplement (300 kcal/d, 15 g protein/d) or no supplement. Supplementation had no significant effect on any variable of pregnancy outcome, and except for fasting state decreases in leucine flux (125 ± 7.14 compared with 113 ± 5.06 μmol ⋅ kg(-1) ⋅ h(-1); P = 0.04) and nonoxidative disposal (110 ± 6.97 compared with 101 ± 3.69 μmol ⋅ kg(-1) ⋅ h(-1); P = 0.02) from trimesters 1 to 3, it had no effect on any other leucine kinetic variable or urea, glycine, and serine fluxes. We conclude that in Indian women with a low BMI, supplementation with energy and protein from week 12 of pregnancy to time of delivery does not improve pregnancy outcome, whole-body protein kinetics, or serine and glycine fluxes. © 2016 American Society for Nutrition.

  12. Scaling of adult body weight to height across sex and race/ethnic groups: relevance to BMI.

    Science.gov (United States)

    Heymsfield, Steven B; Peterson, Courtney M; Thomas, Diana M; Heo, Moonseong; Schuna, John M; Hong, Sangmo; Choi, Woong

    2014-12-01

    Body mass index (BMI) is formulated on the assumption that body weight (BW) scales to height with a power of 2 (BW∝height(2)), independent of sex and race-ethnicity. Powers differing from 2 are observed in studies of selected samples, thus raising the question if BMI is a generalizable metric that makes BW independent of height across populations. The objectives were to test the hypothesis that adult BW scales to height with a power of 2 independent of sex and race-ethnicity and to advance an understanding of BMI as a measure of shape by extending allometric analyses to waist circumference (WC). We conducted cross-sectional subject evaluations, including body composition, from the NHANES and the Korean NHANES (KNHANES). Variations of the allometric model (Y = αX(β)) were used to establish height scaling powers (β ± SE) across non-Hispanic white and black, Mexican American, and Korean men and women. Exploratory analyses in population samples established age and adiposity as important independent determinants of height scaling powers (i.e., β). After age and adiposity in the next series of analyses were controlled for, BW scaling powers were nonsignificantly different between race/ethnic groups within each sex group; WC findings were similar in women, whereas small but significant between-race differences were observed in the men. Sex differences in β values were nonsignificant except for BW in non-Hispanic blacks and WC in Koreans (P ethnic groups, an observation that makes BMI a generalizable height-independent measure of shape across most populations. WC also follows generalizable scaling rules, a finding that has implications for defining body shape in populations who differ in stature. © 2014 American Society for Nutrition.

  13. Causal relationship between the AHSG gene and BMD through fetuin-A and BMI: multiple mediation analysis.

    Science.gov (United States)

    Sritara, C; Thakkinstian, A; Ongphiphadhanakul, B; Chailurkit, L; Chanprasertyothin, S; Ratanachaiwong, W; Vathesatogkit, P; Sritara, P

    2014-05-01

    Using mediation analysis, a causal relationship between the AHSG gene and bone mineral density (BMD) through fetuin-A and body mass index (BMI) mediators was suggested. Fetuin-A, a multifunctional protein of hepatic origin, is associated with bone mineral density. It is unclear if this association is causal. This study aimed at clarification of this issue. A cross-sectional study was conducted among 1,741 healthy workers from the Electricity Generating Authority of Thailand (EGAT) cohort. The alpha-2-Heremans-Schmid glycoprotein (AHSG) rs2248690 gene was genotyped. Three mediation models were constructed using seemingly unrelated regression analysis. First, the ln[fetuin-A] group was regressed on the AHSG gene. Second, the BMI group was regressed on the AHSG gene and the ln[fetuin-A] group. Finally, the BMD model was constructed by fitting BMD on two mediators (ln[fetuin-A] and BMI) and the independent AHSG variable. All three analyses were adjusted for confounders. The prevalence of the minor T allele for the AHSG locus was 15.2%. The AHSG locus was highly related to serum fetuin-A levels (P Multiple mediation analyses showed that AHSG was significantly associated with BMD through the ln[fetuin-A] and BMI pathway, with beta coefficients of 0.0060 (95% CI 0.0038, 0.0083) and 0.0030 (95% CI 0.0020, 0.0045) at the total hip and lumbar spine, respectively. About 27.3 and 26.0% of total genetic effects on hip and spine BMD, respectively, were explained by the mediation effects of fetuin-A and BMI. Our study suggested evidence of a causal relationship between the AHSG gene and BMD through fetuin-A and BMI mediators.

  14. About BMI for Adults

    Science.gov (United States)

    ... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...

  15. Comparative study and grouping of nonstructural (NS1)proteins of influenza A viruses by the method of oligopeptide mapping

    International Nuclear Information System (INIS)

    Sokolov, B.P.; Rudneva, I.A.; Zhdanov, V.M.

    1983-01-01

    Oligopeptide mapping of 35 S-methionine labeled non-stuctural (NS1) proteins of 23 influenza A virus strains showed the presence of both common and variable oligopeptides. Analysis of the oligopeptide maps revealed at least four groups of NS1 proteins. The first group includes NS1 proteins of several human H1N1 influenza viruses (that were designated as H0N1 according to the old classification). The second group is composed of NS1 proteins of H1N1 and H2N2 viruses. The third group includes NS1 proteins of H3N2 human influenza viruses. The fourth group is composed of NS1 proteins of five avian influenza viruses and an equine (H3N8) influenza virus. Two animal influenza viruses A/equi/Prague/56 (H7N7) and A/duck/England/56 (H11N6) contain NS1 proteins that belong to the second group. (Author)

  16. Eating tasty food to cope. Longitudinal association with BMI.

    Science.gov (United States)

    Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D

    2015-04-01

    The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Co-Expression of Bmi-1 and Podoplanin Predicts Overall Survival in Patients With Squamous Cell Carcinoma of the Head and Neck Treated With Radio(chemo)therapy

    International Nuclear Information System (INIS)

    Vormittag, Laurenz; Thurnher, Dietmar; Geleff, Silvana; Pammer, Johannes; Heiduschka, Gregor; Brunner, Markus; Grasl, Matthaeus Ch.; Erovic, Boban M.

    2009-01-01

    Purpose: This study was conducted to determine the expression of Bmi-1 and podoplanin in healthy oral mucosa and in untreated tumor tissues samples of patients with squamous cell carcinomas of the head and neck. All patients were treated by primary radio(chemo)therapy. Methods and Materials: The expression of Bmi-1 and podoplanin was immunohistochemically evaluated in 12 normal oral mucosa and 63 tumor specimens and correlated with patients' clinical data. Results: In healthy mucosa expression of Bmi-1 and podoplanin was restricted to the basal cell layer. Expression of both proteins was found in 79% and 86% of our tumor samples, respectively. In 17 and 8 samples, Bmi-1 and podoplanin were co-expressed at the invasive border or diffuse in the bulk of the tumor, respectively. Univariate analysis showed that the co-expression of Bmi-1 and podoplanin correlated to decreased overall survival (p = 0.044). Moreover, multivariate testing identified high expression of podoplanin (p = 0.044), co-expression of Bmi-1 and podoplanin (p = 0.007) and lack of response to therapy (p < 0.0001) as predictors of shortened overall survival in patients treated with primary radio(chemo)therapy. Conclusions: Bmi-1 and podoplanin are expressed at the invasive front of squamous cell carcinomas of the head and neck. Co-expression of Bmi-1 and podoplanin predicts significantly overall survival of patients treated with primary radio(chemo)therapy

  18. Investigation of the effect of body mass index (BMI) on semen parameters and male reproductive system hormones.

    Science.gov (United States)

    Keskin, Mehmet Zeynel; Budak, Salih; Aksoy, Evrim Emre; Yücel, Cem; Karamazak, Serkan; Ilbey, Yusuf Ozlem; Kozacıoğlu, Zafer

    2017-10-03

    To evaluate the effects of body mass index (BMI) ratio on semen parameters and serum reproductive hormones. The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC), normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165), Group 2 (n = 222) and Group 3 (n = 56). There was no statistically significant difference in terms of all variables between the groups. We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.

  19. BMI was found to be a consistent determinant related to misreporting of energy, protein and potassium intake using self-report and duplicate portion methods.

    Science.gov (United States)

    Trijsburg, Laura; Geelen, Anouk; Hollman, Peter Ch; Hulshof, Paul Jm; Feskens, Edith Jm; Van't Veer, Pieter; Boshuizen, Hendriek C; de Vries, Jeanne Hm

    2017-03-01

    As misreporting, mostly under-reporting, of dietary intake is a generally known problem in nutritional research, we aimed to analyse the association between selected determinants and the extent of misreporting by the duplicate portion method (DP), 24 h recall (24hR) and FFQ by linear regression analysis using the biomarker values as unbiased estimates. For each individual, two DP, two 24hR, two FFQ and two 24 h urinary biomarkers were collected within 1·5 years. Also, for sixty-nine individuals one or two doubly labelled water measurements were obtained. The associations of basic determinants (BMI, gender, age and level of education) with misreporting of energy, protein and K intake of the DP, 24hR and FFQ were evaluated using linear regression analysis. Additionally, associations between other determinants, such as physical activity and smoking habits, and misreporting were investigated. The Netherlands. One hundred and ninety-seven individuals aged 20-70 years. Higher BMI was associated with under-reporting of dietary intake assessed by the different dietary assessment methods for energy, protein and K, except for K by DP. Men tended to under-report protein by the DP, FFQ and 24hR, and persons of older age under-reported K but only by the 24hR and FFQ. When adjusted for the basic determinants, the other determinants did not show a consistent association with misreporting of energy or nutrients and by the different dietary assessment methods. As BMI was the only consistent determinant of misreporting, we conclude that BMI should always be taken into account when assessing and correcting dietary intake.

  20. Maternal Metabolic Health Parameters During Pregnancy in Relation to Early Childhood BMI Trajectories.

    Science.gov (United States)

    Montazeri, Parisa; Vrijheid, Martine; Martinez, David; Basterrechea, Mikel; Fernandez-Somoano, Ana; Guxens, Monica; Iñiguez, Carmen; Lertxundi, Aitana; Murcia, Mario; Tardon, Adonina; Sunyer, Jordi; Valvi, Damaskini

    2018-03-01

    The objective of this study was to evaluate the associations between maternal metabolic parameters and early childhood BMI trajectories. Two thousand two hundred fifty-one children born in Spain between 2004 and 2008 were analyzed. Five BMI z score trajectories from birth to age 4 years were identified by using latent class growth analysis. Multinomial regression assessed the associations between maternal metabolic parameters and offspring's BMI trajectories. Children in the reference BMI trajectory had average size at birth followed by a slower BMI gain. Maternal prepregnancy obesity was associated with trajectories of accelerated BMI gain departing from either higher (relative risk ratio [RRR] = 1.77; 95% CI: 1.07-2.91) or lower size at birth (RRR = 1.91; 95% CI: 1.17-3.12). Gestational weight gain (GWG) above clinical guidelines was associated with a trajectory of higher birth size followed by accelerated BMI gain (RRR = 2.14; 95% CI: 1.53-2.97). Maternal serum triglycerides were negatively associated with BMI trajectories departing from lower birth sizes. Gestational diabetes, maternal serum cholesterol, and C-reactive protein were unrelated to children's BMI trajectories. Maternal prepregnancy obesity, GWG, and serum triglycerides are associated with longitudinal BMI trajectories in early childhood that may increase disease risk in later life. Health initiatives should promote healthy weight status before and during pregnancy to improve maternal and child health. © 2018 The Obesity Society.

  1. Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance

    Science.gov (United States)

    Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun

    2014-01-01

    To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841

  2. Investigation of the effect of body mass index (BMI on semen parameters and male reproductive system hormones

    Directory of Open Access Journals (Sweden)

    Mehmet Zeynel Keskin

    2017-10-01

    Full Text Available Aim: To evaluate the effects of body mass index (BMI ratio on semen parameters and serum reproductive hormones. Materials and methods: The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. Results: The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC, normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165, Group 2 (n = 222 and Group 3 (n = 56. There was no statistically significant difference in terms of all variables between the groups. Conclusions: We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.

  3. Polycomb complex protein BMI-1 promotes invasion and metastasis of pancreatic cancer stem cells by activating PI3K/AKT signaling, an ex vivo, in vitro, and in vivo study

    Science.gov (United States)

    Wang, Min-Cong; Jiao, Min; Wu, Tao; Jing, Li; Cui, Jie; Guo, Hui; Tian, Tao; Ruan, Zhi-ping; Wei, Yong-Chang; Jiang, Li-Li; Sun, Hai-Feng; Huang, Lan-Xuan; Nan, Ke-Jun; Li, Chun-Li

    2016-01-01

    Cancer stem cell theory indicates cancer stem cells are the key to promote tumor invasion and metastasis. Studies showed that BMI-1 could promote self-renew, differentiation and tumor formation of CSCs and invasion/metastasis of human cancer. However, whether BMI-1 could regulate invasion and metastasis ability of CSCs is still unclear. In our study, we found that up-regulated expression of BMI-1 was associated with tumor invasion, metastasis and poor survival of pancreatic cancer patients. CD133+ cells were obtained by using magnetic cell sorting and identified of CSCs properties such as self-renew, multi-differentiation and tumor formation ability. Then, we found that BMI-1 expression was up-regulated in pancreatic cancer stem cells. Knockdown of BMI-1 expression attenuated invasion ability of pancreatic cancer stem cells in Transwell system and liver metastasis capacity in nude mice which were injected CSCs through the caudal vein. We are the first to reveal that BMI-1 could promote invasion and metastasis ability of pancreatic cancer stem cells. Finally, we identified that BMI-1 expression activating PI3K/AKT singing pathway by negative regulating PTEN was the main mechanism of promoting invasion and metastasis ability of pancreatic CSCs. In summary, our findings indicate that BMI-1 could be used as the therapeutic target to inhibiting CSCs-mediated pancreatic cancer metastasis. PMID:26840020

  4. The oncoprotein and stem cell renewal factor BMI1 associates with poor clinical outcome in oesophageal cancer patients undergoing preoperative chemoradiotherapy

    Directory of Open Access Journals (Sweden)

    Yoshikawa Reigetsu

    2012-10-01

    Full Text Available Abstract Background The polycomb group (PcG family BMI1, acting downstream of the hedgehog (Hh pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated that Hh signalling activation can predict very earlier relapse of oesophageal cancers. As data were not available on the clinical role of BMI1 expression in oesophageal cancers after chemoradiotherapy (CRT, we analysed whether it could be also used to predict disease progression and prognosis in oesophageal cancer patients undergoing trimodality therapy of preoperative CRT and oesophagectomy. Methods Expressions of BMI1 and p16INK4A, a downstream target of PcG, were analysed in 78 patients with histologically confirmed oesophageal squamous cell carcinoma (ESCC after preoperative CRT by immunohistochemical staining. The association of BMI1 and p16INK4A expression with clinicopathologic characteristics was analysed by χ2-test. Survival analysis was carried out by the log-rank test using Kaplan-Meier method. Results Among 78 ESCC patients, 24 patients (30.8% showed BMI1 positivity, mainly localised in the nuclei of tumour cells. Patients harbouring BMI1-positive tumour cells showed significantly poorer prognoses than those without such cells or residual tumours (mean disease-free survival (DFS time 16.8 vs 71.2 months; 3-yr DFS 13.3% vs 49.9%, P=0.002; mean OS time 21.8 vs 76.6 months; 3-yr OS 16.2% vs 54.9%, P=0.0005. There was no significant correlation between p16INK4A expression and BMI1 expression. Conclusions Our study shows that BMI1 expression is a predictor of early relapse and poor prognosis in ESCC after CRT. These findings suggest that BMI1 signal activation might be involved in promoting cancer regrowth and progression after CRT, and might be indicative of emergence of ‘more aggressive’ cancer progenitor cells.

  5. Loss of BMI-1 dampens migration and EMT of colorectal cancer in inflammatory microenvironment through TLR4/MD-2/MyD88-mediated NF-κB signaling.

    Science.gov (United States)

    Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua

    2018-02-01

    Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley

  6. Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.

    Science.gov (United States)

    Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran

    2018-03-01

    High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Maternal BMI and diabetes in pregnancy: Investigating variations between ethnic groups using routine maternity data from London, UK.

    Science.gov (United States)

    Nishikawa, Erin; Oakley, Laura; Seed, Paul T; Doyle, Pat; Oteng-Ntim, Eugene

    2017-01-01

    To investigate the ethnicity-specific association between body mass index (BMI) and diabetes in pregnancy, with a focus on the appropriateness of using BMI cut-offs to identify pregnant women at risk of diabetes. Analysis of routinely-collected data from a maternity unit in London, UK. Data were available on 53 264 women delivering between 2004 and 2012. Logistic regression was used to explore the association between diabetes in pregnancy and BMI among women of different ethnicities, and adjusted probability estimates were used to derive risk equivalent cut-offs. ROC curve analysis was used to assess the performance of BMI as a predictor of diabetes in pregnancy. The prevalence of diabetes in pregnancy was 2.3% overall; highest in South and East Asian women (4.6% and 3.7%). In adjusted analysis, BMI category was strongly associated with diabetes in all ethnic groups. Modelled as a continuous variable with a quadratic term, BMI was an acceptable predictor of diabetes according to ROC curve analysis. Applying a BMI cut-off of 30 kg/m2 would identify just over half of Black women with diabetes in pregnancy, a third of White (32%) and South Asian (35%) women, but only 13% of East Asian women. The 'risk equivalent' (comparable to 30 kg/m2 in White women) threshold for South Asian and East Asian women was approximately 21 kg/m2, and 27.5 kg/m2 for Black women. This study suggests that current BMI thresholds are likely to be ineffective for diabetes screening in South and East Asian women, as many cases of diabetes will occur at low BMI levels. Our results suggest that East Asian women appear to face a similarly high risk of diabetes to South Asian women. Current UK guidelines recommend diabetes screening should be offered to all pregnant South Asian women; extending this recommendation to include women of East Asian ethnicity may be appropriate.

  8. The Role of BMI in Hip Fracture Surgery.

    Science.gov (United States)

    Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry

    2018-01-01

    Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.

  9. Changes in body mass, stature and BMI in South African elite U18 Rugby players from different racial groups from 2002-2012.

    Science.gov (United States)

    Durandt, Justin; Green, Mervin; Masimla, Herman; Lambert, Mike

    2018-03-01

    The purpose of this study was to determine whether there are differences between racial groups for body mass, stature and body mass index (BMI) in South African elite U18 rugby players and whether there were significant changes in these measurements between 2002 and 2012. Self-reported body mass and stature were obtained from U18 players (n = 4007) who attended the national tournament during this period. BMI was calculated for each player.White players were 9.8 kg heavier than black players, who were 2.3 kg heavier than coloured players (P body mass of all groups increased from 2002 to 2012 (P body mass, stature and BMI of elite under-18 rugby players in South Africa were significantly different between racial groups. This has implications for transforming the game to make it representative of the South African population.

  10. The effect of prenatal maternal cigarette smoking on children's BMI z-score with SGA as a mediator.

    Science.gov (United States)

    Salahuddin, Meliha; Pérez, Adriana; Ranjit, Nalini; Hoelscher, Deanna M; Kelder, Steven H

    2018-02-21

    The goal of this study was to assess the effect of prenatal maternal cigarette smoking on children's BMI z-score trajectories, and to evaluate whether small-for-gestational-age (SGA) acts as a potential mediator between prenatal maternal cigarette smoking and child's BMI z-score at 4 years of age. Group-based trajectory modeling (GBTM) methods were employed to describe and classify developmental BMI z-score trajectories (the outcome of interest) in children from 9 months to 4 years of age (n = 5221) in the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B) study (2001-2005). Further analysis examined whether the identified BMI z-score trajectories varied with the exposure, prenatal maternal cigarette smoking. Mediation analyses were utilized to examine whether being SGA (binary measure) acted as a potential mediator in the relationship between prenatal maternal cigarette smoking and BMI z-score among 4-year-old children. Using GBTM, two BMI z-score trajectory groups were identified: normal BMI z-score (57.8%); and high BMI z-score (42.2%). Children of mothers who smoked cigarettes during pregnancy were 2.1 times (RR 95% CI: 1.1-4.0, P value = 0.023) more at risk of being in the high BMI z-score trajectory group. Prenatal cigarette smoking was positively related to SGA at birth, but SGA was inversely related to BMI z-score at 4 years. The direct effect (0.19, 95% CI: 0.18, 0.19; P value BMI z-score among 4-year-old children was stronger and in the opposite direction of the indirect effect (-0.04, 95% CI: -0.04, -0.04; P value BMI z-score group, as well with SGA. The effects of prenatal smoking on BMI z-score at 4 years appears to act through pathways other than SGA.

  11. The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.

    Science.gov (United States)

    Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale

    2018-02-01

    Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.

  12. Gender expression associated with BMI in a prospective cohort study of US adolescents.

    Science.gov (United States)

    Bryn Austin, S; Ziyadeh, Najat J; Calzo, Jerel P; Sonneville, Kendrin R; Kennedy, Grace A; Roberts, Andrea L; Haines, Jess; Scherer, Emily A

    2016-02-01

    To examine the relationship between gender expression (GE) and BMI in adolescence. Repeated measures of weight-related behaviors and BMI were collected from 1996 to 2011 via annual/biennial self-report surveys from youth aged 10 to 23 years (6,693 females, 2,978 males) in the longitudinal Growing Up Today Study. GE (very conforming [referent], mostly conforming, nonconforming) was assessed in 2010/11. Sex-stratified, multivariable linear models estimated GE group differences in BMI and the contribution of sexual orientation and weight-related exposures to group differences. Models for males included interaction terms for GE with age. In females, mostly conforming youth had 0.53 kg m(-2) and nonconforming had 1.23 kg m(-2) higher BMI; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 8% and remained statistically significant. In males, mostly conforming youth had -0.67 kg m(-2) and nonconforming had -1.99 kg m(-2) lower BMI (age [in years]) interactions were between -0.09 and -0.14 kg m(-2) ; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 11% and remained statistically significant. GE is a strong independent predictor of BMI in adolescence. Obesity prevention and treatment interventions with youth must address ways that gender norms may reinforce or undermine healthful behaviors. © 2016 The Obesity Society.

  13. Human Polycomb group EED protein negatively affects HIV-1 assembly and release

    Directory of Open Access Journals (Sweden)

    Darlix Jean-Luc

    2007-06-01

    Full Text Available Abstract Background The human EED protein, a member of the superfamily of Polycomb group (PcG proteins with WD-40 repeats, has been found to interact with three HIV-1 components, namely the structural Gag matrix protein (MA, the integrase enzyme (IN and the Nef protein. The aim of the present study was to analyze the possible biological role of EED in HIV-1 replication, using the HIV-1-based vector HIV-Luc and EED protein expressed by DNA transfection of 293T cells. Results During the early phase of HIV-1 infection, a slight negative effect on virus infectivity occurred in EED-expressing cells, which appeared to be dependent on EED-MA interaction. At late times post infection, EED caused an important reduction of virus production, from 20- to 25-fold as determined by CAp24 immunoassay, to 10- to 80-fold based on genomic RNA levels, and this decrease was not due to a reduction of Gag protein synthesis. Coexpression of WTNef, or the non-N-myristoylated mutant NefG2A, restored virus yields to levels obtained in the absence of exogenous EED protein. This effect was not observed with mutant NefΔ57 mimicking the Nef core, or with the lipid raft-retargeted fusion protein LAT-Nef. LATAA-Nef, a mutant defective in the lipid raft addressing function, had the same anti-EED effect as WTNef. Cell fractionation and confocal imaging showed that, in the absence of Nef, EED mainly localized in membrane domains different from the lipid rafts. Upon co-expression with WTNef, NefG2A or LATAA-Nef, but not with NefΔ57 or LAT-Nef, EED was found to relocate into an insoluble fraction along with Nef protein. Electron microscopy of HIV-Luc producer cells overexpressing EED showed significant less virus budding at the cell surface compared to control cells, and ectopic assembly and clustering of nuclear pore complexes within the cytoplasm. Conclusion Our data suggested that EED exerted an antiviral activity at the late stage of HIV-1 replication, which included genomic

  14. The relationship between BMI and striatal dopamine transporter with 99Tcm-TRODAT-1 brain SPECT

    International Nuclear Information System (INIS)

    Lu Rongbin; Liu Xingdang; Liu Congjin; Wang Yuankai; Zhang Guangming; Tang Jie; Chen Zhengqing; Luo Shineng

    2011-01-01

    Objective: To assess the relationship between the BMI and the brain DAT, and the influence of BMI on the brain SPECT imaging with 99 Tc m -TRODAT-1. Methods: MRI and 99 Tc m -TRODAT-1SPECT imaging were performed in 31 healthy volunteers (16 males and 15 females), and then the three-dimensional reconstruction of SPECT images were completed. Based on the MRI images, right striatum (RST) and the left striatum (LST) were drawn as ROI on the 4 most clearly consecutive transverse slices.The cerebellum (CB) was taken as the background reference area and the corresponding uptake ratios of ST/CB, LST/CB and RST/CB were calculated. The Pearson correlation tests for radio-uptake ratios (ST/CB, LST/CB, RST/CB), BMI and age were performed, Then multiple linear regression analysis using ST/CB as dependent variable and BMI and age as independent variables was performed. SPSS 15.0 was used in data analysis. Results: The ST imaging was symmetrical. The radioactivity was higher in the ST front area than that of the back area. The average uptake ratios of ST/CB, LST/CB, RST/CB were 1.71±0.16,1.70±0.16 and 1.72±0.17 respectively, in which the three ratios of the female were 1.74±0.18, 1.71±0.19 and 1.76±0.19 respectively and those of the male were 1.68±0.14, 1.68±0.13 and 1.69±0.15 respectively. ST/CB, LST/CB and RST/CB were negatively correlated with patients' BMI (r = -0.53, -0.57, -0.47, all P<0.05). The ST/CB was negatively correlated with patients' age (r=-0.39, P=0.03). The multiple linear regression analysis showed that the BMI was significant independent variable (β=-0.53, t= -3.36, P=0.002). Conclusions: The ST DAT level may decrease as patients' BMI and age increase. Females' DAT level is slightly higher than males'. For ST DAT imaging, age, gender and BMI should be all taken into consideration. (authors)

  15. Interaction of a non-histone chromatin protein (high-mobility group protein 2) with DNA

    International Nuclear Information System (INIS)

    Goodwin, G.H.; Shooter, K.V.; Johns, E.W.

    1975-01-01

    The interaction with DNA of the calf thymus chromatin non-histone protein termed the high-mobility group protein 2 has been studied by sedimentation analysis in the ultracentrifuge and by measuring the binding of the 125 I-labelled protein to DNA. The results have been compared with those obtained previously by us [Eur. J. Biochem. (1974) 47, 263-270] for the interaction of high-mobility group protein 1 with DNA. Although the binding parameters are similar for these two proteins, high-mobility group protein 2 differs from high-mobility group protein 1 in that the former appears to change the shape of the DNA to a more compact form. The molecular weight of high-mobility group protein 2 has been determined by equilibrium sedimentation and a mean value of 26,000 was obtained. A low level of nuclease activity detected in one preparation of high-mobility group protein 2 has been investigated. (orig.) [de

  16. Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer

    Science.gov (United States)

    2011-01-01

    Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi

  17. Predictors of increasing BMI during the course of diabetes in children and adolescents with type 1 diabetes: data from the German/Austrian DPV multicentre survey.

    Science.gov (United States)

    Fröhlich-Reiterer, Elke E; Rosenbauer, Joachim; Bechtold-Dalla Pozza, Susanne; Hofer, Sabine E; Schober, Edith; Holl, Reinhard W

    2014-08-01

    Increased weight gain has been reported prior to disease onset (accelerator hypothesis) and as a side effect of intensified insulin therapy in type 1 diabetes (T1D). Paediatric studies are complicated by the age-dependency and gender-dependency of BMI, and also by a trend towards obesity in the general population. The aim of this study was to evaluate factors related to the increase in BMI during the course of diabetes in children and adolescents with T1D in a large multicentre survey. Within the DPV database (Diabetespatienten Verlaufsdokumentation) a standardised, prospective, computer-based documentation programme, data of 53,108 patients with T1D, aged 12,774 patients (53% male, mean age 13.4±3.9, mean diabetes duration 4.7±3.0 years and mean age at diabetes onset 8.7±4.0 years) were included in this analysis. Population-based German reference data were used to calculate BMI-SDS and define overweight and obesity. 12.5% of T1D patients were overweight and 2.8% were obese. Multiple longitudinal regression analysis revealed that female gender, low BMI at diabetes onset, intensified insulin therapy and higher insulin dose, as well as pubertal diabetes onset, long diabetes duration and onset in earlier calendar years among girls, were related to higher BMI-SDS increase during the course of diabetes (p1; all). Intensified insulin regimen is associated with weight gain during T1D treatment, in addition to demographic variables. Optimisation of diabetes management, especially in females, might limit weight gain in order to reduce overweight and obesity together with comorbidities among paediatric T1D patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  18. Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1

    International Nuclear Information System (INIS)

    Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon

    2008-01-01

    Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1

  19. Epigenetic regulation of HIV-1 latency: focus on polycomb group (PcG) proteins.

    Science.gov (United States)

    Khan, Sheraz; Iqbal, Mazhar; Tariq, Muhammad; Baig, Shahid M; Abbas, Wasim

    2018-01-01

    HIV-1 latency allows the virus to persist until reactivation, in a transcriptionally silent form in its cellular reservoirs despite the presence of effective cART. Such viral persistence represents a major barrier to HIV eradication since treatment interruption leads to rebound plasma viremia. Polycomb group (PcG) proteins have recently got a considerable attention in regulating HIV-1 post-integration latency as they are involved in the repression of proviral gene expression through the methylation of histones. This epigenetic regulation plays an important role in the establishment and maintenance of HIV-1 latency. In fact, PcG proteins act in complexes and modulate the epigenetic signatures of integrated HIV-1 promoter. Key role played by PcG proteins in the molecular control of HIV-1 latency has led to hypothesize that PcG proteins may represent a valuable target for future HIV-1 therapy in purging HIV-1 reservoirs. In this regard, various small molecules have been synthesized or explored to specifically block the epigenetic activity of PcG. In this review, we will highlight the possible therapeutic approaches to achieve either a functional or sterilizing cure of HIV-1 infection with special focus on histone methylation by PcG proteins together with current and novel pharmacological approaches to reactivate HIV-1 from latency that could ultimately lead towards a better clearance of viral latent reservoirs.

  20. Influence of age, BMI, gender and lumbar level on T1ρ magnetic resonance imaging of lumbar discs in healthy asymptomatic adults

    Energy Technology Data Exchange (ETDEWEB)

    Guebitz, Raphael [Asklepios Hospital Altona, Hamburg (Germany). Dept. of Radiology and Neuroradiology; Lange, Tobias; Gosheger, Georg [University Hospital Muenster (Germany). Dept. of Orthopaedics and Tumor Orthopaedics; Heindel, Walter; Allkemper, Thomas [University Hospital Muenster (Germany). Dept. of Clinical Radiology; Stehling, Christoph [Sankt-Barbara Hospital Ham-Heessen, Hamm (Germany). Clinic for Radiology and Neuroradiology; Gerss, Joachim [Muenster Univ. (Germany). Inst. of Biostatistics and Clinical Research; Kanthak, Christian [Fraunhofer MEVIS, Bremen (Germany). Inst. for Medical Image Computing; Schulte, Tobias L. [Bochum Univ. St. Josef Hospital (Germany). Dept. of Orthopaedics and Trauma Surgery

    2018-02-15

    To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.

  1. Influence of age, BMI, gender and lumbar level on T1ρ magnetic resonance imaging of lumbar discs in healthy asymptomatic adults

    International Nuclear Information System (INIS)

    Guebitz, Raphael; Lange, Tobias; Gosheger, Georg; Heindel, Walter; Allkemper, Thomas; Stehling, Christoph; Gerss, Joachim; Kanthak, Christian; Schulte, Tobias L.

    2018-01-01

    To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.

  2. A novel zinc finger protein Zfp277 mediates transcriptional repression of the Ink4a/arf locus through polycomb repressive complex 1

    DEFF Research Database (Denmark)

    Negishi, Masamitsu; Saraya, Atsunori; Mochizuki, Shinobu

    2010-01-01

    . METHODOLOGY/PRINCIPAL FINDINGS: We examined the function of Zinc finger domain-containing protein 277 (Zfp277), a novel zinc finger protein that interacts with the PcG protein Bmi1. Zfp277 binds to the Ink4a/Arf locus in a Bmi1-independent manner and interacts with polycomb repressor complex (PRC) 1 through...... is essential for the recruitment of PRC1 to the Ink4a/Arf locus. Our findings also highlight dynamic regulation of both Zfp277 and PcG proteins by the oxidative stress pathways....

  3. BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

    Science.gov (United States)

    Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

    2016-01-01

    Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

  4. Relationship between BMI and blood pressure in girls and boys.

    Science.gov (United States)

    Gundogdu, Zuhal

    2008-10-01

    To investigate the relationship between BMI and blood pressure as this is of crucial interest in evaluating both public health and the clinical impact of the so-called obesity epidemic. Data were gathered from 1899 children aged between 6 and 14 years, analysing and evaluating a possible relationship between BMI and systolic and diastolic blood pressure values for both girls and boys. Each child was classified on the basis of age- and sex-specific BMI percentile as normal weight (<85th percentile), overweight (95th percentile). In comparisons among age BMI percentile groups, systolic and diastolic blood pressure values were higher in obese and overweight groups than in normal weight groups for both sexes. Although BMI among girls was higher than among boys in all three percentile groups, there were no significant differences between sexes with respect to blood pressure values. The present findings emphasize the importance of the prevention of obesity in order to prevent future related problems such as hypertension in children and adolescents.

  5. Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.

    Science.gov (United States)

    Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo

    2017-05-01

    Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.

  6. The impact of serum adropin and ischemia modified albumin levels based on BMI in PCOS.

    Science.gov (United States)

    Inal, Zeynep Ozturk; Erdem, Sami; Gederet, Yavuz; Duran, Cevdet; Kucukaydin, Zehra; Kurku, Huseyin; Sakarya, Derya Kilic

    2018-02-21

    The aim of this study was to evaluate the effects of polycystic ovary syndrome (PCOS) and body mass index (BMI) on serum adropin and ischemia modified albumin (IMA) levels. This prospective cross-sectional study was performed with a total of 120 women [group1; non-PCOS = 60 (BMI PCOS = 60 (BMI PCOS and non-PCOS patients in the lean and overweight groups (pPCOS group were lower than in the lean non-PCOS group (pPCOS group than in the overweight non-PCOS group (pPCOS group than in the non-PCOS group in both the lean and overweight groups (pPCOS group, IMA levels increased. Further studies are needed to determine the effects of adropin and IMA in women with PCOS and to use a new marker to monitorize treatment outcomes.

  7. Polycomb group protein-mediated repression of transcription

    DEFF Research Database (Denmark)

    Morey, Lluís; Helin, Kristian

    2010-01-01

    The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work as transcri......The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work...... as transcriptional repressors is incompletely understood, but involves post-translational modifications of histones by two major PcG protein complexes: polycomb repressive complex 1 and polycomb repressive complex 2....

  8. Early childhood BMI trajectories in monogenic obesity due to leptin, leptin receptor, and melanocortin 4 receptor deficiency.

    Science.gov (United States)

    Kohlsdorf, Katja; Nunziata, Adriana; Funcke, Jan-Bernd; Brandt, Stephanie; von Schnurbein, Julia; Vollbach, Heike; Lennerz, Belinda; Fritsch, Maria; Greber-Platzer, Susanne; Fröhlich-Reiterer, Elke; Luedeke, Manuel; Borck, Guntram; Debatin, Klaus-Michael; Fischer-Posovszky, Pamela; Wabitsch, Martin

    2018-02-27

    To evaluate whether early childhood body mass index (BMI) is an appropriate indicator for monogenic obesity. A cohort of n = 21 children living in Germany or Austria with monogenic obesity due to congenital leptin deficiency (group LEP, n = 6), leptin receptor deficiency (group LEPR, n = 6) and primarily heterozygous MC4 receptor deficiency (group MC4R, n = 9) was analyzed. A control group (CTRL) was defined that consisted of n = 22 obese adolescents with no mutation in the above mentioned genes. Early childhood (0-5 years) BMI trajectories were compared between the groups at selected time points. The LEP and LEPR group showed a tremendous increase in BMI during the first 2 years of life with all patients displaying a BMI >27 kg/m 2 (27.2-38.4 kg/m 2 ) and %BMI P95 (percentage of the 95th percentile BMI for age and sex) >140% (144.8-198.6%) at the age of 2 years and a BMI > 33 kg/m 2 (33.3-45.9 kg/m 2 ) and %BMI P95  > 184% (184.1-212.6%) at the age of 5 years. The MC4R and CTRL groups had a later onset of obesity with significantly lower BMI values at both time points (p BMI trajectories in this pediatric cohort with monogenic obesity we suggest that BMI values >27.0 kg/m 2 or %BMI P95  > 140% at the age of 2 years and BMI values >33.0 kg/m 2 or %BMI P95  > 184% at the age of 5 years may be useful cut points to identify children who should undergo genetic screening for monogenic obesity due to functionally relevant mutations in the leptin gene or leptin receptor gene.

  9. Long-term low-calorie low-protein vegan diet and endurance exercise are associated with low cardiometabolic risk.

    Science.gov (United States)

    Fontana, Luigi; Meyer, Timothy E; Klein, Samuel; Holloszy, John O

    2007-06-01

    Western diets, which typically contain large amounts of energy-dense processed foods, together with a sedentary lifestyle are associated with increased cardiometabolic risk. We evaluated the long-term effects of consuming a low-calorie low-protein vegan diet or performing regular endurance exercise on cardiometabolic risk factors. In this cross-sectional study, cardiometabolic risk factors were evaluated in 21 sedentary subjects, who had been on a low-calorie low-protein raw vegan diet for 4.4 +/- 2.8 years, (mean age, 53.1 +/- 11 yrs), 21 body mass index (BMI)-matched endurance runners consuming Western diets, and 21 age- and gender-matched sedentary subjects, consuming Western diets. BMI was lower in the low-calorie low-protein vegan diet (21.3 +/- 3.1 kg/m(2)) and endurance runner (21.1 +/- 1.6 kg/m(2)) groups than in the sedentary Western diet group (26.5 +/- 2.7 kg/m(2)) (p vegan diet and runner groups than in the Western diet group (all p vegan diet group (104 +/- 15 and 62 +/- 11 mm Hg) than in BMI-matched endurance runners (122 +/- 13 and 72 +/- 9 mmHg) and Western diet group (132 +/- 14 and 79 +/- 8 mm Hg) (p vegan diet or regular endurance exercise training is associated with low cardiometabolic risk. Moreover, our data suggest that specific components of a low-calorie low-protein vegan diet provide additional beneficial effects on blood pressure.

  10. BMI-1 Mediates Estrogen-Deficiency-Induced Bone Loss by Inhibiting Reactive Oxygen Species Accumulation and T Cell Activation.

    Science.gov (United States)

    Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun

    2017-05-01

    Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and

  11. Fuel shipment experience, fuel movements from the BMI-1 transport cask

    International Nuclear Information System (INIS)

    Bauer, Thomas L.; Krause, Michael G.

    1986-01-01

    The University of Texas at Austin received two shipments of irradiated fuel elements from Northrup Aircraft Corporation on April 11 and 16, 1985. A total of 59 elements consisting of standard and instrumented TRIGA fuel were unloaded from the BMI-1 shipping cask. At the time of shipment, the Northrup core burnup was approximately 50 megawatt days with fuel element radiation levels, after a cooling time of three months, of approximately 1.75 rem/hr at 3 feet. In order to facilitate future planning of fuel shipment at the UT facility and other facilities, a summary of the recent transfer process including several factors which contributed to its success are presented. Numerous color slides were made of the process for future reference by UT and others involved in fuel transfer and handling of the BMI-1 cask

  12. Determination of the energy requirements in mechanically ventilated critically ill elderly patients in different BMI groups using the Harris–Benedict equation

    Directory of Open Access Journals (Sweden)

    Pi-Hui Hsu

    2018-04-01

    Full Text Available Background: Due to studies on calorie requirement in mechanically ventilated critically ill elderly patients are few, and indirect calorimetry (IC is not available in every intensive care unit (ICU. The aim of this study was to compare IC and Harris–Benedict (HB predictive equation in different BMI groups. Methods: A total of 177 mechanically ventilated critically ill elderly patients (≧65 years old underwent IC for measured resting energy expenditure (MREE. Estimated calorie requirement was calculated by the HB equation, using actual body weight (ABW and ideal body weight (IBW separately. Patients were divided into four BMI groups. One-way ANOVA and Pearson's correlation coefficient were used for statistical analyses. Results: The mean MREE was 1443.6 ± 318.2 kcal/day, HB(ABW was 1110.9 ± 177.0 kcal/day and HB(IBW was 1101.5 ± 113.1 kcal/day. The stress factor (SFA = MREE ÷ HB(ABW was 1.43 ± 0.26 for the underweight, 1.30 ± 0.27 for the normal weight, 1.20 ± 0.19 for the overweight, and 1.20 ± 0.31 for the obese. The SFI (SFI = MREE ÷ HB(IBW was 1.24 ± 0.24 for the underweight, 1.31 ± 0.26 for the normal weight, 1.36 ± 0.21 for the overweight, and 1.52 ± 0.39 for the obese. MREE had significant correlation both with REE(ABW = HB(ABW × SFA (r = 0.46; P < 0.0001 and REE(IBW = HB(IBW × SFI (r = 0.43; P < 0.0001. Conclusion: IC is the best accurate method for assessing calorie requirement of mechanically ventilated critically ill elderly patients. When IC is not available, using the predictive HB equation is an alternative choice. Calorie requirement can be predicted by HB(ABW × 1.20–1.43 for critically ill elderly patients according to different BMI groups, or using HB(IBW × 1.24–1.52 for patients with edema, ascites or no available body weight data. Keywords: Body Mass Index, Elderly critical care, Harris–Benedict equation, Indirect calorimetry

  13. Long-term BMI and growth profiles in offspring of women with gestational diabetes.

    Science.gov (United States)

    Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W

    2018-05-01

    Gestational diabetes mellitus (GDM) is reported to be associated with childhood obesity, however the magnitude of this association and relation to intrauterine growth is uncertain. We, therefore, aimed to assess whether the growth trajectories of large for gestational age (LGA) and non-LGA offspring of mothers with GDM (OGDM) are different until early adolescence. We also aimed to explore whether growth trajectories of OGDM differ from those of offspring of mothers with type 1 or 2 diabetes (ODM1, ODM2). We studied height and BMI standard deviation score (SDS) of the OGDM group, up to the age of 14 years, with subgroup analysis comparing LGA with non-LGA at birth as a reflection of the intrauterine environment. All mothers with GDM who delivered at the University Medical Center Utrecht between 1990 and 2006 were contacted to participate; informed consent was received for 104 OGDM of 93 mothers. Offspring data were collected through Dutch infant welfare centres. Recorded height and weight were converted to BMI and age- and sex-specific SDS values for Dutch children. Additionally, we compared the OGDM group with ODM1 and ODM2 groups in order to identify those offspring with the highest risk of becoming overweight. Growth trajectories were compared between non-LGA and LGA OGDM and between OGDM, ODM1 and ODM2, using a random-effects model. In the longitudinal follow-up a mean of 7.4 ± 2 measurements per infant were available. Mothers had a prepregnancy BMI of 25.8 kg/m 2 and 24% of their infants were LGA at birth. Heights of OGDM were no different from those of the Dutch Growth Study. Non-LGA OGDM showed a BMI SDS comparable with that of the reference population, with a slight increase in early adolescence. LGA OGDM had a higher BMI SDS trajectory than non-LGA OGDM and the reference population, which plateaued at around 10 years of age. Comparison of growth trajectories of OGDM, ODM1 and ODM2 showed ODM2 to have the highest trajectory followed by ODM1 and OGDM

  14. Behavioural patterns only predict concurrent BMI status and not BMI trajectories in a sample of youth in Ontario, Canada.

    Science.gov (United States)

    Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T

    2018-01-01

    Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.

  15. Anti-aging Effect of Transplanted Amniotic Membrane Mesenchymal Stem Cells in a Premature Aging Model of Bmi-1 Deficiency

    Science.gov (United States)

    Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun

    2015-01-01

    To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922

  16. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells

    International Nuclear Information System (INIS)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-01

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.

  17. Body mass index (BMI) in the Saudi population of Gassim.

    Science.gov (United States)

    Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H

    1998-01-01

    In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.

  18. BMI and Lifetime Changes in BMI and Cancer Mortality Risk

    NARCIS (Netherlands)

    Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M

    2015-01-01

    Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and

  19. Associations between parity and maternal BMI in a population-based cohort study.

    Science.gov (United States)

    Iversen, Ditte S; Kesmodel, Ulrik S; Ovesen, Per G

    2018-02-07

    We aimed to investigate the change in prevalence of overweight and obesity in pregnant Danish women from 2004 to 2012, and investigate whether increasing parity was associated with a change in body mass index (BMI) prevalence. We obtained a population-based cohort from the Danish Medical Birth Registry consisting of all Danish women giving birth in 2004-2012 (n = 572 321). This registry contains information on 99.8% of all births in Denmark. We calculated the overall change in prepregnancy BMI status among pregnant women in Denmark, and a multiple linear regression model with adjustment for several potential confounders was used to examine the change in prepregnancy BMI with increasing parity. In 2004, the prevalence of prepregnancy overweight and obesity (BMI ≥ 25) and obesity alone (BMI ≥ 30) was 31.9 and 11%, respectively. In 2012, the prevalence had reached 34.2 and 12.8%. The mean BMI increased for every additional parity from 23.80 (95% CI 23.77-23.82) in parity group 1 to 26.70 (26.52-26.90) in parity group 5+. A multiple linear regression adjusted for potential confounders showed that women on average gained 0.62 (0.58-0.65) BMI units after every additional birth. This study showed a 7.2% increase in overweight and obesity (BMI ≥ 25) and a 16.4% increase in obesity alone (BMI ≥ 30) for pregnant women in Denmark from 2004 to 2012. In addition, an increase in interpregnancy BMI was seen at every additional delivery, suggesting that obesity is an increasing challenge in obstetrics. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.

  20. Evidence for a relationship between VEGF and BMI independent of insulin sensitivity by glucose clamp procedure in a homogenous group healthy young men.

    Directory of Open Access Journals (Sweden)

    Michaela Loebig

    Full Text Available BACKGROUND: This is the first study to experimentally explore the direct relationship between circulating VEGF levels and body mass index (BMI as well as to unravel the role of insulin sensitivity in this context under standardized glucose clamp conditions as the methodical gold-standard. In order to control for known influencing factors such as gender, medication, and arterial hypertension, we examined a highly homogeneous group of young male subjects. Moreover, to encompass also subjects beyond the normal BMI range, low weight and obese participants were additionally included and stress hormones as a main regulator of VEGF were assessed. METHODOLOGY/PRINCIPAL FINDINGS: Under euglycemic clamp conditions, VEGF was measured in 15 normal weight (BMI 20-25 kg/m(2, 15 low weight (BMI30 kg/m(2 male subjects aged 18-30 years and the insulin sensitivity index (ISI was calculated. Since stress axis activation promotes VEGF secretion, concentrations of ACTH, cortisol, and catecholamines were monitored. Despite of comparable ACTH (P = 0.145, cortisol (P = 0.840, and norepinephrine (P = 0.065 levels, VEGF concentrations differed significantly between BMI-groups (P = 0.008 with higher concentrations in obese subjects as compared to normal weight (P = 0.061 and low weight subjects (P = 0.002. Pearson's correlation analysis revealed a positive relationship between BMI and VEGF levels (r = 0.407; P = 0.010 but no correlation of VEGF with ISI (r = 0.224; P = 0.175. CONCLUSIONS/SIGNIFICANCE: Our data demonstrate a positive correlation between concentrations of circulating VEGF levels and BMI in healthy male subjects under highly controlled conditions. This relationship which is apparently disconnected from insulin sensitivity may be part of some pathogenetic mechanisms underlying obesity and type 2 diabetes.

  1. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells.

    Science.gov (United States)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-22

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Human milk insulin is related to maternal plasma insulin and BMI: but other components of human milk do not differ by BMI.

    Science.gov (United States)

    Young, B E; Patinkin, Z; Palmer, C; de la Houssaye, B; Barbour, L A; Hernandez, T; Friedman, J E; Krebs, N F

    2017-09-01

    The impact of maternal BMI and insulin sensitivity on bioactive components of human milk (HM) is not well understood. As the prevalence of obesity and diabetes rises, it is increasingly critical that we understand how maternal BMI and hormones associated with metabolic disease relate to concentrations of bioactive components in HM. This longitudinal cohort design followed 48 breastfeeding mothers through the first four months of lactation, collecting fasting morning HM samples at 2-weeks and 1, 2, 3 and 4-months, and fasting maternal blood at 2-weeks and 4-months. Insulin, glucose, adipokines leptin and adiponectin, appetite regulating hormone ghrelin, marker of oxidative stress 8OHdG and inflammatory cytokines (IL-6, IL-8, and TNF-a) were measured in HM and maternal plasma. A total of 26 normal weight (NW) (BMI=21.4±2.0 kg/m 2 ) and 22 overweight/obese (OW/Ob) (BMI=30.4±4.2 kg/m 2 ) were followed. Of all HM analytes measured, only insulin and leptin were different between groups - consistently higher in the OW/Ob group (leptin: P<0.001; insulin: P<0.03). HM insulin was 98% higher than maternal plasma insulin at 2-weeks and 32% higher at 4-months (P<0.001). Maternal fasting plasma insulin and HOMA-IR were positively related to HM insulin at 2-weeks (P<0.001, R 2 ⩾0.38, n=31), and 4-months (P⩽0.005, R 2 ⩾0.20, n=38). The concentrations of insulin in HM are higher than in maternal plasma and are related to maternal BMI and insulin sensitivity. With the exception of leptin, there were minimal other differences observed in HM composition across a wide range in maternal BMI.

  3. Polycomb Group Proteins RING1A and RING1B Regulate the Vegetative Phase Transition in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Jian Li

    2017-05-01

    Full Text Available Polycomb group (PcG protein-mediated gene silencing is a major regulatory mechanism in higher eukaryotes that affects gene expression at the transcriptional level. Here, we report that two conserved homologous PcG proteins, RING1A and RING1B (RING1A/B, are required for global H2A monoubiquitination (H2Aub in Arabidopsis. The mutation of RING1A/B increased the expression of members of the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL gene family and caused an early vegetative phase transition. The early vegetative phase transition observed in ring1a ring1b double mutant plants was dependent on an SPL family gene, and the H2Aub status of the chromatin at SPL locus was dependent on RING1A/B. Moreover, mutation in RING1A/B affected the miRNA156a-mediated vegetative phase transition, and RING1A/B and the AGO7-miR390-TAS3 pathway were found to additively regulate this transition in Arabidopsis. Together, our results demonstrate that RING1A/B regulates the vegetative phase transition in Arabidopsis through the repression of SPL family genes.

  4. MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

    Science.gov (United States)

    Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

    2018-03-01

    Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

  5. Physical Activity, BMI, and Blood Pressure in US Youth: NHANES 2003-2006.

    Science.gov (United States)

    Betz, Heather Hayes; Eisenmann, Joey C; Laurson, Kelly R; DuBose, Katrina D; Reeves, Mathew J; Carlson, Joseph J; Pfeiffer, Karin A

    2018-03-15

    The objective of this study was to examine the independent and combined association of physical activity and body mass index (BMI) with blood pressure in youth. Youth aged 8-18 years from the 2003-2006 National Health and Nutrition Examination Survey (NHANES) with BMI, blood pressure, and physical activity (accelerometer) were included in the analyses. A total of 2585 subjects (1303 males; 47% of all 8- to 18-year-olds) met these criteria. Obese youth had a systolic blood pressure that was 8 mm Hg higher than normal weight youth. A significant interaction between BMI and physical activity on blood pressure was found (P < .001), and group differences among the BMI/activity groups showed that the 3 obese groups and the overweight/least active group had significantly higher systolic blood pressure than the normal weight/active group across all analyses. The overweight/least active and normal weight/least active groups had significantly higher diastolic blood pressure than the normal weight/active group as well. This study showed a significant independent and combined association of BMI and physical activity with blood pressure in youth. Interventions need to focus on the reduction of fatness/BMI as a way to reduce the cardiovascular risk in youth.

  6. SSX and the synovial-sarcoma-specific chimaeric protein SYT-SSX co-localize with the human Polycomb group complex.

    Science.gov (United States)

    Soulez, M; Saurin, A J; Freemont, P S; Knight, J C

    1999-04-29

    Chromosome translocation t(X;18)(p11.2;q11.2) is unique to synovial sarcomas and results in an 'in frame' fusion of the SYT gene with the SSX1 or closely-related SSX2 gene. Wild-type SYT and SSX proteins, and the SYT-SSX chimaeric proteins, can modulate transcription in gene reporter assays. To help elucidate the role of these proteins in cell function and neoplasia we have performed immunolabelling experiments to determine their subcellular localization in three cell types. Transient expression of epitope-tagged proteins produced distinctive nuclear staining patterns. The punctate staining of SYT and SYT-SSX proteins showed some similarities. We immunolabelled a series of endogenous nuclear antigens and excluded the SYT and SYT-SSX focal staining from association with these domains (e.g. sites of active transcription, snRNPs). In further experiments we immunolabelled the Polycomb group (PcG) proteins RING1 or BMI-1 and showed that SSX and SYT-SSX proteins, but not SYT, co-localized with these markers. Consistent with this we show that SSX and SYT-SSX associate with chromatin, and also associate with condensed chromatin at metaphase. Noteably, SSX produced a dense signal over the surface of metaphase chromosomes whereas SYT-SSX produced discrete focal staining. Our data indicate that SSX and SYT-SSX proteins are recruited to nuclear domains occupied by PcG complexes, and this provides us with a new insight into the possible function of wild-type SSX and the mechanism by which the aberrant SYT-SSX protein might disrupt fundamental mechanisms controlling cell division and cell fate.

  7. Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*

    Science.gov (United States)

    Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long

    2013-01-01

    Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

  8. The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells

    DEFF Research Database (Denmark)

    Bracken, Adrian P; Kleine-Kohlbrecher, Daniela; Dietrich, Nikolaj

    2007-01-01

    The p16INK4A and p14ARF proteins, encoded by the INK4A-ARF locus, are key regulators of cellular senescence, yet the mechanisms triggering their up-regulation are not well understood. Here, we show that the ability of the oncogene BMI1 to repress the INK4A-ARF locus requires its direct association...... and is dependent on the continued presence of the EZH2-containing Polycomb-Repressive Complex 2 (PRC2) complex. Significantly, EZH2 is down-regulated in stressed and senescing populations of cells, coinciding with decreased levels of associated H3K27me3, displacement of BMI1, and activation of transcription...

  9. Cleavage of group 1 coronavirus spike proteins: how furin cleavage is traded off against heparan sulfate binding upon cell culture adaptation

    NARCIS (Netherlands)

    Haan, de C.A.M.; Haijema, B.J.; Schellen, P.; Wichgers Schreur, P.J.; Lintelo, te E.; Vennema, H.; Rottier, P.J.M.

    2008-01-01

    A longstanding enigmatic feature of the group 1 coronaviruses is the uncleaved phenotype of their spike protein, an exceptional property among class I fusion proteins. Here, however, we show that some group 1 coronavirus spike proteins carry a furin enzyme recognition motif and can actually be

  10. Polycomb Group Protein YY1 Is an Essential Regulator of Hematopoietic Stem Cell Quiescence

    Directory of Open Access Journals (Sweden)

    Zhanping Lu

    2018-02-01

    Full Text Available Yin yang 1 (YY1 is a ubiquitous transcription factor and mammalian polycomb group protein (PcG with important functions to regulate embryonic development, lineage differentiation, and cell proliferation. YY1 mediates stable PcG-dependent transcriptional repression via recruitment of PcG proteins that catalyze histone modifications. Many questions remain unanswered regarding how cell- and tissue-specificity is achieved by PcG proteins. Here, we demonstrate that a conditional knockout of Yy1 in hematopoietic stem cells (HSCs decreases long-term repopulating activity and ectopic YY1 expression expands HSCs. Although the YY1 PcG domain is required for Igκ chain rearrangement in B cells, the YY1 mutant lacking the PcG domain retained the capacity to stimulate HSC self-renewal. YY1 deficiency deregulated the genetic network governing HSC cell proliferation and impaired stem cell factor/c-Kit signaling, disrupting mechanisms conferring HSC quiescence. These results reveal a mechanism for how a ubiquitously expressed transcriptional repressor mediates lineage-specific functions to control adult hematopoiesis.

  11. Are genes associated with energy metabolism important in asthma and BMI?

    Science.gov (United States)

    Szczepankiewicz, Aleksandra; Breborowicz, Anna; Sobkowiak, Paulina; Popiel, Anna

    2009-02-01

    Increased serum leptin levels have been observed in asthmatic patients. Leptin, via proliferation and activation of Th2 cells, may induce inflammation in asthma. It has also been demonstrated that leptin mRNA expression and protein levels increase in response to inflammatory stimuli. We hypothesized that polymorphisms in the leptin receptor, leptin and ghrelin genes, may affect their expression and, therefore, be responsible for altered response to increased leptin levels observed in asthma. To our knowledge, there were no studies on a potential role of LEPR, LEP, and GHRL polymorphisms in asthma. We analyzed 129 pediatric patients with asthma and 114 healthy children from the control group ranging from 6 to 18 years of age. The diagnosis of allergic asthma was based on clinical symptoms, the lung function test, and the positive skin prick test and/or increased immunoglobulin E (IgE) levels. Polymorphisms were genotyped by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Statistical analyses were performed with Statistica v.7.1 software (Statistica, StatSoft, Poland; available free at http://www.broad.mit.edu/mpg/haploview/index.php). Linkage disequilibrium analysis was performed with Haploview v.4.0. We observed a statistically significant association of the 3'UTR A/G and the -2549A/G polymorphisms of the leptin gene with asthma. No association with asthma was observed for the K109R and the Q223R polymorphisms of the LEPR gene and the Met72Leu polymorphism of the ghrelin gene. In the analysis of body mass index (BMI) stratified by genotype, we found an association of the -2549A/G LEP, but not of LEPR and GHRL polymorphisms, with higher BMI values in asthmatic patients. We found suggestive evidence for linkage between the two polymorphisms of the LEPR gene (D' = 0.84 CI: 0.71-0.92; r(2) = 0.29) in linkage disequilibrium analysis: The GG haplotype was more frequent in the control healthy group (p = 0.057). No linkage

  12. Expression and Clinicopathological Significance of Mel-18 and Bmi-1 in Esophageal Squamous Cell Carcinoma.

    Science.gov (United States)

    Ji, Huaijun; Cao, Ming; Ren, Kunlun; Sun, Ningbo; Wang, Wei; Zhu, Qiang; Zang, Qi; Jiang, Zhongmin

    2017-01-01

    The Polycomb group genes are a general class of regulators that are responsible for maintaining homeotic gene expression throughout cell division. Polycomb group expression plays an important role in oncogenesis of several types of human cancer. Melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 are key Polycomb group proteins. Studies have shown that melanoma nuclear protein 18 is a potential tumor suppression, and B-cell-specific Moloney leukemia virus insert site 1 is overexpressed in several human malignancies. However, the roles of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in esophageal squamous cell carcinoma are still unclear. In this study, we analyzed the expression levels of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in 89 esophageal cancer tissues and paired normal mucosal tissues using immunohistochemistry, Western blotting, and quantitative real-time polymerase chain reaction analyses. We found that the expression of melanoma nuclear protein 18 in the carcinoma tissues was significantly lower than that in the noncancerous mucosal tissues ( P .05). B-cell-specific Moloney leukemia virus insert site 1 expression was strongly correlated with the degree of differentiation, clinical stage, and lymph node metastasis ( P .05). Moreover, there was a negative correlation between melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 expressions in esophageal squamous cell carcinoma ( P < .05). Our study suggests that melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 may play a crucial role in esophageal squamous cell carcinoma. Melanoma nuclear protein 18 or B-cell-specific Moloney leukemia virus insert site 1 may be a potential biomarker for diagnosis and prognosis of esophageal squamous cell carcinoma.

  13. BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.

    Science.gov (United States)

    Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G

    2018-01-01

    Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.

  14. Acute myeloid leukemia stem cell markers in prognosis and targeted therapy: potential impact of BMI-1, TIM-3 and CLL-1.

    Science.gov (United States)

    Darwish, Noureldien H E; Sudha, Thangirala; Godugu, Kavitha; Elbaz, Osama; Abdelghaffar, Hasan A; Hassan, Emad E A; Mousa, Shaker A

    2016-09-06

    Acute myeloid leukemia (AML) patients show high relapse rates and some develop conventional chemotherapy resistance. Leukemia Stem Cells (LSCs) are the main player for AML relapses and drug resistance. LSCs might rely on the B-cell-specific Moloney murine leukemia virus integration site-1 (BMI-1) in promoting cellular proliferation and survival. Growth of LSCs in microenvironments that are deprived of nutrients leads to up-regulation of the signaling pathways during the progression of the disease, which may illustrate the sensitivity of LSCs to inhibitors of those signaling pathways as compared to normal cells. We analyzed the expression of LSC markers (CD34, CLL-1, TIM-3 and BMI-1) using quantitative RT-PCR in bone marrow samples of 40 AML patients of different FAB types (M1, M2, M3, M4, M5, and M7). We also studied the expression of these markers in 2 AML cell lines (Kasumi-1 and KG-1a) using flow cytometry and quantitative RT-PCR. The overexpression of TIM-3, CLL-1, and BMI-1 was markedly correlated with poor prognosis in these patients. Our in vitro findings demonstrate that targeting BMI-1, which markedly increased in the leukemic cells, was associated with marked decrease in leukemic burden. This study also presents results for blocking LSCs' surface markers CD44, CLL-1, and TIM-3. These markers may play an important role in elimination of AML. Our study indicates a correlation between the expression of markers TIM-3, CLL-1, and especially of BMI-1 and the aggressiveness of AML and thus the potential impact of prognosis and therapies that target LSCs on improving the cure rates.

  15. Dietary intake in the early years and its relationship to BMI in a bi-ethnic group: the Born in Bradford 1000 study.

    Science.gov (United States)

    Mahoney, Samuel; Bryant, Maria; Sahota, Pinki; Barber, Stuart

    2018-04-02

    To assess relationships between dietary intake at age 12, 18 and 36 months and BMI Z-scores at age 36 months in a bi-ethnic group. A prospective cohort study comparing cross-sectional and longitudinal data. Exposures included dietary intake at 12, 18 and 36 months (FFQ) with an outcome of BMI Z-score at age 36 months. Born in Bradford 1000 study, Bradford, UK. Infants at age 12 months (n 722; 44 % White British, 56 % Pakistani), 18 months (n 779; 44 % White British, 56 % Pakistani) and 36 months (n 845; 45 % White British, 55 % Pakistani). Diet at age 12 months was not associated with BMI Z-score at age 36 months. Higher consumption of vegetables at 18 and 36 months was associated with a lower BMI Z-score at 36 months (model coefficient (95 % CI): -0·20 (-0·36, -0·03) and -0·16 (-0·31, -0·02), respectively). Higher consumption of high-fat chips at age 36 months was associated with a lower BMI Z-score at age 36 months (-0·16 (-0·32, 0·00)). Overall, White British children had higher 36-month BMI Z-scores than Pakistani children (adjusted mean difference (95 % CI): 0·21 (0·02, 0·41)). Our findings indicate that dietary intake at 18 and 36 months was somewhat related to BMI Z-score at age 36 months and suggest the importance of early interventions aimed at establishing healthy eating behaviours.

  16. BMI Trajectories from Birth to Young Adulthood.

    Science.gov (United States)

    McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K

    2018-04-19

    This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.

  17. High-Sensitive C-Reactive Protein Levels in a Group of Syrian University Male Students and Its Associations with Smoking, Physical Activity, Anthropometric Measurements, and Some Hematologic Inflammation Biomarkers

    Directory of Open Access Journals (Sweden)

    Wafika Zarzour

    2017-01-01

    Full Text Available In Syria, health risk data on young males are limited. Hence, the aim of the present study was to evaluate cardiovascular disease (CVD risk factors along with C-reactive protein levels measured by high-sensitive method (hsCRP in a group of healthy males of university students (n=101, 18–25 years old. Participants’ anthropometric characteristics; alcohol drinking, smoking, and physical activity habits; parents medical history; and some inflammatory biomarkers were inspected for their associations with hsCRP. Results. Regarding hsCRP level, 19 participants were at average (1–3 mg/L and 13 were at high (>3 mg/L risk of CVD. Nonparametric statistical tests (p value < 0.05 revealed that hsCRP level was higher in participants who had high body mass index (BMI, had high BMI with high waist-to-hip ratio (WHR, or did not practice sport frequently. Unexpectedly, it did not vary between smokers and nonsmokers. In general, it correlated positively with anthropometric and erythrocyte sedimentation rate (ESR measurements. Nevertheless, it negatively correlated with sports practicing in overall and nonsmoker groups and in participants whose parents were without medical history. Finally, when participants with high BMI were smokers, did not practice sport frequently, or had a parent with medical history, their hsCRP levels were higher than others who had the same circumstances but with low BMI.

  18. Lower Circulating C1q/TNF-Related Protein-3 (CTRP3 Levels Are Associated with Obesity: A Cross-Sectional Study.

    Directory of Open Access Journals (Sweden)

    Risa M Wolf

    Full Text Available C1q/TNF-related protein-3 (CTRP3 is a novel adipokine that lowers blood glucose levels, reduces liver triglyceride synthesis, and is protective against hepatic steatosis in diet-induced obese mouse models. We hypothesized that higher circulating serum levels of CTRP3 would be associated with a lean body mass index (BMI and a more favorable metabolic profile in humans. The aim of this study was to investigate CTRP3 levels in lean individuals compared to obese individuals.This was a cross-sectional study of obese (n=44 and lean control patients (n=60. Fasting metabolic parameters were measured in all patients and serum CTRP3 levels were measured by ELISA.BMI of the lean group was 21.9 ± 0.2 kg/m2 and obese group was 45.2 ± 1.1 kg/m2. We found significantly lower circulating levels of CTRP3 in obese individuals (405 ± 8.3 vs. 436 ± 6.7 ng/mL, p=0.004 compared to the lean group. Serum CTRP3 levels were inversely correlated with BMI (p=0.001, and triglycerides (p<0.001, and significantly associated with gender (p<0.01, ethnicity (p=0.05, HDL-cholesterol (p<0.01, and adiponectin (p<0.01. We found BMI (p<0.01, gender (p<0.01, and ethnicity (p<0.05 to be significant predictors of CTRP3 levels when controlling for age in multiple regression analysis.CTRP3 is a beneficial adipokine whose circulating levels are significantly lower in obese individuals. Obesity causes dysregulation in adipokine production, including the down-regulation of CTRP3. Lower CTRP3 levels may contribute to the pathophysiology of metabolic disorders associated with obesity. Optimizing CTRP3 levels through novel therapies may improve obesity and its comorbidities.

  19. The impact of sex and BMI on the clinical course of COPD and bronchial asthma

    Directory of Open Access Journals (Sweden)

    Krzysztof Wytrychowski

    2016-09-01

    Full Text Available Background. Bronchial asthma is a heterogeneous disease, and is one phenotype of asthma with obesity. Chronic obstructive pulmonary disease is the fourth most frequent cause of death in the world. Objectives. The aim of the study was to assess the influence of BMI and sex on the clinical course of uncontrolled asthma and COPD with moderate to severe airflow limitation. Material and methods . The study was performed on 2 groups. Group A: 72 adults suffering from asthma (38 F – females, 34 M – males with at least 1 exacerbation requiring treatment with systemic corticosteroids in the year before the study. Group B: 79 patients (34 F, 45 M with COPD Grades 2 and 3 according to GOLD. Data including age, gender, BMI, disease duration, treatment, concomitant diseases, pack-years, and number of exacerbations in the last year were collected. Asthma Control Questionnaire scores in group A and COPD Assessment Test scores in group B were collected. Pulmonary function tests were performed in both groups. Results . There were no differences between females and males in the analyzed variables in both groups. Obese patients (BMI > 30.0 kg/m2 were selected for analysis from group A (18 F, 10 M and from group B (13 F, 16 M. In group A, the number of exacerbations was significantly lower in males (M 1.3 vs. F 1.9; p = 0.01. In group B the age of obese patients was higher than in patients with BMI ≤ 30.0 (68.3 vs. 62.5; p = 0.002. Conclusion . Poorer control of asthma in obese patients was associated with the female gender. Age is a risk factor for obesity development in patients with COPD.

  20. Interactions of dietary protein and adiposity measures in relation to subsequent changes in body weight and waist circumference

    DEFF Research Database (Denmark)

    Ankarfeldt, Mikkel Z; Angquist, Lars; Jakobsen, Marianne Uhre

    2014-01-01

    and at follow-up about 5 years later were analyzed with multiple linear regression and dietary macronutrient substitution models. Interactions between dietary protein and baseline body mass index (BMI) and baseline WC adjusted for BMI (WCBMI ) (divided in tertiles; nine groups total), were analyzed in relation...... protein, whether replacing carbohydrate or fat, and weight change. However, individuals in the highest tertile of baseline BMI (irrespective of baseline WCBMI ) had significantly inverse change in waist circumference when protein replaced carbohydrate, but not when protein replaced fat. CONCLUSION......: Replacing carbohydrate with protein in the diet may prevent a relative increase in WC in individuals with a greater BMI....

  1. Transcriptional regulation by Polycomb group proteins

    DEFF Research Database (Denmark)

    Di Croce, Luciano; Helin, Kristian

    2013-01-01

    Polycomb group (PcG) proteins are epigenetic regulators of transcription that have key roles in stem-cell identity, differentiation and disease. Mechanistically, they function within multiprotein complexes, called Polycomb repressive complexes (PRCs), which modify histones (and other proteins......) and silence target genes. The dynamics of PRC1 and PRC2 components has been the focus of recent research. Here we discuss our current knowledge of the PRC complexes, how they are targeted to chromatin and how the high diversity of the PcG proteins allows these complexes to influence cell identity....

  2. [PRODUCT OF THE BMI1--A KEY COMPONENT OF POLYCOMB--POSITIVELY REGULATES ADIPOCYTE DIFFERENTIATION OF MOUSE MESENCHYMAL STEM CELLS].

    Science.gov (United States)

    Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V

    2016-01-01

    Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.

  3. Prospective associations between sedentary lifestyle and BMI in midlife.

    Science.gov (United States)

    Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A

    2006-08-01

    A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.

  4. Variations in BMI and prevalence of health risks in diverse racial and ethnic populations.

    Science.gov (United States)

    Stommel, Manfred; Schoenborn, Charlotte A

    2010-09-01

    When examining health risks associated with the BMI, investigators often rely on the customary BMI thresholds of the 1995 World Health Organization report. However, within-interval variations in morbidity and mortality can be substantial, and the thresholds do not necessarily correspond to identifiable risk increases. Comparing the prevalence of hypertension, diabetes, coronary heart disease (CHD), asthma, and arthritis among non-Hispanic whites, blacks, East Asians and Hispanics, we examine differences in the BMI-health-risk relationships for small BMI increments. The analysis is based on 11 years of data of the National Health Interview Survey (NHIS), with a sample size of 337,375 for the combined 1997-2007 Sample Adult. The analysis uses multivariate logistic regression models, employing a nonparametric approach to modeling the BMI-health-risk relationship, while relying on narrowly defined BMI categories. Rising BMI levels are associated with higher levels of chronic disease burdens in four major racial and ethnic groups, even after adjusting for many socio-demographic characteristics and three important health-related behaviors (smoking, physical activity, alcohol consumption). For all population groups, except East Asians, a modestly higher disease risk was noted for persons with a BMI ethnic groups regardless of BMI levels, the evidence presented here does not support the notion that the BMI-health-risk profile of East Asians and others warrants race-specific BMI cutoff points.

  5. Dysregulation of the Bmi-1/p16Ink4a pathway provokes an aging-associated decline of submandibular gland function

    Science.gov (United States)

    Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo

    2015-01-01

    Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744

  6. Relationship of glycemic and triglycerides with BMI in diabetic patients

    International Nuclear Information System (INIS)

    Parvez, A.; Ihsanullah; Rafiq, A.; Ahmad, N.; Khan, E.H.

    2010-01-01

    Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

  7. Relationship of glycemic and triglycerides with BMI in diabetic patients

    Energy Technology Data Exchange (ETDEWEB)

    Parvez, A; Ihsanullah,; Rafiq, A; Ahmad, N; Khan, E H [Khyber Teaching Hospital, Peshawar (Pakistan). Department of Pathology

    2010-04-15

    Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

  8. Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch.

    Science.gov (United States)

    López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca; Guiu, Jordi; Iglesias, Mar; Roman, Angel Carlos; Gutarra, Susana; González, Susana; Muñoz-Cánoves, Pura; Fernández-Salguero, Pedro; Radtke, Freddy; Bigas, Anna; Espinosa, Lluís

    2015-01-01

    Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. To address this issue, we have generated composite tamoxifen-inducible intestine-specific genetic mouse models and analyzed the expression of intestinal differentiation markers. Importantly, we found that activation of β-catenin partially rescues the differentiation phenotype of Rbpj deletion mutants, but not the loss of the ISC compartment. Moreover, we identified Bmi1, which is expressed in the ISC and progenitor compartments, as a gene that is co-regulated by Notch and β-catenin. Loss of Bmi1 resulted in reduced proliferation in the ISC compartment accompanied by p16(INK4a) and p19(ARF) (splice variants of Cdkn2a) accumulation, and increased differentiation to the post-mitotic goblet cell lineage that partially mimics Notch loss-of-function defects. Finally, we provide evidence that Bmi1 contributes to ISC self-renewal. © 2015. Published by The Company of Biologists Ltd.

  9. Maternal Pre-pregnancy BMI and Reproductive Health of Daughters in Young Adulthood

    DEFF Research Database (Denmark)

    Mariansdatter, Saga Elise; Ernst, Andreas; Toft, Gunnar

    2016-01-01

    Objective To investigate the possible associations between maternal pre-pregnancy body mass index (BMI) and daughters' age of menarche and subsequent markers of reproductive health. Methods Nine hundred eighty-five pregnant women (80 %) were enrolled at their routine 30th week examinations in 1988...... dehydroepiandrosterone-sulphate (DHEAS), estradiol, and free estrogen index (FEI), compared to the middle BMI tertile. This was supported by a sub-analysis using the WHO classification (underweight, BMI obese, BMI ≥ 25.00 kg/m2) as exposure groups, in which daughters...... of overweight mothers had lower levels of DHEAS and estradiol, and lower FEI compared to daughters of normal weight mothers. No associations were found for ovarian follicle count in any of the groups. Conclusions for Practice We found that higher maternal BMI is associated with earlier age of menarche...

  10. Inter-individual inequality in BMI: An analysis of Indonesian Family Life Surveys (1993–2007

    Directory of Open Access Journals (Sweden)

    Masoud Vaezghasemi

    2016-12-01

    Full Text Available Widening inequalities in mean Body Mass Index (BMI between social and economic groups are well documented. However, whether changes in mean BMI are followed by changes in dispersion (or variance and whether these inequalities are also occurring within social groups or across individuals remain understudied. In addition, a substantial body of literature exists on the global increase in mean BMI and prevalence of overweight and obesity. However, whether this weight gain is shared proportionately across the whole spectrum of BMI distribution, also remains understudied. We examined changes in the distribution of BMI at the population level over time to understand how changes in the dispersion reflect between-group compared to within-group inequalities in weight gain. Moreover, we investigated the entire distribution of BMI to determine in which percentiles the most weight gain is occurring over time. Utilizing four waves (from 1993 to 2007 of Indonesian Family Life Surveys (IFLS, we estimated changes in the mean and the variance of BMI over time and across various socioeconomic groups based on education and households’ expenditure per capita in 53,648 men and women aged 20–50 years. An increase in mean and standard deviation was observed among men (by 4.3% and 25%, respectively and women (by 7.3% and 20%, respectively over time. Quantile-Quantile plots showed that higher percentiles had greater increases in BMI compared to the segment of the population at lower percentiles. While between socioeconomic group differences decreased over time, within-group differences increased and were more prominent among individuals with poor education and lower per capita expenditures. Population changes in BMI cannot be fully described by average trends or single parameters such as the mean BMI. Moreover, greater increases in within-group dispersion compared with between-group differences imply that growing inequalities are not merely driven by these

  11. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    International Nuclear Information System (INIS)

    Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc

    2012-01-01

    Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive

  12. Cost of fertility treatment and live birth outcome in women of different ages and BMI.

    Science.gov (United States)

    Pandey, Shilpi; McLernon, David J; Scotland, Graham; Mollison, Jill; Wordsworth, Sarah; Bhattacharya, Siladitya

    2014-10-10

    What is the impact of different age and BMI groups on total investigation and treatment costs in women attending a secondary/tertiary care fertility clinic? Women in their early to mid-30s and women with normal BMI had higher cumulative investigation and treatment costs, but also higher probability of live birth. Female age and BMI have been used as criteria for rationing publically funded fertility treatments. Population-based data on the costs of investigating and treating infertility are lacking. A retrospective cohort study of 2463 women was conducted in a single secondary/tertiary care fertility clinic in Aberdeen, Scotland from 1998 to 2008. Participants included all women living in a defined geographical area referred from primary care to a specialized fertility clinic over an 11-year period. Women were followed up for 5 years or until live birth if this occurred sooner. Mean discounted cumulative National Health Service costs (expressed in 2010/2011 GBP) of fertility investigations, treatments (including all types of assisted reproduction), and pregnancy (including delivery episode) and neonatal admissions were calculated and summarized by age (≤ 30, 31-35, 36-40, >40 years) and BMI groupings (years, with 694 (55.1%) of these being natural conceptions. The live birth rate was highest among women in the youngest age group (64.3%), and lowest in those aged >40 years (13.4%). Overall live birth rates were generally lower in women with BMI >30 kg/m(2). The total costs of investigations were generally highest among women younger than 30 years (£491 in those with normal BMI), whilst treatment costs tended to be higher in 31-35 year olds (£1,840 in those with normal BMI). Multivariate modelling predicted a cost increase associated with treatment which was highest among women in the lowest BMI group (across all ages), and also highest among women aged 31-35 years. The increase in the predicted probability of live birth with exposure to treatment was consistent

  13. Comparison of High-Protein, Intermittent Fasting Low-Calorie Diet and Heart Healthy Diet for Vascular Health of the Obese.

    Science.gov (United States)

    Zuo, Li; He, Feng; Tinsley, Grant M; Pannell, Benjamin K; Ward, Emery; Arciero, Paul J

    2016-01-01

    It has been debated whether different diets are more or less effective in long-term weight loss success and cardiovascular disease prevention among men and women. To further explore these questions, the present study evaluated the combined effects of a high-protein, intermittent fasting, low-calorie diet plan compared with a heart healthy diet plan during weight loss, and weight loss maintenance on blood lipids and vascular compliance of obese individuals. The experiment involved 40 obese adults (men, n = 21; women, n = 19) and was divided into two phases: (a) 12-week high-protein, intermittent fasting, low-calorie weight loss diet comparing men and women (Phase 1) and (b) a 1-year weight maintenance phase comparing high-protein, intermittent fasting with a heart healthy diet (Phase 2). Body weight, body mass index (BMI), blood lipids, and arterial compliance outcomes were assessed at weeks 1 (baseline control), 12 (weight loss), and 64 (12 + 52 week; weight loss maintenance). At the end of weight loss intervention, concomitant reductions in body weight, BMI and blood lipids were observed, as well as enhanced arterial compliance. No sex-specific differences in responses were observed. During phase 2, the high-protein, intermittent fasting group demonstrated a trend for less regain in BMI, low-density lipoprotein (LDL), and aortic pulse wave velocity than the heart healthy group. Our results suggest that a high-protein, intermittent fasting and low-calorie diet is associated with similar reductions in BMI and blood lipids in obese men and women. This diet also demonstrated an advantage in minimizing weight regain as well as enhancing arterial compliance as compared to a heart healthy diet after 1 year.

  14. BMI percentile-for-age overestimates adiposity in early compared with late maturing pubertal children

    DEFF Research Database (Denmark)

    Sørensen, Kaspar; Juul, Anders

    2015-01-01

    and bioelectric impedance analyses (BIA) were used to estimate adiposity. Clinical pubertal markers (Tanner stages and testicular volume) were evaluated. LH, FSH, estradiol, testosterone, SHBG and IGF1 levels were determined by immunoassays. RESULTS: In all age groups, higher BMI (all 1 year age-groups, P ≤ 0...

  15. The impact of follicular fluid adiponectin and ghrelin levels based on BMI on IVF outcomes in PCOS.

    Science.gov (United States)

    Inal, H A; Yilmaz, N; Gorkem, U; Oruc, A S; Timur, H

    2016-04-01

    This study aimed at evaluating the effects of polycystic ovary syndrome (PCOS) and body mass index (BMI) on follicular fluid (FF) adiponectin and ghrelin levels, and on in vitro fertilization outcomes in patients who underwent controlled ovarian hyperstimulation. This prospective cross-sectional study was performed with a total of 120 primary infertile women [group 1; non-PCOS = 60 (BMI PCOS = 60 (BMI lean PCOS group than the lean non-PCOS group (p = 0.001), and these levels were lower in the overweight non-PCOS group compared to lean non-PCOS group (0.001). However, there was no difference in the FF ghrelin levels between the groups. Additionally, we could not find a relationship between clinical pregnancy and adiponectin and ghrelin levels. The FF adiponectin and ghrelin levels have no effects on clinical pregnancy in PCOS. Therefore, further studies are needed to elucidate this issue.

  16. Effect of weight, height and BMI on injury outcome in side impact crashes without airbag deployment.

    Science.gov (United States)

    Pal, Chinmoy; Tomosaburo, Okabe; Vimalathithan, K; Jeyabharath, M; Muthukumar, M; Satheesh, N; Narahari, S

    2014-11-01

    A comprehensive analysis is performed to evaluate the effect of weight, height and body mass index (BMI) of occupants on side impact injuries at different body regions. The accident dataset for this study is based on the National Automotive Sampling System-Crashworthiness Data System (NASS-CDS) for accident year 2000-08. The mean BMI values for driver and front passenger are estimated from all types of crashes using NASS database, which clearly indicates that mean BMI has been increasing over the years in the USA. To study the effect of BMI in side impact injuries, BMI was split into three groups namely (1) thin (BMI30). For more clear identification of the effect of BMI in side impact injuries, a minimum gap of three BMI is set in between each adjacent BMI groups. Car model years from MY1995-1999 to MY2000-2008 are chosen in order to identify the degree of influence of older and newer generation of cars in side impact injuries. Impact locations particularly side-front (F), side-center (P) and side-distributed (Y) are chosen for this analysis. Direction of force (DOF) considered for both near side and far side occupants are 8 o'clock, 9 o'clock, 10 o'clock and 2 o'clock, 3 o'clock and 4 o'clock respectively. Age <60 years is also one of the constraints imposed on data selection to minimize the effect of bone strength on the occurrence of occupant injuries. AIS2+ and AIS3+ injury risk in all body regions have been plotted for the selected three BMI groups of occupant, delta-V 0-60kmph, two sets (old and new) of car model years. The analysis is carried with three approaches: (a) injury risk percentage based on simple graphical method with respect to a single variable, (b) injury distribution method where the injuries are marked on the respective anatomical locations and (c) logistic regression, a statistical method, considers all the related variables together. Lower extremity injury risk appears to be high for thin BMI group. It is found that BMI does not have much

  17. [Body image dissatisfaction as a mediator of the association between BMI, self-esteem and mental health in early adolescents: a multiple-group path analysis across gender].

    Science.gov (United States)

    Jang, Mi Heui; Lee, Gyungjoo

    2013-04-01

    This study was done to examine not only the relationships between body mass index (BMI), self-esteem, body image dissatisfaction (BID) and mental health, according to gender, but the mediating role of BID on mental health in relation to BMI and self-esteem among early adolescents. Data from 576 (296 boys and 280 girls) elementary school students in grades 5 to 6 were collected. A multiple-group path analysis was utilized to examine the relationships between BMI, self-esteem, BID and mental health by gender. In the path analysis for all students, poor mental health was related directly to BID, while it was indirectly related to BMI and self-esteem. In the multiple-group path analysis of both genders, BID was found to have a significant direct and indirect effect on mental health for girls alone. The findings suggested that BID should be examined early to prevent poor mental health in early adolescent girls. This study helps to elucidate the role of early adolescent BID on mental health and provides insight for further prevention and intervention programs in school and community mental health settings.

  18. A comparison of chewing rate between overweight and normal BMI individuals.

    Science.gov (United States)

    White, Amy Kristin; Venn, Bernard; Lu, Louise Weiwei; Rush, Elaine; Gallo, Luigi Maria; Yong, Janet Lee Ching; Farella, Mauro

    2015-06-01

    Previous attempts to identify an 'obese eating style' have led to conflicting findings. This observational study compared the chewing features of overweight or obese young adults with those of normal range BMI. We hypothesised that chewing features are individual-specific and differ between participants of a normal BMI and high BMI. Fourteen overweight to obese participants (BMI≥25.0) were pairwise matched with 14 normal range BMI participants (18.5chewing episodes, including rate, duration, and power. Masticatory performance was assessed by a sieve test and was expressed as the percentage of particles ≤2mm after a standardised chewing test. Regardless of the meal, chewing rate was remarkably consistent among participants (ICC=0.89; 95% CI=0.79-0.94). Chewing rate did not differ between high and normal BMI participants (p>0.05), whereas chewing power was significantly higher in high BMI participants (pchewing characteristics were found between BMI groups. Participants chewed at similar rate in the natural environment (pizza) and in the laboratory (rice) setting (p>0.05). Masticatory performance did not differ significantly (p>0.05) between the high (55.9%) and normal (52.4%) BMI groups. Within the limitations of the present study, chewing characteristics appear to be individual-specific with wide variability. Overweight participants chew at a similar rate to control participants, albeit slightly stronger. Our preliminary findings need to be replicated in larger samples. Copyright © 2015. Published by Elsevier Inc.

  19. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    Energy Technology Data Exchange (ETDEWEB)

    Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture

  20. High mobility group A1 protein modulates autophagy in cancer cells.

    Science.gov (United States)

    Conte, Andrea; Paladino, Simona; Bianco, Gaia; Fasano, Dominga; Gerlini, Raffaele; Tornincasa, Mara; Renna, Maurizio; Fusco, Alfredo; Tramontano, Donatella; Pierantoni, Giovanna Maria

    2017-11-01

    High Mobility Group A1 (HMGA1) is an architectural chromatin protein whose overexpression is a feature of malignant neoplasias with a causal role in cancer initiation and progression. HMGA1 promotes tumor growth by several mechanisms, including increase of cell proliferation and survival, impairment of DNA repair and induction of chromosome instability. Autophagy is a self-degradative process that, by providing energy sources and removing damaged organelles and misfolded proteins, allows cell survival under stress conditions. On the other hand, hyper-activated autophagy can lead to non-apoptotic programmed cell death. Autophagy deregulation is a common feature of cancer cells in which has a complex role, showing either an oncogenic or tumor suppressor activity, depending on cellular context and tumor stage. Here, we report that depletion of HMGA1 perturbs autophagy by different mechanisms. HMGA1-knockdown increases autophagosome formation by constraining the activity of the mTOR pathway, a major regulator of autophagy, and transcriptionally upregulating the autophagy-initiating kinase Unc-51-like kinase 1 (ULK1). Consistently, functional experiments demonstrate that HMGA1 binds ULK1 promoter region and negatively regulates its transcription. On the other hand, the increase in autophagosomes is not associated to a proportionate increase in their maturation. Overall, the effects of HMGA1 depletion on autophagy are associated to a decrease in cell proliferation and ultimately impact on cancer cells viability. Importantly, silencing of ULK1 prevents the effects of HMGA1-knockdown on cellular proliferation, viability and autophagic activity, highlighting how these effects are, at least in part, mediated by ULK1. Interestingly, this phenomenon is not restricted to skin cancer cells, as similar results have been observed also in HeLa cells silenced for HMGA1. Taken together, these results clearly indicate HMGA1 as a key regulator of the autophagic pathway in cancer cells

  1. High mobility group protein DSP1 negatively regulates HSP70 transcription in Crassostrea hongkongensis

    Energy Technology Data Exchange (ETDEWEB)

    Miao, Zongyu; Xu, Delin; Cui, Miao; Zhang, Qizhong, E-mail: zhangqzdr@126.com

    2016-06-10

    HSP70 acts mostly as a molecular chaperone and plays important roles in facilitating the folding of nascent peptides as well as the refolding or degradation of the denatured proteins. Under stressed conditions, the expression level of HSP70 is upregulated significantly and rapidly, as is known to be achieved by various regulatory factors controlling the transcriptional level. In this study, a high mobility group protein DSP1 was identified by DNA-affinity purification from the nuclear extracts of Crassostrea hongkongensis using the ChHSP70 promoter as a bait. The specific interaction between the prokaryotically expressed ChDSP1 and the FITC-labeled ChHSP70 promoter was confirmed by EMSA analysis. ChDSP1 was shown to negatively regulate ChHSP70 promoter expression by Luciferase Reporter Assay in the heterologous HEK293T cells. Both ChHSP70 and ChDSP1 transcriptions were induced by either thermal or CdCl{sub 2} stress, while the accumulated expression peaks of ChDSP1 were always slightly delayed when compared with that of ChHSP70. This indicates that ChDSP1 is involved, very likely to exert its suppressive role, in the recovery of the ChHSP70 expression from the induced level to its original state. This study is the first to report negative regulator of HSP70 gene transcription, and provides novel insights into the mechanisms controlling heat shock protein expression. -- Highlights: •HMG protein ChDSP1 shows affinity to ChHSP70 promoter in Crassostrea hongkongensis. •ChDSP1 negatively regulates ChHSP70 transcription. •ChHSP70 and ChDSP1 transcriptions were coordinately induced by thermal/Cd stress. •ChDSP1 may contribute to the recovery of the induced ChHSP70 to its original state. •This is the first report regarding negative regulator of HSP70 transcription.

  2. BMI change during puberty and the risk of heart failure.

    Science.gov (United States)

    Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C

    2018-03-12

    Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.

  3. Maternal and offspring intelligence in relation to BMI across childhood and adolescence.

    Science.gov (United States)

    Wraw, Christina; Deary, Ian J; Der, Geoff; Gale, Catharine R

    2018-01-30

    The present study tested the association between both mothers' and offspring's intelligence and offspring's body mass index (BMI) in youth. Participants were members of the National Longitudinal Survey of Youth 1979 (NLSY-79) Children and Young Adults cohort (n = 11,512) and their biological mothers who were members of the NLSY-79 (n = 4932). Offspring's IQ was measured with the Peabody Individual Achievement Test (PIAT). Mothers' IQ was measured with the Armed Forces Qualification Test (AFQT). A series of regression analyses tested the association between IQ and offspring's BMI by age group, while adjusting for pre-pregnancy BMI and family SES. The analyses were stratified by sex and ethnicity (non-Black and non-Hispanic, Black, and Hispanic). The following associations were observed in the fully adjusted analyses. For the non-Blacks and non-Hispanics, a SD increment in mothers' IQ was negatively associated with daughters' BMI across all age-groups, ranging from β = -0.12 (95% CI -0.22 to -0.02, p = 0.021) in late childhood, to β = -0.17 (95% C.I. -0.27 to -0.07, p = 0001), in early adolescence and a SD increment in boys' IQ was positively associated with their BMI in early adolescence β = 0.09 (95% CI 0.01-0.18, p = 0.031). For Blacks, there was a non-linear relationship between mothers' IQ and daughters' BMI across childhood and between girls' IQ and BMI across adolescence. There was a positive association between mothers' IQ and sons' BMI in early adolescence (β = 0.17, 95% CI 0.02-0.32, p = 0.030). For Hispanic boys, there was a positive IQ-BMI association in late childhood (β = 0.19, 95% CI 0.05-0.33, p = 0.008) and early adolescence (β = 0.17, 95% CI 0.04-0.31, p = 0.014). Mothers' IQ and offspring's IQ were associated with offspring's BMI. The relationships varied in direction and strength across ethnicity, age group and sex. Obesity interventions may benefit from acknowledging the heterogeneous

  4. c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells.

    Science.gov (United States)

    Waldron, T; De Dominici, M; Soliera, A R; Audia, A; Iacobucci, I; Lonetti, A; Martinelli, G; Zhang, Y; Martinez, R; Hyslop, T; Bender, T P; Calabretta, B

    2012-04-01

    Expression of c-Myb is required for normal hematopoiesis and for proliferation of myeloid leukemia blasts and a subset of T-cell leukemia, but its role in B-cell leukemogenesis is unknown. We tested the role of c-Myb in p190(BCR/ABL)-dependent B-cell leukemia in mice transplanted with p190(BCR/ABL)-transduced marrow cells with a c-Myb allele (Myb(f/d)) and in double transgenic p190(BCR/ABL)/Myb(w/d) mice. In both models, loss of a c-Myb allele caused a less aggressive B-cell leukemia. In p190(BCR/ABL)-expressing human B-cell leukemia lines, knockdown of c-Myb expression suppressed proliferation and colony formation. Compared with c-Myb(w/f) cells, expression of Bmi1, a regulator of stem cell proliferation and maintenance, was decreased in pre-B cells from Myb(w/d) p190(BCR/ABL) transgenic mice. Ectopic expression of a mutant c-Myb or Bmi1 enhanced the proliferation and colony formation of Myb(w/d) p190(BCR/ABL) B-cells; by contrast, Bmi1 downregulation inhibited colony formation of p190(BCR/ABL)-expressing murine B cells and human B-cell leukemia lines. Moreover, c-Myb interacted with a segment of the human Bmi1 promoter and enhanced its activity. In blasts from 19 Ph(1) adult acute lymphoblastic leukemia patients, levels of c-Myb and Bmi1 showed a positive correlation. Together, these findings support the existence of a c-Myb-Bmi1 transcription-regulatory pathway required for p190(BCR/ABL) leukemogenesis.

  5. Correlation between BMI and motor coordination in children.

    Science.gov (United States)

    Lopes, Vítor P; Stodden, David F; Bianchi, Mafalda M; Maia, Jose A R; Rodrigues, Luis P

    2012-01-01

    To analyze the association between motor coordination (MC) and body mass index (BMI) across childhood and early adolescence. This study is cross-sectional. Data were collected in 7175 children (boys n=3616, girls n=3559), ages 6-14 years. BMI was calculated from measured height and weight [body mass (kg)/height (m(2))]. Motor coordination was evaluated using Kiphard-Schilling's body coordination test (KTK). Spearman's rank correlation was used to study the association between BMI and MC. A Kruskal-Wallis test was used to analyze the differences in MC between children of normal weight, overweight and obese children. Correlations between MC and BMI were negative and varied between 0.05 and 0.49. The highest negative correlations for both boys and girls was at 11 years of age. There was a general pattern of increasing negative correlations in both genders from 6 to 11 years of age and then a decrease in correlation strengths through 14 years of age. In both boys (χ(2)((2))=324.01; p<0.001) and girls (χ(2)((2))=291.20; p<0.001) there were significant differences in MC between the three groups' weight status. Normal weight children of both sexes demonstrated significantly higher MC scores than overweight. Obese children in both sexes had the lowest MC scores among all three groups. Motor coordination demonstrated an inverse relationship with BMI across childhood and into early adolescence. The strength of the inverse relation increased during childhood, but decreased through early adolescence. Overweight and obese children of both sexes demonstrated significantly lower MC than normal weight children. Copyright © 2011 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  6. Impact of baseline BMI on glycemic control and weight change with metformin monotherapy in Chinese type 2 diabetes patients: phase IV open-label trial.

    Directory of Open Access Journals (Sweden)

    Linong Ji

    Full Text Available Differences exist between treatment recommendations regarding the choice of metformin as first-line therapy for type 2 diabetes patients according to body mass index (BMI. This study compared the efficacy of metformin monotherapy among normal-weight, overweight, and obese patients with newly diagnosed type 2 diabetes.In this prospective, multicenter, open-label study in China, patients aged 23-77 years were enrolled 11:1 according to baseline BMI: normal-weight (BMI 18.5-23.9 kg/m(2; n = 125; overweight (BMI 24.0-27.9 kg/m(2; n = 122 or obese (BMI ≥28 kg/m(2; n = 124. Extended-release metformin was administered for 16 weeks (500 mg/day, up-titrated weekly to a maximum 2,000 mg/day. The primary efficacy endpoint was the effect of baseline BMI on glycemic control with metformin monotherapy, measured as the change from baseline in glycosylated hemoglobin (HbA1c at week 16 compared among BMI groups using ANCOVA. Other endpoints included comparisons of metformin's effects on fasting plasma glucose (FPG, lipid levels and body weight.Mean HbA1c decreases at week 16, adjusted for baseline values, were -1.84%, -1.78% and -1.78% in normal-weight, overweight and obese patients, (P = 0.664; body weight decreased by 2.4%, 3.9% and 3.5%, respectively. FPG levels decreased similarly over time in all BMI groups (P = 0.461 and changes from baseline in high-density lipoprotein cholesterol (HDL-C and low-density lipoprotein cholesterol (LDL-C did not differ significantly among BMI groups at week 16 (P = 0.143 and 0.451, respectively.Baseline BMI had no impact on glycemic control, weight change or other efficacy measures with metformin monotherapy. These data suggest that normal-weight type 2 diabetes patients would derive the same benefits from first-line treatment with metformin as overweight and obese patients, and are not at increased risk of excess weight loss.ClinicalTrials.gov NCT00778622.

  7. The dengue vector Aedes aegypti contains a functional high mobility group box 1 (HMGB1 protein with a unique regulatory C-terminus.

    Directory of Open Access Journals (Sweden)

    Fabio Schneider Ribeiro

    Full Text Available The mosquito Aedes aegypti can spread the dengue, chikungunya and yellow fever viruses. Thus, the search for key molecules involved in the mosquito survival represents today a promising vector control strategy. High Mobility Group Box (HMGB proteins are essential nuclear factors that maintain the high-order structure of chromatin, keeping eukaryotic cells viable. Outside the nucleus, secreted HMGB proteins could alert the innate immune system to foreign antigens and trigger the initiation of host defenses. In this work, we cloned and functionally characterized the HMGB1 protein from Aedes aegypti (AaHMGB1. The AaHMGB1 protein typically consists of two HMG-box DNA binding domains and an acidic C-terminus. Interestingly, AaHMGB1 contains a unique alanine/glutamine-rich (AQ-rich C-terminal region that seems to be exclusive of dipteran HMGB proteins. AaHMGB1 is localized to the cell nucleus, mainly associated with heterochromatin. Circular dichroism analyses of AaHMGB1 or the C-terminal truncated proteins revealed α-helical structures. We showed that AaHMGB1 can effectively bind and change the topology of DNA, and that the AQ-rich and the C-terminal acidic regions can modulate its ability to promote DNA supercoiling, as well as its preference to bind supercoiled DNA. AaHMGB1 is phosphorylated by PKA and PKC, but not by CK2. Importantly, phosphorylation of AaHMGB1 by PKA or PKC completely abolishes its DNA bending activity. Thus, our study shows that a functional HMGB1 protein occurs in Aedes aegypt and we provide the first description of a HMGB1 protein containing an AQ-rich regulatory C-terminus.

  8. [Effects of exogenous high mobility group protein box 1 on angiogenesis in ischemic zone of early scald wounds of rats].

    Science.gov (United States)

    Dai, L; Guo, X; Huang, H J; Liao, X M; Luo, X Q; Li, D; Zhou, H; Gao, X C; Tan, M Y

    2018-04-20

    Objective: To observe effects of exogenous high mobility group protein box 1 (HMGB1) on angiogenesis in ischemic zone of early scald wounds of rats. Methods: Thirty-six Sprague-Dawley rats were divided into HMGB1 group and simple scald (SS) group according to the random number table, with 18 rats in each group. Comb-like copper mould was placed on the back of rats for 20 s after being immersed in 100 ℃ hot water for 3 to 5 min to make three ischemic zones of wound. Immediately after scald, rats in HMGB1 group were subcutaneously injected with 0.4 μg HMGB1 and 0.1 mL phosphate buffer solution (PBS), and rats in SS group were subcutaneously injected with 0.1 mL PBS from boarders of ischemic zone of scald wound. At post scald hour (PSH) 24, 48, and 72, 6 rats in each group were collected. Protein expressions of vascular endothelial growth factor (VEGF) in ischemic zone of wound at PSH 24, 48, and 72 and protein expressions of CD31 in ischemic zone of wound at PSH 48 and 72 were detected by immunohistochemistry. The number of microvessel in CD31 immunohistochemical sections of ischemic zone of wound at PSH 48 and 72 was calculated after observing by the microscope. The mRNA expressions of VEGF and CD31 in ischemic zone of wound were detected by real-time fluorescence quantitative reverse transcription polymerase chain reaction at PSH 24, 48, and 72. Data were processed with analysis of variance of factorial design, t test, and Bonferroni correction. Results: (1) At PSH 24, 48, and 72, protein expressions of VEGF in ischemic zone of wound of rats in HMGB1 group were significantly higher than those of rats in SS group ( t =7.496, 4.437, 5.402, P zone of wound of rats in HMGB1 group were 0.038 8±0.007 9 and 0.057 7±0.001 2 respectively, significantly higher than 0.013 4±0.004 9 and 0.030 3±0.004 0 of rats in SS group ( t =10.257, 15.055, P zone of wound of rats in HMGB1 group was obviously more than that of rats in SS group ( t =3.536, 4.000, P zone of wound of

  9. BMI at birth and overweight at age four.

    Science.gov (United States)

    Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F

    Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

  10. Effectiveness of exercise and protein supplementation intervention on body composition, functional fitness, and oxidative stress among elderly Malays with sarcopenia.

    Science.gov (United States)

    Shahar, Suzana; Kamaruddin, Norshafarina Shari; Badrasawi, Manal; Sakian, Noor Ibrahim Mohamed; Abd Manaf, Zahara; Yassin, Zaitun; Joseph, Leonard

    2013-01-01

    Sarcopenia, characterized as muscle loss that occurs with aging, is a major health problem in an aging population, due to its implications on mobility, quality of life, and fall risk. Protein supplementation could improve the physical fitness by increasing protein anabolism, and exercise has a documented evidence of positive effect on functional status among the elderly. However, the combined effect of both protein supplementation and exercise has not been investigated among sarcopenic elderly in the Asian population. Thus, this study aimed to determine the effectiveness of exercise intervention and protein supplementation either alone or in combination for 12 weeks, on body composition, functional fitness, and oxidative stress among elderly Malays with sarcopenia. Sixty five sarcopenic elderly Malays aged 60-74 years were assigned to the control group, exercise group (ExG), protein supplementation group (PrG), or the combination of exercise and protein supplementation group. A significant interaction effect between body weight and body mass index (BMI) was observed, with the PrG (-2.1% body weight, -1.8% BMI) showing the highest reductions. Further, there was a decrease in % body fat (-4.5%) and an increase in fat-free mass (kg) (+5.7%) in the ExG after 12 weeks (P exercise program was found to improve muscle strength and body composition, while protein supplementation reduced body weight and increased upper body strength, among sarcopenic elderly in Malaysia.

  11. The optimal value of BMI for the lowest risk of osteoporosis in postmenopausal women aged 40-88 years.

    Science.gov (United States)

    Skrzek, A; Kozieł, S; Ignasiak, Z

    2014-06-01

    The aim of this paper is to establish the optimal values of the body mass index (BMI) which would indicate the most favourable preservation of the bone mineral density in postmenopausal women. The material consists of the data of 369 healthy women aged between 40 and 88 years (mean age 67.84, SD=6.70) inhabitants of Wrocław, which were followed up between 2001 and 2006. The absolute measure of bone mineral density (BMD) of the femoral neck was assessed using dual energy X-ray absorptiometry (DEXA), expressed in g/(100mm(2)) and was transformed to T-score values. According to the value of BMI, the women were divided into eight groups, the reference group with value between 18.0 and 21.9kg/m(2) and seven other groups beginning with the value 22.0 with a 2-point interval. Postmenopausal status was defined according to the occurrence of menstruation within the last 360 days. The women with osteopenia and osteoporosis were pooled together and comprised the risk group, whereas the other women comprised the normal group (T-score values above -1.0). The adjusted odds ratio showed the highest value for intervals between 24.0 and 25.9 units of BMI, and the lowest value for interval 26.0-27.9 units of BMI. The Youden index showed the lowest value in the 26.0-27.9BMI kg/m(2) interval. For our sample the optimal value of BMI, with the lowest risk of osteopenia and/or osteoporosis was the value of 26.9kg/m(2). A further increase of BMI does not result in a favourable effect on the bones, it rather intensifies negative phenomena in the body resulting in the onset of many diseases. Copyright © 2014. Published by Elsevier GmbH.

  12. BMI-for-age in South Asian children of 0–20 years in the Netherlands: secular changes and misclassification by WHO growth references

    NARCIS (Netherlands)

    Wilde, J.A. de; Dekker, M.; Middelkoop, B.J.

    2018-01-01

    Background: South Asians are prone to cardiometabolic disease at lower BMI levels than most other ethnic groups, starting in childhood. The magnitude of BMI misclassifications is unknown. Aim: To compare the BMI distribution of contemporary South Asian 0–20 year olds in the Netherlands with: (1) The

  13. A CRM domain protein functions dually in group I and group II intron splicing in land plant chloroplasts.

    Science.gov (United States)

    Asakura, Yukari; Barkan, Alice

    2007-12-01

    The CRM domain is a recently recognized RNA binding domain found in three group II intron splicing factors in chloroplasts, in a bacterial protein that associates with ribosome precursors, and in a family of uncharacterized proteins in plants. To elucidate the functional repertoire of proteins with CRM domains, we studied CFM2 (for CRM Family Member 2), which harbors four CRM domains. RNA coimmunoprecipitation assays showed that CFM2 in maize (Zea mays) chloroplasts is associated with the group I intron in pre-trnL-UAA and group II introns in the ndhA and ycf3 pre-mRNAs. T-DNA insertions in the Arabidopsis thaliana ortholog condition a defective-seed phenotype (strong allele) or chlorophyll-deficient seedlings with impaired splicing of the trnL group I intron and the ndhA, ycf3-int1, and clpP-int2 group II introns (weak alleles). CFM2 and two previously described CRM proteins are bound simultaneously to the ndhA and ycf3-int1 introns and act in a nonredundant fashion to promote their splicing. With these findings, CRM domain proteins are implicated in the activities of three classes of catalytic RNA: group I introns, group II introns, and 23S rRNA.

  14. Paternal body mass index (BMI is associated with offspring intrauterine growth in a gender dependent manner.

    Directory of Open Access Journals (Sweden)

    You-Peng Chen

    Full Text Available BACKGROUND: Environmental alternations leading to fetal programming of cardiovascular diseases in later life have been attributed to maternal factors. However, animal studies showed that paternal obesity may program cardio-metabolic diseases in the offspring. In the current study we tested the hypothesis that paternal BMI may be associated with fetal growth. METHODS AND RESULTS: We analyzed the relationship between paternal body mass index (BMI and birth weight, ultrasound parameters describing the newborn's body shape as well as parameters describing the newborns endocrine system such as cortisol, aldosterone, renin activity and fetal glycated serum protein in a birth cohort of 899 father/mother/child triplets. Since fetal programming is an offspring sex specific process, male and female offspring were analyzed separately. Multivariable regression analyses considering maternal BMI, paternal and maternal age, hypertension during pregnancy, maternal total glycated serum protein, parity and either gestational age (for birth weight or time of ultrasound investigation (for ultrasound parameters as confounding showed that paternal BMI is associated with growth of the male but not female offspring. Paternal BMI correlated with birth parameters of male offspring only: birth weight; biparietal diameter, head circumference; abdominal diameter, abdominal circumference; and pectoral diameter. Cortisol was likewise significantly correlated with paternal BMI in male newborns only. CONCLUSIONS: Paternal BMI affects growth of the male but not female offspring. Paternal BMI may thus represent a risk factor for cardiovascular diseases of male offspring in later life. It remains to be demonstrated whether this is linked to an offspring sex specific paternal programming of cortisol secretion.

  15. Proresolving protein Annexin A1: The role in type 2 diabetes mellitus and obesity.

    Science.gov (United States)

    Pietrani, Nathalia T; Ferreira, Cláudia N; Rodrigues, Kathryna F; Perucci, Luiza O; Carneiro, Fernanda S; Bosco, Adriana A; Oliveira, Marina C; Pereira, Solange S; Teixeira, Antônio L; Alvarez-Leite, Jacqueline I; Ferreira, Adaliene V; Sousa, Lirlândia P; Gomes, Karina B

    2018-04-17

    Annexin A1 (AnxA1) is a protein involved in inflammation resolution that might be altered in obesity-associated type 2 diabetes mellitus (DM), which is a chronic inflammatory disease. The aim of this study was to evaluate AnxA1 serum levels in individuals with and without DM stratified according to the body mass index (BMI), and the dynamic of AnxA1 expression in adipose tissue from humans with obesity and non-obesity. Serum samples were obtained from 41 patients with DM (lean, overweight and obese) and 40 controls, and adipose tissue samples were obtained from 16 individuals with obesity (with or without DM), and 15 controls. DM patients showed similar AnxA1 serum levels when compared to controls. However, when the individuals were stratified according to BMI, AnxA1 levels were higher in individuals with obesity than lean or overweight, and in overweight compared to lean individuals. Moreover, AnxA1 was correlated positively with IL-6 levels. AnxA1 levels were also positively correlated with BMI, waist circumference and waist-to-hip ratio. Furthermore, higher levels of cleaved AnxA1 were observed in adipose tissue from individuals with obesity, independently of DM status. Enhanced levels of AnxA1 in serum of individuals with obesity suggest an attempt to counter-regulate the systemic inflammation process in this disease. However, the higher levels of cleaved AnxA1 in the adipose tissue of individuals with obesity could compromise its anti-inflammatory and proresolving actions, locally. Considering our data, AnxA1 cleavage in the adipose tissue, despite increased serum levels of this protein, and consequently the failure in inflammation resolution, suggests an important pathophysiological mechanism involved in inflammatory status observed in obesity. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  16. Prediction of BMI by impulsivity, eating behavior and activity level

    Directory of Open Access Journals (Sweden)

    Jiang Xiaxia

    2016-01-01

    Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.

  17. The impact of age and sex adjusted body mass index (ISO-BMI) in obese versus non-obese children and adolescents with cholecystectomy.

    Science.gov (United States)

    Kiuru, Eveliina; Kokki, Hannu; Juvonen, Petri; Lintula, Hannu; Paajanen, Hannu; Gissler, Mika; Eskelinen, Matti

    2014-01-01

    The impact of the age and sex adjusted body mass index (ISO-BMI) in the obese vs. non-obese children and adolescents with cholecystectomy for cholelithias is rarely reported. The national database was searched for cholecystectomies performed in paediatric patients between 1997 and 2011, and the 59 paediatric and adolescent patients having cholecystectomy in the Kuopio University Hospital district were divided in two groups by age and sex adjusted BMI (ISO-BMI) using the cut-off point of overweight (ISO-BMI 25 kg/m(2)) based on the Finnish growth standards. Nationwide a total of 840 cholecystectomies were performed during the 15 years study period in Finland, most of which included females (77%), resulting in a mean of annual frequency of 4.8 (range: 3.9-6.1) procedures/100,000 population. In the study sample, most of the patients with the cholelithiasis were female (50/59, 85%). The gender distribution was equal among the younger patients, but among adolescents 6/52 (12%) of the patients with cholelithiasis were boys and 46/52 (88%) of the patients with cholelithiasis were girls. Obesity did not affect on operative parameters. The median operative time was 70 min (range, 30-155) and 66 min (44-130) in the high ISO-BMI-group. The recovery was similar in the two groups: the median length of hospital stay was 4 days in both groups. The patients in the low ISO-BMI-group vs. high ISO-BMI-group had a trend of higher serum bilirubin (p=0.16) and serum AFOS values (p=0.19). In the histological examination of the gallbladders 19/28 (68%) patients in the low ISO-BMI-group had inflammation vs. 26/31 (84%) patients in the high ISO-BMI-group (p=0.15). Our results between obese and non-obese children and adolescents with cholelithiasis are not statistically significant. The obese adolescents with female gender are in greater risk for cholelithiasis. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  18. 2-Year BMI Changes of Children Referred for Multidisciplinary Weight Management

    Directory of Open Access Journals (Sweden)

    Jennifer K. Cheng

    2014-01-01

    Full Text Available Objective. To examine body mass index (BMI changes among pediatric multidisciplinary weight management participants and nonparticipants. Design. In this retrospective database analysis, we used multivariable mixed effect models to compare 2-year BMI z-score trajectories among 583 eligible overweight or obese children referred to the One Step Ahead program at the Boston Children’s Primary Care Center between 2003 and 2009. Results. Of the referred children, 338 (58% attended the program; 245 (42% did not participate and were instead followed by their primary care providers within the group practice. The mean BMI z-score of program participants decreased modestly over a 2-year period and was lower than that of nonparticipants. The group-level difference in the rate of change in BMI z-score between participants and nonparticipants was statistically significant for 0–6 months (P=0.001 and 19–24 months (P=0.008; it was marginally significant for 13–18 months (P=0.051 after referral. Younger participants (<5 years had better outcomes across all time periods examined. Conclusion. Children attending a multidisciplinary program experienced greater BMI z-score reductions compared with usual primary care in a real world practice; younger participants had significantly better outcomes. Future research should consider early intervention and cost-effectiveness analyses.

  19. Low birth weight, adult BMI and inflammation in middle age

    DEFF Research Database (Denmark)

    Pedersen, Jolene Lee Masters; Rod, Naja Hulvej; Avlund, Kirsten

    2013-01-01

    This study examines the association between birthweight and adult BMI with inflammation in middle age measured by interleukin 6 (IL- 6), interleukin 10 (IL-10), interleukin 18 (IL-18), high sensitivity Creactive protein (hsCRP) and tumor necrosis factor alpha (tnf-α). The study is based on partic...

  20. Reduction of radiation exposure and improvement of image quality with BMI-adapted prospective cardiac computed tomography and iterative reconstruction

    International Nuclear Information System (INIS)

    Hosch, Waldemar; Stiller, Wolfram; Mueller, Dirk; Gitsioudis, Gitsios; Welzel, Johanna; Dadrich, Monika; Buss, Sebastian J.; Giannitsis, Evangelos; Kauczor, Hans U.; Katus, Hugo A.; Korosoglou, Grigorios

    2012-01-01

    Purpose: To assess the impact of body mass index (BMI)-adapted protocols and iterative reconstruction algorithms (iDose) on patient radiation exposure and image quality in patients undergoing prospective ECG-triggered 256-slice coronary computed tomography angiography (CCTA). Methods: Image quality and radiation exposure were systematically analyzed in 100 patients. 60 Patients underwent prospective ECG-triggered CCTA using a non-tailored protocol and served as a ‘control’ group (Group 1: 120 kV, 200 mA s). 40 Consecutive patients with suspected coronary artery disease (CAD) underwent prospective CCTA, using BMI-adapted tube voltage and standard (Group 2: 100/120 kV, 100–200 mA s) versus reduced tube current (Group 3: 100/120 kV, 75–150 mA s). Iterative reconstructions were provided with different iDose levels and were compared to filtered back projection (FBP) reconstructions. Image quality was assessed in consensus of 2 experienced observers and using a 5-grade scale (1 = best to 5 = worse), and signal- and contrast-to-noise ratios (SNR and CNR) were quantified. Results: CCTA was performed without adverse events in all patients (n = 100, heart rate of 47–87 bpm and BMI of 19–38 kg/m 2 ). Patients examined using the non-tailored protocol in Group 1 had the highest radiation exposure (3.2 ± 0.4 mSv), followed by Group 2 (1.7 ± 0.7 mSv) and Group 3 (1.2 ± 0.6 mSv) (radiation savings of 47% and 63%, respectively, p < 0.001). Iterative reconstructions provided increased SNR and CNR, particularly when higher iDose level 5 was applied with Multi-Frequency reconstruction (iDose5 MFR) (14.1 ± 4.6 versus 21.2 ± 7.3 for SNR and 12.0 ± 4.2 versus 18.1 ± 6.6 for CNR, for FBP versus iDose5 MFR, respectively, p < 0.001). The combination of BMI adaptation with iterative reconstruction reduced radiation exposure and simultaneously improved image quality (subjective image quality of 1.4 ± 0.4 versus 1.9 ± 0.5 for Group 2 reconstructed using iDose5 MFR versus

  1. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski

    2007-01-01

    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  2. Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

    Science.gov (United States)

    Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

    2011-11-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

  3. Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.

    Science.gov (United States)

    Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena

    2016-04-01

    While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.

  4. Expression and mechanism of high mobility group box protein-1 in retinal tissue of diabetic rats

    Directory of Open Access Journals (Sweden)

    Shuang Jiang

    2016-05-01

    Full Text Available AIM:To investigate the expression and mechanism of high mobility group box protein-1(HMGB1in the retina of diabetic rats. METHODS:Sixty SD rats were randomly divided into diabetic group and control group. Diabetic rat model was produced by intraperitioneal injection of 1% STZ with 60mg/Kg weight. The rats in control group received intraperitioneal injection of normal saline with same dosage. After injection, the rats were sacrificed and eyeballs were enucleated for HE staining, the retina fluorescence angiography, TUNEL and Western Blot detection at 1, 2 and 4mo for the expressions of HMGB1 and NF-κB. RESULTS:Compared with the control group, the retinal cells disorder, cell densities decreases, microvasculars occlusion were founded with inner and outer nuclear layer thinning and ganglion cell apoptosis. The fluorescence angiography showed that peripheral capillaries became circuitous and vascular occlusion and non-perfusion area could be seen. The expressions of HMGB1 and NF-κB were higher than those of control with time dependence and they had significant positive correlations(PCONCLUSION:The expression of HMGB1 increases in diabetic rat retina, which may involve in the occurrence of diabetic retinopathy through the NF- κB pathway.

  5. Are BMI and Sedentariness Correlated? A Multilevel Study in Children

    Directory of Open Access Journals (Sweden)

    Thayse Natacha Gomes

    2015-07-01

    Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.

  6. [Effects of low-protein diet plus alpha-keto acid on micro-inflammation and the relationship between micro-inflammation and nutritional status in patients performing continuous ambulatory peritoneal dialysis: a randomized controlled trial].

    Science.gov (United States)

    Chen, Wei; Guo, Zhi-Yong; Wu, Hao; Sun, Li-Jing; Cai, Li-Li; Xu, Hai-Yan

    2008-05-01

    To investigate the effects of the combination of alpha-keto acid and low-protein diet on the levels of serum cytokines in patients performing continuous ambulatory peritoneal dialysis (CAPD) and to explore the relationship between inflammation and malnutrition in CAPD patients. Eighty-nine CAPD patients were randomized into three groups, and 78 cases completed a one-year follow-up and with complete data. There were 31 cases in low-protein diet plus alpha-keto acid group, 26 cases in low-protein diet group and 21 cases in routine-protein diet group. The levels of serum albumin (Alb), prealbumin (PA), retinol-binding protein (RBP), transferrin (TRF), cholesterol (TC), triglycerides (TG), leptin, and triceps skinfold thickness (TSF), mid-arm muscle circumference (MAMC), body mass index (BMI) were measured. The changes of serum interleukin-1alpha (IL-1alpha), interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-alpha) and C-reactive protein (CRP) were also detected. Compared with low-protein diet group, serum levels of PA, RBP and TRF were significantly increased both in low-protein diet plus alpha-keto acid and routine-protein diet groups ( Pdiet plus alpha-keto acid group and routine-protein diet group. There was an increased tendency in the content of Alb, TC, TG, BMI, TSF and MAMC, but there were no significant differences. The plasma levels of IL-1alpha, IL-6 and TNF-alpha in low-protein diet plus alpha-keto acid group were decreased as compared with the routine-protein diet group, but there were no significant differences. The plasma level of CRP in low-protein diet plus alpha-keto acid group was lower than that in the routine-protein diet group ( Pketo acid and low-protein diet can ameliorate malnutrition and micro-inflammation in CAPD patients.

  7. Do substantial BMI reduction episodes among Swedish schoolchildren have any impact on their final height?

    Science.gov (United States)

    Nilsen, Bente B; Yngve, Agneta; Werner, Bo

    2018-02-06

    This study investigated whether substantial body mass index (BMI) reductions in Swedish schoolchildren aged seven years to 19 years, caused by disease, healthy or unhealthy behaviour, had any impact on their final height. We used height and weight data on 6572 subjects from two nationally representative longitudinal samples of Swedish children born in 1973 and 1981. These provided information on their final height and any BMI reduction episodes. Of the 6572 subjects (50.9% boys), among individuals with information on final height, 1118 had a BMI reduction of 5% and BMI reduction of 10% or more. On a group level, there was no statistically significant difference in the final height of individuals with BMI reductions of 10% or more and those without. The findings were independent of age and the subject's BMI at the start of the reduction episode. However, there were a number of cases where a substantial BMI reduction probably had an impact on the subject's final height. Our study found no evidence that a substantial BMI reduction had any impact on final height on a group level, but further analyses of specific case studies are necessary to determine whether substantial BMI reduction might have an impact on final height. ©2018 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  8. Overweight or obese BMI is associated with earlier, but not later survival after common acute illnesses.

    Science.gov (United States)

    Prescott, Hallie C; Chang, Virginia W

    2018-02-06

    Obesity has been associated with improved short-term mortality following common acute illness, but its relationship with longer-term mortality is unknown. Observational study of U.S. Health and Retirement Study (HRS) participants with federal health insurance (fee-for-service Medicare) coverage, hospitalized with congestive heart failure (N = 4287), pneumonia (N = 4182), or acute myocardial infarction (N = 2001), 1996-2012. Using cox proportional hazards models, we examined the association between overweight or obese BMI (BMI ≥ 25.0 kg/m 2 ) and mortality to 5 years after hospital admission, adjusted for potential confounders measured at the same time as BMI, including age, race, sex, education, partnership status, income, wealth, and smoking status. Body mass index (BMI) was calculated from self-reported height and weight collected at the HRS survey prior to hospitalization (a median 1.1 year prior to hospitalization). The referent group was patients with a normal BMI (18.5 to BMI was associated with lower mortality at 1 year after hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction-with adjusted hazard ratios of 0.68 (95% CI 0.59-0.79), 0.74 (95% CI: 0.64-0.84), and 0.65 (95%CI: 0.53-0.80), respectively. Among participants who lived to one year, however, subsequent survival was similar between patients with normal versus overweight/obese BMI. In older Americans, overweight or obese BMI was associated with improved survival following hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction. This association, however, is limited to the shorter-term. Conditional on surviving to one year, we did not observe a survival advantage associated with excess weight.

  9. Important mitochondrial proteins in human omental adipose tissue show reduced expression in obesity.

    Science.gov (United States)

    Lindinger, Peter W; Christe, Martine; Eberle, Alex N; Kern, Beatrice; Peterli, Ralph; Peters, Thomas; Jayawardene, Kamburapola J I; Fearnley, Ian M; Walker, John E

    2015-09-01

    Obesity is associated with impaired mitochondrial function. This study compares mitochondrial protein expression in omental fat in obese and non-obese humans. Omental adipose tissue was obtained by surgical biopsy, adipocytes were purified and mitochondria isolated. Using anion-exchange chromatography, SDS-PAGE and mass-spectrometry, 128 proteins with potentially different abundances in patient groups were identified, 62 of the 128 proteins are mainly localized in the mitochondria. Further quantification of 12 of these 62 proteins by immune dot blot analysis revealed four proteins citrate synthase, HADHA, LETM1 and mitofilin being inversely associated with BMI, and mitofilin being inversely correlated with gender.

  10. Identification and characterization of the direct interaction between methotrexate (MTX and high-mobility group box 1 (HMGB1 protein.

    Directory of Open Access Journals (Sweden)

    Yuki Kuroiwa

    Full Text Available BACKGROUND: Methotrexate (MTX is an agent used in chemotherapy of tumors and autoimmune disease including rheumatoid arthritis (RA. In addition, MTX has some anti-inflammatory activity. Although dihydrofolate reductase (DHFR is a well-known target for the anti-tumor effect of MTX, the mode of action for the anti-inflammatory activity of MTX is not fully understood. METHODOLOGY/RESULT: Here, we performed a screening of MTX-binding proteins using T7 phage display with a synthetic biotinylated MTX derivative. We then characterized the interactions using surface plasmon resonance (SPR analysis and electrophoretic mobility shift assay (EMSA. Using a T7 phage display screen, we identified T7 phages that displayed part of high-mobility group box 1 (HMGB1 protein (K86-V175. Binding affinities as well as likely binding sites were characterized using genetically engineered truncated versions of HMGB1 protein (Al G1-K87, Bj: F88-K181, indicating that MTX binds to HMGB1 via two independent sites with a dissociation constants (KD of 0.50±0.03 µM for Al and 0.24 ± 0.01 µM for Bj. Although MTX did not inhibit the binding of HMGB1 to DNA via these domains, HMGB1/RAGE association was impeded in the presence of MTX. These data suggested that binding of MTX to part of the RAGE-binding region (K149-V175 in HMGB1 might be significant for the anti-inflammatory effect of MTX. Indeed, in murine macrophage-like cells (RAW 264.7, TNF-α release and mitogenic activity elicited by specific RAGE stimulation with a truncated monomeric HMGB1 were inhibited in the presence of MTX. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that HMGB1 is a direct binding protein of MTX. Moreover, binding of MTX to RAGE-binding region in HMGB1 inhibited the HMGB1/RAGE interaction at the molecular and cellular levels. These data might explain the molecular basis underlying the mechanism of action for the anti-inflammatory effect of MTX.

  11. Interplay between human high mobility group protein 1 and replication protein A on psoralen-cross-linked DNA

    DEFF Research Database (Denmark)

    Reddy, Madhava C; Christensen, Jesper; Vasquez, Karen M

    2005-01-01

    -DNA interstrand cross-link (ICL) to a specific site to determine the effect of HMGB proteins on recognition of these lesions. Our results reveal that human HMGB1 (but not HMGB2) binds with high affinity and specificity to psoralen ICLs, and interacts with the essential NER protein, replication protein A (RPA......), at these lesions. RPA, shown previously to bind tightly to these lesions, also binds in the presence of HMGB1, without displacing HMGB1. A discrete ternary complex is formed, containing HMGB1, RPA, and psoralen-damaged DNA. Thus, HMGB1 has the ability to recognize ICLs, can cooperate with RPA in doing so...

  12. Real-time Kinetics of High-mobility Group Box 1 (HMGB1) Oxidation in Extracellular Fluids Studied by in Situ Protein NMR Spectroscopy*

    Science.gov (United States)

    Zandarashvili, Levani; Sahu, Debashish; Lee, Kwanbok; Lee, Yong Sun; Singh, Pomila; Rajarathnam, Krishna; Iwahara, Junji

    2013-01-01

    Some extracellular proteins are initially secreted in reduced forms via a non-canonical pathway bypassing the endoplasmic reticulum and become oxidized in the extracellular space. One such protein is HMGB1 (high-mobility group box 1). Extracellular HMGB1 has different redox states that play distinct roles in inflammation. Using a unique NMR-based approach, we have investigated the kinetics of HMGB1 oxidation and the half-lives of all-thiol and disulfide HMGB1 species in serum, saliva, and cell culture medium. In this approach, salt-free lyophilized 15N-labeled all-thiol HMGB1 was dissolved in actual extracellular fluids, and the oxidation and clearance kinetics were monitored in situ by recording a series of heteronuclear 1H-15N correlation spectra. We found that the half-life depends significantly on the extracellular environment. For example, the half-life of all-thiol HMGB1 ranged from ∼17 min (in human serum and saliva) to 3 h (in prostate cancer cell culture medium). Furthermore, the binding of ligands (glycyrrhizin and heparin) to HMGB1 significantly modulated the oxidation kinetics. Thus, the balance between the roles of all-thiol and disulfide HMGB1 proteins depends significantly on the extracellular environment and can also be artificially modulated by ligands. This is important because extracellular HMGB1 has been suggested as a therapeutic target for inflammatory diseases and cancer. Our work demonstrates that the in situ protein NMR approach is powerful for investigating the behavior of proteins in actual extracellular fluids containing an enormous number of different molecules. PMID:23447529

  13. Can low BMI Chinese patients with type 2 diabetes benefit from laparoscopic Roux-en-Y gastric bypass surgery?

    Science.gov (United States)

    Wang, Guohui; Zhu, Liyong; Li, Weizheng; Yang, Xiangwu; Li, Pengzhou; Zhu, Shaihong

    2016-12-01

    The efficacy of laparoscopic Roux-en-Y gastric bypass (LRYGB) in type 2 diabetes mellitus (T2D) is closely associated with the preoperative body mass index (BMI) of the patient. There is a lack of long-term and large sampling evidence on the efficacy of LRYGB in T2D patients with low BMI in China. This retrospective study aimed to evaluate the efficacy of surgical treatment in a Chinese population with T2D (especially patients with BMIBMI≥27.5 kg/m 2 in group 1 (high BMI group) had significant improvements in waist circumference, blood glucose levels, homeostasis model assessment-insulin resistance index, and C-peptide levels after LRYGB (PBMIBMI group, including 19 T2D patients with BMIBMI<27.5 kg/m 2 in China. Copyright © 2016 American Society for Bariatric Surgery. Published by Elsevier Inc. All rights reserved.

  14. Micro-RNA-128 (miRNA-128) down-regulation in glioblastoma targets ARP5 (ANGPTL6), Bmi-1 and E2F-3a, key regulators of brain cell proliferation.

    Science.gov (United States)

    Cui, J G; Zhao, Y; Sethi, P; Li, Y Y; Mahta, A; Culicchia, F; Lukiw, W J

    2010-07-01

    High density micro-RNA (miRNA) arrays, fluorescent-reporter miRNA assay and Northern miRNA dot-blot analysis show that a brain-enriched miRNA-128 is significantly down-regulated in glioblastoma multiforme (GBM) and in GBM cell lines when compared to age-matched controls. The down-regulation of miRNA-128 was found to inversely correlate with WHO tumor grade. Three bioinformatics-verified miRNA-128 targets, angiopoietin-related growth factor protein 5 (ARP5; ANGPTL6), a transcription suppressor that promotes stem cell renewal and inhibits the expression of known tumor suppressor genes involved in senescence and differentiation, Bmi-1, and a transcription factor critical for the control of cell-cycle progression, E2F-3a, were found to be up-regulated. Addition of exogenous miRNA-128 to CRL-1690 and CRL-2610 GBM cell lines (a) restored 'homeostatic' ARP5 (ANGPTL6), Bmi-1 and E2F-3a expression, and (b) significantly decreased the proliferation of CRL-1690 and CRL-2610 cell lines. Our data suggests that down-regulation of miRNA-128 may contribute to glioma and GBM, in part, by coordinately up-regulating ARP5 (ANGPTL6), Bmi-1 and E2F-3a, resulting in the proliferation of undifferentiated GBM cells.

  15. Associations between BMI Change and Cardiometabolic Risk in Retired Football Players.

    Science.gov (United States)

    Trexler, Eric T; Smith-Ryan, Abbie E; Defreese, J D; Marshall, Stephen W; Guskiewicz, Kevin M; Kerr, Zachary Y

    2018-04-01

    Elevated rates of cardiometabolic diseases have been observed in former American football players. The current study sought to determine whether change in body mass index (ΔBMI) after retirement influences the prevalence of CHD, diabetes, or high blood pressure (HBP) in former professional football players. Retired professional football players (n = 3729) were sent a survey with questions regarding health status, playing history, and demographic information. Self-reported BMI at the time of retirement was subtracted from current self-reported BMI to calculate ΔBMI. Prevalence of CHD, diabetes, and HBP were determined by asking participants if they had ever been diagnosed by a health care professional. Binomial regression with a Poisson residual and robust variance estimation was used to compute crude prevalence ratios (PR) and 95% confidence intervals (CI) for each outcome. Adjusted PR values were calculated by adjusting for BMI at the time of retirement, age, years of football experience, race, exercise habits, alcohol use, steroid history, smoking history, and playing position. Complete data were available for 2062 respondents. Prevalence of CHD increased 25%-31% for each five-point increase in ΔBMI after retirement (crude PR = 1.25, 95% CI = 1.03-1.52, P = 0.026; adjusted PR = 1.31, 95% CI = 1.11-1.55, P = 0.001). Diabetes prevalence increased 69%-88% for each five-point ΔBMI increase (crude = 1.88, 95% CI = 1.45-2.44, P football players.

  16. Association between Dental Caries and BMI in Children: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Chen, Dongru; Zhi, Qinghui; Zhou, Yan; Tao, Ye; Wu, Liping; Lin, Huancai

    2018-01-01

    Research on the association between dental caries and body mass index (BMI) in children has shown contradictory results; thus we aimed to examine the association between dental caries and the full range of BMI classes among children. We comprehensively searched PubMed, Embase, and the Cochrane Library for studies published prior to March 2017. Articles comparing dental caries among the full range of BMI classes for children below 18 years of both genders were included. Fourteen studies were eligible for this study. Basic information - i.e., first author, published year, study design, country, sample size, age, type of dental caries index and BMI, main results and conclusions, and means and standard deviations of the dental caries indexes used - was pooled. The weighted mean differences and corresponding 95% confidence intervals for dental caries between children with abnormal weight and those with normal weight were analyzed. Generally, no significant differences in caries were found between any abnormal-weight group and the normal-weight group for both primary and permanent teeth. Sensitivity analyses showed that the obese group had more caries than the normal-weight group in their primary teeth. Significantly more caries was found among the overweight and obese children in both primary and permanent teeth in high-income countries, but not in low- and middle-income countries. We recommend that further studies use suitable sample sizes, unify the criteria for BMI categorization and the dental caries index, and investigate the confounding factors that might influence dental caries and BMI. © 2018 S. Karger AG, Basel.

  17. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes ▿

    Science.gov (United States)

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

  18. Reduced cortical thickness associated with visceral fat and BMI

    Directory of Open Access Journals (Sweden)

    Ralf Veit

    2014-01-01

    Full Text Available Structural brain imaging studies have shown that obesity is associated with widespread reductions in gray matter (GM volume. Although the body mass index (BMI is an easily accessible anthropometric measure, substantial health problems are more related to specific body fat compartments, like visceral adipose tissue (VAT. We investigated cortical thickness measures in a group of 72 healthy subjects (BMI range 20–35 kg/m2, age range 19–50 years. Multiple regression analyses were performed using VAT and BMI as predictors and age, gender, total surface area and education as confounds. BMI and VAT were independently associated with reductions in cortical thickness in clusters comprising the left lateral occipital area, the left inferior temporal cortex, and the left precentral and inferior parietal area, while the right insula, the left fusiform gyrus and the right inferior temporal area showed a negative correlation with VAT only. In addition, we could show significant reductions in cortical thickness with increasing VAT adjusted for BMI in the left temporal cortex. We were able to detect widespread cortical thinning in a young to middle-aged population related to BMI and VAT; these findings show close resemblance to studies focusing on GM volume differences in diabetic patients. This may point to the influence of VAT related adverse effects, like low-grade inflammation, as a potentially harmful factor on brain integrity already in individuals at risk of developing diabetes, metabolic syndromes and arteriosclerosis.

  19. Impact of baseline BMI and weight change in CCTG adjuvant breast cancer trials.

    Science.gov (United States)

    Yerushalmi, R; Dong, B; Chapman, J W; Goss, P E; Pollak, M N; Burnell, M J; Levine, M N; Bramwell, V H C; Pritchard, K I; Whelan, T J; Ingle, J N; Shepherd, L E; Parulekar, W R; Han, L; Ding, K; Gelmon, K A

    2017-07-01

    We hypothesized that increased baseline BMI and BMI change would negatively impact clinical outcomes with adjuvant breast cancer systemic therapy. Data from chemotherapy trials MA.5 and MA.21; endocrine therapy MA.12, MA.14 and MA.27; and trastuzumab HERA/MA.24 were analyzed. The primary objective was to examine the effect of BMI change on breast cancer-free interval (BCFI) landmarked at 5 years; secondary objectives included BMI changes at 1 and 3 years; BMI changes on disease-specific survival (DSS) and overall survival (OS); and effects of baseline BMI. Stratified analyses included trial therapy and composite trial stratification factors. In pre-/peri-/early post-menopausal chemotherapy trials (N = 2793), baseline BMI did not impact any endpoint and increased BMI from baseline did not significantly affect BCFI (P = 0.85) after 5 years although it was associated with worse BCFI (P = 0.03) and DSS (P = 0.07) after 1 year. BMI increase by 3 and 5 years was associated with better DSS (P = 0.01; 0.01) and OS (P = 0.003; 0.05). In pre-menopausal endocrine therapy trial MA.12 (N = 672), patients with higher baseline BMI had worse BCFI (P = 0.02) after 1 year, worse DSS (P = 0.05; 0.004) after 1 and 5 years and worse OS (P = 0.01) after 5 years. Increased BMI did not impact BCFI (P = 0.90) after 5 years, although it was associated with worse BCFI (P = 0.01) after 1 year. In post-menopausal endocrine therapy trials MA.14 and MA.27 (N = 8236), baseline BMI did not significantly impact outcome for any endpoint. BMI change did not impact BCFI or DSS after 1 or 3 years, although a mean increased BMI of 0.3 was associated with better OS (P = 0.02) after 1 year. With the administration of trastuzumab (N = 1395) baseline BMI and BMI change did not significantly impact outcomes. Higher baseline BMI and BMI increases negatively affected outcomes only in pre-/peri-/early post-menopausal trial patients. Otherwise, BMI

  20. Endothelial function in young women with polycystic ovary syndrome (PCOS): Implications of body mass index (BMI) and insulin resistance.

    Science.gov (United States)

    El-Kannishy, Ghada; Kamal, Shaheer; Mousa, Amany; Saleh, Omayma; Badrawy, Adel El; Farahaty, Reham El; Shokeir, Tarek

    2010-01-01

    Evidence regarding endothelial function in both obese and nonobese women with PCOS is contradictory. It is unknown whether obese women with PCOS carry an increased risk related to body mass index (BMI). To identify endothelial function and investigate its relationship to body mass index and insulin resistance in young women with PCOS. Twenty-two obese women with PCOS (BMI 35.2 ± 3.2) as well as fourteen lean women (BMI 22.8 ± 2.1)with PCOS were included in the study. Fasting serum insulin, blood glucose were estimated and HOMA and Quicki index were calculated. All patients were subjected to ultrasound recording of brachial artery diameter at rest and after reactive hyperemia (FMD) for assessment of endothelial function. Ten age matched healthy females with normal BMI were chosen as a control group. There were higher basal insulin levels with lower Quicki index and higher HOMA index in women with PCOS than normal group, but the differences were significant only between obese PCOS subgroup and control. On the other hand, FMD was significantly and equally decreased in both groups of women with PCOS, compared with control subjects (3.7 ± 3.2% in the nonobese subgroup and 3.5 ± 2.8% in the obese one vs. 10.6 ± 4.1% in control subjects, P, 0.001). FMD was not correlated with BMI nor insulin resistance indices. Endothelial dysfunction is already present in young women with PCOS. In this patient group, it cannot be attributed to insulin resistance or obesity. © 2010 Asian Oceanian Association for the Study of Obesity . Published by Elsevier Ltd. All rights reserved.

  1. Periodontal inflamed surface area and C-reactive protein as predictors of HbA1c: a study in Indonesia.

    Science.gov (United States)

    Susanto, Hendri; Nesse, Willem; Dijkstra, Pieter U; Hoedemaker, Evelien; van Reenen, Yvonne Huijser; Agustina, Dewi; Vissink, Arjan; Abbas, Frank

    2012-08-01

    Periodontitis may exert an infectious and inflammatory burden, evidenced by increased C-reactive protein (CRP). This burden may impair blood glucose control (HbA1c). The aim of our study was to analyze whether periodontitis severity as measured with the periodontal inflamed surface area (PISA) and CRP predict HbA1c levels in a group of healthy Indonesians and a group of Indonesians treated for type 2 diabetes mellitus (DM2). A full-mouth periodontal examination, including probing pocket depth, gingival recession, clinical attachment loss, plaque index and bleeding on probing, was performed in 132 healthy Indonesians and 101 Indonesians treated for DM2. Using these data, PISA was calculated. In addition, HbA1c and CRP were analyzed. A validated questionnaire was used to assess smoking, body mass index (BMI), education and medical conditions. In regression analyses, it was assessed whether periodontitis severity and CRP predict HbA1c, controlling for confounding and effect modification (i.e., age, sex, BMI, pack years, and education). In healthy Indonesians, PISA and CRP predicted HbA1c as did age, sex, and smoking. In Indonesians treated for DM2, PISA did not predict HbA1c. Periodontitis may impair blood glucose regulation in healthy Indonesians in conjunction with elevated CRP levels. The potential effect of periodontitis on glucose control in DM2 patients may be masked by DM2 treatment. periodontitis may impair blood glucose control through exerting an inflammatory and infectious burden evidenced by increased levels of CRP.

  2. Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma.

    Science.gov (United States)

    Tagde, Ashujit; Markert, Tahireh; Rajabi, Hasan; Hiraki, Masayuki; Alam, Maroof; Bouillez, Audrey; Avigan, David; Anderson, Kenneth; Kufe, Donald

    2017-09-19

    The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM cell survival. The present studies show that targeting MUC1-C with (i) stable and inducible silencing and CRISPR/Cas9 editing and (ii) the pharmacologic inhibitor GO-203, which blocks MUC1-C function, downregulates BMI1, RING1 and RING2 expression. The results demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism. MUC1-C thus promotes MYC occupancy on the BMI1 promoter and thereby activates BMI1 expression. We also show that the MUC1-C→MYC pathway induces RING2 expression. Moreover, in contrast to BMI1 and RING2, we found that MUC1-C drives RING1 by an NF-κB p65-dependent mechanism. Targeting MUC1-C and thereby the suppression of these key PRC1 proteins was associated with downregulation of the PRC1 E3 ligase activity as evidenced by decreases in ubiquitylation of histone H2A. Targeting MUC1-C also resulted in activation of the PRC1-repressed tumor suppressor genes, PTEN, CDNK2A and BIM . These findings identify a heretofore unrecognized role for MUC1-C in the epigenetic regulation of MM cells.

  3. Does BMI influence hospital stay and morbidity after fast-track hip and knee arthroplasty?

    DEFF Research Database (Denmark)

    Husted, Henrik; Jørgensen, Christoffer C.; Gromov, Kirill

    2016-01-01

    -day re-admission rates were around 6% for both THA (6.1%) and TKA (5.9%), without any statistically significant differences between BMI groups in univariate analysis (p > 0.4), but there was a trend of a protective effect of overweight for both THA (p = 0.1) and TKA (p = 0.06). 90-day re...

  4. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

    Science.gov (United States)

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

    2008-01-01

    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embryonic and adult stem cells. By screening proteins responding to DNA damage using laser micro-irradiation, we found that PHF1, a human homolog of Drosophila polycomb-like, Pcl, protein, was recruited to DSBs immediately after irradiation and dissociated within 10 min. The accumulation at DSBs is Ku70/Ku80-dependent, and knockdown of PHF1 leads to X-ray sensitivity and increases the frequency of homologous recombination in HeLa cell. We found that PHF1 interacts physically with Ku70/Ku80, suggesting that PHF1 promotes nonhomologous end-joining processes. Furthermore, we found that PHF1 interacts with a number of proteins involved in DNA damage responses, RAD50, SMC1, DHX9 and p53, further suggesting that PHF1, besides the function in PcG, is involved in genome maintenance processes. PMID:18385154

  5. Correction of self-reported BMI based on objective measurements: a Belgian experience.

    Science.gov (United States)

    Drieskens, S; Demarest, S; Bel, S; De Ridder, K; Tafforeau, J

    2018-01-01

    Based on successive Health Interview Surveys (HIS), it has been demonstrated that also in Belgium obesity, measured by means of a self-reported body mass index (BMI in kg/m 2 ), is a growing public health problem that needs to be monitored as accurately as possible. Studies have shown that a self-reported BMI can be biased. Consequently, if the aim is to rely on a self-reported BMI, adjustment is recommended. Data on measured and self-reported BMI, derived from the Belgian Food Consumption Survey (FCS) 2014 offers the opportunity to do so. The HIS and FCS are cross-sectional surveys based on representative population samples. This study focused on adults aged 18-64 years (sample HIS = 6545 and FCS = 1213). Measured and self-reported BMI collected in FCS were used to assess possible misreporting. Using FCS data, correction factors (measured BMI/self-reported BMI) were calculated in function of a combination of background variables (region, gender, educational level and age group). Individual self-reported BMI of the HIS 2013 were then multiplied with the corresponding correction factors to produce a corrected BMI-classification. When compared with the measured BMI, the self-reported BMI in the FCS was underestimated (mean 0.97 kg/m 2 ). 28% of the obese people underestimated their BMI. After applying the correction factors, the prevalence of obesity based on HIS data significantly increased (from 13% based on the original HIS data to 17% based on the corrected HIS data) and approximated the measured one derived from the FCS data. Since self-reported calculations of BMI are underestimated, it is recommended to adjust them to obtain accurate estimates which are important for decision making.

  6. Important mitochondrial proteins in human omental adipose tissue show reduced expression in obesity

    Directory of Open Access Journals (Sweden)

    Peter W. Lindinger

    2015-09-01

    Full Text Available Obesity is associated with impaired mitochondrial function. This study compares mitochondrial protein expression in omental fat in obese and non-obese humans. Omental adipose tissue was obtained by surgical biopsy, adipocytes were purified and mitochondria isolated. Using anion-exchange chromatography, SDS-PAGE and mass-spectrometry, 128 proteins with potentially different abundances in patient groups were identified, 62 of the 128 proteins are mainly localized in the mitochondria. Further quantification of 12 of these 62 proteins by immune dot blot analysis revealed four proteins citrate synthase, HADHA, LETM1 and mitofilin being inversely associated with BMI, and mitofilin being inversely correlated with gender.

  7. Bidirectional associations between mothers' and fathers' parenting consistency and child BMI.

    Science.gov (United States)

    Jansen, Pauline W; Giallo, Rebecca; Westrupp, Elizabeth M; Wake, Melissa; Nicholson, Jan M

    2013-12-01

    Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. Participants were 4002 children and their parents in the population-based Longitudinal Study of Australian Children. Mothers and fathers self-reported parenting consistency, and children's BMI was measured at 4 biennial waves starting at age 4 to 5 years in 2004. Bidirectionality between parenting and child BMI was examined by using regression analyses in cross-lagged models. The best-fitting models indicated a modest influence from parenting to child BMI, whereas no support was found for bidirectional influences. For mothers, higher levels of parenting consistency predicted lower BMI in children from Waves 1 to 2 and 3 to 4; for example, for every SD increase in mothers' parenting consistency at Wave 1, child BMIz fell by 0.025 in Wave 2 (95% confidence interval: -0.05 to -0.003). For fathers, higher levels of parenting consistency were associated with lower child BMI from Waves 1 to 2 and 2 to 3. Parenting inconsistency of mothers and fathers prospectively predicted small increases in offspring BMI over 2-year periods across middle childhood. However, child BMI did not appear to influence parenting behavior. These findings support recent calls for expanding childhood overweight interventions to address the broad parenting context while involving both mothers and fathers.

  8. Does BMI influence hospital stay and morbidity after fast-track hip and knee arthroplasty?

    DEFF Research Database (Denmark)

    Husted, Henrik; Jørgensen, Christoffer C; Gromov, Kirill

    2016-01-01

    Background and purpose - Body mass index (BMI) outside the normal range possibly affects the perioperative morbidity and mortality following total hip arthroplasty (THA) and total knee arthroplasty (TKA) in traditional care programs. We determined perioperative morbidity and mortality in such pat......Background and purpose - Body mass index (BMI) outside the normal range possibly affects the perioperative morbidity and mortality following total hip arthroplasty (THA) and total knee arthroplasty (TKA) in traditional care programs. We determined perioperative morbidity and mortality...... in such patients who were operated with the fast-track methodology and compared the levels with those in patients with normal BMI. Patients and methods - This was a prospective observational study involving 13,730 procedures (7,194 THA and 6,536 TKA operations) performed in a standardized fast-track setting....... Complete 90-day follow-up was achieved using national registries and review of medical records. Patients were grouped according to BMI as being underweight, of normal weight, overweight, obese, very obese, and morbidly obese. Results - Median length of stay (LOS) was 2 (IQR: 2-3) days in all BMI groups. 30...

  9. [Evaluation of the nutrition mode in children during the pubertal period with BMI < or = 5 percentile in the city of Szczecin].

    Science.gov (United States)

    Goluch-Koniuszy, Zuzanna

    2010-01-01

    This research was aimed at evaluation of the method of nutrition in the children aged 13 during the period of pubertal spurt who had their body mass, body weight and this values led to calculation of BMI indicator which was related to centile distribution of children from Warszawa. From the group 1464 children selected 79 persons (5.4% the whole of investigated) with BMI < or = 5 percentile with underweight and considerable underweight. Their menus of three chosen at random weekdays were obtained. Analysis of the nutrition method of children with underweight and considerable underweight showed low energy value of the diet, cellulose, mineral components (K, Ca, Mg) also liquids deficiency at simultaneously occurrent the general and animal protein, the fat, the cholesterol, mineral components (Na, P, Fe, Cu, Zn), vitamins A, C, E (girls) and from the group B. The children have undergone a special pro health education in the form "live" workshop.

  10. Is BMI a valid measure of obesity in postmenopausal women?

    Science.gov (United States)

    Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew

    2018-03-01

    Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.

  11. Effects of social mobility from childhood to adolescence on BMI.

    Science.gov (United States)

    Muraro, Ana Paula; Gonçalves-Silva, Regina Maria Veras; Ferreira, Márcia Gonçalves; Sichieri, Rosely

    2016-04-01

    Little is known about the contribution of childhood socio-economic position (SEP) and social mobility to weight change. The present study evaluated the effect of family SEP during the pre-school years and social mobility on BMI between birth and adolescence. Longitudinal. The SEP of each child's family was classified according to an asset-based wealth index as low, medium or high. Four different categories of childhood-adolescence SEP groups were created in order to examine social mobility: low-medium/high, medium-medium, medium-high and high-high/medium. For each of these categories, BMI was tracked from birth to adolescence. Linear mixed-effects models were used to analyse the data. Cuiabá-MT, Brazil. A population-based cohort of children born between 1994 and 1999 was assessed between 1999 and 2000, and again between 2009 and 2011. A total of 1716 adolescents were followed from childhood to adolescence (71·4 % of baseline). The prevalence of overweight/obesity was 20·4 % in childhood and 27·7 % in adolescence. A higher SEP in childhood was associated with a greater prevalence of overweight in adolescence. Expressive upward social mobility occurred, mainly in the lowest SEP group. There was a greater rate of change in BMI between birth and adolescence among children with a higher SEP in childhood and children who remained in the higher SEP from childhood to adolescence. Individuals from a higher SEP in childhood and those who remained in the higher social classes showed greater rate of change in BMI. Thus, initial SEP was the major determinant of changes in BMI.

  12. The immediate early gene product EGR1 and polycomb group proteins interact in epigenetic programming during chondrogenesis.

    Directory of Open Access Journals (Sweden)

    Frank Spaapen

    Full Text Available Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3 blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis.

  13. The relationship between BMI and insulin resistance and progression from single to multiple autoantibody positivity and type 1 diabetes among TrialNet Pathway to Prevention participants.

    Science.gov (United States)

    Meah, Farah A; DiMeglio, Linda A; Greenbaum, Carla J; Blum, Janice S; Sosenko, Jay M; Pugliese, Alberto; Geyer, Susan; Xu, Ping; Evans-Molina, Carmella

    2016-06-01

    The incidence of type 1 diabetes is increasing at a rate of 3-5% per year. Genetics cannot fully account for this trend, suggesting an influence of environmental factors. The accelerator hypothesis proposes an effect of metabolic factors on type 1 diabetes risk. To test this in the TrialNet Pathway to Prevention (PTP) cohort, we analysed the influence of BMI, weight status and insulin resistance on progression from single to multiple islet autoantibodies (Aab) and progression from normoglycaemia to diabetes. HOMA1-IR was used to estimate insulin resistance in Aab-positive PTP participants. Cox proportional hazards models were used to evaluate the effects of BMI, BMI percentile (BMI%), weight status and HOMA1-IR on the progression of autoimmunity or the development of diabetes. Data from 1,310 single and 1,897 multiple Aab-positive PTP participants were included. We found no significant relationships between BMI, BMI%, weight status or HOMA1-IR and the progression from one to multiple Aabs. Similarly, among all Aab-positive participants, no significant relationships were found between BMI, weight status or HOMA1-IR and progression to diabetes. Diabetes risk was modestly increased with increasing BMI% among the entire cohort, in obese participants 13-20 years of age and with increasing HOMA1-IR in adult Aab-positive participants. Analysis of the accelerator hypothesis in the TrialNet PTP cohort does not suggest a broad influence of metabolic variables on diabetes risk. Efforts to identify other potentially modifiable environmental factors should continue.

  14. The role of diabetes mellitus and BMI in the surgical treatment of ankle fractures.

    Science.gov (United States)

    Lanzetti, Riccardo Maria; Lupariello, Domenico; Venditto, Teresa; Guzzini, Matteo; Ponzo, Antonio; De Carli, Angelo; Ferretti, Andrea

    2018-02-01

    Open reduction and internal fixation is the standard treatment for displaced ankle fractures. However, the presence of comorbidities such as diabetes mellitus and body mass index (BMI) are associated with poor bone quality, and these factors may predict the development of postoperative complications. The study aim was to assess the role of diabetes mellitus and BMI in wound healing in patients younger than 65 years who were surgically treated for malleoli fractures. Ninety patients, aged from 18 to 65 years old, with surgically treated ankle fracture, were retrospectively enrolled. Patients were classified in two groups: patient with diabetes and patients without diabetes (insulin-dependent and noninsulin dependent). All patients were assessed for wound complications, Visual Analogue Scale and Foot and Ankle Disability Index (FADI) were assessed for all patients. Logistic regression was used to identify the risk of wound complications after surgery using the following factors as explanatory variables: age, gender, duration of surgery, BMI, hypercholesterolemia, smoking history, diabetes mellitus, and high blood pressure. In total, 38.9% of patients showed wound complications. Of them, 17.1% were nondiabetics and 82.9% were diabetics. We observed a significant association between DM and wound complications after surgery (P = .005). Logistic regression analysis revealed that DM (P BMI (P = .03) were associated with wound complications. The odds of having a postoperative wound complication were increased 0.16 times in the presence of diabetes and 1.14 times for increasing BMI. This study showed that diabetes mellitus and higher BMI delay the wound healing and increase the complication rate in young adult patients with surgically treated bimalleolar fractures. Copyright © 2017 John Wiley & Sons, Ltd.

  15. Hypertension and diabetes prevalence among adults with moderately increased BMI (23·0-24·9 kg/m2): findings from a nationwide survey in Bangladesh.

    Science.gov (United States)

    Rahman, Muntasirur; Williams, Gail; Mamun, Abdullah Al

    2017-06-01

    BMI is a proxy for fat accumulation in the body. Increased diabetes and CVD risks have been observed for Asian populations at lower BMI than the WHO-recommended BMI cut-off points for overweight (≥25·0 kg/m2) and obesity (≥30·0 kg/m2). The current study aimed to quantify the increased hypertension (HTN) and type 2 diabetes mellitus (T2DM) prevalence in Bangladeshi adults with moderately increased BMI (23·0-24·9 kg/m2). Data from the most recent Bangladesh Demographic and Health Survey (2011) were analysed. Modified Poisson regression models with robust error variance were used to calculate prevalence ratios (PR) for HTN or T2DM by BMI category, considering BMI=18·5-22·9 kg/m2 as the reference. All analyses incorporated the complex sampling design of the survey. BMI, blood pressure, blood sugar and related information were collected from a nationally representative sample. Adults (n 7433) aged≥35 years. About 12 % of Bangladeshi adults, both male and female, were within the BMI range 23·0-24·9 kg/m2 or moderately overweight. Compared with the reference BMI group (18·5-22·9 kg/m2), they had an increased PR for HTN (1·55-1·77) and T2DM (1·54-1·93). These increased PR are similar to those for the WHO-defined overweight group (BMI=25·0-29·9 kg/m2). Our findings support the recommendation that calls for setting the optimum BMI for Asian populations to 18·5-23·0 kg/m2 for health promotion and for public health interventions like leisure-time physical activity. WHO cut-off points for overweight (≥25 kg/m2) should be used to facilitate international comparisons.

  16. Predictors of BMI Vary along the BMI Range of German Adults – Results of the German National Nutrition Survey II

    Science.gov (United States)

    Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid

    2017-01-01

    Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069

  17. Protective effect of Sestrin2 on apoptosis of dendritic cells induced by high mobility group box-1 protein

    Directory of Open Access Journals (Sweden)

    Li-xue WANG

    2018-04-01

    Full Text Available Objective To investigate the potential role of Sestrin2 (SESN2 in regulating the apoptosis of dendritic cells (DCs induced by high mobility group box-1 protein (HMGB1. Methods DCs (the murine DC cell line DC2.4 were cultured with or without HMGB1 stimulation (cultured with 10ng/ml HMGB1 for 8, 24 and 48 hours, or cultured with HMGB1 for 48 hours at different concentrations of 1, 10 and 100ng/ml, respectively, n=4. The protein level of SESN2, cleaved-caspase-3 and Bcl-2 were analyzed with Western blotting. Localization of SESN2 in cells was observed under confocal laser microscope (LSCM. Cell apoptosis was analyzed with flow cytometry. In addition, DC2.4 cells were transfected with lentivirus containing SESN2 LV-RNA, SESN2 siRNA sequence expressing plasmids or blank vector (NC, NS, n=4. These cells were then stimulated with HMGB1 (100ng/ml for 48 hours, and the apoptosis was accessed as mentioned above. Results Compared with the control group, the expression of SESN2 was obviously up-regulated after HMGB1 (10ng/ml stimulation for 24 and 48 hours (P<0.05. In a dose-dependent response, the expression of SESN2 was markedly enhanced in treatment with 1, 10, 100ng/ml HMGB1 for 48 hours (P<0.05. Compared with the control group (7.35%±1.33%, the percentage of apoptosis was significantly increased with 10, 100ng/ml HMGB1 for 48 hours [(17.02%±4.85%, 17.48%±4.04%, respectively, P<0.05 or P<0.01]. After transfection, compared with blank vector group, the apoptosis of SESN2 siRNA group obviously elevated [(65.96%±2.50% vs. (50.01%±2.07%, P<0.05], and cleaved-caspase-3 expression significantly increased while Bcl-2 expression obviously decreased. In SESN2 LV-RNA group, the apoptosis significantly decreased [(35.57%±1.69% vs. (49.04%±4.87%, P<0.05], and cleaved-caspase-3 expression decreased and Bcl-2 expression obviously increased compared with blank vector group (P<0.05. Conclusion SESN2 has a protective effect against HMGB1 induced apoptosis of DC2

  18. Association of fat mass and obesity-associated and retinitis pigmentosa guanosine triphosphatase (GTPase) regulator-interacting protein-1 like polymorphisms with body mass index in Chinese women.

    Science.gov (United States)

    Chen, Boyu; Li, Zhiqiang; Chen, Jianhua; Ji, Jue; Shen, Jingyi; Xu, Yufeng; Zhao, Yingying; Liu, Danping; Shen, Yinhuan; Zhang, Weijie; Shen, Jiawei; Wang, Yonggang; Shi, Yongyong

    2018-04-14

    Body mass index (BMI) is the most commonly used quantitative measure of adiposity. It is a kind of complex genetic diseases which are caused by multiple susceptibility genes. The first intron of fat mass and obesity-associated (FTO) has been widely discovered to be associated with BMI. Retinitis pigmentosa GTPase regulator-interacting protein-1 like (RPGRIP1L) is located in the upstream region of FTO and has been proved to be linked with obesity through functional tests. We carried out a genetic association analysis to figure out the role of the FTO gene and the RPGRIP1L gene in BMI. A quantitative traits study with 6,102 Chinese female samples, adjusted for age, was performed during our project. Among the twelve SNPs, rs1421085, rs1558902, rs17817449, rs8050136, rs9939609, rs7202296, rs56137030, rs9930506 and rs12149832 in the FTO gene were significantly associated with BMI after Bonferroni correction. Meanwhile, rs9934800 in the RPGRIP1L gene showed significance with BMI before Bonferroni correction, but this association was eliminated after Bonferroni correction. Our results suggested that genetic variants in the FTO gene were strongly associated with BMI in Chinese women, which may serve as targets of pharmaceutical research and development concerning BMI. Meanwhile, we didn't found the significant association between RPGRIP1L and BMI in Chinese women.

  19. The Impact of Sleep-Disordered Breathing on Body Mass Index (BMI): The Sleep Heart Health Study (SHHS).

    Science.gov (United States)

    Brown, Mark A; Goodwin, James L; Silva, Graciela E; Behari, Ajay; Newman, Anne B; Punjabi, Naresh M; Resnick, Helaine E; Robbins, John A; Quan, Stuart F

    2011-12-08

    INTRODUCTION: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB). However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS) were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors. METHODS: A full-montage unattended home polysomnogram (PSG) and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI) was categorized using clinical thresholds: sleep apnea), and ≥ 15 (moderate to severe sleep apnea). Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates. RESULTS: Mean (SD) age was 62.2 years (10.14), 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD) change of 0.53 (2.62) kg/m(2) (p=0.071). A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m(2) (p=0.055) and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m(2) (plosing weight.

  20. Association between C-reactive protein and features of the metabolic syndrome

    DEFF Research Database (Denmark)

    Fröhlich, M; Imhof, A; Berg, Gabriele

    2000-01-01

    OBJECTIVE: To assess the association of circulating levels of C-reactive protein, a sensitive systemic marker of inflammation, with different components of the metabolic syndrome. RESEARCH DESIGN AND METHODS: Total cholesterol (TC), HDL cholesterol, triglycerides, uric acid, BMI , and prevalence...... concentrations in subjects grouped according to the presence of 0-1, 2-3, and > or =4 features of the metabolic syndrome were 1.11, 1.27, and 2.16 mg/l, respectively, with a statistically highly significant trend (P metabolic syndrome...

  1. BMI-for-age in South Asian children of 0-20 years in the Netherlands: secular changes and misclassification by WHO growth references.

    Science.gov (United States)

    de Wilde, J A; Dekker, M; Middelkoop, B J C

    2018-03-01

    South Asians are prone to cardiometabolic disease at lower BMI levels than most other ethnic groups, starting in childhood. The magnitude of BMI misclassifications is unknown. To compare the BMI distribution of contemporary South Asian 0-20 year olds in the Netherlands with: (1) The South Asian norm reference (secular trends); and (2) The WHO child growth standard and reference. The BMI-for-age distribution of 6677 routine measurements of 3322 South Asian children, aged 0-20 years, was described with the LMS method and BMI z-scores. The BMI distribution in South Asian 0-4 year olds was almost similar to the norm reference (mean BMI z-score = 0.11, skewness = 0.31, SD = 1.0), whereas in 5-19 year olds the distribution had shifted upwards (mean = 0.53) and widened (skewness = -0.12, SD = 1.08). Overweight (incl. obesity) and obesity peaked at 8-10 years, at 45-48% and 35-37%, respectively. Relative to the WHO references, the BMI distribution was left-shifted at ages 0-4 years (mean BMI z-score = -0.46, skewness = 0.23, SD = 0.98) and widened at ages 5-20 years (mean = 0.05; skewness = -0.02, SD = 1.40). At most ages, thinness rates were significantly higher and obesity rates lower than based on South Asian norms. A secular change of BMI-for-age in South Asian children mostly affected children >4 years. WHO references likely under-estimate overweight and obesity rates in South Asian children.

  2. Nutritional Intake in Low Body Mass Index (BMI Males with Type 1 Diabetes and Fibrocalcific Pancreatic Diabetes: What are the Unmet Needs? A Cross-Sectional Study from a South Indian Tertiary Care Hospital

    Directory of Open Access Journals (Sweden)

    Mini Joseph

    2017-10-01

    Full Text Available Introduction: There is paucity of data on the nutritional intake in low Body Mass Index (BMI Asian Indians with diabetes. Aim: To study the difference in the nutrient intake pattern in low-BMI Type 1 Diabetes Mellitus (T1DM and Fibrocalcific Pancreatic Diabetes (FCPD patients. Materials and Methods: This cross-sectional study consisted of T1DM (n=40 and FCPD (n=20 male patients with similar BMI. Nutritional data was collected using the 24 hour recall method and food diaries. Fasting blood samples were analysed for lipid profile, serum creatinine, glycosylated haemoglobin, albumin, calcium and vitamin D. Stool samples were analysed for pancreatic elastase. Percentage analysis, Independent sample t-test and Pearson coefficient correlation were used to analyse the data. A p-value<0.05 was considered as statistically significant. Results: The FCPD patients, on biochemical analysis, had significantly lower vitamin D levels compared to the T1DM group (p=0.035. However, haemoglobin, triglycerides, low density lipoproteins, creatinine, albumin and calcium were similar between the groups. In the nutrient data, FCPD patients had a significant higher intake of fat (p=0.039, fibre (p<0.001, calcium (p=0.047, phosphorous (p=0.035, and niacin (p=0.001 and calories from fat (p=0.047. The T1DM group had a significantly higher intake of thiamine (p=0.047 and carbohydrates (p=0.014. Conclusion: T1DM and FCPD groups have similar dietary pattern deficit in fibre, calories, macronutrients and micronutrients. Malabsorption and poor glycaemic control in FCPD patients can be attributed to a higher dietary fat intake. A balanced diet can ensure better glycaemic control.

  3. Analysis of the prognostic value of BMI and the difference in its impact according to age and sex in DLBCL patients.

    Science.gov (United States)

    Kanemasa, Yusuke; Shimoyama, Tatsu; Sasaki, Yuki; Tamura, Miho; Sawada, Takeshi; Omuro, Yasushi; Hishima, Tsunekazu; Maeda, Yoshiharu

    2018-02-01

    Studies that have evaluated the prognostic value of body mass index (BMI) in patients with diffuse large B-cell lymphoma have recently been reported. However, the impact of BMI on survival outcomes remains controversial. We retrospectively analyzed the data of 406 diffuse large B-cell lymphoma patients treated with R-CHOP or R-CHOP-like regimens. The number (%) of patients that were categorized into 1 of 4 groups according to BMI were underweight (BMI (BMI (≥25 kg/m 2 ) (5-y OS, 61.5% vs 85.7%; P = .039). In contrast, in young female patients (BMI had significantly better OS than those with a high BMI (5-y OS, 88.6% vs 46.4%; P BMI on OS between young and elderly patients. In this study, we demonstrated that being underweight and obese were independent prognostic factors compared with being normal weight. In female patients, BMI had a different impact on the prognosis of young and elderly patients, whereas in male patients, there was no difference in the effect of BMI on prognosis according to age. Copyright © 2017 John Wiley & Sons, Ltd.

  4. C-reactive protein and high mobility group box 1 in dogs with gastric dilatation and volvulus.

    Science.gov (United States)

    Uhrikova, Ivana; Rauserova-Lexmaulova, Leona; Rehakova, Kristina; Scheer, Peter; Doubek, Jaroslav

    2015-01-01

    To (1) measure C-reactive protein (CRP) and high mobility group box 1 (HMGB1) and (2) evaluate their prognostic value and relationship to severity of systemic inflammatory response syndrome, routine hematological and acid-base parameters in dogs with gastric dilatation volvulus (GDV). Prospective observational study from September 2010 to June 2012. Veterinary teaching hospital. Forty-one client-owned dogs with GDV. None. Blood was collected before surgery (baseline), postsurgery, 6-10 hours postsurgery, and 18-22 hours postsurgery. CRP and HMGB1 were measured in all samples, and routine hematological, biochemical, and acid-base analyses were performed. Only baseline and postsurgery samples were used from nonsurvivors (n = 10). CRP increased significantly from postsurgery sampling to 18-22 hours postsurgery, while HMGB1 did not change over time. There was a significant difference in HMGB1 between survivors and nonsurvivors over time. Both proteins correlated with systemic inflammatory response syndrome severity, total leukocyte, segmented neutrophils, and band counts. HMGB1 correlated also with acid-base parameters (pH, bicarbonate, base excess). HMGB1 and CRP behaved differently in regards to their kinetic patterns, with HMGB1 appearing to better reflect the severity of tissue injury in dogs with GDV than CRP. © Veterinary Emergency and Critical Care Society 2015.

  5. Time Course of Leptin in Patients with Anorexia Nervosa during Inpatient Treatment: Longitudinal Relationships to BMI and Psychological Factors.

    Directory of Open Access Journals (Sweden)

    Esther Stroe-Kunold

    Full Text Available Leptin, a hormone secreted by adipose tissue, appears to play a major role in the homeostasis of body weight and psychobiological processes associated with anorexia nervosa (AN. However, there is scarce data on its exact influence on this disorder, in particular data over time.The present study addresses whether leptin changes during inpatient treatment play a role for treatment outcome and psychological factors in underweight AN patients.In order to understand whether leptin's role differs in relation to AN severity, data were assessed from 11 patients with a very low BMI and a higher chronicity (high severity group; HSS; mean BMI at the beginning of the study = 13.6; mean duration of illness = 5.1 years vs. nine with less severe symptoms (LSS; mean BMI = 16.2; mean duration of illness = 3.7 years. During the course of treatment, serum leptin concentrations were assessed weekly while weight (BMI was assessed twice per week. Concomitantly, psychological variables were obtained by means of electronic diaries. Unconditional linear growth models were calculated to evaluate the temporal course of leptin in relation to BMI. For HSS patients, two phases of treatment (BMI < 16 and BMI ≥ 16 kg/m2 were investigated.Leptin increased significantly with BMI in both groups of patients. For HSS patients, the increase of leptin in the first treatment phase did not predict later increases in BMI. Furthermore, the relationship of leptin and psychological factors was modulated by symptom severity. In HSS patients, higher leptin levels were associated with greater feelings of depression, anxiety, and stress whereas in LSS patients a higher leptin level showed the trend to be associated with lower psychological symptom burden.Our results suggest that leptin changes are differently associated with weight gain and psychological symptoms depending on the severity of starvation.

  6. Concordance between self-reported pre-pregnancy body mass index (BMI) and BMI measured at the first prenatal study contact.

    Science.gov (United States)

    Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A

    2016-07-26

    The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).

  7. Vegetarian Choices in the Protein Foods Group

    Science.gov (United States)

    ... foods selected are adequate. Protein sources from the Protein Foods Group for vegetarians include eggs (for ovo-vegetarians), beans and peas, nuts, nut butters, and soy products (tofu, tempeh, ...

  8. The Scl1 protein of M6-type group A Streptococcus binds the human complement regulatory protein, factor H, and inhibits the alternative pathway of complement.

    Science.gov (United States)

    Caswell, Clayton C; Han, Runlin; Hovis, Kelley M; Ciborowski, Pawel; Keene, Douglas R; Marconi, Richard T; Lukomski, Slawomir

    2008-02-01

    Non-specific activation of the complement system is regulated by the plasma glycoprotein factor H (FH). Bacteria can avoid complement-mediated opsonization and phagocytosis through acquiring FH to the cell surface. Here, we characterize an interaction between the streptococcal collagen-like protein Scl1.6 of M6-type group A Streptococcus (GAS) and FH. Using affinity chromatography with immobilized recombinant Scl1.6 protein, we co-eluted human plasma proteins with molecular weight of 155 kDa, 43 kDa and 38 kDa. Mass spectrometry identified the 155 kDa band as FH and two other bands as isoforms of the FH-related protein-1. The identities of all three bands were confirmed by Western immunoblotting with specific antibodies. Structure-function relation studies determined that the globular domain of the Scl1.6 variant specifically binds FH while fused to collagenous tails of various lengths. This binding is not restricted to Scl1.6 as the phylogenetically linked Scl1.55 variant also binds FH. Functional analyses demonstrated the cofactor activity of the rScl1.6-bound FH for factor I-mediated cleavage of C3b. Finally, purified FH bound to the Scl1.6 protein present in the cell wall material obtained from M6-type GAS. In conclusion, we have identified a functional interaction between Scl1 and plasma FH, which may contribute to GAS evasion of complement-mediated opsonization and phagocytosis.

  9. Effect of inhaled corticosteroid use on weight (BMI) in pediatric patients with moderate-severe asthma.

    Science.gov (United States)

    Han, Jennifer; Nguyen, John; Kim, Yuna; Geng, Bob; Romanowski, Gale; Alejandro, Lawrence; Proudfoot, James; Xu, Ronghui; Leibel, Sydney

    2018-04-19

    Assess the relationship between inhaled corticosteroid use (ICS) and weight (BMI) in pediatric patients with moderate-severe asthma. Assess if the number of emergency department (ED) visits correlates with overall BMI trajectory. Assess the trend of prescribing biologic therapy in pediatric patients with moderate-severe asthma and determine its relationship with weight (BMI). A retrospective chart review was performed on 93 pediatric patients with moderate-severe asthma to determine the relationship between ICS use and weight (BMI), biologic therapy and BMI, and number of ED visits and BMI trajectory. A mixed effects model was employed with the correlation between repeated measures accounted for through the random effects. There is a statistically significant increase of 0.369 kg/m 2 in BMI trajectory per year in subjects on high-dose steroids compared to an increase of 0.195 kg/m 2 in the low dose group (p BMI of subjects initiated on biologic therapy (omalizumab or mepolizumab) had a statistically significant decrease in BMI trajectory of 0.818 kg/m 2 per year (p BMI trajectory (p BMI trajectory; the higher the dose, the greater the projected BMI increase per year. Initiation of biologic therapy decreased BMI trajectory over time. Lastly, those with frequent ED visits had a higher BMI trend. Future prospective studies are warranted that further evaluate the potential metabolic impacts of ICS and assess the effects of biologic therapy on BMI.

  10. Postnatal BMI changes in children with different birthweights: A trial study for detecting early predictive factors for pediatric obesity

    Science.gov (United States)

    Nakagawa, Yuichi; Nakanishi, Toshiki; Satake, Eiichiro; Matsushita, Rie; Saegusa, Hirokazu; Kubota, Akira; Natsume, Hiromune; Shibata, Yukinobu; Fujisawa, Yasuko

    2018-01-01

    Abstract. The purpose of this study was to clarify the degree of early postnatal growth by birthweight and detect early predictive factors for pediatric obesity. Body mass index (BMI) and degree of obesity were examined in children in the fourth year of elementary school and second year of junior high school. Their BMI at birth and three years of age were also examined. Based on birthweight, participants were divided into three groups: low ( 3500 g). Furthermore, according to the degree of obesity, they were divided into two groups: obese (20% ≤) and non-obese (20% >). The change of BMI from birth to three years of age (ΔBMI) showed a strong inverse relationship with birthweight and was significantly different among the three birthweight groups (low > middle > high). The ΔBMI and BMI at three years of age were higher in obese than in non-obese children and showed significant positive correlations with the degree of obesity. Early postnatal growth might be determined by birthweight and was higher in obese than in non-obese children. The ΔBMI from birth to three years of age and BMI at age of three years could be predictive factors for pediatric obesity. PMID:29403153

  11. A dimer of the lymphoid protein RAG1 recognizes the recombination signal sequence and the complex stably incorporates the high mobility group protein HMG2.

    Science.gov (United States)

    Rodgers, K K; Villey, I J; Ptaszek, L; Corbett, E; Schatz, D G; Coleman, J E

    1999-07-15

    RAG1 and RAG2 are the two lymphoid-specific proteins required for the cleavage of DNA sequences known as the recombination signal sequences (RSSs) flanking V, D or J regions of the antigen-binding genes. Previous studies have shown that RAG1 alone is capable of binding to the RSS, whereas RAG2 only binds as a RAG1/RAG2 complex. We have expressed recombinant core RAG1 (amino acids 384-1008) in Escherichia coli and demonstrated catalytic activity when combined with RAG2. This protein was then used to determine its oligomeric forms and the dissociation constant of binding to the RSS. Electrophoretic mobility shift assays show that up to three oligomeric complexes of core RAG1 form with a single RSS. Core RAG1 was found to exist as a dimer both when free in solution and as the minimal species bound to the RSS. Competition assays show that RAG1 recognizes both the conserved nonamer and heptamer sequences of the RSS. Zinc analysis shows the core to contain two zinc ions. The purified RAG1 protein overexpressed in E.coli exhibited the expected cleavage activity when combined with RAG2 purified from transfected 293T cells. The high mobility group protein HMG2 is stably incorporated into the recombinant RAG1/RSS complex and can increase the affinity of RAG1 for the RSS in the absence of RAG2.

  12. Assessment of Body Mass Index (BMI in 6-11 Years Old Primary School Children in Tabriz City, Iran

    Directory of Open Access Journals (Sweden)

    Nazila Farrin

    2016-06-01

    Full Text Available Background and Objectives: The prevalence of childhood overweight and obesity has been increasingly growing in many societies. The present study aimed to determine body mass index (BMI in primary school boys and girls in Tabriz city. Methods: This descriptive cross-sectional study was conducted on 857 primary school students of Tabriz city in 2012-2013. First, BMI of each person was calculated, and according to the NCHS standard curves, the values below the 5th percentile were considered as malnutrition and underweight, between the 85th-95th percentiles as overweight, and equal to or above the 95th percentile as obesity. Data were analyzed by one-sample t-test and t-test. The significance level was considered to be p<0.05. Results: According to the BMI data, the frequency of underweight, overweight, and obesity in the male students, were 20.9, 5.5, and 3.1%, and in female students were 18.8, 9.7, 0.9%, and in the total number of students were 20.1, 7.4, and 2.1%, respectively. Compared to the 50th percentile, the mean BMI in male students in the age group of 9 years was higher (p<0.01 and in the age group of 6 years was lower (p<0.05. This comparison in the female students indicated higher mean BMI in the age groups of 7, 9, 10, and 11 years compared to the 50th percentile (p<0.05. The frequency of overweight among female students (9.7% was higher than male students (5.5%. However, the frequency of obesity in the male students was approximately 3.5 times higher than female students (p<0.05. Conclusion: Given the existence of both malnutrition states of underweight and obesity in the students and also the significant effect of childhood body weight on chronic disorders in adulthood, proper nutrition planning is necessary at the school level.

  13. Does more education cause lower BMI, or do lower-BMI individuals become more educated? Evidence from the National Longitudinal Survey of Youth 1979.

    Science.gov (United States)

    Benson, Rebecca; von Hippel, Paul T; Lynch, Jamie L

    2017-03-21

    More educated adults have lower average body mass index (BMI). This may be due to selection, if adolescents with lower BMI attain higher levels of education, or it may be due to causation, if higher educational attainment reduces BMI gain in adulthood. We test for selection and causation in the National Longitudinal Survey of Youth 1979, which has followed a representative US cohort from age 14-22 in 1979 through age 47-55 in 2012. Using ordinal logistic regression, we test the selection hypothesis that overweight and obese adolescents were less likely to earn high school diplomas and bachelor's degrees. Then, controlling for selection with individual fixed effects, we estimate the causal effect of degree completion on BMI and obesity status. Among 18-year-old women, but not among men, being overweight or obese predicts lower odds of attaining higher levels of education. At age 47-48, higher education is associated with lower BMI, but 70-90% of the association is due to selection. Net of selection, a bachelor's degree predicts less than a 1 kg reduction in body weight, and a high school credential does not reduce BMI. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. The streptococcal collagen-like protein-1 (Scl1 is a significant determinant for biofilm formation by group a Streptococcus

    Directory of Open Access Journals (Sweden)

    Oliver-Kozup Heaven A

    2011-12-01

    Full Text Available Abstract Background Group A Streptococcus (GAS is a human-specific pathogen responsible for a number of diseases characterized by a wide range of clinical manifestations. During host colonization GAS-cell aggregates or microcolonies are observed in tissues. GAS biofilm, which is an in vitro equivalent of tissue microcolony, has only recently been studied and little is known about the specific surface determinants that aid biofilm formation. In this study, we demonstrate that surface-associated streptococcal collagen-like protein-1 (Scl1 plays an important role in GAS biofilm formation. Results Biofilm formation by M1-, M3-, M28-, and M41-type GAS strains, representing an intraspecies breadth, were analyzed spectrophotometrically following crystal violet staining, and characterized using confocal and field emission scanning electron microscopy. The M41-type strain formed the most robust biofilm under static conditions, followed by M28- and M1-type strains, while the M3-type strains analyzed here did not form biofilm under the same experimental conditions. Differences in architecture and cell-surface morphology were observed in biofilms formed by the M1- and M41-wild-type strains, accompanied by varying amounts of deposited extracellular matrix and differences in cell-to-cell junctions within each biofilm. Importantly, all Scl1-negative mutants examined showed significantly decreased ability to form biofilm in vitro. Furthermore, the Scl1 protein expressed on the surface of a heterologous host, Lactococcus lactis, was sufficient to induce biofilm formation by this organism. Conclusions Overall, this work (i identifies variations in biofilm formation capacity among pathogenically different GAS strains, (ii identifies GAS surface properties that may aid in biofilm stability and, (iii establishes that the Scl1 surface protein is an important determinant of GAS biofilm, which is sufficient to enable biofilm formation in the heterologous host

  15. Effects of two-months balanced diet in metabolically healthy obesity: lipid correlations with gender and BMI-related differences.

    Science.gov (United States)

    Rondanelli, Mariangela; Klersy, Chaterine; Perna, Simone; Faliva, Milena Anna; Montorfano, Gigliola; Roderi, Paola; Colombo, Irma; Corsetto, Paola Antonia; Fioravanti, Marisa; Solerte, Sebastiano Bruno; Rizzo, Angela Maria

    2015-10-29

    Nowadays no researches has been performed on fatty acid profile (FA) and desaturase activity in metabolically healthy obesity (MHO). The aim of this study was to assessed gender and BMI-related difference in FA, estimated desaturase activities and the efficacy on metabolic changes produced by 2-months well-balance diet in MHO subjects. In 103 MHO subjects (30/73 M/F; age:42.2 ± 9.5) FA, estimated desaturase activity, body composition (by DXA), Body Mass Index (BMI), lipid profile, adipokines (leptin, adiponectin, grelin, glucagon-like peptide-1), insulin resistence (by Homestasis metabolic assessment), C-reactive proteine, Atherogenic index of plasma (AIP) and Body Shape Index (ABSI) have been assessed. Gender and BMI related difference have been evaluated and the efficacy produced by 2-months well-balance diet has been considered. At baseline, obese subjects, compared to overweight, show a significantly higher oleic (p insulin resistance (p = 0.006), leptin (p = 0.006), adiponectin (p <0.001), grelin (p = 0.030), CRP (p = 0.004), BMI (p <0.001) and android fat mass (p <0.001). The balanced diet intervention was effective in improving metabolic indices.

  16. Neogambogic acid prevents silica-induced fibrosis via inhibition of high-mobility group box 1 and MCP-1-induced protein 1

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wei [Department of Physiology, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Department of Pharmacology, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Key Laboratory of Developmental Genes and Human Disease, Southeast University, Nanjing 210096 (China); Department of Respiration, Zhongda Hospital, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Zhang, Mei, E-mail: meizhang1717@163.com [Department of Respiration, Zhongda Hospital, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Wang, Zhongjiang [Department of Radiology, Zhongda Hospital, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Cheng, Yusi; Liu, Haijun [Department of Physiology, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Zhou, Zewei [Department of Physiology, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Department of Pharmacology, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Han, Bing [Department of Pharmacology, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Chen, Baoan [Department of Hematology and Oncology, Zhongda Hospital, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Yao, Honghong, E-mail: yaohh@seu.edu.cn [Department of Pharmacology, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Key Laboratory of Developmental Genes and Human Disease, Southeast University, Nanjing 210096 (China); Chao, Jie, E-mail: chaojie@seu.edu.cn [Department of Physiology, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China); Key Laboratory of Developmental Genes and Human Disease, Southeast University, Nanjing 210096 (China); Department of Respiration, Zhongda Hospital, School of Medicine, Southeast University, Nanjing, Jiangsu 210009 (China)

    2016-10-15

    Background: Silicosis is a systemic disease caused by inhaling silicon dioxide (SiO{sub 2}); early stages are characterized by alveolar inflammation, and later stages are characterized by progressive lung fibrosis. Mounting evidence indicates that high-mobility group box 1 (HMGB1) is involved in pulmonary fibrosis. Whether neogambogic acid (NGA) inhibits macrophage and fibroblast activation induced by SiO{sub 2} by targeting HMGB1 remains unclear. Methods and results: Experiments using cultured mouse macrophages (RAW264.7 cells) demonstrated that SiO{sub 2} treatment induces the expression of HMGB1 in a time- and dose-dependent manner via mitogen-activated protein kinases (MAPKs) and the phosphatidylinositol 3-kinase (PI3K)/Akt pathway; in turn, this expression causes macrophage apoptosis and fibroblast activation. Pretreating macrophages with NGA inhibited the HMGB1 expression induced by SiO{sub 2} and attenuated both macrophage apoptosis and fibroblast activation. Moreover, NGA directly inhibited MCP-1-induced protein 1 (MCPIP1) expression, as well as markers of fibroblast activation and migration induced by SiO{sub 2}. Furthermore, the effects of NGA on macrophages and fibroblasts were confirmed in vivo by exposing mice to SiO{sub 2}. Conclusion: NGA can prevent SiO{sub 2}-induced macrophage activation and apoptosis via HMGB1 inhibition and SiO{sub 2}-induced fibrosis via the MCPIP1 pathway. Targeting HMGB1 and MCPIP1 with NGA could provide insights into the potential development of a therapeutic approach for alleviating the inflammation and fibrosis induced by SiO{sub 2}. - Highlights: • The SiO{sub 2} induced HMGB1 in alveolar macrophage and MCPIP1 in fibroblast. • NGA rescued the SiO{sub 2}-induced apoptosis of alveolar macrophages via HMGB1 signaling. • NGA inhibited the fibroblast activation induced by SiO{sub 2} via MCPIP1 signaling. • NGA might represent a potential therapeutic approach for silicosis.

  17. Relation between Mammographic Parenchymal Patterns and Breast Cancer Risk: Considering BMI, Compressed Breast Thickness and Age of Women in Tabriz, Iran.

    Science.gov (United States)

    Mehnati, Parinaz; Alizadeh, Hamed; Hoda, Haleh

    2016-01-01

    Mammographic density determined according paranchymal patterns is a risk factor for breast cancer and its relationships with body and other breast characteristics of women is important. The purpose of the present study was to correlate breast parenchymal patterns and mammography abnormality findings with women's BMI, compressed breast thickness (CBT) and age in Tabriz city, Iran. From 1,100 mammograms interpreted by radiologists, breast parenchymal was classified into four categories from Types 1 (mostly fatty) through 4 (mostly fibroglandular tissue). Age, BMI, and CBT were recorded and their relation with risk for the development of breast abnormalities in mammograms was analyzed. In women with a mean age of 45.8±8.63 years 17.7% were in the high density group (Type 3 and 4). A comparison of four types of breast paranchymal with BMI, CBT and age showed inverse relations to breast density. Abnormal mammographic findings were 25.8% of all reported mammograms with a circular mass (12.7%) as the most common abnormality. About 21% abnormal cases were in less than 40 years. Increasing of BMI had significant relation with breast abnormality but in CBT was not observed. Measurement of women's body characteristics is useful for assistance in mammography diagnosis as well as selection of imaging instrument by high sensitivity for following patient in future. The effects of age, CBT and BMI groups on the breast paranchymal were significant.

  18. Increased serum levels of high mobility group box 1 protein in patients with autistic disorder.

    Science.gov (United States)

    Emanuele, Enzo; Boso, Marianna; Brondino, Natascia; Pietra, Stefania; Barale, Francesco; Ucelli di Nemi, Stefania; Politi, Pierluigi

    2010-05-30

    High mobility group box 1 (HMGB1) is a highly conserved, ubiquitous protein that functions as an activator for inducing the immune response and can be released from neurons after glutamate excitotoxicity. The objective of the present study was to measure serum levels of HMGB1 in patients with autistic disorder and to study their relationship with clinical characteristics. We enrolled 22 adult patients with autistic disorder (mean age: 28.1+/-7.7 years) and 28 age- and gender-matched healthy controls (mean age: 28.7+/-8.1 years). Serum levels of HMGB1 were measured by enzyme-linked immunosorbent assay (ELISA). Compared with healthy subjects, serum levels of HMGB1 were significantly higher in patients with autistic disorder (10.8+/-2.6 ng/mL versus 5.6+/-2.5 ng/mL, respectively, Pautistic disorder. Increased HMGB1 may be a biological correlate of the impaired reciprocal social interactions in this neurodevelopmental disorder. Copyright 2010 Elsevier Inc. All rights reserved.

  19. The architecture of metal coordination groups in proteins.

    Science.gov (United States)

    Harding, Marjorie M

    2004-05-01

    A set of tables is presented and a survey given of the architecture of metal coordination groups in a representative set of protein structures from the Protein Data Bank [Bernstein et al. (1977), J. Mol. Biol. 112, 535-542; Berman et al. (2000), Nucleic Acids Res. 28, 235-242]. The structures have been determined to a resolution of 2.5 A or better; the metals considered are Ca, Mg, Mn, Fe, Cu, Zn, Na and K, with particular emphasis on Ca and Zn and the exclusion of haem groups and Fe/S clusters; the proteins are a representative set in which none has more than 30% sequence identity with any other. In them the metal is coordinated by several donor groups from different amino-acid residues in the protein chain and often also by water or other small molecules. The tables, for approximately 600 metal coordination groups, include information on the conformations of the protein chain in the region around the metal and reliability indicators. They illustrate the wide variety of coordination numbers, chelate-loop sizes and other properties and the different characteristics of different metals. They show that glycine has a particular significance in the position adjacent to a donor residue, especially in Ca coordination groups. They also show that metal coordination does not appear to lead to significant distortions of the torsion angles phi, psi from their normally allowed values. Very few metal coordination groups occur more than once in the representative set and when they do they are usually related in fold and function; they have similar but not necessarily identical conformations. However, individual chelate loops, for example Zn(-C-X-X'-C-), in which both cysteines are coordinated to Zn through S, and X and X' are any amino acids, are repeated frequently in many different and unrelated proteins. Not all chelate loops with the same composition have the same conformation, but for smaller loops there are usually one or two strongly preferred and well defined

  20. Haplotypes in the CRP gene associated with increased BMI and levels of CRP in subjects with type 2 diabetes or obesity from Southwestern Mexico.

    Science.gov (United States)

    Martínez-Calleja, América; Quiróz-Vargas, Irma; Parra-Rojas, Isela; Muñoz-Valle, José Francisco; Leyva-Vázquez, Marco A; Fernández-Tilapa, Gloria; Vences-Velázquez, Amalia; Cruz, Miguel; Salazar-Martínez, Eduardo; Flores-Alfaro, Eugenia

    2012-01-01

    We evaluated the association between four polymorphisms in the CRP gene with circulating levels of C-reactive protein (CRP), type 2 diabetes (T2D), obesity, and risk score of coronary heart disease. We studied 402 individuals and classified them into four groups: healthy, obese, T2D obese, and T2D without obesity, from Guerrero, Southwestern Mexico. Blood levels of CRP, glucose, cholesterol, triglycerides, and leukocytes were measured. Genotyping was performed by PCR/RFLP, and the risk score for coronary heart disease was determined by the Framingham's methodology. The TT genotype of SNP rs1130864 was associated with increased body mass index and T2D patients with obesity. We found that the haplotype 2 (TGAG) was associated with increased levels of CRP (β = 0.3; 95%CI: 0.1, 0.5; P = 0.005) and haplotype 7 (TGGG) with higher body mass index (BMI) (β = 0.2; 95%CI: 0.1, 0.3; P obesity and the haplotype 7 with BMI may explain how obesity and genetic predisposition increase the risk of diseases such as T2D in the population of Southwestern Mexico.

  1. Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.

    Science.gov (United States)

    Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L

    2018-02-01

    Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.

  2. Difficulty buying food, BMI, and eating habits in young children.

    Science.gov (United States)

    Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S

    2018-01-22

    To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.

  3. Socioeconomic differences in childhood BMI trajectories in Belarus.

    Science.gov (United States)

    Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M

    2018-02-28

    To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location,  children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic

  4. Nucleosome acidic patch promotes RNF168- and RING1B/BMI1-dependent H2AX and H2A ubiquitination and DNA damage signaling.

    Directory of Open Access Journals (Sweden)

    Justin W Leung

    2014-03-01

    Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.

  5. Association of eating three meals irregularly with changes in BMI and weight among young Japanese men and women: A 2-year follow-up.

    Science.gov (United States)

    Ibe, Yoko; Miyakawa, Happei; Fuse-Nagase, Yasuko; Hirose, Ayumi Sugawara; Hirasawa, Reiko; Yachi, Yoko; Fujihara, Kazuya; Kobayashi, Kazuto; Shimano, Hitoshi; Sone, Hirohito

    2016-09-01

    Epidemiological longitudinal investigations of the association between not eating three meals regularly and changes in BMI and weight are scarce. The aim of this study was to investigate whether or not regularly eating three meals was associated with changes in BMI and weight in young Japanese men and women. Study participants were 1241 men and 897 women aged 19.0±1.2 and 18.8±0.8years, respectively, who underwent health checkups at a university in Japan in 2001 as the baseline and subsequently in 2003. Weight and height were measured at baseline and 2years later. Whether an individual ate three meals regularly was determined by a self-report questionnaire in 2001. During the 2-year follow-up, the BMI gain was 0.347 for men and 0.067 for women. In the logistic regression analysis, for men, eating three meals irregularly was significantly associated with a 4% BMI gain (OR 1.60, CI 1.11-2.30), 6% BMI gain (OR 1.72, CI 1.12-2.63), 4kg weight gain (OR 2.01, CI 1.29-3.13), 6kg weight gain (OR 1.86, CI 1.02-3.37), and incidence of obesity (BMI ≧ 25)(OR 2.96, CI 1.22-7.17). For women, eating three meals irregularly was significantly associated with a 4% BMI loss (OR 1.99, CI 1.01-3.94), 6% BMI loss (OR 2.79, CI 1.29-6.03), 4kg weight loss (OR 3.85, CI 1.62-9.12), 6kg weight loss (OR 7.65, CI 2.06-28.46), and the incidence of underweight (OR 3.95, CI 1.32-11.89). The current results suggested that eating three meals irregularly was associated with subsequent BMI and weight gains for men and subsequent BMI and weight losses for women; both groups were around 20years of age. Self-reported eating behavior in this study might be used to screen and evaluate young Japanese men and women at high risk for changes in BMI and weight in a practical clinical setting. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Cisplatin Induces Bmi-1 and Enhances the Stem Cell Fraction in Head and Neck Cancer

    Directory of Open Access Journals (Sweden)

    Carolina Nör

    2014-02-01

    Full Text Available Recent evidence has unveiled a subpopulation of highly tumorigenic, multipotent cells capable of self-renewal in head and neck squamous cell carcinomas (HNSCCs. These unique cells, named here cancer stem cells (CSCs, proliferate slowly and might be involved in resistance to conventional chemotherapy. We have shown that CSCs are found in perivascular niches and rely on endothelial cell-secreted factors [particularly interleukin-6 (IL-6] for their survival and self-renewal in HNSCC. Here, we hypothesized that cisplatin enhances the stem cell fraction in HNSCC. To address this hypothesis, we generated xenograft HNSCC tumors with University of Michigan-squamous cell carcinoma 22B (UM-SCC-22B cells and observed that cisplatin treatment increased (P = .0013 the fraction of CSCs [i.e., aldehyde dehydrogenase activity high and cluster of differentiation 44 high (ALDHhighCD44high]. Cisplatin promoted self-renewal and survival of CSCs in vitro, as seen by an increase in the number of orospheres in ultralow attachment plates and induction in B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1 and octamer-binding transcription factor 4 expression. Cisplatin-resistant cells expressed more Bmi-1 than cisplatinsensitive cells. IL-6 potentiated cisplatin-induced orosphere formation generated when primary human HNSCC cells were sorted for ALDHhighCD44high immediately after surgery and plated onto ultralow attachment plates. IL-6-induced signal transducer and activator of transcription 3 (STAT3 phosphorylation (indicative of stemness was unaffected by treatment with cisplatin in UM-SCC-22B cells, whereas IL-6-induced extracellular signal-regulated kinase (ERK phosphorylation (indicative of differentiation processes was partially inhibited by cisplatin. Notably, cisplatin-induced Bmi-1 was inhibited by interleukin-6 receptor blockade in parental and cisplatin-resistant cells. Taken together, these results demonstrate that cisplatin enhances the fraction of CSCs

  7. The effect of standardized food intake on the association between BMI and 1H-NMR metabolites

    NARCIS (Netherlands)

    Schutte, A.M.; Akker, van den Erik B.; Deelen, Joris; Rest, van de O.; Heemst, van D.; Feskens, E.J.M.; Beekman, M.; Slagboom, P.E.

    2016-01-01

    Multiple studies have shown that levels of 1H-NMR metabolites are associated with disease and risk factors of disease such as BMI. While most previous investigations have been performed in fasting samples, meta-analysis often includes both cohorts with fasting and non-fasting blood samples. In the

  8. Impact and duration effect of telemonitoring on ΗbA1c, BMI and cost in insulin-treated Diabetes Mellitus patients with inadequate glycemic control: A randomized controlled study.

    Science.gov (United States)

    Fountoulakis, Stelios; Papanastasiou, Labrini; Gryparis, Alexandros; Markou, Athina; Piaditis, George

    2015-01-01

    To monitor and control the blood glucose levels in inefficiently insulin-treated patients with type 1 and 2 diabetes mellitus (DM) using a telemonitoring system and determine whether the improvement of HbA1c has a lasting effect following its discontinuation. Seventy inefficiently controlled insulin-treated DM patients using telemonitoring (telemonitoring group-TG) [HbA1c 9.9±2.3% (85±24.9mmol/mol)] and 35 age-, body mass index (BMI)- and Hba1c-matched insulin-treated patients receiving outpatient care (control group-CG) [HbA1c 9.7±2.1% (82±23.4mmol/mol)] were enrolled. Data of TG were transmitted from the glucose-meters to our computers via modem. Communication was achieved via e-mails and mobile phone text-messages through integrated software. HbA1c and BMI were evaluated at enrollment, 3 and 6 months, and 6 months after telemonitoring discontinuation. Frequency of hypo- and hyperglycemias and cost were also analyzed. Significant reduction in HbA1c was observed in TG both at 3 [7.1±1.0% (54±10.5mmol/mol) p<0.001] and 6 months [6.9±0.9% (52±9.5mmol/mol) p<0.001], compared to the CG group at the same timepoints. Significant reduction was also observed in the TG subgroups with ΗbA1c≥10% and 10>HbA1c≥7.5% at 3 and 6 months, compared to CG. No statistically significant differences in BMI were observed between TG and CG. Six months after telemonitoring discontinuation, HbA1c in TG was slightly increased [7.3±1.0% (56±10.4mol/mol)]. Attenuation was also observed in both TG subgroups. Compared to CG, the number of monthly hypo- and hyperglycemias was reduced in TG. The intervention had a financial benefit for patients living more than 100 km from the health care provider. Telemonitoring can result in reduction of HbA1c and frequency of hypo- and hyperglycemias. This beneficial effect is slightly attenuated 6 months after terminating telemonitoring.

  9. Intracellular high mobility group B1 protein (HMGB1) represses HIV-1 LTR-directed transcription in a promoter- and cell-specific manner

    International Nuclear Information System (INIS)

    Naghavi, Mojgan H.; Nowak, Piotr; Andersson, Jan; Soennerborg, Anders; Yang Huan; Tracey, Kevin J.; Vahlne, Anders

    2003-01-01

    We investigated whether the high mobility group B 1 (HMGB1), an abundant nuclear protein in all mammalian cells, affects HIV-1 transcription. Intracellular expression of human HMGB1 repressed HIV-1 gene expression in epithelial cells. This inhibitory effect of HMGB1 was caused by repression of long terminal repeat (LTR)-mediated transcription. Other viral promoters/enhancers, including simian virus 40 or cytomegalovirus, were not inhibited by HMGB1. In addition, HMGB1 inhibition of HIV-1 subtype C expression was dependent on the number of NFκB sites in the LTR region. The inhibitory effect of HMGB1 on viral gene expression observed in HeLa cells was confirmed by an upregulation of viral replication in the presence of antisense HMGB1 in monocytic cells. In contrast to what was found in HeLa cells and monocytic cells, endogenous HMGB1 expression did not affect HIV-1 replication in unstimulated Jurkat cells. Thus, intracellular HMGB1 affects HIV-1 LTR-directed transcription in a promoter- and cell-specific manner

  10. Chronic kidney disease progression: a retrospective analysis of 3-year adherence to a low protein diet.

    Science.gov (United States)

    Rizzetto, Felipe; Leal, Viviane de Oliveira; Bastos, Leonardo Soares; Fouque, Denis; Mafra, Denise

    2017-11-01

    The potential benefits and dangers of dietary protein restriction in chronic kidney disease (CKD) are still controversial. Thus, the aim of this study is to evaluate the effect of low protein diet (LPD) on the renal function in nondialysis CKD patients. A retrospective study was conducted from 321 nondialysis CKD patient's medical files (65.1 ± 12.7 yrs, 58.2% men). These patients received individualized dietary protein prescription (0.6-0.8 g protein/kg/day). Protein intake was evaluated by food diary and 24 h-food recall. Adherence to the LPD was considered when patients intake from 90 to 110% of the prescribed amount of protein. The patients were divided into 4 groups: (G1) adherent diabetes mellitus (DM) patients (n = 83); (G2) non-adherent DM patients (n = 106); (G3) adherent non-DM patients (n = 75); (G4) non-adherent non-DM patients (n = 57). Renal function was assessed by estimated glomerular filtration rate (eGFR). Both groups of patients (DM and non-DM) that adhered to the LPD showed significant improvement in eGFR (G1: 38.7 ± 13.2 mL/min to 51.1 ± 17.0 mL/min (p patients, no differences in albumin and BMI were observed at the end of follow up. In non-adherent patients, eGFR significantly decreased in DM group (G2: 44.2 ± 18.5 mL/min to 38.2 ± 15.8 mL/min (p = 0.003)). According to multivariate analysis, annual changes in eGFR were not independent associated with age, gender, BMI, lipid profile, bicarbonate or smoking status. In summary, adherence to low protein diet could be able to improve serum creatinine and eGFR, well-known markers of renal function. However, prospective studies are needed to control confounders which affect renal function and CKD progression.

  11. [Study on immunogenicity of group A and group C meningococcal conjugate vaccine with coupling group B meningococcal outer membrane protein].

    Science.gov (United States)

    Ma, Fu-Bao; Tao, Hong; Wang, Hong-Jun

    2009-10-01

    To evaluate the Immunogenicity of Group A and Group C Meningococcal conjugate Vaccine with coupling Group B Meningococcal Outer Membrane Protein (Men B-OMP). 458 healthy children aged 3-5 months, 6-23 months, 2-6 years and 7-24 years were given the Groups A and C conjugate Vaccine with MenB-OMP or other vaccine as control group to measure the pre-and post-vaccination Men A and C and B by Serum Bactericidal Assay (SBA) in the double-blind randomized controlled trial. 97.65%-100% were 4 times or greater increase in SBA titer for the healthy children given the Groups A and C conjugate Vaccine with MenB-OMP, The geometric mean titer of SBA were 1:194-1:420, which significantly higber than controls. The Group A and C conjugate Vaccine with MenB-OMP was safe and well immunogenic.

  12. The Report Card on BMI Report Cards.

    Science.gov (United States)

    Thompson, Hannah R; Madsen, Kristine A

    2017-06-01

    Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.

  13. [Changing laws of serum high mobility group box 1 protein in septic rats and the intervention effect of xuebijing].

    Science.gov (United States)

    Zhao, Shi-bing; He, Xian-di; Wang, Hua-xue; Zheng, Sheng-yong; Deng, Xi-ming; Duan, Li-bin

    2014-06-01

    To investigate the changing laws of serum high mobility group box 1 protein (HMGB1) in septic rats and intervention effect of Xuebijing on it. Lipopolysaccharide (LPS) (5 mg/kg BW) was intravenously injected into the tail vein of healthy male Wistar rats to prepare the sepsis rat model. In Experiment 1: 50 Wistar rats were randomly divided into three groups, i.e., the normal group (A, n=10); the LPS model group (B, n=10), the LPS +Xuebijing treatment group (C, n=30). Rats in the C group were further divided into three subgroups, i.e., 2 h before LPS injection (group C1), 2 h after LPS injection (group C2), and 8 h after LPS injection (group C3), 10 in each group. Blood samples were collected from the caudal vein to detect serum HMGB1 levels by Western blot at 4, 12, 24, 48, and 72 h after LPS injection. Experiment 2: 30 Wistar rats were equally divided into the LPS model group (D) and the LPS + Xuebijing treatment group (E), 15 in each group. They were treated as rats in the B group and the C1 group respectively. Five rats were sacrificed at 12, 24, and 48 h after LPS injection in the two groups. Blood as well as the tissue samples were harvested to measure such indices as ALT, AST, Cr, and BUN, as well as pathological changes of liver, lung, and kidney. (1) Compared with the A group, serum HMGB1 levels were higher at various time points in the B group (P decrement in the C3 group was less than that in the C1 and C2 groups (P multiple organ dysfunction. Xuebijing could reduce the serum levels of HMGB1, improve biochemical parameters, and attenuate severe inflammatory response of liver, lung, and kidney tissues in septic rats. Besides, the earlier use, the better effect obtained.

  14. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  15. RAP-1a is the main rhoptry-associated-protein-1 (RAP-1) recognized during infection with Babesia sp. BQ1 (Lintan) (B. motasi-like phylogenetic group), a pathogen of sheep in China.

    Science.gov (United States)

    Niu, Qingli; Bonsergent, Claire; Rogniaux, Hélène; Guan, Guiquan; Malandrin, Laurence; Moreau, Emmanuelle

    2016-12-15

    Babesia sp. BQ1 (Lintan) is one of the parasites isolated from infected sheep in China that belongs to the B. motasi-like phylogenetic group. The rhoptry-associated-protein 1 (rap-1) locus in this group consists of a complex organization of 12 genes of three main types: 6 rap-1a variants intercalated with 5 identical copies of rap-1b and a single 3' ending rap-1c gene. In the present study, transcription analysis performed by standard RT-PCR demonstrated that the three different rap-1 gene types and the four rap-1a variants were transcribed by the parasite cultivated in vitro. Peptides, specific for each rap-1 type gene, were selected in putative linear B-epitopes and used to raise polyclonal rabbit antisera. Using these sera, the same expression pattern of RAP-1 proteins was found in parasites cultivated in vitro or collected from acute infection whereas only RAP-1a67 was detectable in merozoite extracts. However, ELISA performed with recombinant RAP-1a67, RAP-1b or RAP-1c and sera from infected sheep demonstrated that RAP-1a67 is the main RAP-1 recognized during infection, even if some infected sheep also recognized RAP-1b and/or RAP-1c. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Methodical investigation of the protein metabolism and of the bioenergetics of protein retention in growing animals. 1

    International Nuclear Information System (INIS)

    Schiemann, R.; Bock, H.D.; Keller, J.; Hoffmann, L.; Krawielitzki, K.; Klein, M.

    1983-01-01

    The influence of different protein levels in the feed (group R1 20%, R2 38% crude protein) and of different energy levels (group J1 low, J2 high energy level) on the composition of the carcass and the apparent half-life periods of the body proteins were determined in 4 groups of 15 male broiler chickens labelled with 15 NH 4 acetate. In all slaughtering phases the higher protein level resulted in a higher weight of the feathers, breast and leg muscles, higher amounts of N in all parts of the body and a higher percentage of feathers, breast and leg muscles of the total carcass than the lower protein level. Between 13 and 19% of the N in the carcass contributed to the feathers, 24-31% to the breast and leg muscles and 50-63% to the rest of the carcass. The relative quotas of the sum of breast and leg muscles in the carcass were higher for the low energy level than for the high energy level. There were no remarkable differences as to the protein content of the muscles in dependence on the energy level, the quota of sarcoplasmatic proteins, however, was higher on the high level in contrast to the low energy level, that of the myofibrillar proteins was lower. The apparent half-life period of the total body protein after normal protein supply was 22 days (group R1) and 14 after high protein supply. The energy levels in groups J1 and J2 had no significant influence on the half-life period of the total body protein. In the body fractions examined the apparent half-life periods were highest in the breast muscle and lowest in the rest of the carcass. The protein stored in the feathers did not undergo decomposition. The protein fractions 'sarcoplasmatic protein' and 'myofibrillar protein' of breast and leg muscle neither differed from one another nor from the respective total muscle fractions as regards their half-life period. (author)

  17. ENERGY CONSUMPTION, THE DISTRIBUTION OF MACRONUTRIENTS AND BMI IN MOTHERS AND THEIR MEXICAN SCHOOLCHILDREN.

    Science.gov (United States)

    Miranda-Ríos, L Lizette; Vásquez-Garibay, Edgar M; Romero-Velarde, Enrique; Nuño-Cosío, M Eugenia; Campos-Barrera, Liliana R

    2015-12-01

    to identify the association between the percentage of adequacy of energy and protein and the distribution of macronutrients and sugar in the diets of mothers and schoolchildren with their respective BMI. in a cross-sectional study, 174 5-12-year-old schoolchildren and their mothers were randomly selected. BMI was measured, and 24-hour dietary surveys were administered on weekdays and weekends. The associations between the dietetic indicators in the mothers and their children and the BMI of the mothers and their children were assessed. The chi-square test, linear regression and odds ratio were used for analysis. excessive energy consumption in the mothers increased the risk of excessive energy consumption in their daughters by 11-fold (p=0.04). Maternal lipid intake was associated with the consumption of lipids in their sons and daughters (p. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  18. Association of Serum Ceruloplasmin Level with Obesity: Some Components of Metabolic Syndrome and High-Sensitive C-Reactive Protein in Iran

    Directory of Open Access Journals (Sweden)

    Seyyed Morteza Safavi

    2012-01-01

    Full Text Available Background. One of the mechanisms that has been suggested for obesity related metabolic disturbances is obesity-induced inflammation. Pro-inflammatory cytokines generated in adipose tissue can increase hepatic synthesis of inflammation-sensitive plasma proteins (ISPs including ceruloplasmin (Cp. In this study we aimed to investigate the relation between serum Cp level and obesity. Methods. 61 persons with body mass index (BMI ≥ 25 kg/m2 (case group and 61 persons with BMI < 25 kg/m2 (control group were included in this study with a case-control design. Serum Cp levels, triglyceride level, fating blood glucose, total cholesterol, LDL-cholesterol, HDL-cholesterol and hsCRP were measured in both groups. Results. We did not observe any significant association between serum Cp level and BMI in all subjects [OR: 1.02 (CI, 0.967 to 1.07] and in case (β=0.012, P=0.86 and control groups (β=0.49, P=0.07 separately. However, in control group, this positive association was marginally significant. We found a positive correlation between serum Cp level and serum triglyceride level. Conclusion. Serum Cp level was not related to obesity in this group of subjects. None of the baseline variables could predict obesity in this group of subjects, including serum Cp level, FBS, total cholesterol, LDL and HDL- cholesterols and hsCRP.

  19. Know Your Body Mass Index (BMI)

    Science.gov (United States)

    ... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...

  20. Effects of BMI, Fat Mass, and Lean Mass on Asthma in Childhood: A Mendelian Randomization Study

    Science.gov (United States)

    Granell, Raquel; Henderson, A. John; Evans, David M.; Smith, George Davey; Ness, Andrew R.; Lewis, Sarah; Palmer, Tom M.; Sterne, Jonathan A. C.

    2014-01-01

    Background Observational studies have reported associations between body mass index (BMI) and asthma, but confounding and reverse causality remain plausible explanations. We aim to investigate evidence for a causal effect of BMI on asthma using a Mendelian randomization approach. Methods and Findings We used Mendelian randomization to investigate causal effects of BMI, fat mass, and lean mass on current asthma at age 7½ y in the Avon Longitudinal Study of Parents and Children (ALSPAC). A weighted allele score based on 32 independent BMI-related single nucleotide polymorphisms (SNPs) was derived from external data, and associations with BMI, fat mass, lean mass, and asthma were estimated. We derived instrumental variable (IV) estimates of causal risk ratios (RRs). 4,835 children had available data on BMI-associated SNPs, asthma, and BMI. The weighted allele score was strongly associated with BMI, fat mass, and lean mass (all p-valuesBMI on asthma was 1.55 (95% CI 1.16–2.07) per kg/m2, p = 0.003. This effect appeared stronger for non-atopic (1.90, 95% CI 1.19–3.03) than for atopic asthma (1.37, 95% CI 0.89–2.11) though there was little evidence of heterogeneity (p = 0.31). The estimated causal RRs for the effects of fat mass and lean mass on asthma were 1.41 (95% CI 1.11–1.79) per 0.5 kg and 2.25 (95% CI 1.23–4.11) per kg, respectively. The possibility of genetic pleiotropy could not be discounted completely; however, additional IV analyses using FTO variant rs1558902 and the other BMI-related SNPs separately provided similar causal effects with wider confidence intervals. Loss of follow-up was unlikely to bias the estimated effects. Conclusions Higher BMI increases the risk of asthma in mid-childhood. Higher BMI may have contributed to the increase in asthma risk toward the end of the 20th century. Please see later in the article for the Editors' Summary PMID:24983943

  1. Changes in blood pressure, bmi and ecg patterns in women using low-dose contraceptives

    International Nuclear Information System (INIS)

    Syed, S.; Rahim, M.; Javed, M.; Qureshi, M.A.

    2008-01-01

    To determine the cardiovascular risk factors in users of second generation contraceptives by recording changes in body mass index, blood pressure and electrocardiogram. Sixty four women volunteered for this study (age range 20-35 years), belonging to low-income group with similar socio-cultural background. The Body Mass Index (BMI) was calculated by measuring height and weight of the subjects, systolic and diastolic blood pressure and ECG recording by standard method. The group means, standard deviations and coefficient correlation for interrelationship among variables in respective groups of subjects were calculated using relevant statistical method and software program. There was no significant difference between BMI of two types of contraceptive users as compared to non users, but BMI was significantly correlated with both systolic and diastolic blood pressures in injectable users as compared to controls. ECG alterations frequently observed in contraceptive users (40%) as compared to controls were normal findings. It was observed that women aged < 30 years and using contraceptives for more than three years had a tendency to gain weight and developed a mild increase in systolic and diastolic blood pressures. (author)

  2. Changes in Adult BMI and Waist Circumference Are Associated with Increased Risk of Advanced Colorectal Neoplasia.

    Science.gov (United States)

    Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F

    2017-11-01

    Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2  = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2  = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.

  3. The impact of sleep-disordered breathing on body mass index (BMI: the sleep heart health study (SHHS

    Directory of Open Access Journals (Sweden)

    Robbins JA

    2011-12-01

    Full Text Available Introduction: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB. However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors.Methods: A full-montage unattended home polysomnogram (PSG and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI was categorized using clinical thresholds: < 5 (normal, ≥ 5 to <15 (mild sleep apnea, and ³ 15 (moderate to severe sleep apnea. Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates.Results: Mean (SD age was 62.2 years (10.14, 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD change of 0.53 (2.62 kg/m2 (p=0.071. A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m2 (p=0.055 and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m2 (p<0.001 compared to those with baseline AHI of <5.Conclusion: Our findings suggest that there is a positive association between severity of SDB and subsequent increased BMI over approximately 5 years. This observation may help explain why persons with SDB have difficulty losing weight.

  4. Association of Protein Intake with Bone Mineral Density and Bone Mineral Content among Elderly Women: The OSTPRE Fracture Prevention Study.

    Science.gov (United States)

    Isanejad, M; Sirola, J; Mursu, J; Kröger, H; Tuppurainen, M; Erkkilä, A T

    2017-01-01

    It has been hypothesized that high protein intakes are associated with lower bone mineral content (BMC). Previous studies yield conflicting results and thus far no studies have undertaken the interaction of body mass index (BMI) and physical activity with protein intakes in relation to BMC and bone mineral density (BMD). To evaluate the associations of dietary total protein (TP), animal protein (AP) and plant protein (PP) intakes with BMC and BMD and their changes. We tested also the interactions of protein intake with, obesity (BMI ≤30 vs. >30 kg/m2) and physical activity level (passive vs. active). Design/ Setting: Prospective cohort study (Osteoporosis Risk-Factor and Fracture-Prevention Study). Participants/measures: At the baseline, 554 women aged 65-72 years filled out a 3-day food record and a questionnaire covering data on lifestyle, physical activity, diseases, and medications. Intervention group received calcium 1000 mg/d and cholecalciferol 800 IU for 3 years. Control group received neither supplementation nor placebo. Bone density was measured at baseline and year 3, using dual energy x-ray absorptiometry. Multivariable regression analyses were conducted to examine the associations between protein intake and BMD and BMC. In cross-sectional analyses energy-adjusted TP (P≤0·029) and AP (P≤0·045) but not PP (g/d) were negatively associated with femoral neck (FN) BMD and BMC. Women with TP≥1·2 g/kg/body weight (BW) (Ptrend≤0·009) had lower FN, lumbar spine (LS) and total BMD and BMC. In follow-up analysis, TP (g/kg/BW) was inversely associated with LS BMD and LS BMC. The detrimental associations were stronger in women with BMI30 kg/m2 and physical activity.

  5. Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan

    Directory of Open Access Journals (Sweden)

    Naho Morisaki

    2017-09-01

    Full Text Available Background: The Institute of Medicine (IOM guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM recommendations. Methods: We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005–2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0–18.4, 18.5–19.9, 20–22.9, 23–24.9, and 25–27.4 kg/m2, we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications using multivariate regression. Results: Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m2, and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m2. Conclusion: Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines.

  6. Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan.

    Science.gov (United States)

    Morisaki, Naho; Nagata, Chie; Jwa, Seung Chik; Sago, Haruhiko; Saito, Shigeru; Oken, Emily; Fujiwara, Takeo

    2017-10-01

    The Institute of Medicine (IOM) guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI) and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM) recommendations. We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005-2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0-18.4, 18.5-19.9, 20-22.9, 23-24.9, and 25-27.4 kg/m 2 ), we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications) using multivariate regression. Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks) for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m 2 , and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m 2 . Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m 2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

  7. BMI, Overweight Status and Obesity Adjusted by Various Factors in All Age Groups in the Population of a City in Northeastern Brazil

    Directory of Open Access Journals (Sweden)

    Raquel Patrícia Ataíde Lima

    2015-04-01

    Full Text Available Objective: In Brazil, demographic, socioeconomic and epidemiological changes over time have led to a transition in nutritional standards, resulting in a gradual reduction of malnutrition and an increased prevalence of overweight and obese individuals, similar to the situation in developed countries in previous decades. This study assessed the body mass index (BMI and the prevalence of an overweight status and obesity, adjusted for various factors, in a population in northeastern Brazil including all age groups. Methods: This is a cross-sectional population-based epidemiological study using single sampling procedure composed of levels. Given the heterogeneity of the variable “income” and the relationship between income, prevalence of diseases and nutrition, a stratified sampling on blocks in the first level was used. In this, city districts were classified by income into 10 strata, according to information obtained from IBGE. A systematic sampling was applied on randomly selected blocks in order to choose the residences that would be part of the sample (second level, including 1165 participants from all age groups. Results and Discussion: The prevalence of an overweight status or obesity was adjusted for demographic, socioeconomic and lifestyle variables. When the Chi-square test was applied, a relationship was observed between the prevalence of an overweight status or obesity and the age group, gender, educational level and income of the participants. Regarding lifestyle parameters, only smoking was associated with the prevalence of an overweight status or obesity, in both adults and in the total sample. The results for the following groups were significant (p < 0.05: the age group from 20 to 59 years, when the individual presented an educational level greater than or equal to high school; and the age group ≥ 60 years, when the individual was female. It is noteworthy that educational level and being female were significant in adjusting for

  8. A Multi-Component Day-Camp Weight-Loss Program Is Effective in Reducing BMI in Children after One Year: A Randomized Controlled Trial.

    Directory of Open Access Journals (Sweden)

    Kristian Traberg Larsen

    Full Text Available The objective of the present study was to evaluate the effectiveness of a one-year multi-component immersive day-camp weight-loss intervention for children with overweight and obesity. The study design was a parallel-group randomized controlled trial. One hundred fifteen 11-13-year-old children with overweight and obesity were randomized into either: A six-week day-camp intervention arm focusing on increased physical activity, and healthy diet followed by a subsequent one-year family-based intervention, or a standard intervention arm consisting of one weekly exercise session for six weeks. Body mass index (BMI was the primary outcome. BMI z-score, clustered cardiovascular risk z-score, and body composition were secondary outcomes. All outcomes were measured at baseline, six week-, and 52 week follow-up. After six weeks, children from the day-camp intervention arm had improved their BMI (-2.2 kg/m2 (95% CI -2.6 to -1.7, P<0.001 and all secondary outcomes when compared to the children from the standard intervention arm. After 52 weeks, the day-camp intervention arm had a lower BMI (-1.2 kg/m2 (95% CI -1.8 to -0.5, P = 0.001, and BMI z-score (-0.20 (95% CI -0.35 to -0.05, P = 0.008, and clustered cardiovascular risk z-score (-0.23 (95% CI -0.37 to -0.08, P = 0.002 compared to the standard intervention arm. No group differences were detected in body composition after 52 weeks. This study shows that the day-camp intervention arm is effective in reducing BMI and improving the metabolic health of children with overweight and obesity. However, the effects seem to be diminishing over time.

  9. Effect of BMI on quality of life and depression levels after bariatric surgery.

    Science.gov (United States)

    Sierżantowicz, Regina; Lewko, Jolanta; Hady, Hady Razak; Kirpsza, Bożena; Trochimowicz, Lech; Dadan, Jacek

    2017-01-01

    Studies conducted in Poland have found that 1% (~300,000) of Polish adults are obese. The degree of weight loss and reduction of discomfort associated with severe obesity are used to evaluate bariatric surgery outcomes. From the patient's point of view, QoL and mental health are the most important determinants of successful surgery, which is why interest in QoL assessment has increased. To assess the effect of BMI on quality of life and depression levels depending on the type of bariatric surgery. The group included 57 women and 43 men aged 20-60 years (mean age 40 years) with BMI from 36 to 40 (31%) and > 40 (69%). Twelve patients (12%) underwent laparoscopic adjustable gastric binding (LAGB), 58 (58%) sleeve gastrectomy, and 30 (30%) Roux-en-Y Gastric Bypass (RYGB). The Bariatric Analysis and Reporting Outcome System (BAROS) was used to assess QoL. The severity of mood disorders was assessed using the Self-Rating Scale of Depression and Anxiety. Six months or 1 year after bariatric surgery, the number of patients with BMI > 40 had decreased from 69 to 14%. We found that the time since bariatric surgery contributed to a significant (p bariatric surgery, including quality of life. Long-term monitoring will be essential in determining psychological changes and the degree of weight loss.

  10. Thermodynamic properties of damaged DNA and its recognition by xeroderma pigmentosum group A protein and replication protein A

    Czech Academy of Sciences Publication Activity Database

    Brabec, Viktor; Stehlíková, Kristýna; Malina, Jaroslav; Vojtíšková, Marie; Kašpárková, Jana

    2006-01-01

    Roč. 446, č. 1 (2006), s. 1-10 ISSN 0003-9861 R&D Projects: GA ČR(CZ) GA305/05/2030; GA ČR(CZ) GD204/03/H016; GA MZd(CZ) NR8562; GA AV ČR(CZ) KJB400040601 Institutional research plan: CEZ:AV0Z50040507 Keywords : differential scanning calorimetry * xeroderma pigmentosum group A protein * replication protein A Subject RIV: BO - Biophysics Impact factor: 2.969, year: 2006

  11. Dinner rituals that correlate with child and adult BMI.

    Science.gov (United States)

    Wansink, Brian; van Kleef, Ellen

    2014-05-01

    What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.

  12. Effect of body weight and BMI on the efficacy of levonorgestrel emergency contraception.

    Science.gov (United States)

    Kapp, Nathalie; Abitbol, Jean Louis; Mathé, Henri; Scherrer, Bruno; Guillard, Hélène; Gainer, Erin; Ulmann, André

    2015-02-01

    To further evaluate the effect of weight and body mass index (BMI) on the efficacy of levonorgestrel emergency contraception. Data from two large, multicenter, randomized controlled trials designed to assess emergency contraceptive efficacy were pooled to evaluate the effect of weight and BMI on pregnancy rates among women who received levonorgestrel. Descriptive methods (comparison of means and distributions according to pregnancy status and pregnancy rates across weight and BMI categories) as well as cubic spline modeling were used to describe the relationship between pregnancy risk and weight/BMI. The analysis population comprised 1731 women, among whom 38 pregnancies were reported. Women for whom levonorgestrel was not effective in preventing pregnancy had a significantly higher mean body weight and BMI than women who did not become pregnant (76.7 vs. 66.4 kg, p85 kg groups, respectively. Statistical modeling demonstrated a steep increase in pregnancy risk starting from a weight near 70-75 kg to reach a risk of pregnancy of 6% or greater around 80 kg. Similar results were obtained for statistical modeling of BMI as well as when the two studies were analyzed individually. All analyses showed a significant drop in the efficacy of levonorgestrel emergency contraception with increasing body weight, with pregnancy risk in the higher weight categories similar to expected rates in the absence of contraception. Like body weight, increasing BMI was highly correlated with increased pregnancy risk. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Definition of new cut-offs of BMI and waist circumference based on body composition and insulin resistance: differences between children, adolescents and adults.

    Science.gov (United States)

    Hübers, M; Pourhassan, M; Braun, W; Geisler, C; Müller, M J

    2017-09-01

    This study aims to determine associations between anthropometric traits, regional fat depots and insulin resistance in children, adolescents and adults to define new cut-offs of body mass index (BMI) or waist circumference (WC). Cross-sectional data were assessed in 433 children, adolescents and adults (aged: 6-60 years, BMI: 23.6 [21.0-27.7] kg m -2 ). Total adipose tissue (TAT), regional subcutaneous adipose tissue (SAT total , SAT trunk ) and visceral adipose tissue (VAT) were determined by whole-body magnetic resonance imaging, fat mass by air-displacement plethysmography. Insulin resistance was evaluated by homeostasis model assessment of insulin resistance (HOMA-IR). Bivariate as well as partial correlations and regression analyses were used. Cut-off values of BMI and WC related to regional fat depots and HOMA-IR were analysed by receiver operating characteristics curve. In adults, TAT, SAT total and SAT trunk increased linearly with increasing BMI and WC, whereas they followed a cubic function in children and adolescents with a steep increase at BMI and WC ≥1 standard deviation score and VAT at WC ≥2 standard deviation score. Sex differences were apparent in adults with women having higher masses of TAT and SAT and men having higher VAT. Using established BMI or WC cut-offs, correspondent masses of TAT, SAT total , SAT trunk and VAT increased from childhood to adulthood. In all age groups, there were positive associations between BMI, WC, SAT trunk , VAT and HOMA-IR. When compared with normative cut-offs of BMI or WC, HOMA-IR-derived cut-offs of regional fat depots were lower in all age groups. Associations between BMI, WC and regional fat depots varied between children, adolescents, young and older adults. When compared with BMI-derived and WC-derived values, an insulin resistance-derived cut-off corresponded to lower masses of regional fat depots. Thus, established BMI and WC cut-offs are not appropriate to assess metabolic disturbances associated

  14. The association of plasma cysteine and gamma-glutamyltransferase with BMI and obesity.

    LENUS (Irish Health Repository)

    Elshorbagy, Amany K

    2009-07-01

    We recently reported a strong positive association of plasma total cysteine (tCys) with fat mass in over 5,000 subjects. As gamma-glutamyltransferase (GGT) enzyme increases cysteine availability by catalyzing glutathione breakdown and is positively associated with BMI and adiposity, we hypothesized that GGT might explain the association of tCys with adiposity. To study whether the associations of tCys and serum GGT with BMI and obesity were interrelated we conducted a cross-sectional study using data from 1,550 subjects recruited from nine European countries in the COMAC project. Multiple linear and logistic regression models and concentration-response curves were used. In age and sex-adjusted analyses, tCys showed strong positive associations with BMI (partial r = 0.19, P < 0.001), and obesity (odds ratio (OR) for 4th vs. 1st tCys quartile: 2.8; 95% confidence interval: 1.6-5.0, P < 0.001), both of which remained robust after adjustment for GGT and other metabolic and lifestyle confounders. Serum GGT was also a positive predictor of BMI (partial r = 0.17, P < 0.001) and obesity (OR for 4th vs. 1st GGT quartile: 4.8; 95% confidence interval: 2.5-9.2, P < 0.001), independent of tCys. However, the associations of GGT with BMI and obesity were weakened by adjustment for obesity-related factors such as serum lipids and blood pressure. These results indicate that tCys is a strong positive predictor of BMI and obesity, independent of GGT and other obesity-related factors. We also suggest that the association of serum GGT with BMI and obesity is unrelated to the role of GGT in cysteine turnover. The potential link between cysteine and fat metabolism should be further evaluated.

  15. The influence of childhood protein energy malnutrition on serum ghrelin and leptin levels

    International Nuclear Information System (INIS)

    Mostafa, A.M.

    2007-01-01

    Protein-energy malnutrition (PEM) is a clinical problem caused by inadequate intake of one or more nutritional elements and remains as one of the most important health problems in developing countries. The aim of this study is to investigate the influence of PEM on ghrelin and leptin levels and to determine the relationships of ghrelin and leptin concentrations with anthropometric measurements in malnourished children. The study group consisted of 24 infants diagnosed as PEM. They were classified into marasmic group (10), kwashiorkor group (8) and marasmic kwashiorkor group (b). Ten healthy infants were enrolled as the control group. Serum ghrelin was evaluated by enzyme linked immuno absorbent assay (ELISA) while serum leptin was determined by radioimmunoassay (RIA). Patients with PEM established a significantly lower midarm circumference, skin fold thickness, (W/A) Z, (W/H) Z, BMI, total proteins, serum albumin, cholesterol and triglycerides compared with the age-matched control group. Markedly elevated mean serum ghrelin levels (448.7± 185.82, 293.83±155.02 and 354.1±90.1 vs 20.97± 8.61 pg/ml, p

  16. Body size estimation of self and others in females varying in BMI.

    Directory of Open Access Journals (Sweden)

    Anne Thaler

    Full Text Available Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI, on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1, but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a. The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

  17. Body size estimation of self and others in females varying in BMI.

    Science.gov (United States)

    Thaler, Anne; Geuss, Michael N; Mölbert, Simone C; Giel, Katrin E; Streuber, Stephan; Romero, Javier; Black, Michael J; Mohler, Betty J

    2018-01-01

    Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI), on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations) represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1), but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a). The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

  18. Impact of HSD11B1 polymorphisms on BMI and components of the metabolic syndrome in patients receiving psychotropic treatments

    KAUST Repository

    Quteineh, Lina; Vandenberghe, Frederik; Saigi Morgui, Nuria; Delacré taz, Auré lie; Choong, Eva; Gholam-Rezaee, Mehdi; Magistretti, Pierre J.; Bondolfi, Guido; Von Gunten, Armin; Preisig, Martin A.; Castelao, Enrique; Vollenweider, Peter; Waeber, Gé rard; Bochud, Murielle; Kutalik, Zoltá n; Conus, Philippe O.; Eap, Chin Bin

    2015-01-01

    Background Metabolic syndrome (MetS) associated with psychiatric disorders and psychotropic treatments represents a major health issue. 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) is an enzyme that catalyzes tissue regeneration of active cortisol from cortisone. Elevated enzymatic activity of 11β-HSD1 may lead to the development of MetS. Methods We investigated the association between seven HSD11B1 gene (encoding 11β-HSD1) polymorphisms and BMI and MetS components in a psychiatric sample treated with potential weight gain-inducing psychotropic drugs (n=478). The polymorphisms that survived Bonferroni correction were analyzed in two independent psychiatric samples (n R1 =168, n R2 =188) and in several large population-based samples (n 1 =5338; n 2 =123 865; n 3 >100 000). Results HSD11B1 rs846910-A, rs375319-A, and rs4844488-G allele carriers were found to be associated with lower BMI, waist circumference, and diastolic blood pressure compared with the reference genotype (P corrected <0.05). These associations were exclusively detected in women (n=257) with more than 3.1 kg/m 2, 7.5 cm, and 4.2 mmHg lower BMI, waist circumference, and diastolic blood pressure, respectively, in rs846910-A, rs375319-A, and rs4844488-G allele carriers compared with noncarriers (P corrected <0.05). Conversely, carriers of the rs846906-T allele had significantly higher waist circumference and triglycerides and lower high-density lipoprotein-cholesterol exclusively in men (P corrected =0.028). The rs846906-T allele was also associated with a higher risk of MetS at 3 months of follow-up (odds ratio: 3.31, 95% confidence interval: 1.53-7.17, P corrected =0.014). No association was observed between HSD11B1 polymorphisms and BMI and MetS components in the population-based samples. Conclusions Our results indicate that HSD11B1 polymorphisms may contribute toward the development of MetS in psychiatric patients treated with potential weight gain-inducing psychotropic drugs, but do not

  19. Obtention of a prosthetic group for labelling of radioiodinated proteins

    International Nuclear Information System (INIS)

    Santos, Josefina da S.; Colturato, Maria Tereza; Araujo, Elaine B. de

    2000-01-01

    Antibodies and peptides labeled with radionuclides has been extensively used in radioimmunotherapy and radioimmunodetection. The principal problem with the use of radioiodinated proteins is the in vivo dehalogenation. The use of prosthetic groups for indirect labeling of proteins with radioiodine has showed to be useful on labeling proteins with greater in vivo stability. A procedure is described for the preparation of an radioiodinated prosthetic group (N-succinimidyl 4-radioiodine-benzoate-SIB), using procedure described by Stocklin et al, with the iodination of p-bromo-benzoic acid and subsequent reaction with TSTU. Preliminary labeling results showed that the prosthetic group can be obtained in a good yield. The coupling of the SIB to the protein will be studied using human IgG as protein model. (author)

  20. C-reactive protein level and obesity as cardiovascular risk factors in polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    Eda Ülkü Uludağ

    2013-09-01

    Full Text Available Objective: To investigate the role of C-reactive protein(CRP level elevation and obesity for the increased cardiovasculardisease risk in polycystic ovary syndrome(PCOS.Methods: A hundred and nine patients with PCOS and 30age matched healthy volunteers with regular menstrualcycle are involved in the study. PCOS group is furthersubdivided into three subgroups according to the bodymass index (BMI. Subgroups included 54 with BMI30. Blood samplesfor glucose, insulin, uric acid, and CRP were collected inthe morning after overnight fasting (12 hours. Homeostasismodel assessment-insulin resistance (HOMA-IRwas calculated. Results: Fasting blood glucose, insulin,and HOMA-IR was significantly higher in PCOS group(p=0.02, p=0.01 and p=0.02. CRP level was higher insubgroup with BMI>30. High CRP level in PCOS wasfound to be independent from BMI (p30.When compared with the control group high insulin levelwas the only to be statistically significant in obese PCOSpatients (p=0.005. HOMA-IR was higher in PCOS subgroupwith BMI>30 when compared with controls and thePCOS subgroup with BMI<25 (p<0.001, p= 0.003.Conclusion: Obesity, hyperinsulinemia, and high CRPlevels are seemed to be related and potentiating eachother in PCOS. Struggling with obesity is one of the mostimportant issues for preventive medicine.Key words: PCOS, CRP, obesity, cardiovascular risk

  1. Do sedentary behaviors mediate associations between socio-demographic characteristics and BMI in women living in socio-economically disadvantaged neighborhoods?

    Science.gov (United States)

    Compernolle, Sofie; De Cocker, Katrien; Abbott, Gavin; Verloigne, Maïté; Cardon, Greet; De Bourdeaudhuij, Ilse; Ball, Kylie

    2015-04-09

    Women living in deprived neighborhoods are a risk group for overweight and obesity, particularly during the childbearing years. Several socio-demographic characteristics may compound this risk, but little is known about why this might be the case. Sedentary behaviors are emerging as a socio-demographically patterned risk factor for obesity. The purpose of the present study was to assess socio-demographic differences in sedentary behaviors, and to examine whether these behaviors could explain the relation between socio-demographic variables and BMI (BMI) in this risk group. Women aged 18-46 years were recruited from 40 urban and 40 rural deprived neighborhoods in Victoria, Australia. In total, 3879 women reported socio-demographic variables (age, educational level, employment status, marital status, number of children, residential location and country of birth), sedentary behaviors (television time, computer time, total screen time and total sedentary time), physical activity, and height and weight, which were used to calculate BMI. For each socio-demographic variable, four single mediation models were conducted using two-level mixed-models regression analyses. Mediating effects were examined using the MacKinnon product-of-coefficients procedure and the Sobel test. All socio-demographic variables were significantly associated with sedentary behaviors. Single mediation analyses revealed that television time (αβ = 0.017, 95% CI = 0.000, 0.030) and total screen time (αβ = 0.006, 95% CI = 0.000, 0.012) mediated 14.1% and 4.9% of the relationship between educational level and BMI, respectively. Total screen time mediated 45.1% of the relationship between employment status and BMI (αβ = -0.020, 95% CI = -0.033, -0.006), and television time mediated 8.2% of the relationship between country of birth and BMI (αβ = -0.008, 95% CI = -0.016, -0.001). Sedentary behaviors differed depending on socio-demographic characteristics, and partly

  2. Production of radioiodinated prosthetic group for indirect protein labeling

    International Nuclear Information System (INIS)

    Santos, Josefina da Silva

    2001-01-01

    Monoclonal antibodies and their fragments and, more recently, radiolabeled peptides have been extensively studied in order to develop radiopharmaceuticals for diagnostic and therapy in Nuclear Medicine. The radioiodination of proteins can be done by a direct method, with radioiodine being incorporated in to a tyrosine residue of the protein by electrophilic substitution. The main problem in the use of radioiodinated proteins, is that they are often dehalogenated in vivo by the action of specific enzymes, probably because of the structural similarity between iodophenyl groups and thyroid hormones. Several protein radioiodination methods have been developed in order to minimize this in vivo dehalogenation using prosthetic groups for indirect labeling. In this case, the radioiodine is first incorporated in to the prosthetic group that is subsequently attached to a terminal amino group or to a ε-amino group of lysine residue. The aim of this work is to obtain a radioiodinated prosthetic group for indirect labeling of proteins. The prosthetic group selected was the N-succinimidyl-4-radioiodine benzoate (SIB), obtained by the iodination of the p-bromobenzoic acid followed by the reaction with TSTU (0-(N-succinimidyl)-N,N,N',N'-tetramethyl uronium tetrafluoroborate) The results of these studies showed that the p-radio iodobenzoic acid was obtained with a radiochemical purity greater than 92% and a labeling yield of about 65%. Some reaction parameters were studied like temperature, time and Cu Cl mass (cataliser). The SIB was quantitatively obtained from p-radio iodobenzoic acid, using basic medium and after removing the water from the reaction using an nitrogen stream. The kinetic of this reaction is very fast with complete consumption of the p-radioiodebenzoic acid after 5 minutes. The coupling of the SIB prosthetic group to the protein was studied using Human Immunoglobulin (IgG) as a protein model. In a comparative way, the same protein was used on direct labeling

  3. Gene-diet interaction effects on BMI levels in the Singapore Chinese population.

    Science.gov (United States)

    Chang, Xuling; Dorajoo, Rajkumar; Sun, Ye; Han, Yi; Wang, Ling; Khor, Chiea-Chuen; Sim, Xueling; Tai, E-Shyong; Liu, Jianjun; Yuan, Jian-Min; Koh, Woon-Puay; van Dam, Rob M; Friedlander, Yechiel; Heng, Chew-Kiat

    2018-02-24

    Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population. We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies. Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10 - 15 ) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP interaction  = 0.043). The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.

  4. TaPP2C1, a Group F2 Protein Phosphatase 2C Gene, Confers Resistance to Salt Stress in Transgenic Tobacco.

    Directory of Open Access Journals (Sweden)

    Wei Hu

    Full Text Available Group A protein phosphatases 2Cs (PP2Cs are essential components of abscisic acid (ABA signaling in Arabidopsis; however, the function of group F2 subfamily PP2Cs is currently less known. In this study, TaPP2C1 which belongs to group F2 was isolated and characterized from wheat. Expression of the TaPP2C1-GFP fusion protein suggested its ubiquitous localization within a cell. TaPP2C1 expression was downregulated by abscisic acid (ABA and NaCl treatments, but upregulated by H2O2 treatment. Overexpression of TaPP2C1 in tobacco resulted in reduced ABA sensitivity and increased salt resistance of transgenic seedlings. Additionally, physiological analyses showed that improved resistance to salt stress conferred by TaPP2C1 is due to the reduced reactive oxygen species (ROS accumulation, the improved antioxidant system, and the increased transcription of genes in the ABA-independent pathway. Finally, transgenic tobacco showed increased resistance to oxidative stress by maintaining a more effective antioxidant system. Taken together, these results demonstrated that TaPP2C1 negatively regulates ABA signaling, but positively regulates salt resistance. TaPP2C1 confers salt resistance through activating the antioxidant system and ABA-independent gene transcription process.

  5. Smoking and Socio-demographic correlates of BMI

    Directory of Open Access Journals (Sweden)

    Peizhi Wang

    2016-06-01

    Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.

  6. The group A streptococcal collagen-like protein 1, Scl1, mediates biofilm formation by targeting the EDA-containing variant of cellular fibronectin expressed in wounded tissue

    Science.gov (United States)

    Oliver-Kozup, Heaven; Martin, Karen H.; Schwegler-Berry, Diane; Green, Brett J.; Betts, Courtney; Shinde, Arti V.; Van De Water, Livingston; Lukomski, Slawomir

    2012-01-01

    Summary Wounds are known to serve as portals of entry for group A Streptococcus (GAS). Subsequent tissue colonization is mediated by interactions between GAS surface proteins and host extracellular matrix components. We recently reported that the streptococcal collagen-like protein-1, Scl1, selectively binds the cellular form of fibronectin (cFn) and also contributes to GAS biofilm formation on abiotic surfaces. One structural feature of cFn, which is predominantly expressed in response to tissue injury, is the presence of a spliced variant containing extra domain A (EDA/EIIIA). We now report that GAS biofilm formation is mediated by the Scl1 interaction with EDA-containing cFn. Recombinant Scl1 proteins that bound cFn also bound recombinant EDA within the C-C′ loop region recognized by the α9β1 integrin. The extracellular 2-D matrix derived from human dermal fibroblasts supports GAS adherence and biofilm formation. Altogether, this work identifies and characterizes a novel molecular mechanism by which GAS utilizes Scl1 to specifically target an extracellular matrix component that is predominantly expressed at the site of injury in order to secure host tissue colonization. PMID:23217101

  7. Nonlinear association of BMI with all-cause and cardiovascular mortality in type 2 diabetes mellitus: a systematic review and meta-analysis of 414,587 participants in prospective studies.

    Science.gov (United States)

    Zaccardi, Francesco; Dhalwani, Nafeesa N; Papamargaritis, Dimitris; Webb, David R; Murphy, Gavin J; Davies, Melanie J; Khunti, Kamlesh

    2017-02-01

    The relationship between BMI and mortality has been extensively investigated in the general population; however, it is less clear in people with type 2 diabetes. We aimed to assess the association of BMI with all-cause and cardiovascular mortality in individuals with type 2 diabetes mellitus. We searched electronic databases up to 1 March 2016 for prospective studies reporting associations for three or more BMI groups with all-cause and cardiovascular mortality in individuals with type 2 diabetes mellitus. Study-specific associations between BMI and the most-adjusted RR were estimated using restricted cubic splines and a generalised least squares method before pooling study estimates with a multivariate random-effects meta-analysis. We included 21 studies including 24 cohorts, 414,587 participants, 61,889 all-cause and 4470 cardiovascular incident deaths; follow-up ranged from 2.7 to 15.9 years. There was a strong nonlinear relationship between BMI and all-cause mortality in both men and women, with the lowest estimated risk from 31-35 kg/m 2 and 28-31 kg/m 2 (p value for nonlinearity 1) respectively. The risk of mortality at higher BMI values increased significantly only in women, whilst lower values were associated with higher mortality in both sexes. Limited data for cardiovascular mortality were available, with a possible inverse linear association with BMI (higher risk for BMI type 2 diabetes, BMI is nonlinearly associated with all-cause mortality with lowest risk in the overweight group in both men and women. Further research is needed to clarify the relationship with cardiovascular mortality and assess causality and sex differences.

  8. Association of Obesity, BMI, and Hispanic Ethnicity on Ambulatory Status in Children with Spinal Dysraphism followed near the California-Mexico Border.

    Science.gov (United States)

    McDonald, Michelle L; Huang, Andy; Proudfoot, James A; Le, Joan T; Chiang, George J; Bush, Ruth A

    2016-01-01

    Evaluate the relationship between body mass index (BMI), overweight status (OW), or obesity (OB) and ambulatory status in a predominantly Hispanic population of children with spinal dysraphism (SD). Retrospective data were extracted from records of 272 children and youth aged 0-24 years with a diagnosis of SD. Body mass index (BMI) and OW / OB rates were calculated for children 0-3 years, 4-11 years, and adolescents older than 11. Ethnicity was predominantly Hispanic (65.4%). No difference in mean BMI or OW / OB rate was found between ambulation groups (p = .20; p = .72). Mean BMI and OW / OB rate increased with increasing age in all groups (p < .001; p = .02). Forty-four percent of patients were OW / OB, which was greater among Hispanics (48.2%) compared with non-Hispanics [(35.2%), p = .03]. Female gender was a risk factor for increased BMI among Hispanics (p = .00). Despite no difference in ambulatory status, increasing BMI and OW / OB are associated with Hispanic ethnicity and increasing age.

  9. Meta-analysis of genome-wide linkage studies in BMI and obesity.

    Science.gov (United States)

    Saunders, Catherine L; Chiodini, Benedetta D; Sham, Pak; Lewis, Cathryn M; Abkevich, Victor; Adeyemo, Adebowale A; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S; Blangero, John; Boehnke, Michael; Borecki, Ingrid B; Chagnon, Yvon C; Chen, Wei; Comuzzie, Anthony G; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F; Froguel, Philippe; Hanson, Robert L; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H; Li, Weidong; Luke, Amy; Martin, Lisa J; Nash, Matthew; Ohman, Miina; Palmer, Lyle J; Peltonen, Leena; Perola, Markus; Price, R Arlen; Redline, Susan; Srinivasan, Sathanur R; Stern, Michael P; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A

    2007-09-01

    The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. We identified 37 published studies containing data on over 31,000 individuals from more than >10,000 families and obtained genome-wide logarithm of the odds (LOD) scores, non-parametric linkage (NPL) scores, or maximum likelihood scores (MLS). BMI was analyzed in a pooled set of all studies, as a subgroup of 10 studies that used BMI-defined obesity, and for subgroups ascertained through type 2 diabetes, hypertension, or subjects of European ancestry. Bins at chromosome 13q13.2- q33.1, 12q23-q24.3 achieved suggestive evidence of linkage to BMI in the pooled analysis and samples ascertained for hypertension. Nominal evidence of linkage to these regions and suggestive evidence for 11q13.3-22.3 were also observed for BMI-defined obesity. The FTO obesity gene locus at 16q12.2 also showed nominal evidence for linkage. However, overall distribution of summed rank p values <0.05 is not different from that expected by chance. The strongest evidence was obtained in the families ascertained for hypertension at 9q31.1-qter and 12p11.21-q23 (p < 0.01). Despite having substantial statistical power, we did not unequivocally implicate specific loci for BMI or obesity. This may be because genes influencing adiposity are of very small effect, with substantial genetic heterogeneity and variable dependence on environmental factors. However, the observation that the FTO gene maps to one of the highest ranking bins for obesity is interesting and, while not a validation of this approach, indicates that other potential loci identified in this study should be investigated further.

  10. Food and drinking patterns as predictors of 6-year BMI-adjusted changes in waist circumference

    DEFF Research Database (Denmark)

    Halkjær, Jytte; Sørensen, Thorkild I A; Tjønneland, Anne

    2004-01-01

    Few studies have investigated the prospective associations between diet or drinking patterns and abdominal obesity; we therefore investigated whether food and beverage groups or patterns predicted 6-year changes in waist circumference (WC) and whether these associations were independent...... of concurrent changes in BMI as a measure of general obesity. The subjects were 2300 middle-aged men and women with repeated measurements of dietary intake, BMI and WC from 1982 to 1993. Intakes from ten food groups and from coffee, tea, wine, beer and spirits were assessed; gender-specific food factors were......, but the associations were weakened, especially for women, after adjustment for BMI changes. None of the food factors was associated with WC changes. Based on the present study, we conclude that very few food items and no food patterns seem to predict changes in WC, whereas high intakes of beer and spirits among women...

  11. Phylogenetic continuum indicates "galaxies" in the protein universe: preliminary results on the natural group structures of proteins.

    Science.gov (United States)

    Ladunga, I

    1992-04-01

    The markedly nonuniform, even systematic distribution of sequences in the protein "universe" has been analyzed by methods of protein taxonomy. Mapping of the natural hierarchical system of proteins has revealed some dense cores, i.e., well-defined clusterings of proteins that seem to be natural structural groupings, possibly seeds for a future protein taxonomy. The aim was not to force proteins into more or less man-made categories by discriminant analysis, but to find structurally similar groups, possibly of common evolutionary origin. Single-valued distance measures between pairs of superfamilies from the Protein Identification Resource were defined by two chi 2-like methods on tripeptide frequencies and the variable-length subsequence identity method derived from dot-matrix comparisons. Distance matrices were processed by several methods of cluster analysis to detect phylogenetic continuum between highly divergent proteins. Only well-defined clusters characterized by relatively unique structural, intracellular environmental, organismal, and functional attribute states were selected as major protein groups, including subsets of viral and Escherichia coli proteins, hormones, inhibitors, plant, ribosomal, serum and structural proteins, amino acid synthases, and clusters dominated by certain oxidoreductases and apolar and DNA-associated enzymes. The limited repertoire of functional patterns due to small genome size, the high rate of recombination, specific features of the bacterial membranes, or of the virus cycle canalize certain proteins of viruses and Gram-negative bacteria, respectively, to organismal groups.

  12. The impact of BMI on sperm parameters and the metabolite changes of seminal plasma concomitantly.

    Science.gov (United States)

    Guo, Dan; Wu, Wei; Tang, Qiuqin; Qiao, Shanlei; Chen, Yiqiu; Chen, Minjian; Teng, Mengying; Lu, Chuncheng; Ding, Hongjuan; Xia, Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

    2017-07-25

    The development of male infertility increased rapidly worldwide, which coinciding with the epidemic of obesity. However, the impact of weight abnormalities on sperm quality is still contestable. To assess the correlation between BMI and sperm parameters, we searched relevant articles in PubMed, Embase, Web of science, and Wanfang database published until June 2015 without language restriction. Otherwise, we also recruited some participants who attended fertility clinic as well as some general populations in this report. We performed a systematic review and meta-analysis about BMI and sperm parameters containing total sperm count, concentration, semen volume and sperm motility (overall and progressive). Metabolomic analysis of seminal plasma was performed to explore the mechanism from a new perspective. This study found standardized weighted mean differences (SMD) in sperm parameters (total sperm count, sperm concentration, and semen volume) of abnormal weight groups decreased to different degree compared to normal weight. Dose-response analysis found SMD of sperm count, sperm concentration and semen volume respectively fell 2.4%, 1.3% and 2.0% compared with normal weight for every 5-unit increase in BMI. Metabolomic analysis of seminal plasma showed that spermidine and spermine were likely to play a vital role in the spermatogenesis progress. This systematic review with meta-analysis has confirmed there was a relationship between BMI and sperm quality, suggesting obesity may be a detrimental factor of male infertility.

  13. Assessing exclusive breastfeeding practices, dietary intakes and body mass index (BMI) of nursing mothers in Ekiti State of Nigeria.

    Science.gov (United States)

    Ijarotimi, Oluwole Steve

    2010-06-01

    Breastfeeding is an unequalled way of providing ideal food for the infants. The benefits of breastfeeding practices to infants and mothers are well documented. However, information on breastfeeding practices and its effect on body mass index (BMI) of mothers are scarce, particularly in Ekiti State of Nigeria. Therefore, the present study is designed to assess breastfeeding practices and its association with BMI of mothers. A descriptive and cross-sectional study was conducted among breastfeeding mothers that attended postnatal clinic of the state specialist hospitals and maternity centers in the study location. The specialist hospital and two-third of the nine maternity centers were purposively selected because of their health facilities and personnel. The mother-child pairs (200 respondents) were randomly selected from the study locations. Information on demographic characteristic, socio-economic parameters, nutritional knowledge of breastfeeding and dietary intakes of mothers were collected using questionnaires. BMI of mothers was determined as described by World Health Organization. Age distribution of mothers was between 25-34 years; and almost half of respondents had good educational background and were engaged in different occupations. The respondent monthly income ranged between = N = 3500 - 26000 ($26.92 - $200); and their dietary intakes varied between starchy and protein-based food. The result also showed that the respondent consumed enough nutrients to meet up the recommended daily allowance for protein, carbohydrate, fat, zinc, magnesium, sodium and phosphorous requirements. The BMI classifications showed that over three-fifth of respondents were normal, while the remaining were underweight (6%) and overweight/obese (26.5%). Also, large proportion of respondents engaged in exclusive breastfeeding and with good knowledge of breastfeeding practices. Statistically, exclusive breastfeeding practices had no correlation between the BMI and frequency of

  14. The Hydroxyl at Position C1 of Genipin Is the Active Inhibitory Group that Affects Mitochondrial Uncoupling Protein 2 in Panc-1 Cells.

    Directory of Open Access Journals (Sweden)

    Yang Yang

    Full Text Available Genipin (GNP effectively inhibits uncoupling protein 2 (UCP2, which regulates the leakage of protons across the inner mitochondrial membrane. UCP2 inhibition may induce pancreatic adenocarcinoma cell death by increasing reactive oxygen species (ROS levels. In this study, the hydroxyls at positions C10 (10-OH and C1 (1-OH of GNP were hypothesized to be the active groups that cause these inhibitory effects. Four GNP derivatives in which the hydroxyl at position C10 or C1 was replaced with other chemical groups were synthesized and isolated. Differences in the inhibitory effects of GNP and its four derivatives on pancreatic carcinoma cell (Panc-1 proliferation were assessed. The effects of GNP and its derivatives on apoptosis, UCP2 inhibition and ROS production were also studied to explore the relationship between GNP's activity and its structure. The derivatives with 1-OH substitutions, geniposide (1-GNP1 and 1-ethyl-genipin (1-GNP2 lacked cytotoxic effects, while the other derivatives that retained 1-OH, 10-piv-genipin (10-GNP1 and 10-acetic acid-genipin (10-GNP2 exerted biological effects similar to those of GNP, even in the absence of 10-OH. Thus, 1-OH is the key functional group in the structure of GNP that is responsible for GNP's apoptotic effects. These cytotoxic effects involve the induction of Panc-1 cell apoptosis through UCP2 inhibition and subsequent ROS production.

  15. The Hydroxyl at Position C1 of Genipin Is the Active Inhibitory Group that Affects Mitochondrial Uncoupling Protein 2 in Panc-1 Cells.

    Science.gov (United States)

    Yang, Yang; Yang, Yifu; Hou, Jianwei; Ding, Yue; Zhang, Tong; Zhang, Yong; Wang, Jianying; Shi, Chenchen; Fu, Wenwei; Cai, Zhenzhen

    2016-01-01

    Genipin (GNP) effectively inhibits uncoupling protein 2 (UCP2), which regulates the leakage of protons across the inner mitochondrial membrane. UCP2 inhibition may induce pancreatic adenocarcinoma cell death by increasing reactive oxygen species (ROS) levels. In this study, the hydroxyls at positions C10 (10-OH) and C1 (1-OH) of GNP were hypothesized to be the active groups that cause these inhibitory effects. Four GNP derivatives in which the hydroxyl at position C10 or C1 was replaced with other chemical groups were synthesized and isolated. Differences in the inhibitory effects of GNP and its four derivatives on pancreatic carcinoma cell (Panc-1) proliferation were assessed. The effects of GNP and its derivatives on apoptosis, UCP2 inhibition and ROS production were also studied to explore the relationship between GNP's activity and its structure. The derivatives with 1-OH substitutions, geniposide (1-GNP1) and 1-ethyl-genipin (1-GNP2) lacked cytotoxic effects, while the other derivatives that retained 1-OH, 10-piv-genipin (10-GNP1) and 10-acetic acid-genipin (10-GNP2) exerted biological effects similar to those of GNP, even in the absence of 10-OH. Thus, 1-OH is the key functional group in the structure of GNP that is responsible for GNP's apoptotic effects. These cytotoxic effects involve the induction of Panc-1 cell apoptosis through UCP2 inhibition and subsequent ROS production.

  16. Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.

    Science.gov (United States)

    Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M

    Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for

  17. Optimum BMI cut points to screen asian americans for type 2 diabetes.

    Science.gov (United States)

    Araneta, Maria Rosario G; Kanaya, Alka M; Hsu, William C; Chang, Healani K; Grandinetti, Andrew; Boyko, Edward J; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; McNeely, Marguerite J; Onishi, Yukiko; Sato, Kyoko K; Fujimoto, Wilfred Y

    2015-05-01

    Asian Americans manifest type 2 diabetes at low BMI levels but may not undergo diagnostic testing for diabetes if the currently recommended BMI screening cut point of ≥25 kg/m(2) is followed. We aimed to ascertain an appropriate lower BMI cut point among Asian-American adults without a prior diabetes diagnosis. We consolidated data from 1,663 participants, ages ≥45 years, without a prior diabetes diagnosis, from population- and community-based studies, including the Mediators of Atherosclerosis in South Asians Living in America study, the North Kohala Study, the Seattle Japanese American Community Diabetes Study, and the University of California San Diego Filipino Health Study. Clinical measures included a 2-h 75-g oral glucose tolerance test, BMI, and glycosylated hemoglobin (HbA1c). Mean age was 59.7 years, mean BMI was 25.4 kg/m(2), 58% were women, and type 2 diabetes prevalence (American Diabetes Association 2010 criteria) was 16.9%. At BMI ≥25 kg/m(2), sensitivity (63.7%), specificity (52.8%), and Youden index (0.16) values were low; limiting screening to BMI ≥25 kg/m(2) would miss 36% of Asian Americans with type 2 diabetes. For screening purposes, higher sensitivity is desirable to minimize missing cases, especially if the diagnostic test is relatively simple and inexpensive. At BMI ≥23 kg/m(2), sensitivity (84.7%) was high in the total sample and by sex and Asian-American subgroup and would miss only ∼15% of Asian Americans with diabetes. The BMI cut point for identifying Asian Americans who should be screened for undiagnosed type 2 diabetes should be <25 kg/m(2), and ≥23 kg/m(2) may be the most practical. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  18. The longitudinal BMI pattern and body composition of patients with anorexia nervosa who require urgent hospitalization: A case control study

    Directory of Open Access Journals (Sweden)

    Kawai Keisuke

    2011-12-01

    Full Text Available Abstract Background The prevention of serious physical complications in anorexia nervosa (AN patients is important. The purpose of this study is to clarify which physical and social factors are related to the necessity for urgent hospitalization of anorexia nervosa (AN patients in a long-term starvation state. We hypothesized that the change of longitudinal BMI, body composition and social background would be useful as an index of the necessity for urgent hospitalization. Methods AN patients were classified into; urgent hospitalization, due to disturbance of consciousness or difficulty walking(n = 17; planned admission (n = 96; and outpatient treatment only groups (n = 136. The longitudinal BMI pattern and the clinical features of these groups were examined. In the hospitalization groups, comparison was done of body composition variation and the social background, including the educational level and advice from family members. Results After adjusting for age and duration of illness, the BMI of the urgent hospitalization group was lower than that of the other groups at one year before hospitalization (P Conclusions The longitudinal pattern of BMI and FFM may be useful for understanding the severity in AN from the viewpoint of failure of the homeostasis system.

  19. Differences in the association between childhood trauma and BMI in ...

    African Journals Online (AJOL)

    However,independent of BMI group, there were significant differences in socioeconomic status (SES) between black and white women (P<0.01). Total CTQ score, as well as the sub-scales, physical and emotional neglect, and physical and sexual abuse were higher in black than white women (all P<0.05), but these scores ...

  20. A simple biosynthetic method for stereospecific resonance assignment of prochiral methyl groups in proteins

    International Nuclear Information System (INIS)

    Plevin, Michael J.; Hamelin, Olivier; Boisbouvier, Jérôme; Gans, Pierre

    2011-01-01

    A new method for stereospecific assignment of prochiral methyl groups in proteins is presented in which protein samples are produced using U-[ 13 C]glucose and subsaturating amounts of 2-[ 13 C]methyl-acetolactate. The resulting non-uniform labeling pattern allows proR and proS methyl groups to be easily distinguished by their different phases in a constant-time two-dimensional 1 H- 13 C correlation spectra. Protein samples are conveniently prepared using the same media composition as the main uniformly-labeled sample and contain higher levels of isotope-enrichment than fractional labeling approaches. This new strategy thus represents an economically-attractive, robust alternative for obtaining isotopically-encoded stereospecific NMR assignments of prochiral methyl groups.

  1. HOMA, BMI, and Serum Leptin Levels Variations during Antiviral Treatment Suggest Virus-Related Insulin Resistance in Noncirrhotic, Nonobese, and Nondiabetic Chronic Hepatitis C Genotype 1 Patients.

    Science.gov (United States)

    Grasso, Alessandro; Malfatti, Federica; Andraghetti, Gabriella; Marenco, Simona; Mazzucchelli, Chiara; Labanca, Sara; Cordera, Renzo; Testa, Roberto; Picciotto, Antonino

    2015-01-01

    Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P = 0.033 and 0.048, resp.) in patients who achieved an early viral load decay (EVR), a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.

  2. HOMA, BMI, and Serum Leptin Levels Variations during Antiviral Treatment Suggest Virus-Related Insulin Resistance in Noncirrhotic, Nonobese, and Nondiabetic Chronic Hepatitis C Genotype 1 Patients

    Directory of Open Access Journals (Sweden)

    Alessandro Grasso

    2015-01-01

    Full Text Available Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P=0.033 and 0.048, resp. in patients who achieved an early viral load decay (EVR, a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.

  3. Racial and Ethnic Differences in Dietary Intake, Physical Activity, and Body Mass Index (BMI) Among Cancer Survivors: 2005 and 2010 National Health Interview Surveys (NHIS).

    Science.gov (United States)

    Byrd, Doratha A; Agurs-Collins, Tanya; Berrigan, David; Lee, Richard; Thompson, Frances E

    2017-12-01

    This paper reports racial/ethnic differences in mean dietary and alcohol intake, physical activity, and body mass index (BMI) among cancer survivors and examines adherence to the American Cancer Society and the US Dietary Guidelines for Americans. Data are from the cross-sectional 2005 and 2010 National Health Interview Surveys (NHIS). The total sample of cancer survivors (N = 3367) included non-Hispanic Whites (NHW; N = 2698), non-Hispanic Blacks (NHBs; N = 379), and Hispanics (N = 290). We compared mean reported dietary intake, moderate/vigorous physical activity, and BMI among racial/ethnic groups. Predicted marginals and multivariate logistic regression analysis were used to compare prevalence of non-adherence with recommendations among groups. Among the three racial/ethnic groups, Hispanics had the highest mean intake of vegetables, fiber, and calcium (p = 0.0003; p < 0.0001; p = 0.001). In the logistic regression model adjusting for sociodemographic covariates, smoking and BMI, Hispanics had lower non-adherence to fiber guidelines (OR = 0.38; CI = 0.24-0.58) than NHWs. NHBs had significantly higher non-adherence to vegetable guidelines (OR = 1.63; CI = 1.07-2.47). NHBs and Hispanics had lower non-adherence with alcohol guidelines than NHWs (OR = 0.35 and 0.38; CI = 0.18-0.69 and 0.19-0.76, respectively). NHBs and Hispanics were more likely to be overweight/obese (OR = 1.66 and 1.57; CI = 1.24-2.23 and CI = 1.11-2.21, respectively). There are racial/ethnic differences in certain health behaviors of cancer survivors. However, non-adherence to guidelines is high in all three racial/ethnic groups. Achieving the recommended guidelines for diet, physical activity, and a healthy BMI is a concern for all cancer survivors, indicating the need for intervention among this growing group of at-risk individuals.

  4. Eating frequency in relation to BMI in very young children: a longitudinal analysis.

    Science.gov (United States)

    Taylor, Rachael W; Iosua, Ella; Heath, Anne-Louise M; Gray, Andrew R; Taylor, Barry J; Lawrence, Julie A; Hanna, Maha; Cameron, Sonya L; Sayers, Rachel; Galland, Barbara

    2017-06-01

    Eating less frequently is associated with increased obesity risk in older children but data are potentially confounded by reverse causation, where bigger children eat less often in an effort to control their weight. Longitudinal data, particularly in younger children, are scarce. We aimed to determine whether eating frequency (meals and snacks) at 2 years of age is associated with past, current or subsequent BMI. Cohort analysis of a randomised controlled trial. Eating frequency at 2 years of age was estimated using 48 h diaries that recorded when each child ate meals and snacks (parent-defined) in five-minute blocks. Body length/height and weight were measured at 1, 2 and 3·5 years of age. Linear regression assessed associations between the number of eating occasions and BMI Z-score, before and after adjustment for potential confounding variables. Prevention of Overweight in Infancy (POI) study, Dunedin, New Zealand. Children (n 371) aged 1-3·5 years. On average, children ate 5·5 (sd 1·2) times/d at 2 years of age, with most children (88-89 %) eating 4-7 times/d. Eating frequency at 2 years was not associated with current (difference in BMI Z-score per additional eating occasion; 95 % CI: -0·02; -0·10, 0·05) or subsequent change (0·02; -0·03, 0·06) in BMI. Similarly, BMI at age 1 year did not predict eating frequency at 2 years of age (difference in eating frequency per additional BMI Z-score unit; 95 % CI: -0·03; -0·19, 0·13). Number of eating occasions per day was not associated with BMI in young children in the present study.

  5. Identification of group specific motifs in Beta-lactamase family of proteins

    Directory of Open Access Journals (Sweden)

    Saxena Akansha

    2009-12-01

    Full Text Available Abstract Background Beta-lactamases are one of the most serious threats to public health. In order to combat this threat we need to study the molecular and functional diversity of these enzymes and identify signatures specific to these enzymes. These signatures will enable us to develop inhibitors and diagnostic probes specific to lactamases. The existing classification of beta-lactamases was developed nearly 30 years ago when few lactamases were available. DLact database contain more than 2000 beta-lactamase, which can be used to study the molecular diversity and to identify signatures specific to this family. Methods A set of 2020 beta-lactamase proteins available in the DLact database http://59.160.102.202/DLact were classified using graph-based clustering of Best Bi-Directional Hits. Non-redundant (> 90 percent identical protein sequences from each group were aligned using T-Coffee and annotated using information available in literature. Motifs specific to each group were predicted using PRATT program. Results The graph-based classification of beta-lactamase proteins resulted in the formation of six groups (Four major groups containing 191, 726, 774 and 73 proteins while two minor groups containing 50 and 8 proteins. Based on the information available in literature, we found that each of the four major groups correspond to the four classes proposed by Ambler. The two minor groups were novel and do not contain molecular signatures of beta-lactamase proteins reported in literature. The group-specific motifs showed high sensitivity (> 70% and very high specificity (> 90%. The motifs from three groups (corresponding to class A, C and D had a high level of conservation at DNA as well as protein level whereas the motifs from the fourth group (corresponding to class B showed conservation at only protein level. Conclusion The graph-based classification of beta-lactamase proteins corresponds with the classification proposed by Ambler, thus there is

  6. Dissociated incretin hormone response to protein versus fat ingestion in obese subjects

    DEFF Research Database (Denmark)

    Lindgren, O; Carr, RD; Holst, Jens Juul

    2011-01-01

    kcal/kg) fat (olive oil) or protein (whey protein) was ingested by non-diabetic obese male volunteers [body mass index (BMI) >30 kg/m(2) ; n = 12] and plasma GIP and GLP-1 were determined. We found no difference in the early GIP or GLP-1 responses to fat versus protein. However, the total 300-min GIP...

  7. Lack of adaptation to human tetherin in HIV-1 Group O and P

    Science.gov (United States)

    2011-01-01

    Background HIV-1 viruses are categorized into four distinct groups: M, N, O and P. Despite the same genomic organization, only the group M viruses are responsible for the world-wide pandemic of AIDS, suggesting better adaptation to human hosts. Previously, it has been reported that the group M Vpu protein is capable of both down-modulating CD4 and counteracting BST-2/tetherin restriction, while the group O Vpu cannot antagonize tetherin. This led us to investigate if group O, and the related group P viruses, possess functional anti-tetherin activities in Vpu or another viral protein, and to further map the residues required for group M Vpu to counteract human tetherin. Results We found a lack of activity against human tetherin for both the Vpu and Nef proteins from group O and P viruses. Furthermore, we found no evidence of anti-human tetherin activity in a fully infectious group O proviral clone, ruling out the possibility of an alternative anti-tetherin factor in this virus. Interestingly, an activity against primate tetherins was retained in the Nef proteins from both a group O and a group P virus. By making chimeras between a functional group M and non-functional group O Vpu protein, we were able to map the first 18 amino acids of group M Vpu as playing an essential role in the ability of the protein to antagonize human tetherin. We further demonstrated the importance of residue alanine-18 for the group M Vpu activity. This residue lies on a diagonal face of conserved alanines in the TM domain of the protein, and is necessary for specific Vpu-tetherin interactions. Conclusions The absence of human specific anti-tetherin activities in HIV-1 group O and P suggests a failure of these viruses to adapt to human hosts, which may have limited their spread. PMID:21955466

  8. Lack of adaptation to human tetherin in HIV-1 Group O and P

    Directory of Open Access Journals (Sweden)

    Haworth Kevin G

    2011-09-01

    Full Text Available Abstract Background HIV-1 viruses are categorized into four distinct groups: M, N, O and P. Despite the same genomic organization, only the group M viruses are responsible for the world-wide pandemic of AIDS, suggesting better adaptation to human hosts. Previously, it has been reported that the group M Vpu protein is capable of both down-modulating CD4 and counteracting BST-2/tetherin restriction, while the group O Vpu cannot antagonize tetherin. This led us to investigate if group O, and the related group P viruses, possess functional anti-tetherin activities in Vpu or another viral protein, and to further map the residues required for group M Vpu to counteract human tetherin. Results We found a lack of activity against human tetherin for both the Vpu and Nef proteins from group O and P viruses. Furthermore, we found no evidence of anti-human tetherin activity in a fully infectious group O proviral clone, ruling out the possibility of an alternative anti-tetherin factor in this virus. Interestingly, an activity against primate tetherins was retained in the Nef proteins from both a group O and a group P virus. By making chimeras between a functional group M and non-functional group O Vpu protein, we were able to map the first 18 amino acids of group M Vpu as playing an essential role in the ability of the protein to antagonize human tetherin. We further demonstrated the importance of residue alanine-18 for the group M Vpu activity. This residue lies on a diagonal face of conserved alanines in the TM domain of the protein, and is necessary for specific Vpu-tetherin interactions. Conclusions The absence of human specific anti-tetherin activities in HIV-1 group O and P suggests a failure of these viruses to adapt to human hosts, which may have limited their spread.

  9. Sickness Presenteeism Among Health Care Workers and the Effect of BMI, Cardiorespiratory Fitness, and Muscle Strength.

    Science.gov (United States)

    Christensen, Jeanette Reffstrup; Kongstad, Malte Bue; Sjøgaard, Gisela; Søgaard, Karen

    2015-12-01

    The primary objective of this study was to assess the relationship between sickness presenteeism and body mass index (BMI), cardiorespiratory fitness (CRF), and maximal voluntary contraction (MVC). Female health care workers (n = 139) were analyzed cross-sectional as well as longitudinal after 3 and 12-month follow-up. Sickness presenteeism was assessed as a summed score using validated questions from three questionnaires: Health and Work Performance Questionnaire, Work Ability Index, and Quantity and Quality Method. CRF was assessed by a maximal cycling test and MVC from four muscle groups. Significant relationships were found between sickness presenteeism and BMI as well as MVC both cross-sectional and as changes over 3 months. Participants with BMI more than 30  kg/m had significantly higher sickness presenteeism than those with BMI less than 25  kg/m. This study suggests that actions that decrease BMI and increase MVC decrease the amount of sickness presenteeism.

  10. Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

    Science.gov (United States)

    Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian

    2018-01-01

    The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (pobesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition and lipid concentrations may improve.

  11. Adult BMI and Access to Built Environment Resources in a High-Poverty, Urban Geography.

    Science.gov (United States)

    Tung, Elizabeth L; Peek, Monica E; Makelarski, Jennifer A; Escamilla, Veronica; Lindau, Stacy T

    2016-11-01

    The purpose of this study is to examine the relationship between BMI and access to built environment resources in a high-poverty, urban geography. Participants (aged ≥35 years) were surveyed between November 2012 and July 2013 to examine access to common health-enabling resources (grocers, outpatient providers, pharmacies, places of worship, and physical activity resources). Survey data were linked to a contemporaneous census of built resources. Associations between BMI and access to resources (potential and realized) were examined using independent t-tests and multiple linear regression. Data analysis was conducted in 2014-2015. Median age was 53.8 years (N=267, 62% cooperation rate). Obesity (BMI ≥30) prevalence was 54.9%. BMI was not associated with potential access to resources located nearest to home. Nearly all participants (98.1%) bypassed at least one nearby resource type; half bypassed nearby grocers (realized access >1 mile from home). Bypassing grocers was associated with a higher BMI (p=0.03). Each additional mile traveled from home to a grocer was associated with a 0.9-higher BMI (95% CI=0.4, 1.3). Quality and affordability were common reasons for bypassing resources. Despite potential access to grocers in a high-poverty, urban region, half of participants bypassed nearby grocers to access food. Bypassing grocers was associated with a higher BMI. Copyright © 2016 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  12. Image noise-based dose adaptation in dynamic volume CT of the heart: dose and image quality optimisation in comparison with BMI-based dose adaptation

    Energy Technology Data Exchange (ETDEWEB)

    Odedra, Devang [Queen' s University, School of Medicine, Kingston, ON (Canada); Blobel, Joerg [Toshiba Medical Systems Europe BV, Zoetermeer (Netherlands); University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada); AlHumayyd, Saad; Durand, Miranda; Jimenez-Juan, Laura; Paul, Narinder [University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada)

    2014-01-15

    To compare the image quality and radiation dose using image-noise (IN)-based determination of X-ray tube settings compared with a body mass index (BMI)-based protocol during CT coronary angiography (CTCA). Two hundred consecutive patients referred for CTCA to our institution were divided into two groups: BMI-based, 100 patients had CTCA with the X-ray tube current adjusted to the patient's BMI while maintaining a fixed tube potential of 120 kV; IN-based, 100 patients underwent imaging with the X-ray tube current and voltage adjusted to the IN measured within the mid-left ventricle on a pre-acquisition trans-axial image. Two independent cardiac radiologists performed blinded image quality assessment with quantification of the IN and signal-to-noise ratio (SNR) from the mid-LV and qualitative assessment using a three-point score. Radiation dose (CTDI and DLP) was recorded from the console. Results showed: IN (HU): BMI-based, 30.1 ± 9.9; IN-based, 33.1 ± 6.7; 32 % variation reduction (P = 0.001); SNR: BMI-based, 18.6 ± 7.1; IN-based, 15.4 ± 3.7; 48 % variation reduction (P < 0.0001). Visual scores: BMI-based, 2.3 ± 0.6; IN-based, 2.2 ± 0.5 (P = 0.54). Radiation dose: CTDI (mGy), BMI-based, 22.68 ± 8.9; IN-based, 17.16 ± 7.6; 24.3 % reduction (P < 0.001); DLP (mGy.cm), BMI-based, 309.3 ± 127.5; IN-based, 230.6 ± 105.5; 25.4 % reduction (P < 0.001). Image-noise-based stratification of X-ray tube parameters for CTCA results in 32 % improvement in image quality and 25 % reduction in radiation dose compared with a BMI-based protocol. (orig.)

  13. To Assess the Effect of Maternal BMI on Obstetrical Outcome

    Science.gov (United States)

    Lakhanpal, Shuchi; Aggarwal, Asha; Kaur, Gurcharan

    2012-06-01

    AIMS: To assess the effect of maternal BMI on complications in pregnancy, mode of delivery, complications of labour and delivery.METHODS:A crossectional study was carried out in the Obst and Gynae department, Kasturba Hospital, Delhi. The study enrolled 100 pregnant women. They were divided into 2 groups based on their BMI, more than or equal to 30.0 kg/m2 were categorized as obese and less than 30 kg/m2 as non obese respectively. Maternal complications in both types of patients were studied.RESULTS:CONCLUSION: As the obstetrical outcome is significantly altered due to obesity, we can improve maternal outcome by overcoming obesity. As obesity is a modifiable risk factor, preconception counseling creating awareness regarding health risk associated with obesity should be encouraged and obstetrical complications reduced.

  14. Sub-grouping and sub-functionalization of the RIFIN multi-copy protein family

    Directory of Open Access Journals (Sweden)

    Sonnhammer Erik L

    2008-01-01

    Full Text Available Abstract Background Parasitic protozoans possess many multicopy gene families which have central roles in parasite survival and virulence. The number and variability of members of these gene families often make it difficult to predict possible functions of the encoded proteins. The families of extra-cellular proteins that are exposed to a host immune response have been driven via immune selection to become antigenically variant, and thereby avoid immune recognition while maintaining protein function to establish a chronic infection. Results We have combined phylogenetic and function shift analyses to study the evolution of the RIFIN proteins, which are antigenically variant and are encoded by the largest multicopy gene family in Plasmodium falciparum. We show that this family can be subdivided into two major groups that we named A- and B-RIFIN proteins. This suggested sub-grouping is supported by a recently published study that showed that, despite the presence of the Plasmodium export (PEXEL motif in all RIFIN variants, proteins from each group have different cellular localizations during the intraerythrocytic life cycle of the parasite. In the present study we show that function shift analysis, a novel technique to predict functional divergence between sub-groups of a protein family, indicates that RIFINs have undergone neo- or sub-functionalization. Conclusion These results question the general trend of clustering large antigenically variant protein groups into homogenous families. Assigning functions to protein families requires their subdivision into meaningful groups such as we have shown for the RIFIN protein family. Using phylogenetic and function shift analysis methods, we identify new directions for the investigation of this broad and complex group of proteins.

  15. Effectiveness of exercise and protein supplementation intervention on body composition, functional fitness, and oxidative stress among elderly Malays with sarcopenia

    Directory of Open Access Journals (Sweden)

    Shahar S

    2013-10-01

    Full Text Available Suzana Shahar,1 Norshafarina Shari Kamaruddin,2 Manal Badrasawi,1 Noor Ibrahim Mohamed Sakian,3 Zahara Abd Manaf,1 Zaitun Yassin,4 Leonard Joseph51Dietetic Programme, 2Biomedical Programme, 3Occupational Therapy Programme, School of Healthcare Sciences, Universiti Kebangsaan Malaysia, Jalan Raja Muda Abdul Aziz, Kuala Lumpur, 4Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Serdang, Selangor, 5Department of Physiotherapy, School of Healthcare Sciences, Universiti Kebangsaan Malaysia, Jalan Raja Muda Abdul Aziz, Kuala Lumpur, MalaysiaAbstract: Sarcopenia, characterized as muscle loss that occurs with aging, is a major health problem in an aging population, due to its implications on mobility, quality of life, and fall risk. Protein supplementation could improve the physical fitness by increasing protein anabolism, and exercise has a documented evidence of positive effect on functional status among the elderly. However, the combined effect of both protein supplementation and exercise has not been investigated among sarcopenic elderly in the Asian population. Thus, this study aimed to determine the effectiveness of exercise intervention and protein supplementation either alone or in combination for 12 weeks, on body composition, functional fitness, and oxidative stress among elderly Malays with sarcopenia. Sixty five sarcopenic elderly Malays aged 60-74 years were assigned to the control group, exercise group (ExG, protein supplementation group (PrG, or the combination of exercise and protein supplementation group. A significant interaction effect between body weight and body mass index (BMI was observed, with the PrG (-2.1% body weight, -1.8% BMI showing the highest reductions. Further, there was a decrease in % body fat (-4.5% and an increase in fat-free mass (kg (+5.7% in the ExG after 12 weeks (P < 0.05. The highest increments in lower and upper body strength were observed in the Pr

  16. Eating behaviour patterns and BMI in Portuguese higher education students.

    Science.gov (United States)

    Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora

    2013-12-01

    Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations

    DEFF Research Database (Denmark)

    Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria

    2018-01-01

    Objective The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during......, and 80% improved their lipid concentrations. Conclusion Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition...... childhood obesity treatment. Methods 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6±21.7), and median BMI SDS 2.8 (range 1.3±5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0...

  18. Higher BMI Is Associated with Reduced Cognitive Performance in Division I Athletes

    Directory of Open Access Journals (Sweden)

    Andrew Fedor

    2013-04-01

    Full Text Available Objective: Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT in Division I collegiate athletes. Methods: Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Results: Regression analyses revealed that BMI incrementally predicted performance on visual memory (R2 change = 0.015, p = 0.026 beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17, visual memory (r = -0.16, and visual motor speed (r = -0.12. Conclusions: These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations.

  19. Higher BMI is associated with reduced cognitive performance in division I athletes.

    Science.gov (United States)

    Fedor, Andrew; Gunstad, John

    2013-01-01

    Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT) in Division I collegiate athletes. Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Regression analyses revealed that BMI incrementally predicted performance on visual memory (R(2) change = 0.015, p = 0.026) beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17), visual memory (r = -0.16), and visual motor speed (r = -0.12). These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations. Copyright © 2013 S. Karger GmbH, Freiburg.

  20. Mechanism by which BMI influences leisure-time physical activity behavior.

    Science.gov (United States)

    Godin, Gaston; Bélanger-Gravel, Ariane; Nolin, Bertrand

    2008-06-01

    The objective of this prospective study was to clarify the mechanism by which BMI influences leisure-time physical activity. This was achieved in accordance with the assumptions underlying the Theory of Planned Behavior (TPB), considered as one of the most useful theories to predict behavior adoption. At baseline, a sample of 1,530 respondents completed a short questionnaire to measure intention and perceived behavioral control (PBC), the two proximal determinants of behavior of TPB. Past behavior, sociodemographic variables, and weight and height were also assessed. The dependent variable, leisure-time physical activity was assessed 3 months later. Hierarchical multiple regression analyses revealed that BMI is a direct predictor of future leisure-time physical activity, not mediated by the variables of TPB. Additional hierarchical analyses indicated that BMI was not a moderator of the intention-behavior and PBC-behavior relationships. The results of this study suggest that high BMI is a significant negative determinant of leisure-time physical activity. This observation reinforces the importance of preventing weight gain as a health promotion strategy for avoiding a sedentary lifestyle.

  1. Haplotypes in the CRP Gene Associated with Increased BMI and Levels of CRP in Subjects with Type 2 Diabetes or Obesity from Southwestern Mexico

    Directory of Open Access Journals (Sweden)

    América Martínez-Calleja

    2012-01-01

    Full Text Available Objective. We evaluated the association between four polymorphisms in the CRP gene with circulating levels of C-reactive protein (CRP, type 2 diabetes (T2D, obesity, and risk score of coronary heart disease. Methods. We studied 402 individuals and classified them into four groups: healthy, obese, T2D obese, and T2D without obesity, from Guerrero, Southwestern Mexico. Blood levels of CRP, glucose, cholesterol, triglycerides, and leukocytes were measured. Genotyping was performed by PCR/RFLP, and the risk score for coronary heart disease was determined by the Framingham's methodology. Results. The TT genotype of SNP rs1130864 was associated with increased body mass index and T2D patients with obesity. We found that the haplotype 2 (TGAG was associated with increased levels of CRP (β=0.3; 95%CI: 0.1, 0.5; P=0.005 and haplotype 7 (TGGG with higher body mass index (BMI (β=0.2; 95%CI: 0.1, 0.3; P<0.001. The risk score for coronary heart disease was associated with increased levels of CRP, but not with any polymorphism or haplotype. Conclusions. The association between the TT genotype of SNP rs1130864 with obesity and the haplotype 7 with BMI may explain how obesity and genetic predisposition increase the risk of diseases such as T2D in the population of Southwestern Mexico.

  2. MicroRNA-330-3p Expression Indicates Good Prognosis and Suppresses Cell Proliferation by Targeting Bmi-1 in Osteosarcoma

    Directory of Open Access Journals (Sweden)

    Zhenxin Zheng

    2018-03-01

    Full Text Available Background/Aims: Growing evidence has shown that miR-330-3p is closely related to the biological behavior of cancer, including proliferation, metastasis, and prognosis. However, there have been no reports on miR-330-3p expression and function in osteosarcoma. Methods: Expression of miR-330-3p in osteosarcoma tissues and cell lines was examined by quantitative PCR. Effects of miR-330-3p on osteosarcoma cell proliferation were investigated in vitro with the Cell Counting Kit-8 colorimetric assay. Targets of miR-330-3p were identified by dual-luciferase reporter assay. Results: The results showed that expression of miR-330 decreased in osteosarcoma tissues and cell lines. Prognosis of patients with high miR-330-3p expression was much better than that of those with low expression (P=0.001, and multivariate analysis suggested that miR-330-3p is an independent prognostic factor for osteosarcoma. In addition, miR-330-3p overexpression significantly inhibited the growth of MG-63 and U2OS osteosarcoma cells. Dual-luciferase reporter assay demonstrated that Bmi-1 was a direct target gene of miR-330-3p, and in a recovery experiment, miR-330-3p suppressed osteosarcoma cell proliferation by directly targeting Bmi-1. Conclusion: Our results suggest that miR-330-3p acts as a tumor suppressor by regulating Bmi-1 expression in osteosarcoma. Thus, miR-330-3p may represent a novel therapeutic target for the treatment of osteosarcoma.

  3. Effects of a High-Protein/Low-Carbohydrate Diet versus a Standard Hypocaloric Diet on Weight and Cardiovascular Risk Factors: Role of a Genetic Variation in the rs9939609 FTO Gene Variant.

    Science.gov (United States)

    de Luis, Daniel Antonio; Aller, Rocío; Izaola, Olatz; Primo, David; Urdiales, Silvia; Romero, Enrique

    2015-01-01

    The common polymorphism rs9939609 of the fat mass- and obesity-associated gene (FTO) has been linked to obesity. Our aim was to investigate its role in weight loss after the administration of a high-protein/low-carbohydrate diet compared to a standard hypocaloric diet (1,000 kcal/day). During 9 months, 195 patients were randomly allocated to a high-protein hypocaloric diet (HP diet) and a standard hypocaloric diet (S diet). With the HP diet, BMI (-1.9 ± 1.2 vs. -2.10 ± 1.8; p diet, BMI (-0.9 ± 1.1 vs. -1.8 ± 1.2; p diet and in both genotype groups, glucose, insulin levels, homeostasis model assessment of insulin resistance (HOMA-IR), total cholesterol, triglycerides and low-density lipoprotein (LDL) decreased. With the S diet, total cholesterol and LDL decreased. Weight loss was better in A allele carriers than noncarriers, and metabolic improvement was better with the HP diet. © 2015 S. Karger AG, Basel.

  4. Modeling the dynamics of BMI changes during adolescence. The Oporto Growth, Health and Performance Study.

    Science.gov (United States)

    de Souza, M C; Eisenmann, J C; e Santos, D V; de Chaves, R N; de Moraes Forjaz, C L; Maia, J A R

    2015-07-01

    The aims of this study were twofold: (i) to model changes in body mass index (BMI) of 10-18-year-old adolescents, and (ii) to investigate the effects of total physical activity (TPA), physical fitness (PF), sleep duration and fruit/vegetable consumption in BMI trajectories across time. Data were obtained from the Oporto Growth, Health and Performance Study and comprised 6894 adolescents (3418 girls) divided into four age cohorts (10, 12, 14 and 16 years) measured annually for 3 years. BMI was computed using the standard formula (kg m(-2)); TPA was estimated with the Baecke questionnaire; PF measures included 1-mile run/walk, 50 yard dash (50YD), standing long jump (SLJ), handgrip strength (HGr) and agility shuttle run. Longitudinal changes in BMI were analyzed using the multilevel modeling approach. The average BMI at age of peak of height velocity was 20.7±0.07 kg m(-2) for girls (P<0.001) and 20.58±0.06 kg m(-2) for boys (P<0.001). The annual increment in BMI was 1.36±0.04 kg m(-2), P<0.001 and 1.23±0.03 kg m(-2), P<0.001 for girls and boys, respectively. PF were related to BMI trajectories in both sexes (Girls: β1mile=0.12±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.28±0.05, P<0.001; βHGr=-8.91±0.54, P<0.001; Boys: β1mile=0.18±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.26±0.04, P<0.001; and βHGr=-8.15±0.45, P<0.001). TPA only showed significant, but positive, association with girls' BMI trajectories (β=0.10±0.03, P=0.001). After adjusting for the covariates, sleep duration and fruit/vegetable intake did not show any significant association with BMI trajectories either sex. BMI increased linearly with age in both gender. PF levels are negatively associated with BMI across time in both boys and girls. Therefore, promotion of PF in the adolescent years seems to be effective in the early prevention of obesity.

  5. Prospective associations between sedentary lifestyle and BMI in midlife

    DEFF Research Database (Denmark)

    Mortensen, Laust Hvas; Siegler, Ilene C; Barefoot, John C

    2006-01-01

    A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle.......A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle....

  6. Association of surfactant protein-d with obesity

    International Nuclear Information System (INIS)

    Jawed, S.

    2016-01-01

    Obesity is associated with inflammatory diseases and obese individual's poses high risk for infections. Surfactant protein D (SP-D) is an important regulator of immunity and inflammation. Latest studies have suggested that it is also involved in lipid homeostasis and obese subjects have decrease concentration of SPD as compared to normal weight peoples. The aim of the current study was to elucidate the relationship among serum SP-D and BMI. Method: This cross sectional study was performed at Dow University of health sciences (DUHS), Karachi. We analysed 90 obese and non-obese subjects for serum SP-D concentration. SP-D was estimated by ELISA. Data was analysed by SPSS 16. Mean SP-D level and demographical variables between the groups were compared by t test, Associations of SP-D with BMI investigated by regression analysis. Results: obese subjects have significant lower levels of Serum SP-D than non-obese and negatively associated with BMI in both genders (p=0.000). Conclusion: This study concluded that obese subjects have lower concentration of SP-D as compare to non-obese and there is an inverse association between the SP-D and BMI. (author)

  7. High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF(II)30 affect estrogen receptor-mediated transcriptional activation.

    Science.gov (United States)

    Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F

    1997-07-01

    The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.

  8. Relationship between protein intake and dynapenia in postmenopausal women.

    Science.gov (United States)

    Filion, M E; Barbat-Artigas, S; Dupontgand, S; Fex, A; Karelis, A D; Aubertin-Leheudre, M

    2012-07-01

    The purpose of this study was to investigate the relationship between protein intake and dynapenia. A cross-sectional/observational study. Department of Kinanthropology at the University of Quebec at Montreal. Seventy-two non-frail postmenopausal women aged between 50 to 75 years were recruited. Body weight (BW), lean body mass (LBM; %) and skeletal muscle mass (bio-electrical impedancemetry analysis), maximum voluntary handgrip strength (using hand dynamometer), aerobic capacity (VO2peak) and dietary intake were measured. Women were divided according to dynapenia criteria. The strongest correlation between muscle strength and protein intake was observed when we express the amount of protein in g/d/BW. No differences for age, BMI, status of menopause, fat mass and VO2peak were observed between non-dynapenic, type I dynapenic and type II dynapenic women, independently of the criteria used. We observed significant differences in protein intake (g/d/BW) between non-dynapenic and type II dynapenic (p<0.01) as well as between type I dynapenic and type II dynapenic (p<0.01) when dynapenia was expressed in kg/BW and in kg/LBM, respectively. It should be noted that no differences in LBM between the three groups were observed when dynapenia was expressed in kg/BW and kg/LBM. Protein intake for all groups respected the RDA of 0.8 to 1.2 g/d/BW (non-dynapenic: 1.44/1.38; type I dynapenic: 1.30/1.33; type II dynapenic: 1.05/1.08 g/d/BW). Protein intake seems to play a role in the development of dynapenia particularly at the level of type II dynapenia. Therefore, an increase in the recommended daily allowance for protein intake may be warranted.

  9. Adrenocortical regulation, eating in the absence of hunger and BMI in young children.

    Science.gov (United States)

    Francis, L A; Granger, D A; Susman, E J

    2013-05-01

    The purpose of this study was to examine relations among adrenocortical regulation, eating in the absence of hunger, and body mass index (BMI) in children ages 5-9years (N=43). Saliva was collected before and after the Trier Social Stress Test for Children (TSST-C), and was later assayed for cortisol. Area under the curve with respect to increase (AUCi) was used as a measure of changes in cortisol release from baseline to 60min post-TSST-C. Age- and sex-specific BMI scores were calculated from measured height and weight, and eating in the absence of hunger was assessed using weighed food intake during a behavioral procedure. We also included a measure of parents' report of child impulsivity, as well as family demographic information. Participants were stratified by age into younger (5-7years) and older (8-9years) groups. In younger children, parents' reports of child impulsivity were significantly and positively associated with BMI; cortisol AUCi was not associated with BMI or eating in the absence of hunger. In older children, however, greater stress-related cortisol AUCi was related to higher BMI scores and greater energy intake in the absence of hunger. The results suggest that cortisol AUCi in response to psychosocial stress may be linked to problems with energy balance in children, with some variation by age. Published by Elsevier Ltd.

  10. Work-family life courses and BMI trajectories in three British birth cohorts.

    Science.gov (United States)

    Lacey, R E; Sacker, A; Bell, S; Kumari, M; Worts, D; McDonough, P; Kuh, D; McMunn, A

    2017-02-01

    Combining work and family responsibilities has previously been associated with improved health in mid-life, yet little is known about how these associations change over time (both biographical and historical) and whether this extends to body mass index (BMI) trajectories for British men and women. The purpose of this study was to investigate relationships between work-family life courses and BMI trajectories across adulthood (16-42 years) for men and women in three British birth cohorts. Multiply imputed data from three nationally representative British birth cohorts were used-the MRC National Survey of Health and Development (NSHD; 1946 birth cohort, n=3012), the National Child Development Study (NCDS; 1958 birth cohort, n=9614) and the British Cohort Study (BCS; 1970 birth cohort, n=8140). A typology of work-family life course types was developed using multi-channel sequence analysis, linking annual information on work, partnerships and parenthood from 16 to 42 years. Work-family life courses were related to BMI trajectories using multi-level growth models. Analyses adjusted for indicators of prior health, birthweight, child BMI, educational attainment and socioeconomic position across the life course, and were stratified by gender and cohort. Work-family life courses characterised by earlier transitions to parenthood and weaker long-term links to employment were associated with greater increases in BMI across adulthood. Some of these differences, particularly for work-family groups, which are becoming increasingly non-normative, became more pronounced across cohorts (for example, increases in BMI between 16 and 42 years in long-term homemaking women: NSHD: 4.35 kg m -2 , 95% confidence interval (CI): 3.44, 5.26; NCDS: 5.53 kg m - 2 , 95% CI: 5.18, 5.88; BCS: 6.69 kg m - 2 , 95% CI: 6.36, 7.02). Becoming a parent earlier and weaker long-term ties to employment are associated with greater increases in BMI across adulthood in British men and women.

  11. Fundamental movement skills in adolescents: Secular trends from 2003 to 2010 and associations with physical activity and BMI.

    Science.gov (United States)

    Huotari, P; Heikinaro-Johansson, P; Watt, A; Jaakkola, T

    2018-03-01

    The aim of this study was to examine the secular trends in fundamental movement skills (FMS) among 15- to 16-year-old adolescents at 2 assessment points scheduled in 2003 and 2010 and to investigate the associations between FMS, physical activity (PA), and body mass index (BMI). In 2003, self-reported PA, weight and height, and objective FMS scores were collected from 2390 students, and in 2010, similar data were generated from a second sample of 1346 students. FMS were assessed during both assessment phases using 3 identical objective FMS tests that were figure 8 dribbling, jumping laterally, and coordination track tests. This study indicated that the sum index of FMS did not change among the boys and the girls between 2 data collection points. However, findings demonstrated a secular decline in coordination test scores in both gender groups between 2 measurement points but an improvement in girls' object control skills between 2003 and 2010. The results also showed that FMS had a significant main effect on BMI in both gender groups, whereas the main effect of PA on BMI was not significant for either gender group. Results also demonstrated that there was no significant interaction effect between FMS and PA on BMI in either of the girls' or the boys' groups. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Uncoupling protein 2 G(-866A polymorphism: a new gene polymorphism associated with C-reactive protein in type 2 diabetic patients C-reactive protein in type 2 diabetic patients

    Directory of Open Access Journals (Sweden)

    Cocozza Sergio

    2010-10-01

    Full Text Available Abstract Background This study evaluated the relationship between the G(-866A polymorphism of the uncoupling protein 2 (UCP2 gene and high-sensitivity C reactive protein (hs-CRP plasma levels in diabetic patients. Methods We studied 383 unrelated people with type 2 diabetes aged 40-70 years. Anthropometry, fasting lipids, glucose, HbA1c, and hs-CRP were measured. Participants were genotyped for the G (-866A polymorphism of the uncoupling protein 2 gene. Results Hs-CRP (mg/L increased progressively across the three genotype groups AA, AG, or GG, being respectively 3.0 ± 3.2, 3.6 ± 5.0, and 4.8 ± 5.3 (p for trend = 0.03. Since hs-CRP values were not significantly different between AA and AG genotype, these two groups were pooled for further analyses. Compared to participants with the AA/AG genotypes, homozygotes for the G allele (GG genotype had significantly higher hs-CRP levels (4.8 ± 5.3 vs 3.5 ± 4.7 mg/L, p = 0.01 and a larger proportion (53.9% vs 46.1%, p = 0.013 of elevated hs-CRP (> 2 mg/L. This was not explained by major confounders such as age, gender, BMI, waist circumference, HbA1c, smoking, or medications use which were comparable in the two genotype groups. Conclusions The study shows for the first time, in type 2 diabetic patients, a significant association of hs-CRP levels with the G(-866A polymorphism of UCP2 beyond the effect of major confounders.

  13. Expression and associations of TRAF1, BMI-1, ALDH1, and Lin28B in oral squamous cell carcinoma.

    Science.gov (United States)

    Wu, Tian-Fu; Li, Yi-Cun; Ma, Si-Rui; Bing-Liu; Zhang, Wen-Feng; Sun, Zhi-Jun

    2017-04-01

    Tumor necrosis factor receptor-associated factor 1, an adaptor protein of tumor necrosis factor 2, is involved in classical nuclear factor (NF)-κB activation and lymphocyte recruitment. However, less is known about the expression and association of tumor necrosis factor receptor-associated factor 1 with cancer stem cell markers in oral squamous cell carcinoma. This study aimed to investigate the expression of tumor necrosis factor receptor-associated factor 1 and stem cell characteristic markers (lin28 homolog B, B cell-specific Moloney murine leukemia virus integration site 1, and aldehyde dehydrogenase 1) in oral squamous cell carcinoma and analyze their relations. Paraffin-embedded tissues of 78 oral squamous cell carcinomas, 39 normal oral mucosa, and 12 oral dysplasia tissues were employed in tissue microarrays, and the expression of tumor necrosis factor receptor-associated factor 1, B cell-specific Moloney murine leukemia virus integration site 1, aldehyde dehydrogenase 1, and lin28 homolog B was measured by immunohistostaining and digital pathological analysis. The expression of tumor necrosis factor receptor-associated factor 1 was higher in the oral squamous cell carcinoma group as compared with the expression in the oral mucosa (p oral dysplasia (p oral squamous cell carcinoma. The patient survival rate was lower in the highly expressed tumor necrosis factor receptor-associated factor 1 group, although the difference was not significant. The clustering analysis showed that tumor necrosis factor receptor-associated factor 1 was most related to aldehyde dehydrogenase 1. These findings suggest that tumor necrosis factor receptor-associated factor 1 has potential direct/indirect regulations with the cancer stem cell markers in oral squamous cell carcinoma, which may help in further analysis of the cancer stem cell characteristics.

  14. Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

    Directory of Open Access Journals (Sweden)

    Tenna Ruest Haarmark Nielsen

    Full Text Available The body mass index (BMI standard deviation score (SDS may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment.876 children and adolescents (498 girls with overweight/obesity, median age 11.2 years (range 1.6-21.7, and median BMI SDS 2.8 (range 1.3-5.7 were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4. Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC, low-density lipoprotein (LDL, high-density lipoprotein (HDL, non-HDL, and triglycerides (TG were available in 469 individuals (264 girls. Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations.At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4 and positively with TG (p = 9.7*10-6. Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10-16 and percent truncal body fat (p<2*10-16. Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001. Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations.Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma

  15. BMI mediates the association between low educational level and higher blood pressure during pregnancy in Japan.

    Science.gov (United States)

    Jwa, Seung Chik; Fujiwara, Takeo; Hata, Akira; Arata, Naoko; Sago, Haruhiko; Ohya, Yukihiro

    2013-04-25

    Research investigating the association between socioeconomic status (SES) and blood pressure (BP) during pregnancy is limited and its underlying pathway is unknown. The aim of this study was to investigate the mediators of the association between educational level as an indicator of the SES and BP in early and mid-pregnancy among Japanese women. Nine hundred and twenty-three pregnant women in whom BP was measured before 16 weeks and at 20 weeks of gestation were enrolled in this study. Maternal educational levels were categorized into three groups: high (university or higher), mid (junior college), and low (junior high school, high school, or vocational training school). The low educational group had higher systolic (low vs. high, difference = 2.39 mmHg, 95% confidence interval [CI]: 0.59 to 4.19) and diastolic BP levels (low vs. high, difference = 0.74 mmHg, 95% CI: -0.52 to 1.99) in early pregnancy. However, the same associations were not found after adjustment for pre-pregnancy body mass index (BMI). BP reduction was observed in mid-pregnancy in all three educational groups and there was no association between educational level and pregnancy-induced hypertension. In Japanese women, the low educational group showed higher BP during pregnancy than the mid or high educational groups. Pre-pregnancy BMI mediates the association between educational level and BP.

  16. The longitudinal BMI pattern and body composition of patients with anorexia nervosa who require urgent hospitalization: A case control study.

    Science.gov (United States)

    Kawai, Keisuke; Yamashita, Sakino; Yamanaka, Takeharu; Gondo, Motoharu; Morita, Chihiro; Nozaki, Takehiro; Takakura, Shu; Hata, Tomokazu; Yamada, Yu; Matsubayashi, Sunao; Takii, Masato; Kubo, Chiharu; Sudo, Nobuyuki

    2011-12-05

    The prevention of serious physical complications in anorexia nervosa (AN) patients is important. The purpose of this study is to clarify which physical and social factors are related to the necessity for urgent hospitalization of anorexia nervosa (AN) patients in a long-term starvation state. We hypothesized that the change of longitudinal BMI, body composition and social background would be useful as an index of the necessity for urgent hospitalization. AN patients were classified into; urgent hospitalization, due to disturbance of consciousness or difficulty walking(n = 17); planned admission (n = 96); and outpatient treatment only groups (n = 136). The longitudinal BMI pattern and the clinical features of these groups were examined. In the hospitalization groups, comparison was done of body composition variation and the social background, including the educational level and advice from family members. After adjusting for age and duration of illness, the BMI of the urgent hospitalization group was lower than that of the other groups at one year before hospitalization (P < 0.01) and decreased more rapidly (P < 0.01). Urgent hospitalization was associated with the fat free mass (FFM) (P < 0.01). Between the groups, no considerable difference in social factors was found. The longitudinal pattern of BMI and FFM may be useful for understanding the severity in AN from the viewpoint of failure of the homeostasis system.

  17. ABO blood groups and risk for obesity in Arar, Northern Saudi Arabia.

    Science.gov (United States)

    Aboel-Fetoh, Nagah M; Alanazi, Arwa R; Alanazi, Abdullah S; Alruwili, Asma N

    2016-12-01

    ABO blood groups are associated with some important chronic diseases. Previous studies have observed an association between ABO blood group and risk for obesity. This study aimed to determine whether there is an association between ABO blood groups and obesity in apparently healthy attendees of primary healthcare (PHC) centers in Arar city, Northern Saudi Arabia. This cross-sectional study included 401 participants aged 15 years and older attending three randomly selected PHC centers in Arar city. Data were collected by means of personal interview using a predesigned questionnaire. Anthropometric examination included height and weight measurements with calculation of BMI. ABO and Rh blood groups were determined. The majority of the participants were female (70.8%). The mean±SD age was 28.6±9.1 years. Only 5.7% were underweight. Both normal and overweight participants were equal in number and constituted 28.4%, whereas obese individuals constituted 37.4% with a mean BMI of 28.56±8.0. Blood group O was the most common (44.1%), followed by A (30.9%), B (18.7%), and AB (6.2%). Rh-positive cases constituted 87.0%. Blood group O was the most common type among the obese individuals (44.7%), followed by A, B, and AB groups (30, 20, and 5.3%, respectively). BMI was highest (28.8±9.2) in blood group O. There were no statistically significant differences between different ABO blood groups as regards BMI, Rh, and sex. Moreover, there was no statistically significant difference between Rh type and BMI. The prevalence of obesity and overweight is high in the population attending PHC centers of Arar city, Northern Saudi Arabia. There is no association between overweight, obesity, and ABO blood groups or Rh.

  18. Comparison of Selected Protein Levels in Tumour and Surgical Margin in a Group of Patients with Oral Cavity Cancer.

    Science.gov (United States)

    Strzelczyk, Joanna Katarzyna; Gołąbek, Karolina; Cuber, Piotr; Krakowczyk, Łukasz; Owczarek, Aleksander Jerzy; Fronczek, Martyna; Choręża, Piotr; Hudziec, Edyta; Ostrowska, Zofia

    2017-08-01

    Oral cavity cancer belongs to head-and-neck squamous cell carcinoma group. The purpose of the study was to assess the levels of certain proteins in a tumour and surgical margin in a group of patients with oral cavity cancer. The levels of DAPK1, MGMT, CDH1, SFRP1, SFRP2, RORA, TIMP3, p16, APC and RASSF1 proteins were measured by ELISA in tissue homogenates. The protein levels of DAPK1, MGMT, CDH1, SFRP2 and RASSF1 were significantly higher in tumour tissue than in the margin, contrary to TIMP3 which was lower in the tumour itself. DAPK1 level in the tumour was significantly higher in females than in males, the MGMT and p16 levels were lower in the tumours with lymph node metastasis (N1 + N2) than in N0 samples. The CDH1 expression was higher in a group with smoking habits, whereas TIMP3 was lower in this group. Changes in the levels of proteins in tumour and surgical margin may be either reflective of tumour occurrence and development, or they might be also responsible for the progress and reoccurrence of the disease. Levels of the studied proteins might be good prognostic factors; however, further studies are required.

  19. Genetic Influences on Growth Traits of BMI

    DEFF Research Database (Denmark)

    Hjelmborg, Jacob V B; Fagnani, Corrado; Silventoinen, Karri

    2008-01-01

    Objective:To investigate the interplay between genetic factors influencing baseline level and changes in BMI in adulthood.Methods and Procedures:A longitudinal twin study of the cohort of Finnish twins (N = 10,556 twin individuals) aged 20-46 years at baseline was conducted and followed up 15 years....... Data on weight and height were obtained from mailed surveys in 1975, 1981, and 1990.Results:Latent growth models revealed a substantial genetic influence on BMI level at baseline in males and females (heritability (h(2)) 80% (95% confidence interval 0.79-0.80) for males and h(2) = 82% (0.81, 0.......84) for females) and a moderate-to-high influence on rate of change in BMI (h(2) = 58% (0.50, 0.69) for males and h(2) = 64% (0.58, 0.69) for females). Only very weak evidence for genetic pleiotropy was observed; the genetic correlation between baseline and rate of change in BMI was very modest (-0.070 (-0.13, -0...

  20. Representativeness and optimal use of body mass index (BMI) in the UK Clinical Practice Research Datalink (CPRD)

    Science.gov (United States)

    Bhaskaran, Krishnan; Forbes, Harriet J; Douglas, Ian; Leon, David A; Smeeth, Liam

    2013-01-01

    Objectives To assess the completeness and representativeness of body mass index (BMI) data in the Clinical Practice Research Datalink (CPRD), and determine an optimal strategy for their use. Design Descriptive study. Setting Electronic healthcare records from primary care. Participants A million patient random sample from the UK CPRD primary care database, aged ≥16 years. Primary and secondary outcome measures BMI completeness in CPRD was evaluated by age, sex and calendar period. CPRD-based summary BMI statistics for each calendar year (2003–2010) were age-standardised and sex-standardised and compared with equivalent statistics from the Health Survey for England (HSE). Results BMI completeness increased over calendar time from 37% in 1990–1994 to 77% in 2005–2011, was higher among females and increased with age. When BMI at specific time points was assigned based on the most recent record, calendar–year-specific mean BMI statistics underestimated equivalent HSE statistics by 0.75–1.1 kg/m2. Restriction to those with a recent (≤3 years) BMI resulted in mean BMI estimates closer to HSE (≤0.28 kg/m2 underestimation), but excluded up to 47% of patients. An alternative strategy of imputing up-to-date BMI based on modelled changes in BMI over time since the last available record also led to mean BMI estimates that were close to HSE (≤0.37 kg/m2 underestimation). Conclusions Completeness of BMI in CPRD increased over time and varied by age and sex. At a given point in time, a large proportion of the most recent BMIs are unlikely to reflect current BMI; consequent BMI misclassification might be reduced by employing model-based imputation of current BMI. PMID:24038008

  1. Viewing as little as 1 hour of TV daily is associated with higher change in BMI between kindergarten and first grade.

    Science.gov (United States)

    Peck, Travis; Scharf, Rebecca J; Conaway, Mark R; DeBoer, Mark D

    2015-08-01

    Evaluate associations between TV viewing and weight status in children from kindergarten to first grade. Linear and logistic regression was used to evaluate associations of TV-viewing time on BMI-z-score cross-sectionally at kindergarten and first grade and longitudinally in between, among a nationally representative sample of 14,645 children from the Early Childhood Longitudinal Study-Kindergarten Cohort 2011. All analyses were adjusted for sex, race/ethnicity, parental education, and household income. Weekday TV-viewing time was correlated with BMI-z-score (P TV daily, children watching ≥1 h in kindergarten and first grade had a greater odds of overweight (1.50-1.60) and obesity (1.58-1.73). Children watching 1-TV had a greater odds of becoming overweight (1.39) and obese (1.86) between evaluations. Children watching as little as 1-TV daily were more likely to become overweight and obese over time. Physicians should encourage families to restrict TV-viewing time to reduce weight gain. © 2015 The Obesity Society.

  2. Polycomb group protein bodybuilding: working out the routines.

    Science.gov (United States)

    Sievers, Cem; Paro, Renato

    2013-09-30

    Polycomb group (PcG) proteins regulate gene expression by modifying chemical and structural properties of chromatin. Isono et al. (2013) now report in Developmental Cell a polymerization-dependent mechanism used by PcG proteins to form higher-order chromatin structures, referred to as Polycomb bodies, and demonstrate its necessity for gene silencing. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Desirable factors for maintaining normal BMI of urban affluent women of Delhi.

    Science.gov (United States)

    Gupta, Anu Taneja; Siddhu, Anupa

    2015-01-01

    The study aimed to identify desirable social, familial, reproductive, dietary, and lifestyle factors for maintaining normal body mass index (BMI) of urban affluent women (25-45 years) in Delhi, India. A total of 387 urban affluent women with at least one living child participated in this cross-sectional study conducted from March 2008 to April 2010. Women were classified into four BMI categories on the basis of World Health Organization (WHO; 2004) classification for Asians. Significant factors for maintaining normal BMI were: Younger age, less parity, nuclear family, normal weight status of parents, postpartum weight gain between 2 and 3 kg, regularity in taking meals, fixed meal size, self-perceived normal weight, and shorter sitting time and television viewing time. Multivariate regression analysis identified five determining factors for maintaining BMI, which are normal weight of father, self-perceived normal weight, fixed meal size, sitting time less than 6 h/day, and television viewing time less than 1 h/day. By small lifestyle modifications, normal BMI can be maintained.

  4. Circular dichroism and fluorescence spectroscopy of cysteinyl-tRNA synthetase from Halobacterium salinarum ssp. NRC-1 demonstrates that group I cations are particularly effective in providing structure and stability to this halophilic protein.

    Directory of Open Access Journals (Sweden)

    Christopher J Reed

    Full Text Available Proteins from extremophiles have the ability to fold and remain stable in their extreme environment. Here, we investigate the presence of this effect in the cysteinyl-tRNA synthetase from Halobacterium salinarum ssp. NRC-1 (NRC-1, which was used as a model halophilic protein. The effects of salt on the structure and stability of NRC-1 and of E. coli CysRS were investigated through far-UV circular dichroism (CD spectroscopy, fluorescence spectroscopy, and thermal denaturation melts. The CD of NRC-1 CysRS was examined in different group I and group II chloride salts to examine the effects of the metal ions. Potassium was observed to have the strongest effect on NRC-1 CysRS structure, with the other group I salts having reduced strength. The group II salts had little effect on the protein. This suggests that the halophilic adaptations in this protein are mediated by potassium. CD and fluorescence spectra showed structural changes taking place in NRC-1 CysRS over the concentration range of 0-3 M KCl, while the structure of E. coli CysRS was relatively unaffected. Salt was also shown to increase the thermal stability of NRC-1 CysRS since the melt temperature of the CysRS from NRC-1 was increased in the presence of high salt, whereas the E. coli enzyme showed a decrease. By characterizing these interactions, this study not only explains the stability of halophilic proteins in extremes of salt, but also helps us to understand why and how group I salts stabilize proteins in general.

  5. Improved labeling strategy for 13C relaxation measurements of methyl groups in proteins

    International Nuclear Information System (INIS)

    Lee, Andrew L.; Urbauer, Jeffrey L.; Wand, A. Joshua

    1997-01-01

    Selective incorporation of 13 C into the methyl groups of protein side chains is described as a means for simplifying the measurement and interpretation of 13 C relaxation parameters.High incorporation (>90%) is accomplished by using pyruvate(3- 13 C, 99%) as the sole carbon source in the growth media for protein overexpression in E. coli. This improved labeling scheme increases the sensitivity of the relaxation experiments by approximately fivefold when compared to randomly fractionally 13 C-labeled protein, allowing high-quality measurements on relatively dilute (<1 mM)protein samples at a relatively low cost

  6. Diagnostic performance of BMI percentiles to identify adolescents with metabolic syndrome.

    Science.gov (United States)

    Laurson, Kelly R; Welk, Gregory J; Eisenmann, Joey C

    2014-02-01

    To compare the diagnostic performance of the Centers for Disease Control and Prevention (CDC) and FITNESSGRAM (FGram) BMI standards for quantifying metabolic risk in youth. Adolescents in the NHANES (n = 3385) were measured for anthropometric variables and metabolic risk factors. BMI percentiles were calculated, and youth were categorized by weight status (using CDC and FGram thresholds). Participants were also categorized by presence or absence of metabolic syndrome. The CDC and FGram standards were compared by prevalence of metabolic abnormalities, various diagnostic criteria, and odds of metabolic syndrome. Receiver operating characteristic curves were also created to identify optimal BMI percentiles to detect metabolic syndrome. The prevalence of metabolic syndrome in obese youth was 19% to 35%, compared with <2% in the normal-weight groups. The odds of metabolic syndrome for obese boys and girls were 46 to 67 and 19 to 22 times greater, respectively, than for normal-weight youth. The receiver operating characteristic analyses identified optimal thresholds similar to the CDC standards for boys and the FGram standards for girls. Overall, BMI thresholds were more strongly associated with metabolic syndrome in boys than in girls. Both the CDC and FGram standards are predictive of metabolic syndrome. The diagnostic utility of the CDC thresholds outperformed the FGram values for boys, whereas FGram standards were slightly better thresholds for girls. The use of a common set of thresholds for school and clinical applications would provide advantages for public health and clinical research and practice.

  7. High mobility group box-1 is phosphorylated by protein kinase C zeta and secreted in colon cancer cells

    International Nuclear Information System (INIS)

    Lee, Hanna; Park, Minhee; Shin, Nara; Kim, Gamin; Kim, Yun Gi; Shin, Jeon-Soo; Kim, Hoguen

    2012-01-01

    Highlights: ► Specific enzyme for HMGB1 phosphorylation and its secretion is proposed. ► Inhibition of PKC-ζ leads to significant reduction of the secreted HMGB1. ► Phosphorylation of specific site of HMGB1 redirects its secretion in cancer cells. ► Activation of PKC-ζ in cancers explains the enhanced HMGB1 secretion. -- Abstract: High mobility group box-1 (HMGB1), a nuclear protein, is overexpressed and secreted in cancer cells. Phosphorylation on two different nuclear localization signal regions are known to be important for the nuclear-to-cytoplasmic transport and secretion of HMGB1. However, little is known about the biochemical mechanism of HMGB1 modifications and its subsequent secretion from cancer cells. To identify the specific enzyme and important sites for HMGB1 phosphorylation, we screened the protein kinase C (PKC) family in a colon cancer cell line (HCT116) for HMGB1 binding by pull-down experiments using a 3XFLAG-HMGB1 construct. Strong interactions between atypical PKCs (PKC-ζ, λ, and ι) and cytoplasmic HMGB1 were observed in HCT116 cells. We further identified the most critical PKC isotype that regulates HMGB1 secretion is PKC-ζ by using PKC inhibitors and siRNA experiments. The serine residues at S39, S53 and S181 of HMGB1 were related to enhancing HMGB1 secretion. We also demonstrated overexpression and activation of PKC-ζ in colon cancer tissues. Our findings suggest that PKC-ζ is involved in the phosphorylation of HMGB1, and the phosphorylation of specific serine residues in the nuclear localization signal regions is related to enhanced HMGB1 secretion in colon cancer cells.

  8. Infant BMI peak as a predictor of overweight and obesity at age 2 years in a Chinese community-based cohort

    Science.gov (United States)

    Sun, Jie; Nwaru, Bright I; Hua, Jing; Li, Xiaohong; Wu, Zhuochun

    2017-01-01

    Objectives Infant body mass index (BMI) peak has proven to be a useful indicator for predicting childhood obesity risk in American and European populations. However, it has not been assessed in China. We characterised infant BMI trajectories in a Chinese longitudinal cohort and evaluated whether BMI peak can predict overweight and obesity at age 2 years. Methods Serial measurements (n=6–12) of weight and length were taken from healthy term infants (n=2073) in a birth cohort established in urban Shanghai. Measurements were used to estimate BMI growth curves from birth to 13.5 months using a polynomial regression model. BMI peak characteristics, including age (in months) and magnitude (BMI, in kg/m2) at peak and prepeak velocities (in kg/m2/month), were estimated. The relationship between infant BMI peak and childhood BMI at age 2 years was examined using binary logistic analysis. Results Mean age at peak BMI was 7.61 months, with a magnitude of 18.33 kg/m2. Boys (n=1022) had a higher average peak BMI (18.60 vs 18.07 kg/m2, pBMI and 1 month increase in peak time, the risk of overweight at age 2 years increased by 2.11 times (OR 3.11; 95% CI 2.64 to 3.66) and 35% (OR 1.35; 95% CI 1.21 to 1.50), respectively. Similarly, higher BMI magnitude (OR 2.69; 95% CI 2.00 to 3.61) and later timing of infant BMI peak (OR 1.35; 95% CI 1.08 to 1.68) were associated with an increased risk of childhood obesity at age 2 years. Conclusions We have shown that infant BMI peak is valuable for predicting early childhood overweight and obesity in urban Shanghai. Because this is the first Chinese community-based cohort study of this nature, future research is required to examine infant populations in other areas of China. PMID:28988164

  9. No evidence that protein truncating variants in BRIP1 are associated with breast cancer risk

    DEFF Research Database (Denmark)

    Easton, Douglas F; Lesueur, Fabienne; Decker, Brennan

    2016-01-01

    BACKGROUND: BRCA1 interacting protein C-terminal helicase 1 (BRIP1) is one of the Fanconi Anaemia Complementation (FANC) group family of DNA repair proteins. Biallelic mutations in BRIP1 are responsible for FANC group J, and previous studies have also suggested that rare protein truncating variants...

  10. Associations Between Parental BMI and the Family Nutrition and Physical Activity Environment in a Community Sample.

    Science.gov (United States)

    Williams, Joel E; Helsel, Brian; Griffin, Sarah F; Liang, Jessica

    2017-12-01

    The purpose of this study was to examine the relationship between parental BMI and the family environment and determine if differences exist in child diet and physical activity related parenting behaviors by parental BMI in a community sample of families recruited through elementary schools in a local school district. We found an association between parental BMI category and family nutrition and physical activity (FNPA) score. Families with an underweight or normal weight parent had a larger proportion (64.3%) of high (indicating a healthier family environment) FNPA scores and families with an overweight or obese parent had a smaller proportion (45.2%) of high FNPA scores (χ 2  = 5.247, P = 0.022). Families with a parent who was overweight or obese had 2.18 times the odds (95% CI 1.11-4.27) of being in the low FNPA ("less healthy" environment) group. Further, underweight/normal weight parents reported higher levels of monitoring of child diet (Z = -3.652, P authoritative parenting behaviors were associated with a less obesogenic home environment and a positive parenting style related to child eating and physical activity behaviors.

  11. Genome-wide association study for the interaction between BMR and BMI in obese Korean women including overweight.

    Science.gov (United States)

    Lee, Myoungsook; Kwon, Dae Young; Kim, Myung-Sunny; Choi, Chong Ran; Park, Mi-Young; Kim, Ae-Jung

    2016-02-01

    This is the first study to identify common genetic factors associated with the basal metabolic rate (BMR) and body mass index (BMI) in obese Korean women including overweight. This will be a basic study for future research of obese gene-BMR interaction. The experimental design was 2 by 2 with variables of BMR and BMI. A genome-wide association study (GWAS) of single nucleotide polymorphisms (SNPs) was conducted in the overweight and obesity (BMI > 23 kg/m(2)) compared to the normality, and in women with low BMR (BMR. A total of 140 SNPs reached formal genome-wide statistical significance in this study (P BMR (rs10786764; P = 8.0 × 10(-7), rs1040675; 2.3 × 10(-6)) and BMI (rs10786764; P = 2.5 × 10(-5), rs10786764; 6.57 × 10(-5)). The other genes related to BMI (HSD52, TMA16, MARCH1, NRG1, NRXN3, and STK4) yielded P BMR and BMI, including NRG3, OR8U8, BCL2L2-PABPN1, PABPN1, and SLC22A17 were identified in obese Korean women (P BMR- and BMI-related genes using GWAS. Although most of these newly established loci were not previously associated with obesity, they may provide new insights into body weight regulation. Our findings of five common genes associated with BMR and BMI in Koreans will serve as a reference for replication and validation of future studies on the metabolic rate.

  12. Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation

    DEFF Research Database (Denmark)

    Sharp, Gemma C; Salas, Lucas A; Monnereau, Claire

    2017-01-01

    -analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1......,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (.... Adjustment for estimated cell proportions greatly attenuated the number of significant CpGs to 104, including 86 sites common to the unadjusted model. At 72/86 sites, the direction of the association was the same in newborns and adolescents, suggesting persistence of signals. However, we found evidence...

  13. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    International Nuclear Information System (INIS)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan

    2016-01-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  14. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com

    2016-08-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  15. BMI changes in children and adolescents attending a specialized childhood obesity center: a cohort study

    OpenAIRE

    Maggio, Albane BR; Saunders Gasser, Catherine; Gal-Duding, Claudine; Beghetti, Maurice; Martin, Xavier E; Farpour-Lambert, Nathalie J; Chamay-Weber, Catherine

    2013-01-01

    Background Multidisciplinary group therapies for obese children and adolescents are effective but difficult to implement. There is a crucial need to evaluate simpler management programs that target the obese child and his family. This study aimed to determine changes in body mass indexes (BMI) after individual family-based obesity intervention with a pediatrician in a specialized obesity center for child and adolescent. Methods This cohort study included 283 patients (3.3 to 17.1 years, mean ...

  16. Socioeconomic gradients in body mass index (BMI) in US immigrants during the transition to adulthood: examining the roles of parental education and intergenerational educational mobility.

    Science.gov (United States)

    Albrecht, Sandra S; Gordon-Larsen, Penny

    2014-09-01

    Despite comparatively lower socioeconomic status (SES), immigrants tend to have lower body weight and weaker SES gradients relative to US-born individuals. Yet, it is unknown how changes in SES over the life-course relate to body weight in immigrants versus US-born individuals. We used longitudinal data from a nationally representative, diverse sample of 13 701 adolescents followed into adulthood to investigate whether associations between SES mobility categories (educational attainment reported by individuals as adults and by their parents during adolescence) and body mass index (BMI) measured in adulthood varied by immigrant generation. Weighted multivariable linear regression models were adjusted for age, sex, race/ethnicity and immigrant generation. Among first-generation immigrants, although parental education was not associated with adult BMI, an immigrant's own education attainment was inversely associated with BMI (β=-2.6 kg/m(2); SE=0.9, peducational mobility was associated with lower adult mean BMI than remaining low SES (β=-2.5 kg/m(2); SE=1.2, pUS-born respondents, college education in adulthood did not attenuate the negative association between parental education and adult BMI. Although an SES gradient emerged in adulthood for immigrants, remaining low SES from adolescence to adulthood was not associated with loss of health advantage relative to US-born respondents of US-born parents of similar SES. Immigrants were able to translate higher SES in adulthood into a lower adult mean BMI regardless of childhood SES, whereas the consequences of lower childhood SES had a longer reach even among the upwardly mobile US born. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  17. Trends in BMI of urban Australian adults, 1980-2000

    DEFF Research Database (Denmark)

    Walls, Helen L; Wolfe, Rory; Haby, Michelle M

    2010-01-01

    of 7.4 kg/m2 at the higher end for women aged 55-64 years. While the prevalence of obesity (BMI >or= 30 kg/m2) doubled, the prevalence of obesity class III (BMI >or= 40 kg/m2) increased fourfold. CONCLUSIONS: BMI in urban Australian adults has increased and its distribution has become increasingly...... right-skewed. This has resulted in a large increase in the prevalence of obesity, particularly the more severe levels of obesity. It will be important to monitor changes in the different classes of obesity and the extent to which obesity interventions both shift the BMI distribution leftwards...

  18. Proteomic analysis of membrane microdomain-associated proteins in the dorsolateral prefrontal cortex in schizophrenia and bipolar disorder reveals alterations in LAMP, STXBP1 and BASP1 protein expression.

    LENUS (Irish Health Repository)

    Behan, A T

    2009-06-01

    The dorsolateral prefrontal cortex (dlpfc) is strongly implicated in the pathogenesis of schizophrenia (SCZ) and bipolar disorder (BPD) and, within this region, abnormalities in glutamatergic neurotransmission and synaptic function have been described. Proteins associated with these functions are enriched in membrane microdomains (MM). In the current study, we used two complementary proteomic methods, two-dimensional difference gel electrophoresis and one-dimensional sodium dodecyl sulphate polyacrylamide gel electrophoresis followed by reverse phase-liquid chromatography-tandem mass spectrometry (RP-LC-MS\\/MS) (gel separation liquid chromatography-tandem mass spectrometry (GeLC-MS\\/MS)) to assess protein expression in MM in pooled samples of dlpfc from SCZ, BPD and control cases (n=10 per group) from the Stanley Foundation Brain series. We identified 16 proteins altered in one\\/both disorders using proteomic methods. We selected three proteins with roles in synaptic function (syntaxin-binding protein 1 (STXBP1), brain abundant membrane-attached signal protein 1 (BASP1) and limbic system-associated membrane protein (LAMP)) for validation by western blotting. This revealed significantly increased expression of these proteins in SCZ (STXBP1 (24% difference; P<0.001), BASP1 (40% difference; P<0.05) and LAMP (22% difference; P<0.01)) and BPD (STXBP1 (31% difference; P<0.001), BASP1 (23% difference; P<0.01) and LAMP (20% difference; P<0.01)) in the Stanley brain series (n=20 per group). Further validation in dlpfc from the Harvard brain subseries (n=10 per group) confirmed increased protein expression in SCZ of STXBP1 (18% difference; P<0.0001), BASP1 (14% difference; P<0.0001) but not LAMP (20% difference; P=0.14). No significant differences in STXBP1, BASP1 or LAMP protein expression in BPD dlpfc were observed. This study, through proteomic assessments of MM in dlpfc and validation in two brain series, strongly implicates LAMP, STXBP1 and BASP1 in SCZ and supports

  19. Body Mass Index (BMI) Trajectories in Infancy Differ by Population Ancestry and May Presage Disparities in Early Childhood Obesity

    Science.gov (United States)

    Roy, Sani M.; Chesi, Alessandra; Mentch, Frank; Xiao, Rui; Chiavacci, Rosetta; Mitchell, Jonathan A.; Kelly, Andrea; Hakonarson, Hakon; Grant, Struan F.A.; Zemel, Babette S.

    2015-01-01

    Context: No consensus definition exists for excess adiposity during infancy. After age 2 years, high body mass index (BMI) is related to adverse cardiometabolic outcomes. Before age 2 years, the utility of BMI as a metric of excess adiposity is unknown. Objectives: The objective of the study was to characterize infant BMI trajectories in a diverse, longitudinal cohort and investigate the relationship between the infancy BMI trajectory and childhood obesity. Subjects: Healthy, nonpreterm infants (n = 2114) in the Genetic Causes for Complex Pediatric Disorders study (The Children's Hospital of Philadelphia) with six or more BMI measurements in the first 13.5 months participated in the study. Design: For each infant, the BMI trajectory was modeled using polynomial regression. Independent effects of clinical factors on magnitude and timing of peak BMI were assessed. The relationship between infancy BMI and early childhood BMI (age 4 y) was examined (n = 1075). Results: The cohort was 53% male and 61% African-American. Peak BMI was 18.6 ± 1.7 kg/m2 and occurred at 8.6 ± 1.4 months. In multivariate analysis, boys had a higher (0.50 kg/m2, P BMI than girls. The peak was higher (0.53 kg/m2, P ≤ .001) and occurred earlier (by 12 d, P BMI. Conclusions: We demonstrate sex- and ancestry-specific differences in infancy BMI and an association of infancy peak BMI with childhood BMI. These findings support the potential utility of infancy BMI to identify children younger than age 2 years with increased risk for later obesity. PMID:25636051

  20. Evaluation of Serum Levels of Pregnancy Associated Plasma Protein-A, Tumor Necrosis Factor-alpha and Highly Sensitive C-Reactive Protein in Diabetic Children

    International Nuclear Information System (INIS)

    Abdel-Messeih, PH.L.; El-safie, A.I.; Said, A.I.

    2011-01-01

    Recent evidence favours the primary role of cellular auto immunity and its humoral mediators in the pathogenesis and follow up of children with type 1 diabetes mellitus (type 1 DM). The present study is carried out to investigate serum levels of pregnancy associated plasma protein-A (PAPP-A), tumor necrosis factor-alpha (TNF-alpha ) and highly sensitive C-reactive protein (hs-CRP) in children with type 1 DM. Potential role of body mass index (BMI) was evaluated. Circulating levels of TNF-alpha, PAPP-A and hs-CRP are significantly increased in children with type 1 DM as compared with healthy subjects suggesting activation of inflammatory immune response system. A significant negative correlation was obtained between TNF-alpha and BMI in diabetic patients. This is highly suggestive of the availability of these non invasive indices to help further examining type 1 DM pathophysiology and monitoring pharmacological interventions to interfere with disease development and progression.

  1. Growth Patterns in the Irish Pyridoxine Nonresponsive Homocystinuria Population and the Influence of Metabolic Control and Protein Intake

    Directory of Open Access Journals (Sweden)

    Orla Purcell

    2017-01-01

    Full Text Available A low methionine diet is the mainstay of treatment for pyridoxine nonresponsive homocystinuria (HCU. There are various guidelines for recommended protein intakes for HCU and clinical practice varies. Poor growth has been associated with low cystine levels. This retrospective review of 48 Irish pyridoxine nonresponsive HCU patients assessed weight, height, body mass index (BMI, protein intake, and metabolic control up to 18 years at nine set time points. Patients diagnosed through newborn screening (NBS were compared to late diagnosed (LD patients. At 18 years the LD group (n=12, mean age at diagnosis 5.09 years were heavier (estimated effect +4.97 Kg, P=0.0058 and taller (estimated effect +7.97 cm P=0.0204 than the NBS group (n=36. There was no difference in growth rate between the groups after 10 years of age. The HCU population were heavier and taller than the general population by one standard deviation with no difference in BMI. There was no association between intermittently low cystine levels and height. Three protein intake guidelines were compared; there was no difference in adult height between those who met the lowest of the guidelines (Genetic Metabolic Dietitians International and those with a higher protein intake.

  2. Growth Patterns in the Irish Pyridoxine Nonresponsive Homocystinuria Population and the Influence of Metabolic Control and Protein Intake.

    Science.gov (United States)

    Purcell, Orla; Coughlan, Aoife; Grant, Tim; McNulty, Jenny; Clark, Anne; Deverell, Deirdre; Mayne, Philip; Hughes, Joanne; Monavari, Ahmad; Knerr, Ina; Crushell, Ellen

    2017-01-01

    A low methionine diet is the mainstay of treatment for pyridoxine nonresponsive homocystinuria (HCU). There are various guidelines for recommended protein intakes for HCU and clinical practice varies. Poor growth has been associated with low cystine levels. This retrospective review of 48 Irish pyridoxine nonresponsive HCU patients assessed weight, height, body mass index (BMI), protein intake, and metabolic control up to 18 years at nine set time points. Patients diagnosed through newborn screening (NBS) were compared to late diagnosed (LD) patients. At 18 years the LD group ( n = 12, mean age at diagnosis 5.09 years) were heavier (estimated effect +4.97 Kg, P = 0.0058) and taller (estimated effect +7.97 cm P = 0.0204) than the NBS group ( n = 36). There was no difference in growth rate between the groups after 10 years of age. The HCU population were heavier and taller than the general population by one standard deviation with no difference in BMI. There was no association between intermittently low cystine levels and height. Three protein intake guidelines were compared; there was no difference in adult height between those who met the lowest of the guidelines (Genetic Metabolic Dietitians International) and those with a higher protein intake.

  3. Vagal modulation of high mobility group box-1 protein mediates electroacupuncture-induced cardioprotection in ischemia-reperfusion injury.

    Science.gov (United States)

    Zhang, Juan; Yong, Yue; Li, Xing; Hu, Yu; Wang, Jian; Wang, Yong-qiang; Song, Wei; Chen, Wen-ting; Xie, Jian; Chen, Xue-mei; Lv, Xin; Hou, Li-li; Wang, Ke; Zhou, Jia; Wang, Xiang-rui; Song, Jian-gang

    2015-10-26

    Excessive release of high mobility group box-1 (HMGB1) protein from ischemic cardiomyocytes activates inflammatory cascades and enhances myocardial injury after reperfusion. Here we report evidence that electroacupuncture of mice at Neiguan acupoints can inhibit the up-regulation of cardiac HMGB1 following myocardial ischemia and attenuate the associated inflammatory responses and myocardial injury during reperfusion. These benefits of electroacupuncture were partially reversed by administering recombinant HMGB1 to the mice, and further potentiated by administering anti-HMGB1 antibody. Electroacupuncture-induced inhibition of HMGB1 release was markedly reduced by unilateral vagotomy or administration of nicotinic receptor antagonist, but not by chemical sympathectomy. The cholinesterase inhibitor neostigmine mimicked the effects of electroacupuncture on HMGB1 release and myocardial ischemia reperfusion injury. Culture experiments with isolated neonatal cardiomyocytes showed that acetylcholine, but not noradrenaline, inhibited hypoxia-induced release of HMGB1 via a α7nAchR-dependent pathway. These results suggest that electroacupuncture acts via the vagal nerve and its nicotinic receptor-mediated signaling to inhibit HMGB1 release from ischemic cardiomyocytes. This helps attenuate pro-inflammatory responses and myocardial injury during reperfusion.

  4. The decline in BMI among Japanese women after World War II.

    Science.gov (United States)

    Maruyama, Shiko; Nakamura, Sayaka

    2015-07-01

    The body mass index (BMI) of the Japanese is significantly lower than is found in other high-income countries. Moreover, the average BMI of Japanese women is lower than that of Japanese men, and the age-specific BMI of Japanese women has decreased over time. The average BMI of Japanese women at age 25 decreased from 21.8 in 1948 to 20.4 in 2010 whereas that of men increased from 21.4 to 22.3 over the same period. We examine the long-term BMI trend in Japan by combining several historical data sources spanning eleven decades, from 1901 to 2012, to determine not only when but also how the BMI decline among women began: whether its inception was period-specific or cohort-specific. Our nonparametric regression analysis generated five findings. First, the BMI of Japanese women peaked with the 1930s birth cohort. This means that the trend is cohort-specific. Second, the BMI of men outpaced that of women in the next cohort. Third, the BMI of Japanese children, boys and girls alike, increased steadily throughout the 20th century. Fourth, the gender difference in the BMI trend is due to a gender difference in the weight trend, not the height trend. Fifth, these BMI trends are observed in urban and rural populations alike. We conclude that the BMI decline among Japanese women began with those who were in their late teens shortly after World War II. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Social disparities in BMI trajectories across adulthood by gender, race/ethnicity and lifetime socio-economic position: 1986-2004.

    Science.gov (United States)

    Clarke, Philippa; O'Malley, Patrick M; Johnston, Lloyd D; Schulenberg, John E

    2009-04-01

    The prevalence of obesity and overweight is rapidly increasing in industrialized countries, with long-term health and social consequences. There is also a strong social patterning of obesity and overweight, with a higher prevalence among women, racial/ethnic minorities and those from a lower socio-economic position (SEP). Most of the existing work in this area, however, is based on cross-sectional data or single cohort studies. No national studies to date have examined how social disparities in obesity and overweight differ by age and historical period using longitudinal data with repeated measures. We used panel data from the nationally representative Monitoring the Future Study (1986-2004) to examine social disparities in trajectories of body mass index (BMI) over adulthood (age 18-45). Self-reported height and weight were collected in this annual US survey of high-school seniors, followed biennially since 1976. Using growth curve models, we analysed BMI trajectories over adulthood by gender, race/ethnicity and lifetime SEP (measured by parents' education and respondent's education). BMI trajectories exhibit a curvilinear rate of change from age 18 to 45, but there was a strong period effect, such that weight gain was more rapid for more recent cohorts. As a result, successive cohorts become overweight (BMI>25) at increasingly earlier points in the life course. BMI scores were also consistently higher for women, racial/ethnic minority groups and those from a lower SEP. However, BMI scores for socially advantaged groups in recent cohorts were actually higher than those for their socially disadvantaged counterparts who were born 10 years earlier. Results highlight the importance of social status and socio-economic resources for maintaining optimal weight. Yet, even those in advantaged social positions have experienced an increase in BMI in recent years.

  6. High mobility group box-1 is phosphorylated by protein kinase C zeta and secreted in colon cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hanna; Park, Minhee; Shin, Nara; Kim, Gamin [Department of Pathology, Yonsei University College of Medicine, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul (Korea, Republic of); Brain Korea 21 Project for Medical Sciences, Yonsei University College of Medicine, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul (Korea, Republic of); Kim, Yun Gi [Department of Internal Medicine, Seoul National University College of Medicine, 28 Yongon-dong, Chongno-gu, Seoul 110-744 (Korea, Republic of); Shin, Jeon-Soo [Department of Microbiology, Yonsei University College of Medicine, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul (Korea, Republic of); Kim, Hoguen, E-mail: hkyonsei@yuhs.ac [Department of Pathology, Yonsei University College of Medicine, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul (Korea, Republic of); Brain Korea 21 Project for Medical Sciences, Yonsei University College of Medicine, 134 Shinchon-Dong, Seodaemoon-Ku, Seoul (Korea, Republic of)

    2012-07-27

    Highlights: Black-Right-Pointing-Pointer Specific enzyme for HMGB1 phosphorylation and its secretion is proposed. Black-Right-Pointing-Pointer Inhibition of PKC-{zeta} leads to significant reduction of the secreted HMGB1. Black-Right-Pointing-Pointer Phosphorylation of specific site of HMGB1 redirects its secretion in cancer cells. Black-Right-Pointing-Pointer Activation of PKC-{zeta} in cancers explains the enhanced HMGB1 secretion. -- Abstract: High mobility group box-1 (HMGB1), a nuclear protein, is overexpressed and secreted in cancer cells. Phosphorylation on two different nuclear localization signal regions are known to be important for the nuclear-to-cytoplasmic transport and secretion of HMGB1. However, little is known about the biochemical mechanism of HMGB1 modifications and its subsequent secretion from cancer cells. To identify the specific enzyme and important sites for HMGB1 phosphorylation, we screened the protein kinase C (PKC) family in a colon cancer cell line (HCT116) for HMGB1 binding by pull-down experiments using a 3XFLAG-HMGB1 construct. Strong interactions between atypical PKCs (PKC-{zeta}, {lambda}, and {iota}) and cytoplasmic HMGB1 were observed in HCT116 cells. We further identified the most critical PKC isotype that regulates HMGB1 secretion is PKC-{zeta} by using PKC inhibitors and siRNA experiments. The serine residues at S39, S53 and S181 of HMGB1 were related to enhancing HMGB1 secretion. We also demonstrated overexpression and activation of PKC-{zeta} in colon cancer tissues. Our findings suggest that PKC-{zeta} is involved in the phosphorylation of HMGB1, and the phosphorylation of specific serine residues in the nuclear localization signal regions is related to enhanced HMGB1 secretion in colon cancer cells.

  7. MicroRNA 128a increases intracellular ROS level by targeting Bmi-1 and inhibits medulloblastoma cancer cell growth by promoting senescence.

    Directory of Open Access Journals (Sweden)

    Sujatha Venkataraman

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are a class of short non-coding RNAs that regulate cell homeostasis by inhibiting translation or degrading mRNA of target genes, and thereby can act as tumor suppressor genes or oncogenes. The role of microRNAs in medulloblastoma has only recently been addressed. We hypothesized that microRNAs differentially expressed during normal CNS development might be abnormally regulated in medulloblastoma and are functionally important for medulloblastoma cell growth. METHODOLOGY AND PRINCIPAL FINDINGS: We examined the expression of microRNAs in medulloblastoma and then investigated the functional role of one specific one, miR-128a, in regulating medulloblastoma cell growth. We found that many microRNAs associated with normal neuronal differentiation are significantly down regulated in medulloblastoma. One of these, miR-128a, inhibits growth of medulloblastoma cells by targeting the Bmi-1 oncogene. In addition, miR-128a alters the intracellular redox state of the tumor cells and promotes cellular senescence. CONCLUSIONS AND SIGNIFICANCE: Here we report the novel regulation of reactive oxygen species (ROS by microRNA 128a via the specific inhibition of the Bmi-1 oncogene. We demonstrate that miR-128a has growth suppressive activity in medulloblastoma and that this activity is partially mediated by targeting Bmi-1. This data has implications for the modulation of redox states in cancer stem cells, which are thought to be resistant to therapy due to their low ROS states.

  8. Plasma progranulin and relaxin levels in PCOS women with normal BMI compared to control healthy subjects

    Directory of Open Access Journals (Sweden)

    Samad Akbarzadeh

    2013-09-01

    Full Text Available Background: Poly Cystic Ovary Syndrome (PCOS is the most commonly encountered endocrine gland disease affecting 5-10 present of women at their reproductive age. This syndrome is associated with type 2 diabetes, dyslipidemia, and obesity. Progranulin and relaxin are adipokins that are related with carbohydrate and lipid metabolism. Due to limited data about progranulin and relaxin plasma levels´ in women with PCOS and normal BMI, this study was conducted. Material and Methods: This study is a cross-sectional. During the study 39 women with PCOS and BMI< 25 on the basis of Rotterdam criteria were chosen as the patient group and 38 healthy women were selected as the control group. The concentration of progranulin and relaxin were measured by ELISA technique. Results: The difference in Plasma concentration of progranulin and relaxin, and also some of the biochemical parameters in the patient group versus to the control group was not significant, but there was significant difference in the concentrations of VLDL, triglyceride (p=0.046, insulin (p=0.016, HOMA-IR (p=0.015, testosterone (p=0.01, and DHEAS (p=0.034 in the patients group compared to the control group. Conclusion: In this study, the difference in Plasma concentration of progranulin and relaxin in the patient group compared to the control group was not significant. It could be inferred that lack of change in plasma level of progranulin and relaxin in women with PCOS is related to BMI<25 and FBS<110. Moreoverestosterones, insulin, DHEAS and HOMA-IR changes could be better predictors of PCOS and its associated diabetes.

  9. Assessing the genetic overlap between BMI and cognitive function

    Science.gov (United States)

    Marioni, R E; Yang, J; Dykiert, D; Mõttus, R; Campbell, A; Ibrahim-Verbaas, Carla A; Bressler, Jan; Debette, Stephanie; Schuur, Maaike; Smith, Albert V; Davies, Gail; Bennett, David A; Deary, Ian J; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosely Jr, Thomas H; Davies, G; Hayward, C; Porteous, D J; Visscher, P M; Deary, I J

    2016-01-01

    Obesity and low cognitive function are associated with multiple adverse health outcomes across the life course. They have a small phenotypic correlation (r=−0.11; high body mass index (BMI)−low cognitive function), but whether they have a shared genetic aetiology is unknown. We investigated the phenotypic and genetic correlations between the traits using data from 6815 unrelated, genotyped members of Generation Scotland, an ethnically homogeneous cohort from five sites across Scotland. Genetic correlations were estimated using the following: same-sample bivariate genome-wide complex trait analysis (GCTA)–GREML; independent samples bivariate GCTA–GREML using Generation Scotland for cognitive data and four other samples (n=20 806) for BMI; and bivariate LDSC analysis using the largest genome-wide association study (GWAS) summary data on cognitive function (n=48 462) and BMI (n=339 224) to date. The GWAS summary data were also used to create polygenic scores for the two traits, with within- and cross-trait prediction taking place in the independent Generation Scotland cohort. A large genetic correlation of −0.51 (s.e. 0.15) was observed using the same-sample GCTA–GREML approach compared with −0.10 (s.e. 0.08) from the independent-samples GCTA–GREML approach and −0.22 (s.e. 0.03) from the bivariate LDSC analysis. A genetic profile score using cognition-specific genetic variants accounts for 0.08% (P=0.020) of the variance in BMI and a genetic profile score using BMI-specific variants accounts for 0.42% (P=1.9 × 10−7) of the variance in cognitive function. Seven common genetic variants are significantly associated with both traits at Pcognitive function. PMID:26857597

  10. Generation of 3D templates of active sites of proteins with rigid prosthetic groups.

    Science.gov (United States)

    Nebel, Jean-Christophe

    2006-05-15

    With the increasing availability of protein structures, the generation of biologically meaningful 3D patterns from the simultaneous alignment of several protein structures is an exciting prospect: active sites could be better understood, protein functions and protein 3D structures could be predicted more accurately. Although patterns can already be generated at the fold and topological levels, no system produces high-resolution 3D patterns including atom and cavity positions. To address this challenge, our research focuses on generating patterns from proteins with rigid prosthetic groups. Since these groups are key elements of protein active sites, the generated 3D patterns are expected to be biologically meaningful. In this paper, we present a new approach which allows the generation of 3D patterns from proteins with rigid prosthetic groups. Using 237 protein chains representing proteins containing porphyrin rings, our method was validated by comparing 3D templates generated from homologues with the 3D structure of the proteins they model. Atom positions were predicted reliably: 93% of them had an accuracy of 1.00 A or less. Moreover, similar results were obtained regarding chemical group and cavity positions. Results also suggested our system could contribute to the validation of 3D protein models. Finally, a 3D template was generated for the active site of human cytochrome P450 CYP17, the 3D structure of which is unknown. Its analysis showed that it is biologically meaningful: our method detected the main patterns of the cytochrome P450 superfamily and the motifs linked to catalytic reactions. The 3D template also suggested the position of a residue, which could be involved in a hydrogen bond with CYP17 substrates and the shape and location of a cavity. Comparisons with independently generated 3D models comforted these hypotheses. Alignment software (Nestor3D) is available at http://www.kingston.ac.uk/~ku33185/Nestor3D.html

  11. Mathematical aspects of molecular replacement. III. Properties of space groups preferred by proteins in the Protein Data Bank.

    Science.gov (United States)

    Chirikjian, G; Sajjadi, S; Toptygin, D; Yan, Y

    2015-03-01

    The main goal of molecular replacement in macromolecular crystallography is to find the appropriate rigid-body transformations that situate identical copies of model proteins in the crystallographic unit cell. The search for such transformations can be thought of as taking place in the coset space Γ\\G where Γ is the Sohncke group of the macromolecular crystal and G is the continuous group of rigid-body motions in Euclidean space. This paper, the third in a series, is concerned with viewing nonsymmorphic Γ in a new way. These space groups, rather than symmorphic ones, are the most common ones for protein crystals. Moreover, their properties impact the structure of the space Γ\\G. In particular, nonsymmorphic space groups contain both Bieberbach subgroups and symmorphic subgroups. A number of new theorems focusing on these subgroups are proven, and it is shown that these concepts are related to the preferences that proteins have for crystallizing in different space groups, as observed in the Protein Data Bank.

  12. Education modifies genetic and environmental influences on BMI

    DEFF Research Database (Denmark)

    Johnson, Wendy; Kyvik, Kirsten Ohm; Skytthe, Axel

    2011-01-01

    environmental correlations between education and BMI differed by level of education, analyzing women and men separately. Correlations between education and BMI were -.13 in women, -.15 in men. High BMI's were less frequent among well-educated participants, generating less variance. In women, this was due...... to restriction of all forms of variance, overall by a factor of about 2. In men, genetic variance did not vary with education, but results for shared and nonshared environmental variance were similar to those for women. The contributions of the shared environment to the correlations between education and BMI......Obesity is more common among the less educated, suggesting education-related environmental triggers. Such triggers may act differently dependent on genetic and environmental predisposition to obesity. In a Danish Twin Registry survey, 21,522 twins of same-sex pairs provided zygosity, height, weight...

  13. Comparison of Efficacy and Safety of Liraglutide 3.0 mg in Individuals with BMI above and below 35 kg/m²: A Post-hoc Analysis

    Science.gov (United States)

    le Roux, Carel; Aroda, Vanita; Hemmingsson, Joanna; Cancino, Ana Paula; Christensen, Rune; Pi-Sunyer, Xavier

    2018-01-01

    Objective To investigate whether the efficacy and safety of liraglutide 3.0 mg differed between two subgroups, BMI 27 to 3.0 mg were evaluated by testing the interaction between treatment group and baseline BMI subgroup. Results Significantly greater weight loss (0–56 weeks) was observed with liraglutide 3.0 mg versus placebo in all patient groups while on treatment. There was no evidence that the weight-lowering effect of liraglutide 3.0 mg differed between BMI subgroups (interaction p > 0.05). Similarly, for most secondary endpoints significantly greater improvements were observed with liraglutide 3.0 mg versus placebo, with no indication treatment effects differing between subgroups. The safety profile of liraglutide 3.0 mg was broadly similar across BMI subgroups. Conclusion This post-hoc analysis did not indicate any differences in the treatment effects, or safety profile, of liraglutide 3.0 mg for individuals with BMI 27 to 3.0 mg can therefore be considered for individuals with a BMI of ≥35 as well as for those with a BMI of 27 to <35 kg/m². PMID:29145215

  14. Maternal BMI and migration status as predictors of childhood obesity in Mexico.

    Science.gov (United States)

    Jiménez-Cruz, A; Wojcicki, J M; Bacardí-Gascón, M; Castellón-Zaragoza, A; García-Gallardo, J L; Schwartz, N; Heyman, M B

    2011-01-01

    To assess the association of maternal migration to Baja California, body mass index (BMI) status, children's perceived food insecurity, and childhood lifestyle behaviors with overweight (BMI > 85% ile), obesity (BMI > 95% ile) and abdominal obesity (Waist Circumference > 90% ile). Convenience sampling methods were used to recruit a cross-sectional sample of 4th, 5th and 6th grade children and their parents at Tijuana and Tecate Public Schools. Children's and parents' weights and heights were measured. Children were considered to have migrant parents if parents were not born in Baja California. One hundred and twenty-two children and their parents were recruited. The mean age of the children was 10.1 ± 1.0 years. Forty nine per cent of children were overweight or obese. Children with obese parents (BMI > 30) had greater odds of being obese, Odds Ratio (OR) 4.9 (95% Confidence Interval (CI), 1.2-19, p = 0.03). Children with migrant parents had greater odds of being obese, OR= 3.7 (95% CI, 1.6-8.3), p = 0.01) and of having abdominal obesity, OR = 3.2 (95% CI, 1.4-7.1, p = 0.01). Children from migrant parents have greater risk of higher consumption of potato chips, OR = 8.0 (95% CI, 2.1-29.1, p = 0.01). Children from non-migrant parents had greater odds of being at risk of hunger. Parental obesity and migration are associated with increased risk of obesity among Mexican children. Children whose parents were born in Baja California have greater odds of being at risk of hunger. Further studies should evaluate the role of migration on risk for childhood obesity.

  15. Decoding of top-down cognitive processing for SSVEP-controlled BMI

    Science.gov (United States)

    Min, Byoung-Kyong; Dähne, Sven; Ahn, Min-Hee; Noh, Yung-Kyun; Müller, Klaus-Robert

    2016-11-01

    We present a fast and accurate non-invasive brain-machine interface (BMI) based on demodulating steady-state visual evoked potentials (SSVEPs) in electroencephalography (EEG). Our study reports an SSVEP-BMI that, for the first time, decodes primarily based on top-down and not bottom-up visual information processing. The experimental setup presents a grid-shaped flickering line array that the participants observe while intentionally attending to a subset of flickering lines representing the shape of a letter. While the flickering pixels stimulate the participant’s visual cortex uniformly with equal probability, the participant’s intention groups the strokes and thus perceives a ‘letter Gestalt’. We observed decoding accuracy of 35.81% (up to 65.83%) with a regularized linear discriminant analysis; on average 2.05-fold, and up to 3.77-fold greater than chance levels in multi-class classification. Compared to the EEG signals, an electrooculogram (EOG) did not significantly contribute to decoding accuracies. Further analysis reveals that the top-down SSVEP paradigm shows the most focalised activation pattern around occipital visual areas; Granger causality analysis consistently revealed prefrontal top-down control over early visual processing. Taken together, the present paradigm provides the first neurophysiological evidence for the top-down SSVEP BMI paradigm, which potentially enables multi-class intentional control of EEG-BMIs without using gaze-shifting.

  16. Relationship between nonalcoholic fatty liver disease and adipocyte fatty acid-binding protein

    Directory of Open Access Journals (Sweden)

    ZHOU Xiaoli

    2013-12-01

    Full Text Available ObjectiveTo investigate the relationship between nonalcoholic fatty liver disease (NAFLD and serum level of adipocyte fatty acid-binding protein (AFABP. MethodsA total of 160 patients who underwent physical examination in the Affiliated Hospital of Ningxia Medical University from July to November 2010 were included in our study. These subjects were divided into two groups according to the diagnostic criteria for NAFLD formulated by the Chinese Medical Association: control group (n=71 and NAFLD group (n=89. The two groups were compared with respect to general condition, body mass index (BMI, blood pressure, AFABP, serum insulin, and other serological indices. The relationship of serum AFABP with NAFLD and other metabolic parameters was analyzed using the Spearman linear correlation coefficient. Comparison of measurement data was made by t test and rank sum test; comparison of enumeration data was made by chi-square test. ResultsThere were more males than females in the NAFLD group. Compared with the control group, the NAFLD group had higher BMI and levels of blood glucose, triglyceride (TG, aspartate aminotransferase (AST, alanine aminotransferase (ALT, and uric acid and lower high-density lipoprotein (HDL level; in addition, the NAFLD group had significantly higher serum AFABP and insulin levels and homeostasis model assessment-estimated insulin resistance (HOMA-IR. The Spearman correlation analysis showed that serum AFABP was positively correlated with NAFLD, BMI, HOMA-IR, serum insulin, blood glucose, TG, ALT, AST, and uric acid but negatively correlated with HDL. After adjustment for sex, age, and BMI, serum AFABP was positively correlated with NAFLD, HOMA-IR, serum insulin, blood glucose, TG, ALT, and uric acid, but had no significant correlation with HDL and AST. ConclusionSerum AFABP is closely associated with NAFLD and may be an independent plasma marker of this disease. AFABP plays a causative role in the pathogenesis of NAFLD.

  17. Associations Between Sedentary Behaviors, Sleep Patterns, and BMI in Young Dancers Attending a Summer Intensive Dance Training Program.

    Science.gov (United States)

    Stracciolini, Andrea; Stein, Cynthia J; Kinney, Susan; McCrystal, Tara; Pepin, Michael J; Meehan Iii, William P

    2017-09-15

    The purpose of this study was to investigate associations between sedentary behaviors, sleep hours, and body mass index (BMI) in 12- to 17-year-old dancers. This was a cross sectional survey in which bivariate correlation and simple linear regression were used to determine associations between self-reported components. One hundred fifteen dancers were queried, 91.3% of whom were female. The mean BMI was 19.6 ± 2.3 kg/m2. Two-thirds of dancers fell below the 50th percentile for age-adjusted BMI, and 30.4% fell below the 25th percentile. Better than 12% of dancers reported a history of anxiety, and 2.6% reported depression. Mean hours of sleep per night was 7.8 ± 0.9, with 58% of the dancers getting less than 8 hours of sleep per night. The mean total screen time for dancers was 3.4 ± 2.1 hours/day, which consisted of tablet and computer usage: 1.6 ± 1.1 hours/day; texting: 0.5 ± 1.1 hours/day; watching television: 1.2 ± 1.1 hours/day; and playing video games 1.2 ± 1.1 hours/ day. Total screen time was independently associated positively with BMI, explaining nearly 10% of the variability in BMI. Age, hours dancing per day, and hours of sleep per night were not independently associated with BMI. To summarize: screen time was associated with increased BMI in this young dancer cohort; the majority of dancers slept less than 8 hours per night; anticipatory guidance addressing media use and sleep hygiene in the adolescent dancer population is needed.

  18. BDNF and BMI effects on brain structures of bipolar offspring: results from the global mood and brain science initiative.

    Science.gov (United States)

    Mansur, R B; Brietzke, E; McIntyre, R S; Cao, B; Lee, Y; Japiassú, L; Chen, K; Lu, R; Lu, W; Li, T; Xu, G; Lin, K

    2017-12-01

    To compare brain-derived neurotrophic factor (BDNF) levels between offspring of individuals with bipolar disorders (BD) and healthy controls (HCs) and investigate the effects of BDNF levels and body mass index (BMI) on brain structures. Sixty-seven bipolar offspring and 45 HCs were included (ages 8-28). Structural images were acquired using 3.0 Tesla magnetic resonance imaging. Serum BDNF levels were measured using enzyme-linked immunosorbent assay. Multivariate and univariate analyses of covariance were conducted. Significantly higher BDNF levels were observed among bipolar offspring, relative to HCs (P > 0.025). Offspring status moderated the association between BDNF and BMI (F 1 =4.636, P = 0.034). After adjustment for relevant covariates, there was a trend for a significant interaction of group and BDNF on neuroimaging parameters (Wilks'λ F 56,94 =1.463, P = 0.052), with significant effects on cerebellar white matter and superior and middle frontal regions. Brain volume and BDNF were positively correlated among HCs and negatively correlated among bipolar offspring. Interactions between BDNF and BMI on brain volumes were non-significant among HCs (Wilks'λ F 28,2 =2.229, P = 0.357), but significant among bipolar offspring (Wilks'λ F 28,12 =2.899, P = 0.028). Offspring status and BMI moderate the association between BDNF levels and brain structures among bipolar offspring, underscoring BDNF regulation and overweight/obesity as key moderators of BD pathogenesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Childhood BMI growth trajectories and endometrial cancer risk

    DEFF Research Database (Denmark)

    Aarestrup, Julie; Gamborg, Michael; Tilling, Kate

    2017-01-01

    Previously, we found that excess weight already in childhood has positive associations with endometrial cancer, however, associations with changes in body mass index (BMI) during childhood are not well understood. Therefore, we examined whether growth in childhood BMI is associated with endometrial...... cancer and its sub-types. A cohort of 155,505 girls from the Copenhagen School Health Records Register with measured weights and heights at the ages of 6 to 14 years and born 1930-89 formed the analytical population. BMI was transformed to age-specific z-scores. Using linear spline multilevel models......, each girl's BMI growth trajectory was estimated as the deviance from the average trajectory for three different growth periods (6.25-7.99, 8.0-10.99, 11.0-14.0 years). Via a link to health registers, 1020 endometrial cancer cases were identified, and Cox regressions were performed. A greater gain...

  20. Genome-wide identification, sequence characterization, and protein-protein interaction properties of DDB1 (damaged DNA binding protein-1)-binding WD40-repeat family members in Solanum lycopersicum.

    Science.gov (United States)

    Zhu, Yunye; Huang, Shengxiong; Miao, Min; Tang, Xiaofeng; Yue, Junyang; Wang, Wenjie; Liu, Yongsheng

    2015-06-01

    One hundred DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family genes were identified in the S. lycopersicum genome. The DWD genes encode proteins presumably functioning as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. These findings provide candidate genes and a research platform for further gene functionality and molecular breeding study. A subclass of DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family proteins has been demonstrated to function as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. However, little information is available about the cognate subfamily genes in tomato (S. lycopersicum). In this study, based on the recently released tomato genome sequences, 100 tomato genes encoding DWD proteins that potentially interact with DDB1 were identified and characterized, including analyses of the detailed annotations, chromosome locations and compositions of conserved amino acid domains. In addition, a phylogenetic tree, which comprises of three main groups, of the subfamily genes was constructed. The physical interaction between tomato DDB1 and 14 representative DWD proteins was determined by yeast two-hybrid and co-immunoprecipitation assays. The subcellular localization of these 14 representative DWD proteins was determined. Six of them were localized in both nucleus and cytoplasm, seven proteins exclusively in cytoplasm, and one protein either in nucleus and cytoplasm, or exclusively in cytoplasm. Comparative genomic analysis demonstrated that the expansion of these subfamily members in tomato predominantly resulted from two whole-genome triplication events in the evolution history.

  1. Temperature, pressure, and electrochemical constraints on protein speciation: Group additivity calculation of the standard molal thermodynamic properties of ionized unfolded proteins

    Directory of Open Access Journals (Sweden)

    J. M. Dick

    2006-01-01

    Full Text Available Thermodynamic calculations can be used to quantify environmental constraints on the speciation of proteins, such as the pH and temperature dependence of ionization state, and the relative chemical stabilities of proteins in different biogeochemical settings. These calculations depend in part on values of the standard molal Gibbs energies of proteins and their ionization reactions as a function of temperature and pressure. Because these values are not generally available, we calculated values of the standard molal thermodynamic properties at 25°C and 1 bar as well as the revised Helgeson-Kirkham-Flowers equations of state parameters of neutral and charged zwitterionic reference model compounds including aqueous amino acids, polypeptides, and unfolded proteins. The experimental calorimetric and volumetric data for these species taken from the literature were combined with group additivity algorithms to calculate the properties and parameters of neutral and ionized sidechain and backbone groups in unfolded proteins. The resulting set of group contributions enables the calculation of the standard molal Gibbs energy, enthalpy, entropy, isobaric heat capacity, volume, and isothermal compressibility of unfolded proteins in a range of proton ionization states to temperatures and pressures exceeding 100°C and 1000 bar. This approach provides a useful frame of reference for thermodynamic studies of protein folding and complexation reactions. It can also be used to assign provisional values of the net charge and Gibbs energy of ionized proteins as a function of temperature and pH. Using these values, an Eh-pH diagram for a reaction representing the speciation of extracellular proteins from Pyrococcus furiosus and Bacillus subtilis was generated. The predicted predominance limits of these proteins correspond with the different electrochemical conditions of hydrothermal vents and soils. More comprehensive calculations of this kind may reveal pervasive

  2. Effects of injected dose, BMI and scanner type on NECR and image noise in PET imaging

    International Nuclear Information System (INIS)

    Chang Tingting; Chang Guoping; Clark, John W Jr; Kohlmyer, Steve; Rohren, Eric; Mawlawi, Osama R

    2011-01-01

    Noise equivalent count rate (NECR) and image noise are two different but related metrics that have been used to predict and assess image quality, respectively. The aim of this study is to investigate, using patient studies, the relationships between injected dose (ID), body mass index (BMI) and scanner type on NECR and image noise measurements in PET imaging. Two groups of 90 patients each were imaged on a GE DSTE and a DRX PET/CT scanner, respectively. The patients in each group were divided into nine subgroups according to three BMI (20-24.9, 25-29.9, 30-45 kg m -2 ) and three ID (296-444, 444-555, 555-740 MBq) ranges, resulting in ten patients/subgroup. All PET data were acquired in 3D mode and reconstructed using the VuePoint HD (registered) fully 3D OSEM algorithm (2 iterations, 21(DRX) or 20 (DSTE) subsets). NECR and image noise measurements for bed positions covering the liver were calculated for each patient. NECR was calculated from the trues, randoms and scatter events recorded in the DICOM header of each patient study, while image noise was determined as the standard deviation of 50 non-neighboring voxels in the liver of each patient. A t-test compared the NECR and image noise for different scanners but with the same BMI and ID. An ANOVA test on the other hand was used to compare the results of patients with different BMI but the same ID and scanner type as well as different ID but the same BMI and scanner type. As expected the t-test showed a significant difference in NECR between the two scanners for all BMI and ID subgroups. However, contrary to what is expected no such findings were observed for image noise measurement. The ANOVA results showed a statistically significant difference in both NECR and image noise among the different BMI for each ID and scanner subgroup. However, there was no statistically significant difference in NECR and image noise across different ID for each BMI and scanner subgroup. Although the GE DRX PET/CT scanner has better

  3. Effect of a High-Protein Diet versus Standard-Protein Diet on Weight Loss and Biomarkers of Metabolic Syndrome: A Randomized Clinical Trial.

    Science.gov (United States)

    Campos-Nonato, Ismael; Hernandez, Lucia; Barquera, Simon

    2017-01-01

    Some studies have shown that protein-enriched diets can lead to greater weight loss and improvements in biomarkers of metabolic syndrome (MeS) than standard protein diets. Therefore, the aim of this study was to determine the effect of increased protein intake on weight loss in Mexican adults with MeS. Randomized controlled trial in 118 adults aged 47.4 ± 11.5 years and meeting the established criteria for MeS were randomized to prescribed hypocaloric diets (500 kcal less than resting metabolic rate) providing either 0.8 g/kg body weight (standard protein diet (SPD)) or 1.34 g/kg body weight (higher protein diet (HPD)) for 6 months. Body weight, waist circumference, percent body fat by bioimpedance analysis, fasting blood glucose, fasting insulin, hemoglobin A1c, total cholesterol, high-density lipoprotein (HDL) cholesterol, very-low-density lipoprotein (VLDL) cholesterol, triglycerides, C-reactive protein, creatinine, blood urea nitrogen, alanine aminotransferase, aspartate aminotransferase, and gamma-glutamyl transferase were measured at baseline, 3 months and at 6 months. There were 105 subjects (51 for SPD and 54 for HPD) who completed the trial. Overall weight loss was 5.1 ± 3.6 kg in the SPD group compared to 7.0 ± 3.7 kg in the in HPD group. Both groups lost a significant percent of centimeters of waist circumference (SPD -6.5 ± 2.6 cm and HPD -8.8 ± 2.6 cm). There was no statistical difference Except for the varying weight losses the two groups did not show any further differences overall. However in the subgroup judged to be adherent more than 75% of the time with the prescribed diets, there was a significant difference in mean weight loss (SPD -5.8% vs. HPD -9.5%) after adjusting for baseline BMI. Both groups demonstrated significant decreases in waist circumference, glucose, insulin, triglycerides, and VLDL cholesterol, but there were no differences between the groups. There were no changes in blood tests for liver or renal function. There were no

  4. Effect of a High-Protein Diet versus Standard-Protein Diet on Weight Loss and Biomarkers of Metabolic Syndrome: A Randomized Clinical Trial

    Directory of Open Access Journals (Sweden)

    Ismael Campos-Nonato

    2017-06-01

    Full Text Available Background: Some studies have shown that protein-enriched diets can lead to greater weight loss and improvements in biomarkers of metabolic syndrome (MeS than standard protein diets. Therefore, the aim of this study was to determine the effect of increased protein intake on weight loss in Mexican adults with MeS. Methods: Randomized controlled trial in 118 adults aged 47.4 ± 11.5 years and meeting the established criteria for MeS were randomized to prescribed hypocaloric diets (500 kcal less than resting metabolic rate providing either 0.8 g/kg body weight (standard protein diet (SPD or 1.34 g/kg body weight (higher protein diet (HPD for 6 months. Body weight, waist circumference, percent body fat by bioimpedance analysis, fasting blood glucose, fasting insulin, hemoglobin A1c, total cholesterol, high-density lipoprotein (HDL cholesterol, very-low-density lipoprotein (VLDL cholesterol, triglycerides, C-reactive protein, creatinine, blood urea nitrogen, alanine aminotransferase, aspartate aminotransferase, and gamma-glutamyl transferase were measured at baseline, 3 months and at 6 months. Results: There were 105 subjects (51 for SPD and 54 for HPD who completed the trial. Overall weight loss was 5.1 ± 3.6 kg in the SPD group compared to 7.0 ± 3.7 kg in the in HPD group. Both groups lost a significant percent of centimeters of waist circumference (SPD -6.5 ± 2.6 cm and HPD -8.8 ± 2.6 cm. There was no statistical difference Except for the varying weight losses the two groups did not show any further differences overall. However in the subgroup judged to be adherent more than 75% of the time with the prescribed diets, there was a significant difference in mean weight loss (SPD -5.8% vs. HPD -9.5% after adjusting for baseline BMI. Both groups demonstrated significant decreases in waist circumference, glucose, insulin, triglycerides, and VLDL cholesterol, but there were no differences between the groups. There were no changes in blood tests for

  5. BMI-for-age graphs with severe obesity percentile curves: tools for plotting cross-sectional and longitudinal youth BMI data.

    Science.gov (United States)

    Racette, Susan B; Yu, Liyang; DuPont, Nicholas C; Clark, B Ruth

    2017-05-24

    Severe obesity is an important and distinct weight status classification that is associated with disease risk and is increasing in prevalence among youth. The ability to graphically present population weight status data, ranging from underweight through severe obesity class 3, is novel and applicable to epidemiologic research, intervention studies, case reports, and clinical care. The aim was to create body mass index (BMI) graphing tools to generate sex-specific BMI-for-age graphs that include severe obesity percentile curves. We used the Centers for Disease Control and Prevention youth reference data sets and weight status criteria to generate the percentile curves. The statistical software environments SAS and R were used to create two different graphing options. This article provides graphing tools for creating sex-specific BMI-for-age graphs for males and females ages 2 to obesity classes 2 and 3, the ability to plot individual data for thousands of children and adolescents on a single graph, and the ability to generate cross-sectional and longitudinal graphs. These new BMI graphing tools will enable investigators, public health professionals, and clinicians to view and present youth weight status data in novel and meaningful ways.

  6. Maternal BMI during Pregnancy: Effect on trace elements Status and ...

    African Journals Online (AJOL)

    Maternal BMI was significantly positively