WorldWideScience

Sample records for group northern altiplano

  1. Permian plants from the Chutani Formation (Titicaca Group, Northern Altiplano of Bolivia: II. The morphogenus Glossopteris

    Directory of Open Access Journals (Sweden)

    Roberto Iannuzzi

    2004-03-01

    Full Text Available Fossil plants belonging to the morphogenera Glossopteris, Pecopteris and Asterotheca were collected from the upper part of the Chutani Formation (Titicaca Group, near the town of San Pablo de Tiquina, on the southeastern shore of Lake Titicaca (northern Altiplano, Bolivia. This paper presents the first description of specimens of the morphogenus Glossopteris from Bolivia. The Bolivian specimens of Glossopteris consist of poorly-preserved impressions, although they present the diagnostic features of this morphogenus. They are fragments of leaves with secondary veins of taeniopterid-type, typical of glossopterids from Late Permian deposits of Gondwana. The only species of Pecopteris confirmed in the first part of this study, i.e. P. dolianitii Rösler and Rohn (see Vieira et al. 2004, was previously reported from the Late Permian beds of the Rio do Rasto and Estrada Nova formations in the Paraná Basin (southern Brazil. Therefore, a Late Permian age is proposed for the fossil plant-bearing beds of the Chutani Formation based on the analyzed assemblage. The phytogeographic implications of this new find are briefly analyzed.Plantas fósseis, pertencentes aos morfo-gêneros Glossopteris, Pecopteris e Asterotheca, foram coletadas na porção superior da seção aflorante da Formação Chutani, próxima ao povoado de San Pablo de Tiquina, sudeste do lago Titicaca (Altiplano norte, Bolívia. Este trabalho apresenta a primeira descrição de espécimes do morfo-gênero Glossopteris provenientes da Bolívia. Os espécimes estudados de Glossopteris consistem em impressões foliares pobremente preservadas nas quais feições diagnósticas estão presentes. Os fragmentos foliares apresentam venação secundária do tipo teniopteróide, uma característica típica de glossopterídeas encontradas em depósitos do Permiano Superior do Gondwana. Por sua vez, a única espécie de Pecopteris confirmada para estes níveis da Formação Chutani, i.e. P. dolianitii

  2. Permian plants from the Chutani Formation (Titicaca Group, Northern Altiplano of Bolivia: I. Genera Pecopteris and Asterotheca

    Directory of Open Access Journals (Sweden)

    Carlos E. L. Vieira

    2004-03-01

    Full Text Available Fossil plants belonging to the morphogenera Glossopteris, Pecopteris and Asterotheca were collected from the upper part of the Chutani Formation (Titicaca Group, near the town of San Pablo de Tiquina, on the southeastern shore of Lake Titicaca (northern Altiplano, Bolivia. Here we report the analysis of fern-type foliage found at this location. Three species of pecopterid fronds are identified: Pecopteris dolianitii Rohn and Rösler, P. cf. P. cadeadensis Rohn and Rösler, and P. cf. P. pedrasica Read. All these species are typically found in Permian deposits of the Paraná Basin in southern Brazil. Despite the poor preservation of the material, a fertile specimen could be studied and was determined as Asterotheca sp. The paleoenvironmental and paleoecological implications of this new find are briefly analyzed.Plantas fósseis, pertencentes aos morfo-gêneros Glossopteris, Pecopteris e Asterotheca, foram coletadas na porção superior da seção aflorante da Formação Chutani, próxima ao povoado de San Pablo de Tiquina, sudeste do lago Titicaca (Altiplano norte, Bolívia. Este trabalho analisa folhagens do tipo feto encontradas neste sítio. Entre os espécimes estéreis, três espécies de frondes pecopterídeas foram identificadas: Pecopteris dolianiti, P. cf. cadeadensis e P. cf. pedrasica. Todas essas espécies eram até agora restritas aos depósitos permianos da Bacia do Paraná. A despeito do estado de preservação ruim do material, um espécime fértil pôde ser determinado como pertencente ao gênero Asterotheca. Implicações paleoambientais e paleoecológicas deste novo achado são brevemente analisadas.

  3. Hydrocarbon potential of Altiplano and northern Subandean, Bolivia

    Energy Technology Data Exchange (ETDEWEB)

    Edman, J.D.; Kirkpatrick, J.R.; Lindsey, D.D.; Lowell, J.D.; Cirbian, M.; Lopez, M.

    1989-03-01

    Seismic, stratigraphic, structural, and geochemical data from the Altiplano, northern Subandean, and northern plains of Bolivia were interpreted in order to evaluate the exploration potential of each province. Identification of three possible source rock intervals, primarily the Devonian and secondarily the Permian and Cretaceous, was used as the basis for recognizing active hydrocarbon systems. For those areas containing source intervals, their analysis revealed that possible reservoir and seal units range in age from Paleozoic to Tertiary; the majority of structures, however, are Eocene or younger. With these general concepts in mind, traps were identified in all three sedimentary provinces. In the northern Altiplano, the most prospective area is along the eastern margin near a southwest and west-vergent thrust belt where hanging-wall anticlines and a warped Eocene-Oligocene(.) unconformity surface form the most likely potential traps. In the central and southern Altiplano, both thrust-related and wrench-related structures present possible exploration targets. In the northern Subandean and Beni plains north of the Isiboro-Chapare area, traps can be classified into two broad groups. First, there are a wide variety of structural traps within the northern Subandean thrust belt, the most attractive of which are footwall structures that have been shielded from surface flushing by hanging-wall strata. Second, in the plains just northeast of the thrust belt, hydrocarbons sourced from the remnant Paleozoic basin may have migrated onto the Isarsama and Madidi highs.

  4. Imaging Lithospheric-scale Structure Beneath Northern Altiplano in Southern Peru and Northern Bolivia

    Science.gov (United States)

    Kumar, A.; Wagner, L. S.; Beck, S. L.; Zandt, G.; Long, M. D.

    2014-12-01

    The northern Altiplano plateau of southern Peru and northern Bolivia is one of the highest topographic features on the Earth, flanked by Western and Eastern Cordillera along its margin. It has strongly influenced the local and far field lithospheric deformation since the early Miocene (Masek et al., 1994). Previous studies have emphasized the importance of both the crust and upper mantle in the evolution of Altiplano plateau (McQuarrie et al., 2005). Early tomographic and receiver function studies, south of 16° S, show significant variations in the crust and upper mantle properties in both perpendicular and along strike direction of the Altiplano plateau (Dorbath et. al., 1993; Myers et al., 1998; Beck and Zandt, 2002). In order to investigate the nature of subsurface lithospheric structure below the northern Altiplano, between 15-18° S, we have determined three-dimensional seismic tomography models for Vp and Vs using P and S-wave travel time data from two recently deployed local seismic networks of CAUGHT and PULSE. We also used data from 8 stations from the PERUSE network (PERU Subduction Experiment). Our preliminary tomographic models show a complex variation in the upper mantle velocity structure with depth, northwest and southeast of lake Titicaca. We see the following trend, at ~85 km depth, northwest of lake Titicaca: low Vp and Vs beneath the Western Cordillera, high Vs beneath the Altiplano and low Vp and Vs beneath the Eastern Cordillera. This low velocity anomaly, beneath Eastern Cordillera, seems to coincide with Kimsachata, a Holocene volcano in southern Peru. At depth greater than ~85 km: we find high velocity anomaly beneath the Western Cordillera and low Vs beneath the Altiplano. This high velocity anomaly, beneath Western Cordillera, coincides with the well-located Wadati-Benioff zone seismicity and perhaps represents the subducting Nazca slab. On the southeast of lake Titicaca, in northern Bolivia, we see a consistently high velocity anomaly

  5. High Cryptosporidium prevalences in healthy Aymara children from the northern Bolivian Altiplano.

    Science.gov (United States)

    Esteban, J G; Aguirre, C; Flores, A; Strauss, W; Angles, R; Mas-Coma, S

    1998-01-01

    The prevalence of Cryptosporidium infection was determined in four Aymara communities in the Bolivian Altiplano, between the city of La Paz and Lake Titicaca, at an altitude of 3,800-4,200 meters. Single stool specimens were randomly collected from 377 5-19-year-old students, all apparently asymptomatic. The total prevalence (31.6%) is possibly the highest reported among healthy humans (a maximum of 9.8% and 2.0% in coprologic surveys in underdeveloped and developed countries, respectively) and one of the highest even in symptomatic subjects. No significant age and sex differences were observed. Such an infection prevalence is probably related to the poor sanitation conditions, contaminated water supplies, overcrowding, and close contact with domestic animals. Continuous exposure to the parasite could be associated with protection against parasite-related symptoms in the children examined.

  6. Climate and lake-level history of the northern Altiplano, Bolivia, as recorded in Holocene sediments of the Rio Desaguadero

    Energy Technology Data Exchange (ETDEWEB)

    Baucom, P.C.; Rigsby, C.A. [East Carolina Univ., Greenville, NC (United States). Dept. of Geology

    1999-05-01

    Strata exposed in terraces and modern cutbanks along the Rio Desaguadero contain a variety of lithofacies that were deposited in four distinct facies associations. These facies associations document a history of aggradation and downcutting that is linked to Holocene climate change on the Altiplano. Braided-stream, meandering-stream, deltaic and shoreline, and lacustrine sediments preserved in multi-level terraces in the northern Rio Desaguadero valley record two high-water intervals: one between 4,500 and 3,900 yr BP and another between 2,000 and 2,200 yr BP. These wet periods were interrupted by three periods of fluvial downcutting, centered at approximately 4,000 yr BP, 3,600 yr BP, and after 2,000 yr BP. Braided-river sediments preserved in a single terrace level in the southern Rio Desaguadero valley record a history of nearly continuous fluvial sedimentation from at least 7,000 yr BP until approximately 3,200 yr BP that was followed by a single episode (post-3,210 yr BP) of down-cutting and lateral migration. The deposition and subsequent fluvial downcutting of the northern strata was controlled by changes in effective moisture that can be correlated to Holocene water-level fluctuations of Lake Titicaca. The deposition and dissection of braided-stream sediments to the south are more likely controlled by a combination of base-level change and sediment input from the Rio Mauri.

  7. Groundwater flow in a closed basin with a saline shallow lake in a volcanic area: Laguna Tuyajto, northern Chilean Altiplano of the Andes.

    Science.gov (United States)

    Herrera, Christian; Custodio, Emilio; Chong, Guillermo; Lambán, Luis Javier; Riquelme, Rodrigo; Wilke, Hans; Jódar, Jorge; Urrutia, Javier; Urqueta, Harry; Sarmiento, Alvaro; Gamboa, Carolina; Lictevout, Elisabeth

    2016-01-15

    Laguna Tuyajto is a small, shallow saline water lake in the Andean Altiplano of northern Chile. In the eastern side it is fed by springs that discharge groundwater of the nearby volcanic aquifers. The area is arid: rainfall does not exceed 200mm/year in the rainiest parts. The stable isotopic content of spring water shows that the recharge is originated mainly from winter rain, snow melt, and to a lesser extent from some short and intense sporadic rainfall events. Most of the spring water outflowing in the northern side of Laguna Tuyajto is recharged in the Tuyajto volcano. Most of the spring water in the eastern side and groundwater are recharged at higher elevations, in the rims of the nearby endorheic basins of Pampa Colorada and Pampa Las Tecas to the East. The presence of tritium in some deep wells in Pampa Colorada and Pampa Las Tecas indicates recent recharge. Gas emission in recent volcanoes increase the sulfate content of atmospheric deposition and this is reflected in local groundwater. The chemical composition and concentration of spring waters are the result of meteoric water evapo-concentration, water-rock interaction, and mainly the dissolution of old and buried evaporitic deposits. Groundwater flow is mostly shallow due to a low permeability ignimbrite layer of regional extent, which also hinders brine spreading below and around the lake. High deep temperatures near the recent Tuyajto volcano explain the high dissolved silica contents and the δ(18)O shift to heavier values found in some of the spring waters. Laguna Tuyajto is a terminal lake where salts cumulate, mostly halite, but some brine transfer to the Salar de Aguas Calientes-3 cannot be excluded. The hydrogeological behavior of Laguna Tuyajto constitutes a model to understand the functioning of many other similar basins in other areas in the Andean Altiplano. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Groundwater flow in a closed basin with a saline shallow lake in a volcanic area: Laguna Tuyajto, northern Chilean Altiplano of the Andes

    International Nuclear Information System (INIS)

    Herrera, Christian; Custodio, Emilio; Chong, Guillermo; Lambán, Luis Javier; Riquelme, Rodrigo; Wilke, Hans; Jódar, Jorge; Urrutia, Javier; Urqueta, Harry; Sarmiento, Alvaro

    2016-01-01

    Laguna Tuyajto is a small, shallow saline water lake in the Andean Altiplano of northern Chile. In the eastern side it is fed by springs that discharge groundwater of the nearby volcanic aquifers. The area is arid: rainfall does not exceed 200 mm/year in the rainiest parts. The stable isotopic content of spring water shows that the recharge is originated mainly from winter rain, snow melt, and to a lesser extent from some short and intense sporadic rainfall events. Most of the spring water outflowing in the northern side of Laguna Tuyajto is recharged in the Tuyajto volcano. Most of the spring water in the eastern side and groundwater are recharged at higher elevations, in the rims of the nearby endorheic basins of Pampa Colorada and Pampa Las Tecas to the East. The presence of tritium in some deep wells in Pampa Colorada and Pampa Las Tecas indicates recent recharge. Gas emission in recent volcanoes increase the sulfate content of atmospheric deposition and this is reflected in local groundwater. The chemical composition and concentration of spring waters are the result of meteoric water evapo-concentration, water–rock interaction, and mainly the dissolution of old and buried evaporitic deposits. Groundwater flow is mostly shallow due to a low permeability ignimbrite layer of regional extent, which also hinders brine spreading below and around the lake. High deep temperatures near the recent Tuyajto volcano explain the high dissolved silica contents and the δ"1"8O shift to heavier values found in some of the spring waters. Laguna Tuyajto is a terminal lake where salts cumulate, mostly halite, but some brine transfer to the Salar de Aguas Calientes-3 cannot be excluded. The hydrogeological behavior of Laguna Tuyajto constitutes a model to understand the functioning of many other similar basins in other areas in the Andean Altiplano. - Highlights: • Recent volcanism formations play a key role in producing recharge. • Groundwater can flow across local

  9. Groundwater flow in a closed basin with a saline shallow lake in a volcanic area: Laguna Tuyajto, northern Chilean Altiplano of the Andes

    Energy Technology Data Exchange (ETDEWEB)

    Herrera, Christian, E-mail: cherrera@ucn.cl [Departamento de Ciencias Geológicas, Universidad Católica del Norte, Casilla 1280, Antofagasta (Chile); Centro de Investigación Tecnológica del Agua en el Desierto (CEITSAZA), Universidad Católica del Norte, Casilla 1280, Antofagasta (Chile); Custodio, Emilio [Department of Geo-Engineering, Technical University of Catalonia/Barcelona Tech (UPC), Barcelona (Spain); Chong, Guillermo [Departamento de Ciencias Geológicas, Universidad Católica del Norte, Casilla 1280, Antofagasta (Chile); Lambán, Luis Javier [Geological Institute of Spain (IGME), Zaragoza (Spain); Riquelme, Rodrigo; Wilke, Hans [Departamento de Ciencias Geológicas, Universidad Católica del Norte, Casilla 1280, Antofagasta (Chile); Jódar, Jorge [Department of Geo-Engineering, Technical University of Catalonia/Barcelona Tech (UPC), Barcelona (Spain); Urrutia, Javier; Urqueta, Harry [Departamento de Ciencias Geológicas, Universidad Católica del Norte, Casilla 1280, Antofagasta (Chile); Centro de Investigación Tecnológica del Agua en el Desierto (CEITSAZA), Universidad Católica del Norte, Casilla 1280, Antofagasta (Chile); Sarmiento, Alvaro [Departamento de Ciencias Geológicas, Universidad Católica del Norte, Casilla 1280, Antofagasta (Chile); and others

    2016-01-15

    Laguna Tuyajto is a small, shallow saline water lake in the Andean Altiplano of northern Chile. In the eastern side it is fed by springs that discharge groundwater of the nearby volcanic aquifers. The area is arid: rainfall does not exceed 200 mm/year in the rainiest parts. The stable isotopic content of spring water shows that the recharge is originated mainly from winter rain, snow melt, and to a lesser extent from some short and intense sporadic rainfall events. Most of the spring water outflowing in the northern side of Laguna Tuyajto is recharged in the Tuyajto volcano. Most of the spring water in the eastern side and groundwater are recharged at higher elevations, in the rims of the nearby endorheic basins of Pampa Colorada and Pampa Las Tecas to the East. The presence of tritium in some deep wells in Pampa Colorada and Pampa Las Tecas indicates recent recharge. Gas emission in recent volcanoes increase the sulfate content of atmospheric deposition and this is reflected in local groundwater. The chemical composition and concentration of spring waters are the result of meteoric water evapo-concentration, water–rock interaction, and mainly the dissolution of old and buried evaporitic deposits. Groundwater flow is mostly shallow due to a low permeability ignimbrite layer of regional extent, which also hinders brine spreading below and around the lake. High deep temperatures near the recent Tuyajto volcano explain the high dissolved silica contents and the δ{sup 18}O shift to heavier values found in some of the spring waters. Laguna Tuyajto is a terminal lake where salts cumulate, mostly halite, but some brine transfer to the Salar de Aguas Calientes-3 cannot be excluded. The hydrogeological behavior of Laguna Tuyajto constitutes a model to understand the functioning of many other similar basins in other areas in the Andean Altiplano. - Highlights: • Recent volcanism formations play a key role in producing recharge. • Groundwater can flow across local

  10. Timing of deformation and rapid subsidence in the northern Altiplano, Peru: Insights from detrital zircon geochronology of the Ayaviri hinterland basin

    Science.gov (United States)

    Horton, B. K.; Perez, N. D.; Saylor, J. E.

    2011-12-01

    Although age constraints on crustal deformation and sediment accumulation prove critical to testing hypotheses of orogenic plateau construction, a common lack of marine facies, volcanic tuffs, and suitable fossils hinders many attempts at chronological reconstructions. A series of elevated retroarc basins along the axis of the Andean orogenic belt provide opportunities to define the timing of deformation and transformation from foreland to hinterland basin configurations. In this study, we present new U-Pb ages of detrital zircons in the Ayaviri intermontane basin of southern Peru (~4 km elevation) in the northern part of the central Andean (Altiplano) plateau. Nearly all sandstone samples show strong unimodal U-Pb age peaks (generally defined by > 5-50 zircons), suggesting these age peaks represent syndepositional volcanism and can be regarded as accurate estimates of true depositional (stratigraphic) age. Integration of these ages with structural and stratigraphic relationships demonstrate the utility of zircon U-Pb geochronology in defining both (1) the timing of basin partitioning and (2) the pace of sediment accumulation. (1) U-Pb ages for several sandstone samples from growth-strata packages associated with two basin-bounding faults reveal structural partitioning of the Ayaviri basin from late Oligocene to Miocene time. In the north, displacement along the southwest-directed Ayaviri thrust fault commenced in late Oligocene time (~28-24 Ma), inducing initial structural partitioning of an upper Eocene-Oligocene, > 5 km thick succession potentially representing an early Andean retroarc foreland basin. In the south, the Ayaviri basin was further disrupted by initial displacement along the northeast-directed Pasani thrust fault in early to middle Miocene time (~18-15 Ma). (2) Additional U-Pb analyses from the Ayaviri basin fill help delimit the long-term rates of sedimentation, suggesting relatively short-lived (< 5 Myr) pulses of accelerated accumulation. Rapid

  11. Microbial Activity Response to Solar Radiation across Contrasting Environmental Conditions in Salar de Huasco, Northern Chilean Altiplano.

    Science.gov (United States)

    Hernández, Klaudia L; Yannicelli, Beatriz; Olsen, Lasse M; Dorador, Cristina; Menschel, Eduardo J; Molina, Verónica; Remonsellez, Francisco; Hengst, Martha B; Jeffrey, Wade H

    2016-01-01

    In high altitude environments, extreme levels of solar radiation and important differences of ionic concentrations over narrow spatial scales may modulate microbial activity. In Salar de Huasco, a high-altitude wetland in the Andean mountains, the high diversity of microbial communities has been characterized and associated with strong environmental variability. Communities that differed in light history and environmental conditions, such as nutrient concentrations and salinity from different spatial locations, were assessed for bacterial secondary production (BSP, 3 H-leucine incorporation) response from short-term exposures to solar radiation. We sampled during austral spring seven stations categorized as: (a) source stations, with recently emerged groundwater (no-previous solar exposure); (b) stream running water stations; (c) stations connected to source waters but far downstream from source points; and (d) isolated ponds disconnected from ground sources or streams with a longer isolation and solar exposure history. Very high values of 0.25 μE m -2 s -1 , 72 W m -2 and 12 W m -2 were measured for PAR, UVA, and UVB incident solar radiation, respectively. The environmental factors measured formed two groups of stations reflected by principal component analyses (near to groundwater sources and isolated systems) where isolated ponds had the highest BSP and microbial abundance (35 microalgae taxa, picoeukaryotes, nanoflagellates, and bacteria) plus higher salinities and PO 4 3- concentrations. BSP short-term response (4 h) to solar radiation was measured by 3 H-leucine incorporation under four different solar conditions: full sun, no UVB, PAR, and dark. Microbial communities established in waters with the longest surface exposure (e.g., isolated ponds) had the lowest BSP response to solar radiation treatments, and thus were likely best adapted to solar radiation exposure contrary to ground source waters. These results support our light history (solar exposure

  12. Altiplano Sur de Bolivia

    OpenAIRE

    Alvarez-Flores, Ricardo; Bommel, Pierre; Bourliaud, Jean; Chevarria Lazo, Marco; Cortes, Geneviève; Cruz, Pablo; Del Castillo, C.; Gasselin, Pierre; Joffre, Richard; Leger, Francois; Nina Laura, Juan Peter; Rambal, Serge; Rivière, Gilles; Tichit, Muriel; Tourrand, Jean-François

    2014-01-01

    Alimento de base de las poblaciones andinas desde hace milenios, la quinua se ha convertido hoy en un producto apreciado en el mercado internacional de alimentos dietéticos, orgánicos y equitativos. Este cambio lo iniciaron los mismos productores del Altiplano Sur de Bolivia hace aproximadamente unos 40 años. En medio de un desierto de altura, ellos lograron desarrollar una floreciente producción agrícola de exportación. Aunque cuentan con lucrativos nichos de mercado, los productores de quin...

  13. Rapid tectonic and paleogeographic evolution associated with the development of the Chucal anticline and the Chucal-Lauca Basin in the Altiplano of Arica, northern Chile

    Science.gov (United States)

    Charrier, Reynaldo; Chávez, Alvaro N.; Elgueta, Sara; Hérail, Gérard; Flynn, John J.; Croft, Darin A.; Wyss, André R.; Riquelme, Rodrigo; García, Marcelo

    2005-05-01

    is intercalated within its middle part). We interpret the contractional deformation to be associated with tectonic activity that led to the uplift of the Altiplano; however, paleobotanical evidence does not indicate any major altitude changes during the time period considered here but rather suggests that rapid uplift took place after the deposition of the Quebrada Macusa Formation.

  14. Endemic human fasciolosis in the Bolivian Altiplano.

    Science.gov (United States)

    Parkinson, M; O'Neill, S M; Dalton, J P

    2007-05-01

    Fasciolosis, caused by trematodes of the genus Fasciola, is an emerging disease of humans. One of the highest levels of human fasciolosis hepatica is found amongst the indigenous Aymaran people of the Northern Bolivian Altiplano. A meta-analysis of epidemiological surveys from 38 communities in the region demonstrates that fasciolosis has been endemic in the region since at least 1984 and is a zoonosis of rural communities. Human and bovine fasciolosis is associated with the communities lying in the plain from Lake Titicaca to La Paz, predominantly in the Los Andes province. In Los Andes incidences of up to 67% of population cohorts were found, and prevalence is age-related with the highest infection rate in children aged 8-11 years.

  15. Eocene Unification of Peruvian and Bolivian Altiplano Basin Depocenters

    Science.gov (United States)

    Saylor, J.; Sundell, K. E.; Perez, N.; Karsky, N.; Lapen, T. J.; Cárdenas, J.

    2017-12-01

    Paleogene evolution of the Altiplano basin has been characterized as a flexural foreland basin which developed in response to magmatic and thrust loading along its western margin. Research focused in southern Peru and Bolivia points to broadly synchronous foredeep deposition in a basin assumed to be have been contiguous from at least 14°-23°S. We investigated Paleogene strata exposed on the southwestern margin of Lake Titicaca near the Peru/Bolivia border in order to establish sediment dispersal systems, sediment sources, and the chronology of deposition. A data set of >1,000 paleocurrent measurements throughout the section consistently indicates a western sediment source. The results of detrital zircon mixture modeling are consistent with derivation from Cretaceous volcanic sources, and Cretaceous and Ordovician sedimentary strata exposed in the Western Cordillera. These results confirm previous models in which sedimentary sources for the Altiplano basin are dominated by the Western Cordillera throughout the Paleogene. The detrital zircon signatures from strata in this stratigraphic section where paleocurrent orientation is well constrained provide a benchmark for future research seeking to determine sediment sources for the Altiplano basin. However, refined chronologies based on detrital zircon U-Pb maximum depositional ages (MDAs) point to development of at least two Paleocene depocenters in Peru and Bolivia separated by a zone of nondeposition or erosion in southern Peru. The basal Muñani Formation in southern Peru yields MDAs of 36.9-40.2 Ma, which requires revision of the previously determined middle Paleocene onset of deposition. The Muñani Formation overlies the Vilquechico Group which has been biostratigraphically determined to range from Campanian-Maastrichtian (or possibly Paleocene, 60 Ma). The revised chronology for the Muñani Formation requires a disconformity of at least 20 Myr during which deposition continued in both the Peruvian and Bolivian

  16. Isotopic tracers of paleohydrologic change in large lakes of the Bolivian Altiplano

    Science.gov (United States)

    Placzek, Christa J.; Quade, Jay; Patchett, P. Jonathan

    2011-01-01

    We have developed an 87Sr/ 86Sr, 234U/ 238U, and δ 18O data set from carbonates associated with late Quaternary paleolake cycles on the southern Bolivian Altiplano as a tool for tracking and understanding the causes of lake-level fluctuations. Distinctive groupings of 87Sr/ 86Sr ratios are observed. Ratios are highest for the Ouki lake cycle (120-95 ka) at 0.70932, lowest for Coipasa lake cycle (12.8-11.4 ka) at 0.70853, and intermediate at 0.70881 to 0.70884 for the Salinas (95-80 ka), Inca Huasi (~ 45 ka), Sajsi (24-20.5 ka), and Tauca (18.1-14.1 ka) lake cycles. These Sr ratios reflect variable contributions from the eastern and western Cordilleras. The Laca hydrologic divide exerts a primary influence on modern and paleolake 87Sr/ 86Sr ratios; waters show higher 87Sr/ 86Sr ratios north of this divide. Most lake cycles were sustained by slightly more rainfall north of this divide but with minimal input from Lake Titicaca. The Coipasa lake cycle appears to have been sustained mainly by rainfall south of this divide. In contrast, the Ouki lake cycle was an expansive lake, deepest in the northern (Poópo) basin, and spilling southward. These results indicate that regional variability in central Andean wet events can be reconstructed using geochemical patterns from this lake system.

  17. A population-based coprological study of human fascioliasis in a hyperendemic area of the Bolivian Altiplano.

    Science.gov (United States)

    Esteban, J G; Flores, A; Angles, R; Strauss, W; Aguirre, C; Mas-Coma, S

    1997-07-01

    The community of Chijipata Alta, at an altitude of 3850 m, near the southern coast of Lake Titicaca in the northern Altiplano of Bolivia, was surveyed for human fascioliasis. The global prevalence (66.7%) and intensity (eggs per gram of faeces--epg: range: 24-4440; arithmetic mean: 1001; geometric mean: 390) proved to be the highest known in the world by means of coprological techniques. These results suggest the existence of highly hyperendemic subzones among the large human fascioliasis-endemic zone of the Bolivian northern Altiplano. Despite the decrease in prevalence and intensity from children (75.0%, 24-4440 epg) to adults (41.7%, 144-864 epg), our findings show that in an hyperendemic zone adult subjects either maintain the parasites acquired when young or are newly infected as the consequence of inhabiting a zone of high infection risk.

  18. Plasma insulin pattern in a Hausa-Fulani ethnic group in northern ...

    African Journals Online (AJOL)

    Plasma insulin pattern in a Hausa-Fulani ethnic group in northern Nigeria. ... Results: Although there were marked individual variations with 16.7% of individuals demonstrating fasting ... Key Words: Plasma Insulin, northern Nigeria Annals of ...

  19. Tooth wear in three ethnic groups in Sabah (northern Borneo).

    Science.gov (United States)

    Milosevic, A; Lo, M S

    1996-12-01

    The prevalence and associated aetiologies of tooth wear were investigated in three ethnic groups in Sabah (Northern Borneo) using the Tooth Wear Index (TWI). The number of surfaces with enamel wear only, dentine exposed for less than a third or dentine exposed for more than a third were categorised into the TW minimal, moderate or severe respectively. A structured questionnaire was used to elicit medical/dental history, oral hygiene practices, satisfaction with body image, diet and other personal habits/details. The sample comprised of a self selected sample of 148 dental hospital attenders; 47 (32 per cent) each of ethnic Chinese and Malay and 54 (36 per cent) of ethnic Kadazan, matched for age and with a similar number of scoreable teeth per subject. Dentine exposure within the total sample was a common finding (95 per cent TW with moderate, 41 per cent TW severe). The Kadazan group had significantly (P Chinese or Malay. Tobacco chewing was positively associated (rho = +0.4, P Chinese subjects. The aetiological factors associated with this tooth wear are different to those encountered in Western cultures.

  20. A 130 ka reconstruction of rainfall on the Bolivian Altiplano

    Science.gov (United States)

    Placzek, C. J.; Quade, J.; Patchett, P. J.

    2013-02-01

    New efforts to link climate reconstructions from shoreline deposits and sediment cores yield an improved and more detailed lake history from the Bolivian Altiplano. On the Southern Altiplano, 10 lake oscillations have been identified from this new unified chronology, each coincident with North Atlantic cold events such as Heinrich Events H5, H2, H1, and the Younger Dryas. By coupling this new lake history to a hydrologic budget model we are able to evaluate precipitation variability on the Southern Bolivian Altiplano over the last 130 ka. These modeling efforts underscore the relative aridity of the Altiplano during the rare and small lake cycles occurring between 80 and 20 ka, when colder temperatures combined with little or no change in rainfall produced smaller paleolakes. Relative aridity between 80 and 20 ka contrasts with the immense Tauca lake cycle (18.1-14.1 ka), which was six times larger than modern Lake Titicaca and coincided with Heinrich Event 1. This improved paleolake record from the Southern Altiplano reveals a strong link between central Andean climate and Atlantic sea-surface temperature gradients during the late Pleistocene, even though today rainfall variability is driven mostly by Pacific sea-surface temperature anomalies associated with El Niño/Southern Oscillation. However, not all Heinrich Events appear to result in lake expansions, most conspicuously during the global cold interval between 80 and 20 ka when the Altiplano and Amazon Basin were relatively arid.

  1. Late Quaternary palaeolakes, rivers, and wetlands on the Bolivian Altiplano and their palaeoclimatic implications

    Science.gov (United States)

    Rigsby, Catherine A.; Platt Bradbury, J.; Baker, Paul A.; Rollins, Stephanie M.; Warren, Michelle R.

    2005-10-01

    Drill cores of sediments from the Rio Desaguadero valley, Bolivia, provide new information about the climate of tropical South America over the past 50 000 years. The modern Rio Desaguadero is fed by Lake Titicaca overflow (and by local tributaries) in the wetter northern Altiplano and discharges into Lake Poopo in the more arid central Altiplano. During the late Quaternary the Rio Desaguadero valley was the site of several generations of palaeolakes and wetlands that formed during periods of increased precipitation and local runoff, augmented by increased overflow from Lake Titicaca. Sediments recovered by drilling in eight localities along the 390-km long valley of the Rio Desaguadero yield a regional history of lacustrine sedimentation and effective precipitation. Lacustrine strata in the drill cores record 12 distinct wet periods in the past 50 000 years. Four of these wet periods resulted in the formation of major palaeolakes in the Rio Desaguadero valley: during the last glacial maximum from before 20 000 to 16 000 cal. yr BP, during the late glacial from about 14 000 to 12 000 cal. yr BP, in the early Holocene from about 10 000 to 7900 cal. yr BP, and in the late Holocene from 4500 cal. yrBP to present. The period that appears to have been most arid was between 7900 and 4500cal.yrBP. The Altiplano wet periods were generally synchronous with North Atlantic cold events (respectively, the last glacial maximum, the Younger Dryas, the 8200cal.yrBP event, and the Neoglacial) implying a relationship between past precipitation variability in tropical South America and North Atlantic sea-surface temperature.

  2. Phylogenetic Analysis of a Novel Molecular Isolate of Spotted Fever Group Rickettsiae from Northern Peru

    National Research Council Canada - National Science Library

    Jiang, Ju; Blair, Patrick J; Felices, Vidal; Moron, Cecilia; Cespedes, Manuel; Anaya, Elizabeth; Schoeler, George B; Sumner, John W; Olson, James G; Richards, Allen L

    2005-01-01

    ...) collected from two domestic horses living in two separate locations in northern Peru (Coletas and Naranjo) was conducted to more clearly characterize this recently reported novel spotted fever group...

  3. Climate, catchment runoff and limnological drivers of carbon and oxygen isotope composition of diatom frustules from the central andean altiplano during the Lateglacial and Early Holocene

    OpenAIRE

    Hernández, Armand; Bao, Roberto; Giralt, Santiago; Sáez, Alberto; Leng, Melanie J.; Barker, Philips A.; Kendrick, C.P.; Sloane, Hilary J.

    2013-01-01

    Diatom-based carbon and oxygen isotope analyses (δ13Cdiatom and δ18Odiatom) were performed on diatomrich laminated sediments of Lake Chungará (Andean Altiplano, northern Chile) deposited during the Lateglacial and Early Holocene (12,400e8300 cal years BP) to reconstruct climate change and environmental response across this major climate transition. The δ13Cdiatom data show both centennial-tomillennial scale changes related to fluctuations in lake productivity and CO2 concentration in the lake...

  4. The genetic history of indigenous populations of the Peruvian and Bolivian Altiplano: the legacy of the Uros.

    Science.gov (United States)

    Sandoval, José Raul; Lacerda, Daniela R; Jota, Marilza S A; Salazar-Granara, Alberto; Vieira, Pedro Paulo R; Acosta, Oscar; Cuellar, Cinthia; Revollo, Susana; Fujita, Ricardo; Santos, Fabrício R

    2013-01-01

    The Altiplano region of the South American Andes is marked by an inhospitable climate to which the autochthonous human populations adapted and then developed great ancient civilizations, such as the Tiwanaku culture and the Inca Empire. Since pre-Columbian times, different rulers established themselves around the Titicaca and Poopo Lakes. By the time of the arrival of Spaniards, Aymara and Quechua languages were predominant on the Altiplano under the rule of the Incas, although the occurrence of other spoken languages, such as Puquina and Uruquilla, suggests the existence of different ethnic groups in this region. In this study, we focused on the pre-Columbian history of the autochthonous Altiplano populations, particularly the Uros ethnic group, which claims to directly descend from the first settlers of the Andes, and some linguists suggest they might otherwise be related to Arawak speaking groups from the Amazon. Using phylogeographic, population structure and spatial genetic analyses of Y-chromosome and mtDNA data, we inferred the genetic relationships among Uros populations (Los Uros from Peru, Uru-Chipaya and Uru-Poopo from Bolivia), and compared their haplotype profiles with eight Aymara, nine Quechua and two Arawak (Machiguenga and Yanesha) speaking populations from Peru and Bolivia. Our results indicated that Uros populations stand out among the Altiplano populations, while appearing more closely related to the Aymara and Quechua from Lake Titicaca and surrounding regions than to the Amazon Arawaks. Moreover, the Uros populations from Peru and Bolivia are genetically differentiated from each other, indicating a high heterogeneity in this ethnic group. Finally, our results support the distinctive ancestry for the Uros populations of Peru and Bolivia, which are likely derived from ancient Andean lineages that were partially replaced during more recent farming expansion events and the establishment of complex civilizations in the Andes.

  5. The genetic history of indigenous populations of the Peruvian and Bolivian Altiplano: the legacy of the Uros.

    Directory of Open Access Journals (Sweden)

    José Raul Sandoval

    Full Text Available The Altiplano region of the South American Andes is marked by an inhospitable climate to which the autochthonous human populations adapted and then developed great ancient civilizations, such as the Tiwanaku culture and the Inca Empire. Since pre-Columbian times, different rulers established themselves around the Titicaca and Poopo Lakes. By the time of the arrival of Spaniards, Aymara and Quechua languages were predominant on the Altiplano under the rule of the Incas, although the occurrence of other spoken languages, such as Puquina and Uruquilla, suggests the existence of different ethnic groups in this region. In this study, we focused on the pre-Columbian history of the autochthonous Altiplano populations, particularly the Uros ethnic group, which claims to directly descend from the first settlers of the Andes, and some linguists suggest they might otherwise be related to Arawak speaking groups from the Amazon. Using phylogeographic, population structure and spatial genetic analyses of Y-chromosome and mtDNA data, we inferred the genetic relationships among Uros populations (Los Uros from Peru, Uru-Chipaya and Uru-Poopo from Bolivia, and compared their haplotype profiles with eight Aymara, nine Quechua and two Arawak (Machiguenga and Yanesha speaking populations from Peru and Bolivia. Our results indicated that Uros populations stand out among the Altiplano populations, while appearing more closely related to the Aymara and Quechua from Lake Titicaca and surrounding regions than to the Amazon Arawaks. Moreover, the Uros populations from Peru and Bolivia are genetically differentiated from each other, indicating a high heterogeneity in this ethnic group. Finally, our results support the distinctive ancestry for the Uros populations of Peru and Bolivia, which are likely derived from ancient Andean lineages that were partially replaced during more recent farming expansion events and the establishment of complex civilizations in the Andes.

  6. Landsat TM inventory and assessment of waterbird habitat in the southern altiplano of South America

    Science.gov (United States)

    Boyle, T.P.; Caziani, S.M.; Waltermire, R.G.

    2004-01-01

    The diverse set of wetlands in southern altiplano of South America supports a number of endemic and migratory waterbirds. These species include endangered endemic flamingos and shorebirds that nest in North America and winter in the altiplano. This research developed maps from nine Landsat Thematic Mapper (TM) images (254,300 km2) to provide an inventory of aquatic waterbird habitats. Image processing software was used to produce a map with a classification of wetlands according to the habitat requirements of different types of waterbirds. A hierarchical procedure was used to, first, isolate the bodies of water within the TM image; second, execute an unsupervised classification on the subsetted image to produce 300 signatures of cover types, which were further subdivided as necessary. Third, each of the classifications was examined in the light of field data and personal experience for relevance to the determination of the various habitat types. Finally, the signatures were applied to the entire image and other adjacent images to yield a map depicting the location of the various waterbird habitats in the southern altiplano. The data sets referenced with a global positioning system receiver were used to test the classification system. Multivariate analysis of the bird communities censused at each lake by individual habitats indicated a salinity gradient, and then the depth of the water separated the birds. Multivariate analysis of the chemical and physical data from the lakes showed that the variation in lakes were significantly associated with difference in depth, transparency, latitude, elevation, and pH. The presence of gravel bottoms was also one of the qualities distinguishing a group of lakes. This information will be directly useful to the Flamingo Census Project and serve as an element for risk assessment for future development.

  7. Acceptability of smoke from prescribed forest burning in the northern inland west: a focus group approach

    Science.gov (United States)

    Brad R. Weisshaupt; Matthew S. Carroll; Keith A. Blatner; William D. Robinson; Pamela J. Jakes

    2005-01-01

    Focus groups were used to gauge tolerance of smoke from broadcast prescribed forest burning in the wildland-urban interface of the northern Inland West. Focus group participants worked through issues surrounding prescribed burning as a management tool to determine if the origin of smoke made a difference in the acceptance of that smoke. Participant responses across...

  8. Experiences with a small scale Solar/Wind pilot installation for basic electrification in the chilean altiplano

    Energy Technology Data Exchange (ETDEWEB)

    Sapiain, Raul; Ovalle, Ricardo; Torres, Ariel; Brockmeyer, Ricarda; Schmidt, Reinhold [Centro de Energias Renovables/Universidad de Tarapaca, Arica, (Chile); Meer, Andreas V. [Solar Institute, Juelich (Germany)

    1997-12-31

    Basic rural electrification programmes are already carried out in the rural areas of northern Chile by local communities and local governments using photovoltaic systems. Solar Home Systems, 12 VDC are installed for individual households while systems for schools, public lighting etc. are realized with bigger systems, 220 VAC. Within a cooperation with the Solar Institute of the Fachhochschule Juelich, Germany, the Renewable Energy Center of the University of Tarapaca designed, installed and evaluated the first solar/wind hybrid installation for basic electrification in northern Chile, realized in Colpitas, a typical small village in the chilean altiplano. The following paper presents results and experiences of this first pilot installation. [Espanol] Ya se estan llevando a cabo programas de electrificacion rural basica en las areas rurales del Norte de Chile por las comunidades y los gobiernos locales, usando sistemas fotovoltaicos. Se instalan Sistemas Domesticos Solares de 12VDC para casas-habitacion individuales, mientras que los sistemas para escuelas, alumbrado publico, etc., se ejecutan con sistemas mas grandes de 220VAC. Con la coperacion del Instituto Solar de la Fachhochschule en Julich, Alemania, el Centro de Energia Renovable de la Universidad de Tarapaca, diseno, instalo y evaluo, la primera instalacion hibrida solar/viento para electrificacion basica en el Norte de Chile, realizado en Colpitas, un pueblo tipico pequeno del altiplano chileno. El siguiete articulo presenta los resultados y experiencias de esta primera instalacion piloto.

  9. Experiences with a small scale Solar/Wind pilot installation for basic electrification in the chilean altiplano

    Energy Technology Data Exchange (ETDEWEB)

    Sapiain, Raul; Ovalle, Ricardo; Torres, Ariel; Brockmeyer, Ricarda; Schmidt, Reinhold [Centro de Energias Renovables/Universidad de Tarapaca, Arica, (Chile); Meer, Andreas V [Solar Institute, Juelich (Germany)

    1998-12-31

    Basic rural electrification programmes are already carried out in the rural areas of northern Chile by local communities and local governments using photovoltaic systems. Solar Home Systems, 12 VDC are installed for individual households while systems for schools, public lighting etc. are realized with bigger systems, 220 VAC. Within a cooperation with the Solar Institute of the Fachhochschule Juelich, Germany, the Renewable Energy Center of the University of Tarapaca designed, installed and evaluated the first solar/wind hybrid installation for basic electrification in northern Chile, realized in Colpitas, a typical small village in the chilean altiplano. The following paper presents results and experiences of this first pilot installation. [Espanol] Ya se estan llevando a cabo programas de electrificacion rural basica en las areas rurales del Norte de Chile por las comunidades y los gobiernos locales, usando sistemas fotovoltaicos. Se instalan Sistemas Domesticos Solares de 12VDC para casas-habitacion individuales, mientras que los sistemas para escuelas, alumbrado publico, etc., se ejecutan con sistemas mas grandes de 220VAC. Con la coperacion del Instituto Solar de la Fachhochschule en Julich, Alemania, el Centro de Energia Renovable de la Universidad de Tarapaca, diseno, instalo y evaluo, la primera instalacion hibrida solar/viento para electrificacion basica en el Norte de Chile, realizado en Colpitas, un pueblo tipico pequeno del altiplano chileno. El siguiete articulo presenta los resultados y experiencias de esta primera instalacion piloto.

  10. Analisis de la microbiota en suelos cultivados del Altiplano central

    OpenAIRE

    Sivila, R.; Hervé, Dominique

    2001-01-01

    Se estudio la poblacion microbina en una rotacion de cultivos con descanso, comun en el Altiplano Central boliviano. Se determino la presencia y densidad de cuatro grupos taxonomicos de microorganismos: bacterias; hongos, actinomicetos y esporas de las micorrizas arbusculares en el suelo rizosferico de cuatro cultivos de la rotacion (papa, quinua, cebada y avena); en las principales especies silvestres perennes (#Stipa ichu, Festuca dolichophylla, Baccharis incarum$) que colonizan las parcela...

  11. Drought on the Altiplano of Bolivia and Peru: Climate, Paleoclimate, and Society

    Science.gov (United States)

    Baker, P. A.; Fritz, S. C.; Rigsby, C. A.; Li, L.; Capriles, J. M.

    2016-12-01

    We examine for the first time the economic, social and political consequences of an extreme drought on the Altiplano that persisted from 1935 to 1945, a period of substantial regional social upheaval. We also examine drought in relation to a pre-historic period of great conflict on the Altiplano during the Late Intermediate Period (ca. AD 1000-1450) (Arkush and Tung, 2013). The level of Lake Titicaca has been measured continuously since 1915. The period from 1935 to 1945 was the longest continuously dry period, with falling lake levels, in this record. Prior to 1960 there were few weather stations in the region. Compositing data from three of these stations from the western margin of Lake Titicaca provides a nearly complete precipitation record with values below the long-term annual average observed every year between 1936 and 1947. Here, 1940 was the driest year, far drier than the consequential 1982/3 El Nino drought, with precipitation only 36% of the mean. Farther north at Cuzco, Peru, every year between 1935 and 1944 was at or below the mean. 1938 was the driest year with 38% of the long-term average value of precipitation. The oxygen isotopic composition of the Quelccaya ice cap (Thompson et al., 1984), situated at the northern limit of the Lake Titicaca watershed, is a reliable indicator of regional precipitation amount. Here, d18O values of ice were continuously at or above the mean value (indicating dry conditions) between 1934 and 1944. Taken together, these four records indicate below-average precipitation at all sites in the region for ten consecutive years, 1935-1944. This extreme drought of the last century was just one manifestation of the highly significant (at the 99.8% confidence level) climate variability that has persisted for at least the past 500 years (Melice and Roucou, 1998). This variability is coherent during the instrumental period with tropical North Atlantic SST.

  12. Les nouveaux besoins en eau et en terres dans l'Altiplano bolivien ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    19 févr. 2015 ... L'Altiplano ou « haute plaine » de Bolivie est un plateau semi-aride qui représente un tiers de la superficie du pays et abrite 2,8 millions d'habitants, soit 30 % de la population bolivienne. L'Altiplano est aussi l'un des endroits les plus pauvres du pays.

  13. Using Focus Groups to Research Sensitive Issues: Insights from Group Interviews on Nursing in the Northern Ireland “Troubles”

    Directory of Open Access Journals (Sweden)

    Joanne Jordan

    2007-12-01

    Full Text Available In this article the authors discuss the usefulness of focus groups for researching sensitive issues using evidence from a study examining the experiences of nurses providing care in the context of the Northern Ireland Troubles. They conducted three group interviews with nurses during which they asked about the issues the nurses face(d in providing nursing care amid enduring social division. Through a discursive analysis of within-group interaction, they demonstrate how participants employ a range of interpretive resources, the effect of which is to prioritize particular knowledge concerning the nature of nursing care. The identification of such patterned activity highlights the ethnographic value of focus groups to reveal social conventions guiding the production of accounts but also suggests that accounts cannot be divorced from the circumstances of their production. Consequently, the authors argue that focus groups should be considered most useful for illuminating locally sanctioned ways of talking about sensitive issues.

  14. Lower Cretaceous Luscar group (revised) of the northern and north-central foothills of Alberta

    Energy Technology Data Exchange (ETDEWEB)

    Langenberg, C W; McMechan, M E

    1985-03-01

    Lower Cretaceous coal-bearing strata exposed in the northern and north-central foothills of Alberta form part of a predominantly nonmarine succession that extends from Montana to northeastern British Columbia. The Luscar Group (revised) forms the sequence of coal bearing Lower Cretaceous strata that disconformably overlies marine and nonmarine strata of the Nikanassin Formation or Minnes Group and disconformably underlies marine shales of the Blackstone or Shaftesbury formations. It includes a thin, basal conglomerate, a predominantly nonmarine sandstone and shale unit that locally contains coal; a marine shale and sandstone unit, and an upper nonmarine sandstone and shale unit that contains thick commercial coal seams. These units form the Cadomin, Gladstone, Moosebar and Gates formations, respectively. The Luscar Group is exposed from Kakwa River to Clearwater River in the Foothills of Alberta. It represents a slight modification, by the inclusion of the thin basal conglomerate, from the previous usage of the term Luscar in the northern Foothills of Alberta. 25 references.

  15. Administration of triclabendazole is safe and effective in controlling fascioliasis in an endemic community of the Bolivian Altiplano.

    Science.gov (United States)

    Villegas, Fidel; Angles, René; Barrientos, René; Barrios, Gary; Valero, María Adela; Hamed, Kamal; Grueninger, Heiner; Ault, Steven K; Montresor, Antonio; Engels, Dirk; Mas-Coma, Santiago; Gabrielli, Albis Francesco

    2012-01-01

    The Bolivian northern Altiplano is characterized by a high prevalence of Fasciola hepatica infection. In order to assess the feasibility, safety and efficacy of large-scale administration of triclabendazole as an appropriate public health measure to control morbidity associated with fascioliasis, a pilot intervention was implemented in 2008. Schoolchildren from an endemic community were screened for fascioliasis and treated with a single administration of triclabendazole (10 mg/kg). Interviews to assess the occurrence of adverse events were conducted on treatment day, one week later, and one month after treatment. Further parasitological screenings were performed three months after treatment and again two months later (following a further treatment) in order to evaluate the efficacy of the intervention. Ninety infected children were administered triclabendazole. Adverse events were infrequent and mild. No serious adverse events were reported. Observed cure rates were 77.8% after one treatment and 97.8% after two treatments, while egg reduction rates ranged between 74% and 90.3% after one treatment, and between 84.2% and 99.9% after two treatments. The proportion of high-intensity infections (≥ 400 epg) decreased from 7.8% to 1.1% after one treatment and to 0% after two treatments. Administration of triclabendazole is a feasible, safe and efficacious public health intervention in an endemic community in the Bolivian Altiplano, suggesting that preventive chemotherapy can be applied to control of fascioliasis. Further investigations are needed to define the most appropriate frequency of treatment.

  16. Potencialidades del cultivo de Alcachofa en el altiplano Cundiboyacense

    OpenAIRE

    Peña López, Mayda Yudy

    2016-01-01

    Es evidente que en los últimos años, el impulso económico del país ha generado un gran dinamismo desarrollando productos no tradicionales, con un alto valor agregado, tendientes a satisfacer demandas y necesidades de los consumidores cada vez más educados y exigentes, uno de estos productos que se ha mantenido con el tiempo es la alcachofa. El objetivo principal de este trabajo es realizar el análisis y optimización de la producción y comercialización de la alcachofa en el Altiplano Cundiboya...

  17. Resolution VII International Conference Working Group on Birds of Prey of Northern Eurasia “Birds of Prey of Northern Eurasia: Problems and Adaptation Under Modern Conditions”

    Directory of Open Access Journals (Sweden)

    Igor V. Karyakin

    2017-01-01

    Full Text Available From 19 to 24 September, 2016 VII International Conference of the Working Group on Raptors of Northern Eurasia “Birds of prey of Northern Eurasia: problems and adaptation under modern conditions” was held on the basis of the Sochi National Park. Materials for the conference were presented by 198 ornithologists from Russia, Ukraine, Belarus, Kazakhstan, Moldova, Turkmenistan, Austria, Great Britain, Hungary, Mongolia, Poland, Estonia and the USA, who published 148 articles in two collections “Birds of prey of Northern Eurasia” and “Palearctic Harriers”.

  18. ABO blood groups and risk for obesity in Arar, Northern Saudi Arabia.

    Science.gov (United States)

    Aboel-Fetoh, Nagah M; Alanazi, Arwa R; Alanazi, Abdullah S; Alruwili, Asma N

    2016-12-01

    ABO blood groups are associated with some important chronic diseases. Previous studies have observed an association between ABO blood group and risk for obesity. This study aimed to determine whether there is an association between ABO blood groups and obesity in apparently healthy attendees of primary healthcare (PHC) centers in Arar city, Northern Saudi Arabia. This cross-sectional study included 401 participants aged 15 years and older attending three randomly selected PHC centers in Arar city. Data were collected by means of personal interview using a predesigned questionnaire. Anthropometric examination included height and weight measurements with calculation of BMI. ABO and Rh blood groups were determined. The majority of the participants were female (70.8%). The mean±SD age was 28.6±9.1 years. Only 5.7% were underweight. Both normal and overweight participants were equal in number and constituted 28.4%, whereas obese individuals constituted 37.4% with a mean BMI of 28.56±8.0. Blood group O was the most common (44.1%), followed by A (30.9%), B (18.7%), and AB (6.2%). Rh-positive cases constituted 87.0%. Blood group O was the most common type among the obese individuals (44.7%), followed by A, B, and AB groups (30, 20, and 5.3%, respectively). BMI was highest (28.8±9.2) in blood group O. There were no statistically significant differences between different ABO blood groups as regards BMI, Rh, and sex. Moreover, there was no statistically significant difference between Rh type and BMI. The prevalence of obesity and overweight is high in the population attending PHC centers of Arar city, Northern Saudi Arabia. There is no association between overweight, obesity, and ABO blood groups or Rh.

  19. Two Millennia of Pb Pollution Related to Altiplano Metallurgical Activities and Leaded Gasoline in South America from Illimani Ice Core

    Science.gov (United States)

    Eichler, A.; Gramlich, G.; Kellerhals, T.; Tobler, L.; Schwikowski, M.

    2014-12-01

    The exploitation of the extended polymetallic deposits of the Altiplano in South America led to significant emissions of the neurotoxic Pb into the atmosphere already since pre-Colonial times. Long-term histories of Pb pollution in Eastern and Western Europe, Asia, and North America suggest that within the Northern Hemisphere emissions from metallurgy and coal combustion are minor compared to that from leaded gasoline during the second half of the 20th century. However, there is no equivalent data for Southern America. Here we present the first comprehensive, high-resolution two millennia Pb emission history for South America, based on an ice core record from Illimani glacier in Bolivia. Illimani is the highest mountain of the eastern Bolivian Andes and is located at the northeastern margin of the Bolivian Altiplano. The 2000 year ice-core based decadal Pb deposition history revealed highest Pb Enrichment Factors (EFs) during the period 1965-85. Metallurgical processing for silver production during periods of the Tiwanaku culture (400-900 AD), the Inca empire (1450-1532 AD), colonial times (1532-1900 AD), and the tin production at the beginning of the 20th century were identified as major sources for enhanced Pb EFs before the 1960s. Gasoline related Pb emissions in 1965-85, however, led to a threefold increase of the Pb EFs compared to the emission level from metal production, considerably preceding those of the past 2000 years. This finding is complementary to the local air pollution signal preserved in lake sediments and in good agreement with various studies from the Northern Hemisphere.

  20. Pliocene and Pleistocene chronostratigraphy of continental sediments underlying the Altiplano at La Paz, Bolivia

    Science.gov (United States)

    Roberts, Nicholas J.; Barendregt, René W.; Clague, John J.

    2018-06-01

    Continental sediments underlying the Altiplano plateau provide insight into the late Cenozoic evolution of the Central Andes. We characterize the magnetostratigraphy and lithostratigraphy of the upper part of this fill sequence along a transect extending southwestward from the Cordillera Real at La Paz, Bolivia, where it is best exposed. Multiple polarity reversals and the locally extensive, 2.74-Ma Chijini Tuff enable correlation between our six sections and three previously reported sections. The tuff ties the composite polarity sequence to the geomagnetic polarity time scale, demonstrating that the stratigraphic record extends from the latest Gilbert Chron (ca. 3.8 Ma) to the late Olduvai subchron (ca. 1.8 Ma), or possibly Jaramillo subchron (ca. 1.0 Ma). The sequence provides Earth's longest known record of low-latitude glaciation and the only record of Pliocene tropical glaciation. It includes evidence for 16 late Pliocene and Early Pleistocene glaciations, separated by interglacials of sufficient length (>103-104 a) to produce mature soil profiles. Successively larger ice caps formed directly before, during, and after the globally warm mid-Piacenzian (3.265-3.025 Ma), and throughout Plio-Pleistocene climate deterioration. The late Pliocene glacial units predate the onset of widespread Northern Hemisphere continental glaciation and in most cases unambiguously correspond to specific cool peaks of the astronomically tuned, benthic oxygen isotope (δ18O) record, including marine isotope stages MG2, M2, KM2, and G10. The glacial events broadly coincide with those nearer both poles, suggesting inter-hemispheric climate linkages. The early formation and subsequent expansion of ice caps beyond glacier margins of the Last Glacial Maximum suggest that the Cordillera Real likely attained its modern height before ca. 3.4 Ma. The number and timing of glaciations, and long-term sediment accumulation and incision rates suggest that the local Altiplano surface formed by ca

  1. TRUST MATTERS: A CROSS-CULTURAL COMPARISON OF NORTHERN GHANA AND OAXACA GROUPS

    Directory of Open Access Journals (Sweden)

    Cristina eAcedo-Carmona

    2015-05-01

    Full Text Available A cross-cultural analysis of trust and cooperation networks in Northern Ghana (NGHA and Oaxaca (OAX was carried out by means of ego networks and interviews. These regions were chosen because both are inhabited by several ethnic groups, thus providing a good opportunity to test the cultural group selection hypothesis. Against the predictions of this approach, we found that in both regions cooperation is grounded in personal trust groups, and that social cohesion depends on these emotional bonds. Moreover, in agreement with Fiske's notion of evolved proclivities, we also found two distinct kinds of trust networks, one for each region, which vary in terms of the degree of ethnic interrelation. This pattern suggests that social cohesion increases when environmental resources are scarce.

  2. Genetic structure of the Mon-Khmer speaking groups and their affinity to the neighbouring Tai populations in Northern Thailand

    OpenAIRE

    Kutanan, Wibhu; Kampuansai, Jatupol; Fuselli, Silvia; Nakbunlung, Supaporn; Seielstad, Mark; Bertorelle, Giorgio; Kangwanpong, Daoroong

    2011-01-01

    Abstract Background The Mon-Khmer speaking peoples inhabited northern Thailand before the arrival of the Tai speaking people from southern China in the thirteenth century A.D. Historical and anthropological evidence suggests a close relationship between the Mon-Khmer groups and the present day majority northern Thai groups. In this study, mitochondrial and Y-chromosomal DNA polymorphisms in more than 800 volunteers from eight Mon-Khmer and ten Tai speaking populations were investigated to est...

  3. Males follow females during fissioning of a group of northern muriquis.

    Science.gov (United States)

    Tokuda, Marcos; Boubli, Jean P; Mourthé, Ítalo; Izar, Patrícia; Possamai, Carla B; Strier, Karen B

    2014-06-01

    Although well documented in matrilocal primate species, group fission is still a poorly known phenomenon among patrilocal primates. In this paper we describe in detail a group fission event in the population of northern muriquis at the Reserva Particular do Patrimônio Natural-Feliciano Miguel Abdala in Caratinga, Minas Gerais, Brazil, using Social Network Analyses (SNA). Data on association patterns were collected during systematic observations from May 2002 to September 2005, and analyzed for dry (from May to October) and rainy seasons (from November to April). The fission process started with subgroup formation in the rainy season 2002-2003, and was completed by the dry season of 2003. By the dry season 2003, the parent group (Jaó) had fissioned to form a second mixed-sex group (Nadir) while a subgroup of males (MU) moved between the parent group and the newly established group. Before the Jaó group fission started (dry season 2002) and during its initial phases (rainy season 2002-2003), females that ultimately composed the daughter group (Nadir) were the most peripheral in the association network. In the rainy season 2002-2003, the median monthly (N=6) operational sex ratio (OSR) of Jaó group was 2.81. However, once Jaó females initiated the fissioning process to establish the Nadir group, the OSR was more favorable to males in the Nadir group than in the Jaó group. Our results suggest that males followed the females to escape an unfavorable OSR in their natal group. © 2013 Wiley Periodicals, Inc.

  4. How young people communicate risks of snowmobiling in northern Norway: a focus group study.

    Science.gov (United States)

    Mehus, Grete; Germeten, Sidsel; Henriksen, Nils

    2011-04-01

    This study aims to understand how the risks of snowmobiling are communicated among northern Norwegian youths. Study design. A qualitative design with focus group interviews was chosen. Interviews centred on safety precautions and estimation of risks related to snowmobiling and driving patterns. Eighty-one students (31 girls and 50 boys) aged between 16 and 23 years from 8 high schools were interviewed in 17 focus groups that were segregated by gender. Interview data were analysed using qualitative content analysis. Boys and girls communicated differently about risks. Peer-group conformity appeared stronger among boys than girls. Boys did not spontaneously relate risks to their snowmobile activities, while girls did. Boys focused upon training, coping and balance between control and lack of control while driving. Girls talked about risks, were aware of risks and sought to avoid risky situations, in contrast to boys. Boys' risk communication in groups was about how to manage challenging situations. Their focus overall was on trying to maintain control while simultaneously testing their limits. Three risk categories emerged: those who drive as they ought to (mostly girls), those who occasionally take some risks (boys and girls) and those who are extreme risk-takers (a smaller number of boys). Perceptions of and communication about risk are related to gender, peer group and familiarity with risk-taking when snowmobiling. Northern Norwegian boys' driving behaviour highlights a specific need for risk reduction, but this must also draw upon factors such as acceptance of social and cultural codes and common sense related to snowmobiling.

  5. Ethnicity and child health in northern Tanzania: Maasai pastoralists are disadvantaged compared to neighbouring ethnic groups.

    Directory of Open Access Journals (Sweden)

    David W Lawson

    Full Text Available The Maasai of northern Tanzania, a semi-nomadic ethnic group predominantly reliant on pastoralism, face a number of challenges anticipated to have negative impacts on child health, including marginalisation, vulnerabilities to drought, substandard service provision and on-going land grabbing conflicts. Yet, stemming from a lack of appropriate national survey data, no large-scale comparative study of Maasai child health has been conducted. Savannas Forever Tanzania surveyed the health of over 3500 children from 56 villages in northern Tanzania between 2009 and 2011. The major ethnic groups sampled were the Maasai, Sukuma, Rangi, and the Meru. Using multilevel regression we compare each ethnic group on the basis of (i measurements of child health, including anthropometric indicators of nutritional status and self-reported incidence of disease; and (ii important proximate determinants of child health, including food insecurity, diet, breastfeeding behaviour and vaccination coverage. We then (iii contrast households among the Maasai by the extent to which subsistence is reliant on livestock herding. Measures of both child nutritional status and disease confirm that the Maasai are substantially disadvantaged compared to neighbouring ethnic groups, Meru are relatively advantaged, and Rangi and Sukuma intermediate in most comparisons. However, Maasai children were less likely to report malaria and worm infections. Food insecurity was high throughout the study site, but particularly severe for the Maasai, and reflected in lower dietary intake of carbohydrate-rich staple foods, and fruits and vegetables. Breastfeeding was extended in the Maasai, despite higher reported consumption of cow's milk, a potential weaning food. Vaccination coverage was lowest in Maasai and Sukuma. Maasai who rely primarily on livestock herding showed signs of further disadvantage compared to Maasai relying primarily on agriculture. We discuss the potential ecological

  6. Administration of Triclabendazole Is Safe and Effective in Controlling Fascioliasis in an Endemic Community of the Bolivian Altiplano

    Science.gov (United States)

    Villegas, Fidel; Angles, René; Barrientos, René; Barrios, Gary; Valero, María Adela; Hamed, Kamal; Grueninger, Heiner; Ault, Steven K.; Montresor, Antonio; Engels, Dirk; Mas-Coma, Santiago; Gabrielli, Albis Francesco

    2012-01-01

    Background The Bolivian northern Altiplano is characterized by a high prevalence of Fasciola hepatica infection. In order to assess the feasibility, safety and efficacy of large-scale administration of triclabendazole as an appropriate public health measure to control morbidity associated with fascioliasis, a pilot intervention was implemented in 2008. Materials and Methods Schoolchildren from an endemic community were screened for fascioliasis and treated with a single administration of triclabendazole (10 mg/kg). Interviews to assess the occurrence of adverse events were conducted on treatment day, one week later, and one month after treatment. Further parasitological screenings were performed three months after treatment and again two months later (following a further treatment) in order to evaluate the efficacy of the intervention. Results Ninety infected children were administered triclabendazole. Adverse events were infrequent and mild. No serious adverse events were reported. Observed cure rates were 77.8% after one treatment and 97.8% after two treatments, while egg reduction rates ranged between 74% and 90.3% after one treatment, and between 84.2% and 99.9% after two treatments. The proportion of high-intensity infections (≥400 epg) decreased from 7.8% to 1.1% after one treatment and to 0% after two treatments. Conclusion Administration of triclabendazole is a feasible, safe and efficacious public health intervention in an endemic community in the Bolivian Altiplano, suggesting that preventive chemotherapy can be applied to control of fascioliasis. Further investigations are needed to define the most appropriate frequency of treatment. PMID:22880138

  7. COOL YOUNG STARS IN THE NORTHERN HEMISPHERE: β PICTORIS AND AB DORADUS MOVING GROUP CANDIDATES

    International Nuclear Information System (INIS)

    Schlieder, Joshua E.; Simon, Michal; Lépine, Sébastien

    2012-01-01

    As part of our continuing effort to identify new, low-mass members of nearby, young moving groups (NYMGs), we present a list of young, low-mass candidates in the northern hemisphere. We used our proven proper-motion selection procedure and ROSAT X-ray and GALEX-UV activity indicators to identify 204 young stars as candidate members of the β Pictoris and AB Doradus NYMGs. Definitive membership assignment of a given candidate will require a measurement of its radial velocity and distance. We present a simple system of indices to characterize the young candidates and help prioritize follow-up observations. New group members identified in this candidate list will be high priority targets for (1) exoplanet direct imaging searches, (2) the study of post-T-Tauri astrophysics, (3) understanding recent local star formation, and (4) the study of local galactic kinematics. Information available now allows us to identify eight likely new members in the list. Two of these, a late-K and an early-M dwarf, we find to be likely members of the β Pic group. The other six stars are likely members of the AB Dor moving group. These include an M dwarf triple system, and three very cool objects that may be young brown dwarfs, making them the lowest-mass, isolated objects proposed in the AB Dor moving group to date.

  8. Preliminary chronostratigraphy of the Tetagouche and Fournier groups in northern New Brunswick

    International Nuclear Information System (INIS)

    Sullivan, R.W.; VanStaal, C.R.

    1996-01-01

    Seven U-Pb zircon ages of volcanic rocks from northern New Brunswick are reported and a preliminary stratigraphy of the middle Ordovician Tetagouche and Fournier groups is presented. Deposition of the Tetagouche Group started with calcareous rocks of the Vallee Lourdes Formation in the Late Arenig (>470 Ma). Quartz- and feldspar-phyric felsic volcanic rocks of the immediately overlying Nepisiquit Falls Formation yielded U-Pb zircon ages between ca. 471 and 469 Ma. These volcanic rocks are time stratigraphic equivalents of the feldspar-phyric dacites of the Spruce Lake Formation, which yielded a U-Pb zircon age of ca. 470 Ma, and tholeiitic and alkalic pillow basalts of the structurally overlying Canoe Landing Lake Formation. The final phase of rhyolitic to dacitic volcanism is marked by the emplacement of distinct quartz- and feldspar-phyric dacitic porphyries at ca. 465 Ma, thus limiting silicic volcanism to the Late Arenig and llanvim. During the Ilandeilo and Caradoc (ca. 464-457 Ma) volcanic activity in the Tetagouche Group was characterized by extrusion of alkali basalts and minor comendites, interlayered with dark shales and siltstones of the Boucher Brook Formation. Oceanic crust of the Fournier Group was also formed during this period. (author). 29 refs., 1 tab., 10 figs

  9. Preliminary chronostratigraphy of the Tetagouche and Fournier groups in northern New Brunswick

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, R W; VanStaal, C R [Geological Survey of Canada, Ottawa, ON (Canada)

    1997-12-31

    Seven U-Pb zircon ages of volcanic rocks from northern New Brunswick are reported and a preliminary stratigraphy of the middle Ordovician Tetagouche and Fournier groups is presented. Deposition of the Tetagouche Group started with calcareous rocks of the Vallee Lourdes Formation in the Late Arenig (>470 Ma). Quartz- and feldspar-phyric felsic volcanic rocks of the immediately overlying Nepisiquit Falls Formation yielded U-Pb zircon ages between ca. 471 and 469 Ma. These volcanic rocks are time stratigraphic equivalents of the feldspar-phyric dacites of the Spruce Lake Formation, which yielded a U-Pb zircon age of ca. 470 Ma, and tholeiitic and alkalic pillow basalts of the structurally overlying Canoe Landing Lake Formation. The final phase of rhyolitic to dacitic volcanism is marked by the emplacement of distinct quartz- and feldspar-phyric dacitic porphyries at ca. 465 Ma, thus limiting silicic volcanism to the Late Arenig and llanvim. During the Ilandeilo and Caradoc (ca. 464-457 Ma) volcanic activity in the Tetagouche Group was characterized by extrusion of alkali basalts and minor comendites, interlayered with dark shales and siltstones of the Boucher Brook Formation. Oceanic crust of the Fournier Group was also formed during this period. (author). 29 refs., 1 tab., 10 figs.

  10. Different selection pressures give rise to distinct ethnic phenomena : a functionalist framework with illustrations from the Peruvian Altiplano.

    Science.gov (United States)

    Moya, Cristina; Boyd, Robert

    2015-03-01

    Many accounts of ethnic phenomena imply that processes such as stereotyping, essentialism, ethnocentrism, and intergroup hostility stem from a unitary adaptation for reasoning about groups. This is partly justified by the phenomena's co-occurrence in correlational studies. Here we argue that these behaviors are better modeled as functionally independent adaptations that arose in response to different selection pressures throughout human evolution. As such, different mechanisms may be triggered by different group boundaries within a single society. We illustrate this functionalist framework using ethnographic work from the Quechua-Aymara language boundary in the Peruvian Altiplano. We show that different group boundaries motivate different ethnic phenomena. For example, people have strong stereotypes about socioeconomic categories, which are not cooperative units, whereas they hold fewer stereotypes about communities, which are the primary focus of cooperative activity. We also show that, despite the cross-cultural importance of ethnolinguistic boundaries, the Quechua-Aymara linguistic distinction does not strongly motivate any of these intergroup processes.

  11. Transient modelling of lacustrine regressions: two case studies from the Andean Altiplano

    Science.gov (United States)

    Condom, Thomas; Coudrain, Anne; Dezetter, Alain; Brunstein, Daniel; Delclaux, François; Jean-Emmanuel, Sicart

    2004-09-01

    A model was developed for estimating the delay between a change in climatic conditions and the corresponding fall of water level in large lakes. The input data include: rainfall, temperature, extraterrestrial radiation and astronomical mid-month daylight hours. The model uses two empirical coefficients for computing the potential evaporation and one parameter for the soil capacity. The case studies are two subcatchments of the Altiplano (196 000 km2), in which the central low points are Lake Titicaca and a salar corresponding to the desiccation of the Tauca palaeolake. During the Holocene, the two catchments experienced a 100 m fall in water level corresponding to a decrease in water surface area of 3586 km2 and 55 000 km2, respectively. Under modern climatic conditions with a marked rainy season, the model allows simulation of water levels in good agreement with the observations: 3810 m a.s.l. for Lake Titicaca and lack of permanent wide ponds in the southern subcatchment. Simulations were carried out under different climatic conditions that might explain the Holocene fall in water level. Computed results show quite different behaviour for the two subcatchments. For the northern subcatchment, the time required for the 100 m fall in lake-level ranges between 200 and 2000 years when, compared with the present conditions, (i) the rainfall is decreased by 15% (640 mm/year), or (ii) the temperature is increased by 5.5 °C, or (iii) rainfall is distributed equally over the year. For the southern subcatchment (Tauca palaeolake), the time required for a 100 m decrease in water level ranges between 50 and 100 years. This decrease requires precipitation values lower than 330 mm/year.

  12. A new species of Bruchidius (Coleoptera: Chrysomelidae: Bruchinae) from Albizia in Northern Thailand and a review of Bruchidius group 5.

    Science.gov (United States)

    Tuda, Midori

    2008-04-01

    A new species, Bruchidius paicus (Insecta, Coleoptera) reared from the seeds of a leguminous tree, Albizia lebbeck (Fabaceae: Mimosoideae: Ingeae), is described from Northern Thailand. Inspection of genital and external morphological traits of B. paicus revealed that the new species belongs to Bruchidius Group 5 (sensu ). The definition of Group 5 is reviewed based on both external and genital morphology. Further comparison of the group to molecular Clade I of Bruchidius (sensu ) indicates the two groups correspond to each other.

  13. Los mayas del altiplano: supervivencia indígena en Chiapas y Guatemala

    OpenAIRE

    Lovell, W. George

    2002-01-01

    En el contexto americano, pocos grupos indígenas han demostrado la capacidad de sobrevivir a lo largo de la historia como los mayas del altiplano. Hoy día en Chiapas existen más de un millón de indígenas mayas, un número que asciende a cinco o seis millones en el caso de Guatemala. Los pueblos mayas han respondido a la invasión y a la dominación para conservar elementos importantes de su cultura. Este artículo discute las formas en que los mayas del altiplano se han adaptado para sobrevivir a...

  14. Telemedicina en Bolivia: proyecto RAFT-Altiplano, experiencias, perspectivas y recomendaciones

    OpenAIRE

    Vargas, Alejandro; Ugalde, Miguel; Vargas, Reynaldo; Narvaez, Ramiro; Geissbuhler, Antoine

    2014-01-01

    OBJETIVO: El objetivo del proyecto RAFT-Altiplano (RAFT, Red Africana Francófona de Telemedicina) es evaluar la viabilidad, potencialidad y riesgos de la implementación y el desarrollo de una red de telemedicina en el contexto de un país en desarrollo, como es el caso del Altiplano de Bolivia, para mejorar el acceso a la atención médica y la formación continua en el área rural. En este estudio se describe el desarrollo de dicho proyecto entre 2011 y 2013. MÉTODOS: Se donaron equipos de teleme...

  15. Ingestion of microplastics by natural zooplankton groups in the northern South China Sea.

    Science.gov (United States)

    Sun, Xiaoxia; Li, Qingjie; Zhu, Mingliang; Liang, Junhua; Zheng, Shan; Zhao, Yongfang

    2017-02-15

    The ingestion of microplastics by five natural zooplankton groups in the northern South China Sea was studied for the first time and two types of sampling nets (505μm and 160μm in mesh size) were compared. The microplastics were detected in zooplankton sampled from 16 stations, with the fibrous microplastics accounting for the largest proportion (70%). The main component of the found microplastics was polyester. The average length of the microplastics was 125μm and 167μm for Nets I and II, respectively. The encounter rates of microplastics/zooplankton increased with trophic levels. The average encounter rate of microplastics/zooplankton was 5%, 15%, 34%, 49%, and 120% for Net I, and 8%, 21%, 47%, 60%, and 143% for Net II for copepods, chaetognaths, jellyfish, shrimp, and fish larvae, respectively. The average abundance of microplastics that were ingested by zooplankton was 4.1pieces/m 3 for Net I and 131.5pieces/m 3 for Net II. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Climate change and potato cropping in the Peruvian Altiplano

    Science.gov (United States)

    Sanabria, J.; Lhomme, J. P.

    2013-05-01

    The potential impacts of climate change on potatoes cropping in the Peruvian highlands (Altiplano) is assessed using climate projections for 2071-2100, obtained from the HadRM3P regional atmospheric model of the Hadley Centre. The atmospheric model is run under two different special report on emission scenarios: high CO2 concentration (A2) and moderate CO2 concentration (B2) for four locations situated in the surroundings of Lake Titicaca. The two main varieties of potato cultivated in the area are studied: the Andean potato ( Solanum tuberosum) and the bitter potato ( Solanum juzepczukii). A simple process-oriented model is used to quantify the climatic impacts on crops cycles and yields by combining the effects of temperature on phenology, of radiation and CO2 on maximum yield and of water balance on yield deficit. In future climates, air temperature systematically increases, precipitation tends to increase at the beginning of the rainy season and slightly decreases during the rest of the season. The direct effects of these climatic changes are earlier planting dates, less planting failures and shorter crop cycles in all the four locations and for both scenarios. Consequently, the harvesting dates occur systematically earlier: roughly in January for the Andean potato instead of March in the current situation and in February for the bitter potato instead of April. Overall, yield deficits will be higher under climate change than in the current climate. There will be a strong negative impact on yields for S. tuberosum (stronger under A2 scenario than under B2); the impact on S. juzepczukii yields, however, appears to be relatively mixed and not so negative.

  17. Genetic structure of the Mon-Khmer speaking groups and their affinity to the neighbouring Tai populations in Northern Thailand.

    Science.gov (United States)

    Kutanan, Wibhu; Kampuansai, Jatupol; Fuselli, Silvia; Nakbunlung, Supaporn; Seielstad, Mark; Bertorelle, Giorgio; Kangwanpong, Daoroong

    2011-06-15

    The Mon-Khmer speaking peoples inhabited northern Thailand before the arrival of the Tai speaking people from southern China in the thirteenth century A.D. Historical and anthropological evidence suggests a close relationship between the Mon-Khmer groups and the present day majority northern Thai groups. In this study, mitochondrial and Y-chromosomal DNA polymorphisms in more than 800 volunteers from eight Mon-Khmer and ten Tai speaking populations were investigated to estimate the degree of genetic divergence between these major linguistic groups and their internal structure. A large fraction of genetic variation is observed within populations (about 80% and 90% for mtDNA and the Y-chromosome, respectively). The genetic divergence between populations is much higher in Mon-Khmer than in Tai speaking groups, especially at the paternally inherited markers. The two major linguistic groups are genetically distinct, but only for a marginal fraction (1 to 2%) of the total genetic variation. Genetic distances between populations correlate with their linguistic differences, whereas the geographic distance does not explain the genetic divergence pattern. The Mon-Khmer speaking populations in northern Thailand exhibited the genetic divergence among each other and also when compared to Tai speaking peoples. The different drift effects and the post-marital residence patterns between the two linguistic groups are the explanation for a small but significant fraction of the genetic variation pattern within and between them. © 2011 Kutanan et al; licensee BioMed Central Ltd.

  18. Multi-parametric investigation of the volcano-hydrothermal system at Tatun Volcano Group, Northern Taiwan

    Science.gov (United States)

    Rontogianni, S.; Konstantinou, K. I.; Lin, C.-H.

    2012-07-01

    The Tatun Volcano Group (TVG) is located in northern Taiwan near the capital Taipei. In this study we selected and analyzed almost four years (2004-2007) of its seismic activity. The seismic network established around TVG initially consisted of eight three-component seismic stations with this number increasing to twelve by 2007. Local seismicity mainly involved high frequency (HF) earthquakes occurring as isolated events or as part of spasmodic bursts. Mixed and low frequency (LF) events were observed during the same period but more rarely. During the analysis we estimated duration magnitudes for the HF earthquakes and used a probabilistic non-linear method to accurately locate all these events. The complex frequencies of LF events were also analyzed with the Sompi method indicating fluid compositions consistent with a misty or dusty gas. We juxtaposed these results with geochemical/temperature anomalies extracted from fumarole gas and rainfall levels covering a similar period. This comparison is interpreted in the context of a model proposed earlier for the volcano-hydrothermal system of TVG where fluids and magmatic gases ascend from a magma body that lies at around 7-8 km depth. Most HF earthquakes occur as a response to stresses induced by fluid circulation within a dense network of cracks pervading the upper crust at TVG. The largest (ML ~ 3.1) HF event that occurred on 24 April 2006 at a depth of 5-6 km had source characteristics compatible with that of a tensile crack. It was followed by an enrichment in magmatic components of the fumarole gases as well as a fumarole temperature increase, and provides evidence for ascending fluids from a magma body into the shallow hydrothermal system. This detailed analysis and previous physical volcanology observations at TVG suggest that the region is volcanically active and that measures to mitigate potential hazards have to be considered by the local authorities.

  19. Multi-parametric investigation of the volcano-hydrothermal system at Tatun Volcano Group, Northern Taiwan

    Directory of Open Access Journals (Sweden)

    S. Rontogianni

    2012-07-01

    Full Text Available The Tatun Volcano Group (TVG is located in northern Taiwan near the capital Taipei. In this study we selected and analyzed almost four years (2004–2007 of its seismic activity. The seismic network established around TVG initially consisted of eight three-component seismic stations with this number increasing to twelve by 2007. Local seismicity mainly involved high frequency (HF earthquakes occurring as isolated events or as part of spasmodic bursts. Mixed and low frequency (LF events were observed during the same period but more rarely. During the analysis we estimated duration magnitudes for the HF earthquakes and used a probabilistic non-linear method to accurately locate all these events. The complex frequencies of LF events were also analyzed with the Sompi method indicating fluid compositions consistent with a misty or dusty gas. We juxtaposed these results with geochemical/temperature anomalies extracted from fumarole gas and rainfall levels covering a similar period. This comparison is interpreted in the context of a model proposed earlier for the volcano-hydrothermal system of TVG where fluids and magmatic gases ascend from a magma body that lies at around 7–8 km depth. Most HF earthquakes occur as a response to stresses induced by fluid circulation within a dense network of cracks pervading the upper crust at TVG. The largest (ML ~ 3.1 HF event that occurred on 24 April 2006 at a depth of 5–6 km had source characteristics compatible with that of a tensile crack. It was followed by an enrichment in magmatic components of the fumarole gases as well as a fumarole temperature increase, and provides evidence for ascending fluids from a magma body into the shallow hydrothermal system. This detailed analysis and previous physical volcanology observations at TVG suggest that the region is volcanically active and that measures to mitigate potential hazards have to be considered by the local authorities.

  20. Preparing for climate change: Breeding frost tolerant potatoes adapted to Andean Highlands especially the Altiplano

    Science.gov (United States)

    Frost can have a devastating impact on potato production since most cultivated potatoes are very sensitive to frost and are severely damaged at air temperatures below -2 or -3 C. In the Altiplano of Peru and Bolivia over 60,000 hectares of potato production is impacted by frost. It has been estimate...

  1. Contribution of isotope techniques to evaluate water resources in the Peruvian Altiplano

    International Nuclear Information System (INIS)

    Araguas, L.; Arroyo, C.; Palza, G.; Rojas, R.; Romero, J.; Silar, J.

    1999-01-01

    Environmental isotopes H , 18 O, 13 C, 3 H, and 14 C were regularly measured in precipitation, surface, and ground water to investigate a series of problems linked with the management of water resources in the Peruvian Altiplano, a plateau located in Southern Peru

  2. Sombrero uplift above the Altiplano-Puna Magma Body: evidence of a ballooning mid-crustal diapir.

    Science.gov (United States)

    Fialko, Yuri; Pearse, Jill

    2012-10-12

    The Altiplano-Puna ultralow-velocity zone in the central Andes, South America, is the largest active magma body in Earth's continental crust. Space geodetic observations reported an uplift in the Altiplano-Puna proper at a rate of ~10 mm/year; however, the nature of the inferred inflation source has been uncertain. We present data showing that the uplift has persisted at a nearly constant rate over the past two decades, and is surrounded by a broad zone of subsidence. We show that the ongoing uplift and peripheral subsidence may result from a large mid-crustal diapir fed by partial melt from the Altiplano-Puna Magma Body.

  3. Dolce Vita in the Rice Paddy - Characterization of weedy rice groups in Northern Italy and investigation of their evolutionary origins

    OpenAIRE

    Grimm, Annabelle

    2014-01-01

    The thesis deals with the topic of the invasive rice form called weedy rice or red rice. Studies focused on the geographical area of Italy. Different populations of weedy rice in Italy were genetically characterized. The evolutionary origins of different weedy rice groups were investigated using molecular, morphological and physiological methods. Invasion of wild rice as well as de-domestication of cultivars could be identified as evolutionary sources of weedy rice in Northern Italy.

  4. Typical patterns of smallholder vulnerability to weather extremes with regard to food security in the Peruvian Altiplano

    NARCIS (Netherlands)

    Sietz, D.; Mamani Choque, S.E.; Lûdeke, M.K.B.

    2012-01-01

    Smallholder livelihoods in the Peruvian Altiplano are frequently threatened by weather extremes, including droughts, frosts and heavy rainfall. Given the persistence of significant undernourishment despite regional development efforts, we propose a cluster approach to evaluate smallholders’

  5. The Genetic History of Indigenous Populations of the Peruvian and Bolivian Altiplano: The Legacy of the Uros

    OpenAIRE

    Sandoval, Jos? Raul; Lacerda, Daniela R.; Jota, Marilza S. A.; Salazar-Granara, Alberto; Vieira, Pedro Paulo R.; Acosta, Oscar; Cuellar, Cinthia; Revollo, Susana; Fujita, Ricardo; Santos, Fabr?cio R.

    2013-01-01

    The Altiplano region of the South American Andes is marked by an inhospitable climate to which the autochthonous human populations adapted and then developed great ancient civilizations, such as the Tiwanaku culture and the Inca Empire. Since pre-Columbian times, different rulers established themselves around the Titicaca and Poopo Lakes. By the time of the arrival of Spaniards, Aymara and Quechua languages were predominant on the Altiplano under the rule of the Incas, although th...

  6. Isotopic composition and origin of the precipitation in Northern Chile

    International Nuclear Information System (INIS)

    Aravena, R.; Pena, H.; Grilli, A.; Pollastri, A.; Fuenzalida, H.

    1997-01-01

    Full text: A three years isotope data on precipitation collected in northern Chile show a very distinct pattern, with depleted δ 18 and -150/00 observed at high altitude stations, compared to δ 18 0 values ranging between - 10 and -6/00 measured at the lower altitude areas. The depleted δ 0 values observed in the high altitude area, the Altiplano, are related to different processes that affect the air masses as moved from the Atlantic, crossed the Amazon Basin (continental effect), ascend the Andes (altitude effect) and precipitated (convective effect) in the Altiplano. It is postulated that a second source of moisture, associated to air masses from the Pacific, explained the enriched isotopic values observed in the lower altitude areas. Similar isotopic pattern, documented in springs and groundwater, indicates that the rain data presented in this paper is an accurate representation of the long term behavior of the isotopic composition of the rain in northern Chile

  7. Correlation between PFGE Groups and mrp/epf/sly Genotypes of Human Streptococcus suis Serotype 2 in Northern Thailand

    Directory of Open Access Journals (Sweden)

    Prasit Tharavichitkul

    2014-01-01

    Full Text Available Streptococcus suis infection is a severe zoonotic disease commonly found in Northern Thailand where people often consume raw pork and/or pig’s blood. The most frequent clinical presentations are meningitis, sepsis, and endocarditis with higher rate of mortality and hearing loss sequelae. To clarify the correlation between pulsed-field gel electrophoresis (PFGE groups and mrp/epf/sly genotypes of S. suis serotype 2, 62 patient and 4 healthy pig isolates from Northern Thailand were studied. By PFGE analysis, at 66% homology, most human isolates (69.4% and 1 pig isolate were in group A, whereas 14.5% of human isolates and 3 out of 4 pig isolates were in group D. According to mrp/epf/sly genotypes, 80.6% of human isolates were identified in mrp+epf−sly− and only 12.9% were in mrp−epf−sly+ genotypes; in contrast, 1 and 3 pig isolates were detected in these two genotypes, respectively. Interestingly, all isolates of S. suis serotype 2 classified in PFGE groups A, B, and E were set in mrp+epf−sly− genotypes. These data show a close correlation between PFGE groups and mrp/epf/sly genotypes of human S. suis serotype 2.

  8. Correlation between PFGE Groups and mrp/epf/sly Genotypes of Human Streptococcus suis Serotype 2 in Northern Thailand.

    Science.gov (United States)

    Tharavichitkul, Prasit; Wongsawan, Kanreuthai; Takenami, Naoki; Pruksakorn, Sumalee; Fongcom, Achara; Gottschalk, Marcelo; Khanthawa, Banyong; Supajatura, Volaluk; Takai, Shinji

    2014-01-01

    Streptococcus suis infection is a severe zoonotic disease commonly found in Northern Thailand where people often consume raw pork and/or pig's blood. The most frequent clinical presentations are meningitis, sepsis, and endocarditis with higher rate of mortality and hearing loss sequelae. To clarify the correlation between pulsed-field gel electrophoresis (PFGE) groups and mrp/epf/sly genotypes of S. suis serotype 2, 62 patient and 4 healthy pig isolates from Northern Thailand were studied. By PFGE analysis, at 66% homology, most human isolates (69.4%) and 1 pig isolate were in group A, whereas 14.5% of human isolates and 3 out of 4 pig isolates were in group D. According to mrp/epf/sly genotypes, 80.6% of human isolates were identified in mrp (+) epf (-) sly (-) and only 12.9% were in mrp (-) epf (-) sly (+) genotypes; in contrast, 1 and 3 pig isolates were detected in these two genotypes, respectively. Interestingly, all isolates of S. suis serotype 2 classified in PFGE groups A, B, and E were set in mrp (+) epf (-) sly (-) genotypes. These data show a close correlation between PFGE groups and mrp/epf/sly genotypes of human S. suis serotype 2.

  9. Inter-group conflict and cooperation: field experiments before, during and after sectarian riots in Northern Ireland

    Directory of Open Access Journals (Sweden)

    Antonio S Silva

    2015-11-01

    Full Text Available The idea that cooperative groups out-compete less cooperative groups has been proposed as a theoretical possibility for the evolution of cooperation through cultural group selection. Previous studies have found an association between increased cooperation and exposure to inter-group violence, but most have not been able to identify the specific target of cooperation and are based on correlational data making it difficult to establish causality. In this study we test the hypothesis that inter-group conflict promotes parochial altruism (i.e. in-group altruism and out-group hostility by using longitudinal data of a real-world measure of cooperation – charity and school donations – sampled before, during and after violent sectarian riots between Catholics and Protestants in Belfast, Northern Ireland. We find that conflict is associated with reductions in all types of cooperation, with reduced donations to a neutral charity, and both in-group and out-group primary schools. After the conflict, both in-group and out-group donations increased again. In this context we find no evidence that inter-group conflict promotes parochial altruism.

  10. Surface uplift in the Central Andes driven by growth of the Altiplano Puna Magma Body.

    Science.gov (United States)

    Perkins, Jonathan P; Ward, Kevin M; de Silva, Shanaka L; Zandt, George; Beck, Susan L; Finnegan, Noah J

    2016-10-25

    The Altiplano-Puna Magma Body (APMB) in the Central Andes is the largest imaged magma reservoir on Earth, and is located within the second highest orogenic plateau on Earth, the Altiplano-Puna. Although the APMB is a first-order geologic feature similar to the Sierra Nevada batholith, its role in the surface uplift history of the Central Andes remains uncertain. Here we show that a long-wavelength topographic dome overlies the seismically measured extent of the APMB, and gravity data suggest that the uplift is isostatically compensated. Isostatic modelling of the magmatic contribution to dome growth yields melt volumes comparable to those estimated from tomography, and suggests that the APMB growth rate exceeds the peak Cretaceous magmatic flare-up in the Sierran batholith. Our analysis reveals that magmatic addition may provide a contribution to surface uplift on par with lithospheric removal, and illustrates that surface topography may help constrain the magnitude of pluton-scale melt production.

  11. Los mayas del altiplano: supervivencia indígena en Chiapas y Guatemala

    Directory of Open Access Journals (Sweden)

    Lovell, W. George

    2002-06-01

    Full Text Available En el contexto americano, pocos grupos indígenas han demostrado la capacidad de sobrevivir a lo largo de la historia como los mayas del altiplano. Hoy día en Chiapas existen más de un millón de indígenas mayas, un número que asciende a cinco o seis millones en el caso de Guatemala. Los pueblos mayas han respondido a la invasión y a la dominación para conservar elementos importantes de su cultura. Este artículo discute las formas en que los mayas del altiplano se han adaptado para sobrevivir a casi cinco siglos de conquista, identificando tres fases claves en su trayectoria histórica: (1 la experiencia colonial, que abarca los años entre 1524 y 1821; (2 una época de reforma y revolución, que corre de 1821 a 1954; y (3 un período de marginalización y descuido desde 1954 en adelante. Pese al desfío, los mayas del altiplano están equipados culturalmente para perdurar.

  12. The Influence of Fold and Fracture Development on Reservoir Behavior of the Lisburne Group of Northern Alaska

    Energy Technology Data Exchange (ETDEWEB)

    Wallace, Wesley K.; Hanks, Catherine L.; Whalen, Michael T.; Jensen1, Jerry; Shackleton, J. Ryan; Jadamec, Margarete A.; McGee, Michelle M.; Karpov1, Alexandre V.

    2001-07-23

    The Carboniferous Lisburne Group is a major carbonate reservoir unit in northern Alaska. The lisburne is detachment folded where it is exposed throughout the northeastern Brooks Range, but is relatively underformed in areas of current production in the subsurface of the North Slope. The objectives of this study are to develop a better understanding of four major aspects of the Lisburne: (1) The geometry and kinematics of detachment folds and their truncation by thrust faults, (2) The influence of folding on fracture patterns, (3) The influence of deformation on fluid flow, and (4) Lithostratigraphy and its influence on folding, faulting, fracturing, and reservoir characteristics.

  13. Two new species of the Pterostichus macrogenys species group (Coleoptera, Carabidae discovered in shallow subterranean habitats in northern Honshu, Japan

    Directory of Open Access Journals (Sweden)

    Kôji Sasakawa

    2017-01-01

    Full Text Available Shallow subterranean environments have recently received attention as a habitat for Carabidae beetles, and many new species have been discovered using collection techniques devised for this habitat. We report the discovery of two new species of the macrogenys species group of the Pterostichus subgenus Nialoe Tanaka, 1958, collected by subterranean baited traps in northern Honshu, Japan. Pterostichus shinbodakensis Sasakawa & Itô, sp. n. is described from Mt. Shinbodake, Niigata Prefecture, and P. tateishiyamanus Sasakawa & Itô, sp. n. is described from the southeastern foot of Mt. Tateishiyama, Fukushima Prefecture. Comparative male genital morphology shows that among the known species, the two new species are most closely related to P. falcispinus Sasakawa, 2005 and P. chokaisanus Sasakawa, 2009, respectively. In addition, sympatric occurrence of P. shinbodakensis with a smaller, unidentified species of the species group was also confirmed. The implications of these results for future studies of the macrogenys species group, as well as those of Nialoe, are discussed.

  14. Atmospheric circulation over the Bolivian Altiplano during dry and wet periods and extreme phases of the Southern Oscillation

    Science.gov (United States)

    Vuille, M.

    1999-11-01

    The atmospheric circulation over the Bolivian Altiplano during composite WET and DRY periods and during HIGH and LOW index phases of the Southern Oscillation was investigated using daily radiosonde data from Antofagasta (Chile), Salta (Argentina), Lima (Peru) and La Paz (Bolivia), daily precipitation data from the Bolivian/Chilean border between 18° and 19°S and monthly NCEP (National Centers for Environmental Prediction) reanalysis data between 1960 and 1998. In austral summer (DJF) the atmosphere during WET periods is characterized by easterly wind anomalies in the middle and upper troposphere over the Altiplano, resulting in increased moisture influx from the interior of the continent near the Altiplano surface. The Bolivian High is intensified and displaced southward. On the other hand, westerly winds usually prevail during DRY summer periods, preventing the moisture transport from the east from reaching the western Altiplano. Precipitation tends to be deficient over the western Bolivian Altiplano during LOW index summers and above average during HIGH and LOW+1 summers, but the relation is weak and statistically insignificant. LOW summers feature broadly similar atmospheric circulation anomalies as DRY periods and can be regarded as an extended DRY period or as a summer with increased occurrence of DRY episodes. HIGH summers, and to a lesser degree LOW+1 summers, are characterized by broadly opposite atmospheric characteristics, featuring a more pronounced Bolivian High located significantly further south, and easterly wind anomalies over the Altiplano. In winter (JJA) precipitation events are rare; these are associated with increased northerly and westerly wind components, reduced pressure and temperature, and increased specific humidity over the entire Altiplano. Atmospheric circulation anomalies during LOW periods are less pronounced in austral winter (JJA) than in summer, but generally feature similar changes (increased temperatures and a vertically

  15. Uranium deposits in the Beaverlodge area, northern Saskatchewan: their relationship to the Martin Group (Proterozoic) and the underlying basement

    International Nuclear Information System (INIS)

    Mazimhaka, P.K.; Hendry, H.E.

    1989-01-01

    The rocks of the Martin Group crop out in an area 60 km by 50 km north of Lake Athabasca near Uranium City, northern Saskatchewan. This area has numerous uranium showings within a few kilometres of the unconformity below the Martin Group. Mineralization occurs in fault zones, in basement rocks and in sedimentary and volcanic rocks of the Martin Group. Martin Group sediments accumulated in alluvial fans, braided streams, and ephemeral lakes. The thickest sequence (8 km to 10 km) is preserved in the Beaverlodge area, near Uranium City. The style of sedimentation changed through time as the basin evolved from deposition of conglomeratic detritus along fault scarps to the accumulation of silt in ephemeral lakes. The uneven nature of the sub-Martin unconformity surface, the lithotype of the lowermost conglomerates and breccias (Beaverlodge Formation), and the shape of the basin fill indicate deposition in fault-controlled basins. The earliest economic uranium mineralization in the rocks of the Martin Group was epigenetic. The mineralization was coeval with that in basement rocks. Economic mineralization in basement rocks and in the lowermost formation of the Martin Group is close to the unconformity. Epigenetic uranium mineralization thus appears to have resulted from processes that were related, in time and space, to either the formation of the unconformity or the deposition of the Martin Group or both. (author). 29 refs, 5 figs

  16. Does social deprivation influence inter-group contact outcomes for pupils in Northern Ireland?

    Directory of Open Access Journals (Sweden)

    Joanne Hughes

    2015-02-01

    Full Text Available The education system in Northern Ireland is characterized by division, with around 95% of the pupil population attending predominantly co-religionist schools. In a society that is transitioning from a thirty year conflict that has been framed by hostilities between the main Catholic and Protestant communities, reconciliation interventions in education have sought to promote the value of intergroup contact between pupils attending separate schools. Some qualitative research suggests that such initiatives are more likely to have positive outcomes for pupils from more middle class backgrounds than those from more disadvantaged communities and areas that experienced high levels of conflict related incidents and deaths during the pre-ceasefire years. Drawing on contact theory and empirical evidence from a large scale quantitative study, we seek to examine this theory. Using free school meals as a proxy for social class, our findings are consistent in finding that there is a differential impact of contact for those from less affluent backgrounds, and we conclude by arguing that this should be reflected in policy responses.

  17. The Lower Cretaceous Way Group of northern Chile: An alluvial fan-fan delta complex

    Science.gov (United States)

    Flint, S.; Clemmey, H.; Turner, P.

    1986-01-01

    Alluvial fan sediments of the Lower Cretaceous Coloso Basin in northern Chile were deposited in a half-graben and derived from andesitic volcanics of a former island arc. Transport directions were towards the east, away from the present-day Peru-Chile trench. Grain flow, density modified grain flow and sheetflow processes were responsible for most of the sediment deposition with cohesive debris flows playing only a minor part. An early phase of conglomerate deposition (Coloso Formation) into a restricted basin records the transition from proximal fan facies with abundant grain flows and remobilized screes to mid-fan facies dominated by sheetflows. Stratiform copper mineralization near the top of the lower conglomerates is related to the unroofing of the Jurassic island arc. This mineralization comprises copper sulphide-cemented sands and gravels and formed by the reaction of mineralized detritus with diagenetic and hydrothermal solutions. A later phase of deposition (Lombriz Formation) includes sandstones, siltstones and conglomerates with a source area different from the Coloso Formation. This change in source may be related to strike-slip tectonics as the basin extended. The Lombriz conglomerates pass distally (eastwards) into red sandstones and purple siltstones with thin limestones deposited under marine conditions. This sequence is interpreted as a major fan delta complex. It passes conformably into marine carbonates of the Tableado Formation signifying the complete drowning of the basin in lower Cretaceous times.

  18. Risk-matching behavior in microcredit group formation: evidence from northern Ethiopia

    NARCIS (Netherlands)

    Berhane Tesfay, G.; Gardebroek, C.; Moll, H.A.J.

    2009-01-01

    Theoretical models on group lending assume the formation of groups of homogenous risk types. Recent theoretical and empirical findings challenge this view arguing that when markets for insurance are missing, risk homogeneity may not hold any more and risk heterogeneity can be the optimal outcome.

  19. Evolved priors for ethnolinguistic categorization: A case study from the Quechua–Aymara boundary in the Peruvian Altiplano

    Science.gov (United States)

    Moya, Cristina

    2013-01-01

    Ethnic categories uniquely structure human social worlds. People readily form stereotypes about these, and other social categories, but it is unclear whether certain dimensions are privileged for making predictions about strangers when information is limited. If humans have been living in culturally-structured groups for much of their evolutionary history, we might expect them to have adaptations for prioritizing ethno-linguistic cues as a basis for making predictions about others. We provide a strong test of this possibility through a series of studies in a field context along the Quechua–Aymara linguistic boundary in the Peruvian Altiplano where the language boundary is not particularly socially meaningful. We find evidence of such psychological priors among children and adults at this site by showing that their age, and the social categories’ novelty affect participants’ reliance on ethno-linguistic inductive inferences (i.e. one-to-many predictions). Studies 1–3 show that participants make more ethno-linguistic inferences when the social categories are more removed from their real-world context. Additionally, in Study 4 when the category is marked with acoustic cues of language use, young children rely heavily on ethno-linguistic predictions, even though adults do not. PMID:24072962

  20. Evolved priors for ethnolinguistic categorization: A case study from the Quechua-Aymara boundary in the Peruvian Altiplano.

    Science.gov (United States)

    Moya, Cristina

    2013-07-01

    Ethnic categories uniquely structure human social worlds. People readily form stereotypes about these, and other social categories, but it is unclear whether certain dimensions are privileged for making predictions about strangers when information is limited. If humans have been living in culturally-structured groups for much of their evolutionary history, we might expect them to have adaptations for prioritizing ethno-linguistic cues as a basis for making predictions about others. We provide a strong test of this possibility through a series of studies in a field context along the Quechua-Aymara linguistic boundary in the Peruvian Altiplano where the language boundary is not particularly socially meaningful. We find evidence of such psychological priors among children and adults at this site by showing that their age, and the social categories' novelty affect participants' reliance on ethno-linguistic inductive inferences (i.e. one-to-many predictions). Studies 1-3 show that participants make more ethno-linguistic inferences when the social categories are more removed from their real-world context. Additionally, in Study 4 when the category is marked with acoustic cues of language use, young children rely heavily on ethno-linguistic predictions, even though adults do not.

  1. Craniofacial chronological microdifferentiation of human prehistoric populations of the Azapa valley, northern Chile Microdiferenciación cronológica craneofacial de poblaciones humanas prehistóricas del Valle de Azapa, norte de Chile

    Directory of Open Access Journals (Sweden)

    FRANCISCO ROTHHAMMER

    2002-03-01

    Full Text Available Archeological evidence suggest that the cultural developments occurred in the highlands around lake Titicaca in the Central Andes, exerted influence on the cultural elaborations of the human groups that peopled the valley of Azapa, close to the city of Arica, and the Pacific coast of northern Chile. In this communication we show by means of a distance analysis, that a craniofacial differentiation accompanied the process of cultural evolution in the valley. The biological influence of Tiwanaku is partially reflected in craniofacial morphology, providing preliminary evidence that cultural changes were associated to intermittent gene flow from the highlands, specially during the Alto Ramírez and San Miguel phasesLos desarrollos culturales ocurridos en el altiplano en el área circumtiticaca en los Andes centrales, ejercieron influencia sobre las elaboraciones culturales de los grupos humanos que poblaban el Valle de Azapa cercano a la ciudad de Arica y la costa del norte de Chile. En esta comunicación presentamos un análisis de distancias que demostró que una diferenciación craniofacial acompaño en el valle el proceso de evolución cultural. La influencia biológica de Tiwanaku se refleja parcialmente en la morfología craniofacial, proporcionando evidencia preliminar de que los cambios culturales en el valle se realizaron acompañados de flujo génico intermitente desde el altiplano, especialmente durante las fases Alto Ramírez y San Miguel

  2. Econometric analyses of microfinance credit group formation, contractual risks and welfare impacts in Northern Ethiopia

    NARCIS (Netherlands)

    Berhane Tesfay, G.

    2009-01-01

    Key words
    Microfinance, joint liability, contractual risk, group formation, risk-matching, impact evaluation, Panel data econometrics, dynamic panel probit, trend models, fixed-effects, composite counterfactuals, propensity score matching, farm households, Ethiopia.

    Lack of

  3. Bactericidal activity of M protein conserved region antibodies against group A streptococcal isolates from the Northern Thai population

    Directory of Open Access Journals (Sweden)

    Pruksachatkunakorn Chulabhorn

    2006-08-01

    Full Text Available Abstract Background Most group A streptococcal (GAS vaccine strategies have focused on the surface M protein, a major virulence factor of GAS. The amino-terminus of the M protein elicits antibodies, that are both opsonic and protective, but which are type specific. J14, a chimeric peptide that contains 14 amino acids from the M protein conserved C-region at the carboxy-terminus, offers the possibility of a vaccine which will elicit protective opsonic antibodies against multiple different GAS strains. In this study, we searched for J14 and J14-like sequences and the number of their repeats in the C-region of the M protein from GAS strains isolated from the Northern Thai population. Then, we examined the bactericidal activity of J14, J14.1, J14-R1 and J14-R2 antisera against multiple Thai GAS strains. Results The emm genes of GAS isolates were sequenced and grouped as 14 different J14-types. The most diversity of J14-types was found in the C1-repeat. The J14.1 type was the major sequence in the C2 and C3-repeats. We have shown that antisera raised against the M protein conserved C-repeat region peptides, J14, J14.1, J14-R1 and J14-R2, commonly found in GAS isolates from the Northern Thai population, are able to kill GAS of multiple different emm types derived from an endemic area. The mean percent of bactericidal activities for all J14 and J14-like peptide antisera against GAS isolates were more than 70%. The mean percent of bactericidal activity was highest for J14 antisera followed by J14-R2, J14.1 and J14-R1 antisera. Conclusion Our study demonstrated that antisera raised against the M protein conserved C-repeat region are able to kill multiple different strains of GAS isolated from the Northern Thai population. Therefore, the four conserved "J14" peptides have the potential to be used as GAS vaccine candidates to prevent streptococcal infections in an endemic area.

  4. Factores asociados a mastitis en vacas de la microcuenca lechera del altiplano norte de Antioquia, Colombia

    OpenAIRE

    Ramírez Vásquez, Nicolás; Arroyave Henao, Ofelia; Cerón-Muñoz, Mario; Jaramillo, Manuel; Cerón, Juan; Palacio, Luis Guillermo

    2011-01-01

    Se efectuó un estudio de corte sobre la prevalencia de mastitis bovina en una muestra representativa de las granjas lecheras del altiplano norte de Antioquia, Colombia. Se evaluaron los resultados del California Mastitis Test (CMT), Recuento de Células Somáticas (RCS) y cultivo bacteriológico de leche, y se analizaron los factores de riesgo asociados a mastitis bovina. El análisis estadístico de la información se efectuó por medio de estadística descriptiva, análisis de razón de prevalencias ...

  5. Precipitation changes in the South American Altiplano since 1300 AD reconstructed by tree-rings

    Directory of Open Access Journals (Sweden)

    M. S. Morales

    2012-03-01

    Full Text Available Throughout the second half of the 20th century, the Central Andes has experienced significant climatic and environmental changes characterized by a persistent warming trend, an increase in elevation of the 0 °C isotherm, and sustained glacier shrinkage. These changes have occurred in conjunction with a steadily growing demand for water resources. Given the short span of instrumental hydroclimatic records in this region, longer time span records are needed to understand the nature of climate variability and to improve the predictability of precipitation, a key factor modulating the socio-economic development in the South American Altiplano and adjacent arid lowlands. In this study we present the first quasi-millennial, tree-ring based precipitation reconstruction for the South American Altiplano. This annual (November–October precipitation reconstruction is based on the Polylepis tarapacana tree-ring width series and represents the closest dendroclimatological record to the Equator in South America. This high-resolution reconstruction covers the past 707 yr and provides a unique record characterizing the occurrence of extreme events and consistent oscillations in precipitation. It also allows an assessment of the spatial and temporal stabilities of the teleconnections between rainfall in the Altiplano and hemispheric forcings such as El Niño-Southern Oscillation. Since the 1930s to present, a persistent negative trend in precipitation has been recorded in the reconstruction, with the three driest years since 1300 AD occurring in the last 70 yr. Throughout the 707 yr, the reconstruction contains a clear ENSO-like pattern at interannual to multidecadal time scales, which determines inter-hemispheric linkages between our reconstruction and other precipitation sensitive records modulated by ENSO in North America. Our reconstruction points out that century-scale dry periods are a recurrent feature in the Altiplano climate, and that the

  6. Altiplano Sur de Bolivia : capítulo 5.1.b

    OpenAIRE

    Winkel, Thierry; Alvarez-Flores, R.; Bommel, P.; Bourliaud, J.; Chevarria Lazo, M.; Cortes, G.; Cruz, P.; Del Castillo, C.; Gasselin, P.; Joffre, R.; Léger, F.; Nina Laura, J.P.; Rambal, S.; Rivière, G.; Tichit, M.

    2014-01-01

    Alimento de base de las poblaciones andinas desde hace milenios, la quinua se ha convertido hoy en un producto apreciado en el mercado internacional de alimentos dietéticos, orgánicos y equitativos. Este cambio lo iniciaron los mismos productores del Altiplano Sur de Bolivia hace aproximadamente unos 40 años. En medio de un desierto de altura, ellos lograron desarrollar una floreciente producción agrícola de exportación. Aunque cuentan con lucrativos nichos de mercado, los productores de quin...

  7. Characteristics and Origins of Hot Springs in the Tatun Volcano Group in Northern Taiwan

    Directory of Open Access Journals (Sweden)

    Chia-Mei Liu

    2011-01-01

    Full Text Available This paper systematically surveyed distribution and field occurrences of 13 hot springs as well as geochemical investigation on the geothermal area of the Tatun Volcano Group (TVG. According to Piper diagrams, pH values, field occurrences and water-rock interactions, these hot springs can be classified into three types: (1 Type I, SO42- acidic water where the reservoir is located in the Wuchishan Formation; (2 Type II, HCO3- a near neutral spring where waters originate from the volcanic terrane (andesite; and (3 Type III, Cl- -rich acidic water where waters emanate from shallower Wuchishan Formation. In terms of isotopic ratio, δD and δ18O values, two groups of hot spring can be recognized. One is far away from the meteoric water line of the Tatun area with values ranging between -26.2‰ and -3.5‰, and from -3.2‰ to 1.6‰, respectively. However, another close to the meteoric water line of the Tatun area is between -28.4‰ and -13.6‰, and from -5.5‰ to -4.2‰, respectively. In addition, the δ34S value of thermal waters can also be distinguished into two groups, one ranging from 26.1‰ to 28.5‰, and the other between 0.8‰ and 7.8‰. Based on field occurrences and geochemical characteristics, a model has been proposed to illustrate the origin of these hot springs.

  8. Radiotherapy in cooperative clinical trials: Northern California Oncology Group (NCOG) method

    International Nuclear Information System (INIS)

    MacDonald, E.A.; Meurk, M.L.; Ray, G.; Phillips, T.L.; Carter, S.K.

    1980-01-01

    The inclusion of radiation therapy in multimodality clinical research has demonstrated the need for consultion and standardization of terminology and practice between participating centers. A set of guidelines has been developed to ensure that the radiotherapy section of a cooperative study is comprehensive and unambiguous, and that the techniques, fractionation and dosage used are sufficiently uniform to provide a homogeneous group of patients for comparative purposes. An outline is given for the preparation of radiotherapy protocols including the necessary details of physical factors, localization and simulation, portal and treatment volume definition, dosimetry requirements, specification of dose, and treatment documentation

  9. Presence of the dinosaur Scelidosaurus indicates Jurassic age for the Kayenta Formation (Glen Canyon Group, northern Arizona)

    Science.gov (United States)

    Padian, Kevin

    1989-05-01

    The Glen Canyon Group (Moenave, Wingate, Kayenta and Navajo Formations) of northern Arizona represents an extensive outcrop of early Mesozoic age terrestrial sediments. The age of these formations has long been disputed because independent stratigraphic data from marine tie-ins, paleobotanical and palynological evidence, and radiometric calibrations have been scanty or absent. The fauna of the Kayenta Formation in particular has been problematic because it has appeared to contain both typical Late Triassic and Early Jurassic taxa Here I report that the principal evidence for Late Triassic taxa, dermal scutes previously assigned to an aetosaur, in fact belongs to the thyreophoran ornithischian dinosaur Scelidosaurus, previously known only as a washed-in form found in marine sediments in the Early Jurassic of England. The presence of this dinosaur represents the first vertebrate biostratigraphic tie-in of the Glen Canyon Group horizons with reliably dated marine deposits in Europe. Together with revised systematic assessments of other vertebrates and independent evidence from fossil pollen, it supports an Early Jurassic age for the Kayenta Formation and most or all of the Glen Canyon Group.

  10. Sitting with others: mental health self-help groups in northern Ghana

    Directory of Open Access Journals (Sweden)

    Cohen Alex

    2012-03-01

    Full Text Available Abstract Background Over the past four decades, there has been increasing interest in Self-Help Groups, by mental health services users and caregivers, alike. Research in high-income countries suggests that participation in SHGs is associated with decreased use of inpatient facilities, improved social functioning among service users, and decreased caregiver burden. The formation of SHGs has become an important component of mental health programmes operated by non-governmental organisations (NGOs in low-income countries. However, there has been relatively little research examining the benefits of SHGs in this context. Methods Qualitative research with 18 SHGs, five local non-governmental organisations, community mental health nurses, administrators in Ghana Health Services, and discussions with BasicNeeds staff. Results SHGs have the potential to serve as key components of community mental health programmes in low-resource settings. The strongest evidence concerns how SHGs provide a range of supports, e.g., social, financial, and practical, to service users and caregivers. The groups also appear to foster greater acceptance of service users by their families and by communities at large. Membership in SHGs appears to be associated with more consistent treatment and better outcomes for those who are ill. Discussion This study highlights the need for longitudinal qualitative and quantitative evaluations of the effect of SHGs on clinical, social and economic outcomes of service users and their carers. Conclusions The organisation of SHGs appears to be associated with positive outcomes for service users and caregivers. However, there is a need to better understand how SHGs operate and the challenges they face.

  11. Knowledge of hepatitis B and vaccination status of some expatriate ethnic groups of blue collar workers in Northern Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Abdul Sattar Khan

    2008-01-01

    Background: Hepatitis B (HBV infection is relatively common throughout the world, but more prevalent in low socioeconomic and underprivileged classes. The chronic infection may lead to severe consequences including Hepatocellular carcinoma (HCC. Method: A cross-sectional, community-based survey of some ethnic expatriate groups of blue color workers (n=665 living in four main areas along the Northern Borders of Saudi Arabia was completed in 2005. We examined knowledge of HBV and vaccination status and compared them with some socio-demographic factors. Results: The mean age of the participants was 45.61 years (±8.44, 53% of whom were Non-Arabs (Non Arabic speaking. Of the total, 41.6% gave seven or more correct answers out of 12 questions addressing knowledge about the transmission and sequelae of HBV. Almost 40% of the respondents had not been vaccinated while the remaining respondents had had three full doses of vaccination. A high level of knowledge (≥ 7 correct answers was significantly associated (p0.05 with level of knowledge. However, vaccination status was associated (p<0.05 with almost all socio-demographic factors. Conclusion: Hepatitis screening programs for expatriates in the Kingdom of Saudi Arabia started 10 years ago and are expected to have a great impact on the combat against HBV infections and their complications. However, beyond screening, health promotion, vaccination campaigns, and access to vaccine for the underprivileged classes are some necessary measures towards achieving success.

  12. Healthcare Utilization by Older Age Groups in Northern States of Peninsular Malaysia: The Role of Predisposing, Enabling and Need Factors.

    Science.gov (United States)

    Samsudin, Shamzaeffa; Abdullah, Norehan

    2017-06-01

    Determining factors that affect healthcare utilization by the elderly is vital for the health system to be more responsive in providing care to this vulnerable group. The main objective of this paper is to identify the effect of the predisposing, enabling, and need factors on doctor visits and in-patient care for the elderly residing in the northern region of Malaysia. A multistage cluster sampling was used in selecting the sample for the study. A total of 1414 respondents aged 60 and over were interviewed face-to-face using a structured questionnaire. A probit model was used in estimating the utilization equations. At a significance level of 0.05, except for age, all predisposing and enabling factors were not statistically significant in affecting the doctor visits. On the other hand, being a male, smoker, medical insurance holder or had not actively involved in social interaction within the reference period increases the likelihood of being in-patient. Health-related variables remain the most significant factors that determine healthcare utilization, including both doctor visits and in-patient stays, in the area of study, which suggests that government policies to improve population health may influence the level of healthcare use in the future.

  13. A Framework to Evaluate Ecological and Social Outcomes of Collaborative Management: Lessons from Implementation with a Northern Arizona Collaborative Group

    Science.gov (United States)

    Muñoz-Erickson, Tischa A.; Aguilar-González, Bernardo; Loeser, Matthew R. R.; Sisk, Thomas D.

    2010-01-01

    As collaborative groups gain popularity as an alternative means for addressing conflict over management of public lands, the need for methods to evaluate their effectiveness in achieving ecological and social goals increases. However, frameworks that examine both effectiveness of the collaborative process and its outcomes are poorly developed or altogether lacking. This paper presents and evaluates the utility of the holistic ecosystem health indicator (HEHI), a framework that integrates multiple ecological and socioeconomic criteria to evaluate management effectiveness of collaborative processes. Through the development and application of the HEHI to a collaborative in northern Arizona, the Diablo Trust, we present the opportunities and challenges in using this framework to evaluate the ecological and social outcomes of collaborative adaptive management. Baseline results from the first application of the HEHI are presented as an illustration of its potential as a co-adaptive management tool. We discuss lessons learned from the process of selecting indicators and potential issues to their long-term implementation. Finally, we provide recommendations for applying this framework to monitoring and adaptive management in the context of collaborative management.

  14. The occurrence of Spotted Fever Group (SFG) Rickettsiae in Ixodes ricinus ticks (Acari: Ixodidae) in northern Poland.

    Science.gov (United States)

    Stańczak, Joanna

    2006-10-01

    Ixodes ricinus, the most commonly observed tick species in Poland, is known vector of microorganisms pathogenic for humans as TBE virus, Borrelia burgdorferi s.1., Anaplasma phagocytophilum and Babesia sp. in this country. Our study aimed to find out whether this tick can also transmit also rickettsiae of the spotted fever group (SFG). DNA extracts from 560 ticks (28 females, 34 males, and 488 nymphs) collected in different wooded areas in northern Poland were examined by PCR for the detection of Rickettsia sp., using a primer set RpCS.877p and RpCS.1258n designated to amplify a 381-bp fragment of gltA gene. A total of 2.9% ticks was found to be positive. The percentage of infected females and males was comparable (10.5% and 11.8%, respectively) and 6.6-7.6 times higher than in nymphs (1.6%). Sequences of four PCR-derived DNA fragments (acc. no. DQ672603) demonstrated 99% similarity with the sequence of Rickettsia helvetica deposited in GenBank. The results obtained suggest the possible role of I. ricinus as a source of a microorganism, which recently has been identified as an agent of human rickettsioses in Europe.

  15. The Influence of fold and fracture development on reservoir behavior of the Lisburne Group of northern Alaska

    Energy Technology Data Exchange (ETDEWEB)

    Wesley K. Wallace; Catherine L. Hanks; Jerry Jensen: Michael T. Whalen; Paul Atkinson; Joseph Brinton; Thang Bui; Margarete Jadamec; Alexandre Karpov; John Lorenz; Michelle M. McGee; T.M. Parris; Ryan Shackleton

    2004-07-01

    The Carboniferous Lisburne Group is a major carbonate reservoir unit in northern Alaska. The Lisburne is folded and thrust faulted where it is exposed throughout the Brooks Range, but is relatively undeformed in areas of current production in the subsurface of the North Slope. The objectives of this study were to develop a better understanding of four major aspects of the Lisburne: (1) The geometry and kinematics of folds and their truncation by thrust faults. (2) The influence of folding on fracture patterns. (3) The influence of deformation on fluid flow. (4) Lithostratigraphy and its influence on folding, faulting, fracturing, and reservoir characteristics. Symmetrical detachment folds characterize the Lisburne in the northeastern Brooks Range. In contrast, Lisburne in the main axis of the Brooks Range is deformed into imbricate thrust sheets with asymmetrical hangingwall anticlines and footwall synclines. The Continental Divide thrust front separates these different structural styles in the Lisburne and also marks the southern boundary of the northeastern Brooks Range. Field studies were conducted for this project during 1999 to 2001 in various locations in the northeastern Brooks Range and in the vicinity of Porcupine Lake, immediately south of the Continental Divide thrust front. Results are summarized below for the four main subject areas of the study.

  16. Widespread Lake Highstands in the Southernmost Andean Altiplano during Heinrich Event 1: Implications for the South American Summer Monsoon

    Science.gov (United States)

    Chen, C. Y.; McGee, D.; Quade, J.

    2014-12-01

    Speleothem-based oxygen isotope records provide strong evidence of anti-phased behavior of the northern and southern hemisphere summer monsoons during Heinrich events, but we lack rigorous constraints on the amount of wetting or drying occurring in monsoon regions. Studies centered on shoreline deposits of closed-basin lakes are well suited for establishing such quantitative controls on water balance changes by providing unequivocal evidence of lake volume variations. Here we present new dating constraints on the highstands of several high-altitude (3800-4350 m) paleolakes in the southern Andean Altiplano, an outlying arid region of the Atacama Desert stretching across the Chilean-Bolivian-Argentinian border east of the Andes (20-25°S). These lakes once occupied the closed basins where only phreatic playas, dry salars, and shallow ponds exist today. Initial U-Th dating of massive shoreline tufas reveals that these deposits are dateable to within ±150 to 300 yrs due to high U concentrations and low initial Th content (as indicated by high 230Th/232Th). Our U-Th and 14C dates show that lake highstands predominantly occur between 18.5 and 14.5 kyrs BP, coinciding with Heinrich Event 1 (HE1) and the expansion of other nearby lakes, such as Lake Titicaca. Because of their (1) location at the modern-day southwestern edge of the summer monsoon, (2) intact shoreline preservation, and (3) precise age control, these lakes may uniquely enable us to reconstruct the evolution of water balance (P-E) changes associated with HE1. Hydrologic modeling constrained by temperature estimates provided by local glacial records is used to provide bounds for past precipitation changes. We also examine North Atlantic cooling as the mechanism for these changes by comparing a compilation of S. American lake level records with various hosing experiments and transient climate simulations at HE1. Our results lend us confidence in expanding our U-Th work to other shoreline tufas in the

  17. Gender and age disparities in adult undernutrition in northern Uganda: high-risk groups not targeted by food aid programmes.

    Science.gov (United States)

    Schramm, Stine; Kaducu, Felix Ocaka; Smedemark, Siri Aas; Ovuga, Emilio; Sodemann, Morten

    2016-06-01

    To determine the prevalence of adult malnutrition and associated risk factors in a post-conflict area of northern Uganda. A cross-sectional community survey was performed from September 2011 to June 2013. All registered residents in Gulu Health and Demographic Surveillance System aged 15 years and older were considered eligible. Trained field assistants collected anthropometric measurements (weight and height) and administered questionnaires with information on sociodemographic characteristics, food security, smoking and alcohol. Nutritional status was classified by body mass index. In total, 2062 men and 2924 women participated and were included in the analyses. The prevalence of underweight was 22.3% for men and 16.0% for women, whereas the prevalence of overweight was 1.5% for men and 7.6% for women. In men, underweight was associated with younger (15-19 years) and older age (>55 years) (P < 0.001), being divorced/separated [odds ratio (OR) = 1.91 (95% confidence interval (CI): 1.21-2.99] and smoking (OR = 2.13, 95% CI: 1.67-2.73). For women, underweight was associated with older age (P < 0.001) and hungry-gap rainy season (May-July) (OR = 1.33, 95% CI: 1.04-1.69). Widowed or divorced/separated women were not more likely to be underweight. No association was found between education, alcohol consumption or food security score and underweight. Our findings are not in line with the conventional target groups in nutritional programmes and highlight the importance of continuous health and nutritional assessments of all population groups that reflect local social determinants and family structures. © 2016 John Wiley & Sons Ltd.

  18. Saghro Group in the Ougnat Massif (Morocco), an evidence for a continuous Cadomian basin along the northern West African Craton

    Science.gov (United States)

    Michard, André; Soulaimani, Abderrahmane; Ouanaimi, Hassan; Raddi, Youssef; Aït Brahim, Lahsen; Rjimati, Ech-Cherki; Baidder, Lahssen; Saddiqi, Omar

    2017-03-01

    The Saghro Group (SG) is a folded, low-grade volcano-sedimentary series up to 8 km thick that crops out within and to the north of the Pan-African suture zone in the central and eastern Anti-Atlas. Here we describe the SG of the Ougnat inliers that are exposed in the easternmost Anti-Atlas beneath the unconformable, Late Ediacaran Ouarzazate Group (OZG) volcanic rocks. The Ougnat SG mostly consists of volcaniclastic greywackes accumulated in a peritidal-to-shallow basin. The basin infilling was deformed by NNE-trending, mostly upright folds with axial-planar slaty cleavage and low-grade metamorphism. The deformed SG rocks were intruded by the ∼550 Ma Mellab hypovolcanic granodiorite. The latter also crosscuts the lowest OZG rocks that are dated to 574-571 Ma in the western Saghro region. The SG rocks that form the Siroua and Saghro inliers have an oldest age of 620-610 Ma and were folded at ∼610-580 Ma at the onset of the Cadomian orogenic events. We show that the SG rocks are similar to the ;Série verte; (SV) rocks that are exposed in the Ougarta and western Hoggar east of the Pan-African suture. We infer that the SG and SV rocks accumulated in a same, continuous basin that was bounding the West African Craton to the north and the east. This strongly subsiding basin formed close to a volcanic arc and was folded during the last Pan-African synmetamorphic events. Fold orientation and age of folding differ however along the edge of the West African Craton. The orogenic greywackes that form the remnants of the SG-SV basin thus constitute a precious record of the diachronic Cadomian event s.l. along the West African Craton northern margin.

  19. [Ethnographic study of neurological and mental diseases among the Uru-Chipaya peoples of the Andean Altiplano].

    Science.gov (United States)

    Carod-Artal, F J; Vázquez-Cabrera, C B

    The Uru-Chipaya people are an ethnic group of about 2,500 people, descendants of primitive Andean cultures. Their isolation (they live at an altitude of 4,000 metres in southern Bolivia), their non-written language (Chipaya-Puquina) and their traditional way of life, clothing and customs, which are similar to those used for thousands of years, make this an unusual culture. The aim of our work was to carry out an ethnographic study of the neurological diseases experienced by these people, the way they conceive such disorders and their therapeutic approaches to them. An ethnographic field study was conducted in June 2004. A structured interview was held with a yatiri, or Chipaya healer, to allow classification of the neurological or mental diseases. Epilepsy (tukuri) is interpreted as being a consequence of an evil spirit entering through the nose. Treatment consists in drinking an infusion containing dried powdered butterfly (jesko), birds or curupancho. Achamixi (headache) is common and is treated by drinking the yatiri's fermented urine, herb tea made from the chachacoma plant and by blowing, which is done by the yatiri over the patient's head. Fright, the symptoms of which are similar to those of a post-traumatic stress disorder, is treated by a wilancha, that is, the ritual sacrifice of a llama offered to the Pachamama. Sadness, the cultural equivalent to depression, is treated with infusions made from ayrampo, a plant found in the Andean Altiplano. Psychosis (sumsu), which is treated by means of a wilancha, and mental retardation/static encephalopathy (pustkis), which are considered to be a result of a fright suffered by the mother during pregnancy, also exist. No mention was made of the existence of extrapyramidal or vascular pathologies. The cultural equivalents of certain neurological pathologies (headache, epilepsy, mental retardation, anxiety and depression) are present in this ancestral culture.

  20. Collaborative survey of perinatal loss in planned and unplanned home births. Northern Region Perinatal Mortality Survey Coordinating Group.

    OpenAIRE

    1996-01-01

    OBJECTIVE: To document the outcome of planned and unplanned births outside hospital. DESIGN: Confidential review of every pregnancy ending in stillbirth or neonatal death in which plans had been made for home delivery, irrespective of where delivery eventually occurred. The review was part of a sustained collaborative survey of all perinatal deaths. SETTING: Northern Regional Health Authority area. SUBJECTS: All 558,691 registered births to women normally resident in the former Northern Regio...

  1. Hemoglobin E Prevalence among Ethnic Groups Residing in Malaria-Endemic Areas of Northern Thailand and Its Lack of Association with Plasmodium falciparum Invasion In Vitro.

    Directory of Open Access Journals (Sweden)

    Pathrapol Lithanatudom

    Full Text Available Hemoglobin E (HbE is one of the most common hemoglobin variants caused by a mutation in the β-globin gene, and found at high frequencies in various Southeast Asian groups. We surveyed HbE prevalence among 8 ethnic groups residing in 5 villages selected for their high period malaria endemicity, and 5 for low endemicity in northern Thailand, in order to uncover factors which may affect genetic persistence of HbE in these groups. We found the overall HbE prevalence 6.7%, with differing frequencies from 0% in the Pwo Karen, the Lawa, and the Skaw Karen to 24% in the Mon. All HbE genes were heterozygous (AE. Differences in HbE prevalence among the studied ethnic groups indirectly documents that ancestries and evolutionary forces, such as drift and admixture, are the important factors in the persistence of HbE distribution in northern Thailand. Furthermore, the presence of HbE in groups of northern Thailand had no effect on the in vitro infectivity and proliferation of Plasmodium falciparum, nor the production of hemozoin, a heme crystal produced by malaria parasites, when compared to normal red-blood-cell controls. Our data may contribute to a better understanding on the persistence of HbE among ethnic groups and its association with malaria.

  2. [Telemedicine in Bolivia: RAFT-Altiplano project, experiences, future prospects, and recommendations].

    Science.gov (United States)

    Vargas, Alejandro; Ugalde, Miguel; Vargas, Reynaldo; Narvaez, Ramiro; Geissbuhler, Antoine

    2014-01-01

    The objective of the RAFT-Altiplano project (RAFT: Réseau en Afrique Francophone pour la Télémédecine, or African Francophone Telemedicine Network) is to evaluate the viability, potential, and risks of implementing and developing a telemedicine network in the context of a developing country-specifically, the Altiplano region of Bolivia-to improve access to medical care and continuing education in a rural area. The activities described in this report took place between 2011 and 2013. Digital telemedicine equipment was donated to the health centers and a Microsoft®-based platform capable of integration with other technologies (using standardized formats) was developed to manage documents and clinical content electronically. Health professionals were trained in teleconsultation and the teleconsultation workflow was designed. The tele-education system used is Dudal, which requires only a small bandwidth. After three years of implementation, an organized working structure of teleconsultation and tele-education tools, adapted to the Latin American context, is now in place and connections have been established with hospitals, institutions, and health centers. The project has improved access to specialized medical care in remote health centers and third-level hospitals in urban areas, and it has become the foundation for development of the national project "TeleSalud for Bolivia" promoted by the Ministry of Health, which involves use of the new Bolivian satellite, Túpac Katari. It is viable to develop and set up telemedicine tools to serve the population in remote regions of Bolivia when they are made available to government and municipal health institutions and communication between them and the health centers takes place in a coordinated manner. The sharing of experiences, challenges, and risks encountered is very useful in designing and implementing the telemedicine project "TeleSalud for Bolivia" on a national scale.

  3. Variability in precipitation in a watershed in the altiplano, Peru and modes of variation

    Science.gov (United States)

    Mazzarino, M.; Brown, C. M.

    2012-12-01

    This research examines system linkages between climate, water availability, pasture availability, camelids (llamas and alpacas) and indigenous herders in an Andean watershed in southern Peru. In this region, extreme meteorological events such as drought and flood, occur often and have the potential to negatively impact herding livelihoods. Predictability in the system is paramount to reducing risks associated with these events. In the altiplano, a large portion of variability in precipitation has been attributed to the influence of El Nino Southern Oscillation (ENSO). In light of climate change and observations by herders, this research returns to the question of teleconnections in the altiplano. We use December through March precipitation totals obtained from eight meteorological stations for 43 years (1964-2006) and sea surface temperatures (SSTs) in the equatorial Pacific and Atlantic to characterize the hydroclimatology in the watershed and determine modes of variability. Following principal components analysis, prevailing periodicities in regional precipitation were determined using wavelet analysis and spatial correlation and regression analysis were used to determine the relationship between SST anomalies (SSTA's) and precipitation events in the watershed. Results suggest a non-linear and non-stationary mode of variability. We draw three conclusions from the results: 1) Positive precipitation extremes are dominated by an ENSO signal in the Nino 2 region; 2) Post 1987 there is a weak relationship, if any, between anomalously dry years in the precipitation record and SSTA's in the equatorial Pacific; 3) There is a stronger relationship (inverse) between precipitation in the region and SSTA's in the tropical Atlantic than previously believed.

  4. Seasonal profiles of malaria infection, anaemia, and bednet use among age groups and communities in northern Ghana.

    Science.gov (United States)

    Koram, Kwadwo A; Owusu-Agyei, Seth; Fryauff, David J; Anto, Francis; Atuguba, Frank; Hodgson, Abraham; Hoffman, Stephen L; Nkrumah, Francis K

    2003-09-01

    We conducted all-age point prevalence surveys to profile the severity and seasonality of malaria and anaemia in Kassena-Nankana District of northern Ghana. Random cross-sectional surveys were timed to coincide with the end of low (May 2001) and high (November 2001) malaria transmission seasons and to yield information as to the potential value of haemoglobin (Hb) levels and parasitaemia as markers of malaria morbidity and/or malaria vaccine effect. Parasitaemia was found in 22% (515 of 2286) screened in May (dry-low transmission), and in 61% of the general population (1026 of 1676) screened in November (wet-high transmission). Malaria prevalence in May ranged from 4% (infants <6 months and adults 50-60 years) to 54% (children 5-10 years). Age-specific malaria prevalence in November ranged from 38% (adults 50-60 years) to 82% (children 5-10 years). Differences between low- and high-transmission periods in the prevalence of severe anaemia (SA) among young children (6-24 months) were unexpectedly comparable (low, 3.9%vs. high, 5.4%; P = 0.52) and greatly reduced from levels measured in this same community and age group in November 2000 (12.5%) and November 1996 (22.0%). Despite the lower frequency of anaemia/SA in young children surveyed in 2001, it was still clear that this condition was strongly associated with parasitaemia and that children under 5 years of age experienced a significant drop in their mean Hb levels by the end of the high transmission season. Prevalence of parasitaemia was significantly lower (P < 0.01) among infants and young children (<2 years) whose parents reported the use of bednets. There was a significantly lower risk of parasitaemia among infants [odds ratio (OR) 6-8] and young children (OR 3-4) living in the central, more urbanized sector of the study area.

  5. Level of knowledge and understanding of informed consent amongst the training grade group orthodontists in England, Wales and Northern Ireland.

    Science.gov (United States)

    Sharma, Pratik K; Chate, Robert A

    2011-06-01

    To assess the level of knowledge and understanding of informed consent in UK orthodontic trainees. A cross-sectional, written questionnaire-based study. Hospital orthodontic departments in England, Wales and Northern Ireland. A one page questionnaire which covered a range of legal issues pertinent to informed consent was circulated to 207 members of the Training Grades Group (TGG) of the British Orthodontic Society (BOS). The questionnaire consisted of four open questions with 11 responses, which the investigators considered to be ideal, seven closed questions requiring yes/no responses and one question requiring a yes/no response followed by two open responses. Following the initial circulation, a second posting to non-responders was conducted. The response rate was 61% (N=126). The mean number of complete answers to the 21 questions was 13 (62%; median 13; mode 14). There were a low number of complete responses to specific questions in the following areas - explanations patients need from clinicians prior to obtaining consent; how to fully judge if a patient is capable of consenting; how to manage a patient incapable of giving consent; the legal status of fathers consenting on behalf of their children; whether consent forms have to be re-signed if the start of treatment is delayed by six months or more and responsibility for obtaining consent for dental treatment under general anaesthesia. There was a disappointingly high proportion of incomplete answers to questions testing the knowledge and understanding of the law as it pertains to informed consent exists amongst members of the TGG of BOS.

  6. Assessment of undiscovered conventional oil and gas resources, onshore Claiborne Group, United Statespart of the northern Gulf of Mexico Basin

    Science.gov (United States)

    Hackley, P.C.; Ewing, T.E.

    2010-01-01

    The middle Eocene Claiborne Group was assessed for undiscovered conventional hydrocarbon resources using established U.S. Geological Survey assessment methodology. This work was conducted as part of a 2007 assessment of Paleogene-Neogene strata of the northern Gulf of Mexico Basin, including the United States onshore and state waters (Dubiel et al., 2007). The assessed area is within the Upper Jurassic-CretaceousTertiary composite total petroleum system, which was defined for the assessment. Source rocks for Claiborne oil accumulations are interpreted to be organic-rich, downdip, shaley facies of the Wilcox Group and the Sparta Sand of the Claiborne Group; gas accumulations may have originated from multiple sources, including the Jurassic Smackover Formation and the Haynesville and Bossier shales, the Cretaceous Eagle Ford and Pearsall (?) formations, and the Paleogene Wilcox Group and Sparta Sand. Hydrocarbon generation in the basin started prior to deposition of Claiborne sediments and is currently ongoing. Primary reservoir sandstones in the Claiborne Group include, from oldest to youngest, the Queen City Sand, Cook Mountain Formation, Sparta Sand, Yegua Formation, and the laterally equivalent Cockfield Formation. A geologic model, supported by spatial analysis of petroleum geology data, including discovered reservoir depths, thicknesses, temperatures, porosities, permeabilities, and pressures, was used to divide the Claiborne Group into seven assessment units (AUs) with three distinctive structural and depositional settings. The three structural and depositional settings are (1) stable shelf, (2) expanded fault zone, and (3) slope and basin floor; the seven AUs are (1) lower Claiborne stable-shelf gas and oil, (2) lower Claiborne expanded fault-zone gas, (3) lower Claiborne slope and basin-floor gas, (4) lower Claiborne Cane River, (5) upper Claiborne stable-shelf gas and oil, (6) upper Claiborne expanded fault-zone gas, and (7) upper Claiborne slope and basin

  7. Predictors of Strength of In-Group Identity in Northern Ireland: Impact of Past Sectarian Conflict, Relative Deprivation, and Church Attendance.

    Science.gov (United States)

    Goeke-Morey, Marcie C; Taylor, Laura K; Merrilees, Christine E; Cummings, E Mark

    2015-07-01

    Social identity in Northern Ireland is multifaceted, with historical, religious, political, social, economic, and psychological underpinnings. Understanding the factors that influence the strength of identity with the Protestant or Catholic community, the two predominate social groups in Northern Ireland, has implications for individual well-being as well as for the continuation of tension and violence in this setting of protracted intergroup conflict. This study examined predictors of the strength of in-group identity in 692 women (mean age 37 years) in post-accord Northern Ireland. For Catholics, strength of in-group identity was positively linked to past negative impact of sectarian conflict and more frequent current church attendance, whereas for Protestants, strength of in-group identity was related to greater status satisfaction regarding access to jobs, standard of living, and political power compared to Catholics; that is, those who felt less relative deprivation. The discussion considers the differences in the factors underlying stronger identity for Protestants and Catholics in this context.

  8. Long-Term Uplift in the Altiplano-Puna Neovolcanic Zone: Evidence of an Active Magmatic Diapir?

    Science.gov (United States)

    Fialko, Y.; Pearse, J.

    2012-12-01

    We present InSAR observations of a long-term uplift in the Altiplano-Puna neovolcanic zone (central Andes, South America). Previous observations revealed a a massive Ultra Low Velocity Zone (ULVZ) at depth of 17-19 km (Zandt et al., 2003), and surface deformation that was attributed to Uturuncu, a dormant volcano in the middle of the Altiplano-Puna neovolcanic zone (Pritchard and Simons, 2002). Our time series analysis of combined data from different sensors (ERS-1/2 and ENVISAT), satellite tracks, and observation modes (fine beam and ScanSAR) reveals that the central uplift has persisted at a nearly constant rate of ~1 cm/yr over the last two decades, and is surrounded by a broad zone of subsidence. We use the satellite line-of-sight velocities from different look directions to constrain the depth and geometry of the inferred sources of magmatic unrest. Inversions based on elastic half-space models indicate that the inflation source is located well below the brittle-ductile transition, and likely resides at the depth of the seismically imaged ULVZ. We investigated the effects of inelastic deformation in the ambient crust using finite element models. The models incorporated laboratory-derived rheologies of the ambient crust, and geotherms appropriate for an active neo-volcanic zone such as the one in the Altiplano-Puna province. Based on a large number of numerical simulations constrained by the observed surface velocities, we conclude that the ongoing uplift and peripheral subsidence result from a large mid-crustal diapir fed by a partially molten source region in the middle crust. The observed pattern of surface deformation due to the Altiplano-Puna ULVZ is remarkably similar to that due to the Socorro Magma Body (SMB) in central New Mexico, USA (Pearse and Fialko, 2010), suggesting a common process. mosaic of the mean LOS velocity showing uplift and peripheral subsidence due to the inferred mid-crustal diapir.

  9. The quinoa boom of the southern Bolivian Altiplano - linking geomorphology, erosion and spatial production patterns

    Science.gov (United States)

    Sander, Lasse; Jacobsen, Sven-Erik

    2014-05-01

    Quinoa (Chenopodium quinoa Willd.) is a native Andean crop that gained worldwide popularity over the last few decades due to its outstanding nutritional properties. The plant is characterized by an exceptional adaptation and is able to produce decent yields despite harsh environmental conditions like drought, frost, or soil salinity. Quinoa is thus an exceptional income opportunity in the arid southern Bolivian Altiplano, an area endemically struck by rural poverty and malnutrition. In the early 1970s, the Bolivian government introduced the first tractors to southern Bolivia's Salar region with the intention to push agricultural development - with obvious success. The cultivation of quinoa is today the most important land use, with a continued increase in production volume and areal extent. We here trace back land-use changes from 1972 to 2013 in one of the most important areas of quinoa production. Using Landsat images, SRTM elevations and field survey data, we investigate the relationship of field areas to erosion patterns and large-scale geomorphology. The soils of the southern Bolivian Altiplano are highly susceptible to particle entrainment due to a loose and sandy substrate, strong winds, and rapid drainage during precipitation and snow melt events. It appears that many of the first quinoa fields were established on flood plain deposits, where good yields could be anticipated despite the apparent risk of erosion. The subsequent expansion of production areas was paralleled by an increase in field density. Locally, this implied a reduction of fallowing length and the incorporation of marginal lands. The almost complete removal of natural (i.e. protecting) vegetation over large and continuous areas, results in increased wind erosion and partial crop failure. While production extended by approx. 1,6 % per year between 1985 and 2003, an average annual increase of 8,4 % could be observed for the last decade, when many new fields were established at lower elevations

  10. Location selection of agricultural-residuals particleboard industry through group decision: The case study of northern Iran

    Directory of Open Access Journals (Sweden)

    Majid Azizi

    2016-12-01

    Full Text Available This paper presents a framework for locating agricultural-residuals particleboard industry in the northern provinces of Iran. Particleboard industry is the only Iranian wood and paper industry with an export potential and the use of agricultural residuals as the raw material can help with increasing the production in this industry, while reducing the damage to forest resources. The northern provinces of Iran are agricultural centers with ample amounts of agricultural residues. These provinces are, therefore, preferable to other provinces as the construction sites of particleboard plants. In the location selection model presented in this paper, the Analytical Hierarchy Process (AHP method is used and the results indicate that the criterion of ‘material and production’ and the sub-criterion of ‘reliability of supply’ have the highest priorities, and that Golestan province is the best alternative.

  11. THE INFLUENCE OF FOLD AND FRACTURE DEVELOPMENT ON RESERVOIR BEHAVIOR OF THE LISBURNE GROUP OF NORTHERN ALASKA

    Energy Technology Data Exchange (ETDEWEB)

    Wesley K. Wallace; Catherine L. Hanks; Jerry Jensen; Michael T. Whalen

    2002-01-01

    The Carboniferous Lisburne Group is a major carbonate reservoir unit in northern Alaska. The Lisburne is detachment folded where it is exposed throughout the northeastern Brooks Range, but is relatively undeformed in areas of current production in the subsurface of the North Slope. The objectives of this study are to develop a better understanding of four major aspects of the Lisburne: (1) The geometry and kinematics of detachment folds and their truncation by thrust faults. (2) The influence of folding on fracture patterns. (3) The influence of deformation on fluid flow. (4) Lithostratigraphy and its influence on folding, faulting, fracturing, and reservoir characteristics. The Lisburne in the main axis of the Brooks Range is characteristically deformed into imbricate thrust sheets with asymmetrical hanging wall anticlines and footwall synclines. In contrast, the Lisburne in the northeastern Brooks Range is characterized by symmetrical detachment folds. The focus of our 2000 field studies was at the boundary between these structural styles in the vicinity of Porcupine Lake, in the Arctic National Wildlife Refuge. The northern edge of thrust-truncated folds in Lisburne is marked by a local range front that likely represents an eastward continuation of the central Brooks Range front. This is bounded to the north by a gently dipping panel of Lisburne with local asymmetrical folds. The leading edge of the flat panel is thrust over Permian to Cretaceous rocks in a synclinal depression. These younger rocks overlie symmetrically detachment-folded Lisburne, as is extensively exposed to the north. Six partial sections were measured in the Lisburne of the flat panel and local range front. The Lisburne here is about 700 m thick and is interpreted to consist primarily of the Wachsmuth and Alapah Limestones, with only a thin veneer of Wahoo Limestone. The Wachsmuth (200 m) is gradational between the underlying Missippian Kayak Shale and the overlying Mississippian Alapah, and

  12. Telemedicina en Bolivia: proyecto RAFT-Altiplano, experiencias, perspectivas y recomendaciones

    Directory of Open Access Journals (Sweden)

    Alejandro Vargas

    2014-06-01

    Full Text Available OBJETIVO: El objetivo del proyecto RAFT-Altiplano (RAFT, Red Africana Francófona de Telemedicina es evaluar la viabilidad, potencialidad y riesgos de la implementación y el desarrollo de una red de telemedicina en el contexto de un país en desarrollo, como es el caso del Altiplano de Bolivia, para mejorar el acceso a la atención médica y la formación continua en el área rural. En este estudio se describe el desarrollo de dicho proyecto entre 2011 y 2013. MÉTODOS: Se donaron equipos de telemedicina digitales a los centros de salud y se desarrolló una plataforma basada en tecnología Microsoft®integrable con otras tecnologías (con formatos estándares, para gestionar electrónicamente contenidos y documentos clínicos. Se ha capacitado a los profesionales de la salud para realizar las teleconsultas y se ha diseñado un flujo de trabajo de teleconsulta. El sistema de teleenseñanza utilizado es Dudal, porque requiere poco ancho de banda. RESULTADOS: Tras tres años de implementación se dispone de una estructura de trabajo organizada con los diferentes hospitales, instituciones y centros de salud adaptada al contexto latinoamericano para la implementación y utilización de herramientas de teleconsulta y teleenseñanza. El proyecto ha mejorado el acceso a la atención médica especializada en los centros de salud alejados y en los hospitales de tercer nivel de zonas urbanas y ha sido la antesala del desarrollo del proyecto nacional "TeleSalud para Bolivia" promovido por el Ministerio de Salud que contempla la utilización del nuevo satélite boliviano Túpac Katari. CONCLUSIONES: Es viable desarrollar e implementar herramientas de telemedicina en regiones remotas de Bolivia en beneficio de la población cuando se ponen a disposición de las instituciones gubernamentales y municipales de salud y el trabajo entre ellas y los centros asistenciales se realiza de forma coordinada. La comunicación de experiencias, dificultades y riesgos

  13. THE INFLUENCE OF FOLD AND FRACTURE DEVELOPMENT ON RESERVOIR BEHAVIOR OF THE LISBURNE GROUP OF NORTHERN ALASKA

    Energy Technology Data Exchange (ETDEWEB)

    Wesley K. Wallace; Catherine L. Hanks; Michael T. Whalen; Jerry Jensen; Paul K. Atkinson; Joseph S. Brinton

    2000-05-01

    The Lisburne Group is a major carbonate reservoir unit in northern Alaska. The Lisburne is detachment folded where it is exposed throughout the northeastern Brooks Range, but is relatively undeformed in areas of current production in the subsurface of the North Slope. The objectives of this study are to develop a better understanding of four major aspects of the Lisburne: (1) The geometry and kinematics of detachment folds and their truncation by thrust faults. (2) The influence of folding and lithostratigraphy on fracture patterns. (3) Lithostratigraphy and its influence on folding, faulting, fracturing, and reservoir characteristics. (4) The influence of lithostratigraphy and deformation on fluid flow. The results of field work during the summer of 1999 offer some preliminary insights: The Lisburne Limestone displays a range of symmetrical detachment fold geometries throughout the northeastern Brooks Range. The variation in fold geometry suggests a generalized progression in fold geometry with increasing shortening: Straight-limbed, narrow-crested folds at low shortening, box folds at intermediate shortening, and folds with a large height-to-width ratio and thickened hinges at high shortening. This sequence is interpreted to represent a progressive change in the dominant shortening mechanism from flexural-slip at low shortening to bulk strain at higher shortening. Structural variations in bed thickness occur throughout this progression. Parasitic folding accommodates structural thickening at low shortening and is gradually succeeded by penetrative strain as shortening increases. The amount of structural thickening at low to intermediate shortening may be inversely related to the local amount of structural thickening of the Kayak Shale, the incompetent unit that underlies the Lisburne. The Lisburne Limestone displays a different structural style in the south, across the boundary between the northeastern Brooks Range and the main axis of the Brooks Range fold

  14. CONVERSIÓN RELIGIOSA E IDENTIDAD CULTURAL EN EL ALTIPLANO PERUANO

    Directory of Open Access Journals (Sweden)

    Enrique Rivera Vela

    2015-12-01

    Full Text Available El artículo que se presenta se interesa en conocer las razones que motivan a un sector de la población del Altiplano peruano, muy arraigada a las creencias de la religión cristiana católica y a sus propias tradiciones culturales y religiosas andinas, a convertirse a otros dogmas religiosos, dejando de lado algunos referentes identitarios que dan unidad cultural a las poblaciones de esta parte del país y debilitando con ello su propia identidad cultural. Para este fin, se ha tomado como muestra a integrantes de ocho nuevos movimientos religiosos ubicados en la ciudad de Puno, donde a través de la técnica de la entrevista, se ha logrado conocer los motivos de la conversión religiosa de casi medio centenar de ellos, así como aspectos relacionados con su identidad cultural. El análisis de la información recabada, permite opinar que al convertirse a un dogma distinto, lo más importante para este sector de la población, es su identidad religiosa y ya no tanto su identidad cultural.

  15. Tomographic Imaging of the Peru Subduction Zone beneath the Altiplano and Implications for Andean Tectonics

    Science.gov (United States)

    Davis, P. M.; Foote, E. J.; Stubailo, I.; Phillips, K. E.; Clayton, R. W.; Skinner, S.; Audin, L.; Tavera, H.; Dominguez Ramirez, L. A.; Lukac, M. L.

    2010-12-01

    This work describes preliminary tomography results from the Peru Seismic Experiment (PERUSE) a 100 station broadband seismic network installed in Peru. The network consists a linear array of broadband seismic stations that was installed mid-2008 that runs from the Peruvian coast near Mollendo to Lake Titicaca. A second line was added in late 2009 between Lake Titicaca and Cusco. Teleseismic and local earthquake travel time residuals are being combined in the tomographic inversions. The crust under the Andes is found to be 70-80 km thick decreasing to 30 km near the coast. The morphology of the Moho is consistent with the receiver function images (Phillips et al., 2010; this meeting) and also gravity. Ray tracing through the heterogeneous structure is used to locate earthquakes. However the rapid spatial variation in crustal thickness, possibly some of the most rapid in the world, generates shadow zones when using conventional ray tracing for the tomography. We use asymptotic ray theory that approximates effects from finite frequency kernels to model diffracted waves in these regions. The observation of thickened crust suggests that models that attribute the recent acceleration of the Altiplano uplift to crustal delamination are less likely than those that attribute it to crustal compression.

  16. Anaerobic co-digestion of aquatic flora and quinoa with manures from Bolivian Altiplano

    International Nuclear Information System (INIS)

    Alvarez, Rene; Liden, Gunnar

    2008-01-01

    Quinoa stalk (Chenopodium quinoa Willd.) from agricultural crop residue, totora (Schoenoplectus tatora) and o-macrophytes (aquatic flora) from Lake Titicaca (on the Bolivian Altiplano) were studied in a wet anaerobic co-digestion process together with manure from llama, cow and sheep. Anaerobic semi-continuous experiments were performed in (10) 2-l reactors at a temperature of 25 deg. C with 30 days of hydraulic retention time (HRT) and an organic loading rate (OLR) of 1.8 kg VS m -3 d -1 . Totora was found to be the best co-substrate. In mixture ratios of 1:1 (VS basis), it increased the biogas productivity by 130% for llama manure, 60% for cow manure, and 40% for sheep manure. It was possible to use up to 58% (VS basis) of totora in the substrate. Higher concentrations (including pure totora) could not be digested, as that caused acidification problems similar to those caused by other lignocellulosic materials. When quinoa and o-macrophytes were used as co-substrates, the increase in biogas productivity was slightly less. However, these co-substrates did not cause any operational problems. An additional advantage of quinoa and o-macrophytes was that they could be used in any proportion (even in pure form) without causing any destabilization problems in the anaerobic digestion process

  17. CAMBIO DE USO DE SUELO EN UNA MICROCUENCA DEL ALTIPLANO MEXICANO

    Directory of Open Access Journals (Sweden)

    J. A. García Orozco

    2011-01-01

    Full Text Available El territorio mexicano se caracteriza por una amplia diversidad ambiental debido a diversos factores fisiográficos (ubicación geográfica, relieve, clima, tipo de suelo, vegetación. En México, los procesos de cambio en el uso del suelo se derivan de la interacción de amplios factores geográficos, económicos, políticos, sociales, demográficos y culturales. El objetivo de este trabajo fue identificar y evaluar los cambios en el uso del suelo ocurridos en la microcuenca del río San José, ubicado en los municipios de San Felipe del Progreso y San José del Rincón, en el Altiplano Mexicano, entre los años 2000 y 2008. Se utilizó el software Arc Gis y funciones matemáticas para calcular los cambios de uso de suelo y evaluar la pérdida de áreas boscosas próximas a zonas agrícolas. El cambio más significativo se presenta sobre áreas forestales transformadas en agricultura de temporal.

  18. Treerunners, cryptic lizards of the Plica plica group (Squamata, Sauria, Tropiduridae) of northern South America

    Science.gov (United States)

    Murphy, John C.; Jowers, Michael J.

    2013-01-01

    Abstract The arboreal, Neotropical lizard Plica plica (Linnaeus, 1758) has been long considered a widespread species with a distribution east of the Andes. A preliminary examination of 101 specimens from about 28 locations mostly north of the Amazon suggests that Plica plica is a cryptic species complex with taxa that can be distinguished on the basis of the number of scale rows at mid-body; the arrangement, shape and ornamentation of scales on the snout; the number of lamellae on the fourth toe; the number of subocular plates; as well as other commonly used external morphological traits. The allopatric species discussed here are concordant with northern South American geography. Plica plica (Linnaeus, 1758) is associated with the Guiana Shield (Suriname, Guyana and Venezuela). A second species, P. caribeana sp. n. is associated with the Caribbean Coastal Range of Venezuela including Trinidad and Tobago. A third, distinctive species, P. rayi sp. n. is associated with the middle Orinoco at the eastern edge of the Guiana Shield. Two other species, P. kathleenae sp. n. and P. medemi sp. n., each based upon a single specimen, one from the Sierra Acarai Mountains of Guyana, and the other from southern Meta, Colombia are described. In addition to morphological analyses, we sequenced 12S and 16S rDNA gene fragments from one Plica plica from Trinidad to assess its relationship and taxonomy to other mainland Plica cf. plica. The results suggest Plica caribeana sp. n. likely diverged prior to the separation of Trinidad from northern Venezuela. Isolation in the Caribbean Coastal Range during its rapid uplift in the late Miocene, combined with a marine incursion into northern Venezuela may have contributed to their genetic divergence from other populations. PMID:24363569

  19. Partial mitochondrial DNA sequences suggest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae), forest malaria vectors, in northern Vietnam.

    Science.gov (United States)

    Takano, Kohei Takenaka; Nguyen, Ngoc Thi Hong; Nguyen, Binh Thi Huong; Sunahara, Toshihiko; Yasunami, Michio; Nguyen, Manh Duc; Takagi, Masahiro

    2010-04-30

    During the last decade, Southeast Asian countries have been very successful in reducing the burden of malaria. However, malaria remains endemic in these countries, especially in remote and forested areas. The Leucosphyrus group of the genus Anopheles harbors the most important malaria vectors in forested areas of Southeast Asia. In Vietnam, previous molecular studies have resulted in the identification of only Anopheles dirus sensu stricto (previously known as An. dirus species A) among the Leucosphyrus group members. However, Vietnamese entomologists have recognized that mosquitoes belonging to the Leucosphyrus group in northern Vietnam exhibit morphological characteristics similar to those of Anopheles takasagoensis, which has been reported only from Taiwan. Here, we aimed to confirm the genetic and morphological identities of the members of the Leucosphyrus group in Vietnam. In the molecular phylogenetic trees reconstructed using partial COI and ND6 mitochondrial gene sequences, samples collected from southern and central Vietnam clustered together with GenBank sequences of An. dirus that were obtained from Thailand. However, samples from northern Vietnam formed a distinct clade separated from both An. dirus and An. takasagoensis by other valid species. The results suggest the existence of a cryptic species in northern Vietnam that is morphologically similar to, but phylogenetically distant from both An. dirus and An. takasagoensis. We have tentatively designated this possible cryptic species as Anopheles aff. takasagoensis for convenience, until a valid name is assigned. However, it is difficult to distinguish the species solely on the basis of morphological characteristics. Further studies on such as karyotypes and polytene chromosome banding patterns are necessary to confirm whether An. aff. takasagoensis is a valid species. Moreover, studies on (1) the geographic distribution, which is potentially spreading along the Vietnam, China, Laos, and Myanmar borders

  20. Collaborative survey of perinatal loss in planned and unplanned home births. Northern Region Perinatal Mortality Survey Coordinating Group.

    Science.gov (United States)

    1996-11-23

    To document the outcome of planned and unplanned births outside hospital. Confidential review of every pregnancy ending in stillbirth or neonatal death in which plans had been made for home delivery, irrespective of where delivery eventually occurred. The review was part of a sustained collaborative survey of all perinatal deaths. Northern Regional Health Authority area. All 558,691 registered births to women normally resident in the former Northern Regional Health Authority area during 1981-94. Perinatal death. The estimated perinatal mortality during 1981-94 among women booked for a home birth was 14 deaths in 2888 births. This was less than half that among all women in the region. Only three of the 14 women delivered outside hospital. Independent review suggested that two of the 14 deaths might have been averted by different management. Both births occurred in hospital, and in only one was management before admission of the mother judged inappropriate. Perinatal loss to the 64 women who booked for hospital delivery but delivered outside and to the 67 women who delivered outside hospital without ever making arrangements to receive professional care during labour accounted for the high perinatal mortality (134 deaths in 3466 deliveries) among all births outside hospital. The perinatal hazard associated with planned home birth in the few women who exercised this option (unplanned delivery outside hospital.

  1. Genetic relatedness of indigenous ethnic groups in northern Borneo to neighboring populations from Southeast Asia, as inferred from genome-wide SNP data.

    Science.gov (United States)

    Yew, Chee Wei; Hoque, Mohd Zahirul; Pugh-Kitingan, Jacqueline; Minsong, Alexander; Voo, Christopher Lok Yung; Ransangan, Julian; Lau, Sophia Tiek Ying; Wang, Xu; Saw, Woei Yuh; Ong, Rick Twee-Hee; Teo, Yik-Ying; Xu, Shuhua; Hoh, Boon-Peng; Phipps, Maude E; Kumar, S Vijay

    2018-07-01

    The region of northern Borneo is home to the current state of Sabah, Malaysia. It is located closest to the southern Philippine islands and may have served as a viaduct for ancient human migration onto or off of Borneo Island. In this study, five indigenous ethnic groups from Sabah were subjected to genome-wide SNP genotyping. These individuals represent the "North Borneo"-speaking group of the great Austronesian family. They have traditionally resided in the inland region of Sabah. The dataset was merged with public datasets, and the genetic relatedness of these groups to neighboring populations from the islands of Southeast Asia, mainland Southeast Asia and southern China was inferred. Genetic structure analysis revealed that these groups formed a genetic cluster that was independent of the clusters of neighboring populations. Additionally, these groups exhibited near-absolute proportions of a genetic component that is also common among Austronesians from Taiwan and the Philippines. They showed no genetic admixture with Austro-Melanesian populations. Furthermore, phylogenetic analysis showed that they are closely related to non-Austro-Melansian Filipinos as well as to Taiwan natives but are distantly related to populations from mainland Southeast Asia. Relatively lower heterozygosity and higher pairwise genetic differentiation index (F ST ) values than those of nearby populations indicate that these groups might have experienced genetic drift in the past, resulting in their differentiation from other Austronesians. Subsequent formal testing suggested that these populations have received no gene flow from neighboring populations. Taken together, these results imply that the indigenous ethnic groups of northern Borneo shared a common ancestor with Taiwan natives and non-Austro-Melanesian Filipinos and then isolated themselves on the inland of Sabah. This isolation presumably led to no admixture with other populations, and these individuals therefore underwent

  2. Isotopic composition and origin of the precipitation in Northern Chile

    International Nuclear Information System (INIS)

    Aravena, R.; Suzuki, O.; Pena, H.; Pollastri, A.; Fuenzalida, H.; Grilli, A.

    1999-01-01

    A 3 a data set of isotopes in precipitation from northern Chile show a very distinct pattern, with δ 18 O values ranging between -18 and -15per thousand at high altitude stations, compared to δ 18 O values between -10 and -6per thousand at the lower altitude areas. The 18 O-depleted values observed in the high altitude area, the Altiplano, are related to processes that affect the air masses that originated over the Atlantic, cross the Amazon Basin (continental effect), ascend the Andes (altitude effect) and precipitated (convective effect) in the Altiplano. It is postulated that a second source of moisture, associated with air masses from the Pacific, may contribute to the 18 O-enriched values observed in the lower altitude areas. Similar isotopic patterns are documented in springs and groundwater indicating that the data presented in this paper are an accurate representation of the long term behavior isotopic composition of rain in northern Chile. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  3. Isotopic composition and origin of the precipitation in Northern Chile

    Energy Technology Data Exchange (ETDEWEB)

    Aravena, R. [Department of Earth Sciences, University of Waterloo, Waterloo (Canada); Suzuki, O. [Exploracion y Desarrollo de Recursos Hidricos, Santiago (Chile); Pena, H. [Direccion General de Aguas, Ministerio de Obras Publicas, Santiago (Chile); Pollastri, A. [Comision Chilena de Energia Nuclear, Santiago (Chile); Fuenzalida, H. [Departamento de Geofisica, Universidad of Chile, Santiago (Chile); Grilli, A. [Empresa Metropolitana de Obras Sanitarias, Santiago (Chile)

    1999-06-01

    A 3 a data set of isotopes in precipitation from northern Chile show a very distinct pattern, with {delta}{sup 18}O values ranging between -18 and -15per thousand at high altitude stations, compared to {delta}{sup 18}O values between -10 and -6per thousand at the lower altitude areas. The {sup 18}O-depleted values observed in the high altitude area, the Altiplano, are related to processes that affect the air masses that originated over the Atlantic, cross the Amazon Basin (continental effect), ascend the Andes (altitude effect) and precipitated (convective effect) in the Altiplano. It is postulated that a second source of moisture, associated with air masses from the Pacific, may contribute to the {sup 18}O-enriched values observed in the lower altitude areas. Similar isotopic patterns are documented in springs and groundwater indicating that the data presented in this paper are an accurate representation of the long term behavior isotopic composition of rain in northern Chile. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  4. 20 January 2014 - Members of the Regional Assemblies and Parliaments United Kingdom of Great Britain and Northern Ireland visiting the LHC tunnel at Point 8 with Technology Department, Vacuum, Surfaces and Coatings Group P. Cruikshank.

    CERN Document Server

    Pantelia, Anna

    2014-01-01

    20 January 2014 - Members of the Regional Assemblies and Parliaments United Kingdom of Great Britain and Northern Ireland visiting the LHC tunnel at Point 8 with Technology Department, Vacuum, Surfaces and Coatings Group P. Cruikshank.

  5. Task 50 - deposition of lignites in the Fort Union Group and related strata of the northern Great Plains

    Energy Technology Data Exchange (ETDEWEB)

    Hartman, J.H.; Roth, B.; Kihm, A.J.

    1997-08-11

    Late Cretaceous, Paleocene, and early Eocene geologic and paleontologic studies were undertaken in western North Dakota, eastern and south-central Montana, and northwestern and northeastern Wyoming. These study areas comprise the Williston, Bighorn, and Powder River Basins, all of which contain significant lignite resources. Research was undertaken in these basins because they have the best geologic sections and fossil record for the development of a chronostratigraphic (time-rock) framework for the correlation of lignite beds and other economic resources. A thorough understanding of the precise geologic age of the deposition of sediments permits a powerful means of interpreting the record of geologic events across the northern Great Plains. Such an understanding allows for rigorous interpretation of paleoenviromnents and estimates of resource potential and quality in this area of economically significant deposits. This work is part of ongoing research to document change in the composition of molluscan fossil faunas to provide a paleoenvironmentally sensitive independent means of interpreting time intervals of brief duration during the Late Cretaceous, Paleocene, and Eocene. This study focuses on the record of mollusks and, to a lesser extent, mammals in the (1) Hell Creek-Tullock Formations, which include the Cretaceous-Paleocene boundary, in the western portion of the Williston Basin, Montana; (2) uppermost Cretaceous, Paleocene, and lowermost Eocene strata in western North Dakota, which -includes the last interior seaway in North Dakota; (3) upper Paleocene and lowermost Eocene of the northern portion of the Bighorn Basin of south-central Montana and northwestern Wyoming; and (4) Powder River Basin of northeastern Wyoming and southeastern Montana. The geologic record provides different physical and paleontological information to aid in interpreting the geologic record through the study interval.

  6. Do cosmogenic nuclides (10Be, 14C , 21Ne, 26Al) track late Quaternary climate changes on the Altiplano?

    Science.gov (United States)

    Hippe, K.; Kober, F.; Zeilinger, G.; Ivy-Ochs, S.; Kubik, P.; Maden, C.; Wieler, R.

    2010-12-01

    The high Altiplano plateau is the most prominent element of the Central Andes, separating the Andean Cordilleras between 15° to 22° S. It represents a tectonically quiet, intramontane basin with arid to semi-arid climate, low relief and internal drainage. Throughout the late Quaternary regional climate on the Altiplano repeatedly changed between wet and dry conditions [1]. The influence of climate on the plateau evolution during the Pleistocene/Holocene is unclear, however, as data on erosion processes and rates on the Altiplano are sparse. Here, we present a multiple-nuclide study investigating surface denudation at the eastern Altiplano of Bolivia (16°-17° S) on millennial and longer timescales. The aim is a better understanding of the complex feedback between climate, tectonics and geomorphology on the topographic evolution of the Andes. Catchment-wide denudation (CWD) rates are provided for a 150 km NW-SE transect along the Altiplano edge based on the analyses of cosmogenic 10Be, 26Al, 21Ne and in-situ 14C in river-borne sediment. Single nuclide CWD rates obtained for 10Be, 26Al and 21Ne are similar for all three nuclides and on the order of 3-37 mm/ka. Thus, the calculated denudation rates provide an averaged denudation history dating back at least to the middle Pleistocene. Denudation rates correlate positively with the mean basin hillslope, which is mainly controlled by basin lithology. For most catchments both, the 26Al/10Be ratios and the 21Ne/10Be ratios indicate a complex erosion/exposure history with probably several periods of sediment storage and burial/shielding totalling ~0.5 - 1.2 Ma. Local geomorphology featuring low slopes and low relief, small terraces and local floodplains also suggests that sediment transport might have been periodically ineffective. Concentrations of in-situ produced short-lived 14C are significantly lower than expected from the concentrations of the long-lived and stable cosmogenic nuclides. This would indicate a 30

  7. The fault pattern in the northern Negev and southern Coastal Plain of Israel and its hydrogeological implications for groundwater flow in the Judea Group aquifer

    Science.gov (United States)

    Weinberger, G.; Rosenthal, E.

    1994-03-01

    On the basis of a broadly expanding data base, the hydrogeological properties of the Judea Group sequence in the northern Negev and southern Coastal Plain of Israel have been reassessed. The updated subsurface model is based on data derived from water- and oil-wells and on recent large-scale geophysical investigations. A new regional pattern of the reassessed geological through the subsurface of the study area has been revealed. In view of the reassessed geological and hydrological subsurface setting, it appears that the Judea Group aquifer should not be regarded as one continuous and undisturbed hydrological unit; owing to the occurrence of regional faults, its subaquifers are locally interconnected. These subaquifers, which contain mainly high-quality water, are juxtaposed, as a result of faulting, against Kurnub Group sandstones containing brackish paleowater. The latter Group is faulted against late Jurassic formations containing highly saline groundwater. In the Beer Sheva area, the Judea Group aquifer is vertically displaced against the Senonian and Eocene Mt. Scopus and Avdat Groups, which also contain brackish and saline water. In the southern Coastal Plain, major faults locally dissect also the Pleistocene Kurkar Group, facilitating inflow of Mg-rich groundwater deriving from Judea Group dolomites. The new geological evidence and its hydrogeological implications provide new solutions for previously unexplained salinization phenomena.

  8. The last glacial cycle and palaeolake synchrony in the southern bolivian Altiplano: Cerro Azanaques case study

    Directory of Open Access Journals (Sweden)

    1995-01-01

    Full Text Available SYNCHRONISME ENTRE LE DERNIER CYCLE GLACIAIRE ET L'EXTENSION DES PALÉOLACS DANS LE SUD DE L'ALTIPLANO BOLIVIEN : EXEMPLE DU CERRO AZANAQUES. Dans la Cordillère Orientale, au niveau du Cerro Azanaques (18°S, Bolivie, des moraines, des sédiments glaciaires, des rivages paléolacustres, des deltas et des stromatolites qui se sont préservés, révèlent des conditions climatiques fortement différentes dans le passé. La culmination de la dernière avancée du glacier Lijunimani a été datée par la méthode du radiocarbone à 13 000 ans BP à partir de sédiments glaciaires ayant remanié un horizon organique de tourbe. La cartographie de cette diacmitite argileuse particulière révèle un delta en forme de cône bordé par un glacier cela montre que les glaciers et les anciens systèmes lacustres font partie d'un processus d'expansion simultanée. L'étude stratigraphique détaillée réalisée au Cerro Azanaques fournit de fortes évidences allant dans le sens d'une réponse commune des glaciers et des lacs à un signal piloté par un changement climatique les lacs ne sont donc pas le simple résultat de la fonte des glaciers des cordillères. SINCRONISMO ENTRE EL ÚLTIMO CICLO GLACIAL Y LA EXTENSIÓN DE LOS PALEOLAGOS EN EL SUR DEL ALTIPLANO BOLIVIANO: CASO DEL CERRO AZANAQUES. En la Cordillera Oriental, a la altura del Cerro Azanaques (18º S, Bolivia aparecen preservadas morrenas y sedimentos glaciares, líneas de costa paleolacustres, deltas y estromatolitos, lo que revela condiciones climáticas pasadas significativamente diferentes. La culminación del último avance del glaciar Lijunimani ha sido fechada mediante radiocarbono a 13 000 años BP a partir de sedimentos glaciares que han desplazado un horizonte orgánico de turba. La cartografía de esta particular diamictita arcillosa revela un delta en forma de abanico con hielo en sus márgenes lo que indica que los glaciares y los sistemas paleolacustres sufrieron un proceso

  9. Hidroquímica de las aguas del Altiplano de Bolivia

    Directory of Open Access Journals (Sweden)

    1995-01-01

    Full Text Available HYDROCHIMIE DES EAUX DE L’ALTIPLANO BOLIVIEN. Les eaux de surface ont été échantillonnées sur 36 points de mesure du bassin endoreïque qui inclut le lac Titicaca, le rio Desaguadero et les lacs Uru-Uru et Poopó (bassin TDPS. Pour les eaux souterraines, des échantillons ont été prélevés dans 37 puits du bassin TDPS et dans 33 puits de la province Aroma. La présente étude concerne la période de 1989 à 1993 qui est déficitaire en précipitation. La salinité augmente du nord au sud c’est un problème grave pour les lacs Uru-Uru et Poopó. Au sud du bassin versant, il y a une pollution naturelle par arsenic, silice, chlorures, sulfates, sodium, calcium et bore. L’influence anthropique est à l’origine d’une pollution bactériologique dans la région d’Oruro et aussi d’une pollution par le wolfram, l’étain, le cobalt, le cadmium, le nickel, l’antimoine et le plomb dans les zones rurales. En général, les eaux de surface présentent un risque pour les populations ainsi que pour les animaux et l’irrigation. En revanche les eaux souterraines montrent de meilleures caractéristiques physico-chimiques. Se muestrearon 36 lugares de agua superficial en la cuenca que incluye el lago Titicaca, río Desaguadero y los lagos Uru Uru y Poopó (Sistema TDPS. En agua subterránea se analizaron 37 pozos del sistema TDPS y 33 pozos en la provincia Aroma. La presente evaluación se refiere a un período de déficit pluviométrico entre 1989 y 1993. El contenido en sales aumenta de norte a sur y es grave en los lagos Uru-Uru y Poopó. Al sur de la cuenca, se nota una contaminación natural por arsénico, sílice, cloruros, sulfatos, sodio, calcio y boro. La contaminación antrópica está al origen de una polución de tipo bacteriológico en el área de Oruro y con wolfram, estaño, cobalto, cadmio, níquel, antimonio y plomo en el área rural. En general, las aguas superficiales presentan riesgos para el consumo humano, animal y para riego

  10. Micrositios del pasto navajita (Bouteloua gracilis en comunidades de pastizal y de matorral del Altiplano Mexicano

    Directory of Open Access Journals (Sweden)

    Rosalva García-Sánchez

    2005-01-01

    Full Text Available El objetivo de este trabajo fue determinar si hay un tipo de micrositio específico para el establecimiento de Bouteloua gracilis, con patrones recurrentes, en dos diferentes tipos de comunidades vegetales. El pasto navajita azul es una especie perenne de alto valor forrajero y resistente a la sequía. Para ello se realizó un recorrido por tres matorrales y tres pastizales del Altiplano Mexicano; los sitios estudiados fueron elegidos con base en los reportes de ejemplares colectados y herborizados. Los resultados muestran, por un lado, que en los pastizales se presentan micrositios más de tipo funcional que físico, que determinan el establecimiento de B. gracilis, debido principalmente a los altos requerimientos de humedad edáfica de las semillas para germinar y desarrollarse. El micrositio más frecuente que determina el reclutamiento de los individuos provenientes de semilla es el suelo cercano a individuos adultos de su propia especie. Por otro lado, en los matorrales se detectaron, de manera recurrente, varias condiciones de micrositio para la especie y se observó que el tipo de micrositio es determinante, tanto para el establecimiento como para el crecimiento de este y otros pastos; también, el estudio mostró que en comunidades de matorral existe una mayor diversidad de micrositios que en los pastizales, por lo que se concluye que los individuos de B. gracilis, en los matorrales, crecen asociados a micrositios específicos que le brindan protección contra la desecación.

  11. Impact of sickle cell trait on the thrombotic risk associated with non-O blood groups in northern Nigeria.

    Science.gov (United States)

    Ahmed, Sagir G; Kagu, Modu B; Ibrahim, Umma A; Bukar, Audu A

    2015-10-01

    The non-O blood group is an established risk factor for deep vein thrombosis (DVT), while controversy surrounds the role of sickle cell trait (SCT) as a risk factor for DVT. We hypothesised that if SCT is a risk factor for DVT, individuals with non-O blood groups and SCT (Hb AS) would have a higher risk of DVT than their counterparts with non-O blood groups and normal haemoglobin phenotype (Hb AA). We retrospectively analysed the prevalence of SCT and non-O blood groups among 148 DVT patients with control subjects in order to determine the role of SCT as a risk factor for DVT and its impact on the risk of DVT among patients with non-O blood groups. In comparison with control subjects, DVT patients had significantly higher prevalences of SCT (35.1% vs 27.7%, p=0.04) and non-O blood groups (68.9% vs 45.9%, p=0.02). The odds ratios for DVT due to SCT, non-O blood groups with normal Hb phenotype (Hb AA) and non-O blood groups with SCT (Hb AS) were 1.3, 2.4 and 3.5, respectively. These results suggest that SCT by itself is a weak risk factor for DVT but it has the potential of escalating the DVT risk among patients with non-O blood groups. The combined effects of elevated clotting factors (non-O group effect) and increased clotting factor activation (SCT effect) were responsible for the escalated DVT risk among patients with co-inheritance of non-O blood groups and SCT. Co-inheritance of SCT and non-O blood group is, therefore, an important mixed risk factor for DVT. This should be taken into account when assessing DVT risk profiles of patients in Africa and other parts of the world where the SCT is prevalent.

  12. 40Ar/39Ar chronology of the McMurdo Volcanic Group at The Pleiades, Northern Victoria Land, Antarctica

    International Nuclear Information System (INIS)

    Esser, R.P.; Kyle, P.R.

    2002-01-01

    Fifteen samples from The Pleiades volcanic centre in northern Victoria Land, Antarctica, were dated using the 40 Ar/ 39 Ar furnace step-heating method. Ages range from 847 to 6 ka. Eight samples are <100 ka, showing that The Pleiades are very young. Three trachyte samples suggest eruptive activity started at c. 830 ka. An apparent increase in volcanic activity began at c. 100 ka, and at c. 65 ka a significant phase of cone building occurred at Mt Atlas, the largest volcanic cone at The Pleiades. At c. 45 ka, lava flows were erupted on the western flank of Mt Pleiones adjacent to Mt Atlas and near the summit of Alcyone Cone. The youngest activity (6 ± 6 ka) occurred at Taygete Cone, an endogenous dome of trachyte. The near-zero age for Taygete Cone is consistent with evidence of recent volcanism, including fresh hydrothermal activity and compositionally similar pumice lapilli scattered over parts of The Pleiades. (author). 6 refs., 3 figs., 1 tab

  13. Partial mitochondrial DNA sequences suggest the existence of a cryptic species within the Leucosphyrus group of the genus Anopheles (Diptera: Culicidae, forest malaria vectors, in northern Vietnam

    Directory of Open Access Journals (Sweden)

    Yasunami Michio

    2010-04-01

    Full Text Available Abstract Background During the last decade, Southeast Asian countries have been very successful in reducing the burden of malaria. However, malaria remains endemic in these countries, especially in remote and forested areas. The Leucosphyrus group of the genus Anopheles harbors the most important malaria vectors in forested areas of Southeast Asia. In Vietnam, previous molecular studies have resulted in the identification of only Anopheles dirus sensu stricto (previously known as An. dirus species A among the Leucosphyrus group members. However, Vietnamese entomologists have recognized that mosquitoes belonging to the Leucosphyrus group in northern Vietnam exhibit morphological characteristics similar to those of Anopheles takasagoensis, which has been reported only from Taiwan. Here, we aimed to confirm the genetic and morphological identities of the members of the Leucosphyrus group in Vietnam. Results In the molecular phylogenetic trees reconstructed using partial COI and ND6 mitochondrial gene sequences, samples collected from southern and central Vietnam clustered together with GenBank sequences of An. dirus that were obtained from Thailand. However, samples from northern Vietnam formed a distinct clade separated from both An. dirus and An. takasagoensis by other valid species. Conclusions The results suggest the existence of a cryptic species in northern Vietnam that is morphologically similar to, but phylogenetically distant from both An. dirus and An. takasagoensis. We have tentatively designated this possible cryptic species as Anopheles aff. takasagoensis for convenience, until a valid name is assigned. However, it is difficult to distinguish the species solely on the basis of morphological characteristics. Further studies on such as karyotypes and polytene chromosome banding patterns are necessary to confirm whether An. aff. takasagoensis is a valid species. Moreover, studies on (1 the geographic distribution, which is potentially

  14. [Genetic Variability and Structure of SNP Haplotypes in the DMPK Gene in Yakuts and Other Ethnic Groups of Northern Eurasia in Relation to Myotonic Dystrophy].

    Science.gov (United States)

    Swarovskaya, M G; Stepanova, S K; Marussin, A V; Sukhomyasova, A L; Maximova, N R; Stepanov, V A

    2015-06-01

    The genetic variability of the DMPK locus has been studied in relation to six SNP markers (rs2070736, rs572634, rs1799894, rs527221, rs915915, and rs10415988) in Yakuts with myotonic dystrophy (MD) in the Yakut population and in populations of northern Eurasia. Significant differences were observed in the allele frequencies between patients and a population sample of Yakuts for three SNP loci (rs915915, rs1799894, and rs10415988) associated with a high chance of disease manifestation. The odds ratios (OR) of MD development in representatives of the Yakut population for these three loci were 2.59 (95% CI, p = 0,004), 4.99 (95% CI, p = 0.000), and 3.15 (95% CI, p = 0.01), respectively. Haplotype TTTCTC, which is associated with MD, and haplotype GTCCTT, which was observed only in Yakut MD patients (never in MD patients of non-Yakut origin), were revealed. A low level of variability in the locus of DMRK gene in Yakuts (H(e) = 0.283) compared with other examined populations was noted. An analysis of pairwise genetic relationships between populations revealed their significant differentiation for all the examined loci. In addition, a low level of differentiation in territorial groups of Yakut populations (F(ST) = 0.79%), which was related to the high subdivision of the northern Eurasian population (F(ST) = 11.83%), was observed.

  15. A glassy lava flow from Toconce volcano and its relation with the Altiplano-Puna Magma Body in Central Andes

    Science.gov (United States)

    Godoy, B.; Rodriguez, I.; Aguilera, F.

    2012-12-01

    Toconce is a composite stratovolcano located at the San Pedro - Linzor volcanic chain (SPLVC). This volcanic chain distributes within the Altiplano-Puna region (Central Andes) which is characterized by extensive rhyodacitic-to-rhyolitic ignimbritic fields, and voluminous domes of dacitic-to-rhyolitic composition (de Silva, 1989). The felsic melts that gave origin to ignimbrites and domes at this area were generated by mixing of mantle-derived magmas and anatectic melts assimilated during their ascent through the thick crust. Thus, partially molten layers exist in the upper crust below the APVC (de Silva et al., 2006). Evidence of large volumes of such melts has been also proposed by geophysical methods (i.e. the Altiplano-Puna Magma Body; Chmielowsky et al., 1999) In this work, petrography and whole rock, mineralogical and melt inclusions geochemistry of a glassy lava flow of Toconce volcano are presented. Petrographically, this lava flow shows a porphyric texture, with euhdral to subhedral plagioclase, ortho- and clino-pyroxene phenocrysts immersed in a glassy groundmass. Geochemically, the lava flow has 64.7% wt. SiO2. The glassy groundmass (~70% wt. SiO2) is more felsic than all the lavas in the volcanic chain (47-68% wt., Godoy et al., 2011). Analyzed orthopyroxene-hosted melt inclusions show an even higher SiO2 content (72-75% wt.), and a decreasing on Al2O3, Na2O, and CaO content with differentiation. Crystallization pressures of this lava flow, obtained using Putirka's two-pyroxene and clinopyroxene-liquid models (Putirka, 2008), range between 6 and 9 kbar. According to crystallization pressures, and major element composition, a felsic source located at shallow crustal pressures - where plagioclase is a stable mineralogical phase - originated the inclusions. This could be related to the presence of the Altiplano-Puna Magma Body (APMB) located below SPLVC. On the other hand, glassy groundmass, and disequilibrium textures in minerals of this lava flow could

  16. One size does not fit all: HIV testing preferences differ among high-risk groups in Northern Tanzania.

    Science.gov (United States)

    Ostermann, Jan; Njau, Bernard; Mtuy, Tara; Brown, Derek S; Mühlbacher, Axel; Thielman, Nathan

    2015-01-01

    In order to maximize the effectiveness of "Seek, Test, and Treat" strategies for curbing the HIV epidemic, new approaches are needed to increase the uptake of HIV testing services, particularly among high-risk groups. Low HIV testing rates among such groups suggest that current testing services may not align well with the testing preferences of these populations. Female bar workers and male mountain porters have been identified as two important high-risk groups in the Kilimanjaro Region of Tanzania. We used conventional survey methods and a discrete choice experiment (DCE), a preference elicitation method increasingly applied by economists and policy-makers to inform health policy and services, to analyze trade-offs made by individuals and quantify preferences for HIV testing services. Bivariate descriptive statistics were used to analyze differences in survey responses across groups. Compared to 486 randomly selected community members, 162 female bar workers and 194 male Kilimanjaro porters reported 2-3 times as many lifetime sexual partners (p porters preferred testing in venues where antiretroviral therapy was readily available. Both high-risk groups were less averse to traveling longer distances to test compared to their community counterparts. These results expose systematic differences in HIV testing preferences across high-risk populations compared to their community peers. Tailoring testing options to the preferences of high-risk populations should be evaluated as a means of improving uptake of testing in these populations.

  17. Functional groupings and food web of an artificial reef used for sea cucumber aquaculture in northern China

    Science.gov (United States)

    Xu, Qinzeng; Zhang, Libin; Zhang, Tao; Zhang, Xuelei; Yang, Hongsheng

    2017-01-01

    Artificial reef is considered as a useful tool to remodel habitats in coastal and estuarine area. Some artificial reefs (ARs) were conducted in Shandong Peninsula for sea cucumber Apostichopus japonicus integrated multi-trophic aquaculture (IMTA). Little is known about the main feeding type and food resources of living organisms in this IMTA ecosystem. Neither is the information about other animals competing food with A. japonicus. Functional group (FG) and their food resources of mobile organisms and epifauna in ARs area were investigated. There were three types of food resources and five FGs within two trophic levels in studied area. Particle organic matter (POM), seaweed detritus and sediment were considered to be the main food resources. The first three FGs were primary consumers and were mainly epifauna, while the other two FGs were secondary consumers. FG 1 species were filter feeders, and group 2 was all deposit feeders and A. japonicus was in this group. FG 2 contained few species and this indicated that A. japonicus had few food competitors. FG 3 contained most epifauna species which were detritus feeders and this result implied that the artificial oyster shell reed can retain detritus effectively. The food sources of group 4 were complex. Species of group 5, mostly fish, occupied the top trophic level and fed primarily on species of FG 1 and FG 2. This kind of ARs can retain detritus effectively and provide suitable habitat to epifauna and surrounding natural fauna community.

  18. A quantitative and constraint-specific method to assess the potential impact of new agricultural technology : the case of frost resistant potato for the Altiplano (Peru and Bolivia)

    NARCIS (Netherlands)

    Hijmans, R.J.; Condori, B.; Carrillo, R.; Kropff, M.J.

    2003-01-01

    A quantitative and constraint-specific approach to assess the potential impact of new agricultural technology is described and applied to frost resistant potato cultivars for the Altiplano (Peru and Bolivia). The approach uses geo-referenced databases and a simulation model. Calculations are made

  19. Factores asociados a mastitis en vacas de la microcuenca lechera del altiplano norte de Antioquia, Colombia

    Directory of Open Access Journals (Sweden)

    Nicolás Ramírez Vásquez

    2011-12-01

    Full Text Available Se efectuó un estudio de corte sobre la prevalencia de mastitis bovina en una muestra representativa de las granjas lecheras del altiplano norte de Antioquia, Colombia. Se evaluaron los resultados del California Mastitis Test (CMT, Recuento de Células Somáticas (RCS y cultivo bacteriológico de leche, y se analizaron los factores de riesgo asociados a mastitis bovina. El análisis estadístico de la información se efectuó por medio de estadística descriptiva, análisis de razón de prevalencias y regresión logística multinivel. Con la prueba de CMT se detectó un 20% de cuartos afectados con mastitis, la prevalencia de mastitis subclínica por vaca fue del 39,5% y la de mastitis clínica fue del 1,7%. Se efectuaron 648 cultivos de muestras de leche, de las cuales 23,9% fueron negativas, 34% positivas a Streptococcus agalactiae y 10,2% a Estafilococo coagulasa negativo. El análisis de regresión reveló que las vacas que tuvieron más de seis meses de lactancia presentaron una Odds Ratio (OR de 2,65 en comparación con las de un mes de lactancia (p < 0,05. Se halló un OR de 1,24 para la asociación de la edad y la mastitis (p < 0,05. Para el lavado de manos se encontró un OR de 0,36 en comparación con no hacerlo (p < 0,05. En conclusión, se halló una alta frecuencia de mastitis por vaca. El microorganismo más hallado fue el Streptococcus agalactiae. El trauma podría ser una causa importante de mastitis dado que no se observó crecimiento bacteriano en 23,9% de los cultivos de muestras de leche de cuartos con mastitis.

  20. Let's Talk about Children Evaluation (LTCE) study in northern Finland: a multiple group ecological study of children's health promotion activities with a municipal and time-trend design.

    Science.gov (United States)

    Kujala, Veikko; Jokinen, Jaana; Ebeling, Hanna; Pohjola, Anneli

    2017-07-13

    Making change towards child and family-based and coordinated services is critical to improve quality, outcomes and value. The Let's Talk about Children (LTC) approach, which consists of brief psychoeducational discussions with parents of kindergarten-aged and school-aged children, has been launched as a municipality-specific programme in the Council of Oulu Region. The aim of this paper is to present a protocol of an ecological study evaluating the group-specific effects of an intervention about LTC activities in a geographically defined population. The programme is designed to promote children's socioemotional well-being. A quasi-experimental ecological study protocol is implemented to evaluate whether systematic LTC practices improve children's well-being. A multi-informant setting covers 30 municipalities in northern Finland and involves all the municipal teachers, social and healthcare workers. In each municipality, a Local Management Team is responsible for implementing the LTC programme and collecting the annual data of LTC discussions and network meetings. The outcome data are retrieved from child welfare statistics and hospital registers. The population data, child welfare statistics and referrals to hospitals was retrieved at baseline (2014), and will be retrieved annually. Furthermore, the annual data of LTC discussions and network meetings will be collected of the years 2015-2018. The study design has been approved by the management of the Oulu University Hospital in accordance with the guidelines given by The Regional Ethics Committee of the Northern Ostrobothnia Hospital District in Oulu, Finland. All data are treated and implemented according to national data security laws. Study findings will be disseminated to provincial and municipal partners, collaborative community groups and the research and development community. The Let's Talk about Children Evaluation study databases will guide future regional development action and policies. © Article

  1. The use of nominal group technique in identifying community health priorities in Moshi rural district, northern Tanzania

    DEFF Research Database (Denmark)

    Makundi, E A; Manongi, R; Mushi, A K

    2005-01-01

    in the list implying that priorities should not only be focused on diseases, but should also include health services and social cultural issues. Indeed, methods which are easily understood and applied thus able to give results close to those provided by the burden of disease approaches should be adopted....... The patients/caregivers, women's group representatives, youth leaders, religious leaders and community leaders/elders constituted the principal subjects. Emphasis was on providing qualitative data, which are of vital consideration in multi-disciplinary oriented studies, and not on quantitative information from....... It is the provision of ownership of the derived health priorities to partners including the community that enhances research utilization of the end results. In addition to disease-based methods, the Nominal Group Technique is being proposed as an important research tool for involving the non-experts in priority...

  2. Group A rotavirus and norovirus display sharply distinct seasonal profiles in Belém, northern Brazil

    Directory of Open Access Journals (Sweden)

    Jones Anderson Monteiro Siqueira

    2013-08-01

    Full Text Available Several viruses have been associated with acute gastroenteritis (AGE, and group A rotavirus (RVA and nor-ovirus (NoV are the most prevalent. This study aimed to assess their prevalence among children hospitalised for diarrhoea during a three-year surveillance study. From May 2008-April 2011, overall positivity rates of 21.6% (628/2904 and 35.4% (171/483 were observed for RVA and NoV, respectively. The seasonality observed indicated distinct patterns when both viruses were compared. This finding may explain why hospitalisation for AGE remains constant throughout the year. Continuous AGE monitoring is needed to better assess the patterns of infection.

  3. Ancient DNA from hunter-gatherer and farmer groups from Northern Spain supports a random dispersion model for the Neolithic expansion into Europe.

    Directory of Open Access Journals (Sweden)

    Montserrat Hervella

    Full Text Available BACKGROUND/PRINCIPAL FINDINGS: The phenomenon of Neolithisation refers to the transition of prehistoric populations from a hunter-gatherer to an agro-pastoralist lifestyle. Traditionally, the spread of an agro-pastoralist economy into Europe has been framed within a dichotomy based either on an acculturation phenomenon or on a demic diffusion. However, the nature and speed of this transition is a matter of continuing scientific debate in archaeology, anthropology, and human population genetics. In the present study, we have analyzed the mitochondrial DNA diversity in hunter-gatherers and first farmers from Northern Spain, in relation to the debate surrounding the phenomenon of Neolithisation in Europe. METHODOLOGY/SIGNIFICANCE: Analysis of mitochondrial DNA was carried out on 54 individuals from Upper Paleolithic and Early Neolithic, which were recovered from nine archaeological sites from Northern Spain (Basque Country, Navarre and Cantabria. In addition, to take all necessary precautions to avoid contamination, different authentication criteria were applied in this study, including: DNA quantification, cloning, duplication (51% of the samples and replication of the results (43% of the samples by two independent laboratories. Statistical and multivariate analyses of the mitochondrial variability suggest that the genetic influence of Neolithisation did not spread uniformly throughout Europe, producing heterogeneous genetic consequences in different geographical regions, rejecting the traditional models that explain the Neolithisation in Europe. CONCLUSION: The differences detected in the mitochondrial DNA lineages of Neolithic groups studied so far (including these ones of this study suggest different genetic impact of Neolithic in Central Europe, Mediterranean Europe and the Cantabrian fringe. The genetic data obtained in this study provide support for a random dispersion model for Neolithic farmers. This random dispersion had a different

  4. Post-glacial faulting in the Lansjaerv area, Northern Sweden. Comments from the expert group on a field visit at the Molberget post-glacial fault area, 1991

    International Nuclear Information System (INIS)

    Stanfors, R.; Ericsson, L.O.

    1993-05-01

    Post-glacial faults have been recognized in the northern Baltic shield for several decades. It is important to evaluate whether such neotectonic movements can lead to new fracturing or decisively alter the geohydrological or geohydrochemical situation around a final repository for spent nuclear fuel. The post-glacial Lansjaerv fault was chosen for an interdisciplinary study because of its relative accessibility. The goals of the study were to assess the mechanisms that caused present day scraps, to clarify the extent of any recent fracturing and to clarify the extent of any ongoing movements. All these objectives were reasonably met through a series of studies, which have been performed by SKB during 1986-1992 in two phases. This report gives a summary of the first phase of the Lansjaerv study (1986-1989) and describes achievements that have been gained during the second phase of the study. As a final of the field-work in the Lansjaerv area a meeting combined with a field excursion was arranged by SKB in June 1991 for a group of international experts. Comments from the expert group on the excursion and the overall Lansjaerv project are presented. One of the major conclusions is that the Lansjaerv post-glacial fault reactivated pre-existing old structures and that the causes of the post-glacial movements is a combination of plate tectonics and deglaciation

  5. La mitigación de heladas en los camellones del altiplano andino

    Directory of Open Access Journals (Sweden)

    2003-01-01

    . Higher wind velocity or higher air relative humidity also enhances the frost mitigation effect. El sistema de camellones o “waru warus” es una antigua técnica agrícola de manejo del suelo y del agua. En los tiempos prehispánicos era muy frecuente en la región del lago Titicaca. Consiste esencialmente en una serie de plataformas de tierra rodeadas por canales de agua. Las plantas se cultivan sobre las plataformas y el nivel del agua en los canales puede controlarse a través de entradas y salidas de agua. Un beneficio importante y ampliamente reconocido de este sistema de manejo en el altiplano es su contribución a la mitigación de heladas nocturnas durante la campaña agrícola. Con el objetivo de cuantificar este fenómeno y describir los procesos físicos responsables de la mitigación, se ha realizado un experimento en la región del lago Titicaca sobre un sistema de camellones cultivado con papas comparándolo con una parcela “testigo” en la “Pampa”. Se presentan resultados experimentales que evidencian por una parte, el valor elevado de la temperatura del agua con respecto a la del cultivo sobre las plataformas, y por otra, una temperatura de cultivo siempre mayor (1-2 grados en los camellones que en la Pampa. Conjuntamente se presenta un modelo mecanístico adaptado de un esquema de transferencia bi-capa de tipo “Shuttleworth-Wallace” (una capa de vegetación y un sustrato de agua. El modelo precisa el papel que juegan los canales en la dinámica del calor y por lo tanto en la variación de la temperatura del cultivo durante la noche. El efecto de mitigación se debe al flujo de calor que emana del agua y a menudo también a la condensación del vapor de agua sobre las hojas del cultivo. Utilizando el modelo de manera predictiva, se muestra que canales más anchos o plataformas más estrechas tienen un impacto positivo sobre la temperatura mínima del cultivo alcanzada durante la noche. Aumentar la profundidad del agua mejora también la mitigaci

  6. Variation in woody plant mortality and dieback from severe drought among soils, plant groups, and species within a northern Arizona ecotone.

    Science.gov (United States)

    Koepke, Dan F; Kolb, Thomas E; Adams, Henry D

    2010-08-01

    Vegetation change from drought-induced mortality can alter ecosystem community structure, biodiversity, and services. Although drought-induced mortality of woody plants has increased globally with recent warming, influences of soil type, tree and shrub groups, and species are poorly understood. Following the severe 2002 drought in northern Arizona, we surveyed woody plant mortality and canopy dieback of live trees and shrubs at the forest-woodland ecotone on soils derived from three soil parent materials (cinder, flow basalt, sedimentary) that differed in texture and rockiness. Our first of three major findings was that soil parent material had little effect on mortality of both trees and shrubs, yet canopy dieback of trees was influenced by parent material; dieback was highest on the cinder for pinyon pine (Pinus edulis) and one-seed juniper (Juniperus monosperma). Ponderosa pine (Pinus ponderosa) dieback was not sensitive to parent material. Second, shrubs had similar mortality, but greater canopy dieback, than trees. Third, pinyon and ponderosa pines had greater mortality than juniper, yet juniper had greater dieback, reflecting different hydraulic characteristics among these tree species. Our results show that impacts of severe drought on woody plants differed among tree species and tree and shrub groups, and such impacts were widespread over different soils in the southwestern U.S. Increasing frequency of severe drought with climate warming will likely cause similar mortality to trees and shrubs over major soil types at the forest-woodland ecotone in this region, but due to greater mortality of other tree species, tree cover will shift from a mixture of species to dominance by junipers and shrubs. Surviving junipers and shrubs will also likely have diminished leaf area due to canopy dieback.

  7. Mineralogical, chemical, and crystallographic properties of supergene jarosite-group minerals from the Xitieshan Pb-Zn sulfide deposit, northern Tibetan Plateau, China

    Science.gov (United States)

    Chen, Lei; Li, Jian-Wei; Rye, Robert O.; Benzel, William H.; Lowers, H.A.; He, Ming-Zhong

    2013-01-01

    Supergene jarosite-group minerals are widespread in weathering profiles overlying Pb-Zn sulfide ores at Xitieshan, northern Tibetan Plateau, China. They consist predominantly of K-deficient natrojarosite, with lesser amounts of K-rich natrojarosite and plumbojarosite. Electron microprobe (EMP) analyses, scanning electron microcopy (SEM) investigation, and X-ray mapping reveal that the jarosite-group minerals are characterized by spectacular oscillatory zoning composed of alternating growth bands of K-deficient and K-bearing natrojarosite (K2O >1 wt.%). Plumbojarosite, whenever present, occurs as an overgrowth in the outermost bands, and its composition can be best represented by K0.29Na0.19Pb0.31Fe2.66Al0.22(SO4)1.65(PO4)0.31(AsO4)0.04(OH)7.37. The substitution of monovalent for divalent cations at the A site of plumbojarosite is charge balanced by the substitution of five-valent for six-valent anions in XO,4/sub> at the X site. Thermogravimetric analysis (TGA) of representative samples reveal mass losses of 11.46 wt.% at 446.6 °C and 21.42 wt.% at 683.4 °C due to dehydroxylation and desulfidation, respectively. TGA data also indicate that the natrojarosite structure collapses at 446.6 °C, resulting in the formation of NaFe(SO4)2 and minor hematite. The decomposition products of NaFe(SO4) are hematite and Na,2SO4. Powder X-ray diffraction (XRD) analyses show that the jarosite-group minerals have mean unit-cell parameters of a=7.315 ä and c=016.598 ä. XRD and EMP data support the view that substitutions of Na for K in the A site and full Fe occupancy in the B site can considerably decrease the unit-cell parameter c, but only slightly increase a. The results from this study suggest that the observed oscillatory zoning of jarosite-group minerals at Xitieshan resulted mainly from substitutions of K for Na at the A site and P for S at the X site.

  8. Geologic assessment of undiscovered conventional oil and gas resources in the Lower Paleogene Midway and Wilcox Groups, and the Carrizo Sand of the Claiborne Group, of the Northern Gulf coast region

    Science.gov (United States)

    Warwick, Peter D.

    2017-09-27

    The U.S. Geological Survey (USGS) recently conducted an assessment of the undiscovered, technically recoverable oil and gas potential of Tertiary strata underlying the onshore areas and State waters of the northern Gulf of Mexico coastal region. The assessment was based on a number of geologic elements including an evaluation of hydrocarbon source rocks, suitable reservoir rocks, and hydrocarbon traps in an Upper Jurassic-Cretaceous-Tertiary Composite Total Petroleum System defined for the region by the USGS. Five conventional assessment units (AUs) were defined for the Midway (Paleocene) and Wilcox (Paleocene-Eocene) Groups, and the Carrizo Sand of the Claiborne Group (Eocene) interval including: (1) the Wilcox Stable Shelf Oil and Gas AU; (2) the Wilcox Expanded Fault Zone Gas and Oil AU; (3) the Wilcox-Lobo Slide Block Gas AU; (4) the Wilcox Slope and Basin Floor Gas AU; and (5) the Wilcox Mississippi Embayment AU (not quantitatively assessed).The USGS assessment of undiscovered oil and gas resources for the Midway-Wilcox-Carrizo interval resulted in estimated mean values of 110 million barrels of oil (MMBO), 36.9 trillion cubic feet of gas (TCFG), and 639 million barrels of natural gas liquids (MMBNGL) in the four assessed units. The undiscovered oil resources are almost evenly divided between fluvial-deltaic sandstone reservoirs within the Wilcox Stable Shelf (54 MMBO) AU and deltaic sandstone reservoirs of the Wilcox Expanded Fault Zone (52 MMBO) AU. Greater than 70 percent of the undiscovered gas and 66 percent of the natural gas liquids (NGL) are estimated to be in deep (13,000 to 30,000 feet), untested distal deltaic and slope sandstone reservoirs within the Wilcox Slope and Basin Floor Gas AU.

  9. Determination of the pyrethroid insecticide metabolite 3-PBA in plasma and urine samples from farmer and consumer groups in northern Thailand

    Science.gov (United States)

    THIPHOM, SARUNYA; PRAPAMONTOL, TIPPAWAN; CHANTARA, SOMPORN; MANGKLABRUKS, AMPICA; SUPHAVILAI, CHAISUREE; AHN, KI CHANG; GEE, SHIRLEY J.; HAMMOCK, BRUCE D.

    2014-01-01

    In this study, the enzyme-linked immunosorbent assays (ELISA) were modified to detect 3-PBA in plasma (including the adducted form) and urine among a large group of consumers and farmers in an agricultural area. The samples were collected on the same day in the morning from 100 consumers (50 females, 50 males) and 100 farmers (50 females, 50 males) in the Fang district, Chiang Mai province, northern Thailand. The ELISA was very sensitive having an IC50 value of 26.7 and 15.3 ng/mL, a limit of quantitation of 5 and 2.5 ng/mL and a limit of detection of 1.08 and 1.94 ng/mL for plasma and urine, respectively. These methods had low (< 5%) intra- and inter-assay coefficients of variation. The extraction technique satisfactorily eliminated the matrix effect from samples before ELISA analysis, yielding good recoveries (85.9–99.4% and 87.3–98.0%, respectively). For the volunteer study, the detection rate for plasma 3-PBA was 24% in consumers and 42% in farmers, but the median and range values were similar (median 5.87 ng/mL, range 5.16–8.44 ng/mL in consumers and 6.27 ng/mL, range 4.29–9.57 ng/mL in farmers). The rate of detection in the urine was similar (76% and 69%, in consumers and in farmers), yet the median concentration was significantly higher in farmers (8.86 μg/g creatinine in consumers vs 16.1 μg/g creatinine in farmers) and the range also much wider in farmers (1.62–80.5 μg/g creatinine in consumers and 0.80–256.2 μg/g creatinine in farmers). There was no correlation between plasma 3-PBA and urinary 3-PBA concentrations in the study presumably because plasma 3-PBA is a measure of cumulative exposures while urinary 3-PBA reflects acute exposures. In addition, metabolism and excretion of pyrethroids varies by individual. Nevertheless, this study demonstrated that these volunteers were exposed to pyrethroids. To our knowledge, this is the first report that compared plasma 3-PBA and urinary 3-PBA in a large group of volunteers. The ELISA method

  10. Economic assessment at farm level of the implementation of deficit irrigation for quinoa production in the Southern Bolivian Altiplano

    Directory of Open Access Journals (Sweden)

    J. Cusicanqui

    2013-10-01

    Full Text Available In the Southern Bolivian Altiplano recent research has suggested to introduce deficit irrigation as a strategy to boost quinoa yields and to stabilize it at 2.0 ton ha-1. In this study we carried out an economic assessment of the implementation of deficit irrigation at farm level using a hydro-economic model for simulating profit for quinoa production. As input of the model we worked with previously developed farms typology (livestock, quinoa and subsistence farms, simulated quinoa production with and without irrigation using AquaCrop model, and calculated yield response functions for four different climate scenarios (wet, normal, dry and very dry years. Results from the hydro-economic model demonstrate that maximum profit is achieved with less applied irrigated water than for maximum yield, and irrigated quinoa earned more profit than rainfed production for all farms types and climate scenarios. As expected, the benefits of irrigation under dry and very dry climate conditions were higher than those under normal and wet years, and benefits among farms types were higher for quinoa farms. In fact, profit of irrigated quinoa might be stabilized at around BOB 6500 ha-1 (about USD 920 compared with the huge differences found for rainfed conditions for all climate scenarios. Interestingly, the economic water productivity, expressed in terms of economic return for amount of applied irrigated water (BOB mm-1, reached the highest values with intermediate and low level of water availability schemes of deficit irrigation for all climate scenarios.

  11. Physical features, phenolic compounds, betalains and total antioxidant capacity of coloured quinoa seeds (Chenopodium quinoa Willd.) from Peruvian Altiplano.

    Science.gov (United States)

    Abderrahim, Fatima; Huanatico, Elizabeth; Segura, Roger; Arribas, Silvia; Gonzalez, M Carmen; Condezo-Hoyos, Luis

    2015-09-15

    Physical features, bioactive compounds and total antioxidant capacity (TAC) of coloured quinoa varieties (Chenopodium quinoa Willd.) from Peruvian Altiplano were studied. Quinoa seeds did not show a pure red colour, but a mixture which corresponded to different fractal colour values (51.0-71.8), and they varied from small to large size. Regarding bioactive compounds, total phenolic (1.23-3.24mg gallic acid equivalents/g) and flavonol contents (0.47-2.55mg quercetin equivalents/g) were highly correlated (r=0.910). Betalains content (0.15-6.10mg/100g) was correlated with L colour parameter (r=-0.569), total phenolics (r=0.703) and flavonols content (r=0.718). Ratio of betaxanthins to betacyanins (0.0-1.41) was negatively correlated with L value (r=-0.744). Whereas, high TAC values (119.8-335.9mmol Trolox equivalents/kg) were negatively correlated with L value (r=-0.779), but positively with betalains (r=0.730), as well as with free (r=0.639), bound (r=0.558) and total phenolic compounds (r=0.676). Unexploited coloured quinoa seeds are proposed as a valuable natural source of phenolics and betalains with high antioxidant capacity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Sr- and Nd- isotope variations along the Pleistocene San Pedro - Linzor volcanic chain, N. Chile: Tracking the influence of the upper crustal Altiplano-Puna Magma Body

    Science.gov (United States)

    Godoy, Benigno; Wörner, Gerhard; Le Roux, Petrus; de Silva, Shanaka; Parada, Miguel Ángel; Kojima, Shoji; González-Maurel, Osvaldo; Morata, Diego; Polanco, Edmundo; Martínez, Paula

    2017-07-01

    Subduction-related magmas that erupted in the Central Andes during the past 10 Ma are strongly affected by crustal assimilation as revealed by an increase in 87Sr/86Sr isotope ratios with time that in turn are correlated with increased crustal thickening during the Andean orogeny. However, contamination is not uniform and can be strongly influenced locally by crustal composition, structure and thermal condition. This appears to be the case along the NW-SE San Pedro - Linzor volcanic chain (SPLVC) in northern Chile, which straddles the boundary of a major zone of partial melt, the Altiplano_Puna Magma Body (APMB). Herein we report 40Ar/39Ar ages, compositional and isotope data on lavas from the SPLVC that track the influence of this zone of partial melting on erupted lavas with geochronological and geochemical data. Ages reported here indicate that SPLVC has evolved in the last 2 M.y., similar to other volcanoes of the Western Cordillera (e.g. Lascar, Uturuncu, Putana). 87Sr/86Sr ratios increase systematically along the chain from a minimum value of 0.7057 in San Pedro dacites to a maximum of 0.7093-0.7095 for the Toconce and Cerro de Leon dacites in the SE. These changes are interpreted to reflect the increasing interaction of SPLVC parental magmas with partial melt within the APMB eastwards across the chain. The 87Sr/86Sr ratio and an antithetic trend in 143Nd/144Nd is therefore a proxy for the contribution of melt from the APMB beneath this volcanic chain. Similar 87Sr/86Sr increases and 143Nd/144Nd decreases are observed in other transects crossing the boundary of the APMB. Such trends can be recognized from NW to SE between Aucanquilcha, Ollagüe, and Uturuncu volcanoes, and from Lascar volcano to the N-S-trending Putana-Sairecabur-Licancabur volcanic chain to the north. We interpret these isotopic trends as reflecting different degrees of interaction of mafic parental melts with the APMB. High 87Sr/86Sr, and low 143Nd/144Nd reveal zones where the APMB is

  13. Seismic imaging of the upper mantle beneath the northern Central Andean Plateau: Implications for surface topography

    Science.gov (United States)

    Ward, K. M.; Zandt, G.; Beck, S. L.; Wagner, L. S.

    2015-12-01

    Extending over 1,800 km along the active South American Cordilleran margin, the Central Andean Plateau (CAP) as defined by the 3 km elevation contour is second only to the Tibetan Plateau in geographic extent. The uplift history of the 4 km high Plateau remains uncertain with paleoelevation studies along the CAP suggesting a complex, non-uniform uplift history. As part of the Central Andean Uplift and the Geodynamics of High Topography (CAUGHT) project, we use surface waves measured from ambient noise and two-plane wave tomography to image the S-wave velocity structure of the crust and upper mantle to investigate the upper mantle component of plateau uplift. We observe three main features in our S-wave velocity model including (1), a high velocity slab (2), a low velocity anomaly above the slab where the slab changes dip from near horizontal to a normal dip, and (3), a high-velocity feature in the mantle above the slab that extends along the length of the Altiplano from the base of the Moho to a depth of ~120 km with the highest velocities observed under Lake Titicaca. A strong spatial correlation exists between the lateral extent of this high-velocity feature beneath the Altiplano and the lower elevations of the Altiplano basin suggesting a potential relationship. Non-uniqueness in our seismic models preclude uniquely constraining this feature as an uppermost mantle feature bellow the Moho or as a connected eastward dipping feature extending up to 300 km in the mantle as seen in deeper mantle tomography studies. Determining if the high velocity feature represents a small lithospheric root or a delaminating lithospheric root extending ~300 km into the mantle requires more integration of observations, but either interpretation shows a strong geodynamic connection with the uppermost mantle and the current topography of the northern CAP.

  14. Holocene Multi-Decadal to Millennial-Scale Hydrologic Variability on the South American Altiplano

    Science.gov (United States)

    Fritz, S. C.; Baker, P. A.; Ekdahl, E.; Burns, S.

    2006-12-01

    On orbital timescales, lacustrine sediment records in the tropical central Andes show massive changes in lake level due to mechanisms related to global-scale drivers, varying at precessional timescales. Here we use stable isotopic and diatom records from two lakes in the Lake Titicaca drainage basin to reconstruct multi- decadal to millennial scale precipitation variability during the last 7000 to 8000 years. The records are tightly coupled at multi-decadal to millennial scales with each other and with lake-level fluctuations in Lake Titicaca, indicating that the lakes are recording a regional climate signal. A quantitative reconstruction of precipitation from stable isotopic data indicates that the central Andes underwent significant wet to dry alternations at multi- centennial frequencies with an amplitude of 30 to 40% of total precipitation. A strong millennial-scale component, similar in duration to periods of increased ice rafted debris flux in the North Atlantic, is observed in both lake records, suggesting that tropical North Atlantic sea-surface temperature (SST) variability may partly control regional precipitation. No clear relationship is evident between these records and the inferred ENSO history from Lago Pallcacocha in the northern tropical Andes. In the instrumental period, regional precipitation variability on inter-annual timescales is clearly influenced by Pacific modes; for example, most El Ninos produce dry and warm conditions in this part of the central Andes. However, on longer timescales, the control of tropical Pacific modes is less clear. Our reconstructions suggest that the cold intervals of the Holocene Bond events are periods of increased precipitation in the central Andes, thus indicating an anti-phasing of precipitation variation in the southern tropics of South America relative to the Northern Hemisphere monsoon region.

  15. Northern employment

    International Nuclear Information System (INIS)

    Zavitz, J.

    1997-01-01

    Hiring practices and policies and employment opportunities that were available in the Beaufort Sea and MacKenzie Delta project for local residents and for people from southern Canada were dealt with in this chapter. Depending on the source, Northern hiring was a mere token, or a genuine and successful effort on the part of the companies to involve the native population and to share with them the benefits of the project. The fact remains that opening up job opportunities for Northerners was not easily attained, and would never have been realized without the involvement of government and community organizations. Government also played a major role in developing policies and training regimes. By the end of exploration operations, the hiring of Northern residents in the oil and gas industry had become a requirement of drilling applications. Training programs were also created to ensure that Northern residents received the means necessary to take advantage of Northern employment opportunities

  16. Producción de β-glucosidasas por cultivos de bacterias termófilas indígenas del altiplano boliviano

    OpenAIRE

    Casablanca Alarcón, Esther; Ríos Manríquez, Neida; Terrazas Siles, Enrique; Álvarez Aliaga, María Teresa

    2011-01-01

    β-glucoside production by thermophilic bacteria indigenous the bolivian altiplano culture Resumen Las β-glucosidasas son enzimas que poseen actividad hidrolítica y transferasa o transglucosidasa. Tienen diversas aplicaciones; en la biosíntesis de oligosacáridos, producción de etanol utilizando residuos agrícolas y en la industria de vinos. La aplicación industrial, sin embargo, requiere estabilidad a temperaturas elevadas, por lo que los microorganismos termófilos tienen gran interés. El prop...

  17. Sistema hidrogeológico del altiplano de Rionegro y del Valle de la Unión en la zona central de Antioquia.

    OpenAIRE

    Hoyos Patiño, Fabián; Vélez Otálvaro, María Victoria; Múnera Estrada, Juan Camilo; Arias, Daniel Eduardo

    2001-01-01

    La investigación hidrogeológica en el altiplano oriental de Antioquia, en sus pisos de Rionegro y de la Unión muestra la existencia de abundantes recursos de agua subterránea tanto en los depósitos aluviales como en las colinas saprolíticas de ambos pisos. En ellos pueden distinguirse los acuíferos libres en los aluviones, en los suelos residuales, y en las rocas fracturadas, y acuiferos confinados en el basamento rocoso. Tanto en los depósitos aluviales como en el basamento rocoso son co...

  18. Gestión del conocimiento como estrategia de desarrollo de competencias del talento humano en la Universidad Nacional del Altiplano.

    OpenAIRE

    Cóndor y Condori, Adolfo del

    2012-01-01

    La investigación examina las tendencias actuales de gestión del conocimiento y talento humano en la Universidad Nacional del Altiplano (UNA) en el periodo 2009-2010, con el propósito de ver en perspectiva y en el contexto de la tecnología y los nuevos paradigmas su situación actual, ya que la Universidad es puesto en tela de juicio por la sociedad la que reclama mayor responsabilidad social y ética fáctica, es decir no solo declarativa, sino también en la acción y efecto sobre la comunidad. E...

  19. Primeros registros del ibis blanco (Eudocimus albus en el Altiplano de San Luis Potosí, México

    Directory of Open Access Journals (Sweden)

    Natalia de Gortari-Ludlow

    2012-07-01

    Full Text Available Reportamos dos observaciones visuales del ibis blanco (Eudocimus albus de la Laguna de Los Coyotes, un afluente natural del manantial la Media Luna que se localiza en el municipio de Rioverde, San Luis Potosí, México. Los avistamientos ocurrieron en septiembre de 2011 y febrero de 2012. Este es el primer reporte de la presencia de esta ave en dicha localidad, y es importante porque la especie ha sido escasamente encontrada en ambientes no ribereños del Altiplano Mexicano.

  20. A Multiproxy Approach to Unraveling Climate and Human Demography in the Peruvian Altiplano from a 5000 year Lake Sediment Core

    Science.gov (United States)

    Vaught-Mijares, R. M.; Hillman, A. L.; Abbott, M. B.; Werne, J. P.; Arkush, E.

    2017-12-01

    Drought and flood events are thought to have shaped the ways in which Andean societies have adapted to life in the Titicaca Basin region, particularly with regard to land use practices and settlement patterns. This study examines a small lake in the region, Laguna Orurillo. Water isotopes suggest that the lake primarily loses water through evaporation, making it hydrologically sensitive. In 2015, a 3.4 m overlapping sediment record was collected and inspected for evidence of shallow water facies and erosional unconformities to reconstruct paleohydrology. Sediment core chronology was established using 7 AMS radiocarbon dates and 210Pb dating and indicates that the core spans 5000 years. Additional sediment core measurements include magnetic susceptibility, bulk density, organic/carbonate content, and XRD. Results show a pronounced change in sediment composition from brittle, angular salt deposits to massive calcareous silt and clay around 5000 years BP. Multiple transitions from clay to sand show potential lake level depressions at 1540, 2090, and 2230, yr BP that are supported by a drastic increase in carbonate composition from 2760-1600 yr BP. Additional shallow-water periods may be reflected in the presence of rip-up clasts from 4000 to 3000 yr BP. These early interpretations align well with existing hydrologic records from Lake Titicaca. In order to develop a more detailed climate and land use record, isotope analyses of authigenic carbonate minerals using δ13C and δ18O and leaf waxes using δD are being developed. Ultimately, this record will be linked with records from nearby Lagunas Arapa and Umayo. Additional proxies for human population such as fecal 5β-stanols and proximal anthropologic surveys will be synthesized to contribute to a regional understanding of Holocene climate variability and human demography in the Peruvian Altiplano.

  1. Diurnal variability and biogeochemical reactivity of mercury species in an extreme high-altitude lake ecosystem of the Bolivian Altiplano.

    Science.gov (United States)

    Alanoca, L; Amouroux, D; Monperrus, M; Tessier, E; Goni, M; Guyoneaud, R; Acha, D; Gassie, C; Audry, S; Garcia, M E; Quintanilla, J; Point, D

    2016-04-01

    Methylation and demethylation represent major transformation pathways regulating the net production of methylmercury (MMHg). Very few studies have documented Hg reactivity and transformation in extreme high-altitude lake ecosystems. Mercury (Hg) species concentrations (IHg, MMHg, Hg°, and DMHg) and in situ Hg methylation (M) and MMHg demethylation (D) potentials were determined in water, sediment, floating organic aggregates, and periphyton compartments of a shallow productive Lake of the Bolivian Altiplano (Uru Uru Lake, 3686 m). Samples were collected during late dry season (October 2010) and late wet season (May 2011) at a north (NS) and a south (SS) site of the lake, respectively. Mercury species concentrations exhibited significant diurnal variability as influenced by the strong diurnal biogeochemical gradients. Particularly high methylated mercury concentrations (0.2 to 4.5 ng L(-1) for MMHgT) were determined in the water column evidencing important Hg methylation in this ecosystem. Methylation and D potentials range were, respectively, production in both water (up to 0.45 ng MMHg L(-1) day(-1)) and sediment compartments (2.0 to 19.7 ng MMHg g(-1) day(-1)). While the sediment compartment appears to represent a major source of MMHg in this shallow ecosystem, floating organic aggregates (dry season, SS) and Totora's periphyton (wet season, NS) were found to act as a significant source (5.8 ng MMHg g(-1) day(-1)) and a sink (-2.1 ng MMHg g(-1) day(-1)) of MMHg, respectively. This work demonstrates that high-altitude productive lake ecosystems can promote MMHg formation in various compartments supporting recent observations of high Hg contents in fish and water birds.

  2. Efecto de fertilizantes orgánicos y inorgánicos en el cultivo de la papa (Solanum tuberosum L.) en cuatro comunidades del Altiplano central de Bolivia

    OpenAIRE

    Tangara, E.

    2007-01-01

    A presentation about the importance of potato production, definition of the problem, methodology, model, measure variables, results and discussion, and conclusions of the project that evaluates the effects of organic and inorganic fertilizers application on potato production in four communities in the Bolivian Central Altiplano. available in SANREM office, ESIILTRA-4 (Practices and Strategies for Vulnerable Agro-Ecosystems)

  3. Geogenic arsenic and other trace elements in the shallow hydrogeologic system of Southern Poopó Basin, Bolivian Altiplano

    International Nuclear Information System (INIS)

    Ormachea Muñoz, Mauricio; Wern, Hannes; Johnsson, Fredrick; Bhattacharya, Prosun; Sracek, Ondra; Thunvik, Roger; Quintanilla, Jorge; Bundschuh, Jochen

    2013-01-01

    Highlights: • Groundwater used as drinking water has elevated concentrations of arsenic and boron. • Sediments are potential sources of arsenic and boron in shallow groundwater. • Fe-oxides and hydroxides are important absorbents of arsenic. • Multiple geochemical processes drive mobilisation of arsenic in groundwater. -- Abstract: Environmental settings in the southern area of Lake Poopó in the Bolivian highlands, the Altiplano, have generated elevated amounts of arsenic (As) in the water. The area is characterised by a semiarid climate, slow hydrological flow and geologic formations of predominantly volcanic origin. The present study aimed at mapping the extent of the water contamination in the area and to investigate the geogenic sources and processes involved in the release of As to the groundwater. Ground- and surface-water samples were collected from 24 different sites, including drinking water wells and rivers, in the southern Poopó basin in two different field campaigns during the dry and rainy seasons. The results revealed variable levels of As in shallow drinking water wells and average concentration exceeding the WHO guidelines value. Arsenic concentrations range from below 5.2 μg/L (the detection level) to 207 μg/L and averages 72 μg/L. Additionally, high boron (B) concentrations (average 1902 μg/L), and high salinity are further serious concerns for deteriorating the groundwater quality and rendering it unsuitable for drinking. Groundwater is predominantly of the Na–Cl–HCO 3 type or the Ca–Na–HCO 3 type with neutral or slightly alkaline pH and oxidising character. While farmers are seriously concerned about the water scarcity, and on a few occasions about salinity, there are no concerns about As and B present at levels exceeding the WHO guidelines, and causing negative long term effects on human health. Sediment samples from two soil profiles and a river bed along with fourteen rock samples were also collected and analysed

  4. Geogenic arsenic and other trace elements in the shallow hydrogeologic system of Southern Poopó Basin, Bolivian Altiplano

    Energy Technology Data Exchange (ETDEWEB)

    Ormachea Muñoz, Mauricio, E-mail: ormachea@kth.se [KTH – International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, Royal Institute of Technology (KTH), Teknikringen 76, SE-100 44 Stockholm (Sweden); Laboratorio de Hidroquímica, Instituto de Investigaciones Químicas, Universidad Mayor de San Andrés, 303, La Paz (Bolivia, Plurinational State of); Wern, Hannes; Johnsson, Fredrick; Bhattacharya, Prosun [KTH – International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, Royal Institute of Technology (KTH), Teknikringen 76, SE-100 44 Stockholm (Sweden); Sracek, Ondra [Department of Geology, Faculty of Science, Palacký University, 17. listopadu 12, 771 46 Olomouc (Czech Republic); Thunvik, Roger [KTH – International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, Royal Institute of Technology (KTH), Teknikringen 76, SE-100 44 Stockholm (Sweden); Quintanilla, Jorge [Laboratorio de Hidroquímica, Instituto de Investigaciones Químicas, Universidad Mayor de San Andrés, 303, La Paz (Bolivia, Plurinational State of); Bundschuh, Jochen [KTH – International Groundwater Arsenic Research Group, Division of Land and Water Resources Engineering, Department of Sustainable Development, Environmental Sciences and Engineering, Royal Institute of Technology (KTH), Teknikringen 76, SE-100 44 Stockholm (Sweden); Faculty of Engineering and Surveying, University of Southern Queensland, Toowoomba, Queensland 4350 (Australia)

    2013-11-15

    Highlights: • Groundwater used as drinking water has elevated concentrations of arsenic and boron. • Sediments are potential sources of arsenic and boron in shallow groundwater. • Fe-oxides and hydroxides are important absorbents of arsenic. • Multiple geochemical processes drive mobilisation of arsenic in groundwater. -- Abstract: Environmental settings in the southern area of Lake Poopó in the Bolivian highlands, the Altiplano, have generated elevated amounts of arsenic (As) in the water. The area is characterised by a semiarid climate, slow hydrological flow and geologic formations of predominantly volcanic origin. The present study aimed at mapping the extent of the water contamination in the area and to investigate the geogenic sources and processes involved in the release of As to the groundwater. Ground- and surface-water samples were collected from 24 different sites, including drinking water wells and rivers, in the southern Poopó basin in two different field campaigns during the dry and rainy seasons. The results revealed variable levels of As in shallow drinking water wells and average concentration exceeding the WHO guidelines value. Arsenic concentrations range from below 5.2 μg/L (the detection level) to 207 μg/L and averages 72 μg/L. Additionally, high boron (B) concentrations (average 1902 μg/L), and high salinity are further serious concerns for deteriorating the groundwater quality and rendering it unsuitable for drinking. Groundwater is predominantly of the Na–Cl–HCO{sub 3} type or the Ca–Na–HCO{sub 3} type with neutral or slightly alkaline pH and oxidising character. While farmers are seriously concerned about the water scarcity, and on a few occasions about salinity, there are no concerns about As and B present at levels exceeding the WHO guidelines, and causing negative long term effects on human health. Sediment samples from two soil profiles and a river bed along with fourteen rock samples were also collected and

  5. Diagnostico Técnico de la Producción Lechera en Algunas Explotaciones del Altiplano Norte de Antioquia

    Directory of Open Access Journals (Sweden)

    Ortega García Antonio

    1997-12-01

    Full Text Available Se evaluaron 57 explotaciones lecheras representativas del altiplano Norte de Antioquia, correspondientes a los municipios de Belmira, Entrerrios, San Pedro de los Milagros, Don Matías Santa Rosa de Osos, San José de la Montaña y Yarumal. La zona está situada entre 2200 y 2550 msnm y tiene precipitaciones anuales entre 2060 y 4000 mm La topografía predominante es ondulada y los suelos de textura franco-arenosa, son ácidos y de baja fertilidad. Se trabajó mediante una encuesta inicial sobre características generales de la explotación y luego se realizó un monitoreo, durante 6 meses, sobre los parámetros productivos y reproductivos. El análisis de la información se realizó mediante estadística descriptiva. El tamaño de las fincas, predominante en la zona, es de menos de 50 hectáreas y con promedio de 42 animales, en su mayoría de raza Holstein. Los pastos predominantes son kikuyo (Pennisetun clandestinum, y en segundo lugar la falsa poa (Holcus lanalus. Un 90-100 % de las fincas utilizan fertilizante químico y hasta un 70 % de ellas, aplican porquinaza, pero solo un 40-50% utilizan encalamiento; sin embargo es necesaria mucha transferencia tecnológica acerca del manejo adecuado de pasturas. Los insectos plagas chinche (Collaria sp y lorito verde (Draeculacephala sp, causan daño grave en las praderas y se requieren alternativas viables para su control. El uso de suplementos concentrados en vacas y novillas es inadecuado y son requeridas acciones de transferencia tecnológica, relacionadas con el uso eficiente de ellos. Solamente el 24 %de los ganaderos usa inseminación artificial, pero parece ser más importante el problema alimenticio en la zona. La crianza de las terneras se realiza en base a leche, suministrando 200-400 litros en períodos entre 60 y 120 días, con muy poco uso de suplemento concentrado. La producción de leche por vaca/día está entre 10.5-12.1 litros, acorde con el programa alimenticio

  6. Indoor metallic pollution related to mining activity in the Bolivian Altiplano.

    Science.gov (United States)

    Fontúrbel, Francisco E; Barbieri, Enio; Herbas, Cristian; Barbieri, Flavia L; Gardon, Jacques

    2011-10-01

    The environmental pollution associated with mining and metallurgical activities reaches its greatest extent in several Andean cities and villages. Many locations in this area have accumulated through centuries a large amount of mining wastes, often disregarding the magnitude of this situation. However, in these naturally mineralized regions, there is little information available stating the exact role of mining and metallurgical industries in urban pollution. In this study, we demonstrated that the various metallic elements present in indoor dust (As, Cd, Cu, Pb, Sb, Sn, Zn) had a common origin and this contamination was increased by the proximity to the mines. Lead dust concentration was found at concerning levels for public health. In addition, wrong behaviors such as carrying mining workwear home contributed to this indoor dust pollution. Consequently, the constant exposure of the population could represent a potential health hazard for vulnerable groups, especially children. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Indoor metallic pollution related to mining activity in the Bolivian Altiplano

    International Nuclear Information System (INIS)

    Fonturbel, Francisco E.; Barbieri, Enio; Herbas, Cristian; Barbieri, Flavia L.; Gardon, Jacques

    2011-01-01

    The environmental pollution associated with mining and metallurgical activities reaches its greatest extent in several Andean cities and villages. Many locations in this area have accumulated through centuries a large amount of mining wastes, often disregarding the magnitude of this situation. However, in these naturally mineralized regions, there is little information available stating the exact role of mining and metallurgical industries in urban pollution. In this study, we demonstrated that the various metallic elements present in indoor dust (As, Cd, Cu, Pb, Sb, Sn, Zn) had a common origin and this contamination was increased by the proximity to the mines. Lead dust concentration was found at concerning levels for public health. In addition, wrong behaviors such as carrying mining workwear home contributed to this indoor dust pollution. Consequently, the constant exposure of the population could represent a potential health hazard for vulnerable groups, especially children. - Highlights: → We measured polymetallic pollution in household indoor dust from a mining town. → Toxic elements (Pb, As, Cd, Sb) in dust are correlated, suggesting a common origin. → The most polluted houses are within a 1 km radius around the mining center. → Carrying mining workwear home increases indoor pollution. → Lead concentrations in dust represent a serious concern for Public Health (600 μg/g). - In a typical Andean mining city, the urban indoor pollution with toxic metallic elements is directly related to the closeness of the mining activities.

  8. Indoor metallic pollution related to mining activity in the Bolivian Altiplano

    Energy Technology Data Exchange (ETDEWEB)

    Fonturbel, Francisco E., E-mail: fonturbel@ug.uchile.cl [Departamento de Ciencias Ecologicas, Facultad de Ciencias, Universidad de Chile, Santiago (Chile); Barbieri, Enio [IRD-HSM (Institut de Recherche pour le Developpement), La Paz (Bolivia, Plurinational State of); Herbas, Cristian [Universidad Mayor de San Andres, IGEMA Institute (Instituto de Investigaciones Geologicas y del Medio Ambiente), La Paz (Bolivia, Plurinational State of); Barbieri, Flavia L.; Gardon, Jacques [IRD-HSM (Institut de Recherche pour le Developpement), La Paz (Bolivia, Plurinational State of); Universidad Mayor de San Andres, SELADIS Institute (Instituto de Servicios de Laboratorio para el Diagnostico e Investigacion en Salud), La Paz (Bolivia, Plurinational State of)

    2011-10-15

    The environmental pollution associated with mining and metallurgical activities reaches its greatest extent in several Andean cities and villages. Many locations in this area have accumulated through centuries a large amount of mining wastes, often disregarding the magnitude of this situation. However, in these naturally mineralized regions, there is little information available stating the exact role of mining and metallurgical industries in urban pollution. In this study, we demonstrated that the various metallic elements present in indoor dust (As, Cd, Cu, Pb, Sb, Sn, Zn) had a common origin and this contamination was increased by the proximity to the mines. Lead dust concentration was found at concerning levels for public health. In addition, wrong behaviors such as carrying mining workwear home contributed to this indoor dust pollution. Consequently, the constant exposure of the population could represent a potential health hazard for vulnerable groups, especially children. - Highlights: > We measured polymetallic pollution in household indoor dust from a mining town. > Toxic elements (Pb, As, Cd, Sb) in dust are correlated, suggesting a common origin. > The most polluted houses are within a 1 km radius around the mining center. > Carrying mining workwear home increases indoor pollution. > Lead concentrations in dust represent a serious concern for Public Health (600 {mu}g/g). - In a typical Andean mining city, the urban indoor pollution with toxic metallic elements is directly related to the closeness of the mining activities.

  9. Nutritional status, dietary habits, nutritional knowledge and self-care assessment in a group of older adults attending community centres in Pavia, Northern Italy.

    Science.gov (United States)

    Turconi, G; Rossi, M; Roggi, C; Maccarini, L

    2013-02-01

    The population of industrialised countries is ageing as a consequence of an increase in life expectancy. As a result of the increasing ageing process, the assessment of nutritional status and dietary habits, as well as the assessment of self-care, is needed to plan selected actions aimed at improving the quality of life in the third and fourth life spans. A cross-sectional study was carried out on a randomly selected sample of 200 healthy older adults (≥65 years old), attending community centres for older people in Pavia, Northern Italy. Ninety-two percent of the recruited subjects participated in the survey. Anthropometric measurements and the Mini Nutritional Assessment were performed. Dietary habits, nutritional knowledge and self-care were investigated using a questionnaire administered by two dietitians. The majority of subjects were low socio-economic status and overweight [mean (SD) body mass index = 28.4 (4.3) kg/m(2) ], 12% were malnourished according to their Mini Nutritional Assessment score and the majority of the arm muscle circumference measurements were below the 10th percentile, predicting accelerated loss of lean mass, even in the healthy independently living older adults. Only 30% of the sample had adequate dietary habits, whereas the ability to self-care was good for the whole sample. The unhealthy and unbalanced diet, frequently too rich in sugar and fats and low in protein intake, might explain being overweight and the loss of lean mass in the study subjects. © 2012 The Authors Journal of Human Nutrition and Dietetics © 2012 The British Dietetic Association Ltd.

  10. Inventario de recursos turísticos como base para la planificación territorial en la zona altiplano de san Luis Potosi, México

    Directory of Open Access Journals (Sweden)

    Paloma Blanco López

    2015-01-01

    Full Text Available Este artículo aborda el análisis del potencial turístico como condición para la planificación turística. Se explica el turismo como factor de desarrollo y a la planificación como instrumento de su gestión. Se utilizan los municipios con mayor potencial turístico en la Zona Altiplano de San Luis Potosí para exponer y ejemplificar los resultados del diagnóstico de la región. Después se evalúan los instrumentos vigentes de planificación turística vigentes en San Luis Potosí y se ofrece una propuesta de aprovechamiento turístico con ayuda de un análisis FODA para los municipios seleccionados.

  11. Curriculum por competencias y desempeño laboral de los egresados de la escuela profesional de administración de la Universidad Nacional del Altiplano.

    OpenAIRE

    Coyla Zela, Mario Aurelio

    2008-01-01

    El trabajo de investigación tiene el propósito de analizar el currículo por competencias y su incidencia en el desempeño laboral de los egresados de la escuela profesional de administración en la Universidad Nacional del Altiplano, en el período 2007, y proponer la construcción de capacidades de acuerdo a la exigencia laboral del mercado y la complementación de su formación para un mejor proceso de integración a la empresa. El tipo de investigación es descriptivo que comprende la descripción,...

  12. Influence of group II metals on Radium-226 concentration ratios in the native green plum (Buchanania obovata) from the Alligator Rivers Region, Northern Territory, Australia

    International Nuclear Information System (INIS)

    Medley, Peter; Bollhöfer, Andreas

    2016-01-01

    In this study, uptake of Ra from soil, and the influence of group II metals on Ra uptake, into the stones and edible flesh of the fruit of the wild green plum, Buchanania obovata, was investigated. Selective extraction of the exchangeable fraction of the soil samples was undertaken but was not shown to more reliably predict Ra uptake than total soil Ra activity concentration. Comparison of the group II metal to Ca ratios (i.e. Sr/Ca, Ba/Ca, Ra/Ca) in the flesh with exchangeable Ca shows that Ca outcompetes group II metals for root uptake and that the uptake pathway discriminated against group II metals relative to ionic radius, with uptake of Ca > Sr > Ba >> Ra. Flesh and stone analysis showed that movement of group II metals to these components of the plant, after root uptake, was strongly related. This supports the hypothesis that Sr, Ba and Ra are being taken up as analogue elements, and follow the same uptake and translocation pathways, with Ca. Comparison with previously reported data from a native passion fruit supports the use of total soil CRs on natural, undisturbed sites. As exchangeable CRs for Ra reach a saturation value it may be possible to make more precise predictions using selective extraction techniques for contaminated or disturbed sites. - Highlights: • We studied uptake of Ra-226 from soil into Buchanania obovata. • The influence of group II metals (Sr, Ba and Ca) on Ra uptake was investigated. • The exchangeable Ra fraction of the soil was not a more reliable predictor of Ra uptake than total soil Ra. • Ca outcompetes group II metals Sr, Ba and Ra for root uptake. • Uptake discriminated against group II metals relative to ionic radius, with uptake of Ca > Sr > Ba >> Ra.

  13. Etnografía de la infección respiratoria aguda en una zona rural del altiplano mexicano

    Directory of Open Access Journals (Sweden)

    MARTÍNEZ HOMERO

    1997-01-01

    Full Text Available Objetivo. Identificar los términos utilizados por las madres para referirse a enfermedades, signos y síntomas relacionados con infecciones respiratorias agudas, así como los signos de alarma que las motivan a buscar atención médica; asimismo, describir prácticas comunes de manejo de la enfermedad en el hogar. Material y métodos. Se trata de un estudio etnográfico en seis comunidades rurales del altiplano mexicano. Se entrevistó a 12 informantes clave, a seis madres de niños fallecidos por infección respiratoria aguda, y a 24 madres de niños menores de cinco años, con diversas técnicas etnográficas para complementar la información obtenida ("triangulación". Resultados. Las enfermedades comúnmente identificadas incluyeron gripa, anginas, tos, bronquitis, pulmonía, neumonía y "broncomonía". Los síntomas clave para el diagnóstico fueron escurrimiento de moco nasal, dolor de garganta, tos, dolor de cabeza o de cuerpo, calentura, "hervor" de pecho, y referencias a que el niño "está molesto o llorón", se pone morado o le hace falta el aire. La taquipnea fue referida como "respira fuerte", "respira mucho", "respira rápido" y "tiene sesido"; el tiraje, "se le hunde el pecho"; el estridor, como "quejido o ronquido de pecho"; la sibilancia, como "ronquido de pecho", y para la cianosis; "se pone morado". Entre los tratamientos ofrecidos en el hogar destacan el uso de tés, aplicación de limón, jitomate, tomate o papa en la garganta, y aplicación de sebo o pomada en pecho y espalda. No fue común la autoprescripción de antibióticos pero sí la de antipiréticos. La mayoría de las madres reconoció enfermedades leves y, en menor proporción, graves. Ante un caso grave de insuficiencia respiratoria aguda, la opción más frecuentemente elegida fue acudir a la clínica del proyecto; en segundo lugar al médico particular en la cabecera municipal, y al hospital de la Secretaría de Salud en la Jurisdicción. La cercanía y el

  14. First study conducted in Northern India that identifies group C rotavirus as the etiological agent of severe diarrhea in children in Delhi.

    Science.gov (United States)

    Tiku, Vasundhara Razdan; Jiang, Baoming; Kumar, Praveen; Aneja, Satender; Bagga, Arvind; Bhan, Maharaj Kishen; Ray, Pratima

    2017-05-30

    Group C Rotavirus (RVC) is an enteric pathogen responsible for acute gastroenteritis in children and adults globally. At present there are no surveillance studies on group C Rotaviruses in India and therefore their prevalence in India remains unknown. The present study aimed to evaluate group C rotavirus infection among rotavirus (N = 180) by Enzyme immunoassay were screened for group C rotavirus by RT-PCR with VP6, VP7 and VP4 gene specific primers. The PCR products were further sequenced (VP6, VP7, VP4) and analyzed to ascertain their origin and G and P genotypes. Six out of 180 (group A rotavirus negative) samples were found positive for group C rotavirus by VP6 gene specific RT-PCR, of which 3 were also found positive for VP7 and VP4 genes. Phylogenetic analysis of VP7 and VP4 genes of these showed them to be G4 and P[2] genotypes. Overall, the nucleotide sequence data (VP6, VP7 and VP4) revealed a close relationship with the human group C rotavirus with no evidence of animal ancestry. Interestingly, the nucleotide sequence analysis of various genes also indicated differences in their origin. While the identity matrix of VP4 gene (n = 3) showed high amino acid sequence identity (97.60 to 98.20%) with Korean strain, the VP6 gene (n = 6) showed maximum identity with Nigerian strain (96.40 to 97.60%) and VP7 gene (n = 3) with Bangladeshi and USA strains. This is true for all analyzed samples. Our study demonstrated the group C rotavirus as the cause of severe diarrhea in young children in Delhi and provides insights on the origin of group C rotavirus genes among the local strains indicating their source of transmission. Our study also highlights the need for a simple and reliable diagnostic test that can be utilized to determine the disease burden due to group C rotavirus in India.

  15. Prevalencia y resistencia a antibióticos de Escherichia coli O157:H7 aislada de canales de bovinos sacrificados en rastros del altiplano central Mexicano

    Directory of Open Access Journals (Sweden)

    Nydia Edith Reyes-Rodríguez

    2013-01-01

    Full Text Available La carne es el principal vehículo de toxiinfecciones alimentarias como consecuencia de una higiene deficiente en el sacrificio de los animales o durante el manejo de las canales. En este estudio se analizaron tres rastros municipales del Altiplano Central Mexicano, de los cuales se obtuvieron 228 muestras pareadas de canal (n=114 y contenido de colon (n=114 de bovinos que fueron sacrificados en estos rastros; se obtuvieron 2 (0.8 % cepas de E. coli O157:NM a partir de contenido de colon y 6 (2.6 % cepas de E. coli O157:H7 (5 de canales y 1 de contenido de colon. El porcentaje de aislamiento de cada rastro fue variable, encontrando diferencias significativas ( P <0.05. En las cepas de E. coli O157:NM y O157:H7 se observa que la resistencia más alta fue para cefalotina con un 75 %, carbencilina con 62.5 %, amikacina con 50 % y gentamicina con 50 %, el 16.7 % de las cepas de E. coli O157:H7 presentaron los geneseae , stx1 y stx2 y el 66.7 % los gen eae y stx2 . En conclusión los resultados obtenidos muestra la presencia E. coli O157:H7 con factores de virulencia y resistencia a antibióticos, en canales de bovinos de rastros del altiplano central Mexicano, considerándose una fuente de contaminación importante y un riesgo para la salud pública.

  16. What is safe and clean water in rural Bolivian communities? A preliminary investigation of heavy metal contamination in rural community water systems in the Bolivian Altiplano

    Science.gov (United States)

    Borella, M.; Guido, Z.; Borella, P.; Ketron, T.

    2009-12-01

    A proliferation of potable water systems utilizing groundwater is currently underway in the Lake Titicaca region of the Bolivian Altiplano. With the aid of national and international organizations, rural communities are developing groundwater sources because the region’s surface water is highly contaminated with waterborne pathogens—the primary factor contributing to high child mortality rates in developing nations. According to UNICEF, 86 percent of Bolivian families have access to “improved” water systems, which predominantly take the form of deep groundwater wells or contained natural springs. While the water systems have worked well to reduce pathogens in drinking water systems that cause illnesses such as dysentery, the water is rarely tested for heavy metal contamination, such as arsenic and lead. While bacteria analysis is essential, it is not the only component of healthy drinking water. Testing for heavy metals is especially important in the Bolivian Altiplano because abundant volcanic deposits and massive sulfide deposits suggest that in some areas it is likely that the water contains elevated concentrations of heavy metals. In this study, Terra Resource Development International, A California-based 502(c)3 nonprofit organization, partnered with Stanford University, the Technical University of Bolivia, and the Bolivian Geologic and Mining Survey to collect water samples in 36 rural community situated in four watersheds feeding into Lake Titicaca. Water was collected from shallow, hand dug wells, deep groundwater wells, springs, and small rivers in the Tiwanku, Laja, Batallas, Achacachi watersheds and were analyzed for inorganic contaminants. Samples were analyzed at Stanford’s Environmental Measurements Facility using the Inductively Coupled Plasma (ICP) Spectrometer for major ions and heavy metals. Results will help determine which, if any, community water systems are at risk of heavy metal contamination, where more comprehensive sampling is

  17. Meddling with middle modalities: a decomposition approach to mental health inequalities between intersectional gender and economic middle groups in northern Sweden

    Directory of Open Access Journals (Sweden)

    Per E. Gustafsson

    2016-11-01

    Full Text Available Background: Intersectionality has received increased interest within population health research in recent years, as a concept and framework to understand entangled dimensions of health inequalities, such as gender and socioeconomic inequalities in health. However, little attention has been paid to the intersectional middle groups, referring to those occupying positions of mixed advantage and disadvantage. Objective: This article aimed to 1 examine mental health inequalities between intersectional groups reflecting structural positions of gender and economic affluence and 2 decompose any observed health inequalities, among middle groups, into contributions from experiences and conditions representing processes of privilege and oppression. Design: Participants (N=25,585 came from the cross-sectional ‘Health on Equal Terms’ survey covering 16- to 84-year-olds in the four northernmost counties of Sweden. Six intersectional positions were constructed from gender (woman vs. men and tertiles (low vs. medium vs. high of disposable income. Mental health was measured through the General Health Questionnaire-12. Explanatory variables covered areas of material conditions, job relations, violence, domestic burden, and healthcare contacts. Analysis of variance (Aim 1 and Blinder-Oaxaca decomposition analysis (Aim 2 were used. Results: Significant mental health inequalities were found between dominant (high-income women and middle-income men and subordinate (middle-income women and low-income men middle groups. The health inequalities between adjacent middle groups were mostly explained by violence (mid-income women vs. men comparison; material conditions (mid- vs. low-income men comparison; and material needs, job relations, and unmet medical needs (high- vs. mid-income women comparison. Conclusions: The study suggests complex processes whereby dominant middle groups in the intersectional space of economic affluence and gender can leverage strategic

  18. An integrative description of Mesobiotus ethiopicus sp. nov. (Tardigrada: Eutardigrada: Parachela: Macrobiotidae: harmsworthi group) from the northern Afrotropic region

    DEFF Research Database (Denmark)

    Stec, Daniel; Kristensen, Reinhardt Møbjerg

    2017-01-01

    A new species of the Mesobiotus harmsworthi group is described from Ethiopia. An integrative taxonomy approach was applied by combining morphological and morphometric analyses—imaging under phase contrast and scanning electron microscopy with molecular analysis (18S rRNA, 28S rRNA and COI markers...

  19. Changes in the structure and function of northern Alaskan ecosystems when considering variable leaf-out times across groupings of species in a dynamic vegetation model

    Science.gov (United States)

    Euskirchen, E.S.; Carman, T.B.; McGuire, Anthony David

    2013-01-01

    The phenology of arctic ecosystems is driven primarily by abiotic forces, with temperature acting as the main determinant of growing season onset and leaf budburst in the spring. However, while the plant species in arctic ecosystems require differing amounts of accumulated heat for leaf-out, dynamic vegetation models simulated over regional to global scales typically assume some average leaf-out for all of the species within an ecosystem. Here, we make use of air temperature records and observations of spring leaf phenology collected across dominant groupings of species (dwarf birch shrubs, willow shrubs, other deciduous shrubs, grasses, sedges, and forbs) in arctic and boreal ecosystems in Alaska. We then parameterize a dynamic vegetation model based on these data for four types of tundra ecosystems (heath tundra, shrub tundra, wet sedge tundra, and tussock tundra), as well as ecotonal boreal white spruce forest, and perform model simulations for the years 1970 -2100. Over the course of the model simulations, we found changes in ecosystem composition under this new phenology algorithm compared to simulations with the previous phenology algorithm. These changes were the result of the differential timing of leaf-out, as well as the ability for the groupings of species to compete for nitrogen and light availability. Regionally, there were differences in the trends of the carbon pools and fluxes between the new phenology algorithm and the previous phenology algorithm, although these differences depended on the future climate scenario. These findings indicate the importance of leaf phenology data collection by species and across the various ecosystem types within the highly heterogeneous Arctic landscape, and that dynamic vegetation models should consider variation in leaf-out by groupings of species within these ecosystems to make more accurate projections of future plant distributions and carbon cycling in Arctic regions.

  20. Isolation and characterization of Streptococcus spp. group B in Nile tilapias (Oreochromis niloticus reared in hapas nets and earth nurseries in the northern region of Parana State, Brazil

    Directory of Open Access Journals (Sweden)

    Salvador Rogério

    2005-01-01

    Full Text Available The objective of this study was to isolate and characterize Streptococcus spp. in Nile tilapias (Oreochromis niloticus reared in net-pens and earth nurseries. Eight intensive tilapia-rearing farms were investigated in north Paraná, Brazil from April 1st 2001 to April 30th 2002. The fish were reared in a system of hapas nets on four farms and in earth nurseries on other four farms. A total of 370 samples were analyzed of material collected from 120 fish (brain, liver, kidney, skin scrapes, ascites liquid and eye that were sown on BHI agar (Brain Heart Infusion supplemented with 1% yeast extract and sheep blood. Streptococcus spp. was isolated in 36 of the samples (18 brain, eight liver, eight kidney and two ascites liquid from 25 fish. Streptococci were isolated in both systems, almost in the same proportion. First the streptococci were characterized by the catalase and esculin test, growth in methylene blue and sodium chloride at 6.5%. They were classified in groups by the Slidex Strepto-Kit (BioMerieux, France. The phenotypic characteristics were determined by the Api 20 Strep microtest system (BioMerieux, France. The 36 Streptococcus spp. samples did not present hemolysis and were classified as Lancefield group B. Further 16 samples were identified as Streptococcus agalactiae and 20 were not identified by the Api 20 Strep, but presented the same biochemical profile described for the reference strain of Streptococcus difficile (ND-2-22.

  1. Vitamin A status of the minority ethnic group of Karen hill tribe children aged 1-6 years in Northern Thailand.

    Science.gov (United States)

    Tienboon, Prasong; Wangpakapattanawong, Prasit

    2007-01-01

    Vitamin A deficiency (VAD) is the most common cause of childhood blindness in the developing world. It is estimated that by giving adequate vitamin A, in vitamin A deficient populations, child mortality from measles can be reduced by 50%, and mortality from diarrheal disease by 40%. Overall mortality in children 6-59 months of age can be reduced by 23%. This paper reported results from a study of vitamin A status and malnutrition of the minority ethnic group of Karen hill tribe children aged 1-6 years in the north of Thailand. All children aged 1-6 years (N = 158; 83 boys, 75 girls) from the three Karen villages (Mae Hae Tai, Mae Yot, Mae Raek) of Mae Chaem district in the north of Thailand were studied. The Karen is the largest mountain ethnic minority ("hill tribe") group in Thailand. All children were examined by a qualified medical doctor and were assessed for their vitamin A intakes using 24 hours dietary recall. Thai food composition table from Ministry of Health, Thailand were used as references. The results were compared with the Thai Recommended Dietary Allowances. Children aged 1-3 years and 4-6 years were separately analysed due to the differences in Thai Recommended Dietary Allowances between the two age groups. A whole blood of 300 microL was obtained by "fingerstick" for determination of serum vitamin A. Community or village's vitamin A status was assessed by using Simplified Dietary Assessment (SDA) method and Helen Keller International (HKI) food frequency method. Descriptive statistics were used to analyse the data. All families of the study boys and girls had income lower than the Thailand poverty line (US $ 1,000/year). On average, 63% of children from Mae Hae Tai village, 1.5% of children from Mae Yot village and none of children from Mae Raek village had serum vitamin AKaren children in Mae Chaem district, recommendations were made as follow: (1) increased use of fat and oil, particularly in areas with high risk of VAD; (2) more general work

  2. Community exposure and vulnerability to water quality and availability: a case study in the mining-affected Pazña Municipality, Lake Poopó Basin, Bolivian Altiplano

    OpenAIRE

    French, Megan; Alem, Natalie; Edwards, Stephen J.; Blanco Coariti, Efraín; Cauthin, Helga; Hudson-Edwards, Karen A.; Luyckx, Karen; Quintanilla, Jorge; Sánchez Miranda, Oscar

    2017-01-01

    Assessing water sources for drinking and irrigation along with community vulnerability, especially in developing and rural regions, is important for reducing risk posed by poor water quality and limited water availability and accessibility. We present a case study of rural mining-agricultural communities in the Lake Poopó Basin, one of the poorest regions on the Bolivian Altiplano. Here, relatively low rainfall, high evaporation, salinization and unregulated mining activity have contributed t...

  3. Barriers to access to education for young people with epilepsy in Northern Tanzania: A qualitative interview and focus group study involving teachers, parents and young people with epilepsy.

    Science.gov (United States)

    Quereshi, Charlotte; Standing, Holly C; Swai, Amina; Hunter, Ewan; Walker, Richard; Owens, Stephen

    2017-07-01

    Educational outcomes for young people with epilepsy (YPE) in Hai District, Tanzania, are poor, as is commonly observed elsewhere in Sub-Saharan Africa. The reasons for this finding are not well understood, though stigma arising from supernatural concepts of epilepsy is frequently cited as a barrier to YPE accessing education. In this study, we aimed to explore the reasons why many YPE in Tanzania experience poor access to education, and elicit ways in which education could be improved for YPE according to teachers, parents and YPE. Ten focus group discussions with teachers were organized in Hai schools between March and May 2016. The themes arising from these discussions were identified, coded, analyzed and tested in semi-structured interviews with 19 YPE and 17 parents identified from a prevalent cohort of YPE identified in 2009. Behavioral problems and learning difficulties were cited as the main barriers to education for YPE. Other barriers included parental stigmatization, teachers' inadequate seizure management, and limited access to specialist schools. Teachers perceived that parents and YPE believe in spiritual etiology and traditional management for epilepsy. However, the majority of teachers, parents, and YPE cited biological etiology and management options, although understanding of epilepsy etiology and management could be improved amongst all groups. A multidimensional approach is needed to improve educational access, and hence outcomes, for YPE. Widespread community education is needed to improve knowledge of epilepsy etiology and management. Teachers require seizure management training, and parents need help to recognize YPE's right to education. Educational needs assessments would help to identify YPE requiring specialist schooling, and access to this could be improved. These interventions will likely reduce stigma, ensure appropriate academic and pastoral care at school, and thus enable YPE to attend, and succeed, in education. Copyright © 2017

  4. Segregated Planktonic and Bottom-Dwelling Archaeal Communities in High-Temperature Acidic/Sulfuric Ponds of the Tatun Volcano Group, Northern Taiwan

    Directory of Open Access Journals (Sweden)

    Ting-Wen Cheng

    2013-01-01

    Full Text Available Geothermal environments are characterized by dynamic redox and temperature fluctuations inherited from the exposure of deeply-sourced, hot, reducing fluids to low-temperature, oxidizing ambient environments. To investigate whether microbial assemblages shifted in response to the changes of a redox state within acidic hot ponds, we collected three paired water and sediment samples from the Tatun Volcano Group, assessed metabolic roles of community members, and correlated their functional capabilities with geochemical factors along depth. Molecular analyses revealed that Sulfolobus spp., Acidianus spp. and Vulcanisaeta spp. capable of respiring elemental sulfur under oxic and/or low-oxygen conditions were the major archaeal members in planktonic communities. In contrast, obligate anaerobic Caldisphaera spp. dominated over others in bottom-dwelling communities. Bacteria were only detected in one locality wherein the majority was affiliated with microaerophilic Hydrogenobaculum spp. Cluster analyses indicated that archaeal communities associated with sediments tended to cluster together and branch off those with water. In addition, the quantities of dissolved oxygen within the water column were substantially less than those in equilibrium with atmospheric oxygen, indicating a net oxygen consumption most likely catalyzed by microbial processes. These lines of evidence suggest that the segregation of planktonic from bottom-dwelling archaeal assemblages could be accounted for by the oxygen affinities inherited in individual archaeal members. Community assemblages in geothermal ecosystems would be often underrepresented without cautious sampling of both water and sediments.

  5. Climate and tectonic evolution of the Descanso-Yauri basin in the northernmost Altiplano: Archetype example of a 'lithospheric drip' basin

    Science.gov (United States)

    Kar, N.; Garzione, C. N.

    2015-12-01

    We present a new multiproxy Miocene-Pliocene paleoelevation record of the northernmost Altiplano plateau reconstructed from pollen, clumped isotope (TΔ47) and δ18Oc of sedimentary carbonates and leaf wax n-alkane δD signatures. The ~18Ma to ~9Ma deposits of our study area, Descanso-Yauri basin in southern Peru show 11 to 16ºC warmer than modern mean annual air temperature, low elevation vegetation pollen assemblage (dominated by Podocarpus), and an average precipitation δ18Omw (VSMOW) value of -8.3±2.0‰ (2σ). The ~5 to 4 Ma deposits in the Descanso-Yauri basin are characterized by herb and shrub vegetation and an average δ18O mw (VSMOW) value of -14.6±3.0‰ (2σ), indicative of an elevation and/or climate similar to modern conditions. Based on the multiproxy paleoclimate record, we interpret that there was a 2±1 km surface uplift between 9 and 5 Ma in the northernmost Altiplano plateau. Deformation history analysis through map scale structural investigation combined with provenance analysis from conglomerate clast composition and paleocurrents show that the thrusts bounding the NE side of the Descanso-Yauri basin were active until ˜9Ma. Deformation waned afterwards, and switched to an extensional deformation regime, coincident with decrease in subsidence rate from ˜0.2mm/year to ˜0.03mm/year. Depositional history reconstructed by facies analysis and stratigraphic correlation reveal that deposition in the basin began with transverse braided river systems that formed along the thrust front and gave way to a larger fluvial-lacustrine system until ˜4 Ma. The basin deposits show an overall fining upward trend from coarse clastic dominated, in the lower most parts of the basin fill to fluvial overbank and lacustrine mudstone and diatomite deposits in the middle-upper parts. The thickest deposits formed in the central part of the basin. Based on these depositional and deformational patterns, we infer that the Descanso-Yauri basin formed in response to a

  6. Isotopic and chemical composition of groundwater in the Bolivian Altiplano, present space evolution records hydrologic conditions since 11,000 Yr

    International Nuclear Information System (INIS)

    Coudrain, A.; Talbi, A.; Loubet, M.; Gallaire, R.; Jusserand, C.; Ramirez, E.; Ledoux, E.

    1999-01-01

    The phreatic aquifer of the central Altiplano shows a Cl concentration that increases from 0.5 meq l -1 upstream to 150 meq l -1 downstream. The main outflow process from the aquifer is the upward flow E into the unsaturated zone associated to evaporation close to soil surface. A relation has been established for any arid zone areas on the base of isotopic profiles: E (mm yr -1 ) = 63 Z -1.5 where Z (m) is the water table depth under soil surface. The aquifer under study may have acquired its high chlorine content during last lacustrine phase (Tauca, 12 ka BP). Arguments for this hypothesis are: (i) maximum level of the lake (3780 m) higher than present soil elevation in the area, (ii) same order of salinity in the paleolake and in the more saline groundwater, (iii) weak molar ratio of Li/Cl in saline groundwater and in the Tauca, (iv) modelling of Cl transport over 11,000 years consistent with observed spatial evolution of Cl in groundwater. To this scenario, might be superimposed the assumption of a delay for the convective transfer of salt towards south by the coupled effects of accumulation of salt in the unsaturated zone by evaporation from the aquifer during thousand or so years, and of the subsequent return of this salt downwards to the aquifer during some short rainy periods. The 87 Sr/ 86 Sr, major and trace element compositions of surface and groundwater support this proposed scenario. (author)

  7. Políticas de salud basadas en el concepto de interculturalidad: Los centros de salud intercultural en el altiplano boliviano

    Directory of Open Access Journals (Sweden)

    Susana Ramírez Hita

    2009-07-01

    Full Text Available Actualmente en Bolivia, uno de los mayores problemas en el ámbito de la salud es la incorporación del concepto de cultura a las políticas sanitarias, hecho que hizo que se crearan centros de salud denominados "interculturales", así como el Modelo de Salud Familiar Comunitario e Intercultural. Este artículo, a través de una investigación realizada en el año 2007 en la zona altiplánica de Bolivia, pretende demostrar como el concepto de cultura está sirviendo de base para implementar políticas que no están ayudando a cambiar los deficientes índices epidemiológicos del país.One of the most important problems in the health field nowadays in Bolivia is the incorporation of the culture concept to public health politics, which had led to the creation of health centers called "intercultural", as well as the Communitary and Intercultural Model of Family Health. This paper, based on a research project undertaken in 2007 in the Bolivian altiplano, seeks to demonstrate how the culture concept is being used as a basis to implement politics that are not contributing to improve the deficient epidemiological indexes of the country.

  8. Brechas de rentabilidad económica en pequeñas unidades de producción de leche en el altiplano central mexicano

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Romo Bacco

    2014-01-01

    Full Text Available Entre las grandes y pequeñas unidades de producción lechera (PUPL existen brechas en la rentabilidad económica (RE debido a economías de escala significativas; aunque también pueden hallarse al interior del estrato de pequeña escala, dificultando el avance tecnológico y sustentabilidad de la producción lechera. El objetivo fue identificar la presencia de brechas de RE y relacionarlas con los factores productivos de PUPL. Se entrevistaron 89 propietarios de PUPL del Altiplano Central Mexicano (Valle de Aguascalientes registrados en el Programa de Capacitación y Asistencia Técnica de SAGARPA (2011; muestra con 95 % de confiabilidad y 10% de precisión; 162 variables; PUPL con 1.0. Sólo una de cinco PUPL tuvo resultados superavitarios (17/89=19.1 %; IC95%: 14.9, 23.3 %, asociados directamente (P1.0: 7/20 vs 10/69. Estos resultados sugieren que las políticas públicas y privadas pudieran enfocar sus esfuerzos a cerrar las brechas de RE entre PUPL, mejorando el alcance del potencial técni co de producción, las estrategias de intercambio comercial, la preservación del empleo y recursos naturales.

  9. Clasificación taxonómica de los suelos del altiplano de San Félix, departamentos de Caldas.

    Directory of Open Access Journals (Sweden)

    Jaramillo J. Daniel F.

    2000-12-01

    Full Text Available En 5 perfiles de suelos derivados de piroclastos de la secuencia El Cedral, en el altiplano de San Félix, Municipio de Satamina (Caldas, se estudiaron las propiedades ándicas y espódicas de sus materiales, con el fin de clasificarlos taxonómicamente según el sistema del USDA (Soil Survey Staff, SSS, 1998. Con ayuda de la propuesta de ajuste de Shoji et al (1996. Ninguno de los suelos cumple todos los requisitos para materiales espódicos o ándicos pero por sus características fueron clasificados en el orden Andisol; sus propiedades quimcas los ubicaron en el subgrupo Acrudoxic de los grandes grupos Fluviales (3 de 5 perfiles y Hapludand, familia medial isomésica. Se sugiere incluir en la clasificación del subgrupo, la partícula Thaptic para resaltar la presencia de un horizonte Ab, cuando el límite superior de éste presente dentro de los 100 cm superiores del suelo, aún si no se cumple estrictamente los requerimientos de calor.

  10. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  11. 9 April 2013 - Minister for Universities and Science United Kingdom of Great Britain and Northern Ireland D. Willetts in the ATLAS experimental cavern with ATLAS Collaboration Spokesperson D. Charlton and in the LHC tunnel at Point 1 with Beams Department Head P. Collier. Director for Accelerators and Technology S. Myers, Editor at the Communication Group K. Kahle and Beams Department Engineer R. Veness present.

    CERN Multimedia

    Jean-Claude Gadmer

    2013-01-01

    9 April 2013 - Minister for Universities and Science United Kingdom of Great Britain and Northern Ireland D. Willetts in the ATLAS experimental cavern with ATLAS Collaboration Spokesperson D. Charlton and in the LHC tunnel at Point 1 with Beams Department Head P. Collier. Director for Accelerators and Technology S. Myers, Editor at the Communication Group K. Kahle and Beams Department Engineer R. Veness present.

  12. APW path traced for the Guiana Shield (2070-1960 Ma) and Paleogeographic Implications: Paleomagnetic data from the 1.98-1.96 Ga Surumu Group (Northern Amazonian Craton)

    Science.gov (United States)

    Bispo-Santos, F.; Dagrella Filho, M. S.; Reis, N. J.; Trindade, R. I.

    2013-05-01

    Definition of continental paleogeography for times prior to formation of Columbia Supercontinent (1900-1850 Ma) is very complex, since amalgamation of some continental blocks of Earth was still in progress, as in the case of Laurentia, Baltica and Amazonian Craton. So, paleogeographic models proposed for this time are still very speculative and/or subjective. The use of the paleomagnetic technique tracing apparent polar wander (APW) paths for the various cratonic blocks can contribute to understand the continental amalgamation and breakup, especially for times where all created oceanic lithosphere was fully consumed. In this study, we present the paleomagnetic data obtained for samples collected from 39 sites from the well-dated 1980-1960 Ma (U-Pb) volcanic rocks belonging to the Surumu Group, cropping out in the northern Roraima State (Guiana Shield, Amazonian Craton). AF and thermal treatment revealed northwestern directions with moderate downward inclinations on samples from 20 out of the 39 analyzed sites. Site mean directions cluster around the mean, Dm = 298.6°; Im = 39.4° (N = 20; α95 = 10.1°), which yielded a key paleomagnetic pole (SG) for the Guiana Shield, located at 234.8°E, 27.4°N (A95 = 9.8°). Magnetic mineralogy experiments show that the magnetization of these rocks, probably of primary origin, is carried by magnetite and/or hematite. The SG pole contributes to a better fit of the APW path traced for Guiana Shield during the Paleoproterozoic (2070-1960 Ma). Comparison with the APW path traced for the West-Africa Craton for the same time interval suggests that these cratonic blocks were linked at 2000-1960 Ma ago, forming a paleogeography in which the Guri (Guiana Shield) and Sassandra (West-Africa Craton) shear zones were aligned as suggested in previous geologic models. KEYWORDS: Paleoproterozoic, Paleomagnetism, APWP, Amazonian Craton, Surumu Group.

  13. Evolution oligo-miocène de l'Altiplano occidental ( arc et avant arc du nord du Chili, Arica ) : tectonique , volcanisme, sédimentation, géomorphologie et bilan érosion-sédimentation.

    OpenAIRE

    Garcia , Marcelo

    2001-01-01

    The oligo-neogene geodynamic evolution of Altiplano, at the latitude od "Codo de Arica", is characterised by an important compressive defonnation and volcanism. In the eastern part of the chain (Bolivia), the shortening is weIl documented (190-280 km), and it explain a very thick crust (65 km). However, in the western part, the geological history is not weIl known and in part controversial. The study of the Arica region, on three regional transects (to scale 1:50.000), permit to propose a rep...

  14. Lo que a nadie asusta pero a todos preocupa. Etnografía de los miedos cotidianos en una comunidad del altiplano sur boliviano

    Directory of Open Access Journals (Sweden)

    Gil García, Francisco M.

    2014-12-01

    Full Text Available From the idea that fear is installed in our lives, I analyze the double talk of fears denied and concerns recognized from which the inhabitants of a community in the Bolivian high-plateau explain their daily lives, paying particular attention to the reasons given by adults in the education of children when being in certain environments or forbid them to perform certain actions. So, I will present a spatial distinction among urban settings: the own spaces, secure and recognized —but potentially threatened—, and the territory of the others, which the concurrency of past and present terrible otherness transforms in a frightening geography where things happen, fear scenarios that need to be conspirators and reordered.Partiendo de la idea de que el miedo existe instalado en nuestras vidas, se analiza el doble discurso de miedos negados y preocupaciones reconocidas desde el que los habitantes de una comunidad del altiplano boliviano explican su vida cotidiana, prestando especial atención a las razones esgrimidas por los adultos en la educación de los niños a la hora de prohibirles frecuentar determinados ambientes o realizar en ellos ciertas acciones. Para ello partiré de una distinción espacial dentro del entramado urbano, diferenciando así entre espacios propios, seguros y reconocidos —pero potencialmente amenazados— que, debido a la concurrencia de determinadas alteridades terribles presentes y pretéritas, son sentidos como un territorio de los otros, una geografía atemorizadora donde suceden cosas, escenarios del miedo que necesitan ser conjurados y reordenados.

  15. EVALUACIÓN PRELIMINAR DE LA SUSTENTABILIDAD DE UNA PROPUESTA AGROECOLOGICA, EN EL SUBTRÓPICO DEL ALTIPLANO CENTRAL DE MÉXICO

    Directory of Open Access Journals (Sweden)

    Jesús Gastón Gutiérrez Cedillo

    2011-05-01

    La evaluación de sustentabilidad mediante enfoques sistémicos, ha recibido atención recientemente dado su potencial como herramienta de toma de decisiones. Por otra parte, las fincas experimentales universitarias requieren cumplir con funciones de investigación, docencia y extensión, además de ser ambiental y económicamente sustentables. Se realizó la evaluación de una finca universitaria ubicada en el subtrópico del Altiplano Central de México. En la primera fase del estudio (2004 se realizaron la caracterización, el diagnóstico y la evaluación inicial. Se identificaron y priorizaron los principales problemas, para los cuales se derivaron propuestas de solución bajo un enfoque agroecológico. Posteriormente se seleccionaron y midieron 14 indicadores de carácter ambiental, económico y social. Los resultados muestran valores bajos en la mayoría de los indicadores, como resultado de una baja integración entre subsistemas y la ausencia de prácticas de conservación de recursos. La metodología utilizada fue útil para ampliar el entendimiento sobre los procesos ecosistémicos y plantear técnicas y alternativas de solución. Â

  16. Posibilidad de mejorar la calidad fisicoquímica y microbiológica de la leche cruda en el altiplano boyacense

    Directory of Open Access Journals (Sweden)

    Roy José Andrade-Becerra

    2012-07-01

    Full Text Available Presenta los resultados de un proyecto que se desarrolló durante los meses de agosto a diciembre de 2009 en 58 fincas ubicadas en los municipios de Duitama, Tibasosa, Belén, Sotaquirá, Iza, Santa Rosa de Viterbo, Tuta, Nobsa, Firavitoba, Tunja y Paipa, con el objetivo de buscar el mejoramiento de la calidad microbiológica y fisicoquímica de la leche que se produce en el altiplano boyacense. Se tomaron 1160 muestras de leche cruda, y se enviaron al laboratorio de la empresa Cobinaga para ser analizadas en su calidad fisicoquímica (porcentaje de proteína y grasa [lactoscan®] y microbiológica (unidades formadoras de colonia UFC [recuento de mesófilos en placa Petrifilm®], conteo de células somáticas CCS [Fossomatic®].Con la mejora de la rutina de ordeño y de la limpieza de equipos y utensilios, con el control y la prevención de mastitis y la caracterización de cada finca, se logró el mejoramiento de la proteína en un promedio de 2.86%a 2.93%, la grasa osciló dentro de rangos de 3.2 a 4.4 en promedio, el conteo de unidades formadoras de colonia mejoró, alcanzando 18 mil UFC/ml, y el conteo de células somáticas subió a 325 mil CCS/ml.

  17. Respuesta de Physalis peruviana a la fertilización con diferentes dosis de N, P y K en el Altiplano de Pasto, Colombia

    Directory of Open Access Journals (Sweden)

    Amanda Silva Parra

    2015-10-01

    Full Text Available En un Andisol Typic dystrandept del Altiplano de Pasto (2800 m.s.n.m., 12.6°C, 820 mm/año y 900 h de luz solar, Colombia, se evaluaron algunas variables de crecimiento, contenido de nutrientes y producción de uvilla (Physalis peruviana como respuesta a la fertilización con N, P y K. Los tratamientos consistieron en la aplicación de urea (46% N como fuente de N, superfosfato triple-SPT (46% de P2O5 como fuente de P y cloruro de potasio-KCl (60% K2O como fuente de K, en dosis iguales para cada fuente, de 80, 150 y 300 kg/ha/año aplicados en dos épocas al momento del trasplante y 30 días después, antes de la floración. Los resultados mostraron diferencias en fuentes y dosis (P ≤ 0.01 en todas las variables analizadas. Las dosis de 300 kg/ha de urea, 150 kg/ha de SPT y 300 kg/ha de KCl favorecieron la mayor altura de planta, la materia seca y la absorción de NPK (P ≤ 0.05. La absorción de N fue mayor que la de K y éste a su vez que la de P en todas las interacciones evaluadas (P ≤ 0.05. La aplicación de 300 kg/ha de cada uno de los fertilizantes ocasiono incremento del rendimiento de P. peruviana. Por otra parte, fueron encontrados efectos positivos en la absorción NPK en relación con los rendimientos de Physalis peruviana con 300 kg/ha de urea, 150 kg/ha de SPT y 300 kg/ha de KCl (P ≤ 0.05, por tanto se recomiendan estas dosis de fertilizantes.

  18. «Sangres» para propiciar la vida: metáforas y creencias sobre la concepción «humana» en el altiplano andino

    Directory of Open Access Journals (Sweden)

    Vicente Martín, Patricia

    2016-06-01

    conceptos de fertilidad de las gentes del altiplano.

  19. Corrección de temperatura en el altiplano peruano utilizando análisis Wavelet Multiresolución sobre datos adquiridos por percepción remota

    OpenAIRE

    Barreda Polar, Carolina Elena

    2015-01-01

    Universidad Nacional Agraria La Molina. Escuela de Posgrado. Maestría en Meteorología Aplicada Datos de temperatura de día y de noche, estimados por MODIS, fueron corregidos para obtener la temperatura máxima y mínima del aire, en la región del Altiplano peruano, en el periodo 2001-2012. El modelo conceptual basado en el análisis wavelet multiresolución, propone el ensamble entre las señales de temperatura de MODIS y la temperatura medida en estación. Imágenes MODIS-LST (MOD11C2) de te...

  20. Cambios proyectados de los recursos hídricos bajo escenarios de emisiones RCP4.5 y 8.5 de modelos climáticos globales del CMIP5 en el Altiplano Peruano

    OpenAIRE

    Lujano Laura, Efrain; Servicio Nacional de Meteorología e Hidrología; Hidalgo Sanchez, Liz S.; Servicio Nacional de Meteorología e Hidrología; Tapia Aguilar, Bernardino; Servicio Nacional de Meteorología e Hidrología; Lujano Laura, Apolinario; Autoridad Nacional del Agua; Diaz Aguilar, Renny D.; Servicio Nacional de Meteorología e Hidrología

    2016-01-01

    La investigación, se realizó en el ámbito del altiplano Peruano, con el objetivo de evaluar los cambios en la disponibilidad del recurso hídrico bajo escenarios de emisiones de Modelos Climáticos Globales (MCG) del Proyecto de Intercomparación de Modelos Acoplados Fase 5 (CMIP5). La distribución espacio-temporal de la precipitación, se tomó como referencia la climatología 1971 – 2000 y sus proyecciones para el horizonte 2071 – 2100, así mismo para la simulación de caudales se utilizó el model...

  1. Community exposure and vulnerability to water quality and availability: a case study in the mining-affected Pazña Municipality, Lake Poopó Basin, Bolivian Altiplano.

    Science.gov (United States)

    French, Megan; Alem, Natalie; Edwards, Stephen J; Blanco Coariti, Efraín; Cauthin, Helga; Hudson-Edwards, Karen A; Luyckx, Karen; Quintanilla, Jorge; Sánchez Miranda, Oscar

    2017-10-01

    Assessing water sources for drinking and irrigation along with community vulnerability, especially in developing and rural regions, is important for reducing risk posed by poor water quality and limited water availability and accessibility. We present a case study of rural mining-agricultural communities in the Lake Poopó Basin, one of the poorest regions on the Bolivian Altiplano. Here, relatively low rainfall, high evaporation, salinization and unregulated mining activity have contributed to environmental degradation and water issues, which is a situation facing many Altiplano communities. Social data from 72 households and chemical water quality data from 27 surface water and groundwater sites obtained between August 2013 and July 2014 were used to develop locally relevant vulnerability assessment methodologies and ratings with respect to water availability and quality, and Chemical Water Quality Hazard Ratings to assess water quality status. Levels of natural and mining-related contamination in many waters (CWQHR ≥ 6; 78% of assessed sites) mean that effective remediation would be challenging and require substantial investment. Although waters of fair to good chemical quality (CWQHR ≤ 5; 22% of assessed sites) do exist, treatment may still be required depending on use, and access issues remain problematic. There is a need to comply with water quality legislation, improve and maintain basic water supply and storage infrastructure, build and operate water and wastewater treatment plants, and adequately and safely contain and treat mine waste. This study serves as a framework that could be used elsewhere for assessing and mitigating water contamination and availability affecting vulnerable populations.

  2. Community exposure and vulnerability to water quality and availability: a case study in the mining-affected Pazña Municipality, Lake Poopó Basin, Bolivian Altiplano

    Science.gov (United States)

    French, Megan; Alem, Natalie; Edwards, Stephen J.; Blanco Coariti, Efraín; Cauthin, Helga; Hudson-Edwards, Karen A.; Luyckx, Karen; Quintanilla, Jorge; Sánchez Miranda, Oscar

    2017-10-01

    Assessing water sources for drinking and irrigation along with community vulnerability, especially in developing and rural regions, is important for reducing risk posed by poor water quality and limited water availability and accessibility. We present a case study of rural mining-agricultural communities in the Lake Poopó Basin, one of the poorest regions on the Bolivian Altiplano. Here, relatively low rainfall, high evaporation, salinization and unregulated mining activity have contributed to environmental degradation and water issues, which is a situation facing many Altiplano communities. Social data from 72 households and chemical water quality data from 27 surface water and groundwater sites obtained between August 2013 and July 2014 were used to develop locally relevant vulnerability assessment methodologies and ratings with respect to water availability and quality, and Chemical Water Quality Hazard Ratings to assess water quality status. Levels of natural and mining-related contamination in many waters (CWQHR ≥ 6; 78% of assessed sites) mean that effective remediation would be challenging and require substantial investment. Although waters of fair to good chemical quality (CWQHR ≤ 5; 22% of assessed sites) do exist, treatment may still be required depending on use, and access issues remain problematic. There is a need to comply with water quality legislation, improve and maintain basic water supply and storage infrastructure, build and operate water and wastewater treatment plants, and adequately and safely contain and treat mine waste. This study serves as a framework that could be used elsewhere for assessing and mitigating water contamination and availability affecting vulnerable populations.

  3. Northern Dimension: Participant Strategies

    Directory of Open Access Journals (Sweden)

    Busygina Irina

    2009-03-01

    Full Text Available This article is devoted to the “Northern Dimension” initiative of the EU which also includes North-West Russia, Norway and Iceland. It is noted that the “Northern Dimension” in the theoretical perspective can be considered as part of strategic multi-level interactions between member-states of the EU and Russia. On this basis, the authors analyze implications and effects of the strategic interdependence of all the EU-Russia relation levels.

  4. Northern Dimension: Participant Strategies

    Directory of Open Access Journals (Sweden)

    Busygina I.

    2009-01-01

    Full Text Available his article is devoted to the “Northern Dimension” initiative of the EU which also includes North-West Russia, Norway and Iceland. It is noted that the “Northern Dimension” in the theoretical perspective can be considered as part of strategic multi-level interactions between member-states of the EU and Russia. On this basis, the authors analyze implications and effects of the strategic interdependence of all the EU-Russia relation levels.

  5. Adverbial descriptions in Northern Sotho | Pretorius | South African ...

    African Journals Online (AJOL)

    Important language strategies, such as the use of auxiliary word groups and ideophones in expressing adverbial meanings are, to a great extent, neglected in most popular Northern Sotho grammars. Owing to the fact that in most cases, no one-to-one lexical equivalence exists between Northern Sotho and for instance ...

  6. Exfoliation syndrome in Northern Nigeria

    Directory of Open Access Journals (Sweden)

    Idakwo U

    2018-01-01

    Full Text Available Ugbede Idakwo,1 Olusola Olawoye,2 Benedictus GK Ajayi,1 Robert Ritch3 1Eleta Eye Institute, Ibadan, Nigeria; 2Department of Ophthalmology, College of Medicine, University of Ibadan, Ibadan, Nigeria; 3Einhorn Clinical Research Center, Department of Ophthalmology, New York Eye and Ear Infirmary of Mount Sinai, New York, NY, USA Purpose: To estimate the frequency of exfoliation syndrome (XFS and its association with ocular diseases in Northern Nigeria.Materials and methods: Consecutive patients who presented to the outpatient department of ECWA Eye Hospital Kano from February 2015 to May 2015 were included in the study. Each patient had a complete ophthalmic examination. The anterior segment examination included tonometry, gonioscopy, and detailed slit-lamp examination to assess for the presence or absence of exfoliation material, inflammatory cells, and other abnormal findings. Patients with exfoliation material on the anterior lens surface and/or pupillary margin in either or both eyes were considered to have XFS. Statistical analysis was performed using the Statistical Package for the Social Sciences version 16.0.Results: A total of 620 patients living in Northern Nigeria from the 6 geopolitical zones were examined. The majority of them (34.5% were indigenous Hausas. There was a male preponderance of 56.6%, while the mean age at presentation for examination in all age groups was 55.7±13.7 years. There were 9 patients with XFS; the frequency was 1.5%, with most of the patients being 70–80 years old. In patients who were ≥50 years, the frequency was 2.5%. Patients with XFS had a higher mean age of 68±4.9 years. The frequency of XFS among glaucoma patients was 4.4%, while among cataract patients it was 3.7%. No other associated ocular disease was found in the patients with XFS.Conclusion: This study shows that XFS does exist in Northern Nigeria, as was found in the South. The prevalence of XFS was, however, not reported in the Nigerian

  7. Existe-t-il une mémoire des 15 000 dernières années dans l'aquifère de l'Altiplano?

    Directory of Open Access Journals (Sweden)

    1998-01-01

    Full Text Available L’aquifère de l’Altiplano central présente une concentration en Cl croissante d’amont (0,5 meq l-1 en aval (150 meq l-1. Les valeurs supérieures à 20 meq l-1 ne peuvent pas être expliquées par un fonctionnement hydrologique comparable à celui prévalant actuellement. Le principal flux sortant de l’aquifère est l’évaporation (E dont la quantification régionale a été estimée à l’aide d’une relation établie pour l’ensemble des zones arides : E (mm an-1 = 63 Z-1,5 avec Z (m la profondeur du niveau saturé sous le sol. L’aquifère étudié a pu acquérir de fortes salinités lors de l’importante phase lacustre Tauca (15 Ka BP. Les arguments en faveur de cette hypothèse sont : (i niveau maximum du lac (3 780 m supérieur à l’altitude du sol dans la zone, (ii même ordre de salinité dans le Tauca et dans les eaux souterraines salées, (iii rapports isotopiques du Sr identiques dans les dépôts calcaires du Tauca et dans les eaux souterraines salées, (iv rapport molaire Li/Cl faible dans les eaux souterraines salées et dans le Tauca, (v temps de transfert modélisé compatible avec l’évolution spatiale actuelle de la concentration en Cl. On peut surimposer à ce scénario l’hypothèse d’un retard du transfert convectif vers l’aval par les effets conjugués de l’accumulation de sel dans la zone non saturée par évaporation de la nappe pendant des milliers d’années, et du retour de ce sel vers l’aquifère lors de courtes périodes très pluvieuses. ¿EXISTE MEMORIA DE LOS ULTIMOS 15 000 AÑOS EN LA CAPA FREÁTICA DEL ALTIPLANO CENTRAL? El acuífero del Altiplano central presenta una concentración en Cl que crece desde aguas arriba (0,5 meq l-1 hasta aguas abajo (150 meq l-1. Los valores que superan los 20 meq l-1 no se pueden explicar con un funcionamiento similar al presente. El flujo mayor que sale del acuífero es evaporación (E cuya evaluación a nivel regional se realizó mediante la relación establecida

  8. Northern Ireland gas industry

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, R S [Belfast City Council Gas Dept.; Asquith, R S; Brown, J M; McKay, G

    1977-07-01

    Throughout Northern Ireland the production of town gas is derived from hydrocarbon feedstocks. In the larger undertakings in Northern Ireland the feedstock is light distillate; a light petroleum feedstock which is a crude gasoline comprised mainly of pentanes, reformed in catalytic plants. The remaining gas undertakings produce a liquefied petroleum gas (LPG)/air mixture using a mixture of either butane or propane and air. The individual gas units and the type of reforming feedstock are shown. A review of the oil-dependence of town gas and electricity production in Northern Ireland has been considered and is mainly responsible for the high fuel prices experienced in the community. A detailed description of the reforming process has been described, and considerable efforts have been made to optimize the process. In spite of substantial economic savings being made on the processing unit, the gas industry is very susceptible to the changes in oil prices which have escalated rapidly in recent years. The difference in gas prices between the United Kingdom and Northern Ireland indicates that North Sea gas would offer major economic benefits to the gas industry in Northern Ireland, which is operating at a substantial loss at the moment. The industrial concerns, which are dependent on gas and therefore paying high fuel costs, suffer in competition with outside companies. The injection of a moderately cheap natural gas supply to the community may encourage industrial expansion and provide work in a high unemployment area. Although substantial costs must be incurred in distribution pipelines and burner conversions if Northern Ireland changes to natural gas, there appears to be a strong case to introduce North Sea gas in the near future.

  9. Northern blotting analysis

    DEFF Research Database (Denmark)

    Josefsen, Knud; Nielsen, Henrik

    2011-01-01

    Northern blotting analysis is a classical method for analysis of the size and steady-state level of a specific RNA in a complex sample. In short, the RNA is size-fractionated by gel electrophoresis and transferred by blotting onto a membrane to which the RNA is covalently bound. Then, the membrane...... is analysed by hybridization to one or more specific probes that are labelled for subsequent detection. Northern blotting is relatively simple to perform, inexpensive, and not plagued by artefacts. Recent developments of hybridization membranes and buffers have resulted in increased sensitivity closing...

  10. Northern blotting analysis

    DEFF Research Database (Denmark)

    Josefsen, Knud; Nielsen, Henrik

    2011-01-01

    is analysed by hybridization to one or more specific probes that are labelled for subsequent detection. Northern blotting is relatively simple to perform, inexpensive, and not plagued by artefacts. Recent developments of hybridization membranes and buffers have resulted in increased sensitivity closing...

  11. insurgencies in northern Uganda

    African Journals Online (AJOL)

    International Criminal Court (ICC) investigations into the LRA activities. ... and the rebel movements in northern Uganda, see Human Rights Watch 2003, and ... the ICC, Luis Moreno Ocampo, met at Hotel Intercontinental, Hyde Park, London, ..... expunge criminal liability for war crimes and crimes against humanity, appear.

  12. Northern pipelines : challenges and needs

    Energy Technology Data Exchange (ETDEWEB)

    Dean, D.; Brownie, D. [ProLog Canada Inc., Calgary, AB (Canada); Fafara, R. [TransCanada PipeLines Ltd., Calgary, AB (Canada)

    2007-07-01

    Working Group 10 presented experiences acquired from the operation of pipeline systems in a northern environment. There are currently 3 pipelines operating north of 60, notably the Shiha gas pipeline near Fort Liard, the Ikhil gas pipeline in Inuvik and the Norman Wells oil pipeline. Each has its unique commissioning, operating and maintenance challenges, as well as specific training and logistical support requirements for the use of in-line inspection tools and other forms of integrity assessment. The effectiveness of cathodic protection systems in a permafrost northern environment was also discussed. It was noted that the delay of the Mackenzie Gas Pipeline Project by two to three years due to joint regulatory review may lead to resource constraints for the project as well as competition for already scarce human resources. The issue of a potential timing conflict with the Alaskan Pipeline Project was also addressed as well as land use issues for routing of supply roads. Integrity monitoring and assessment issues were outlined with reference to pipe soil interaction monitoring in discontinuous permafrost; south facing denuded slope stability; base lining projects; and reclamation issues. It was noted that automatic welding and inspection will increase productivity, while reducing the need for manual labour. In response to anticipated training needs, companies are planning to involve and train Aboriginal labour and will provide camp living conditions that will attract labour. tabs., figs.

  13. 3rd February 2011-Science Museum Patrons-Kingdom of Great Britain and Northern Ireland-visiting CMS cavern and LHC Tunnel with A. De Roeck,CMS Collaboration Deputy Spokesperson and M. Lamont,Beams Department, Operation Group Leader

    CERN Multimedia

    Maximilien Brice

    2011-01-01

    The delegation: Mr Ian Blatchford,Director of the Science Museum and NMSI Mrs Susan Fisher,Director of Development, National Museum of Science and Industry (NMSI) Dr Douglas Gurr,Chairman of the Board of Trustees, NMSI Mr Martin Smith,Previous NMSI trustee Mrs Elise Smith,Spouse Mr Michael Wilson,NMSI trustee Mrs Jane Wilson,Spouse Mr Gregg Wilson,Son Dr Ann Coxon,UK Friends of the Science Museum Trustee Mr Nicholas Lewis,Contact of Martin Smith accompanied by P. Wells,Physics Department, ATLAS Inner Detector Group Leader and A. Koek,Communication group (International Arts Development, CERN Cultural Policy and Strategy with the Arts, The Collide Programme)

  14. PROCESOS DE CAMBIO EN EL USO DEL SUELO DE UNA MICROCUENCA EN EL ALTIPLANO MEXICANO. EL CASO DEL RÍO SAN JOSÉ EN EL ESTADO DE MÉXICO

    Directory of Open Access Journals (Sweden)

    Jazmín Azucena García Orozco

    2012-01-01

    Full Text Available El territorio mexicano se caracteriza por una amplia diversidad ambiental debido a la ubicación geográfica, relieve, clima, tipo de suelo, vegetación En México, los procesos de cambio en el uso del suelo se derivan de la interacción de diversos factores geográficos, económicos, políticos, sociales, demográficos y culturales. El objetivo de este trabajo es identificar y evaluar los cambios en el uso del suelo ocurridos en la microcuenca del río San José, ubicado en los municipios de San Felipe del Progreso y San José del Rincón, en el Altiplano Mexicano, entre los años 2000 y 2008. Se utilizó el software Arc Gis y funciones matemáticas para calcular los cambios de uso de suelo y evaluar la pérdida de áreas boscosas próximas a zonas agrícolas. El cambio más significativo se presenta sobre áreas forestales transformadas en agricultura de temporal.

  15. Reafirmación de la vitalidad de los rituales a las montañas y a la lluvia después del paso de un huracán en el Altiplano Mam de Guatemala

    Directory of Open Access Journals (Sweden)

    Julie Hermesse

    2014-09-01

    Full Text Available Las condiciones meteorológicas de Mesoamérica se caracterizan por la alternancia sucesiva de temporadas secas y temporadas de lluvias. En las primeras, los agricultores deben enfrentarse a una escasez de agua, mientras que en las segundas, deben prepararse al peligro del exceso de lluvias, o incluso a tormentas tropicales y a huracanes. En el Altiplano Mam de Guatemala, región montañosa fundamentalmente agrícola, los cambios en los patrones de lluvias son las principales amenazas para los cultivos. No es pues extraño que, desde tiempos remotos, las poblaciones mam pidan a los ajq'ij (sacerdote maya que asuman el papel de intermediarios ante las «figuras invisibles» de la lluvia y de las montañas. Un trabajo etnográfico de larga duración, empezado en Guatemala después del paso del huracán Stan (2005, permitió observar la vivacidad y la continuidad de rituales tradicionales que tienen por objetivo controlar la lluvia y proteger las montañas. Esto, a pesar de la emergencia de un contexto de cambio de los sistemas simbólicos ante las conversiones masivas al evangelismo.

  16. Northern pipelines : backgrounder

    International Nuclear Information System (INIS)

    2002-04-01

    Most analysts agree that demand for natural gas in North America will continue to grow. Favourable market conditions created by rising demand and declining production have sparked renewed interest in northern natural gas development. The 2002 Annual Energy Outlook forecasted U.S. consumption to increase at an annual average rate of 2 per cent from 22.8 trillion cubic feet to 33.8 TCF by 2020, mostly due to rapid growth in demand for electric power generation. Natural gas prices are also expected to increase at an annual average rate of 1.6 per cent, reaching $3.26 per thousand cubic feet in 2020. There are currently 3 proposals for pipelines to move northern gas to US markets. They include a stand-alone Mackenzie Delta Project, the Alaska Highway Pipeline Project, and an offshore route that would combine Alaskan and Canadian gas in a pipeline across the floor of the Beaufort Sea. Current market conditions and demand suggest that the projects are not mutually exclusive, but complimentary. The factors that differentiate northern pipeline proposals are reserves, preparedness for market, costs, engineering, and environmental differences. Canada has affirmed its role to provide the regulatory and fiscal certainty needed by industry to make investment decisions. The Government of the Yukon does not believe that the Alaska Highway Project will shut in Mackenzie Delta gas, but will instead pave the way for development of a new northern natural gas industry. The Alaska Highway Pipeline Project will bring significant benefits for the Yukon, the Northwest Territories and the rest of Canada. Unresolved land claims are one of the challenges that has to be addressed for both Yukon and the Northwest Territories, as the proposed Alaska Highway Pipeline will travel through traditional territories of several Yukon first Nations. 1 tab., 4 figs

  17. Petroleum systems and geologic assessment of undiscovered oil and gas, Cotton Valley group and Travis Peak-Hosston formations, East Texas basin and Louisiana-Mississippi salt basins provinces of the northern Gulf Coast region. Chapters 1-7.

    Science.gov (United States)

    ,

    2006-01-01

    The purpose of the U.S. Geological Survey's (USGS) National Oil and Gas Assessment is to develop geologically based hypotheses regarding the potential for additions to oil and gas reserves in priority areas of the United States. The USGS recently completed an assessment of undiscovered oil and gas potential of the Cotton Valley Group and Travis Peak and Hosston Formations in the East Texas Basin and Louisiana-Mississippi Salt Basins Provinces in the Gulf Coast Region (USGS Provinces 5048 and 5049). The Cotton Valley Group and Travis Peak and Hosston Formations are important because of their potential for natural gas resources. This assessment is based on geologic principles and uses the total petroleum system concept. The geologic elements of a total petroleum system include hydrocarbon source rocks (source rock maturation, hydrocarbon generation and migration), reservoir rocks (sequence stratigraphy and petrophysical properties), and hydrocarbon traps (trap formation and timing). The USGS used this geologic framework to define one total petroleum system and eight assessment units. Seven assessment units were quantitatively assessed for undiscovered oil and gas resources.

  18. Age evaluation and causation of rock-slope failures along the western margin of the Antrim Lava Group (ALG), Northern Ireland, based on cosmogenic isotope (36Cl) surface exposure dating

    Science.gov (United States)

    Southall, David W.; Wilson, Peter; Dunlop, Paul; Schnabel, Christoph; Rodés, Ángel; Gulliver, Pauline; Xu, Sheng

    2017-05-01

    The temporal pattern of postglacial rock-slope failure in a glaciated upland area of Ireland (the western margin of the Antrim Lava Group) was evaluated using both 36Cl exposure dating of surface boulders on run-out debris and 14C dating of basal organic soils from depressions on the debris. The majority of the 36Cl ages ( 21-15 ka) indicate that major failures occurred during or immediately following local deglaciation ( 18-17 ka). Other ages ( 14-9 ka) suggest some later, smaller-scale failures during the Lateglacial and/or early Holocene. The 14C ages (2.36-0.15 cal ka BP) indicate the very late onset of organic accumulation and do not provide close limiting age constraints. Rock-slope failure during or immediately following local deglaciation was probably in response to some combination of glacial debuttressing, slope steepening and paraglacial stress release. Later failures may have been triggered by seismic activity associated with glacio-isostatic crustal uplift and/or permafrost degradation consequent upon climate change. The 36Cl ages support the findings of previous studies that show the deglacial - Lateglacial period in northwest Ireland and Scotland to have been one of enhanced rock-slope failure. Table S2 Concentrations of main elements (as oxides) etc.

  19. Ethno-botanical studies from northern Pakistan

    International Nuclear Information System (INIS)

    Afzal, S.; Afzal, N.

    2009-01-01

    In this research paper efforts have been made to document the ethno-botanical knowledge of important plant species found in Northern Pakistan. It includes Thandiani, Galiat, Kaghan, Swat, Buner, Dir, Chitral and Northern Areas of Pakistan. The area has many climatic and vegetation zones or biomes. Locals residing in mountainous areas belonging to various ethnic groups are traditionally utilizing plants over many generations; these ethnic groups have their distinct life style, belief, traditions and cultural heritage. Plant collection and data regarding traditional uses in various areas of Northern Pakistan has been done periodically in different flowering /fruiting seasons. Locals of old age belonging to various ethnic groups were personally interviewed for establishing uses of plants. Photography is done for easy identification and habitat recognition. Collected plant specimens and seeds were preserved. Plant species were dried, mounted, identified and authenticated. Seventy six species were known to have traditional and ethno botanical uses. Plants have been utilized for many generations. Ethnic groups have distinct life style and have different economic uses for these plants. Due to unsustainable exploitation of natural habitats scarcity of drug plants has occurred. As consequence some species are depleting and may become extinct in near future, e. g. Morchella esculenta, Colchicum lueteum and Viola serpens are just a few of these. Although some sporadic information is available about the flora of this region but very little documented record of the ethno-botanically important plants has been established. It is expected that this research paper will be beneficial for students, researchers, farmers, foresters and general public. On the basis of data obtained it is concluded that ethno-botanical Flora of Northern Pakistan is quite rich and is diverse, due to the difference in altitude, climate and other topographic conditions. (author)

  20. Atmospheric circulation in northern hemisphere and north atlantic oscillation

    Directory of Open Access Journals (Sweden)

    Александр Вадимович Холопцев

    2015-08-01

    Full Text Available Conditions under which statistical connections of interannual changes of repitition duration periods in Northern hemisphere of elementary circulation mechanisms associated to meridional northern and meridional southern groups with variations of North Atlantic oscillation are significant were revealed. It is shown, that the characteristics changes of these connections taking place in modern period can be caused by distribution changes of distribution of sea surface temperatures

  1. Northern Pintail Telemetry [ds231

    Data.gov (United States)

    California Natural Resource Agency — Using radio-telemetry, female northern pintail (Anas acuta) survival, distribution, and movements during late August-March in Central California were determined...

  2. Biogeographical affinities and species richness of copronecrophagous beetles (Scarabaeoidea in the southeastern Mexican High Plateau Afinidades biogeográficas y riqueza de especies de escarabajos copronecrófagos (Scarabaeoidea en el sureste del altiplano mexicano

    Directory of Open Access Journals (Sweden)

    Alfonsina Arriaga

    2012-06-01

    Full Text Available In this study we establish the biogeographical affinities of the Scarabaeoidea dung beetle fauna in the dry southeast of the Mexican Plateau and analyze species diversity and how it changes with site, soil and vegetation type. Beetles were systematically captured in 6 windows in the region between Perote, Veracruz and El Seco, Puebla. A total of 9 species and 960 beetles belonging to Scarabaeinae, Aphodiinae and Trogidae were captured. Canthon humectus humectus and Phanaeus quadridens were found in greater abundance in cattle pastures. Trox plicatus is the only species captured in the badlands. The beetle fauna of this landscape is poor owing to a combination of circumstances, mainly the soil, recent volcanic activity and limited food availability. The results obtained are compared with those of 2 other dry landscapes in central Mexico (Metztitlán and Tehuacán. Our landscape shares 50% of its species with Metztitlán and 37.5% with Tehuacán. The species shared between all 3 landscapes are Canthon (B. puncticollis, Onthophagus lecontei and Labarrus pseudolividus. The fauna was characteristic of the southern Mexican Plateau, but poorer in both the number of species and individuals; some species-expected from a biogeographic perspective-were missing.Establecemos las afinidades biogeográficas de los Scarabaeoidea copronecrófagos del sureste seco del altiplano mexicano, así como la diversidad de especies y sus cambios en diferentes sitios, tipos de vegetación y suelos. Se recolectó en 6 diferentes ventanas entre Perote, Veracruz y El Seco, Puebla, obteniéndose un total de 9 especies y 960 individuos de Scarabaeinae, Aphodiinae y Trogidae. Canthon humectus humectus y Phanaeus quadridens fueron más abundantes en las áreas de pastoreo de ganado. Trox plicatus fue la única especie capturada en la zona de malpaís. En conjunto, la fauna de este paisaje es pobre debido a una combinación de circunstancias, principalmente la naturaleza del suelo

  3. Efecto del nivel de infestación de Varroa destructor sobre la producción de miel de colonias de Apis mellifera en el altiplano semiárido de México

    Directory of Open Access Journals (Sweden)

    Carlos Aurelio Medina-Flores

    2011-01-01

    Full Text Available El propósito del presente trabajo fue determinar sí el ácaro Varroa destructor afecta la producción de miel en colonias de abejas melíferas (Apis mellifera del altiplano semiárido de México. Se utilizaron 32 colonias que variaban en sus niveles de infestación del ácaro y que no habían recibido ningún acaricida durante dos años. Se determinó la producción de miel y el nivel de parasitosis en abejas adultas de estas colonias y los datos se sometieron a un análisis de correlación. Se encontró una correlación negativa y significativa entre el nivel de infestación por Varroa y la producción de miel (r= -0.44, P=0.01. Los valores medios de infestación y producción de miel (±DE fueron 15.21 ± 8.44 % y 36.26 ± 29.24 kg, respectivamente. Los resultados indican que al incrementarse el nivel de varroosis, la producción de miel se reduce de manera significativa. Se recomienda que las colonias de abejas infestadas por Varroa destructor sean sometidas a métodos de control que reduzcan la población del ácaro para contribuir a incrementar la producción de miel.

  4. SISTEMAS DE ALIMENTACIÓN PARA LAS CABRAS Y EVALUACIÓN CUALITATIVA DE LOS PIENSOS A LOS QUE SE TIENEN ACCESO DURANTE LA TEMPORADA DE SECA: DOS ESTUDIOS DE CASO DEL ALTIPLANO MEXICANO

    Directory of Open Access Journals (Sweden)

    Philipp Nagel

    2011-01-01

    Full Text Available El objetivo de este estudio fue caracterizar las estrategias de alimentación existentes y las principales fuentes de alimentación utilizadas en dos diferentes sistemas de producción caprina en el altiplano mexicano durante la temporada de seca. Se recolectaron plantas forrajeras importantes en los pastizales, éstas fueron analizadas para conocer su contenido de nutrientes. En encuestas y talleres participativos, los granjeros proporcionaron información sobres sus sistemas de producción. Se recopilaron análisis químicos de 43 plantas forrajeras durante la temporada de seca, estos análisis en su mayoría mostraron escasos contenidos de nutrientes. Algunas leguminosas y compuestas tuvieron un valor razonable de alimentación, pero podrían contener mecanismos de defensa los cuales limitan su uso potencial. Mejorar o incluso mantener la productividad del sistema de producción actual depende fuertemente del mejoramiento de la base nutricional, sobre todo durante la temporada de seca que es cuando las plantas forrajeras escasean. Enfoques recientes, como el cultivo de ciertas plantas forrajeras, las cuales también contribuyen a la reducción de la erosión y la pérdida del suelo, deberían ser desarrollados e implementados. La información proporcionada por los granjeros muestra que los dos sistemas de producción estudiados en el presente artículo difieren: Por una parte, los granjeros se basan principalmente en los métodos agrícolas tradicionales, y por la otra, los granjeros están continuamente en busca de nuevas opciones agrícolas con fuerte apoyo técnico de un proyecto externo.

  5. Northern Eurasia Future Initiative (NEFI)

    DEFF Research Database (Denmark)

    Groisman, Pavel; Shugart, Herman; Kicklighter, David

    2017-01-01

    . The Northern Eurasia Future Initiative (NEFI) has been designed as an essential continuation of the Northern Eurasia Earth Science Partnership Initiative (NEESPI), which was launched in 2004. NEESPI sought to elucidate all aspects of ongoing environmental change, to inform societies and, thus, to better...

  6. Transverse lie in labor: A study from Kaduna, Northern Nigeria ...

    African Journals Online (AJOL)

    Results: During the period there were 16633 deliveries and 30 women with transversely lying fetuses, giving an incidence of 1 in 554 deliveries. Forty percent of the cases were neglected transverse lies. The para 4 and above group had the highest incidence of 2.69/1000. Northern minorities ethnic group had the highest ...

  7. Evaporite karst of northern lower Michigan

    Science.gov (United States)

    Black, T.J.

    1997-01-01

    Michigan has three main zones of evaporite karst: collapse breccia in Late Silurian deposits of the Mackinac Straits region; breccia, collapse sinks, and mega-block collapse in Middle Devonian deposits of Northern Lower Michigan, which overlaps the preceding area; and areas of soil swallows in sinks of Mississippian deposits between Turner and Alabaster in Arenac and Iosco counties, and near Grand Rapids in Kent County. The author has focused his study on evaporite karst of the Middle Devonian deposits. The Middle Devonian depos its are the Detroit River Group: a series consisting of limestone, dolomite, shale, salt, gypsum, and anhydrite. The group occurs from subcrop, near the surface, to nearly 1400 feet deep from the northern tip of the Southern Peninsula to the south edge of the "solution front" Glacial drift is from zero to 350 feet thick. Oil and gas exploration has encountered some significant lost-circulation zones throughout the area. Drilling without fluid returns, casing-seal failures, and lost holes are strong risks in some parts of the region. Lost fluid returns near the top of the group in nearby areas indicate some karst development shortly after deposition. Large and irregular lost-circulation zones, linear and patch trends of large sink holes, and 0.25 mile wide blocks of down-dropped land in the northern Lower Peninsula of Michigan were caused by surface- and ground-water movement along faults into the Detroit River Group. Glaciation has removed some evidence of the karst area at the surface. Sinkhole development, collapse valleys, and swallows developed since retreat of the glacier reveal an active solution front in the Detroit River Group.

  8. Microevolution of human archaic groups of Arica, northern Chile, and its genetic contribution to populations from the Formative Period Microevolución de grupos humanos arcaicos de Arica, norte de Chile, y su contribución genética a las poblaciones del Período Formativo

    Directory of Open Access Journals (Sweden)

    HÉCTOR HUGO VARELA

    2006-06-01

    Full Text Available The microevolution of the archaic populations from Chile's northern coast and its morphological contribution to Formative period groups was studied. The sample comprised 181 individuals belonging to two Archaic (Morro-Uhle and Morro 1-1/6 and one Formative (Playa Miller-7 [Plm-7] series of the coast and one sample from the Formative (Alto Ramírez exhumed at the Azapa Valley. A total of 29 metric variables of the cranium were analyzed. Biological variability was assessed using discriminant analysis and Mahalanobis' D² distance stadistic (MDS. Population structure was inferred using a method based on quantitative genetic theory that predicts a lineal relationship between average within-group phenotypic variance and group distance to the population centroid. The four samples studied proved to be different from a morphologic point of view. The greatest distance was observed between Plm-7 (coast Formative and Alto Ramirez (valley Formative, the least between Morro-Uhle and Morro 1-1/6, the remaining distances presenting intermediate values. Regarding the total population, the most divergent group was Alto Ramírez and the least divergent was Morro1-1/6. A gradual biologic change was observed between Archaic (Morro Uhle and Morro 1-1/6 and coastal Formative populations (Plm-7 pointing to a morphological (genetic contribution of Archaic fishermen to Formative population of Chile's northern coast, without excluding gene flow from other groups of the South Central Andean AreaEstudiamos la microevolución de las poblaciones arcaicas de la costa norte y sus contribuciones morfológicas al Período Formativo. La muestra comprendió 181 individuos pertenecientes a dos colecciones arcaicas de la costa (Morro-Uhle y Morro 1-1/6 y una al formativo (Alto Ramírez exhumada en el Valle de Azapa. Un total de 29 variables métricas del cráneo fueron analizadas. La variabilidad biológica fue determinada utilizando análisis discriminante y distancias de

  9. Adapting online learning for Canada's Northern public health workforce

    Directory of Open Access Journals (Sweden)

    Marnie Bell

    2013-08-01

    Full Text Available Background . Canada's North is a diverse, sparsely populated land, where inequalities and public health issues are evident, particularly for Aboriginal people. The Northern public health workforce is a unique mix of professional and paraprofessional workers. Few have formal public health education. From 2009 to 2012, the Public Health Agency of Canada (PHAC collaborated with a Northern Advisory Group to develop and implement a strategy to strengthen public health capacity in Canada's 3 northern territories. Access to relevant, effective continuing education was identified as a key issue. Challenges include diverse educational and cultural backgrounds of public health workers, geographical isolation and variable technological infrastructure across the north. Methods . PHAC's Skills Online program offers Internet-based continuing education modules for public health professionals. In partnership with the Northern Advisory Group, PHAC conducted 3 pilots between 2008 and 2012 to assess the appropriateness of the Skills Online program for Northern/Aboriginal public health workers. Module content and delivery modalities were adapted for the pilots. Adaptations included adding Inuit and Northern public health examples and using video and teleconference discussions to augment the online self-study component. Results . Findings from the pilots were informative and similar to those from previous Skills Online pilots with learners in developing countries. Online learning is effective in bridging the geographical barriers in remote locations. Incorporating content on Northern and Aboriginal health issues facilitates engagement in learning. Employer support facilitates the recruitment and retention of learners in an online program. Facilitator assets included experience as a public health professional from the north, and flexibility to use modified approaches to support and measure knowledge acquisition and application, especially for First Nations, Inuit and

  10. Adapting online learning for Canada's Northern public health workforce.

    Science.gov (United States)

    Bell, Marnie; MacDougall, Karen

    2013-01-01

    Canada's North is a diverse, sparsely populated land, where inequalities and public health issues are evident, particularly for Aboriginal people. The Northern public health workforce is a unique mix of professional and paraprofessional workers. Few have formal public health education. From 2009 to 2012, the Public Health Agency of Canada (PHAC) collaborated with a Northern Advisory Group to develop and implement a strategy to strengthen public health capacity in Canada's 3 northern territories. Access to relevant, effective continuing education was identified as a key issue. Challenges include diverse educational and cultural backgrounds of public health workers, geographical isolation and variable technological infrastructure across the north. PHAC's Skills Online program offers Internet-based continuing education modules for public health professionals. In partnership with the Northern Advisory Group, PHAC conducted 3 pilots between 2008 and 2012 to assess the appropriateness of the Skills Online program for Northern/Aboriginal public health workers. Module content and delivery modalities were adapted for the pilots. Adaptations included adding Inuit and Northern public health examples and using video and teleconference discussions to augment the online self-study component. Findings from the pilots were informative and similar to those from previous Skills Online pilots with learners in developing countries. Online learning is effective in bridging the geographical barriers in remote locations. Incorporating content on Northern and Aboriginal health issues facilitates engagement in learning. Employer support facilitates the recruitment and retention of learners in an online program. Facilitator assets included experience as a public health professional from the north, and flexibility to use modified approaches to support and measure knowledge acquisition and application, especially for First Nations, Inuit and Metis learners. Results demonstrate that

  11. An elusive new species of Marsupial Frog (Anura: Hemiphractidae: Gastrotheca from the Andes of northern Peru

    Directory of Open Access Journals (Sweden)

    William E. Duellman

    2013-06-01

    Full Text Available A new species of marsupial frog, genus Gastrotheca, is described from high-elevation grasslands in the Andes in Región Amazonas in northernPeru, where even calling males are well hidden in deep moss. The new species is distinguished from all congeners by its unique color pattern that includes a narrow, blackbordered, yellow middorsal stripe. The species apparently belongs to the Gastrotheca plumbea Group, which ranges in the Andes from northern Colombia to northern Peru.

  12. Water in northern Alberta

    Energy Technology Data Exchange (ETDEWEB)

    1987-01-01

    This report contains background information, including historical aspects, roles of government agencies, and relevant technical information, for use as a resource document at a conference on water resources in northern Alberta. An overview is presented of the three river basins which are the geographic focus of this report (Peace River, Athabasca, and Beaver River), describing their characteristics, the types of human activity occurring in them, and the relevant issues pertaining to water. The roles and responsibilities of government departments and agencies in water management are then introduced. A section on water resource issues defines ten topic areas, and for each issue, a summary of the issue, background of the issue, and key concerns and suggested actions are given. These issue areas concern groundwater management (including protection from contamination by oil field produced water), community water supply, farmland drainage and erosion, protection of surface water quality, watershed and wetlands management, farm and rural water supply, tourism/recreation and fisheries, industrial water use (particularly by the oil sand, forestry, and hydroelectric power industries), native peoples' concerns, and water diversion. The final section discusses a number of common themes which arose from the public consultation process, including integrated planning and program coordination, monitoring and enforcement, public information, and research requirements. 22 refs., 8 figs., 3 tabs.

  13. Northern Fur Seal Food Habits

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains food habits samples, usually scats, collected opportunistically on northern fur seal rookeries and haulouts in Alaska from 1987 to present....

  14. U-series in zircon and 40Ar/39Ar geochronology reveal the most recent stage of a supervolcanic cycle in the Altiplano-Puna Volcanic Complex, Central Andes

    Science.gov (United States)

    Tierney, C.; de Silva, S. L.; Schmitt, A. K.; Jicha, B.; Singer, B. S.

    2010-12-01

    The ignimbrite flare up that produced the Altiplano-Puna Volcanic Complex of the Central Andes is characterized by episodic supervolcanism over a ~10 Ma time-span that climaxed about 4Ma. Since peak activity, the temporal and spatial record of volcanism suggests a waning of the system with only one other supervolcanic eruption at 2.6Ma. The most recent phase of volcanism from the APVC comprises a series of late Pleistocene domes that share a general petrochemical resemblance to the ignimbrites. New U-series data on zircons and high precision 40Ar/39Ar age determinations reveal that these effusive eruptions represent a temporally coherent magmatic episode. The five largest domes (Chao, Chillahuita, Chanka, Chascon-Runtu Jarita, and Tocopuri) have a combined volume >40 km3, and are distributed over an elliptical area of over 3000km2 centered at 22°S 68°W. They are crystal rich (>50%) dacites to rhyolites. New 40Ar/39Ar age determinations on biotite for the domes range range from 108±6 to 190±50 ka. However, 40Ar/39Ar ages from sanidine for some of the domes are more precise and span from 87±4 to 97±2 ka. We therefore interpret the eruption age of all these domes to be ~90 - 100 ka. This is consistent with SIMS U-series crystallization ages from the rims of 66 zircon crystals from four of the domes that reveal a fairly continuous spread of ages from ~90 ka to >300 ka with potentially common peaks in zircon ages at 100 ka and ~200 ka. U-Pb dating on the interiors of some of these zircon crystals indicates crystallization ages of up to 1.5 Ma. The common peaks of zircon crystallization between domes suggest that magma that fed these domes shared a larger regional source. Furthermore, the large volume of this potential source and the crystal-rich nature of the lava imply that this source was likely a large body of crystal-mush. The continuous nature of the zircon rim age population indicates that the residence time of this magma body was likely >200kyr. Potential

  15. Isotopic evolution of aqueous sulphate in northern Chile water

    International Nuclear Information System (INIS)

    Aravena, R.; Suzuki, O.; Fritz, P.; Pena, H.; Rauert, W.

    1987-01-01

    Full text: The extremely arid condition of northern Chile is the main obstacle to the present and future development of urban centres and economic activities in the region. The existing water resources are scarce. During the last decade, isotope techniques have been applied to investigate aspects such as the origin and residence time of the groundwater, these being extremely important for water development and water management. This paper presents 18 O and 34 S data in aqueous sulphate, as well as 18 O, 2 H, and 3 H from springs, rivers and groundwater samples of the Pampa del Tamarugal and Salar de Llamara basins. The principal aim of this study was to investigate the isotope evolution of the sulphate, the origin of the sulphur, the groundwater flow path, and the possibility of using the 18 O of the sulphate as a tracer for estimation of the residence time of the groundwater. Springs that have their recharge area in the high Altiplano (Salar del Huasco basin) show δ values between +5.0 per mille and +6.0 per mille for the 18 O and +5.0 per mille and +9.0 per mille for the 34 S isotope. Springs from lower altitude, show an isotope content between + 8.6 per mille and + 10.6 per mille for 18 O and +7.4 per mille and + 11.7 per mille for 34 S. The groundwaters in the Pampa aquifers, based on their hydrogen and oxygen isotope composition, are associated with different recharge areas. However, these waters show an isotope range for the sulphate similar to .he one of the springs, and no clear relationships are observed between isotope content, flow path and residence time. This pattern could be related to the poorly defined aquifer systems present in the Pampa. The Llamara groundwaters have a uniform isotope content and are the most enriched in the region (δ 18 O = -6.0 per mille and δ 2 H = -50 per mille). The isotope composition of their sulphate compares well with the Pampa groundwater, indicating a similar sulphate source. The isotope composition of gypsum

  16. Radiological monitoring of northern slopes of Mogoltau

    International Nuclear Information System (INIS)

    Murtazaev, Kh.; Boboev, B.D.; Bolibekov, Sh.; Akhmedov, M.Z.

    2010-01-01

    Present article is devoted to radiological monitoring of northern slopes of Mogoltau. The physicochemical properties of water of northern slopes of Mogoltau were studied. The radiation monitoring of northern slopes of Mogoltau was carried out during several years under various weather conditions. The exposure rate of human settlements of northern part of Mogoltau was defined.

  17. Ground use by northern muriquis (Brachyteles hypoxanthus).

    Science.gov (United States)

    Mourthé, Italo M C; Guedes, Danusa; Fidelis, Janaína; Boubli, Jean P; Mendes, Sérgio L; Strier, Karen B

    2007-06-01

    Many arboreal primates descend to the ground, a custom that may occur more frequently in disturbed habitats, and in the presence of researchers to whom the primates are habituated. In this paper, we describe opportunistic observations of ground use in two groups of northern muriquis (Brachyteles hypoxanthus) at the RPPN Feliciano Miguel Abdala, Minas Gerais, Brazil. Members of both groups were observed drinking, resting, feeding, playing, and traveling on the ground to different degrees, and variation in the levels of habituation of the two groups may be responsible for the differences in the distribution of their terrestrial activities. The potential increase in vulnerability to predation or disease owing to ground use has implications for the conservation of this critically endangered species. (c) 2007 Wiley-Liss, Inc.

  18. Tornadoes Strike Northern Wisconsin

    Science.gov (United States)

    2007-01-01

    A series of tornadoes ripped through the Upper Midwest region of the United States in the evening of June 7, 2007. At least five different tornadoes touched down in Wisconsin, according to the Associated Press, one of which tore through the Bear Paw Resort in northern Wisconsin. Despite dropping as much as fifteen centimeters (six inches) of rain in some places and baseball-size hail in others, authorities were reporting no deaths attributable to the storm system, and only a smattering of injuries, but considerable property damage in some areas. When the MODIS instrument on NASA's Terra satellite observed the area on June 9, 2007, the track torn through the woods by one of the tornadoes stands out quite clearly. This photo-like image uses data collected by MODIS in the normal human vision range to give a familiar natural-looking appearance. The landscape is largely a checkerboard of farms, towns, roads, and cities. The pale land is predominantly farmland where crops have not fully grown in yet. Dark blue shows the winding path of rivers and lakes dotting the landscape. The large blue lake on the east (right) side of the image is Lake Michigan. Towns and cities, including the city of Green Bay, are gray. To the north side, farmland gives way to dark green as land use shifts from agriculture to the Menominee Indian Reservation and Nicolet National Forest. The diagonal slash through the dark green forested land shows the tornado track. Bare land was revealed where the tornado tore down trees or stripped vegetation off the branches. The high-resolution image provided above is at MODIS' full spatial resolution (level of detail) of 250 meters per pixel. The MODIS Rapid Response System provides this image at additional resolutions.

  19. Northern perspectives on medical elective tourism: a qualitative study

    Science.gov (United States)

    Coke, Sarah; Kuper, Ayelet; Richardson, Lisa; Cameron, Anita

    2016-01-01

    Background: The Royal College of Physicians and Surgeons of Canada recognizes education to be necessary for doctors to provide culturally safe care. Communities in northern Canada have large populations of Aboriginal people and other marginalized groups. Our goal was to identify the elements of appropriate predeparture curricula for these medical trainees. Methods: We conducted our study in Kenora, Ontario. With the help of a core collaborative group and the support of the local Aboriginal Health Access Centre, we interviewed a purposive sample of community members about their interactions with trainees from southern Canada. Aboriginal and non-Aboriginal researchers with roots in northern and southern Canada brought perspectives to the inductive analysis. Results: We conducted 17 semistructured interviews between February and March 2014. Participants felt that southern trainees were inadequately educated in northern politics, society and history. They identified 2 more themes: determinants of health affecting the local Aboriginal population, and provider and patient factors affecting delivery of culturally competent care. Participants also shared ideas on how best to implement this content into curricula. Interpretation: Providing culturally competent care to northern communities is a complex process requiring education. Using a collaborative method, we were able to delineate the experiences of members of a northern community and identify knowledge gaps of southern trainees travelling there. Our results provide a foundation for the content and structure of formal predeparture curricula to enable such trainees to provide culturally safe care. PMID:27398374

  20. Northern perspectives on medical elective tourism: a qualitative study.

    Science.gov (United States)

    Coke, Sarah; Kuper, Ayelet; Richardson, Lisa; Cameron, Anita

    2016-01-01

    The Royal College of Physicians and Surgeons of Canada recognizes education to be necessary for doctors to provide culturally safe care. Communities in northern Canada have large populations of Aboriginal people and other marginalized groups. Our goal was to identify the elements of appropriate predeparture curricula for these medical trainees. We conducted our study in Kenora, Ontario. With the help of a core collaborative group and the support of the local Aboriginal Health Access Centre, we interviewed a purposive sample of community members about their interactions with trainees from southern Canada. Aboriginal and non-Aboriginal researchers with roots in northern and southern Canada brought perspectives to the inductive analysis. We conducted 17 semistructured interviews between February and March 2014. Participants felt that southern trainees were inadequately educated in northern politics, society and history. They identified 2 more themes: determinants of health affecting the local Aboriginal population, and provider and patient factors affecting delivery of culturally competent care. Participants also shared ideas on how best to implement this content into curricula. Providing culturally competent care to northern communities is a complex process requiring education. Using a collaborative method, we were able to delineate the experiences of members of a northern community and identify knowledge gaps of southern trainees travelling there. Our results provide a foundation for the content and structure of formal predeparture curricula to enable such trainees to provide culturally safe care.

  1. Working group 4: Terrestrial

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    A working group at a Canada/USA symposium on climate change and the Arctic identified major concerns and issues related to terrestrial resources. The group examined the need for, and the means of, involving resource managers and users at local and territorial levels in the process of identifying and examining the impacts and consequences of climatic change. Climatic change will be important to the Arctic because of the magnitude of the change projected for northern latitudes; the apparent sensitivity of its terrestrial ecosystems, natural resources, and human support systems; and the dependence of the social, cultural, and economic welfare of Arctic communities, businesses, and industries on the health and quality of their environment. Impacts of climatic change on the physical, biological, and associated socio-economic environment are outlined. Gaps in knowledge needed to quantify these impacts are listed along with their relationships with resource management. Finally, potential actions for response and adaptation are presented

  2. SITUATION OF THE SPANISH AMERICANS OF NORTHERN NEW MEXICO.

    Science.gov (United States)

    KNOWLTON, CLARK S.

    THE SPANISH AMERICANS OF NORTHERN NEW MEXICO HAVE CONSTITUTED ONE OF THE UNRECOGNIZED DISADVANTAGED GROUPS. PER CAPITA INCOME IS LOW AND THE RATES OF UNEMPLOYMENT AND WELFARE ARE HIGH. THE CAUSES OF THE PRESENT SITUATION ARE--(1) LOSS OF LAND, (2) CULTURAL AND LINGUISTIC DISCRIMINATORY ATTITUDES, (3) NON-PROVISION OF ADEQUATE PROGRAMS TO…

  3. Genetic diversity in Cucurbita pepo landraces from northern ...

    African Journals Online (AJOL)

    The dendrogram mainly grouped the populations according to their mature fruit colour, and then according to their geographical origin. All genetic parameters indicated that there was plentiful genetic diversity in C. pepo landraces of northern KwaZulu-Natal, South Africa. Key words: Cucurbita pepo landraces, genetic ...

  4. It's Not an Exact Science: Teaching Entrepreneurship in Northern Ireland

    Science.gov (United States)

    Hegarty, Cecilia

    2006-01-01

    Purpose: The purpose of this paper is to evaluate the approach to embedding entrepreneurship within third level education in Northern Ireland by assessing the perceptions of lecturers and learners and monitoring the effectiveness of teaching methods. Design/methodology/approach: Surveys and focus groups were conducted with lecturers and learners…

  5. Surgical reconstruction of Northern Uganda war victims. | Kalanzi ...

    African Journals Online (AJOL)

    Background: Aid groups estimate that since 1086 when the war conflicts in Northern Uganda started, over 30,000 people have died in the insurgency and over 20,000 people have remained maimed. Arising from the conflict, innocent civilians have had their limbs, lips, eyes, ears, noses, breasts, fingers and toes cut off.

  6. Culturally and economically important nontimber forest products of northern Maine

    Science.gov (United States)

    Michelle J. Baumflek; Marla R. Emery; Clare. Ginger

    2010-01-01

    Nontimber forest products (NTFPs) gathered for food, medicine, craft, spiritual, aesthetic, and utilitarian purposes make substantial contributions to the economic viability and cultural vitality of communities. In the St. John River watershed of northern Maine, people identifying with cultural groups including Acadian, Maliseet, Mi'kmaq, Scotch-Irish, and Swedish...

  7. The regulation of uranium mining in the Northern Territory

    International Nuclear Information System (INIS)

    Wedd, M.

    1989-01-01

    The regulatory framework developed for uranium mining operations in the Northern Territory is reviewed. The respective roles of the Commonwealth Government, State Government and other regulatory authority are described. Whilst complex, expensive and cumbersome the regulatory process has so far ensured input from diverse interest groups and it allowed for environmental protection control in the Alligator River Region

  8. Adult Undernutrition in Rural Post-conflict Northern Uganda

    DEFF Research Database (Denmark)

    Schramm, Stine; Sodemann, Morten

    2017-01-01

    This chapter outlines the prevalence and high-risk groups for adult undernutrition and discusses the social, behavioral, and structural mechanisms that can lead to food insecurity and undernutrition in a post-conflict setting like northern Uganda. In summary, adult undernutrition is higher in the...

  9. Primary cutaneous malignancies in the Northern Cape Province of ...

    African Journals Online (AJOL)

    size, the Northern Cape (NC) Province has the smallest population of the ... whether skin cancer incidence in SA has followed the global trend.[12] ... high risk of mortality.[16] As ... 2012 was conducted using public and private health sector databases. .... majority of KSs occurred in the younger age group 30 - 39 years.

  10. Group X

    Energy Technology Data Exchange (ETDEWEB)

    Fields, Susannah

    2007-08-16

    This project is currently under contract for research through the Department of Homeland Security until 2011. The group I was responsible for studying has to remain confidential so as not to affect the current project. All dates, reference links and authors, and other distinguishing characteristics of the original group have been removed from this report. All references to the name of this group or the individual splinter groups has been changed to 'Group X'. I have been collecting texts from a variety of sources intended for the use of recruiting and radicalizing members for Group X splinter groups for the purpose of researching the motivation and intent of leaders of those groups and their influence over the likelihood of group radicalization. This work included visiting many Group X websites to find information on splinter group leaders and finding their statements to new and old members. This proved difficult because the splinter groups of Group X are united in beliefs, but differ in public opinion. They are eager to tear each other down, prove their superiority, and yet remain anonymous. After a few weeks of intense searching, a list of eight recruiting texts and eight radicalizing texts from a variety of Group X leaders were compiled.

  11. Group Flow and Group Genius

    Science.gov (United States)

    Sawyer, Keith

    2015-01-01

    Keith Sawyer views the spontaneous collaboration of group creativity and improvisation actions as "group flow," which organizations can use to function at optimum levels. Sawyer establishes ideal conditions for group flow: group goals, close listening, complete concentration, being in control, blending egos, equal participation, knowing…

  12. Northern micro-grid project

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, David; Singh, Bob

    2010-09-15

    The electrical distribution system for the Kasabonika Lake First Nation in northern Ontario (Canada) consumed 1.2 million liters of diesel fuel in 2008, amounting to 3,434 tones of CO2 emissions. The Northern Micro-Grid Project, supported by seven partners, involves integrating renewable generation & storage into the Kasabonika Lake distribution system. Through R&D and demonstration, the objectives are to reduce the amount of diesel consumed, support the distribution system exclusively on renewable resources during light loads, engage and impart knowledge/training to better position the community for future opportunities. The paper will discuss challenges, opportunities and future plans associated with the project.

  13. Permutation groups

    CERN Document Server

    Passman, Donald S

    2012-01-01

    This volume by a prominent authority on permutation groups consists of lecture notes that provide a self-contained account of distinct classification theorems. A ready source of frequently quoted but usually inaccessible theorems, it is ideally suited for professional group theorists as well as students with a solid background in modern algebra.The three-part treatment begins with an introductory chapter and advances to an economical development of the tools of basic group theory, including group extensions, transfer theorems, and group representations and characters. The final chapter feature

  14. Titan's Stratospheric Condensibles at High Northern Latitudes During Northern Winter

    Science.gov (United States)

    Anderson, Carrie; Samuelson, R.; Achterberg, R.

    2012-01-01

    The Infrared Interferometer Spectrometer (IRIS) instrument on board Voyager 1 caught the first glimpse of an unidentified particulate feature in Titan's stratosphere that spectrally peaks at 221 per centimeter. Until recently, this feature that we have termed 'the haystack,' has been seen persistently at high northern latitudes with the Composite Infrared Spectrometer (CIRS) instrument onboard Cassini, The strength of the haystack emission feature diminishes rapidly with season, becoming drastically reduced at high northern latitudes, as Titan transitions from northern winter into spring, In contrast to IRIS whose shortest wavenumber was 200 per centimeter, CIRS extends down to 10 per centimeter, thus revealing an entirely unexplored spectral region in which nitrile ices have numerous broad lattice vibration features, Unlike the haystack, which is only found at high northern latitudes during northern winter/early northern spring, this geometrically thin nitrile cloud pervades Titan's lower stratosphere, spectrally peaking at 160 per centimeter, and is almost global in extent spanning latitudes 85 N to 600 S, The inference of nitrile ices are consistent with the highly restricted altitude ranges over which these features are observed, and appear to be dominated by a mixture of HCN and HC3N, The narrow range in altitude over which the nitrile ices extend is unlike the haystack, whose vertical distribution is significantly broader, spanning roughly 70 kilometers in altitude in Titan's lower stratosphere, The nitrile clouds that CIRS observes are located in a dynamically stable region of Titan's atmosphere, whereas CH4 clouds, which ordinarily form in the troposphere, form in a more dynamically unstable region, where convective cloud systems tend to occur. In the unusual situation where Titan's tropopause cools significantly from the HASI 70.5K temperature minimum, CH4 should condense in Titan's lower stratosphere, just like the aforementioned nitrile clouds, although

  15. Bolivia Altiplano and Cordillera Occidental Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The gravity station data (59,933 records) were compiled by various organizations. This data base was received in June, 1993. Principal gravity parameters include...

  16. Group devaluation and group identification

    NARCIS (Netherlands)

    Leach, C.W.; Rodriguez Mosquera, P.M.; Vliek, M.L.W.; Hirt, E.

    2010-01-01

    In three studies, we showed that increased in-group identification after (perceived or actual) group devaluation is an assertion of a (preexisting) positive social identity that counters the negative social identity implied in societal devaluation. Two studies with real-world groups used order

  17. Lie groups and algebraic groups

    Indian Academy of Sciences (India)

    We give an exposition of certain topics in Lie groups and algebraic groups. This is not a complete ... of a polynomial equation is equivalent to the solva- bility of the equation ..... to a subgroup of the group of roots of unity in k (in particular, it is a ...

  18. Viral diseases of northern ungulates

    Directory of Open Access Journals (Sweden)

    K. Frölich

    2000-03-01

    Full Text Available This paper describes viral diseases reported in northern ungulates and those that are a potential threat to these species. The following diseases are discussed: bovine viral diarrhoea/mucosal disease (BVD/MD, alphaherpesvirus infections, malignant catarrhal fever (MCF, poxvirus infections, parainfluenza type 3 virus infection, Alvsborg disease, foot-and-mouth disease, epizootic haemorrhage disease of deer and bluetongue disease, rabies, respiratory syncytial virus infection, adenovirus infection, hog-cholera, Aujeszky's disease and equine herpesvirus infections. There are no significant differences in antibody prevalence to BVDV among deer in habitats with high, intermediate and low density of cattle. In addition, sequence analysis from the BVDV isolated from roe deer (Capreolus capreolus showed that this strain was unique within BVDV group I. Distinct BVDV strains might circulate in free-ranging roe deer populations in Germany and virus transmission may be independent of domestic livestock. Similar results have been obtained in a serological survey of alpha-herpesviruses in deer in Germany. Malignant catarrhal fever was studied in fallow deer (Cervus dama in Germany: the seroprevalence and positive PCR results detected in sheep originating from the same area as the antibody-positive deer might indicate that sheep are the main reservoir animals. Contagious ecthyma (CE is a common disease in domestic sheep and goats caused by the orf virus. CE has been diagnosed in Rocky Mountain bighorn sheep (Ovis canadensis, mountain goats (Oreamnos americanus, Dall sheep (Ovis dalli, chamois (Rupkapra rupi-capra, muskox {Ovibos moschatus and reindeer (Rangifer tarandus. Most parainfluenza type 3 virus infections are mild or clinically undetectable. Serological surveys in wildlife have been successfully conducted in many species. In 1985, a new disease was identified in Swedish moose (Alces alces, designated as Alvsborg disease. This wasting syndrome probably

  19. June 1990 Northern, Iran Images

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A magnitude 7.7 earthquake occurred in the Gilan Province between the towns of Rudbar and Manjil in northern Iran on Thursday, June 21, 1990 (June 20 at 21:00 GMT)....

  20. Group Work

    Science.gov (United States)

    Wilson, Kristy J.; Brickman, Peggy; Brame, Cynthia J.

    2018-01-01

    Science, technology, engineering, and mathematics faculty are increasingly incorporating both formal and informal group work in their courses. Implementing group work can be improved by an understanding of the extensive body of educational research studies on this topic. This essay describes an online, evidence-based teaching guide published by…

  1. Reflection groups

    International Nuclear Information System (INIS)

    Eggermont, G.

    2006-01-01

    In 2005, PISA organised proactive meetings of reflection groups on involvement in decision making, expert culture and ethical aspects of radiation protection.All reflection group meetings address particular targeted audiences while the output publication in book form is put forward

  2. Novel insect-specific flavivirus isolated from northern Europe

    Science.gov (United States)

    Huhtamo, Eili; Moureau, Gregory; Cook, Shelley; Julkunen, Ora; Putkuri, Niina; Kurkela, Satu; Uzcátegui, Nathalie Y.; Harbach, Ralph E.; Gould, Ernest A.; Vapalahti, Olli; de Lamballerie, Xavier

    2012-01-01

    Mosquitoes collected in Finland were screened for flaviviral RNA leading to the discovery and isolation of a novel flavivirus designated Hanko virus (HANKV). Virus characterization, including phylogenetic analysis of the complete coding sequence, confirmed HANKV as a member of the “insect-specific” flavivirus (ISF) group. HANKV is the first member of this group isolated from northern Europe, and therefore the first northern European ISF for which the complete coding sequence has been determined. HANKV was not transcribed as DNA in mosquito cell culture, which appears atypical for an ISF. HANKV shared highest sequence homology with the partial NS5 sequence available for the recently discovered Spanish Ochlerotatus flavivirus (SOcFV). Retrospective analysis of mitochondrial sequences from the virus-positive mosquito pool suggested an Ochlerotatus mosquito species as the most likely host for HANKV. HANKV and SOcFV may therefore represent a novel group of Ochlerotatus-hosted insect-specific flaviviruses in Europe and further afield. PMID:22999256

  3. Group theory

    CERN Document Server

    Scott, W R

    2010-01-01

    Here is a clear, well-organized coverage of the most standard theorems, including isomorphism theorems, transformations and subgroups, direct sums, abelian groups, and more. This undergraduate-level text features more than 500 exercises.

  4. Group Grammar

    Science.gov (United States)

    Adams, Karen

    2015-01-01

    In this article Karen Adams demonstrates how to incorporate group grammar techniques into a classroom activity. In the activity, students practice using the target grammar to do something they naturally enjoy: learning about each other.

  5. Computer group

    International Nuclear Information System (INIS)

    Bauer, H.; Black, I.; Heusler, A.; Hoeptner, G.; Krafft, F.; Lang, R.; Moellenkamp, R.; Mueller, W.; Mueller, W.F.; Schati, C.; Schmidt, A.; Schwind, D.; Weber, G.

    1983-01-01

    The computer groups has been reorganized to take charge for the general purpose computers DEC10 and VAX and the computer network (Dataswitch, DECnet, IBM - connections to GSI and IPP, preparation for Datex-P). (orig.)

  6. Group learning

    DEFF Research Database (Denmark)

    Pimentel, Ricardo; Noguira, Eloy Eros da Silva; Elkjær, Bente

    The article presents a study that aims at the apprehension of the group learning in a top management team composed by teachers in a Brazilian Waldorf school whose management is collective. After deciding to extend the school, they had problems recruiting teachers who were already trained based...... on the Steiner´s ideas, which created practical problems for conducting management activities. The research seeks to understand how that group of teachers collectively manage the school, facing the lack of resources, a significant heterogeneity in the relationships, and the conflicts and contradictions......, and they are interrelated to the group learning as the construction, maintenance and reconstruction of the intelligibility of practices. From this perspective, it can be said that learning is a practice and not an exceptional phenomenon. Building, maintaining and rebuilding the intelligibility is the group learning...

  7. Geological evolution of the Neoproterozoic Bemarivo Belt, northern Madagascar

    Science.gov (United States)

    Thomas, Ronald J.; De Waele, B.; Schofield, D.I.; Goodenough, K.M.; Horstwood, M.; Tucker, R.; Bauer, W.; Annells, R.; Howard, K. J.; Walsh, G.; Rabarimanana, M.; Rafahatelo, J.-M.; Ralison, A.V.; Randriamananjara, T.

    2009-01-01

    The broadly east-west trending, Late Neoproterozoic Bemarivo Belt in northern Madagascar has been re-surveyed at 1:100 000 scale as part of a large multi-disciplinary World Bank-sponsored project. The work included acquisition of 14 U-Pb zircon dates and whole-rock major and trace element geochemical data of representative rocks. The belt has previously been modelled as a juvenile Neoproterozoic arc and our findings broadly support that model. The integrated datasets indicate that the Bemarivo Belt is separated by a major ductile shear zone into northern and southern "terranes", each with different lithostratigraphy and ages. However, both formed as Neoproterozoic arc/marginal basin assemblages that were translated southwards over the north-south trending domains of "cratonic" Madagascar, during the main collisional phase of the East African Orogeny at ca. 540 Ma. The older, southern terrane consists of a sequence of high-grade paragneisses (Sahantaha Group), which were derived from a Palaeoproterozoic source and formed a marginal sequence to the Archaean cratons to the south. These rocks are intruded by an extensive suite of arc-generated metamorphosed plutonic rocks, known as the Antsirabe Nord Suite. Four samples from this suite yielded U-Pb SHRIMP ages at ca. 750 Ma. The northern terrane consists of three groups of metamorphosed supracrustal rocks, including a possible Archaean sequence (Betsiaka Group: maximum depositional age approximately 2477 Ma) and two volcano-sedimentary sequences (high-grade Milanoa Group: maximum depositional age approximately 750 Ma; low grade Daraina Group: extrusive age = 720-740 Ma). These supracrustal rocks are intruded by another suite of arc-generated metamorphosed plutonic rocks, known as the Manambato Suite, 4 samples of which gave U-Pb SHRIMP ages between 705 and 718 Ma. Whole-rock geochemical data confirm the calc-alkaline, arc-related nature of the plutonic rocks. The volcanic rocks of the Daraina and Milanoa groups also

  8. Group technology

    International Nuclear Information System (INIS)

    Rome, C.P.

    1976-01-01

    Group Technology has been conceptually applied to the manufacture of batch-lots of 554 machined electromechanical parts which now require 79 different types of metal-removal tools. The products have been grouped into 7 distinct families which require from 8 to 22 machines in each machine-cell. Throughput time can be significantly reduced and savings can be realized from tooling, direct-labor, and indirect-labor costs

  9. Abelian groups

    CERN Document Server

    Fuchs, László

    2015-01-01

    Written by one of the subject’s foremost experts, this book focuses on the central developments and modern methods of the advanced theory of abelian groups, while remaining accessible, as an introduction and reference, to the non-specialist. It provides a coherent source for results scattered throughout the research literature with lots of new proofs. The presentation highlights major trends that have radically changed the modern character of the subject, in particular, the use of homological methods in the structure theory of various classes of abelian groups, and the use of advanced set-theoretical methods in the study of undecidability problems. The treatment of the latter trend includes Shelah’s seminal work on the undecidability in ZFC of Whitehead’s Problem; while the treatment of the former trend includes an extensive (but non-exhaustive) study of p-groups, torsion-free groups, mixed groups, and important classes of groups arising from ring theory. To prepare the reader to tackle these topics, th...

  10. Group dynamics.

    Science.gov (United States)

    Scandiffio, A L

    1990-12-01

    Group dynamics play a significant role within any organization, culture, or unit. The important thing to remember with any of these structures is that they are made up of people--people with different ideas, motivations, background, and sometimes different agendas. Most groups, formal or informal, look for a leader in an effort to maintain cohesiveness of the unit. At times, that cultural bond must be developed; once developed, it must be nurtured. There are also times that one of the group no longer finds the culture comfortable and begins to act out behaviorally. It is these times that become trying for the leader as she or he attempts to remain objective when that which was once in the building phase of group cohesiveness starts to fall apart. At all times, the manager must continue to view the employee creating the disturbance as an integral part of the group. It is at this time that it is beneficial to perceive the employee exhibiting problem behaviors as a special employee, as one who needs the benefit of your experience and skills, as one who is still part of the group. It is also during this time that the manager should focus upon her or his own views in the area of power, communication, and the corporate culture of the unit that one has established before attempting to understand another's point of view. Once we understand our own motivation and accept ourselves, it is then that we may move on to offer assistance to another. Once we understand our insecurities recognizing staff dysfunction as a symptom of system dysfunction will not be so threatening to the concept of the manager that we perceive ourselves to be. It takes a secure person to admit that she or he favors staff before deciding to do something to change things. The important thing to know is that it can be done. The favored staff can find a new way of relating to others, the special employee can find new modes of behavior (and even find self-esteem in the process), the group can find new ways

  11. Offshore northern Europe, the challenges

    International Nuclear Information System (INIS)

    Bergseth, S.

    1996-01-01

    This paper relates to challenges of the offshore activity in the North Sea. It is appropriate to address these challenges in the context of generating values through efficient management of resources, markets, safety and technology, as the challenges lie therein. The petroleum industry is built to turn natural resources into market value, assuring broad benefits to stake holders and shareholders. In the following, the challenges facing the industry the industry offshore Northern Europe is examined on this background

  12. Edible insects of Northern Angola

    OpenAIRE

    Lautenschläger,Thea; Neinhuis,Christoph; Monizi,Mawunu; Mandombe,José Lau; Förster,Anke; Henle,Thomas; Nuss,Matthias

    2017-01-01

    From 2013–2017, we accompanied and interviewed local people harvesting edible insects in the Northern Angolan province of Uíge. Insect and host plant samples were collected for species identification and nutritive analyses. Additionally, live caterpillars were taken to feed and keep until pupation and eclosion of the imago, necessary for morphological species identification. Altogether, 18 insect species eaten by humans were recorded. Twenty four edible insect species were formerly known from...

  13. Group representations

    CERN Document Server

    Karpilovsky, G

    1994-01-01

    This third volume can be roughly divided into two parts. The first part is devoted to the investigation of various properties of projective characters. Special attention is drawn to spin representations and their character tables and to various correspondences for projective characters. Among other topics, projective Schur index and projective representations of abelian groups are covered. The last topic is investigated by introducing a symplectic geometry on finite abelian groups. The second part is devoted to Clifford theory for graded algebras and its application to the corresponding theory

  14. Lego Group

    DEFF Research Database (Denmark)

    Møller Larsen, Marcus; Pedersen, Torben; Slepniov, Dmitrij

    2010-01-01

    The last years’ rather adventurous journey from 2004 to 2009 had taught the fifth-largest toy-maker in the world - the LEGO Group - the importance of managing the global supply chain effectively. In order to survive the largest internal financial crisis in its roughly 70 years of existence......, the management had, among many initiatives, decided to offshore and outsource a major chunk of its production to Flextronics. In this pursuit of rapid cost-cutting sourcing advantages, the LEGO Group planned to license out as much as 80 per cent of its production besides closing down major parts...

  15. Informal groups

    NARCIS (Netherlands)

    E. van den Berg; P. van Houwelingen; J. de Hart

    2011-01-01

    Original title: Informele groepen Going out running with a group of friends, rather than joining an official sports club. Individuals who decide to take action themselves rather than giving money to good causes. Maintaining contact with others not as a member of an association, but through an

  16. Hygiene and sanitation among ethnic minorities in Northern Vietnam

    DEFF Research Database (Denmark)

    Rheinländer, Thilde; Samuelsen, Helle; Dalsgaard, Anders

    2010-01-01

    Improving sanitation and hygiene to prevent infectious diseases is of high priority in developing countries. This study attempts to gain in-depth understanding of hygiene and sanitation perceptions and practices among four Ethnic Minority Groups (EMGs) in a rural area of northern Vietnam. It is b......-based hygiene promotion is also recommended to curb dependency and spark initiatives in ethnic minority communities. Finally, interventions should focus on hygiene "software"--promoting hygiene behaviour changes known to effectively prevent hygiene related diseases.......Improving sanitation and hygiene to prevent infectious diseases is of high priority in developing countries. This study attempts to gain in-depth understanding of hygiene and sanitation perceptions and practices among four Ethnic Minority Groups (EMGs) in a rural area of northern Vietnam...

  17. Ecology and social system of northern gibbons living in cold seasonal forests.

    Science.gov (United States)

    Guan, Zhen-Hua; Ma, Chang-Yong; Fei, Han-Lan; Huang, Bei; Ning, Wen-He; Ni, Qing-Yong; Jiang, Xue-Long; Fan, Peng-Fei

    2018-07-18

    Gibbons in China represent the northernmost margin of present day gibbon species distribution (around N25°). Compared to tropical habitats, northern gibbon habitats are characterized by low temperatures and remarkable seasonal variation in fruit abundance. How gibbons adapt to their cold and seasonal habitats and what ecological factors affect their sociality are key questions for understanding their ecology and social system evolution, the elucidation of which will contribute to the conservation of these special populations/species. According to preliminary short-term studies, northern gibbons consume more leaves and use larger home ranges than tropical gibbons. Interestingly, some Nomascus groups consist of more than one adult female. However, these preliminary results are not well understood or incorporated into current socio-ecological theories regarding gibbon species. To better understand northern gibbons, our team has systematically studied three habituated groups of Nomascus concolor, three groups of N. nasutus, and two habituated groups of Hoolock tianxing since 2002. In this paper, we stress the challenges facing gibbons living in northern habitats and summarize their behavioral adaptations to their harsh environments. We also describe the northern gibbon social system and discuss the potential relationships between their ecology and sociality. Finally, we highlight future research questions related to northern gibbons in China.

  18. Ecology and social system of northern gibbons living in cold seasonal forests

    Directory of Open Access Journals (Sweden)

    Zhen-Hua Guan

    2018-07-01

    Full Text Available Gibbons in China represent the northernmost margin of present day gibbon species distribution (around N25°. Compared to tropical habitats, northern gibbon habitats are characterized by low temperatures and remarkable seasonal variation in fruit abundance. How gibbons adapt to their cold and seasonal habitats and what ecological factors affect their sociality are key questions for understanding their ecology and social system evolution, the elucidation of which will contribute to the conservation of these special populations/species. According to preliminary short-term studies, northern gibbons consume more leaves and use larger home ranges than tropical gibbons. Interestingly, some Nomascus groups consist of more than one adult female. However, these preliminary results are not well understood or incorporated into current socio-ecological theories regarding gibbon species. To better understand northern gibbons, our team has systematically studied three habituated groups of Nomascus concolor, three groups of N. nasutus, and two habituated groups of Hoolock tianxing since 2002. In this paper, we stress the challenges facing gibbons living in northern habitats and summarize their behavioral adaptations to their harsh environments. We also describe the northern gibbon social system and discuss the potential relationships between their ecology and sociality. Finally, we highlight future research questions related to northern gibbons in China.

  19. Etnografía de la infección respiratoria aguda en una zona rural del altiplano mexicano Ethnography of acute respiratory illnesses in a rural zone of the Mexican central highlands

    Directory of Open Access Journals (Sweden)

    HOMERO MARTÍNEZ

    1997-05-01

    Full Text Available Objetivo. Identificar los términos utilizados por las madres para referirse a enfermedades, signos y síntomas relacionados con infecciones respiratorias agudas, así como los signos de alarma que las motivan a buscar atención médica; asimismo, describir prácticas comunes de manejo de la enfermedad en el hogar. Material y métodos. Se trata de un estudio etnográfico en seis comunidades rurales del altiplano mexicano. Se entrevistó a 12 informantes clave, a seis madres de niños fallecidos por infección respiratoria aguda, y a 24 madres de niños menores de cinco años, con diversas técnicas etnográficas para complementar la información obtenida ("triangulación". Resultados. Las enfermedades comúnmente identificadas incluyeron gripa, anginas, tos, bronquitis, pulmonía, neumonía y "broncomonía". Los síntomas clave para el diagnóstico fueron escurrimiento de moco nasal, dolor de garganta, tos, dolor de cabeza o de cuerpo, calentura, "hervor" de pecho, y referencias a que el niño "está molesto o llorón", se pone morado o le hace falta el aire. La taquipnea fue referida como "respira fuerte", "respira mucho", "respira rápido" y "tiene sesido"; el tiraje, "se le hunde el pecho"; el estridor, como "quejido o ronquido de pecho"; la sibilancia, como "ronquido de pecho", y para la cianosis; "se pone morado". Entre los tratamientos ofrecidos en el hogar destacan el uso de tés, aplicación de limón, jitomate, tomate o papa en la garganta, y aplicación de sebo o pomada en pecho y espalda. No fue común la autoprescripción de antibióticos pero sí la de antipiréticos. La mayoría de las madres reconoció enfermedades leves y, en menor proporción, graves. Ante un caso grave de insuficiencia respiratoria aguda, la opción más frecuentemente elegida fue acudir a la clínica del proyecto; en segundo lugar al médico particular en la cabecera municipal, y al hospital de la Secretaría de Salud en la Jurisdicción. La cercanía y el

  20. Pteridophyta collected in Northern Nigeria and Northern Cameroon

    Directory of Open Access Journals (Sweden)

    Jan kornaś

    2014-01-01

    Full Text Available 25 species of Pteridophyta were collected in Northern Nigeria (mainly the Lake Chad Basin and the Mandara Mts. and in the neighbouring parts of Cameroon. 11 of them have not been recorded previously from this area: Isoetes schweinfurthii A. Br. in Bak., Selaginella tenerrima A. Br. ex Kuhn, Ophioglossum gomenzianum Welw. ex A. Br., Marsilea coromandeliana Willd., M. distorta A. Br., M. nubica A. Br., M. subterranea Lepr. ex A. Br., Azolla africana Desv., Ceratopteris richardii Brogn., Adiantum capillus-veneris Linn., and Actiniopleris semiflabellata Pic. Ser.

  1. INNOVATION POTENTIAL OF RUSSIAN NORTHERN REGIONS: DEVELOPMENT TRENDS

    Directory of Open Access Journals (Sweden)

    E.N. Berezikova

    2008-06-01

    Full Text Available In the work for the first time a methodology of complex evaluation of innovation potentials of the regions is proposed. As a result the index of innovation potentials of Russian northern regions was determined, and on its basis all regions are referred to groups corresponding their innovation rating. A system of measures on stimulation of innovation activities in regions has been proposed

  2. Conservation as development in Northern Australia: from policies to ethnography

    OpenAIRE

    Fache, Élodie

    2017-01-01

    Introduction Since the mid-1990s, “ranger” jobs, groups and programs have been established in many indigenous communities of Northern Australia. “Rangers” form a new category of Aboriginal social actors who are employed and paid to deliver environmental services through their activities that are generally described as “natural (and cultural) resource management”. Their role is presented as based on the formalisation and professionalisation of “traditional” responsibilities towards the land an...

  3. Squamate reptiles of the Atlantic Forest of northern Bahia, Brazil

    OpenAIRE

    de Freitas, Marco

    2014-01-01

    We present a list of squamate reptiles of the northern Atlantic forest of Bahia, Brazil, comprising a total of 29 municipalities. The study area was sampled opportunistically over more than 20 years resulting in a total of 482 specimens deposited in various herpetological collections. Of these, 314 were snakes belonging to 62 species and seven families, 42 were amphisbaenas belonging to five species in a single family and 125 specimens were lizards, grouped in 36 species and 12 families.

  4. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2011-01-01

    The CMS Communications Group, established at the start of 2010, has been busy in all three areas of its responsibility: (1) Communications Infrastructure, (2) Information Systems, and (3) Outreach and Education. Communications Infrastructure There are now 55 CMS Centres worldwide that are well used by physicists working on remote CMS shifts, Computing operations, data quality monitoring, data analysis and outreach. The CMS Centre@CERN in Meyrin, is the centre of the CMS offline and computing operations, hosting dedicated analysis efforts such as during the CMS Heavy Ion lead-lead running. With a majority of CMS sub-detectors now operating in a “shifterless” mode, many monitoring operations are now routinely performed from there, rather than in the main Control Room at P5. The CMS Communications Group, CERN IT and the EVO team are providing excellent videoconferencing support for the rapidly-increasing number of CMS meetings. In parallel, CERN IT and ...

  5. Group therapy

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: In his review 'Genesis of Unified Gauge Theories' at the symposium in Honour of Abdus Salam (June, page 23), Tom Kibble of Imperial College, London, looked back to the physics events around Salam from 1959-67. He described how, in the early 1960s, people were pushing to enlarge the symmetry of strong interactions beyond the SU(2) of isospin and incorporate the additional strangeness quantum number. Kibble wrote - 'Salam had students working on every conceivable symmetry group. One of these was Yuval Ne'eman, who had the good fortune and/or prescience to work on SU(3). From that work, and of course from the independent work of Murray Gell- Mann, stemmed the Eightfold Way, with its triumphant vindication in the discovery of the omega-minus in 1964.' Yuval Ne'eman writes - 'I was the Defence Attaché at the Israeli Embassy in London and was admitted by Salam as a part-time graduate student when I arrived in 1958. I started research after resigning from the Embassy in May 1960. Salam suggested a problem: provide vector mesons with mass - the problem which was eventually solved by Higgs, Guralnik, Kibble,.... (as described by Kibble in his article). I explained to Salam that I had become interested in symmetry. Nobody at Imperial College at the time, other than Salam himself, was doing anything in groups, and attention further afield was focused on the rotation - SO(N) - groups. Reacting to my own half-baked schemes, Salam told me to forget about the rotation groups he taught us, and study group theory in depth, directing me to Eugene Dynkin's classification of Lie subalgebras, about which he had heard from Morton Hamermesh. I found Dynkin incomprehensible without first learning about Lie algebras from Henri Cartan's thesis, which luckily had been reproduced by Dynkin in his 1946 thesis, using his diagram method. From a copy of a translation of Dynkin's thesis which I found in the British Museum Library, I

  6. Northern peatlands in global climatic change

    Energy Technology Data Exchange (ETDEWEB)

    Laiho, R.; Laine, J.; Vasander, H. [eds.] [Helsinki Univ. (Finland). Dept. of Forest Ecology

    1996-12-31

    Northern peatlands are important in regulating the global climate. While sequestering carbon dioxide, these peatlands release ca. 24-39 Tg methane annually to the atmosphere. This is 5-20 % of the annual anthropogenic methane emissions to the atmosphere. The greenhouse gas balance of peatlands may change as a consequence of water level draw-down after land-use change, or if summers become warmer and drier, as has been predicted for high latitudes after climatic warming. Subsequent emissions of methane would decrease, whereas emissions of carbon dioxide and nitrous oxide would increase. Within the Finnish Research Programme on Climate Change (SILMU), the research project `Carbon Balance of Peatlands and Climate Change` (SUOSILMU) has been under progress since 1990. It is a co-operative research project, with research groups from the Universities of Helsinki and Joensuu, the Finnish Forest Research Institute, the National Public Health Institute and the Finnish Environment Agency. The research consortium of this project organised a workshop entitled `Northern Peatlands in Global Climatic Change - Hyytiaelae Revisited` October 8-12, 1995. The main objective of the workshop was to review the state of the art of the carbon cycling research in natural and managed peatlands. The role of peatlands in the greenhouse effect, their response and feedback to the predicted climate change, and the consequences of land-use changes were assessed, and the future research needs were evaluated. The latest information on the role of peatlands in the atmospheric change was given in 50 posters and 4 key lectures. Results of SUOSILMU projects were demonstrated during a 1-day field excursion to one of the intensive study sites, Lakkasuo near Hyytiaelae

  7. The Northern Manitoba Mining Academy

    Science.gov (United States)

    Alexandre, Paul

    2017-04-01

    The Northern Manitoba Mining Academy (NMMA, miningacademy.ca) is a new educational institution located in Flin Flon, Manitoba. It is associated with the University College of the North and is specifically intended to serve the needs of the Northern Manitoban communities with regards to job creation by providing training in a variety of mining, construction, and exploration related areas. NMMA's mission is to provide innovative and responsible solutions for the creation of a knowledgeable, skilled, and sustainable workforce within a vibrant, mineral-rich resource industry. It facilitates strategic training initiatives and research activities in order to strengthen the social, economic, and environmental benefits of a robust mining and resources sector. In terms of education, NMMA offers its own programs, mostly short courses in health and safety, courses organized by the University College of the North (wilderness safety, prospecting, and exploration), and courses organized in association with provincial Industries-Based Safety Programs and Associations (a variety of construction-related trades). However, the programming is not limited to those courses already on the syllabus: the Academy operates on open-doors policy and welcomes people with their unique and diverse needs; it prides itself in its ability to tailor or create specific on-demand courses and deliver them locally in the North. The Northern Manitoba Mining Academy also provides access to its world-class facilities for field-based undergraduate courses, as well as graduate students and researchers doing field work. Full sample preparation facilities are offered to students and scientists in all natural and environmental sciences.

  8. Buddhism on the Border: Shan Buddhism and Transborder Migration in Northern Thailand

    OpenAIRE

    Murakami, Tadayoshi

    2012-01-01

    This paper examines the transformation of Shan Buddhism in the border area of Northern Thailand. Shan and other ethnic groups have a long history of migration between Northern Thailand and the Shan State of Myanmar; the migration continued even after the border was demarcated at the end of the nineteenth century. Recently, the migration has become unidirectional--from Myanmar to Thailand-- and the number of migrants is growing steadily. An anomalous situation exists in this area: a fluid bord...

  9. Northern communities sustainable energy initiative

    Energy Technology Data Exchange (ETDEWEB)

    Oltman, Ursula; Widmeyer, Scott; Moen, Harlan

    2010-09-15

    The Circumpolar North may provide the solution to the world's most urgent problems. Combining new technologies with the resources, opportunities and needs of the north, the Arctic region may become instrumental in promoting nature's ability to sequester natural carbons while supplying future energy demands to the world. With the technologies for efficiencies and CCS, the abundant supply of natural gas exists for an efficient northern network of electrical generating facilities in the circumpolar region. A symbiotic relationship between facilities can ensure dependable clean electricity and support East-West distribution of power across international time zones strategically connected to southern grids.

  10. Nature: a colour comparison between Northern South Africa and Northern Australia

    CSIR Research Space (South Africa)

    Baumbach, J

    2009-10-01

    Full Text Available During 1983 DSTO in Australia measured the reflectances of grass, trees and soil in northern Australia, using a custom-build spectroradiometer. During 2002 CSIR in South Africa performed similar measurements in northern South Africa, using a...

  11. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2010-01-01

    The CMS Communications Group, established at the start of 2010, has been strengthening the activities in all three areas of its responsibility: (1) Communications Infrastructure, (2) Information Systems, and (3) Outreach and Education. Communications Infrastructure The Communications Group has invested a lot of effort to support the operations needs of CMS. Hence, the CMS Centres where physicists work on remote CMS shifts, Data Quality Monitoring, and Data Analysis are running very smoothly. There are now 55 CMS Centres worldwide, up from just 16 at the start of CMS data-taking. The latest to join are Imperial College London, the University of Iowa, and the Università di Napoli. The CMS Centre@CERN in Meyrin, which is now full repaired after the major flooding at the beginning of the year, has been at the centre of CMS offline and computing operations, most recently hosting a large fraction of the CMS Heavy Ion community during the lead-lead run. A number of sub-detector shifts can now take pla...

  12. Group play

    DEFF Research Database (Denmark)

    Tychsen, Anders; Hitchens, Michael; Brolund, Thea

    2008-01-01

    Role-playing games (RPGs) are a well-known game form, existing in a number of formats, including tabletop, live action, and various digital forms. Despite their popularity, empirical studies of these games are relatively rare. In particular there have been few examinations of the effects of the v......Role-playing games (RPGs) are a well-known game form, existing in a number of formats, including tabletop, live action, and various digital forms. Despite their popularity, empirical studies of these games are relatively rare. In particular there have been few examinations of the effects...... of the various formats used by RPGs on the gaming experience. This article presents the results of an empirical study, examining how multi-player tabletop RPGs are affected as they are ported to the digital medium. Issues examined include the use of disposition assessments to predict play experience, the effect...... of group dynamics, the influence of the fictional game characters and the comparative play experience between the two formats. The results indicate that group dynamics and the relationship between the players and their digital characters, are integral to the quality of the gaming experience in multiplayer...

  13. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2011-01-01

    The CMS Communications Group has been busy in all three areas of its responsibility: (1) Communications Infrastructure, (2) Information Systems, and (3) Outreach and Education. Communications Infrastructure The 55 CMS Centres worldwide are well used by physicists working on remote CMS shifts, Computing operations, data quality monitoring, data analysis and outreach. The CMS Centre@CERN in Meyrin, is the centre of the CMS Offline and Computing operations, and a number of subdetector shifts can now take place there, rather than in the main Control Room at P5. A new CMS meeting room has been equipped for videoconferencing in building 42, next to building 40. Our building 28 meeting room and the facilities at P5 will be refurbished soon and plans are underway to steadily upgrade the ageing equipment in all 15 CMS meeting rooms at CERN. The CMS evaluation of the Vidyo tool indicates that it is not yet ready to be considered as a potential replacement for EVO. The Communications Group provides the CMS-TV (web) cha...

  14. Giant Reed Distribution - Northern California [ds333

    Data.gov (United States)

    California Natural Resource Agency — The Arundo Distribution layer is a compilation of Arundo donax observations in northern and central California, obtained from several sources, including Arundo...

  15. Herpetofauna Surveys, Northern California - 2010 [ds694

    Data.gov (United States)

    California Natural Resource Agency — We recorded all incidental herpetofauna encountered during visual encounter and dipnet surveys in northern California. Surveys took place from April 2, 2010 to...

  16. Groundwater management in northern Iraq

    Science.gov (United States)

    Stevanovic, Zoran; Iurkiewicz, Adrian

    2009-03-01

    Groundwater is vital and the sole resource in most of the studied region of northern Iraq. It has a significant role in agriculture, water supply and health, and the elimination of poverty in rural areas. Although Iraq is currently dramatically disturbed by complex political and socio-economic problems, in its northern part, i.e. the Kurdish-inhabited region, fast urbanization and economic expansion are visible everywhere. Monitoring and water management schemes are necessary to prevent aquifer over-exploitation in the region. Artificial recharge with temporary runoff water, construction of subsurface dams and several other aquifer management and regulation measures have been designed, and some implemented, in order to improve the water situation. Recommendations, presented to the local professionals and decision-makers in water management, include creation of Water Master Plans and Water User Associations, synchronization of drilling programmes, rehabilitation of the existing well fields, opening of new well fields, and the incorporation of new spring intakes in some areas with large groundwater reserves, as well as construction of numerous small-scale schemes for initial in situ water treatment where saline groundwater is present.

  17. Cult sites in northern Sweden

    Directory of Open Access Journals (Sweden)

    Stefan Brink

    1990-01-01

    Full Text Available The pagan cult in northern Sweden, i.e, Norrland, has for some decades been a neglected chapter in our history, a situation which unfortunately applies to Sweden as a whole, at least where onomastics are concerned. The aim is thus to deliver an overview of the evidence that we have of pre-Christian religious activities in these northern parts — in this aspect, onomastic material is nearly almost all we have got — and some general remarks about the conversion to the new Christian religion. The area of investigation is what in the (Swedish medieval period was known as Norrland. In other words, the part of Sweden considered here is modern Central Norrland. With our state of knowledge of today it is not so easy to pick out the place-names that have denoted some kind of pagan cult activity. The place-name material can be divided into: 1. Theoforic place-names 2. place-names denoting the site of a pagan cult, which do not however contain theoforic elements 3. place-names with a possible pagan cultic element.

  18. Geothermal conditions in Northern Switzerland

    International Nuclear Information System (INIS)

    Rybach, L.; Eugster, W.; Griesser, J.C.

    1987-01-01

    The geothermal field in northern Switzerland, derived from a great number of borehole temperature measurements, is characterized by a strongly positive temperature gradient and heat flow anomaly (>150 mW/m 2 ) in the lower Aare valley. The anomaly is centered above the recently discovered Permocarboniferous trough. Several possibilities to explain the anomaly (thermal disturbance in the mantle, cooling shallow intrusion, locally strong uplift/erosion, local contrasts in petrophysical properties) can be ruled out on the basis of model calculations. Uprising deep groundwater is favoured as the mechanism creating the observed anomaly. Deep groundwater circulation was investigated in detail, especially to clarify the hydraulic role of the Permocarboniferous trough, by coupled thermo-hydraulic modelling, using the integrated finite difference technique. The model was carefully validated by field data. The results reveal the draining effect of the Permocarboniferous trough and indicate that vertical permeability is present in the vicinity of the trough even at depths of several kilometers. They further imply that large parts of the crystalline basement in northern Switzerland have average hydraulic conductivities >10 -9 m/sec and that Darcy velocities in the order of 10 mm/year must be expected. (author) 24 refs., 4 figs., 1 tab

  19. 137Cs in the population of northern Sweden

    International Nuclear Information System (INIS)

    Aagren, G.; Bjoereland, A.; Johansson, Lennart.

    1996-12-01

    The activity of Cs 137 has been studied in several different population groups in northern Sweden after the Chernobyl accident. Special attention has been given to the Saami (Lapp) population from which we have measured a group of volunteers regularly between 1986 and 1990. In 1991 we started a study on randomly chosen groups from the general population and members of the Saami communities from three regions in northern Sweden with different deposition levels. The results from these measurements have shown an effective half-time of Cs whole-body content in the Saami groups of about five years. The measurements in 1996 show decreasing levels of activities in the different population groups with half-times between 4 and 12 years. Another exposed group is breast-fed babies. We have measured the transfer of Cs from mother to baby via the breast milk in 12 cases. The activity in breast milk was measured to be 14% of the activity in the mother (calculated using specific activity - Bq/kg). The corresponding activity in the baby was 90% of the activity in the mother. 13 refs

  20. Dust Allergens within Rural Northern Rocky Mountain Residences.

    Science.gov (United States)

    Weiler, Emily; Semmens, Erin; Noonan, Curtis; Cady, Carol; Ward, Tony

    2015-01-23

    To date, few studies have characterized allergens within residences located in rural areas of the northern Rocky Mountain region. In this study, we collected dust samples from 57 homes located throughout western Montana and northern Idaho. Dust samples were collected and later analyzed for dust mite allergens Der f 1 and Der p 1 , Group 2 mite allergens ( Der p 2 and Der f 2 ), domestic feline ( Fel d 1 ), and canine ( Can f 1 ). Indoor temperature and humidity levels were also measured during the sampling program, as were basic characteristics of each home. Dog (96%) and cat (82%) allergens were the most prevalent allergens found in these homes (even when a feline or canine did not reside in the home). Results also revealed the presence of dust mites. Seven percent (7%) of homes tested positive for Der p 1 , 19% of homes were positive for Der f 1 , and 5% of homes were positive for the Group 2 mite allergens. Indoor relative humidity averaged 27.0 ± 7.6% within the homes. Overall, humidity was not significantly associated with dust mite presence, nor was any of the other measured home characteristics. This study provides a descriptive assessment of indoor allergen presence (including dust mites) in rural areas of the northern Rocky Mountains, and provides new information to assist regional patients with reducing allergen exposure using in-home intervention strategies.

  1. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2010-01-01

    The recently established CMS Communications Group, led by Lucas Taylor, has been busy in all three of its main are areas of responsibility: Communications Infrastructure, Information Systems, and Outreach and Education Communications Infrastructure The damage caused by the flooding of the CMS Centre@CERN on 21st December has been completely repaired and all systems are back in operation. Major repairs were made to the roofs, ceilings and one third of the floor had to be completely replaced. Throughout these works, the CMS Centre was kept operating and even hosted a major press event for first 7 TeV collisions, as described below. Incremental work behind the scenes is steadily improving the quality of the CMS communications infrastructure, particularly Webcasting, video conferencing, and meeting rooms at CERN. CERN/IT is also deploying a pilot service of a new videoconference tool called Vidyo, to assess whether it might provide an enhanced service at a lower cost, compared to the EVO tool currently in w...

  2. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2011-01-01

    Communications Infrastructure The 55 CMS Centres worldwide are well used by physicists working on remote CMS shifts, Computing operations, data quality monitoring, data analysis and outreach. The CMS Centre@CERN in Meyrin is particularly busy at the moment, hosting about 50 physicists taking part in the heavy-ion data-taking and analysis. Three new CMS meeting room will be equipped for videoconferencing in early 2012: 40/5B-08, 42/R-031, and 28/S-029. The CMS-TV service showing LHC Page 1, CMS Page 1, etc. (http://cmsdoc.cern.ch/cmscc/projector/index.jsp) is now also available for mobile devices: http://cern.ch/mcmstv. Figure 12: Screenshots of CMS-TV for mobile devices Information Systems CMS has a new web site: (http://cern.ch/cms) using a modern web Content Management System to ensure content and links are managed and updated easily and coherently. It covers all CMS sub-projects and groups, replacing the iCMS internal pages. It also incorporates the existing CMS public web site (http:/...

  3. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2012-01-01

      Outreach and Education We are fortunate that our research has captured the public imagination, even though this inevitably puts us under the global media spotlight, as we saw with the Higgs seminar at CERN in December, which had 110,000 distinct webcast viewers. The media interest was huge with 71 media organisations registering to come to CERN to cover the Higgs seminar, which was followed by a press briefing with the DG and Spokespersons. This event resulted in about 2,000 generally positive stories in the global media. For this seminar, the CMS Communications Group prepared up-to-date news and public material, including links to the CMS results, animations and event displays [http://cern.ch/go/Ch8thttp://cern.ch/go/Ch8t]. There were 44,000 page-views on the CMS public website, with the Higgs news article being by far the most popular item. CMS event displays from iSpy are fast becoming the iconic media images, featuring on numerous major news outlets (BBC, CNN, MSN...) as well as in the sci...

  4. TPMG Northern California appointments and advice call center.

    Science.gov (United States)

    Conolly, Patricia; Levine, Leslie; Amaral, Debra J; Fireman, Bruce H; Driscoll, Tom

    2005-08-01

    Kaiser Permanente (KP) has been developing its use of call centers as a way to provide an expansive set of healthcare services to KP members efficiently and cost effectively. Since 1995, when The Permanente Medical Group (TPMG) began to consolidate primary care phone services into three physical call centers, the TPMG Appointments and Advice Call Center (AACC) has become the "front office" for primary care services across approximately 89% of Northern California. The AACC provides primary care phone service for approximately 3 million Kaiser Foundation Health Plan members in Northern California and responds to approximately 1 million calls per month across the three AACC sites. A database records each caller's identity as well as the day, time, and duration of each call; reason for calling; services provided to callers as a result of calls; and clinical outcomes of calls. We here summarize this information for the period 2000 through 2003.

  5. Soil carbon stock change following afforestation in Northern Europe

    DEFF Research Database (Denmark)

    Bárcena, Teresa G; Kiær, Lars Pødenphant; Vesterdal, Lars

    2014-01-01

    of forest age, former land-use, forest type, and soil textural class. Three major improvements were incorporated in the meta-analysis: analysis of major interaction groups, evaluation of the influence of nonindependence between samples according to study design, and mass correction. Former land use......Northern Europe supports large soil organic carbon (SOC) pools and has been subjected to high frequency of land-use changes during the past decades. However, this region has not been well represented in previous large-scale syntheses of land-use change effects on SOC, especially regarding effects...... of afforestation. Therefore, we conducted a meta-analysis of SOC stock change following afforestation in Northern Europe. Response ratios were calculated for forest floors and mineral soils (0–10 cm and 0–20/30 cm layers) based on paired control (former land use) and afforested plots. We analyzed the influence...

  6. Biogeographic implications of small mammals from Northern Highlands in Tanzania with first data from the volcanic Mount Kitumbeine

    Czech Academy of Sciences Publication Activity Database

    Sabuni, C.; Aghová, Tatiana; Bryjová, Anna; Šumbera, R.; Bryja, Josef

    (2018) ISSN 0025-1461 Institutional support: RVO:68081766 Keywords : biogeography * Crocidura montis group * cytochrome b * Lophuromys * montane habitats * Northern Highlands of Tanzania Subject RIV: EG - Zoology Impact factor: 0.805, year: 2016

  7. The Alcoholism Situation in a Northern City

    Science.gov (United States)

    Martynov, M. Iu.; Martynova, D. Iu.

    2012-01-01

    Alcohol abuse in Russia has been increasing in recent years, especially in northern regions, as has the incidence of alcohol-related disease rates. A survey was conducted in Surgut (the Khanty-Mansi autonomous okrug) that determined the factors lending to the prevalence of alcohol abuse among the population of the northern city and assessed the…

  8. African Journals Online: Northern Mariana Islands

    African Journals Online (AJOL)

    African Journals Online: Northern Mariana Islands. Home > African Journals Online: Northern Mariana Islands. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Browse By Category · Browse Alphabetically · Browse By Country · List All Titles · Free to read Titles This ...

  9. Sowing pregerminated northern red oak acorns

    Science.gov (United States)

    Richard M. Godman; Gilbert A. Mattson

    1992-01-01

    Northern red oak is extremely difficult to regenerate, although it has produced good acorn crops nearly half of the last 32 years in northern Wisconsin. Field trials have shown that for successful seeding, you must protect acorns from predation by wildlife and sow them when temperatures are most favorable for germination.

  10. Environmental overview of geothermal development: northern Nevada

    Energy Technology Data Exchange (ETDEWEB)

    Slemmons, D.B.; Stroh, J.M.; Whitney, R.A. (eds.)

    1980-08-01

    Regional environmental problems and issues associated with geothermal development in northern Nevada are studied to facilitate environmental assessment of potential geothermal resources. The various issues discussed are: environmental geology, seismicity of northern Nevada, hydrology and water quality, air quality, Nevada ecosystems, noise effects, socio-economic impacts, and cultural resources and archeological values. (MHR)

  11. Harvesting systems for the northern forest hardwoods

    Science.gov (United States)

    Chris B. LeDoux

    2011-01-01

    This monograph is a summary of research results and environmental compliance measures for timber harvesting operations. Data are presented from the Northern Research Station's forest inventory and analysis of 20 states in the northern forest hardwoods. Harvesting systems available in the region today are summarized. Equations for estimating harvesting costs are...

  12. Northern Security and Global Politics

    DEFF Research Database (Denmark)

    This book takes a comprehensive approach to security in the Nordic-Baltic region, studying how this region is affected by developments in the international system. The advent of the new millennium coincided with the return of the High North to the world stage. A number of factors have contributed......-unipolar", indicating a period of flux and of declining US unipolar hegemony. Drawing together contributions from key thinkers in the field, Northern Security and Global Politics explores how this situation has affected the Nordic-Baltic area by addressing two broad sets of questions. First, it examines what impact...... declining unipolarity - with a geopolitical shift to Asia, a reduced role for Europe in United States policy, and a more assertive Russia - will have on regional Nordic-Baltic security. Second, it takes a closer look at how the regional actors respond to these changes in their strategic environment...

  13. TSUNAMI HAZARD IN NORTHERN VENEZUELA

    Directory of Open Access Journals (Sweden)

    B. Theilen-Willige

    2006-01-01

    Full Text Available Based on LANDSAT ETM and Digital Elevation Model (DEM data derived by the Shuttle Radar Topography Mission (SRTM, 2000 of the coastal areas of Northern Venezuela were investigated in order to detect traces of earlier tsunami events. Digital image processing methods used to enhance LANDSAT ETM imageries and to produce morphometric maps (such as hillshade, slope, minimum and maximum curvature maps based on the SRTM DEM data contribute to the detection of morphologic traces that might be related to catastrophic tsunami events. These maps combined with various geodata such as seismotectonic data in a GIS environment allow the delineation of coastal regions with potential tsunami risk. The LANDSAT ETM imageries merged with digitally processed and enhanced SRTM data clearly indicate areas that might be prone by flooding in case of catastrophic tsunami events.

  14. Increasing Northern Hemisphere water deficit

    Science.gov (United States)

    McCabe, Gregory J.; Wolock, David M.

    2015-01-01

    A monthly water-balance model is used with CRUTS3.1 gridded monthly precipitation and potential evapotranspiration (PET) data to examine changes in global water deficit (PET minus actual evapotranspiration) for the Northern Hemisphere (NH) for the years 1905 through 2009. Results show that NH deficit increased dramatically near the year 2000 during both the cool (October through March) and warm (April through September) seasons. The increase in water deficit near 2000 coincides with a substantial increase in NH temperature and PET. The most pronounced increases in deficit occurred for the latitudinal band from 0 to 40°N. These results indicate that global warming has increased the water deficit in the NH and that the increase since 2000 is unprecedented for the 1905 through 2009 period. Additionally, coincident with the increase in deficit near 2000, mean NH runoff also increased due to increases in P. We explain the apparent contradiction of concurrent increases in deficit and increases in runoff.

  15. Ultraviolet resources over Northern Eurasia.

    Science.gov (United States)

    Chubarova, Natalia; Zhdanova, Yekaterina

    2013-10-05

    We propose a new climatology of UV resources over Northern Eurasia, which includes the assessments of both detrimental (erythema) and positive (vitamin D synthesis) effects of ultraviolet radiation on human health. The UV resources are defined by using several classes and subclasses - UV deficiency, UV optimum, and UV excess - for 6 different skin types. To better quantifying the vitamin D irradiance threshold we accounted for an open body fraction S as a function of effective air temperature. The spatial and temporal distribution of UV resources was estimated by radiative transfer (RT) modeling (8 stream DISORT RT code) with 1×1° grid and monthly resolution. For this purpose special datasets of main input geophysical parameters (total ozone content, aerosol characteristics, surface UV albedo, UV cloud modification factor) have been created over the territory of Northern Eurasia. The new approaches were used to retrieve aerosol parameters and cloud modification factor in the UV spectral region. As a result, the UV resources were obtained for clear-sky and mean cloudy conditions for different skin types. We show that the distribution of UV deficiency, UV optimum and UV excess is regulated by various geophysical parameters (mainly, total ozone, cloudiness and open body fraction) and can significantly deviate from latitudinal dependence. We also show that the UV optimum conditions can be simultaneously observed for people with different skin types (for example, for 4-5 skin types at the same time in spring over Western Europe). These UV optimum conditions for different skin types occupy a much larger territory over Europe than that over Asia. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Data selector group sequencer interface

    International Nuclear Information System (INIS)

    Zizka, G.; Turko, B.

    1984-01-01

    A CAMAC-based module for high rate data selection and transfer to Tracor Northern TN-1700 multichannel analysis system is described. The module can select any group of 4096 consecutive addresses of events, in the range of 24 bits. This module solves the problem of connecting a number of time digitizing systems to the memory of a multichannel analyzer. Continuous processing rate up to 200,000 events per second along with the live display make the testing of the above systems very efficient and relatively inexpensive. The module also can be programmed for storing the preset group of addresses into more than one section of the memory. The events are analyzed in each section of the memory during the preset time. Multiple spectra can thus be taken automatically in a sequence

  17. Case studies: Northern Saskatchewan, Canada

    International Nuclear Information System (INIS)

    2009-01-01

    Northern Saskatchewan comprises an area of about 350 000 km 2 . In 1951 the population was 11 000 people but by 2003 it was approaching 40 000, of whom about 87% are aboriginal, consisting of either First Nations or Metis people. The first uranium mining area developed in northern Saskatchewan was Uranium City, north of Lake Athabasca. These first mines started production in the early 1950s. Of the 10 producing mines, only Eldorado Nuclear remained in operation after 1965. The development of Uranium City, including better services such as a hospital, drew some aboriginals into the area. There was some aboriginal employment in the early mines but, with few exceptions, these employees only stayed a short time. The mining companies developed training programmes to prepare aboriginals for regular, wage earning jobs. This included lifestyle training such as how to manage personal finances. Further extensive training programmes were required on the job to help these employees become fully contributing members of the workforce, who could advance in their jobs, expand their job opportunities and earnings, and in order to reduce turnover. The question of accommodating mine staff is a complex one, including several options. The first option, a company town, can be developed adjacent to the mine site. It is owned by the company and accommodates everyone who works at the mine and in its service industries. This can result in lower cost accommodation for mine staff with the benefit of no personal capital investment that cannot be recouped after mine closure. The capital cost to the mining company is higher; there is an administrative cost to managing and maintaining many houses, apartments and bunkhouses, and the decommissioning problem at the end of mine life is bigger. Initial developments in northern Saskatchewan were based on the company town concept. At the time there were 25 or more advanced exploration projects in the Uranium City area, 10 of which developed into

  18. Mass coral bleaching in the northern Persian Gulf, 2012

    Directory of Open Access Journals (Sweden)

    Javid Kavousi

    2014-09-01

    Full Text Available Coral bleaching events due to elevated temperatures are increasing in both frequency and magnitude worldwide. Mass bleaching was recorded at five sites in the northern Persian Gulf during August and September 2012. Based on available seawater temperature data from field, satellite and previous studies, we suggest that the coral bleaching threshold temperature in the northern Persian Gulf is between 33.5 and 34°C, which is about 1.5 to 2.5°C lower than that in the southern part. To assess the bleaching effects, coral genera counted during 60-minute dives were categorized into four groups including healthy, slightly bleached ( 50% bleached tissue and fully bleached colonies. The anomalously high sea surface temperature resulted in massive coral bleaching (~84% coral colonies affected. Acropora spp. colonies, which are known as the most vulnerable corals to thermal stress, were less affected by the bleaching than massive corals, such as Porites, which are among the most thermo-tolerant corals. Turbid waters, suggested as coral refugia against global warming, did not protect corals in this study since most affected corals were found in the most turbid waters. The 2012 bleaching in the northern Persian Gulf was relatively strong from the viewpoint of coral bleaching severity. Long-term monitoring is needed to understand the actual consequences of the bleaching event on the coral reefs and communities.

  19. Oligocene paleogeography of the northern Great Plains and adjacent mountains

    International Nuclear Information System (INIS)

    Seeland, D.

    1985-01-01

    Early Oligocene paleogeography of the northern Great Plains and adjacent mountains is inferred in part from published surface and subsurface studies of the pre-Oligocene surface. These studies are combined with published and unpublished information on clast provenance, crossbedding orientation, and Eocene paleogeography. The Oligocene Arctic Ocean-Gulf of Mexico continental divide extended from the southern Absaroka Mountains east along the Owl Creek Mountains, across the southern Powder River Basin, through the northern Black Hills, and eastward across South Dakota. Streams north of the divide flowed northeastward. The Olligocene White River Group contains 50 to 90 percent airfall pyroclastic debris from a northern Great Basin source. Most of the uranium deposits of the region in pre-Oligocene rocks can be related to a uranium source in the volcanic ash of the White River; in many places the pre-Oligocene deposits can be related to specific Oligocene channels. Uranium deposits in sandstones of major Oligocene rivers are an important new type of deposit. The Oligocene channel sandstones also contain small quantities of gold, molybdenum, gas, and oil

  20. Peatmoss (Sphagnum) diversification associated with Miocene Northern Hemisphere climatic cooling?

    Science.gov (United States)

    Shaw, A Jonathan; Devos, Nicolas; Cox, Cymon J; Boles, Sandra B; Shaw, Blanka; Buchanan, Alex M; Cave, Lynette; Seppelt, Rodney

    2010-06-01

    Global climate changes sometimes spark biological radiations that can feed back to effect significant ecological impacts. Northern Hemisphere peatlands dominated by living and dead peatmosses (Sphagnum) harbor almost 30% of the global soil carbon pool and have functioned as a net carbon sink throughout the Holocene, and probably since the late Tertiary. Before that time, northern latitudes were dominated by tropical and temperate plant groups and ecosystems. Phylogenetic analyses of mosses (phylum Bryophyta) based on nucleotide sequences from the plastid, mitochondrial, and nuclear genomes indicate that most species of Sphagnum are of recent origin (ca. Sphagnum species are not only well-adapted to boreal peatlands, they create the conditions that promote development of peatlands. The recent radiation that gave rise to extant diversity of peatmosses is temporally associated with Miocene climatic cooling in the Northern Hemisphere. The evolution of Sphagnum has had profound influences on global biogeochemistry because of the unique biochemical, physiological, and morphological features of these plants, both while alive and after death. 2010 Elsevier Inc. All rights reserved.

  1. Gold and gold working in Late Bronze Age Northern Greece

    Science.gov (United States)

    Vavelidis, M.; Andreou, S.

    2008-04-01

    Numerous objects of gold displaying an impressive variety of types and manufacturing techniques are known from the Late Bronze Age (LBA) contexts of Mycenaean Greece, but very little is known about the origin and processing of gold during the second millennium b.c. Ancient literature and recent research indicate that northern Greece is probably the richest gold-bearing region in Greece, and yet, very little evidence exists regarding the exploitation of its deposits and the production as well as use of gold in the area during prehistory. The unusual find of a group of small stone crucibles at the prehistoric settlement of Thessaloniki Toumba, one with visible traces of gold melting, proves local production and offers a rare opportunity to examine the process of on-site gold working. Furthermore, the comparison of the chemical composition of prehistoric artefacts from two settlements with those of gold deposits in their immediate areas supports the local extraction of gold and opens up the prospect for some of the Mycenaean gold to have originated in northern Greece. The scarcity of gold items in northern Greek LBA contexts may not represent the actual amount of gold produced and consumed, but could be a result of the local social attitudes towards the circulation and deposition of artefacts from precious metals.

  2. Community-based study on intracerebral hemorrhage in northern Hokkaido. Northern Hokkaido Stroke Study (NOHSS)

    International Nuclear Information System (INIS)

    Sako, Kazuhiro; Shirai, Wakako; Tokumitu, Naoki; Aizawa, Shizuka

    2008-01-01

    A survey on stroke was conducted to evaluate the incidence of intracerebral hemorrhage and the prevalence of risk factors. The subjects, comprising those patients who suffesed a stroke, were registered on the Northern Hokkaido Stroke Study between July 2002 and June 2006. The severity of their illness was rated by the National Institutes of Health Stroke Scale (NIHSS) at hospital admission, while their outcome was determined by the mortality within 3 months and the mRS (modified Rankin Scale score). Of the 1,046 registered stroke patients, 271 (25.9%) were found to suffer from cerebral hemorrhage. Their mean age was 70.3±11.7 years; male-to-female ratio, 154/117; mean NIHSS at admission, 11.8±8.1; mortality within 3 months, 19.2%; and percentage who regained independence within 3 months (mRS: ≤2), 32.5%. A history of hypertension was found in 72.6%, and 13.7% had no treatment. MRI (T2*) revealed micro-hemorrhage outside the lesions in 67.5%. Forty-seven patients (17.3%) were taking anti-platelet agents at the onset of intracerebral hemorrhage. There was no significant difference between the mortalities of the anti-platelet-agent-users and non-users but the percentage of those regaining independence within 3 months was 19.1% for the users against 37.3% for the non-users (p=0.0177), with a significantly poor outcome in the user group. In northern Hokkaido, the incidence of cerebral hemorrhage remains high, and the percentage of those with poorly controlled or uncontrolled hypertension was 30%. These findings suggest a need to educate not only the inhabitants themselves but also the physicians engaged in their care. (author)

  3. Roman whetstone production in northern Gaul (Belgium and northern France

    Directory of Open Access Journals (Sweden)

    Aurélie Thiébaux

    2016-10-01

    Full Text Available This paper focuses on the latest research on the production of Roman whetstones in northern Gaul. To date, little has been written about this specialised industry. However, three workshops producing whetstones were discovered recently in the north of Gaul in Buizingen (Province of Flemish Brabant, Belgium, Nereth (Province of Liège, Belgium and Le Châtelet-sur-Sormonne (Department of Ardennes, France. Production debris and rough-outs recovered at these sites allowed us to reconstruct the operational sequence of manufacture, from the choice of raw material to the finished product. Technological studies enabled us to determine the production stages and highlight the similarities and differences between the three study areas. Analyses of the materials reveal the use of fine-grained sedimentary and low-grade metamorphic rocks outcropping near the workshops. All these rocks are linked to the Caledonian inliers of Brabant-London, Stavelot-Venn, and Rocroi. The large amount of waste found at Le Châtelet-sur-Sormonne, far more than that recovered at Buizingen and Nereth, is indicative of the economic importance of this whetstone workshop. This importance is reflected in the fact that whetstones from Le Châtelet-sur-Sormonne are distributed over a large area throughout Belgium, France (Nord-Pas-de-Calais, Picardie and Champagne-Ardenne regions, Germany, and the Netherlands. This paper presents the waste and rough-outs from the three production sites. It also defines rock types and their origins and offers insights into whetstone manufacturing processes and techniques.

  4. Consuming fire ants reduces northern bobwhite survival and weight gain

    Science.gov (United States)

    Myers, P.E.; Allen, Craig R.; Birge, Hannah E.

    2014-01-01

    Northern bobwhite quail, Colinus virginianus (L.) (Galliformes: Odontophoridae), population declines are well documented, but pinpointing the reasons for these decreases has proven elusive. Bobwhite population declines are attributed primarily to loss of habitat and land use changes. This, however, does not entirely explain population declines in areas intensively managed for bobwhites. Although previous research demonstrates the negative impact of red imported fire ant (Solenopsis invicta Buren) (Hymenoptera: Formicidae) on northern bobwhites, the mechanisms underlying this effect are largely unknown. To meet the protein demands of early growth and development, bobwhite chicks predominantly consume small insects, of which ants are a substantial proportion. Fire ants alter ant community dynamics by often reducing native ant diversity and abundance while concurrently increasing the abundance of individuals. Fire ants have negative effects on chicks, but they are also a large potential protein source, making it difficult to disentangle their net effect on bobwhite chicks. To help investigate these effects, we conducted a laboratory experiment to understand (1) whether or not bobwhites consume fire ants, and (2) how the benefits of this consumption compare to the deleterious impacts of bobwhite chick exposure to fire ants. Sixty bobwhite chicks were separated into two groups of 30; one group was provided with starter feed only and the second group was provided with feed and fire ants. Bobwhite chicks were observed feeding on fire ants. Chicks that fed on fire ants had reduced survival and weight gain. Our results show that, while fire ants increase potential food sources for northern bobwhite, their net effect on bobwhite chicks is deleterious. This information will help inform land managers and commercial bobwhite rearing operations.

  5. Northern star J.S. Plaskett

    CERN Document Server

    Broughton, R Peter

    2018-01-01

    Northern Star explores Plaskett's unorthodox and fascinating life from his rural roots near Woodstock through his days as a technician at the University of Toronto to his initiation in astronomy at the Dominion Observatory in Ottawa.

  6. Northern Pintail - Flight Path Telemetry [ds117

    Data.gov (United States)

    California Natural Resource Agency — North-south flight paths of radio-tagged female northern pintails were monitored in a section of Highway 152 near Los Banos, California during 4 and 11 November and...

  7. Northern California 6 arc-second DEM

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The 6-second Northern California Elevation Grid provides bathymetric data in ASCII raster format of 6-second resolution in geographic coordinates. This grid is...

  8. Northern California 36 arc-second DEM

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The 36-second Northern California Elevation Grid provides bathymetric data in ASCII raster format of 36-second resolution in geographic coordinates. This grid is...

  9. Child malnutrition in Tigray, Northern Ethiopia

    NARCIS (Netherlands)

    Mulugeta, A.; Hagos, F.; Kruseman, G.; Linderhof, V.G.M.; Stroecker, B.; Abraha, Z.; Yohannes, M.; Samuel, G.G.

    2010-01-01

    Objective: Estimate levels of and identify factors contributing to child malnutrition in Tigray, Northern Ethiopia. Design: Cross-sectional survey. Setting: Rural communities from four zones of Tigray. Subjects: Three hundred and eighteen under five children representing 587 randomly selected

  10. War and reconstruction in northern Mozambique

    OpenAIRE

    Tilman Bruck

    2006-01-01

    The article discusses some of the economic effects of war in northern Mozambique. It indicates how the historical and structural features of the economy of northern Mozambique restricted post-war reconstruction and post-war poverty alleviation. These features include the dominance of only a few cash crops for export, the absence of much rural trading, poor communication infrastructure, and weak political and state institutions. The specific nature of the internal war further weakened the stat...

  11. Groundwater quality in the Northern Coast Ranges Basins, California

    Science.gov (United States)

    Mathany, Timothy M.; Belitz, Kenneth

    2015-01-01

    The Northern Coast Ranges (NOCO) study unit is 633 square miles and consists of 35 groundwater basins and subbasins (California Department of Water Resources, 2003; Mathany and Belitz, 2015). These basins and subbasins were grouped into two study areas based primarily on locality. The groundwater basins and subbasins located inland, not adjacent to the Pacific Ocean, were aggregated into the Interior Basins (NOCO-IN) study area. The groundwater basins and subbasins adjacent to the Pacific Ocean were aggregated into the Coastal Basins (NOCO-CO) study area (Mathany and others, 2011).

  12. Bird diversity in northern Myanmar and conservation implications.

    Science.gov (United States)

    Zhang, Ming-Xia; Kyaw, Myint; Li, Guo-Gang; Zhao, Jiang-Bo; Zeng, Xiang-Le; Swa, Kyaw; Quan, Rui-Chang

    2017-09-18

    We conducted four bird biodiversity surveys in the Putao area of northern Myanmar from 2015 to 2017. Combined with anecdotal information collected between 2012 and 2015, we recorded 319 bird species, including two species ( Arborophila mandellii and Lanius sphenocercus ) previously unrecorded in Myanmar. Bulbuls (Pycnonotidae), babblers (Timaliidae), pigeons and doves (Columbidae), and pheasants and partridges (Phasianidae) were the most abundant groups of birds recorded. Species richness below 1 500 m a. s. l. was higher than species richness at higher elevations. Our results suggest that the current protected areas in this region should be expanded to lower elevations to cover critical conservation gaps.

  13. Bird diversity in northern Myanmar and conservation implications

    Science.gov (United States)

    Zhang, Ming-Xia; Kyaw, Myint; Li, Guo-Gang; Zhao, Jiang-Bo; Zeng, Xiang-Le; Swa, Kyaw; Quan, Rui-Chang

    2017-01-01

    We conducted four bird biodiversity surveys in the Putao area of northern Myanmar from 2015 to 2017. Combined with anecdotal information collected between 2012 and 2015, we recorded 319 bird species, including two species (Arborophila mandellii and Lanius sphenocercus) previously unrecorded in Myanmar. Bulbuls (Pycnonotidae), babblers (Timaliidae), pigeons and doves (Columbidae), and pheasants and partridges (Phasianidae) were the most abundant groups of birds recorded. Species richness below 1 500 m a. s. l. was higher than species richness at higher elevations. Our results suggest that the current protected areas in this region should be expanded to lower elevations to cover critical conservation gaps. PMID:29181901

  14. Clerical "concubines" in northern Italy during the fourteenth century.

    Science.gov (United States)

    Cossar, Roisin

    2011-01-01

    This essay reconstructs the lives of a neglected group of women in the Christian church during the later Middle Ages. So-called clerical “concubines” were well-known in their communities, but their lived experience has been largely ignored by modern historians. Yet studying clerical concubines sheds light not only on the women themselves, but also on the social organization of the medieval Christian church. Drawing on information gathered from notarial acts across the northern Italian peninsula, I argue that concubines were not a unitary group. Their experiences varied instead according to their status and the regions they inhabited. For instance, while laywomen who became priests’ concubines moved into their lovers’ homes, nuns retained cells in their religious houses during these relationships. Furthermore, concubines in cities such as Treviso could openly live with their lovers and share their property, while in other places, such as Bergamo, severe legal restrictions on concubines made them a particularly vulnerable group.

  15. Radiocesium in reindeer breeders in Northern Norway since 1965

    International Nuclear Information System (INIS)

    Selnaes, T.D.; Strand, P.

    1995-01-01

    Reindeer breeders in Kautokeino, Northern Norway, have been monitored for whole body content of 137 Cs every years since 1965. The group was chosen because of it's large intake of reindeer meat (65 kg/year). The same group has been monitored throughout the years. Some supplements have been made, to maintain the average age within the group. Whole body countings have been performed with a scintillation detector and i single- or multichannel analyzer. The highest values were monitored in 1966, when the average body content of 137 Cs was 39,500 Bq for men, and 18,600 Bq for women. Whole body contents are today around 2,000 Bq, giving a calculated whole body dose of 0.1 mSv/year. 5 refs., 4 figs

  16. Biodegradability of northern crude oil

    Energy Technology Data Exchange (ETDEWEB)

    Cook, F D; Westlake, D W.S.

    1976-01-01

    Field studies on the microbiological degradation of crude oils encompassed the placing of oil-soaked plots in two areas in the Northwest Territories and Alberta. Replicate plots received amendments of fertilizer, oil-utilizing bacteria, fertilizer plus bacteria or were untreated except for the oil. Changes in microbial numbers and chemical composition of recovered oil were determined periodically. The initial stimulatory effect on bacterial numbers brought about by the addition of fertilizers to oil-soaked plots diminished two years after the application to a point where the differences were no longer significant. Experiments carried out in the Norman Wells area to determine the effect of the amount of fertilizer applied on oil degradation have yielded inconclusive results. The data suggest that at least 2.7 kg of urea-phosphate fertilizer per kl of oil is required to maintain a reasonable oil degradation rate. Preliminary studies on the use of fertilizer coated with chemicals to increase its hydrophobic character indicate that they could be useful in treating wet-land oil spills. Soils from the McKenzie River drainage basin indicate that bacteria are present which can use oil under mesophilic conditions. However, the ability to use the same oil under psychrophilic conditions is more restricted. At least one bacterial species from each mixed population studied was capable of bringing about chemical changes in oil similar to those observed for the original mixed culture. The potential hazards and uses of the seeding of oil spills is discussed relative to the environmental conditions found in the northern part of Canada. 35 refs., 2 figs., 15 tabs.

  17. Serosurvey of antibodies against spotted fever group Rickettsia spp. in horse farms in Northern Paraná, Brazil Soroprevalência de anticorpos contra Rickettsia spp. do grupo febre maculosa em equinos de haras no Norte do Paraná, Brasil

    Directory of Open Access Journals (Sweden)

    Katia Tamekuni

    2010-12-01

    Full Text Available Brazilian spotted fever (BSF is an emerging disease most likely caused by Rickettsia rickettsii. The objective of the present study was to estimate the seroprevalence of BSF rickettsia infections in equines from six horse farms located in Londrina County, Paraná, Southern Brazil. Six owners of horse farms situated in Cambé, Santa Fé, Guaraci and Londrina municipalities participated in the study. All farms were located in areas where BSF has not been reported. A total of 273 horses were sampled and their sera were tested by indirect Immunofluorescence assay (IFA using R. rickettsii and R. parkeri antigens. Titers equal to and greater than 64 were considered positive. Of 273 sera tested, 15 (5.5% reacted to R. rickettsii and 5 (1.8% to R. parkeri. Five out of the six farms studied revealed seropositive animals and seropositivity rate ranged from 0 to 13%. The titers ranged from 64 to 512, and four samples had a titer of 512. Nine animals reacted to R. rickettsii with titers four-fold higher than those for R. parkeri. These results suggest that horses in Northern Paraná may have been exposed to rickettsiae identical or closely related to R. rickettsii.Febre Maculosa Brasileira (FMB é uma doença emergente, sendo Rickettsia rickettsii o seu principal agente etiológico. O objetivo deste estudo foi determinar a soroprevalência de rickettsia do grupo da febre maculosa em equinos de seis haras localizados nos municípios de Cambé, Santa Fé, Guaraci e Londrina. As propriedades eram localizadas na região Norte do Paraná onde casos de FMB ainda não foram diagnosticados. Foram colhidas amostras de sangue de 273 equinos, e os soros foram testados pela RIFI, usando R. rickettsii e R. parkeri como antígenos, considerando-se como positivos títulos >64. Entre 273 soros, 15 (5,5% reagiram contra R. rickettsii e 5 (1,8% para R. parkeri. Cinco de seis haras estudados tinham animais reativos, e a taxa de sororreatividade variou de 0 a 13%. Os t

  18. WICCI Wildlife Working Group Report

    Science.gov (United States)

    LeDee, Olivia E.; Hagell, Suzanne; Martin, K.; McFarland, David; Meyer, Michael; Paulios, Andy; Ribic, Christine A.; Sample, D.; Van Deelen, Timothy R.

    2013-01-01

    Wisconsin is world-renowned for its diversity of ecological landscapes and wildlife populations.  The northern forests, southern prairies, and interior and coastal wetlands of the state are home to more than 500 terrestrial animal species.  These animals supply the Wisconsin public with aesthetic, cultural, and economic benefits; our identity and economy are intertwined with these natural resources.  Climate change is altering the behavior, distribution, development, reproduction, and survival of these animal populations.  In turn, these changes will alter the aesthetic, cultural, and economic benefits we receive from them.  The focus of the Wildlife Working Group is to document past and current impacts, anticipate changes in wildlife distribution and abundance, and develop adaptation strategies to maintain the vitality and diversity of Wisconsin's wildlife populations.

  19. Beneficial Insect Borders Provide Northern Bobwhite Brood Habitat

    Science.gov (United States)

    Moorman, Christopher E.; Plush, Charles J.; Orr, David B.; Reberg-Horton, Chris

    2013-01-01

    Strips of fallow vegetation along cropland borders are an effective strategy for providing brood habitat for declining populations of upland game birds (Order: Galliformes), including northern bobwhite (Colinus virginianus), but fallow borders lack nectar-producing vegetation needed to sustain many beneficial insect populations (e.g., crop pest predators, parasitoids, and pollinator species). Planted borders that contain mixes of prairie flowers and grasses are designed to harbor more diverse arthropod communities, but the relative value of these borders as brood habitat is unknown. We used groups of six human-imprinted northern bobwhite chicks as a bioassay for comparing four different border treatments (planted native grass and prairie flowers, planted prairie flowers only, fallow vegetation, or mowed vegetation) as northern bobwhite brood habitat from June-August 2009 and 2010. All field border treatments were established around nine organic crop fields. Groups of chicks were led through borders for 30-min foraging trials and immediately euthanized, and eaten arthropods in crops and gizzards were measured to calculate a foraging rate for each border treatment. We estimated arthropod prey availability within each border treatment using a modified blower-vac to sample arthropods at the vegetation strata where chicks foraged. Foraging rate did not differ among border treatments in 2009 or 2010. Total arthropod prey densities calculated from blower-vac samples did not differ among border treatments in 2009 or 2010. Our results showed plant communities established to attract beneficial insects should maximize the biodiversity potential of field border establishment by providing habitat for beneficial insects and young upland game birds. PMID:24376759

  20. Adaptability of black walnut, black cherry, and Northern red oak to Northern California

    Science.gov (United States)

    Philip M. McDonald

    1987-01-01

    When planted in sheltered sites in northern California, only 49% of black walnut (Juglans nigra L.) and 58% of black cherry (Prunus serotina Ehrh.) survived for 15 years, and 20% of northern red oak (Quercus rubra L.) survived for 10 years. The black walnut trees averaged 0.6 inches diameter at breast...

  1. Factors Affecting Student Academic Success in Gateway Courses at Northern Arizona University

    Science.gov (United States)

    Benford, Russell; Gess-Newsome, Julie

    2006-01-01

    Students in gateway business, math, and science courses at Northern Arizona University receive non-passing grades (grades of D, F, and W) at high rates. To identify possible trends in demographic groups that receive DFWs and to investigate why students receive DFWs in these courses, a student survey was administered to 719 students in 7 gateway…

  2. Liveweight And Its Effects On Work Output In Northern Nigeria White ...

    African Journals Online (AJOL)

    The working performance of indigenous draught oxen under small holder management in northern Nigeria was investigated. The oxen, belonging to the White Fulani breed were paired and harnessed into groups I, II and III with liveweights of 300 – 350, 360 – 400 and 410 – 450 kg, respectively. The working performance of ...

  3. Indigenous Gambling Motivations, Behaviour and Consequences in Northern New South Wales, Australia

    Science.gov (United States)

    Breen, Helen M.; Hing, Nerilee; Gordon, Ashley

    2011-01-01

    Against a background of public health, we sought to examine and explain gambling behaviours, motivations and consequences of Indigenous Australians in northern New South Wales. Adhering to national Aboriginal and ethical guidelines and using qualitative methods, 169 Indigenous Australians were interviewed individually and in small groups using…

  4. Effects of fuel treatments on carbon-disturbance relationships in forests of the northern Rocky Mountains

    Science.gov (United States)

    Elizabeth Reinhardt; Lisa Holsinger

    2010-01-01

    Fuel treatments alter conditions in forested stands at the time of the treatment and subsequently. Fuel treatments reduce on-site carbon and also change the fire potential and expected outcome of future wildfires, including their carbon emissions. We simulated effects of fuel treatments on 140 stands representing seven major habitat type groups of the northern Rocky...

  5. Democratic Decentralization Reforms and Their Unintended Consequences in Postslavery Northern Benin,

    DEFF Research Database (Denmark)

    Hahonou, Eric Komlavi

    2017-01-01

    The paper retraces the recent political emancipation of the Gando, a group of people from Northern Benin whose servile status had been an argument for placing them at the margins of their society and excluding them from political participation. Since the recent democratization process that took p...

  6. Accurate and inaccurate HIV transmission beliefs, stigmatizing and HIV protection motivation in northern Thailand

    NARCIS (Netherlands)

    Boer, Hendrik; Emons, P.A.A.; Emons, P.A.A.

    2004-01-01

    We assessed the relation between accurate beliefs about HIV transmission and inaccurate beliefs about HIV transmission and emotional reactions to people with AIDS (PWA) and AIDS risk groups, stigmatizing attitudes and motivation to protect from HIV. In Chiang Rai, northern Thailand, 219 respondents

  7. Leading Integrated Schools: A Study of the Multicultural Perspectives of Northern Irish Principals

    Science.gov (United States)

    McGlynn, Claire

    2008-01-01

    This article is concerned with the sustained peace education initiative of integrated schooling and in particular with leadership responses to cultural diversity. Using a case study group of principals of integrated (mixed Catholic, Protestant and other) schools in Northern Ireland, the author explores how principals perceive and lead their…

  8. Pesticide Use and Prevention Practices of Tangerine Growers in Northern Thailand

    Science.gov (United States)

    Chalermphol, Juthathip; Shivakoti, Genesh P.

    2009-01-01

    To investigate pesticide use and prevention practices of tangerine growers in Fang district, Chiang Mai province in Northern Thailand. A questionnaire survey of 312 farmers in the study area, in-depth interviews and group discussions. Only 36% of the participants pursued the recommended prevention practices every time they used pesticides.…

  9. Northern Ireland and truth and reconciliation healing through remembering: The story so far

    Directory of Open Access Journals (Sweden)

    Wall David

    2002-01-01

    Full Text Available This paper outlines the work of truth and reconciliation project done in Northern Ireland "Healing through Remembering", and the findings of the Project Group that reported in June 2002. The Paper identifies future actions emerging from the Report.

  10. Assessing Outgroup Prejudice among Secondary School Pupils in Northern England: Introducing the Outgroup Prejudice Index

    Science.gov (United States)

    Brockett, Adrian; Village, Andrew; Francis, Leslie J.

    2010-01-01

    The Outgroup Prejudice Index is a six-item scale that uses social distance to assess prejudice towards ethnic and religious out groups among Asians and whites. It was developed among a sample of 2,982 teenagers attending schools in northern England who indicated their religion as "Muslim", "Christian" or "No…

  11. Novel Bartonella Species in Insectivorous Bats, Northern China.

    Directory of Open Access Journals (Sweden)

    Hui-Ju Han

    Full Text Available Bartonella species are emerging human pathogens. Bats are known to carry diverse Bartonella species, some of which are capable of infecting humans. However, as the second largest mammalian group by a number of species, the role of bats as the reservoirs of Bartonella species is not fully explored, in term of their species diversity and worldwide distribution. China, especially Northern China, harbors a number of endemic insectivorous bat species; however, to our knowledge, there are not yet studies about Bartonella in bats in China. The aim of the study was to investigate the prevalence and genetic diversity of Bartonella species in bats in Northern China. Bartonella species were detected by PCR amplification of gltA gene in 25.2% (27/107 bats in Mengyin County, Shandong Province of China, including 1/3 Rhinolophus ferrumequinum, 2/10 Rhinolophus pusillus, 9/16 Myotis fimbriatus, 1/5 Myotis ricketti, 14/58 Myotis pequinius. Phylogenetic analysis showed that Bartonella species detected in bats in this study clustered into ten groups, and some might be novel Bartonella species. An association between Bartonella species and bat species was demonstrated and co-infection with different Bartonella species in a single bat was also observed. Our findings expanded our knowledge on the genetic diversity of Bartonella in bats, and shed light on the ecology of bat-borne Bartonella species.

  12. Proposed purchasing, employment and training policies for northern projects

    International Nuclear Information System (INIS)

    1991-09-01

    Manitoba Hydro is about to embark on a major construction project in the northern part of the province. Important considerations involved in this project include purchasing the necessary materials, products, and services, and employing a suitable work force. An outline is presented of draft policies being considered by Manitoba Hydro to enhance northern-aboriginal and northern participation in its future development projects in northern Manitoba. The policies are presented in four sections: purchasing for northern construction and operation activities; training and employment for construction of a generation station and expansion of a converter station; training and employment for construction of a major north-south transmission line; and training and employment for northern operations and maintenance work at existing facilities. Aspects of these policies include giving preference in purchasing to northern and aboriginal businesses, training initiatives and employee counselling for aboriginal employees, and hiring preferences directed toward northern aboriginals and northern residents

  13. Which finite simple groups are unit groups?

    DEFF Research Database (Denmark)

    Davis, Christopher James; Occhipinti, Tommy

    2014-01-01

    We prove that if G is a finite simple group which is the unit group of a ring, then G is isomorphic to either (a) a cyclic group of order 2; (b) a cyclic group of prime order 2^k −1 for some k; or (c) a projective special linear group PSLn(F2) for some n ≥ 3. Moreover, these groups do all occur a...

  14. The Maritime Cultural Landscape of Northern Patagonia

    Science.gov (United States)

    Lira, Nicolás

    2017-12-01

    This article is a contribution to the study of the indigenous navigation and its boats in the region of northern Patagonia. This article also aims to contribute to the understanding of indigenous navigation practices and technologies and their origins from prehistoric times to the mid-twentieth century. It presents and discusses the concept of Westerdahl's Maritime Cultural Landscape in relation to other landscape concepts. This model is applied to northern Patagonia in order to discuss if it is possible to speak of a true maritime culture in the region. For this purpose, archaeological, historical and ethnographic data are presented in an integrative and innovative methodology for the discipline. Finally, the Maritime Cultural Landscape model will allow the integration of aquatic and terrestrial landscapes as routes traveled by native inhabitants of northern Patagonia and southern Chile, and propose an important and diversified maritime, river and lake tradition.

  15. Accessing northern California earthquake data via Internet

    Science.gov (United States)

    Romanowicz, Barbara; Neuhauser, Douglas; Bogaert, Barbara; Oppenheimer, David

    The Northern California Earthquake Data Center (NCEDC) provides easy access to central and northern California digital earthquake data. It is located at the University of California, Berkeley, and is operated jointly with the U.S. Geological Survey (USGS) in Menlo Park, Calif., and funded by the University of California and the National Earthquake Hazard Reduction Program. It has been accessible to users in the scientific community through Internet since mid-1992.The data center provides an on-line archive for parametric and waveform data from two regional networks: the Northern California Seismic Network (NCSN) operated by the USGS and the Berkeley Digital Seismic Network (BDSN) operated by the Seismographic Station at the University of California, Berkeley.

  16. Stratigraphy of the Martian northern plains

    Science.gov (United States)

    Tanaka, K. L.

    1993-01-01

    The northern plains of Mars are roughly defined as the large continuous region of lowlands that lies below Martian datum, plus higher areas within the region that were built up by volcanism, sedimentation, tectonism, and impacts. These northern lowlands span about 50 x 10(exp 6) km(sup 2) or 35 percent of the planet's surface. The age and origin of the lowlands continue to be debated by proponents of impact and tectonic explanations. Geologic mapping and topical studies indicate that volcanic, fluvial, and eolian deposition have played major roles in the infilling of this vast depression. Periglacial, glacial, fluvial, eolian, tectonic, and impact processes have locally modified the surface. Because of the northern plains' complex history of sedimentation and modification, much of their stratigraphy was obscured. Thus the stratigraphy developed is necessarily vague and provisional: it is based on various clues from within the lowlands as well as from highland areas within and bordering the plains. The results are summarized.

  17. Building Healthy Northern Communities Through Strengthening Capacity

    Directory of Open Access Journals (Sweden)

    Glen Schmidt

    2015-03-01

    Full Text Available This study examines and evaluates the effects of one-time funding on capacity building of health and social welfare organizations in a remote and northern section of British Columbia Canada. The Province of British Columbia awarded a two million dollar grant (Canadian to the University of Northern British Columbia (UNBC. Organizations applied for funds through a competitive process that was managed by the School of Social Work at UNBC. Twenty-five different community organizations and agencies received funding for a period of eighteen months. The organizations and agencies delivered a range of services and activities located in remote First Nations communities as well as the natural resource-based single industry towns of northern BC.

  18. Religious beliefs along the suicidal path in northern Taiwan.

    Science.gov (United States)

    Fang, Chun-Kai; Lu, Hsin-Chin; Liu, Shen-ing; Sun, Yi-Wen

    2011-01-01

    This study aimed to understand the current inclinations toward depression and compulsion for members of four different religious groups, and to predict religious beliefs along the suicide path through analyzing the lifetime prevalence of suicidal ideation and suicide attempts for members of these religious groups. Participants in this cross-sectional study, which adopted purposive sampling, were members of Christianity, Catholicism, Buddhism, and Taoism in northern Taiwan. In the case of suicide experiences, suicides among people one knows, and tendency toward compulsion and depression, there are statistical differences between the four religions. According to the results, some people with suicidal tendency will attend religious activities; therefore, we predict that religious beliefs play an important role in suicide prevention.

  19. Resource industries and security issues in northern Alberta

    Energy Technology Data Exchange (ETDEWEB)

    Flanagan, T. [Calgary Univ., AB (Canada). Dept. of Political Science

    2009-06-15

    Public concern over global warming has led to many political attacks on the oil industry, particularly Alberta's tar sand industry. This document focused on security issues in northern Alberta and reviewed past incidences of security threats. The likelihood of sabotage to wells, pipelines, buildings, and other industry facilities was assessed. Five potential sources of opposition were identified, notably individual saboteurs, eco-terrorists, mainstream environmentalists, First Nations, and the Metis people. All except the Metis have at various times used some combination of litigation, blockades, boycotts, sabotage, and violence against economic development projects. This report stated that although such incidents will likely continue in the future, it is unlikely that extra-legal obstruction will become widespread unless these various groups cooperate with each other. Since these groups have different social characteristics and conflicting political interests, it is unlikely that such cooperation will occur. 34 refs.

  20. Climate Impacts on Northern Canada: Regional Background

    Energy Technology Data Exchange (ETDEWEB)

    Prowse, Terry D.; Peters, Daniel L. (Water and Climate Impacts Research Centre, Environment Canada, Dept. of Geography, Univ. of Victoria, Victoria, BC (Canada)). e-mail: terry.prowse@ec.gc.caa; Furgal, Chris (Indigenous Environmental Studies Program, Trent Univ., Peterborough, ON (Canada)); Bonsal, Barrie R. (National Water Research Inst., National Hydrology Research Centre, Environment Canada, Saskatoon, SK (Canada))

    2009-07-15

    Understanding the implications of climate change on northern Canada requires a background about the size and diversity of its human and biogeophysical systems. Occupying an area of almost 40% of Canada, with one-third of this contained in Arctic islands, Canada's northern territories consist of a diversity of physical environments unrivaled around the circumpolar north. Major ecozones composed of a range of landforms, climate, vegetation, and wildlife include: Arctic, boreal and taiga cordillera; boreal and taiga plains; taiga shield; and northern and southern Arctic. Although generally characterized by a cold climate, there is an enormous range in air temperature with mean annual values being as high as -5 deg C in the south to as low as -20 deg C in the high Arctic islands. A similar contrast characterizes precipitation, which can be >700 mm y-1 in some southern alpine regions to as low as 50 mm y-1 over islands of the high Arctic. Major freshwater resources are found within most northern ecozones, varying from large glaciers or ice caps and lakes to extensive wetlands and peat lands. Most of the North's renewable water, however, is found within its major river networks and originates in more southerly headwaters. Ice covers characterize the freshwater systems for multiple months of the year while permafrost prevails in various forms, dominating the terrestrial landscape. The marine environment, which envelops the Canadian Arctic Archipelago, is dominated by seasonal to multiyear sea ice often several meters thick that plays a key role in the regional climate. Almost two-thirds of northern Canadian communities are located along coastlines with the entire population being just over 100 000. Most recent population growth has been dominated by an expansion of nonaboriginals, primarily the result of resource development and the growth of public administration. The economies of northern communities, however, remain quite mixed with traditional land

  1. Agrosilvopastoral Systems in Northern Thailand and Northern Laos: Minority Peoples’ Knowledge versus Government Policy

    Directory of Open Access Journals (Sweden)

    Chalathon Choocharoen

    2014-05-01

    Full Text Available Traditional agrosilvopastoral systems have been an important component of the farming systems and livelihoods of thousands of ethnic minority people in the uplands of Mainland Southeast Asia. Drawing on a combination of qualitative and participatory inquiries in nine ethnic minority communities, this study emphasizes the complex articulation of local farmers’ knowledge which has been so far excluded from governmental development and conservation policies in the northern uplands of Thailand and Laos. Qualitative analysis of local knowledge systems is performed using the Agroecological Knowledge Toolkit (AKT5 software. Results show that ethnic minorities in the two countries perceive large ruminants to be a highly positive component of local forest agro-ecosystems due to their contribution to nutrient cycling, forest fire control, water retention, and leaf-litter dispersal. The knowledge and perceptions of agrosilvopastoral farmers are then contrasted with the remarkably different forestry policy frameworks of the two countries. We find that the knowledge and diversity of practices exercised by ethnic minority groups contrasts with the current simplified and negative image that government officials tend to construct of agrosilvopastoral systems. We conclude that local knowledge of forest-livestock systems can offer alternative or complementary explanations on ecological cause-and-effect relationships which may need further scientific investigation and validation.

  2. Northern Land Council v. the Commonwealth

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    The Ranger Project Area in the Northern Territory contains deposits of uranium. By section 5 of the Atomic Energy Amendment Act (No. 2) 1980 the assignment of an agreement between the Commonwealth and joint venturers for the conduct of uranium mining was authorised. The Northern Land Council, representing Aboriginal interests, challenged the validity of the section. It was held that the section was valid. The Council also submitted that, although it had entered into an agreement with the Commonwealth in 1978, the agreement was void or voidable

  3. Rural telemedicine project in northern New Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Zink, S.; Hahn, H.; Rudnick, J.; Snell, J.; Forslund, D. [Los Alamos National Lab., NM (United States); Martinez, P. [Northern New Mexico Community Coll., Espanola, NM (United States)

    1998-12-31

    A virtual electronic medical record system is being deployed over the Internet with security in northern New Mexico using TeleMed, a multimedia medical records management system that uses CORBA-based client-server technology and distributed database architecture. The goal of the NNM Rural Telemedicine Project is to implement TeleMed into fifteen rural clinics and two hospitals within a 25,000 square mile area of northern New Mexico. Evaluation of the project consists of three components: job task analysis, audit of immunized children, and time motion studies. Preliminary results of the evaluation components are presented.

  4. Coastal geomorphology of the Martian northern plains

    Science.gov (United States)

    Parker, Timothy J.; Gorsline, Donn S.; Saunders, Stephen R.; Pieri, David C.; Schneeberger, Dale M.

    1993-01-01

    The paper considers the question of the formation of the outflow channels and valley networks discovered on the Martian northern plains during the Mariner 9 mission. Parker and Saunders (1987) and Parker et al. (1987, 1989) data are used to describe key features common both in the lower reaches of the outflow channels and within and along the margins of the entire northern plains. It is suggested, that of the geological processes capable of producing similar morphologies on earth, lacustrine or marine deposition and subsequent periglacial modification offer the simplest and most consistent explanation for the suit of features found on Mars.

  5. ABCGheritage project - promoting geotourism in northern Finland, northern Norway and the Kola Peninsula

    Science.gov (United States)

    Pihlaja, Jouni; Johansson, Peter; Lauri, Laura S.

    2014-05-01

    Nature tourism has been a growing business sector in the Barents area during the recent decades. With the purpose to develop nature tourism in a sustainable way, a cooperation project ABCGheritage - Arctic Biological, Cultural and Geological Heritage has been carried out. Project has received partial funding from the EU Kolarctic ENPI program. In the geoheritage part of the project the main activities were aimed to develop pro-environmental ways of geotourism in the area. The three main participants in the geoheritage part of the project are the Geological Survey of Finland, Northern Finland Office, the Geological Institute of the Kola Science Centre of the Russian Academy of Sciences and Bioforsk Soil and Environment from northeastern Norway. The duration of the project is 2012-2014 and most of the work has already been completed even if most of the results are not published yet. Totally ten different tasks have been implemented in the geological part of the project. The largest task has been the preparation of a geological outdoor map and guide book of the Khibiny Tundra locating in the central part of the Kola Peninsula. In Finland already 11 such maps have been published, and the experiences gained during their production have been used in this project, too. Geological heritage trails to the Khibiny Tundra have also been created and they will be drawn on the map. The second concrete result is the Barents Tour for Geotourist -guide, which will be published as a guide book, web pages and an exhibition. The route comprises ca 35 best geological demonstration sites along the circle route from northern Finland to northeastern Norway, from there to Kola Peninsula and then back to Finland. Information of the route will be available for all interested travelers. In addition to the geological outdoor map of the Khibiny Tundra and "Barents Tour for Geotourists"-guide, the primary outputs of the project are the geological nature trails on the field, geological

  6. Group Cohesion in Experiential Growth Groups

    Science.gov (United States)

    Steen, Sam; Vasserman-Stokes, Elaina; Vannatta, Rachel

    2014-01-01

    This article explores the effect of web-based journaling on changes in group cohesion within experiential growth groups. Master's students were divided into 2 groups. Both used a web-based platform to journal after each session; however, only 1 of the groups was able to read each other's journals. Quantitative data collected before and…

  7. The practice of 'Dr' Paep: continuity and change in indigenous healing in northern Thailand.

    Science.gov (United States)

    Weisberg, D H

    1984-01-01

    Dr. Paep Plienphleng is an indigenous curer in a rural district in Chiang Mai Province, Northern Thailand, where he is numbered among the group of healers known as mqq mueang ('Northern doctors'). He specializes in curing saan or 'tumors' by combining several techniques: indigenous surgery, herbal curing and supernatural curing. Other aspects of Dr Paep's practice have been due to larger trends in indigenous healing that have affected him and other curers over past decades. This paper describes the practice of Dr Paep and some aspects of his healing, and examines the context of his practice by exploring other categories of indigenous healers found in this area of the North. It is concluded that Northern Thai healing is undergoing a transformation from a stress on general healing to an emphasis on the use of supernatural cures, more specialization among healers and efforts to adapt services to fit the plural system of care found in this rural Northern Thai environment. Thus, we find the skills of indigenous healers and the nature of indigenous Northern Thai medicine allow for creative adaptation to a changing medical environment.

  8. Group Work Publication-1991.

    Science.gov (United States)

    Zimpfer, David G.

    1992-01-01

    Lists 21 new publications in group work, of which 9 are reviewed. Those discussed include publications on group counseling and psychotherapy, structured groups, support groups, psychodrama, and social group work. (Author/NB)

  9. Quantum isometry groups

    Indian Academy of Sciences (India)

    Jyotishman Bhowmick

    2015-11-07

    Nov 7, 2015 ... Classical. Quantum. Background. Compact Hausdorff space. Unital C∗ algebra. Gelfand-Naimark. Compact Group. Compact Quantum Group. Woronowicz. Group Action. Coaction. Woronowicz. Riemannian manifold. Spectral triple. Connes. Isometry group. Quantum Isometry Group. To be discussed.

  10. Nurturing a Self-Help Group

    Directory of Open Access Journals (Sweden)

    Marsha A. Schubert

    2015-04-01

    Full Text Available In April 1987, the parent of a child who was both learning disabled and intellectually gifted and talented and a professional educator (the author founded Parents of Gifted and Learning-Disabled Students of Northern Virginia, a self-help group for people who were dealing with the challenges posed by such children. The article begins with a background explaining the need for such a group followed by a history of the group and a description of how it functioned. It then details ways in which the author and the group interacted over the course of 5 years. A major component of this interaction was the members’ partnering in a research study with the author—a process now known as participatory action research (PAR—and the outcomes of that partnership.

  11. Vegetation in group selection openings: ecology and manipulation

    Science.gov (United States)

    Philip M. McDonald; Gary O. Fiddler

    1991-01-01

    Group selection openings ranging from 0.1 to 2.0 acres in mixed conifer stands in northern and central California were evaluated for effect of site preparation, opening size, kind and amount of vegetation, and release treatment. Small openings, in general, are characterized by less sunlight and lower temperature extremes than clearcuttings. Roots from border trees...

  12. Women and development in Northern Belize.

    Science.gov (United States)

    Brockmann, C T

    1985-07-01

    Northern Belize, composed of Orange Walk and Corozal districts, is the sugar-producing region of Belize, a newly independent country on the Caribbean coast of Central America, and because of the extensive involvement in the modern sugar industry, existing status differentials in Orange Walk have increased. Town farmers have increased their sugarcane license sizes more than villagers and also are much more likely to meet or exceed their delivery quotas than villagers. There has been the differentiation of a new middle socioeconomic stratum in Orange Walk, with a much higher proportion of villagers remaining in the lower stratum than townspeople. With greater involvement in the market economy, there has been a decline in the social integration of groups in the district as well as less symbiosis between husband and wife and among related male age mates. Some people now consistently work for others; there was an egalitarian labor exchange before. With the decline in subsistence production, the extensive reciprocity in food among related women diminishes. Women have participated in the overall changes in Orange Walk, yet their position vis-a-vis men has become weaker. Women are most likely to hold licenses in the communities that participated earliest in the sugar industry and that are the most traditional. With greater market involvement, women become less likely to hold licenses. Women's licenses have not increased to the same degree as those of men. And, with the income from sugar and wage labor, the family income is more and more viewed as belonging to men, rather than being the result of a joint family enterprise. Women become dependent on what men give them, with less control and security. With declining subsistence production, women have a reduced basis of involvement in traditional reciprocal food exchanges with other households. They lose some independent sources of money income with the result of increasing undernutrition for young children. The economic

  13. Winter cooling in the northern Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    PrasannaKumar, S.; Prasad, T.G.

    forcing that leads to the observed high productivity during winter in the northern Arabian Sea. The weak northerly winds and increased solar insolation during the inter-monsoon period, led to the development of a highly stratified upper layer with warm sea...

  14. The visual arts in Northern Ireland hospitals.

    Science.gov (United States)

    Cromie, H

    1995-10-01

    Since 1989 there has been a burgeoning of the visual arts in Northern Ireland hospitals. This paper compares the three organisational models for hospital arts currently operating within the Province and in an overview discusses ways to coordinate working practice for future development of the visual arts in local hospitals.

  15. The visual arts in Northern Ireland hospitals.

    Science.gov (United States)

    Cromie, H.

    1995-01-01

    Since 1989 there has been a burgeoning of the visual arts in Northern Ireland hospitals. This paper compares the three organisational models for hospital arts currently operating within the Province and in an overview discusses ways to coordinate working practice for future development of the visual arts in local hospitals. Images Fig 1 Fig 2 Fig 3 PMID:8533183

  16. Potato pathogens in Northern and Western Europe

    NARCIS (Netherlands)

    Schepers, H.T.A.M.; Cooke, L.R.

    2015-01-01

    The climatic conditions in Northern and Western (NW) Europe, which are very suitable for the cultivation of potatoes, are also very favourable for a range of diseases of which late blight, caused by Phytophthora infestans, is by far the most important with the potential to cause total crop loss. It

  17. The Times and the Northern Ireland Conflict

    Directory of Open Access Journals (Sweden)

    Zouhaïr Abassi

    2006-03-01

    Full Text Available Abstract: In societies in conflict the role of the media is supposed to be neutral and to report conflicts fairly and with balanced analyses. By their public debates on conflicts they are also supposed to take part in pacifying societies and in helping to bring peace. Cottle (1997, for instance, explained that even though some findings related to the British media and its reporting of the Northern Ireland conflict were relevant, he argued that they needed revision. Consequently, he proposed new paradigms of media studies. Elliott (1977 and Curtis(1996 showed that the British media concentrated on violence in general and on republican violence in particular. Moreover, they argued that the British media neglected social and political contexts in their reporting of the conflict. The aim of this paper is then to examine some aspects of how the British media cover the Northern Ireland conflict. We studied the coverage of the Northern Ireland conflict by The (London Times (1990-1995. We used a discourse analysis method to study the paper’s discourse structure in its representation of the Northern Ireland conflict.

  18. Placing our northern hardwood woodlots under management

    Science.gov (United States)

    Russell J. Hutnik

    1956-01-01

    Do you own a woodlot? Does it contain mostly northern hardwoods - that is, beech, birch, maple, and ash, with some hemlock and spruce? If the answers to these two questions are "yes," then you may be interested in the work that is carried on at the Bartlett Experimental Forest in New Hampshire. This is one of the field laboratories established by the U. S....

  19. Seismic activity of northern and central Switzerland

    International Nuclear Information System (INIS)

    Deichmann, N.; Ballarin Dolfin, D.; Kastrup, U.

    2000-12-01

    The present report is part of an ongoing study by the Swiss Seismological Service, that was initiated by Nagra almost 20 years ago. It is devoted to the detailed monitoring of the earthquake activity in northern and central Switzerland. The main objective of this study is to provide information about the locations of active deformation and the state of stress in the Earth's crust and to relate these to the geological features visible at the surface. Originally, this seismotectonic investigation was restricted to the northern part of Switzerland; later it was extended also to the central part. Concerning the seismotectonics of northern Switzerland, this report constitutes a continuation of earlier publications. Here we review the seismic activity and earthquake focal mechanisms of the last 10 years and subsequently derive a comprehensive picture of the deformation and stress in the Earth's crust of northern Switzerland, based on all data available up to the end of 1999. Concerning the seismotectonics of central Switzerland, this publication constitutes the first publicly available report. (author) [de

  20. Survival of adult martens in Northern Wisconsin

    Science.gov (United States)

    Nicholas P. McCann; Patrick A. Zollner; Jonathan H. Gilbert

    2010-01-01

    Low adult marten (Martes americana) survival may be one factor limiting their population growth >30 yr after their reintroduction in Wisconsin, USA. We estimated annual adult marten survival at 0.81 in northern Wisconsin, with lower survival during winter (0.87) than summer-fall (1.00). Fisher (Martes pennanti) and raptor kills...

  1. From Poetry to Music: "Northern Lullaby"

    Science.gov (United States)

    Cardany, Audrey Berger

    2011-01-01

    Nancy White Carlstrom's children's book, "Northern Lullaby," conjures through poetry the beauty of the Alaskan landscape in the evening. The book provides an opportunity for music teachers to help their students transform text and visual images to music. The author describes connections for reading comprehension in the general music…

  2. Nursing care after death in Northern Ireland.

    Science.gov (United States)

    Pearce, Lynne

    2017-06-30

    Essential facts According to the Registrar General Annual Report published in August 2016 there were 15,548 deaths in Northern Ireland in 2015, with almost two thirds being of people aged 75 or more. Almost half (48%) occurred in NHS hospitals, with a further 20% in other hospitals or nursing homes.

  3. Trypanosomes of Bufo americanus from northern Michigan.

    Science.gov (United States)

    Werner, J K; Davis, J S; Slaght, K S

    1988-10-01

    Two hundred one American toads (Bufo americanus) from northern Michigan were examined for blood trypanosomes. Three species, Trypanosoma bufophlebotomi, T. schmidti-like sp. and T. pseudopodia, had prevalences of 27, 16 and 1%, respectively. Cross experimental inoculations showed that T. bufophlebotomi from toads is not the same as T. ranarum found in frogs of the family Ranidae of this region.

  4. Mining and energy in the Northern Territory

    International Nuclear Information System (INIS)

    1982-01-01

    Included in this book is a section on each of the major minerals of present or future importance to the Northern Territory. Brief details of the uranium mining projects at Nabarlek, Ranger, Koongarra and Jabiluka in the Alligator Rivers regions are given. Subjects such as environmental protection, Aboriginal land rights and the geology of the area are also considered

  5. Deprivation, HIV and AIDS in Northern Uganda

    African Journals Online (AJOL)

    2007-09-28

    physical aggression, deprivation, hunger and family separation, among others, for over twenty years. ... by various types of sexual crimes of rape (including marital rape), defilement and child .... insecurity and civil strife raged in northern Uganda mainly between the government ...... The Daily Monitor of September 28, 2007.

  6. Otological emergencies among the northern Nigerian children ...

    African Journals Online (AJOL)

    Conclusion: Acute suppurative otitis media, acute otitis media and foreign body insertion into the ear still constitute the common otological emergencies in Northern Nigeria. These are all preventable emergencies through community health education, training of community health worker to recognize the symptom and signs ...

  7. Ecological units of the Northern Region: Subsections

    Science.gov (United States)

    John A. Nesser; Gary L. Ford; C. Lee Maynard; Debbie Dumroese

    1997-01-01

    Ecological units are described at the subsection level of the Forest Service National Hierarchical Framework of Ecological Units. A total of 91 subsections are delineated on the 1996 map "Ecological Units of the Northern Region: Subsections," based on physical and biological criteria. This document consists of descriptions of the climate, geomorphology,...

  8. Reducing vulnerability among pastoralists in Northern Kenya

    International Development Research Centre (IDRC) Digital Library (Canada)

    CCAA

    vulnerability among pastoralist communities in Mandera and Turkana in Northern Kenya, led by the Kenyan NGO ... to understand how people have experienced droughts and other ... norms and gender roles may make them more or less vulnerable, ... and see direct impacts on the resources they depend on for their.

  9. Forest carbon sinks in the Northern Hemisphere

    Science.gov (United States)

    Christine L. Goodale; Michael J. Apps; Richard A. Birdsey; Christopher B. Field; Linda S. Heath; Richard A. Houghton; Jennifer C. Jenkins; Gundolf H. Kohlmaier; Werner Kurz; Shirong Liu; Gert-Jan Nabuurs; Sten Nilsson; Anatoly Z. Shvidenko

    2002-01-01

    There is general agreement that terrestrial systems in the Northern Hemisphere provide a significant sink for atmospheric CO2; however, estimates of the magnitude and distribution of this sink vary greatly. National forest inventories provide strong, measurement-based constraints on the magnitude of net forest carbon uptake. We brought together...

  10. Freshwater reservoir effect variability in Northern Germany

    DEFF Research Database (Denmark)

    Philippsen, Bente; Heinemeier, Jan

    2012-01-01

    Kayhude at the river Alster and Schlamersdorf at the river Trave, both in Schleswig-Holstein, Northern Germany. Measurements on modern materials from these rivers may not give a single reservoir age correction that can be applied to archaeological samples, but they will show the order of magnitude...

  11. The Lemmatisation of Adverbs in Northern Sotho*

    African Journals Online (AJOL)

    Information Technology

    A dictionary should not primarily reflect the attitude of the lexicographer; it should ... ditional focus on the word as representative of the lexicon should be shifted to .... 25. Thirdly, a single glance at the treatment of adverbs in Northern Sotho dic-.

  12. Nitrite maxima in the Northern Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Sankaranarayanan, V.N.; DeSousa, S.N.; Fondekar, S.P.

    There are 2 nitrite maxima in the Northern Arabian Sea, one at the thermocline depth and the other at depths between 300 and 500 m. The 2nd maximum is more prominent in the northeastern part of the Arabian Sea. The 1st maximum is associated...

  13. Historic Hydroclimatic Variability in Northern Mexico

    Science.gov (United States)

    José Villanueva-Diaz; J. Cerano-Paredes; D.W. Stahle; B. H. Luckman; M.D. Therrell; M.K. Cleaveland; G. Gutierrez-Garcia

    2006-01-01

    The understanding of historic hydroclimatic variability is basic to plan for a proper management of limited water resources in northern Mexico. The objective of this study was to develop a network of tree-ring chronologies for climate reconstruction and to analyze the influence of circulatory patterns, such as ENSO. Climatic sensitive treering chronologies were...

  14. Mobile rural youth in northern Ghana

    DEFF Research Database (Denmark)

    Gough, Katherine; Birch-Thomsen, Torben

    2016-01-01

    , followed by structural adjustment programmes and neoliberalism, have all contributed to increasing the inequality between the north and the south. Although Ghana has now joined the ranks of lower middle-income countries, its northern part lags behind, with 22.2% of the population living below the poverty...

  15. Demographic change in the northern forest

    Science.gov (United States)

    Kenneth M. Johnson; Susan I. Stewart; Miranda H. Mockrin

    2012-01-01

    The Northern Forest spans more than 26 million acres across Maine, New Hampshire, New York, and Vermont. With densely settled urban cores, sprawling suburbs, struggling industrial and forest products towns, fast growing recreational areas, and isolated rural villages, the region includes many of the diverse strands that together compose the demographic fabric of the...

  16. The Lemmatization of Copulatives in Northern Sotho*

    African Journals Online (AJOL)

    rbr

    The indicative series The present tense Principal Identifying pos. lst and 2nd .... na 'man' and morutiši 'teacher' or bohlale 'wisdom' or mpša 'dog' in Table 1, A–C ... (and the compiler of a basic Northern Sotho grammar) to use the user's pre-.

  17. The Enigma of Mercury's Northern Rise

    Science.gov (United States)

    James, P. B.

    2018-05-01

    Various aspects of the "northern rise" make it hard to explain: Its composition and chronology don't stand out from its surroundings, it seems to have uplifted late, and it has a huge gravity anomaly. We'll discuss the possible formation mechanisms.

  18. Seasonally asymmetric enhancement of northern vegetation productivity

    Science.gov (United States)

    Park, T.; Myneni, R.

    2017-12-01

    Multiple evidences of widespread greening and increasing terrestrial carbon uptake have been documented. In particular, enhanced gross productivity of northern vegetation has been a critical role leading to observed carbon uptake trend. However, seasonal photosynthetic activity and its contribution to observed annual carbon uptake trend and interannual variability are not well understood. Here, we introduce a multiple-source of datasets including ground, atmospheric and satellite observations, and multiple process-based global vegetation models to understand how seasonal variation of land surface vegetation controls a large-scale carbon exchange. Our analysis clearly shows a seasonally asymmetric enhancement of northern vegetation productivity in growing season during last decades. Particularly, increasing gross productivity in late spring and early summer is obvious and dominant driver explaining observed trend and variability. We observe more asymmetric productivity enhancement in warmer region and this spatially varying asymmetricity in northern vegetation are likely explained by canopy development rate, thermal and light availability. These results imply that continued warming may facilitate amplifying asymmetric vegetation activity and cause these trends to become more pervasive, in turn warming induced regime shift in northern land.

  19. Controlling human oesophagostomiasis in northern Ghana

    NARCIS (Netherlands)

    Ziem, Juventus Benogle

    2006-01-01

    This thesis describes aspects of the epidemiology and attempts to control infection and pathology due to the nematode parasite Oesophagostomum bifurcum . In northern Ghana and Togo O. bifurcum is an important parasite of humans; elsewhere it is predominantly seen as a parasite of non-human primates.

  20. Group typicality, group loyalty and cognitive development.

    Science.gov (United States)

    Patterson, Meagan M

    2014-09-01

    Over the course of childhood, children's thinking about social groups changes in a variety of ways. Developmental Subjective Group Dynamics (DSGD) theory emphasizes children's understanding of the importance of conforming to group norms. Abrams et al.'s study, which uses DSGD theory as a framework, demonstrates the social cognitive skills underlying young elementary school children's thinking about group norms. Future research on children's thinking about groups and group norms should explore additional elements of this topic, including aspects of typicality beyond loyalty. © 2014 The British Psychological Society.

  1. Discussion on several geological problems and uranium metallogeny on northern border of northern China block (platform)

    International Nuclear Information System (INIS)

    Chen Hong.

    1987-01-01

    According to the informations from the satellite image and the field investigation the following geological events on the northern border of the Northern China Block are recognized and confirmed, duch as suture zones between blocks, folding-reversed fault zones, back-arc collision zones (faulted zones), transitional zone between platform and geosyncline, magmatic are and the double sturcture composed of NNE trend magmatic active belt and fault-depression belts (basins) of Yenshan-Ximalaya age. On thsee bases the following problems, such as the unique structural environment of uranium mineralization related to abyssal magmatic rocks and Yenshan magmatic active zone (including volcanic belt) on the northern border of the Northern China Block, the metallogenetic modes for urnaium deposits of 'magmatic type' and 'neutralized surface type' in fault-depression zone and the classification of uranium metallogenetic belts and the criteria for such classification are studied and discussed. Several uranium deposits are given for illustrations

  2. Hydrochemical synthesis Northern Switzerland: tertiary- and Malm-aquifers

    International Nuclear Information System (INIS)

    Schmassmann, H.; Kullin, M.; Wexsteen, P.

    1990-05-01

    This Tertiary-Malm synthesis represents the first part of an overall hydrochemical synthesis of deep groundwaters in Northern Switzerland and adjacent areas. The investigation is mainly based on data from Nagra deep boreholes, from Nagra regional programme as well as from external sources. The first part provides a hydrogeological overview including a brief description of the aquifer rocks. A compilation of all existing hydraulic potential data is given and discussed for Northern Switzerland, Bodensee area and western Swabian Alb. In the Molasse Basin, hydrochemical and isotope analyses allowed a distinction of three main water types positioned one upon another: calcium-magnesium-bicarbonate groundwaters, sodium-bicarbonate and sodium-chloride deep groundwaters. Hydrochemical and isotopegeochemical details of these three water types comprise the major part of this report. Unlike the other two water types, the calcium-magnesium-bicarbonate groundwaters also include shallow waters with considerable tritium activities, indicating a mean residence time of less than 35 years. The spacial distribution of these three water types are demonstrated and different secular flow models in the Tertiary-Malm Aquifer group are discussed. (author) figs., tabs., 194 refs

  3. Urban conflict: reterritorialization in Northern part of Bekasi

    Science.gov (United States)

    Sadono, W.; Herlily

    2018-03-01

    Inter-group conflict is one of the crucial issues affecting urban development in Northern part of Bekasi. It begins with the destruction of monuments until the rejection of worship places (in this case is a church) by mass organizations. These incidents occurred because the native assumed that the migrants took their territory. They concerned about the modern development brought by the migrants that caused the shrinking of local culture. The behavior of these mass organizations constituted the district that made the urban space seemed ‘not inclusive’ indirectly. This paper offered another alternative in urban design to reduce conflicts within the territory. We sought about the district context and reterritorialized the conflicted area. We used Reterritorialization approach to restore ‘border’ in order to sharpen and strengthen the territory. We conducted direct observation method, socio-cultural mapping, in-depth interview, and 3D model. This paper aimed to affirm the territory in urban space that would be able to accommodate the needs of the district user. The result is a design of transitional space that functionates as negotiation space. The transitional space is an intervention using Reterritorialization approach to reduce conflicts that occur in the urban space of the Northern part of Bekasi.

  4. 7 CFR 457.142 - Northern potato crop insurance provisions.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Northern potato crop insurance provisions. 457.142... INSURANCE CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.142 Northern potato crop insurance provisions. The Northern Potato Crop Insurance Provisions for the 2008 and succeeding...

  5. Executive Summary: Forests of the Northern United States

    Science.gov (United States)

    Stephen R. Shifley; Francisco X. Aguilar; Nianfu Song; Susan I. Stewart; David J. Nowak; Dale D. Gormanson; W. Keith Moser; Sherri Wormstead; Eric J. Greenfield

    2012-01-01

    This executive summary provides an overview of the 200-page report, Forests of the Northern United States, which covers in detail current forest conditions, recent trends, issues, threats and opportunities in the forests in the 20 Northern States. It provides a context for subsequent Northern Forest Futures Project analyses that will forecast alternative future...

  6. AREVA group overview; Presentation du groupe AREVA

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-02-08

    This document presents the Group Areva, a world nuclear industry leader, from a financial holding company to an industrial group, operating in two businesses: the nuclear energy and the components. The structure and the market of the group are discussed, as the financial assets. (A.L.B.)

  7. Overgroups of root groups in classical groups

    CERN Document Server

    Aschbacher, Michael

    2016-01-01

    The author extends results of McLaughlin and Kantor on overgroups of long root subgroups and long root elements in finite classical groups. In particular he determines the maximal subgroups of this form. He also determines the maximal overgroups of short root subgroups in finite classical groups and the maximal overgroups in finite orthogonal groups of c-root subgroups.

  8. Interagency mechanical operations group numerical systems group

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-09-01

    This report consists of the minutes of the May 20-21, 1971 meeting of the Interagency Mechanical Operations Group (IMOG) Numerical Systems Group. This group looks at issues related to numerical control in the machining industry. Items discussed related to the use of CAD and CAM, EIA standards, data links, and numerical control.

  9. Temporal trends in Inuit, First Nations and non-Aboriginal birth outcomes in rural and northern Quebec.

    Science.gov (United States)

    Simonet, Fabienne; Wilkins, Russell; Luo, Zhong-Cheng

    2012-01-01

    The objective was to assess trends in Inuit, First Nations and non-Aboriginal birth outcomes in the rural and northern regions of Quebec. In a birth cohort-based study of all births to residents of rural and northern Quebec from 1991 through 2000 (n = 177,193), we analyzed birth outcomes and infant mortality for births classified by maternal mother tongue (Inuit, First Nations or non-Aboriginal) and by community type (predominantly First Nations, Inuit or non-Aboriginal). From 1991-1995 to 1996-2000, there was a trend of increasing rates of preterm birth for all 6 study groups. In all rural and northern areas, low birth weight rates increased significantly only for the Inuit mother tongue group [RR1.45 (95% CI 1.05-2.01)]. Stillbirth rates showed a non-significant increase for the Inuit mother tongue group [RR1.76 (0.64-4.83)]. Neonatal mortality rates decreased significantly in the predominantly non-Aboriginal communities and in the non-Aboriginal mother tongue group [RR0.78 (0.66-0.92)], and increased non-significantly for the First Nations mother tongue group [RR2.17 (0.71-6.62)]. Perinatal death rates increased for the First Nations mother tongue grouping in northern areas [RR2.19 (0.99-4.85)]. There was a disconcerting rise of some mortality outcomes for births to First Nations and Inuit mother tongue women and to women in predominantly First Nations and Inuit communities, in contrast to some improvements for births to non-Aboriginal mother tongue women and to women in predominantly non-Aboriginal communities in rural or northern Quebec, indicating a need for improving perinatal and neonatal health for Aboriginal populations in rural and northern regions.

  10. Temporal trends in Inuit, First Nations and non-Aboriginal birth outcomes in rural and northern Quebec

    Directory of Open Access Journals (Sweden)

    Fabienne Simonet

    2012-06-01

    Full Text Available Objectives. The objective was to assess trends in Inuit, First Nations and non-Aboriginal birth outcomes in the rural and northern regions of Quebec. Study design and methods. In a birth cohort-based study of all births to residents of rural and northern Quebec from 1991 through 2000 (n = 177,193, we analyzed birth outcomes and infant mortality for births classified by maternal mother tongue (Inuit, First Nations or non-Aboriginal and by community type (predominantly First Nations, Inuit or non-Aboriginal. Results. From 1991–1995 to 1996–2000, there was a trend of increasing rates of preterm birth for all 6 study groups. In all rural and northern areas, low birth weight rates increased significantly only for the Inuit mother tongue group [RR1.45 (95% CI 1.05–2.01]. Stillbirth rates showed a non-significant increase for the Inuit mother tongue group [RR1.76 (0.64–4.83]. Neonatal mortality rates decreased significantly in the predominantly non-Aboriginal communities and in the non-Aboriginal mother tongue group [RR0.78 (0.66–0.92], and increased non-significantly for the First Nations mother tongue group [RR2.17 (0.71–6.62]. Perinatal death rates increased for the First Nations mother tongue grouping in northern areas [RR2.19 (0.99–4.85]. Conclusion. There was a disconcerting rise of some mortality outcomes for births to First Nations and Inuit mother tongue women and to women in predominantly First Nations and Inuit communities, in contrast to some improvements for births to non-Aboriginal mother tongue women and to women in predominantly non-Aboriginal communities in rural or northern Quebec, indicating a need for improving perinatal and neonatal health for Aboriginal populations in rural and northern regions.

  11. Theory of Lie groups

    CERN Document Server

    Chevalley, Claude

    2018-01-01

    The standard text on the subject for many years, this introductory treatment covers classical linear groups, topological groups, manifolds, analytic groups, differential calculus of Cartan, and compact Lie groups and their representations. 1946 edition.

  12. Introduction to Sporadic Groups

    Directory of Open Access Journals (Sweden)

    Luis J. Boya

    2011-01-01

    Full Text Available This is an introduction to finite simple groups, in particular sporadic groups, intended for physicists. After a short review of group theory, we enumerate the 1+1+16=18 families of finite simple groups, as an introduction to the sporadic groups. These are described next, in three levels of increasing complexity, plus the six isolated ''pariah'' groups. The (old five Mathieu groups make up the first, smallest order level. The seven groups related to the Leech lattice, including the three Conway groups, constitute the second level. The third and highest level contains the Monster group M, plus seven other related groups. Next a brief mention is made of the remaining six pariah groups, thus completing the 5+7+8+6=26 sporadic groups. The review ends up with a brief discussion of a few of physical applications of finite groups in physics, including a couple of recent examples which use sporadic groups.

  13. Vignapandeyana (Fabaceae), a new species from northern Western Ghats, India.

    Science.gov (United States)

    Gaikwad, Sayajirao; Gore, Ramchandra; Randive, Sonali

    2015-01-01

    Vigna subg. Ceratotropis (Piper) Verdc. represents a homogenous and distinct group of species with highly specialized complex floral characters. It is most diverse in Asia. India, with 24 species, represents a secondary center of species diversity of the subgenus. A new species, Vignapandeyana RD Gore, SP Gaikwad & SD Randive, is described from hill slopes of the northern Western Ghats of India. It resembles Vignayadavii Gaikwad et al. and Vignadalzelliana (Kuntze) Verdc. but differs from the latter in its dimorphic shoots (some subterranean, with cleistogamous flowers) and densely hairy pods, from the former by its curved style, flattened style beak, foveolate seed coat and absence of standard protuberance and horn-like keel pocket in cleistogamous flowers.

  14. A renewable energy and hydrogen scenario for northern Europe

    DEFF Research Database (Denmark)

    Sørensen, Bent

    2008-01-01

    renewable energy supply system is demonstrated with the use of the seasonal reservoir-based hydrocomponents in the northern parts of the region. The outcome of the competition between biofuels and hydrogen in the transportation sector is dependent on the development of viable fuel cells and on efficient......A scenario based entirely on renewable energy with possible use of hydrogen as an energy carrier is constructed for a group of North European countries. Temporal simulation of the demand-supply matching is carried out for various system configurations. The role of hydrogen technologies for energy...... of energy trade between the countries, due to the different endowments of different countries with particular renewable energy sources, and to the particular benefit that intermittent energy sources, such as wind and solar, can derive from exchange of power. The establishment of a smoothly functioning...

  15. Engendering social suffering: a Chinese diasporic community in northern Thailand.

    Science.gov (United States)

    Huang, Shu-Min

    2014-01-01

    This paper examines how reproducing Chineseness has become a source of social suffering through the case study of a group of Yunnan Chinese who escaped Chinese communist rules in the Mainland in 1949 or shortly after and settled in northern Thailand in the 1960s. As self-proclaimed carriers of traditional Chinese culture, they worked arduously to replicate whatever they considered 'authentic' Chinese through a narrow interpretation of the Confucian moral tenets in daily life. The (re)establishment of a patriarchal social order in Thailand - a society with a relatively high level of gender-equality, has inflicted tremendous pain and suffering among women and youth in this reified society. Ethnographic fieldwork, upon which this paper was based, was conducted in Maehong Village, Chiang Mai Province, between 2002 and 2007.

  16. Prevalence of infectious diseases in feral cats in Northern Florida.

    Science.gov (United States)

    Luria, Brian J; Levy, Julie K; Lappin, Michael R; Breitschwerdt, Edward B; Legendre, Alfred M; Hernandez, Jorge A; Gorman, Shawn P; Lee, Irene T

    2004-10-01

    Objectives of this study were to determine prevalence of infection in feral cats in Northern Florida with a select group of infectious organisms and to determine risk factors for infection. Blood samples or sera from 553 cats were tested with a panel of antibody, antigen or PCR assays. Male cats were at higher risk for FIV, Mycoplasma haemofelis, and M. haemominutum. Infection with either FeLV or FIV was associated with increased risk for coinfection with the other retrovirus, M. haemofelis, or M. haemominutum. Bartonella henselae had the highest prevalence and was the only organism that did not have any associated risk for coinfection with other organisms. Feral cats in this study had similar or lower prevalence rates of infections than those published for pet cats in the United States. Thus, feral cats assessed in this study appear to be of no greater risk to human beings or other cats than pet cats.

  17. Knee injuries in skiing. A prospective study from northern Sweden.

    Science.gov (United States)

    Edlund, G; Gedda, S; Hemborg, A

    1980-01-01

    This paper evaluates 420 ski injuries occurring in Northern Sweden in 1977. Our main aim was to correlate knee injuries with types of skiing and to note a change in incidence with evolution of equipment. Fifty-eight lesions (13.8%) affected the knee joint which is about the same frequency as 10 years earlier nor has introduction of high stiff boots in downhill skiing increased incidence of knee injuries. Cross-country and long-distance skiing produced more knee injuries (24.7%) than downhill skiing (11.4%). Cross-country skiers were older and more women in this group sustained knee injuries. The use of non-release type bindings is probably the main reason for this higher incidence but age and different skiing techniques seem to contribute.

  18. Amphibians of the northern Great Plains

    Science.gov (United States)

    Larson, Diane L.; Euliss, Ned H.; Lannoo, Michael J.; Mushet, David M.; Mac, M.J.; Opler, P.A.; Puckett Haecker, C. E.; Doran, P.D.

    1998-01-01

    No cry of alarm has been sounded over the fate of amphibian populations in the northern grasslands of North America, yet huge percentages of prairie wetland habitat have been lost, and the destruction continues. Scarcely 30% of the original mixedgrass prairie remains in Nebraska, South Dakota, and North Dakota (See Table 1 in this chapter). If amphibian populations haven’t declined, why haven’t they? Or, have we simply failed to notice? Amphibians in the northern grasslands evolved in a boom-or-bust environment: species that were unable to survive droughts lasting for years died out long before humans were around to count them. Species we find today are expert at seizing the rare, wet moment to rebuild their populations in preparation for the next dry season. When numbers can change so rapidly, who can say if a species is rare or common? A lot depends on when you look.

  19. Trace gas fluxes from northern peatlands

    Energy Technology Data Exchange (ETDEWEB)

    Moore, T [McGill Univ., Montreal (Canada). Geography Dept.

    1997-12-31

    Peatlands cover large areas in northern environments: 1.1, 0.1 and 1.7 x 10{sup 4} km{sup 2} in Canada, Finland and the former Soviet Union, respectively. Interest has been generated into the role these extensive areas of peatlands play in controlling the chemistry of the atmosphere. In particular, it has become established that peatlands can be a source of methane (CH{sub 4}) and nitrous oxide (N{sub 2}O), and a sink of carbon dioxide (CO{sub 2}), the latter through the rates of plant production exceeding the rate of decomposition of plant material and peat. In this presentation the recent advances in trace gas flux measurements in northern peatlands are presented. (16 refs.)

  20. Aisle-truss houses of Northern Jutland

    DEFF Research Database (Denmark)

    Eybye, Birgitte Tanderup

    2014-01-01

    The aisle-truss houses of Northern Jutland were built under hard conditions, such as harsh climate and scarce resources. Hence, the aisle-truss houses display a number of resource-saving and sustainable building principles, including the arcade construction and the use of passive energy strategies......, which make them relevant to research. This paper investigates resource-saving and sustainable principles in the aisle-truss houses of Thy, Northern Jutland. General features as well as three cases of the one-wing dwelling aisle-truss houses are studied. The aim is to improve the understanding of aisle......-truss houses. Another aim is to suggest strategies for modern sustainable building on the basis of the identified principles in aisle-truss houses....

  1. Uranium and thorium deposits of Northern Ontario

    International Nuclear Information System (INIS)

    Robertson, J.A.; Gould, K.L.

    1983-01-01

    This, the second edition of the uranium-thorium deposit inventory, describes briefly the deposits of uranium and/or thorium in northern Ontario, which for the purposes of this circular is defined as that part of Ontario lying north and west of the Grenville Front. The most significant of the deposits described are fossil placers lying at or near the base of the Middle Precambrian Huronian Supergroup. These include the producing and past-producing mines of the Elliot Lake - Agnew Lake area. Also included are the pitchblende veins spatially associated with Late Precambrian (Keweenawan) diabase dikes of the Theano Point - Montreal River area. Miscellaneous Early Precambrian pegmatite, pitchblende-coffinite-sulphide occurrences near the Middle-Early Precambrian unconformity fringing the Lake Superior basin, and disseminations in diabase, granitic rocks, alkalic complexes and breccias scattered throughout northern Ontario make up the rest of the occurrences

  2. Trace gas fluxes from northern peatlands

    Energy Technology Data Exchange (ETDEWEB)

    Moore, T. [McGill Univ., Montreal (Canada). Geography Dept.

    1996-12-31

    Peatlands cover large areas in northern environments: 1.1, 0.1 and 1.7 x 10{sup 4} km{sup 2} in Canada, Finland and the former Soviet Union, respectively. Interest has been generated into the role these extensive areas of peatlands play in controlling the chemistry of the atmosphere. In particular, it has become established that peatlands can be a source of methane (CH{sub 4}) and nitrous oxide (N{sub 2}O), and a sink of carbon dioxide (CO{sub 2}), the latter through the rates of plant production exceeding the rate of decomposition of plant material and peat. In this presentation the recent advances in trace gas flux measurements in northern peatlands are presented. (16 refs.)

  3. Presence of third molars in orthodontic patients from northern Greece

    Directory of Open Access Journals (Sweden)

    Barka G

    2012-05-01

    Full Text Available Georgia Barka,1 Georgios Tretiakov,1 Theodosios Theodosiou,2 Ioulia Ioannidou-Marathiotou31School of Dentistry, 2Biostatistics, Department of Informatics, School of Natural Sciences, 3Department of Orthodontics, School of Dentistry, Aristotle University of Thessaloniki, Thessaloniki, GreeceObjective: The purpose of the present study was to investigate the frequency of presence of third molar teeth and their distribution in each jaw and each side, according to sex, in a group of orthodontic patients with permanent dentition from northern Greece.Methods: The sample included panoramic radiographs from 220 patients with permanent dentition (mean age 13.62 ± 1.81. The Χ2 test was used to assess the relationships between the variables, and the Fisher's exact test was used in cases where the expected frequencies in each cell were <5.Results: The frequency of third molar presence was 79.1%, and 20.9% was the frequency of third molar agenesis. Intersexual differences in the number of third molars was not statistically significant. There was a correlation between the distribution of third molars on the right and the left side (Fisher's exact test = 100.788; P = 0. The two sides showed the same tendency toward the presence or absence of third molars. A correlation was also found between the distribution of maxillary and mandibular third molars (Fisher's exact test = 24.372; P = 0. In each jaw, the presence or absence of third molars was highly related to the number of third molars found in the other jaw.Conclusion: The present results showed that in this orthodontic group of northern Greek patients, presence accounted for 79.1% and agenesis for 20.9%. No significant difference was found between the frequencies of third molar presence on the left and right sides in either the maxilla or mandible.Keywords: third molars, presence, orthodontic population, Greeks

  4. Biomass utilization at Northern States Power Company

    International Nuclear Information System (INIS)

    Ellis, R.P.

    1994-01-01

    Northern States Power Company (open-quotes NSPclose quotes) generates, transmits and distributes electricity and distributes natural gas to customers in Minnesota, Wisconsin, North Dakota, South Dakota and Michigan. An important and growing component of the fuel needed to generate steam for electrical production is biomass. This paper describes NSP's historical use of biomass, current biomass resources and an overview of how NSP plans to expand its use of biomass in the future

  5. Food irradiation - a Northern Ireland dimension

    International Nuclear Information System (INIS)

    McMurray, C.H.; Stevenson, M.H.

    1988-01-01

    Irradiation is a technology which has been exploited in a wide variety of industries ranging from sterilization of medical products and polymer modification to applications with respect to food. Whilst food irradiation has recently become a controversial subject, the process has been studied for many years. Many products could be irradiated to advantage and these need to be thoroughly investigated before final recommendations can be made as to the commercial feasibility and suitability of the processing technology in the Northern Ireland context

  6. Making 3D movies of Northern Lights

    Science.gov (United States)

    Hivon, Eric; Mouette, Jean; Legault, Thierry

    2017-10-01

    We describe the steps necessary to create three-dimensional (3D) movies of Northern Lights or Aurorae Borealis out of real-time images taken with two distant high-resolution fish-eye cameras. Astrometric reconstruction of the visible stars is used to model the optical mapping of each camera and correct for it in order to properly align the two sets of images. Examples of the resulting movies can be seen at http://www.iap.fr/aurora3d

  7. Recent climate changes in the northern hemisphere

    International Nuclear Information System (INIS)

    Trenberth, K.E.

    1990-01-01

    The consistency of analyzed changes in surface wind stress, sea level pressures and surface temperatures between 1980-86 and previous periods indicates the reality of statistically significant and substantial climate changes in the Northern Hemisphere, especially over the North Pacific, on decadal time scales. Cooling in North Pacific sea surface temperatures and warming along the west coast of North America and Alaska are ascribed mainly to the changes in thermal advection associated with a deeper and more extensive Aleutian Low

  8. Las poblaciones de Phytophthora infestans presentes en papa en el altiplano Cundiboyacense en 1996 son monomórficas para la enzima glucosa-6-fosfato Isomerasa Populations of Phytophthora infestans present on potato in the Cundinamarca and Boyacá plateau in 1996 are monomorphic for glucose-6-phosphate isomerase

    Directory of Open Access Journals (Sweden)

    Gualtero Cúellar Elsa Janeth

    1998-06-01

    Full Text Available La gota de la papa. causada por Phytophthora infestans. es responsable, en gran medida. de la disminución de la producción de este cultivo en el altiplano Cundiboyacense. Hasta el momento, el control de la gota se ha basado, principalmente, en la aplicación de fungicidas. La observación
    de una mayor variabilidad genética en las poblaciones del patógeno en varios caracteres, incluyendo la sensibilidad a fungicidas. ha mostrado la necesidad de conocer la estructura genética de las poblaciones locales: por esto se realizó una caracterización aloenzimática de las poblaciones de P infestans en Cundinamarca y Boyacá a través de glucosa-6-fosfato isomerasa (GPI lo cual permitió determinar su naturaleza clonal. En efecto todos los aislamientos locales evaluados presentaron genotipo 100/100 para GPI, es decir. fueron homocigotos monomórficos. El aislamiento Ro presentó un genotipo 86/100 que, al ser comparado
    con aislamientos de Estados Unidos, corresponde al linaje US-1. El aislamiento MT2 presentó un genotipo 84/100. Estos aislamientos corresponden a poblaciones heterocigotas que pueden ser el resultado de la reproducción sexual. El aislamiento HIN presentó un genotipo 100/100 coincidiendo con los aislamientos locales: este aislamiento es del tipo de apareamiento A1, y por comparación con aislamientos de Estados Unidos, corresponde al linaje US-6. este linaje representa una de las primeras migraciones de México a Estados Unidos, Europa y luego al resto del mundo anteriores a la migración del tipo A2. Los resultados de los análisis indicaron que las poblaciones locales no presentan diversidad, siendo por tanto de origen clonal; estos resultados están de acuerdo con la evaluación de las mismas poblaciones por  sensibilidad a metalaxil y tipo de apareamiento (González, 1997. Las poblaciones de P infestans de las localidades muestreadas en el altiplano Cundiboyacense son clonales y están constituidas por un s

  9. A regional soil and sediment geochemical study in northern California

    International Nuclear Information System (INIS)

    Goldhaber, Martin B.; Morrison, Jean M.; Holloway, JoAnn M.; Wanty, Richard B.; Helsel, Dennis R.; Smith, David B.

    2009-01-01

    Regional-scale variations in soil geochemistry were investigated in a 20,000-km 2 study area in northern California that includes the western slope of the Sierra Nevada, the southern Sacramento Valley and the northern Coast Ranges. Over 1300 archival soil samples collected from the late 1970s to 1980 in El Dorado, Placer, Sutter, Sacramento, Yolo and Solano counties were analyzed for 42 elements by inductively coupled plasma-atomic emission spectrometry and inductively coupled plasma-mass spectrometry following a near-total dissolution. These data were supplemented by analysis of more than 500 stream-sediment samples from higher elevations in the Sierra Nevada from the same study site. The relatively high-density data (1 sample per 15 km 2 for much of the study area) allows the delineation of regional geochemical patterns and the identification of processes that produced these patterns. The geochemical results segregate broadly into distinct element groupings whose distribution reflects the interplay of geologic, hydrologic, geomorphic and anthropogenic factors. One such group includes elements associated with mafic and ultramafic rocks including Cr, Ni, V, Co, Cu and Mg. Using Cr as an example, elevated concentrations occur in soils overlying ultramafic rocks in the foothills of the Sierra Nevada (median Cr = 160 mg/kg) as well as in the northern Coast Ranges. Low concentrations of these elements occur in soils located further upslope in the Sierra Nevada overlying Tertiary volcanic, metasedimentary and plutonic rocks (granodiorite and diorite). Eastern Sacramento Valley soil samples, defined as those located east of the Sacramento River, are lower in Cr (median Cr = 84 mg/kg), and are systematically lower in this suite compared to soils from the west side of the Sacramento Valley (median Cr = 130 mg/kg). A second group of elements showing a coherent pattern, including Ca, K, Sr and REE, is derived from relatively silicic rocks types. This group occurs at elevated

  10. A regional soil and sediment geochemical study in northern California

    Science.gov (United States)

    Goldhaber, M.B.; Morrison, J.M.; Holloway, J.M.; Wanty, R.B.; Helsel, D.R.; Smith, D.B.

    2009-01-01

    Regional-scale variations in soil geochemistry were investigated in a 20,000-km2 study area in northern California that includes the western slope of the Sierra Nevada, the southern Sacramento Valley and the northern Coast Ranges. Over 1300 archival soil samples collected from the late 1970s to 1980 in El Dorado, Placer, Sutter, Sacramento, Yolo and Solano counties were analyzed for 42 elements by inductively coupled plasma-atomic emission spectrometry and inductively coupled plasma-mass spectrometry following a near-total dissolution. These data were supplemented by analysis of more than 500 stream-sediment samples from higher elevations in the Sierra Nevada from the same study site. The relatively high-density data (1 sample per 15 km2 for much of the study area) allows the delineation of regional geochemical patterns and the identification of processes that produced these patterns. The geochemical results segregate broadly into distinct element groupings whose distribution reflects the interplay of geologic, hydrologic, geomorphic and anthropogenic factors. One such group includes elements associated with mafic and ultramafic rocks including Cr, Ni, V, Co, Cu and Mg. Using Cr as an example, elevated concentrations occur in soils overlying ultramafic rocks in the foothills of the Sierra Nevada (median Cr = 160 mg/kg) as well as in the northern Coast Ranges. Low concentrations of these elements occur in soils located further upslope in the Sierra Nevada overlying Tertiary volcanic, metasedimentary and plutonic rocks (granodiorite and diorite). Eastern Sacramento Valley soil samples, defined as those located east of the Sacramento River, are lower in Cr (median Cr = 84 mg/kg), and are systematically lower in this suite compared to soils from the west side of the Sacramento Valley (median Cr = 130 mg/kg). A second group of elements showing a coherent pattern, including Ca, K, Sr and REE, is derived from relatively silicic rocks types. This group occurs at elevated

  11. Wildfires in northern Siberian larch dominated communities

    International Nuclear Information System (INIS)

    Kharuk, Viacheslav I; Dvinskaya, Maria L; Im, Sergey T; Ranson, Kenneth J

    2011-01-01

    The fire history of the northern larch forests within the permafrost zone in a portion of northern Siberia (∼66°N, 100°E) was studied. Since there is little to no human activity in this area, fires within the study area were mostly caused by lightning. Fire return intervals (FRI) were estimated on the basis of burn marks on tree stems and dates of tree natality. FRI values varied from 130 to 350 yr with a 200 ± 50 yr mean. For southerly larch dominated communities, FRI was found to be shorter (77 ± 20 yr at ∼ 61°N, and 82 ± 7 at 64°N), and it was longer at the northern boundary (∼71°) of larch stands (320 ± 50 yr). During the Little Ice Age period in the 16th–18th centuries, FRI was approximately twice as long those as recorded in this study. Fire caused changes in the soil including increases in soil drainage and permafrost thawing depth, and a radial growth increase to about twice the background value (with more than six times observed in extreme cases). This effect may simulate the predicted warming impact on the larch growth in the permafrost zone.

  12. Pacific Northern Gas Ltd. annual report 2002

    International Nuclear Information System (INIS)

    2003-01-01

    Pacific Northern Gas Ltd. operates in west-central and northeast British Columbia. The company delivers natural gas to customers through a transmission pipeline connected to Duke Energy system near Summit Lake, British Columbia. This report states that in 2002 financial results were disappointing. The company's net income in 2002 was lower than it was in 2001 ($4.6 million versus $5.7 million). In December 2002, Pacific Northern Gas Ltd. completed $15 million in financing. Additions to property, plant and equipment reached a total of $6 million in 2002. A new, seven-year contract with Methanex Corporation was successfully negotiated. Pacific Northern Gas Ltd. filed revenue requirements applications with the British Columbia Utilities Commission, seeking the Commission's approval of rates for 2003 and requesting approval of a new deferral account in all divisions. A settlement of the western system 2003 revenue requirements application was negotiated with its customers. The annual report presented a highlight of all activities, including corporate governance and management discussions and analysis. Consolidated financial statements were also provided. tabs

  13. Detailed radon emanation mapping in Northern Latium

    International Nuclear Information System (INIS)

    Aumento, F.

    1993-01-01

    Detailed radon surveys over 5,000 km 2 of Northern Latium, covering the northern part of the volcanic province of Central Italy, commenced in the mid eighties as part of a geothermal exploration programme; the surveys have subsequently been continued and amplified with environmental protection in mind. The area is now covered by ground emission maps, radon levels in water supplies, emissions from the different lithologies and concentrations in houses. The high uraniferous content of the volcanics, the porous nature of the ubiquitous pyroclastics, and active geothermal systems in the area combine to convey to ground level high concentrations of radon. The emissions show strong lateral variations which are geologically and tectonically controlled, such that only detailed surveys reveal the extent and locations of anomalous radon emanations. Unfortunately, long ago towns often developed in strategic locations. For Northern Latium this means on volcanic highs formed by faulted tuff blocks, two geological features associated with particularly high radon emissions. As a result, in contrast to the low average indoor radon concentrations for the greater part of Italy, in some of these town the average values exceed 450 Bq/m 3 . (author). 1 fig

  14. Time, space, and composition relations among northern Nevada intrusive rocks and their metallogenic implications

    Science.gov (United States)

    duBray, E.A.

    2007-01-01

    Northern Nevada contains ∼360 igneous intrusions subequally distributed among three age groups: middle Tertiary, Cretaceous, and Jurassic. These intrusions are dominantly granodiorite and monzogranite, although some are more mafic. Major-oxide and trace-element compositions of intrusion age groups are remarkably similar, forming compositional arrays that are continuous, overlapping, and essentially indistinguishable. Within each age group, compositional diversity is controlled by a combination of fractional crystallization and two-component mixing. Mafic intrusions represent mixing of mantle-derived magma and assimilated continental crust, whereas intermediate to felsic intrusions evolved by fractional crystallization. Several petrologic parameters suggest that the northern Nevada intrusion age groups formed in a variety of subduction-related, magmatic arc settings: Jurassic intrusions were likely formed during backarc, slab-window magmatism related to breakoff of the Mezcalera plate; Cretaceous magmatism was related to rapid, shallow subduction of the Farallon plate and consequent inboard migration of arc magmatism; and Tertiary magmatism initially swept southward into northern Nevada in response to foundering of the Farallon plate and was followed by voluminous Miocene bimodal magmatism associated with backarc continental rifting.

  15. Group Work: How to Use Groups Effectively

    Science.gov (United States)

    Burke, Alison

    2011-01-01

    Many students cringe and groan when told that they will need to work in a group. However, group work has been found to be good for students and good for teachers. Employers want college graduates to have developed teamwork skills. Additionally, students who participate in collaborative learning get better grades, are more satisfied with their…

  16. Findings: LANL outsourcing focus groups

    Energy Technology Data Exchange (ETDEWEB)

    Jannotta, M.J.; McCabe, V.B.

    1996-12-31

    In March 1996, a series of 24 3-hour dialog focus groups were held with randomly selected Laboratory employees and contractors to gain their perceptions regarding potentials and problems for privatization and consolidation. A secondary goal was to educate and inform the workforce about potentials and issues in privatization and consolidation. Two hundred and thirty-six participants engaged in a learning session and structured input exercises resulting in 2,768 usable comments. Comments were categorized using standard qualitative methods; resulting categories included positive and negative comments on four models (consolidation, spin offs, outsourcing, and corporate partnering) and implications for the workforce, the Laboratory, and the local economy. Categories were in the areas of increasing/decreasing jobs, expertise, opportunity/salary/benefits, quality/efficiency, and effect on the local area and economy. An additional concern was losing Laboratory culture and history. Data were gathered and categorized on employee opinion regarding elements of successful transition to the four models, and issues emerged in the areas of terms and conditions of employment; communication; involvement; sound business planning; ethics and fairness; community infrastructure. From the aggregated opinion of the participants, it is recommended that decision-makers: Plan using sound business principles and continually communicate plans to the workforce; Respect workforce investments in the Laboratory; Tell the workforce exactly what is going on at all times; Understand that economic growth in Northern New Mexico is not universally viewed as positive; and Establish dialog with stakeholders on growth issues.

  17. Free Boolean Topological Groups

    Directory of Open Access Journals (Sweden)

    Ol’ga Sipacheva

    2015-11-01

    Full Text Available Known and new results on free Boolean topological groups are collected. An account of the properties that these groups share with free or free Abelian topological groups and properties specific to free Boolean groups is given. Special emphasis is placed on the application of set-theoretic methods to the study of Boolean topological groups.

  18. Small Group Research

    Science.gov (United States)

    McGrath, Joseph E.

    1978-01-01

    Summarizes research on small group processes by giving a comprehensive account of the types of variables primarily studied in the laboratory. These include group structure, group composition, group size, and group relations. Considers effects of power, leadership, conformity to social norms, and role relationships. (Author/AV)

  19. Tracing Fukushima Radionuclides in the Northern Hemisphere -An Overview

    Science.gov (United States)

    Thakur, Punam; Ballard, Sally; Nelson, Roger

    2013-04-01

    A massive 9.0 earthquake and ensuing tsunami struck the northern coast of the Honshu-island, Japan on March 11, 2011 and severely damaged the electric system of the Fukushima- Daiichi Nuclear Power Plant (NPP). The structural damage to the plant disabled the reactor's cooling systems. Subsequent fires, a hydrogen explosion and possible partial core meltdowns released radioactive fission products into the atmosphere. The atmospheric release from the crippled Fukushima NPP started on March 12, 2011 with a maximum release phase from March 14 to 17. The radioactivity released was dominated by volatile fission products including isotopes of the noble gases xenon (Xe-133) and krypton (Kr-85); iodine (I-131,I-132); cesium (Cs-134,Cs-136,Cs-137); and tellurium (Te-132). The non-volatile radionuclides such as isotopes of strontium and plutonium are believed to have remained largely inside the reactor, although there is evidence of plutonium release into the environment. Global air monitoring across the northern hemisphere was increased following the first reports of atmospheric releases. According to the source term, declared by the Nuclear and Industrial Safety Agency (NISA) of Japan), approximately 160 PBq (1 PBq (Peta Becquerel = 10^15 Bq)) of I-131 and 15 PBq of Cs-137 (or 770 PBq "iodine-131 equivalent"), were released into the atmosphere. The 770 PBq figure is about 15% of the Chernobyl release of 5200 PBq of "iodine-131 equivalent". For the assessment of contamination after the accident and to track the transport time of the contaminated air mass released from the Fukushima NPP across the globe, several model calculations were performed by various research groups. All model calculations suggested long-range transport of radionuclides from the damaged Fukushima NPP towards the North American Continent to Europe and to Central Asia. As a result, an elevated level of Fukushima radionuclides were detected in air, rain, milk, and vegetation samples across the northern

  20. Resolving relationships between several Neolithic and Mesolithic populations in Northern Eurasia using geometric morphometrics.

    Science.gov (United States)

    Stansfield Bulygina, Ekaterina; Rasskasova, Anna; Berezina, Natalia; Soficaru, Andrei D

    2017-09-01

    Remains from several Eastern European and Siberian Mesolithic and Neolithic sites are analysed to clarify their biological relationships. We assume that groups' geographical distances correlate with genetic and, therefore, morphological distances between them. Material includes complete male crania from several Mesolithic and Neolithic burial sites across Northern Eurasia and from several modern populations. Geometric morphometrics and multivariate statistical techniques are applied to explore morphological trends, group distances, and correlations with their geographical position, climate, and the time of origin. Despite an overlap in the morphology among the modern and archeological groups, some of them show significant morphological distances. Geographical parameters account for only a small proportion of cranial variation in the sample, with larger variance explained by geography and age together. Expectations of isolation by distance are met in some but not in all cases. Climate accounts for a large proportion of autocorrelation with geography. Nearest-neighbor joining trees demonstrate group relationships predicted by the regression on geography and on climate. The obtained results are discussed in application to relationships between particular groups. Unlike the Ukrainian Mesolithic, the Yuzhny Oleni Ostrov Mesolithic displays a high morphological affinity with several groups from Northern Eurasia of both European and Asian origin. A possibility of a common substrate for the Yuzhny Oleni Ostrov Mesolithic and Siberian Neolithic groups is reviewed. The Siberian Neolithic is shown to have morphological connection with both modern Siberian groups and the Native North Americans. © 2017 Wiley Periodicals, Inc.

  1. Hygiene and sanitation promotion strategies among ethnic minority communities in Northern Vietnam

    DEFF Research Database (Denmark)

    Rheinländer, Thilde; Thanh Xuan, Le Thi; Ngoc Hoat, Luu

    2012-01-01

    on frontline promoters to perform effective behaviour change communication. It is also recommended to support more participatory and community-based initiatives, which can address the complex socio-economic and cultural determinants of health in multi-ethnic population groups. These lessons learned can improve......Effective rural hygiene and sanitation promotion (RHSP) is a major challenge for many low-income countries. This paper investigates strategies and stakeholders' roles and responsibilities in RHSP implementation in a multi-ethnic area of northern Vietnam, in order to identify lessons learned...... for future RHSP.A stakeholder analysis was performed, based on 49 semi-structured individual interviews and one group interview with stakeholders in RHSP in a northern province of Vietnam. Participants came from three sectors (agriculture, health and education), unions supported by the Vietnamese government...

  2. Geometric group theory

    CERN Document Server

    Druţu, Cornelia

    2018-01-01

    The key idea in geometric group theory is to study infinite groups by endowing them with a metric and treating them as geometric spaces. This applies to many groups naturally appearing in topology, geometry, and algebra, such as fundamental groups of manifolds, groups of matrices with integer coefficients, etc. The primary focus of this book is to cover the foundations of geometric group theory, including coarse topology, ultralimits and asymptotic cones, hyperbolic groups, isoperimetric inequalities, growth of groups, amenability, Kazhdan's Property (T) and the Haagerup property, as well as their characterizations in terms of group actions on median spaces and spaces with walls. The book contains proofs of several fundamental results of geometric group theory, such as Gromov's theorem on groups of polynomial growth, Tits's alternative, Stallings's theorem on ends of groups, Dunwoody's accessibility theorem, the Mostow Rigidity Theorem, and quasiisometric rigidity theorems of Tukia and Schwartz. This is the f...

  3. Profinite graphs and groups

    CERN Document Server

    Ribes, Luis

    2017-01-01

    This book offers a detailed introduction to graph theoretic methods in profinite groups and applications to abstract groups. It is the first to provide a comprehensive treatment of the subject. The author begins by carefully developing relevant notions in topology, profinite groups and homology, including free products of profinite groups, cohomological methods in profinite groups, and fixed points of automorphisms of free pro-p groups. The final part of the book is dedicated to applications of the profinite theory to abstract groups, with sections on finitely generated subgroups of free groups, separability conditions in free and amalgamated products, and algorithms in free groups and finite monoids. Profinite Graphs and Groups will appeal to students and researchers interested in profinite groups, geometric group theory, graphs and connections with the theory of formal languages. A complete reference on the subject, the book includes historical and bibliographical notes as well as a discussion of open quest...

  4. Phylogenetic Analysis of a Novel Molecular Isolate of Spotted Fever Group Rickettsiae from Northern Peru

    National Research Council Canada - National Science Library

    Jiang, Ju; Blair, Patrick J; Felices, Vidal; Moron, Cecilia; Cespedes, Manuel; Anaya, Elizabeth; Schoeler, George B; Sumner, John W; Olson, James G; Richards, Allen L

    2005-01-01

    ... (SFG) rickettsia. Following nested polymerase chain reaction (PCR) amplification of the 17-kDa gene, gltA, ompB, ompA, and sca4, amplicons were purified, sequenced, and compared to those downloaded from GenBank...

  5. Characterization of Spotted Fever Group Rickettsiae in Flea and Tick Specimens From Northern Peru

    National Research Council Canada - National Science Library

    Blair, Patrick J; Jiang, Ju; Schoeler, George B; Moron, Cecilia; Anaya, Elizabeth; Cespedes, Manuel; Cruz, Christopher; Felices, Vidal; Guevara, Carolina; Mendoza, Leonardo; Villaseca, Pablo; Sumner, John W; Richards, Allen L; Olson, James G

    2004-01-01

    ... the focus of an outbreak of febrile disease in humans attributed, in part, to SFG rickettsia infections. Molecular identification of the etiologic agents from these samples was determined after partial sequencing of the 17-kDa common antigen gene...

  6. Characterization of Spotted Fever Group Rickettsiae in Flea and Tick Specimens From Northern Peru

    Science.gov (United States)

    2004-11-01

    boliviensis 3 (18.7) 1 (6.2) Ixodes pararicinus 2 (12.5) 0 Flea speciesb Adoratopsilla intermedia 2 (3.4) 0 Ctenocephalides felis 33 (55.9) 2 (3.4...analysis of a genus-common rickettsial antigen gene. J. Bacteriol. 171:5199–5201. 3. Azad, A. F., S. Radulovic, J. A. Higgins , B. H. Noden, and J. M...Y. Acad. Sci. 990:57–61. 21. Hackstadt, T. 1996. The biology of rickettsiae. Infect. Agents Dis. 5:127–143. 22. Higgins , J. A., S. Radulovic, M. E

  7. Forest conflict in Thailand: northern minorities in focus.

    Science.gov (United States)

    Hares, Minna

    2009-03-01

    This paper aims at exploring the local background of and solutions to the forest conflict in upland areas inhabited by ethnic minorities, who are called hill tribes, in northern Thailand. A so-called hill tribe problem has been officially identified as a result of the slash-and-burn cultivation and other perceived problems, such as opium poppy cultivation, illegal immigration, and the suspicion of disloyalty to the state. This has created distrust and tension between the groups and authorities. The local conflict has recently been related to the dilemma of conserving the forest from all human interference, while many people live and make their livelihood within and adjacent to the protected areas. Furthermore, as the results imply, strictly protected areas and reforestation have also increased the competition over land and natural resources and, thereby, the likelihood of local conflicts. The scarcity and pollution of water, illegal logging, and poor fire control have contributed to the conflicts between local communities. The conflicts between the local communities and officials have been nourished by political and public discussions. Using definitions and terms with negative connotations and ignoring the heterogeneity between the groups or labeling some groups as malevolent have increased distrust and strengthened existing stereotypical images. Conflict resolution starts with efforts toward better mutual understanding, and changes in structures and attitudes are necessary. Local cooperation, utilization of traditional methods, and local institutions are central to conflict solving.

  8. Forest Conflict in Thailand: Northern Minorities in Focus

    Science.gov (United States)

    Hares, Minna

    2009-03-01

    This paper aims at exploring the local background of and solutions to the forest conflict in upland areas inhabited by ethnic minorities, who are called hill tribes, in northern Thailand. A so-called hill tribe problem has been officially identified as a result of the slash-and-burn cultivation and other perceived problems, such as opium poppy cultivation, illegal immigration, and the suspicion of disloyalty to the state. This has created distrust and tension between the groups and authorities. The local conflict has recently been related to the dilemma of conserving the forest from all human interference, while many people live and make their livelihood within and adjacent to the protected areas. Furthermore, as the results imply, strictly protected areas and reforestation have also increased the competition over land and natural resources and, thereby, the likelihood of local conflicts. The scarcity and pollution of water, illegal logging, and poor fire control have contributed to the conflicts between local communities. The conflicts between the local communities and officials have been nourished by political and public discussions. Using definitions and terms with negative connotations and ignoring the heterogeneity between the groups or labeling some groups as malevolent have increased distrust and strengthened existing stereotypical images. Conflict resolution starts with efforts toward better mutual understanding, and changes in structures and attitudes are necessary. Local cooperation, utilization of traditional methods, and local institutions are central to conflict solving.

  9. Group purchasing: an overview.

    Science.gov (United States)

    Wetrich, J G

    1987-07-01

    The various types and operational methods of purchasing groups are described, and evaluation of groups is discussed. Since group purchasing is increasing in popularity as a method of controlling drug costs, community and hospital pharmacy managers may need to evaluate various groups to determine the appropriateness of their services. Groups are categorized as independent, system based, or alliance or association based. Instead of "purchasing," some groups develop contracts for hospitals, which then purchase directly from the vendor. Aside from this basic difference between groups that purchase and groups that contract, comparisons among groups are difficult because of the wide variation in sizes and services. Competition developing from diversification among groups has led to "super groups," formed from local and regional groups. In evaluating groups, advantages and disadvantages germane to accomplishing the member's objectives must be considered. To ensure a group's success, members must be committed and support the group's philosophies; hospital pharmacists must help to establish a strong formulary system. To select vendors, groups should develop formal qualification and selection criteria and should not base a decision solely on price. The method of solicitation (bidding or negotiating), as well as the role of the prime vendor, should be studied. Legal implications of group purchasing, especially in the areas of administrative fees and drug diversion, must also be considered. The most advantageous group for each organization will include members with common missions and will be able to implement strategies for future success.

  10. CLINICAL PROFILE AND COMMON CAUSES OF HAEMOLYTIC ANAEMIA IN A TERTIARY CARE HOSPITAL, NORTHERN KERALA

    OpenAIRE

    Jog Antony; Reeta J; Sreelakshmi S; Rohit Mathew4; Adarsh Surendran

    2016-01-01

    BACKGROUND Haemolytic anaemia is a well-recognised clinical problem. This study looks into the clinical profile of haemolytic anaemia and also attempts to find out the common underlying causative disease. It also tries to group the patients according to the clinical manifestations and underlying causes. MATERIALS AND METHODS This is a hospital-based observational study conducted in a tertiary care centre in Northern Kerala. Forty-four adult patients with clinical manifestati...

  11. A Profile of the Northern Cape Province: Demographics, Poverty, Inequality and Unemployment

    OpenAIRE

    Pauw, Kalie

    2005-01-01

    This paper forms part of a series of papers that present profiles of South Africa's provinces, with a specific focus on key demographic statistics, poverty and inequality estimates, and estimates of unemployment. In this volume comparative statistics are presented for agricultural and non-agricultural households, as well as households from different racial groups, locations (metropolitan, urban and rural areas) and district municipalities of the Northern Cape. Most of the data presented are d...

  12. Preliminary survey of ticks (Acari : Ixodidae on cattle in northern Sudan

    Directory of Open Access Journals (Sweden)

    D.A. Salih

    2004-11-01

    Full Text Available In a cross sectional survey conducted during the period June 2001 to July 2002, the geographical distribution of ticks on cattle in the Sudan was determined. Seventeen locations were surveyed from Northern, Central, Eastern, Western, Blue Nile and White Nile Provinces. Total body collections of ticks were made from 20 cattle at each location. Four tick genera and 11 species were identified. The tick species collected included Amblyomma lepidum, Amblyomma variegatum, Boophilus decoloratus, Hyalomma anatolicum anatolicum, Hyalomma dromedarii, Hyalomma impeltatum, Hyalomma marginatum rufipes, Hyalomma truncatum, Rhipicephalus evertsi evertsi, Rhipicephalus sanguineus group and Rhipicephalus simus simus. Major ecological changes have occurred due to extensive animal movement, deforestation, desertification and establishment of large mechanized agricultural schemes. These factors have certainly affected the distribution of ticks and tick-borne diseases in the Sudan. The absence of A. variegatum and A. lepidum in northern Sudan was not surprising, since these tick species are known to survive in humid areas and not in the desert and semi-desert areas of northern Sudan. The absence of B. annulatus in northern and central Sudan is in accordance with the finding that this tick species is restricted to the southern parts of the central Sudan. The presence of H. anatolicum anatolicum in Um Benin in relatively high abundance is an interesting finding. The present finding may indicate that the southern limit of this species has changed and moved southwards to latitude 13o N. It is concluded that major changes in tick distribution have taken place in the Sudan

  13. Investigator Argus X-12 study on the population of northern Croatia

    Directory of Open Access Journals (Sweden)

    Josip Crnjac

    2016-10-01

    Full Text Available Abstract X chromosome STR typing has emerged recently as a powerful tool, complementary to autosomal STR typing, in solving complex forensic and missing person cases. Investigator® Argus X-12 is a commercial product that allows co-amplification of 12 X chromosomal markers belonging to four linkage groups (LGs. In this study, we analyzed by capillary electrophoresis blood samples from 100 females and 102 males from a population of northern Croatia. Statistical analysis included calculation of allele and haplotype frequencies, as well as forensic parameters. The most informative marker for the northern Croatia population was DXS10135 with PIC=0.9211 and a total of 27 alleles. The least polymorphic marker was DXS8378 with 6 alleles. The proportion of observed haplotypes from the number of possible haplotypes varied from 2.74–8.57% across all LGs, with LG1 being the most informative. Of the 11 tested world populations compared to the population of northern Croatia, significant differences in genetic distance (FST were found for Greenlandic and all non-European populations. We found that all tested markers are in HWE and can thus be used for match probability calculation. Because of high combined power of discrimination in both men and women, Investigator® Argus X-12 is applicable for the northern Croatia population in routine forensic casework.

  14. Practitioner survey of the state of health integration in environmental assessment: The case of northern Canada

    International Nuclear Information System (INIS)

    Noble, Bram; Bronson, Jackie

    2006-01-01

    Based on a case study of health integration in Canadian northern EA, this paper further demonstrates the lack of consistent integration of health in EA practice. A survey was administered to northern EA and health practitioners, administrators and special interest groups to assess current northern health assessment practices, the scope of health in EA, EA performance with regard to health assessment and the perceived barriers to health integration. Results suggest that health is currently recognized as an important component of northern EA and is addressed in the majority of cases; however, health is addressed primarily during the pre-decision stages of EA and less often during post-decision follow-up and monitoring. Moreover, when health is addressed, attention is limited to the physical components of health and health impacts due to physical environmental change, with considerably less attention given to the social aspects of health. Results also suggest dissent between EA practitioners, health practitioners and other interests concerning the overall state of health in EA; however, there is consensus on the key challenges to improved integration, namely differences in understanding of the scope of health and expectations of EA to assess health impacts; limited coordination between EA and health practitioners; limited scope and requirements of current EA legislation for health assessment; and the lack of supporting EA methods and frameworks

  15. From the Northern Eurasia Earth Science Partnership Initiative to the Northern Eurasia Future Initiative

    Science.gov (United States)

    Streletskiy, D. A.; Groisman, P. Y.; Shugart, H. H., Jr.; Gulev, S.; Maksyutov, S. S.; Qi, J.

    2017-12-01

    Since 2004, the Northern Eurasia Earth Science Partnership Initiative (NEESPI) - an interdisciplinary program of internationally-supported Earth systems and science research - has addressed large-scale and long-term manifestations of climate and environmental changes over Northern Eurasia and their impact on the Global Earth system. With 40 books and more than 1500 peer-reviewed journal publications to its credit, NEESPI's output can now be used to directly support decision-making for societal needs. Specifically, it was decided to shift gradually the foci of regional studies in Northern Eurasia towards applications with the following major Science Question: "What dynamic and interactive change(s) will affect societal well-being, activities, and health, and what might be the mitigation and adaptation strategies that could support sustainable development and decision-making activities in Northern Eurasia?" To answer this question requires a stronger socio-economic component in the ongoing and future regional studies focused on sustainable societal development under changing climatic and environmental conditions. The NEESPI Research Team has reorganized itself into "Northern Eurasia Future Initiative" (NEFI) and developed a new Science Plan released in June 2016. The Plan underwent a 6-month-long public review and was finalized at the end of 2016. Its description was thereafter split between two review papers: Groisman et al. (2017) and Monier et al. (2017). The first paper describes the Plan rationale and a new set of topical questions. The second paper describes a major modeling approach that will be employed in addressing the "what to do" questions of the NEFI Research (cf., presentation by Monier et al. at this Session). In the current presentation, we outline the new NEFI research foci and present latest NEFI findings including international projects in the Eurasian Arctic, boreal zone, and the Dry Land Belt of Northern Eurasia (cf., also presentations at sister

  16. Ordered groups and infinite permutation groups

    CERN Document Server

    1996-01-01

    The subjects of ordered groups and of infinite permutation groups have long en­ joyed a symbiotic relationship. Although the two subjects come from very different sources, they have in certain ways come together, and each has derived considerable benefit from the other. My own personal contact with this interaction began in 1961. I had done Ph. D. work on sequence convergence in totally ordered groups under the direction of Paul Conrad. In the process, I had encountered "pseudo-convergent" sequences in an ordered group G, which are like Cauchy sequences, except that the differences be­ tween terms of large index approach not 0 but a convex subgroup G of G. If G is normal, then such sequences are conveniently described as Cauchy sequences in the quotient ordered group GIG. If G is not normal, of course GIG has no group structure, though it is still a totally ordered set. The best that can be said is that the elements of G permute GIG in an order-preserving fashion. In independent investigations around that t...

  17. Violence against wives: a silent suffering in northern Saudi community.

    Science.gov (United States)

    Abo-Elfetoh, Nagah M; Abd El-Mawgod, Mohamed M

    2015-09-01

    Violence against women is a worldwide epidemic. It may take different forms depending on history, culture, background, and experiences, but it causes great suffering for women, their families, and the communities in which they live. Despite its high prevalence, no previous studies that have been conducted in Arar, northern area of Kingdom of Saudi Arabia (KSA), addressing this issue could be traced. The aim of this study was to measure the prevalence and determinants of violence experienced by ever-married women attending primary health centers in Arar city, Northern Border, KSA. This study is a cross-sectional study conducted during the period from January to June 2014 in Arar city in the Northern Province of the KSA. Data were collected through an interviewer-administered questionnaire. A total of 208 wives (184 currently married, 16 divorced, and eight widowed) attending five randomly selected primary healthcare centers in Arar, KSA, were interviewed. Collected data provided information on both physical and emotional violence. The study revealed that the overall prevalence of domestic violence in the studied group was 80.7 and 100.0% for physical and psychological violence, respectively. On studying the reasons for physical violence, half (50%) of the participants reported no clear cause, 19.2% reported failure to adequately care for children (such as cleaning, feeding, and dressing), and 7.8% reported causes related to poor scholastic achievement and couple conflict about appropriate approaches of upbringing of children. Suspicion on wife's fidelity was the most common form of psychological violence (21%). The perpetrator was the husband in 76.9% of cases and the husband's family was the perpetrator in 3.8% of cases. Physical violence was significantly higher during the first 10 years of marriage compared with other durations. University-educated husbands showed significantly lower percentage of physical violence against women compared with those of other

  18. DEVONIAN RUGOSE CORALS FROM THE KARAKORUM MOUNTAINS (NORTHERN PAKISTAN

    Directory of Open Access Journals (Sweden)

    STEFAN SCHRÖDER

    2004-11-01

    Full Text Available The Karakorum Block is regarded as a microplate of "Gondwanan" origin and was part of the Cimmerian continent ("Mega Lhasa" which rifted away from the northern margin of Gondwana during the Late Palaeozoic/Early Mesozoic. From the Northern Karakorum Range (Yarkhun and Karambar River Valleys: structurally belonging to the Northern Sedimentary Belt an Upper Givetian to Lower Frasnian rugose coral fauna of the Shogram Formation is described. The fauna is dominated by cosmopolitan genera such as Hexagonaria, Disphyllum, Macgeea and the Temnophyllum/Spinophyllum group, generally showing a geographically wide distribution, although being absent from the Eastern Americas Realm in the Upper Givetian/Lower Frasnian. Therefore its components are of little use for biogeographical deductions at sub-realm level, and in explaining the relation between the Karakorum Range and other Cimmerian crustal blocks. A remarkable exception is the first record of the genus Pseudopexiphyllum outside of Turkey, indicating a connection to the western part of the Cimmerides. On species level, the coral fauna of the Shogram Formation is characterized by the development of a diverse and rather unique fauna including about 35 taxa, that differs from the faunas known from neighbouring crustal blocks. So far, faunistic links to the Central Iranian Microcontinent (Yazd-, and Tabas-Block, the northwest Iranian Plate (Elburz, Central Pamir, the Lhasa Block and Western Qiangtang are not clear, and although each of these fragments are believed to be closely connected they were apparently not in direct contact during the Devonian. However, the Karakorum fauna is remarkably close to one known from the Helmand Block in Afghanistan, showing a very similar generic composition that includes numerous morphologically closely related, although not identical species. Accordingly, the restricted faunal exchange led to the development of new taxa. Distribution of the new species of Spinophyllum

  19. Comparison of minocycline and azithromycin for the treatment of mild scrub typhus in northern China.

    Science.gov (United States)

    Zhao, Minxing; Wang, Ting; Yuan, Xiaoyu; Du, Weiming; Lin, Miaoxin; Shen, Yanbo

    2016-09-01

    Scrub typhus, caused by Orientia tsutsugamushi, has recently emerged in northern China where the disease had not been known to exist. Although doxycycline and azithromycin are the recommended agents for the treatment of scrub typhus, clinical responses depend both on the susceptibilities of various O. tsutsugamushi strains and the severity of the disease. A retrospective analysis was conducted on patients diagnosed with mild scrub typhus from August 2013 to January 2016 in the Affiliated Hospital of Nantong University, northern China. A total of 40 patients who received minocycline treatment and 34 patients who received azithromycin treatment were included in the analysis. All patients except one defervesced within 120 h after initiating antimicrobial therapy. Kaplan-Meier curves in association with log-rank test showed that the median time to defervescence was significantly shorter for the minocycline-treated group than the azithromycin-treated group (P = 0.003). There were no serious adverse events during treatment. No relapse occurred in either group during the 1-month follow-up period. In conclusion, both minocycline and azithromycin are effective and safe for the treatment of mild scrub typhus, but minocycline is more active than azithromycin against O. tsutsugamushi infection acquired in northern China. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  20. Migratory bird habitat in relation to tile drainage and poorly drained hydrologic soil groups

    Science.gov (United States)

    Kastner, Brandi; Christensen, Victoria G.; Williamson, Tanja N.; Sanocki, Chris A.

    2016-01-01

    The Prairie Pothole Region (PPR) is home to more than 50% of the migratory waterfowl in North America. Although the PPR provides an abundance of temporary and permanent wetlands for nesting and feeding, increases in commodity prices and agricultural drainage practices have led to a trend of wetland drainage. The Northern Shoveler is a migratory dabbling duck species that uses wetland habitats and cultivated croplands in the PPR. Richland County in North Dakota and Roberts County in South Dakota have an abundance of wetlands and croplands and were chosen as the study areas for this research to assess the wetland size and cultivated cropland in relation to hydrologic soil groups for the Northern Shoveler habitat. This study used geographic information system data to analyze Northern Shoveler habitats in association with Natural Resource Conservation Service soil data. Habitats, which are spatially associated with certain hydrologic soil groups, may be at risk of artificial drainage installations because of their proximity to cultivated croplands and soil lacking in natural drainage that may become wet or inundated. Findings indicate that most wetlands that are part of Northern Shoveler habitats were within or adjacent to cultivated croplands. The results also revealed soil hydrologic groups with high runoff potential and low water transmission rates account for most of the soil within the Northern Shoveler‘s wetland and cropland habitats. Habitats near agriculture with high runoff potential are likely to be drained and this has the potential of reducing Northern Shoveler habitat.

  1. TAXONOMIC REVISION OF THE TIGRINA LEOPARDUS TIGRINUS (SCHREBER, 1775 SPECIES GROUP (CARNIVORA, FELIDAE

    Directory of Open Access Journals (Sweden)

    FABIO OLIVEIRA DO NASCIMENTO

    Full Text Available ABSTRACT The tigrina Leopardus tigrinus (Schreber, 1775 is a small-sized Neotropical spotted cat found from northern Argentina and southern Brazil to Costa Rica. Four subspecies are traditionally recognized: L. t. tigrinus (Schreber, 1775 from northern Brazil, the Guianas and eastern Venezuela; L. t. pardinoides (Gray, 1867 from western Venezuela, Colombia, Ecuador and Peru; L. t. guttulus (Hensel, 1872 from southern Brazil, Paraguay and northern Argentina; and L. t. oncillus (Thomas, 1903 from Costa Rica. We studied external and craniodental morphology in quantitative and qualitative terms from 250 specimens in order to clarify the taxonomic status of tigrina. Based on the characters analyzed in this study, we recognize three diagnosable morphogroups, each with a distinct geographic distribution: northern/northwestern/west (samples from northern Brazil, the Guianas, Venezuela, Colombia, Ecuador, Peru, northwestern Argentina and Costa Rica, eastern (samples from northeastern and central Brazil, and southern (samples from southern Brazil, Paraguay and northeastern Argentina. Taking into account the morphologic evidence presented here, supported by biogeographic data and molecular studies available, we recognize three full species for tigrinas: L. tigrinus (including the putative subspecies L. t. pardinoides and L. t. oncillus as junior synonyms for northern/northwestern/west group; L. emiliae (Thomas, 1914 for eastern group; and L. guttulus for southern group.

  2. ALIGNMENTS OF GROUP GALAXIES WITH NEIGHBORING GROUPS

    International Nuclear Information System (INIS)

    Wang Yougang; Chen Xuelei; Park, Changbom; Yang Xiaohu; Choi, Yun-Young

    2009-01-01

    Using a sample of galaxy groups found in the Sloan Digital Sky Survey Data Release 4, we measure the following four types of alignment signals: (1) the alignment between the distributions of the satellites of each group relative to the direction of the nearest neighbor group (NNG); (2) the alignment between the major axis direction of the central galaxy of the host group (HG) and the direction of the NNG; (3) the alignment between the major axes of the central galaxies of the HG and the NNG; and (4) the alignment between the major axes of the satellites of the HG and the direction of the NNG. We find strong signal of alignment between the satellite distribution and the orientation of central galaxy relative to the direction of the NNG, even when the NNG is located beyond 3r vir of the host group. The major axis of the central galaxy of the HG is aligned with the direction of the NNG. The alignment signals are more prominent for groups that are more massive and with early-type central galaxies. We also find that there is a preference for the two major axes of the central galaxies of the HG and NNG to be parallel for the system with both early central galaxies, however, not for the systems with both late-type central galaxies. For the orientation of satellite galaxies, we do not find any significant alignment signals relative to the direction of the NNG. From these four types of alignment measurements, we conclude that the large-scale environment traced by the nearby group affects primarily the shape of the host dark matter halo, and hence also affects the distribution of satellite galaxies and the orientation of central galaxies. In addition, the NNG directly affects the distribution of the satellite galaxies by inducing asymmetric alignment signals, and the NNG at very small separation may also contribute a second-order impact on the orientation of the central galaxy in the HG.

  3. Principles for poverty alleviation among the youth in Northern Uganda

    Directory of Open Access Journals (Sweden)

    A. Wilson

    2010-07-01

    Full Text Available This article deals with the statistical data and analysis con-cerning poverty among the young people in Uganda. The poverty is continuously ascending, with the most affected region being Northern Uganda. The major cause of poverty in Uganda has been the “South-North divide” fuelled by poor political leadership, that divides people along the lines of politics and ethnicity. Poverty has caused many young people of Northern Uganda to resort to rebellion against the government currently in power. This has led to unending political instability and civil strife most especially in Northern Uganda. In this article atten-tion is given to the conflict in Northern Uganda and attempts are made to propose some amicable resolutions. The discussion includes the current poverty scenario in Northern Uganda and possible strategies for reducing the poverty rate that has caused much damage in Northern Uganda.

  4. Socio-sexual behavior of female northern muriquis (Brachyteles hypoxanthus).

    Science.gov (United States)

    Possamai, Carla B; Young, Robert J; Mendes, Sergio L; Strier, Karen B

    2007-07-01

    Female northern muriquis (Brachyteles hypoxanthus) are known to engage in frequent copulations with multiple partners, a pattern that in other primates has been attributed to various functions such as confusing paternity, reducing male aggression, or ensuring fertilization. However, in some female primates, promiscuity is restricted to times when conceptions are unlikely. We investigated whether female northern muriquis might exhibit a similarly mixed strategy by examining their mating, social, and activity patterns during their conception cycles versus other times. Systematic behavioral data were collected during an 18-month period between August 2001 and February 2003 on 13 adult females in a well-studied group at the RPPN-Feliciano Miguel Abdala, Minas Gerais, Brazil. Females mated on an average of 12.5+/-7.9 days during the study period, and spent significantly less time resting and engaging in non-sexual social behaviors, and significantly more time in sexual behaviors on days that they copulated than on days they did not. Three of the eight females for which sufficient data were available copulated significantly more often with their spatially closest non-kin associates, and four of five females that could be analyzed copulated significantly more often with their most frequent non-kin embrace partners. Comparisons between conception and non-conception periods revealed no differences in female activity budgets or in either the number of copulations or the number of different mating partners per female. Our results suggest that some females mate preferentially with close associates and social partners, but there is no indication that females alter their behavior during the cycles in which they conceive.

  5. Understanding vaccine hesitancy in polio eradication in northern Nigeria.

    Science.gov (United States)

    Taylor, Sebastian; Khan, Mahmud; Muhammad, Ado; Akpala, Okey; van Strien, Marit; Morry, Chris; Feek, Warren; Ogden, Ellyn

    2017-11-07

    Vaccine hesitancy constitutes a major threat to the Global Polio Eradication Initiative (GPEI), and to further expansion of routine immunisation. Understanding hesitancy, leading in some cases to refusal, is vital to the success of GPEI. Re-emergence of circulating wild poliovirus in northern Nigeria in mid-2016, after 24months polio-free, gives urgency to this. But it is equally important to protect and sustain the global gains available through routine immunisation in a time of rising scepticism and potential rejection of specific vaccines or immunisation more generally. This study is based on a purposive sampling survey of 1653 households in high- and low-performing rural, semiurban and urban areas of three high-risk states of northern Nigeria in 2013-14 (Sokoto, Kano and Bauchi). The survey sought to understand factors at household and community level associated with propensity to refuse polio vaccine. Wealth, female education and knowledge of vaccines were associated with lower propensity to refuse oral polio vaccine (OPV) among rural households. But higher risk of refusal among wealthier, more literate urban household rendered these findings ambiguous. Ethnic and religious identity did not appear to be associated with risk of OPV refusal. Risk of vaccine refusal was highly clustered among households within a small sub-group of sampled settlements. Contrary to expectations, households in these settlements reported higher levels of expectation of government as service provider, but at the same time lesser confidence in the efficacy of their relations with government. Results suggest that strategies to address the micro-political dimension of vaccination - expanding community-level engagement, strengthening the role of local government in public health, and enhancing public participation of women - should be effective in reducing non-compliance, asan important set of strategies complementary to conventional didactic/educational approaches and working through

  6. Citizens' action group

    International Nuclear Information System (INIS)

    Andritzky, W.

    1978-01-01

    For the first empirical study of citizens' action groups 331 such groups were consulted. Important information was collected on the following aspects of these groups: their self-image, areas and forms of activities, objectives and their extent, how long the group has existed, successes and failures and their forms of organisation. (orig.) [de

  7. Fluid inclusion investigations in Nagra's boreholes of Northern Switzerland

    International Nuclear Information System (INIS)

    Mullis, J.

    1987-01-01

    Fluid inclusions studied in quartz and calcite from 6 Nagra-boreholes and the oil exploration well Pfaffnau in northern Switzerland were used to evaluate the evolution of fluid composition and trapping conditions. The studied boreholes covered representative sections of the Tertiary, Mesozoic and Permo-Carboniferous sedimentary rocks in addition to the underlying crystalline basement. Two fluid groups were identified, one containing salt-poor NaCl-(KCl) fluids of Upper Carboniferous age, and a second group containing salt-rich to salt-poor CaCl 2 -NaCl-(MgCl 2 ) fluids trapped between Permian and Tertiary times. The inclusions of the first group were trapped at relatively high temperatures (100 degrees to 350 degrees C, rarely up to 400 degrees C) and low pressures (probably below 1 kbar). Their widespread occurrence along healed fractures in rock forming minerals of the crystalline basement and in detrital quartz grains of the Permo-Carboniferous and Triassic sandstones imply a tectonic/thermic event on a regional scale during late Variscan orogeny. The second group of fluids comprises early salt-rich and late salt-poor inclusions. The inclusions were trapped between 30 degrees and 140 degrees C and are detected preferentially in fissure minerals and porefilling cements. The widespread occurrence of the salt-poor fluids along healed fractures inside the host minerals imply major tectonic events especially during Tertiary times. These tectonic events are probably responsible for increased fluid migration and possibly also for brine dilution. The two fluid groups display a considerable similarity with the high-temperature/low-saliniferous Variscan fluid system of the Black Forest and Oberpfalz. (author) 44 refs., 5 figs., 2 tabs

  8. Seroprevalence of bovine theileriosis in northern China

    Directory of Open Access Journals (Sweden)

    Yaqiong Li

    2016-11-01

    Full Text Available Abstract Background Bovine theileriosis is a common disease transmitted by ticks, and can cause loss of beef and dairy cattle worldwide. Here, an indirect enzyme-linked immunosorbent assay (iELISA based on Theileria luwenshuni surface protein (TlSP was developed and used to carry out a seroepidemiological survey of bovine theileriosis in northern China. Methods We used the BugBuster Ni-NTA His•Bind Purification Kit to purify recombinant TlSP (rTlSP, which was subsequently analyzed by Western Blotting to evaluate cross-reactivity with other pathogen-positive sera. The iELISA method based on rTlSP was successfully developed. Sera from 2005 blood samples were tested with the rTlSP-iELISA method, and blood smears from these samples were observed by microscopy. Results The specificity of iELISA was 98.9%, the sensitivity was 98.5%, and the cut-off was selected as 24.6%. Western Blot analysis of rTlSP confirmed that there were cross-reactions with Theileria luwenshuni, Theileria uilenbergi, Theileria ovis, Theileria annulata, Theileria orientalis and Theileria sinensis. The epidemiological survey showed that the highest positive rate of bovine theileriosis was 98.3%, the lowest rate was 84.1%, and the average positive rate was 95.4% by iELISA. With microscopy, the highest positive rate was 38.9%, the lowest rate was 5.1%, and the relative average positive rate was 13.7%. Conclusions An rTlSP-iELISA was developed to detect circulating antibodies against bovine Theileria in northern China. This is the first report on the seroprevalence of bovine theileriosis in northern China, and it also provides seroepidemiological data on bovine theileriosis in China.

  9. Accumulation of carbon in northern mire ecosystems

    Energy Technology Data Exchange (ETDEWEB)

    Tolonen, K.; Turunen, J.; Alm, J. [Joensuu Univ. (Finland). Dept. of Biology; Korhola, A. [Helsinki Univ. (Finland). Lab. of Physical Geography; Jungner, H. [Helsinki Univ. (Finland). Dating Lab.; Vasander, H. [Helsinki Univ. (Finland). Dept. of Forest Ecology

    1996-12-31

    The basic feature in the functional ecology of any mire ecosystem is retardation of the effective decay of organic material resulting in a conspicuous accumulation of plant debris as peat overtime. The carbon accumulation process is slow, and climatic change may have an impact on the carbon cycle of peatlands, therefore, it has been of interest to study the rate of carbon accumulation by geological methods from dated peat strata. The approach is hampered by several facts. First, the mires vary enormously as to their vegetation and hydrology and hence their production and decay properties. It follows that a great number of study sites are needed. Second, the peat in mires expands both vertically and laterally, and this requires a spatial reconstruction of carbon accumulation within a mire basin. Third, simple geological methods cannot account for the actual rate of carbon accumulation in peat, and finally, an additional carbon sink in the mire ecosystems can be the mineral subsoil beneath peat. The proposed warming will perhaps shift northwards the existing climatic mire regimes and, thus, the northern aapa fens will change to Sphagnum bogs that are more effective in sequestering carbon, but distinctly less effective in their CH{sub 4} and N{sub 2}O emanation. The role of mire fires in more remote northern areas may then become another important factor. The answer to the important question of future total sequestration of carbon to peatlands depends on the precipitation and its seasonal distribution pattern. Most climatic scenarios predict a decrease in the evaporation surplus during the summer at northern regions. Presumably, the consequent lowering of the water table would improve growth of forest on mires and simultaneously decrease the methane fluxes from peat. The combined net effect could be a clear restraining of the radiative forcing

  10. Accumulation of carbon in northern mire ecosystems

    Energy Technology Data Exchange (ETDEWEB)

    Tolonen, K; Turunen, J; Alm, J [Joensuu Univ. (Finland). Dept. of Biology; Korhola, A [Helsinki Univ. (Finland). Lab. of Physical Geography; Jungner, H [Helsinki Univ. (Finland). Dating Lab.; Vasander, H [Helsinki Univ. (Finland). Dept. of Forest Ecology

    1997-12-31

    The basic feature in the functional ecology of any mire ecosystem is retardation of the effective decay of organic material resulting in a conspicuous accumulation of plant debris as peat overtime. The carbon accumulation process is slow, and climatic change may have an impact on the carbon cycle of peatlands, therefore, it has been of interest to study the rate of carbon accumulation by geological methods from dated peat strata. The approach is hampered by several facts. First, the mires vary enormously as to their vegetation and hydrology and hence their production and decay properties. It follows that a great number of study sites are needed. Second, the peat in mires expands both vertically and laterally, and this requires a spatial reconstruction of carbon accumulation within a mire basin. Third, simple geological methods cannot account for the actual rate of carbon accumulation in peat, and finally, an additional carbon sink in the mire ecosystems can be the mineral subsoil beneath peat. The proposed warming will perhaps shift northwards the existing climatic mire regimes and, thus, the northern aapa fens will change to Sphagnum bogs that are more effective in sequestering carbon, but distinctly less effective in their CH{sub 4} and N{sub 2}O emanation. The role of mire fires in more remote northern areas may then become another important factor. The answer to the important question of future total sequestration of carbon to peatlands depends on the precipitation and its seasonal distribution pattern. Most climatic scenarios predict a decrease in the evaporation surplus during the summer at northern regions. Presumably, the consequent lowering of the water table would improve growth of forest on mires and simultaneously decrease the methane fluxes from peat. The combined net effect could be a clear restraining of the radiative forcing

  11. Dreyfusia nordmannianae in Northern and Central Europe

    DEFF Research Database (Denmark)

    Ravn, Hans Peter; Havill, N.P.; Akbulut, S.

    2013-01-01

    The silver fir woolly adelgid, Dreyfusia nordmannianae, is the most severe pest occurring on Abies nordmanniana in Central and Northern Europe. The adelgid is particularly damaging to trees in Christmas tree plantations. Dreyfusia nordmannianae is native to the Caucasus region and alien to Europe...... were examined for phylogenetic structure. There was no evidence of differentiation, suggesting that these Dreyfusia species have recently diverged or require taxonomic revision. All existing published and unpublished reports on natural enemies of D. nordmannianae in its place of origin were reviewed...

  12. Freshwater reservoir effect variability in Northern Germany

    DEFF Research Database (Denmark)

    Philippsen, B.; Heinemeier, J.

    2013-01-01

    The freshwater reservoir effect is a potential problem when radiocarbon dating fish bones, shells, human bones, or food crusts on pottery from sites near rivers or lakes. The reservoir age in hardwater rivers can be up to several thousand years and may be highly variable. Accurate 14C dating of f...... that can also be expected for the past. This knowledge will be applied to the dating of food crusts on pottery from the Mesolithic sites Kayhude at the Alster River and Schlamersdorf at the Trave River, both in Schleswig-Holstein, northern Germany....

  13. The Criminal justice system in Northern Ireland

    OpenAIRE

    Carr, Nicola

    2017-01-01

    As with any country, crime and justice and the contours of criminal justice have to be situated within the particular historical, social, and political context. Nowhere is this truer than in Northern Ireland, where the criminal justice system that has emerged has been shaped by a violent political conflict which spanned over three decades (from the late 1960s to the late 1990s). In the transition to peace, the reform of criminal justice agencies has been central—to a wider project of state le...

  14. Deep seismic sounding in northern Eurasia

    Science.gov (United States)

    Benz, H.M.; Unger, J.D.; Leith, W.S.; Mooney, W.D.; Solodilov, L.; Egorkin, A.V.; Ryaboy, V.Z.

    1992-01-01

    For nearly 40 years, the former Soviet Union has carried out an extensive program of seismic studies of the Earth's crust and upper mantle, known as “Deep Seismic Sounding” or DSS [Piwinskii, 1979; Zverev and Kosminskaya, 1980; Egorkin and Pavlenkova, 1981; Egorkin and Chernyshov, 1983; Scheimer and Borg, 1985]. Beginning in 1939–1940 with a series of small-scale seismic experiments near Moscow, DSS profiling has broadened into a national multiinstitutional exploration effort that has completed almost 150,000 km of profiles covering all major geological provinces of northern Eurasia [Ryaboy, 1989].

  15. Biogeochemical processes in the northern Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Gaye-Haake, B.; Guptha, M.V.S.; Murty, V.S.N.; Ittekkot, V.

    in the northern Indian Ocean’’, and from national research programs of India and Germany con- ducted as a contribution to the international JGOFS Process Study in the Arabian Sea. Addi- tional contributions cover research carried out within India’s Polymetallic... of coccolithophorids in addition to organic carbon and carbonate con- centrations and accumulation rates for a 200ka record Prabhu and Shankar show that glacial stages 2,4 and 6 have had higher productivities in the eastern Arabian Sea at about 151N. They, moreover...

  16. The Evolution of Northern Hemisphere Glaciation

    Science.gov (United States)

    Wright, J. D.

    2001-05-01

    For much of the last 50 million years, high-latitude regions remained too warm to allow snow to accumulate and form ice sheets. Shackleton et al. (1984) published a landmark paper correlating the first occurrence of ice-rafted detritus (IRD) observed at Rockall Plateau with a prominent increase in benthic foraminiferal d18O values during the late Pliocene. These late Pliocene to Pleistocene ice sheets were modulated on an orbital frequency and have characterized the global climate over the past 2.6 myr (Shackleton and Opdyke, 1973; Shackleton et al., 1984; Ruddiman, et al., 1986). During the early Pliocene, northern hemisphere glaciation (NHG) variations were less significant (Jansen et al., 1993). Our understanding of the Plio-Pleistocene ice sheet cycles can be viewed from two different perspectives. When viewed from the late Pleistocene, the fundamental question is what changed near the early/late Pliocene boundary to produce the large-scale, glacial-interglacial cycles of the past 2.6 Ma. In contrast, the view from the middle to late Miocene is quite different. Since the pioneering work of Shackleton et al. (1984), the record of NHG has been extended further back in time with drilling in the Norwegian Sea (ODP Leg 104). At Sites 642 and 644, IRD was found throughout the late Miocene and back to ~12 Ma. More recent drilling in the high northern latitudes occurred on ODP Leg 151. Site 909 recovered a middle Miocene section from the Fram Straits with rounded quartz grains that were interpreted as IRD (Wolf-Welling et al., 1996). Age estimates for those sediments place the first northern hemisphere ice sheets at least as old as 14 Ma. The occurrence of sand-sized particles (>1000 μm) and coal below this level indicates the possibility of glacial activity in the Northern Hemisphere as early as 16 Ma. Thus, the late Pliocene to Pleistocene cycles appear to be the resumption of the glacial-interglacial pattern that began during the Miocene. While the Miocene ice

  17. Lignite boost for North. [Northern Ireland

    Energy Technology Data Exchange (ETDEWEB)

    Clerkin, H.

    1986-01-01

    Reserves of lignite, estimated at around 500 million tonnes, have been discovered on the shores of Lough Neagh, Northern Ireland. The Government has granted a mining licence and planning permission to Burnett and Hallamshire Holdings to start work on the deposit. It is proposed to mine the lignite using opencast methods. Much of this deposit will be consumed in a purpose-built mine mouth power station with further reserves being dried in the approved processing plant to produce a range of industrial and domestic fuels. Carbonising the lignite may eliminate pollution. However, large scale investment will be required before Ireland's economy can switch to lignite.

  18. Offshore wind market outlook in Northern Europe

    Energy Technology Data Exchange (ETDEWEB)

    Pimenta de Miranda, Wilfried; Trulsson, Ola; Ekloef, Eva-Britt; Niemenen, Karel

    2010-08-15

    After more than 10 years of slow developments, the offshore wind market is now accelerating. Thanks to a sustained political drive from UK and Germany, the rest of Northern Europe is now following the path as offshore wind is being recognized as one of the key resources available to the EU to meet its renewable energy ambitions. Exposed to increasing technical issues, rising costs and the financial crisis, lessons learned are now being shared and integrated throughout Europe and appropriate regulatory and planning reforms are now being deployed to speed the deployment of offshore wind. (Author)

  19. Phonological skills as predictor of reading success: An investigation of emergent bilingual Northern Sotho/English learners

    Directory of Open Access Journals (Sweden)

    Wilsenach, Carien

    2013-12-01

    Full Text Available The relationship between phonological skills and reading has not been studied extensively in the African languages spoken in South Africa. This study focuses on phonological skills and reading in emergent bilingual Northern Sotho/English learners. Fifty Grade 3 learners (all native speakers of Northern Sotho were tested on non-word repetition skills, syllable awareness, phonological working memory and reading. The learners fell into two groups: group 1 attended a school where English was the medium of instruction from the first grade, while group 2 attended a school where literacy instruction took place in Northern Sotho for the first three years of schooling. The results indicate that there is a significant correlation between phonological skills and reading in Northern Sotho. Furthermore, group 2 performed significantly better on all of the phonological measures (with the exception of phonological working memory and reading measures. The findings suggest that a complete lack of mother tongue instruction can influence phonological and literacy development negatively. The study also suggests that the absence of mother tongue literacy instruction causes stagnation in the development of phonological processing skills in the mother tongue.

  20. Sharia as ‘Desert Business’: Understanding the Links between Criminal Networks and Jihadism in Northern Mali

    DEFF Research Database (Denmark)

    Haugegaard, Rikke

    2017-01-01

    How can we understand the social and economic dynamics that enable the operative space of the militant networks in northern Mali? This article argues that jihadist militant groups are actors in local power struggles rather than ‘fighters’ or ‘terrorists’ with extremist ideological motivations. I ...

  1. Understanding the leisure constraints of Hispanic-Americans in Northern Virginia: an exploratory analysis of constraints, socioeconomic status and acculturation

    Science.gov (United States)

    Edward F, II Byrne; Ellen B. Drogin Rodgers

    2003-01-01

    The purpose of this study is to investigate the constraints to use of outdoor recreation resources and participation in leisure activities among Hispanic restaurant workers in Northern Virginia; specifically, the relationship of socioeconomic status and acculturation to leisure constraints. The dramatic rate of increase of Hispanic-Americans, the group's low...

  2. Communication in Organizational Groups

    OpenAIRE

    Monica RADU

    2007-01-01

    Organizational group can be defined as some persons between who exist interactive connections (functional, communication, affective, normative type). Classification of these groups can reflect the dimension, type of relationship or type of rules included. Organizational groups and their influence over the individual efficiency and the efficiency of the entire group are interconnected. Spontaneous roles in these groups sustain the structure of the relationship, and the personality of each indi...

  3. [Social crisis, spontaneous groups and group order].

    Science.gov (United States)

    Edelman, Lucila; Kordon, Diana

    2002-12-01

    Argentina has gone through very difficult times during the last years and, in particularly, new kinds of social practices have emerged in order to cope with the crisis. This situation demands and urges a new type of reflection upon the double role of groups, as tools to transform reality and as a way to elaborate those processes regarding subjectivity. In this paper we analyse some topics regarding the groupal field (considering spontaneous groups as well as groupal devices that allow to elaborate the crisis). We consider social bond to be the condition of possibility for the existence of the psyche and of time continuity, and that it also makes possible personal and social elaboration of trauma, crisis and social catastrophe. We develop some aspects of an specific device (the reflection group), which we have already depicted in another moment, showing it's usefulness to cope with social crisis and to promote the subjective elaboration of crisis.

  4. Natural regeneration of northern hardwoods in the northern Great Lakes Region.

    Science.gov (United States)

    Carl H. Tubbs

    1977-01-01

    Reviews silvical and silvicultural information about natural regeneration pertinent to forestry practices in Lake State northern hardwood types. Seed production; effects of light, moisture, temperature and competition on establishment and growth; and how damage affects mortality rates and form are covered. Clearcutting, selection, and shelterwood experiments are...

  5. Sonoma Ecology Center Northern California Arundo Distribution Data

    Data.gov (United States)

    California Natural Resource Agency — The Arundo Distribution layer is a compilation of Arundo donax observations in northern and central California, obtained from numerous sources, including Arundo...

  6. The Amazon-Laurentian connection as viewed from the Middle Proterozoic rocks in the central Andes, western Bolivia and northern Chile

    Science.gov (United States)

    Tosdal, R.M.

    1996-01-01

    Middle Proterozoic rocks underlying the Andes in western Bolivia, western Argentina, and northern Chile and Early Proterozoic rocks of the Arequipa massif in southern Peru?? from the Arequipa-Antofalla craton. These rocks are discontinuously exposed beneath Mesozoic and Cenozoic rocks, but abundant crystalline clasts in Tertiary sedimentary rocks in the western altiplano allow indirect samples of the craton. Near Berenguela, western Bolivia, the Oligocene and Miocene Mauri Formation contains boulders of granodiorite augen gneiss (1171??20 Ma and 1158??12 Ma; U-Pb zircon), quartzose gneiss and granofels that are inferred to have arkosic protoliths (1100 Ma source region; U-Pb zircon), quartzofeldspathic and mafic orthogneisses that have amphibolite- and granulite-facies metamorphic mineral assemblages (???1080 Ma metamorphism; U-Pb zircon), and undeformed granitic rocks of Phanerozoic(?) age. The Middle Proterozoic crystalline rocks from Berenguela and elsewhere in western Bolivia and from the Middle Proterozoic Bele??n Schist in northern Chile generally have present-day low 206Pb/204Pb ( 15.57), and elevated 208Pb/204Pb (37.2 to 50.7) indicative of high time-averaged Th/U values. The Middle Proterozoic rocks in general have higher presentday 206Pb/204Pb values than those of the Early Proterozoic rocks of the Arequipa massif (206Pb/204Pb between 16.1 and 17.1) but lower than rocks of the southern Arequipa-Antofalla craton (206Pb/204Pb> 18.5), a difference inferred to reflect Grenvillian granulite metamorphism. The Pb isotopic compositions for the various Proterozoic rocks lie on common Pb isotopic growth curves, implying that Pb incorporated in rocks composing the Arequipa-Antofalla craton was extracted from a similar evolving Pb isotopic reservoir. Evidently, the craton has been a coherent terrane since the Middle Proterozoic. Moreover, the Pb isotopic compositions for the Arequipa-Antofalla craton overlap those of the Amazon craton, thereby supporting a link

  7. The quinoa boom of the southern Bolivian Altiplano

    DEFF Research Database (Denmark)

    Sander, Lasse; Jacobsen, Sven-Erik

    2014-01-01

    with the intention to push agricultural development – with obvious success. The cultivation of quinoa is today the most important land use, with a continued increase in production volume and areal extent. We here trace back land-use changes from 1972 to 2013 in one of the most important areas of quinoa production......, and rapid drainage during precipitation and snow melt events. It appears that many of the first quinoa fields were established on flood plain deposits, where good yields could be anticipated despite the apparent risk of erosion. The subsequent expansion of production areas was paralleled by an increase...

  8. EDITORIAL: Northern Hemisphere high latitude climate and environmental change

    Science.gov (United States)

    Groisman, Pavel; Soja, Amber

    2007-10-01

    funded projects (always with international participation) in the United States, Russian Federation, China, European Union, Japan, and Canada have been mutually united to explore the scientifically significant Northern Eurasian region. NEESPI scientists have been quite productive during the past two years (2005 2006) publishing more than 200 books, book chapters, and papers in refereed journals. NEESPI sessions at international conferences are open to everyone who works on environmental and climate change problems in Northern Eurasia and the circumpolar boreal zone. This thematic issue brings together articles from the authors who presented their latest results at the Annual Fall American Geophysical Union Meeting in San Francisco (December 2006). The research letters in this issue are preceded by two editorial papers (Leptoukh et al and Sherstyukov et al) devoted to informational support of research in the NEESPI domain that is critical to the success of the Initiative. The following papers are quite diverse and are assembled into five groups devoted to studies of climate and hydrology, land cover and land use, the biogeochemical cycle and its feedbacks, the cryosphere, and human dimensions in the NEESPI domain and the circumpolar boreal zone. Focus on Northern Hemisphere High Latitude Climate and Environmental Change Contents The articles below represent the first accepted contributions and further additions will appear in the near future. Editorials NASA NEESPI Data and Services Center for Satellite Remote Sensing Information Gregory Leptoukh, Ivan Csiszar, Peter Romanov, Suhung Shen, Tatiana Loboda and Irina Gerasimov NEESPI Science and Data Support Center for Hydrometeorological Information in Obninsk, Russia B G Sherstyukov, V N Razuvaev, O N Bulygina and P Ya Groisman Climate and hydrology Changes in the fabric of the Arctic's greenhouse blanket Jennifer A Francis and Elias Hunter Spatial variations of summer precipitation trends in South Korea, 1973 2005 Heejun

  9. Diagnostic and laboratory test ordering in Northern Portuguese Primary Health Care: a cross-sectional study

    Science.gov (United States)

    Sá, Luísa; Teixeira, Andreia Sofia Costa; Tavares, Fernando; Costa-Santos, Cristina; Couto, Luciana; Costa-Pereira, Altamiro; Hespanhol, Alberto Pinto; Santos, Paulo

    2017-01-01

    Objectives To characterise the test ordering pattern in Northern Portugal and to investigate the influence of context-related factors, analysing the test ordered at the level of geographical groups of family physicians and at the level of different healthcare organisations. Design Cross-sectional study. Setting Northern Primary Health Care, Portugal. Participants Records about diagnostic and laboratory tests ordered from 2035 family physicians working at the Northern Regional Health Administration, who served approximately 3.5 million Portuguese patients, in 2014. Outcomes To determine the 20 most ordered diagnostic and laboratory tests in the Northern Regional Health Administration; to identify the presence and extent of variations in the 20 most ordered diagnostic and laboratory tests between the Groups of Primary Care Centres and between health units; and to study factors that may explain these variations. Results The 20 most ordered diagnostic and laboratory tests almost entirely comprise laboratory tests and account for 70.9% of the total tests requested. We can trace a major pattern of test ordering for haemogram, glucose, lipid profile, creatinine and urinalysis. There was a significant difference (P<0.001) in test orders for all tests between Groups of Primary Care Centres and for all tests, except glycated haemoglobin (P=0.06), between health units. Generally, the Personalised Healthcare Units ordered more than Family Health Units. Conclusions The results from this study show that the most commonly ordered tests in Portugal are laboratory tests, that there is a tendency for overtesting and that there is a large variability in diagnostic and laboratory test ordering in different geographical and organisational Portuguese primary care practices, suggesting that there may be considerable potential for the rationalisation of test ordering. The existence of Family Health Units seems to be a strong determinant in decreasing test ordering by Portuguese family

  10. Northern New Mexico regional airport market feasibility

    Energy Technology Data Exchange (ETDEWEB)

    Drake, R.H.; Williams, D.S.

    1998-06-01

    This report is about the market for airline travel in northern New Mexico. Interest in developing a northern New Mexico regional airport has periodically surfaced for a number of years. The New Mexico State Legislature passed a memorial during the 1998 Second Session calling for the conduct of a study to determine the feasibility of building a new regional airport in NNM. This report is a study of the passenger market feasibility of such an airport. In addition to commercial passenger market feasibility, there are other feasibility issues dealing with siting, environmental impact, noise, economic impact, intermodal transportation integration, region-wide transportation services, airport engineering requirements, and others. These other feasibility issues are not analyzed in any depth in this report although none were discovered to be show-stoppers as a by-product of the authors doing research on the passenger market itself. Preceding the need for a detailed study of these other issues is the determination of the basic market need for an airport with regular commercial airline service in the first place. This report is restricted to an in-depth look at the market for commercial passenger air service in NNM. 20 figs., 8 tabs.

  11. Radioactivity in Northern Ireland soils - December 1986

    International Nuclear Information System (INIS)

    Jenkins, D.W.K.

    1989-01-01

    The main objective of the survey was to establish the radionuclide content of permanent pasture soils. The extent of contamination from the Chernobyl accident was also studied with the use of Cs-134 as an indicator of Chernobyl fallout. A preliminary radiological assessment was performed by referring to the generalised derived limits. Results of the grassland grid survey show that Chernobyl-derived radiocaesium was widely spread throughout Northern Ireland with the exception of the East Coast where the deposition was more localised reflecting the showery-rainfall pattern on the 3rd May 1986. Accumulation of Chernobyl material showed a high correlation with rainfall on that day, which resulted in a substantial increase in Cs-137 levels compared to estimated pre-Chernobyl concentrations in many areas. The main areas affected lay in a band across the country from the North East to the South with a smaller incursion to the North. The plutonium content in soils from Northern Ireland arising from nuclear weapons fallout was similar to levels found in other surveys completed in Great Britain before Chernobyl. (author)

  12. Child Abuse in Northern Sri Lanka.

    Science.gov (United States)

    Sathiadas, M G; Mayoorathy, S; Varuni, K; Ranganathan, Shalini Sri

    2017-02-01

    To identify areas of deficiencies and gaps in child protection services in Northern Sri Lanka. Also, to help in recommending strategies, programmes of interventions for addressing issues of child abuse and advice the legal system. A retrospective study was done to determine the socio-demographic details, type of abuse, clinical profile, relationship of the perpetrator and nature of abuse among children admitted to a tertiary care centre from 2009 through 2014, a period after cessation of a 60-y conflict. Data were obtained from hospital based records and records maintained at the district probation office. Seven hundred twenty cases were referred to the tertiary care centre with abuse. Majority of the children were from the Jaffna district, the northern city of the war affected area and mean age of the children affected was 14.5 ± 2.6 y. Females were affected more than the males and 352 children were seen following sexual abuse. The clinical examination showed penetrative injury in 15 %. The perpetrator was known in 70 % of the situations and the victim was coerced into a relationship for abuse. Attempted suicide was seen in significant numbers during the immediate post war period and school dropout and delinquent behaviour was seen in later years. The problem of child abuse is considerable in this region and there is an urgent need to strengthen the services offered to the victims. Urgent steps are needed to safeguard these children, especially in the war affected areas.

  13. Proposed artificial recharge studies in northern Qatar

    Science.gov (United States)

    Kimrey, J.O.

    1985-01-01

    The aquifer system in northern Qatar comprises a water-table aquifer in the Rus Formation which is separated by an aquitard from a partially confined aquifer in the top of the overlying Umm er Radhuma Formation. These two aquifers are composed of limestone and dolomite of Eocene and Paleocene age and contain a fragile lens of freshwater which is heavily exploited as a source of water for agricultural irrigation. Net withdrawals are greatly in excess of total recharge, and quality of ground water is declining. Use of desalinated seawater for artificial recharge has been proposed for the area. Artificial recharge, on a large scale, could stabilize the decline in ground-water quality while allowing increased withdrawals for irrigation. The proposal appears technically feasible. Recharge should be by injection to the Umm er Radhuma aquifer whose average transmissivity is about 2,000 meters squared per day (as compared to an average of about 200 meters squared per day for the Rus aquifer). Implementation of artificial recharge should be preceded by a hydrogeologic appraisal. These studies should include test drilling, conventional aquifer tests, and recharge-recovery tests at four sites in northern Qatar. (USGS)

  14. Pharmaceutical ethnobotany in Northern Navarra (Iberian Peninsula).

    Science.gov (United States)

    Cavero, R Y; Akerreta, S; Calvo, M I

    2011-01-07

    This paper provides significant ethnobotanical information on pharmaceutical plant uses in Northern Navarra from an area known both for its high biological diversity and its cultural significance, suggesting the survival of uses lost elsewhere. Collect, analyze and evaluate the ethnobotanical knowledge about medicinal plants in Northern Navarra (Iberian Peninsula) with 4243 km(2) and 71,069 inhabitants. We performed semi-structured interviews with 253 informants (mean age 69; 61% women, 39% men) in 120 locations, identified the plant reported and analyzed the results, comparing them with those from other territories. The informants reported data on 174 medicinal plants belonging to 63 botanical families. This work is focused on human medicinal plant uses, which represent 98% of the pharmaceutical uses (1725 use reports). The species with the highest number of cites are Chamaemelum nobile, Sambucus nigra and Verbena officinalis, with a long tradition of use in The Mountain (Navarra). All different plant parts are used; aerial part is exploited more frequently than other plant parts. Most of the listed remedies use a single ingredient, typically soaked in water. Usually, the administration is primarily oral followed by topical applications. The main ailments treated are digestive troubles, wounds and dermatological problems, and respiratory affections. Informants reported 24 new or scarcely cited uses for 23 medicinal plants. For 35% of the species (8) we have not found bibliographical references in the scientific literature and 48% (11) have only one to three references. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  15. Social cliques in male northern muriquis Brachyteles hypoxanthus

    Directory of Open Access Journals (Sweden)

    Marcos TOKUDA, Jean P. BOUBLI, Patrícia IZAR, Karen B. STRIER

    2012-04-01

    Full Text Available Analyses of spatial relationships and social interactions provide insights into the social structure of animal societies and the ways in which social preferences among and between dyads affect higher order social relationships. In this paper we describe the patterns of spatial associations and social interactions among adult male northern muriquis in order to evaluate the dynamics of their social networks above the dyadic levels. Systematic observations were made on the 17 adult males present in a multi-male/multi-female group from April 2004 through February 2005, and in July 2005. Analyses of their spatial relationships identified two distinct male cliques; some adult males (called “N” males were more connected to the females and immatures than other adult males (“MU” males, which were more connected to one another. Affiliative interactions were significantly higher among dyads belonging to the same clique than to different cliques. Although frequencies of dyadic agonistic interactions were similarly low among individuals within and between cliques, MU males appeared to be subordinate to N males. Nonetheless, there were no significant differences in the copulation rates estimated for MU males and N males. Mutual benefits of cooperation between MU and N cliques in intergroup encounters might explain their ongoing associations in the same mixed-sex group [Current Zoology 58 (2: 342-352, 2012].

  16. Mother-offspring associations in northern muriquis, Brachyteles hypoxanthus.

    Science.gov (United States)

    Tolentino, Karynna; Roper, James J; Passos, Fernando C; Strier, Karen B

    2008-03-01

    Maternal care of offspring is ubiquitous among primates, but its duration varies across species due to factors such as dispersal patterns and social dynamics, which influence opportunities for and potential benefits of maternal investment in older offspring, respectively. We examined mother-offspring associations in wild northern muriquis (Brachyteles hypoxanthus), in which males are philopatric, females typically disperse before puberty, and social relationships among and between males and females are egalitarian. Associations were systematically recorded between ten mothers, each with two-six offspring in the study group, and all group members from August 2003-May 2004 at the RPPN-Feliciano Miguel Abdala in Minas Gerais, Brazil. Infants of both sexes received similarly high percentages of their mothers' association time. Mothers without infants also maintained strong associations with their youngest juvenile sons. Mothers did not spend consistently more time associating with either juvenile or adult sons than daughters. Our finding of non-preferential associations between muriqui mothers and their older male offspring suggests that extended maternal investment in offspring may be of minimal value in their egalitarian society compared with its value for species living in hierarchical societies.

  17. [Psychotherapy and religion: a survey of Northern Bavarian psychotherapists].

    Science.gov (United States)

    Demling, J H; Wörthmüller, M; O'Connolly, T A

    2001-02-01

    By taking a survey of physicians and psychologists accredited as psychotherapists in Franconia (northern Bavaria), we attempted to draw conclusions about the importance of religion for the therapists themselves and for their therapeutic settings. 253 physicians and 78 psychologists returned usable questionnaires (a return rate of 70% for each group). 30% of each group were non-denominational, significantly more men than women were not religious or considered themselves "agnostic/atheistic." Catholic therapists appeared to be more loyal toward their church and more open-minded toward religion in general than protestants and non-denominationals, respectively. Around 1/5 of the psychologists had prayed for their patients. Among the psychoanalysts there were no fewer non-denominationals or agnostics/atheists than among physician/psychotherapists or behavioural therapists. The physician/psychoanalysts classified the role of religion as less important than physician/psychotherapists; however, there were marked differences between the psychoanalytic schools. Many therapists could imagine consulting a spiritual counselor in appropriate cases. The results indicate a correlation between the subjective attitude of therapists toward religion and their handling of this topic in therapeutic practice.

  18. Social cliques in male northern muriquis Brachyteles hypoxanthus

    Institute of Scientific and Technical Information of China (English)

    Marcos TOKUDA; Jean P. BOUBLI; Patrícia IZAR; Karen B. STRIER

    2012-01-01

    Analyses of spatial relationships and social interactions provide insights into the social structure of animal societies and the ways in which social preferences among and between dyads affect higher order social relationships.In this paper we describe the patterns of spatial associations and social interactions among adult male northern muriquis in order to evaluate the dynamics of their social networks above the dyadic levels.Systematic observations were made on the 17 adult males present in a multi-male/multi-female group from April 2004 through February 2005,and in July 2005.Analyses of their spatial relationships identified two distinct male cliques; some adult males (called "N" males) were more connected to the females and immatures than other adult males ("MU" males),which were more connected to one another.Affiliative interactions were significantly higher among dyads belonging to the same clique than to different cliques.Although frequencies of dyadic agonistic interactions were similarly low among individuals within and between cliques,MU males appeared to be subordinate to N males.Nonetheless,there were no significant differences in the copulation rates estimated for MU males and N males.Mutual benefits of cooperation between MU and N cliques in intergroup encounters might explain their ongoing associations in the same mixed-sex group [Current Zoology 58 (2):342-352,2012].

  19. Women Empowerment and Climate Change Adaptation in Northern Quezon

    Directory of Open Access Journals (Sweden)

    Maria Salome Almario -Desoloc

    2014-10-01

    Full Text Available After being hit by a devastating typhoon in late 1994, donations coming from international sources poured. The Sisters of Sion Australia, a church-based group in Real Quezon, did not only facilitate the reconstruction of destroyed houses in the affected areas but also maximized the extra money received through establishing a non-profit women’s organization. This study focused on KUMARE Inc., the NGO that emerged in response to the need of helping people become more responsible in protecting their families against climate change. Focus group discussions and key informant interviews were conducted to provide insight on how microfinance aided in empowering women and mitigating the effects of climate change in Northern Quezon. Results showed that aside from increasing the incomes of families, women became active partners in the development and implementation of environmental projects. Their participation had not only promoted environmental awareness among their families but also other sectors of the community involved in their cause, particularly the local government units that included them in disaster risk management. The findings are discussed in the light of gender and development, social change and partnership.

  20. The northern lakes of Egypt: Encounters with a wetland environment

    International Nuclear Information System (INIS)

    Parmenter, B.M.

    1991-01-01

    Five lakes fringe the northern coast of Egypt. Together they represent 25% of the remaining wetland habitat in the Mediterranean basin. Residents of these lakes traditionally exploited a wide variety of resources. Today these lakes face a number of threats to their existence, including large-scale reclamation and water pollution. Agricultural authorities, engineers, fishery managers, and conservationists in Egypt and abroad debate about how best to manage and develop the lake region's resources, but few of these groups understand or communicate with one another, or with residents of lake communities. This study explores how these various groups encounter the coastal lakes of Egypt, focusing particularly on Lakes Manzala and Burullus. Its purpose is to explore the ways in which the lakes, their resources and their inhabitants have been evaluated, and to analyze how underlying preconceptions, goals and structures of professional discourse influence such evaluations. The thesis is that environmental management is in reality not a rational plan but a process. Egypt is currently attempting to develop a coherent strategy to remedy its environmental problems without adversely affecting economic growth