ERD-based online brain-machine interfaces (BMI) in the context of neurorehabilitation: optimizing BMI learning and performance.

Science.gov (United States)

Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G

2011-10-01

Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.

Maternal BMI and diabetes in pregnancy: Investigating variations between ethnic groups using routine maternity data from London, UK.

Science.gov (United States)

Nishikawa, Erin; Oakley, Laura; Seed, Paul T; Doyle, Pat; Oteng-Ntim, Eugene

2017-01-01

To investigate the ethnicity-specific association between body mass index (BMI) and diabetes in pregnancy, with a focus on the appropriateness of using BMI cut-offs to identify pregnant women at risk of diabetes. Analysis of routinely-collected data from a maternity unit in London, UK. Data were available on 53 264 women delivering between 2004 and 2012. Logistic regression was used to explore the association between diabetes in pregnancy and BMI among women of different ethnicities, and adjusted probability estimates were used to derive risk equivalent cut-offs. ROC curve analysis was used to assess the performance of BMI as a predictor of diabetes in pregnancy. The prevalence of diabetes in pregnancy was 2.3% overall; highest in South and East Asian women (4.6% and 3.7%). In adjusted analysis, BMI category was strongly associated with diabetes in all ethnic groups. Modelled as a continuous variable with a quadratic term, BMI was an acceptable predictor of diabetes according to ROC curve analysis. Applying a BMI cut-off of 30 kg/m2 would identify just over half of Black women with diabetes in pregnancy, a third of White (32%) and South Asian (35%) women, but only 13% of East Asian women. The 'risk equivalent' (comparable to 30 kg/m2 in White women) threshold for South Asian and East Asian women was approximately 21 kg/m2, and 27.5 kg/m2 for Black women. This study suggests that current BMI thresholds are likely to be ineffective for diabetes screening in South and East Asian women, as many cases of diabetes will occur at low BMI levels. Our results suggest that East Asian women appear to face a similarly high risk of diabetes to South Asian women. Current UK guidelines recommend diabetes screening should be offered to all pregnant South Asian women; extending this recommendation to include women of East Asian ethnicity may be appropriate.

Changes in body mass, stature and BMI in South African elite U18 Rugby players from different racial groups from 2002-2012.

Science.gov (United States)

Durandt, Justin; Green, Mervin; Masimla, Herman; Lambert, Mike

2018-03-01

The purpose of this study was to determine whether there are differences between racial groups for body mass, stature and body mass index (BMI) in South African elite U18 rugby players and whether there were significant changes in these measurements between 2002 and 2012. Self-reported body mass and stature were obtained from U18 players (n = 4007) who attended the national tournament during this period. BMI was calculated for each player.White players were 9.8 kg heavier than black players, who were 2.3 kg heavier than coloured players (P body mass of all groups increased from 2002 to 2012 (P body mass, stature and BMI of elite under-18 rugby players in South Africa were significantly different between racial groups. This has implications for transforming the game to make it representative of the South African population.

BMI and BMI SDS in childhood: annual increments and conditional change.

Science.gov (United States)

Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt

2017-02-01

Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.

Influence of different types of compression garments on exercise-induced muscle damage markers after a soccer match.

Science.gov (United States)

Marqués-Jiménez, Diego; Calleja-González, Julio; Arratibel-Imaz, Iñaki; Delextrat, Anne; Uriarte, Fernando; Terrados, Nicolás

2018-01-01

There is not enough evidence of positive effects of compression therapy on the recovery of soccer players after matches. Therefore, the objective was to evaluate the influence of different types of compression garments in reducing exercise-induced muscle damage (EIMD) during recovery after a friendly soccer match. Eighteen semi-professional soccer players (24 ± 4.07 years, 177 ± 5 cm; 71.8 ± 6.28 kg and 22.73 ± 1.81 BMI) participated in this study. A two-stage crossover design was chosen. Participants acted as controls in one match and were assigned to an experimental group (compression stockings group, full-leg compression group, shorts group) in the other match. Participants in experimental groups played the match wearing the assigned compression garments, which were also worn in the 3 days post-match, for 7 h each day. Results showed a positive, but not significant, effect of compression garments on attenuating EIMD biomarkers response, and inflammatory and perceptual responses suggest that compression may improve physiological and psychological recovery.

Impact of age on intermittent hypoxia in obstructive sleep apnea: a propensity-matched analysis.

Science.gov (United States)

Bostanci, Asli; Bozkurt, Selen; Turhan, Murat

2018-05-01

To determine independent relationship of aging with chronic intermittent hypoxia, we compared hypoxia-related polysomnographic variables of geriatric patients (aged ≥ 65 years) with an apnea-hypopnea index (AHI)-, gender-, body mass index (BMI)-, and neck circumference-matched cohort of non-geriatric patients. The study was conducted using clinical and polysomnographic data of 1280 consecutive patients who underwent complete polysomnographic evaluation for suspected sleep-disordered breathing (SDB) at a single sleep disorder center. A propensity score-matched analysis was performed to obtain matched cohorts of geriatric and non-geriatric patients, which resulted in successful matching of 168 patients from each group. Study groups were comparable for gender (P = 0.999), BMI (P = 0.940), neck circumference (P = 0.969), AHI (P = 0.935), and severity of SDB (P = 0.089). The oximetric variables representing the duration of chronic intermittent hypoxia such as mean (P = 0.001), the longest (P = 0.001) and total apnea durations (P = 0.003), mean (P = 0.001) and the longest hypopnea durations (P = 0.001), and total sleep time with oxygen saturation below 90% (P = 0.008) were significantly higher in the geriatric patients as compared with younger adults. Geriatric patients had significantly lower minimum (P = 0.013) and mean oxygen saturation (P = 0.001) than non-geriatric patients. The study provides evidence that elderly patients exhibit more severe and deeper nocturnal intermittent hypoxia than the younger adults, independent of severity of obstructive sleep apnea, BMI, gender, and neck circumference. Hypoxia-related polysomnographic variables in geriatric patients may in fact reflect a physiological aging process rather than the severity of a SDB.

Community-Specific BMI Cutoff Points for South Indian Females

Directory of Open Access Journals (Sweden)

K. B. Kishore Mohan

2011-01-01

Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.

Endothelial function in young women with polycystic ovary syndrome (PCOS): Implications of body mass index (BMI) and insulin resistance.

Science.gov (United States)

El-Kannishy, Ghada; Kamal, Shaheer; Mousa, Amany; Saleh, Omayma; Badrawy, Adel El; Farahaty, Reham El; Shokeir, Tarek

2010-01-01

Evidence regarding endothelial function in both obese and nonobese women with PCOS is contradictory. It is unknown whether obese women with PCOS carry an increased risk related to body mass index (BMI). To identify endothelial function and investigate its relationship to body mass index and insulin resistance in young women with PCOS. Twenty-two obese women with PCOS (BMI 35.2 ± 3.2) as well as fourteen lean women (BMI 22.8 ± 2.1)with PCOS were included in the study. Fasting serum insulin, blood glucose were estimated and HOMA and Quicki index were calculated. All patients were subjected to ultrasound recording of brachial artery diameter at rest and after reactive hyperemia (FMD) for assessment of endothelial function. Ten age matched healthy females with normal BMI were chosen as a control group. There were higher basal insulin levels with lower Quicki index and higher HOMA index in women with PCOS than normal group, but the differences were significant only between obese PCOS subgroup and control. On the other hand, FMD was significantly and equally decreased in both groups of women with PCOS, compared with control subjects (3.7 ± 3.2% in the nonobese subgroup and 3.5 ± 2.8% in the obese one vs. 10.6 ± 4.1% in control subjects, P, 0.001). FMD was not correlated with BMI nor insulin resistance indices. Endothelial dysfunction is already present in young women with PCOS. In this patient group, it cannot be attributed to insulin resistance or obesity. © 2010 Asian Oceanian Association for the Study of Obesity . Published by Elsevier Ltd. All rights reserved.

BMI and BMI SDS in childhood: annual increments and conditional change

OpenAIRE

Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt

2016-01-01

Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...

Relationship between BMI and blood pressure in girls and boys.

Science.gov (United States)

Gundogdu, Zuhal

2008-10-01

To investigate the relationship between BMI and blood pressure as this is of crucial interest in evaluating both public health and the clinical impact of the so-called obesity epidemic. Data were gathered from 1899 children aged between 6 and 14 years, analysing and evaluating a possible relationship between BMI and systolic and diastolic blood pressure values for both girls and boys. Each child was classified on the basis of age- and sex-specific BMI percentile as normal weight (<85th percentile), overweight (95th percentile). In comparisons among age BMI percentile groups, systolic and diastolic blood pressure values were higher in obese and overweight groups than in normal weight groups for both sexes. Although BMI among girls was higher than among boys in all three percentile groups, there were no significant differences between sexes with respect to blood pressure values. The present findings emphasize the importance of the prevention of obesity in order to prevent future related problems such as hypertension in children and adolescents.

BMI and Lifetime Changes in BMI and Cancer Mortality Risk

NARCIS (Netherlands)

Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M

2015-01-01

Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and

miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

Energy Technology Data Exchange (ETDEWEB)

Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

2015-01-02

Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

Evidence for a relationship between VEGF and BMI independent of insulin sensitivity by glucose clamp procedure in a homogenous group healthy young men.

Directory of Open Access Journals (Sweden)

Michaela Loebig

Full Text Available BACKGROUND: This is the first study to experimentally explore the direct relationship between circulating VEGF levels and body mass index (BMI as well as to unravel the role of insulin sensitivity in this context under standardized glucose clamp conditions as the methodical gold-standard. In order to control for known influencing factors such as gender, medication, and arterial hypertension, we examined a highly homogeneous group of young male subjects. Moreover, to encompass also subjects beyond the normal BMI range, low weight and obese participants were additionally included and stress hormones as a main regulator of VEGF were assessed. METHODOLOGY/PRINCIPAL FINDINGS: Under euglycemic clamp conditions, VEGF was measured in 15 normal weight (BMI 20-25 kg/m(2, 15 low weight (BMI30 kg/m(2 male subjects aged 18-30 years and the insulin sensitivity index (ISI was calculated. Since stress axis activation promotes VEGF secretion, concentrations of ACTH, cortisol, and catecholamines were monitored. Despite of comparable ACTH (P = 0.145, cortisol (P = 0.840, and norepinephrine (P = 0.065 levels, VEGF concentrations differed significantly between BMI-groups (P = 0.008 with higher concentrations in obese subjects as compared to normal weight (P = 0.061 and low weight subjects (P = 0.002. Pearson's correlation analysis revealed a positive relationship between BMI and VEGF levels (r = 0.407; P = 0.010 but no correlation of VEGF with ISI (r = 0.224; P = 0.175. CONCLUSIONS/SIGNIFICANCE: Our data demonstrate a positive correlation between concentrations of circulating VEGF levels and BMI in healthy male subjects under highly controlled conditions. This relationship which is apparently disconnected from insulin sensitivity may be part of some pathogenetic mechanisms underlying obesity and type 2 diabetes.

BMI Group-Related Differences in Physical Fitness and Physical Activity in Preschool-Age Children: A Cross-Sectional Analysis

Science.gov (United States)

Niederer, Iris; Kriemler, Susi; Zahner, Lukas; Burgi, Flavia; Ebenegger, Vincent; Marques- Vidal, Pedro; Puder, Jardena J.

2012-01-01

In the Ballabeina study, we investigated age- and BMI-group-related differences in aerobic fitness (20 m shuttle run), agility (obstacle course), dynamic (balance beam) and static balance (balance platform), and physical activity (PA, accelerometers) in 613 children (M age = 5.1 years, SD = 0.6). Normal weight (NW) children performed better than…

Physical Activity, BMI, and Blood Pressure in US Youth: NHANES 2003-2006.

Science.gov (United States)

Betz, Heather Hayes; Eisenmann, Joey C; Laurson, Kelly R; DuBose, Katrina D; Reeves, Mathew J; Carlson, Joseph J; Pfeiffer, Karin A

2018-03-15

The objective of this study was to examine the independent and combined association of physical activity and body mass index (BMI) with blood pressure in youth. Youth aged 8-18 years from the 2003-2006 National Health and Nutrition Examination Survey (NHANES) with BMI, blood pressure, and physical activity (accelerometer) were included in the analyses. A total of 2585 subjects (1303 males; 47% of all 8- to 18-year-olds) met these criteria. Obese youth had a systolic blood pressure that was 8 mm Hg higher than normal weight youth. A significant interaction between BMI and physical activity on blood pressure was found (P < .001), and group differences among the BMI/activity groups showed that the 3 obese groups and the overweight/least active group had significantly higher systolic blood pressure than the normal weight/active group across all analyses. The overweight/least active and normal weight/least active groups had significantly higher diastolic blood pressure than the normal weight/active group as well. This study showed a significant independent and combined association of BMI and physical activity with blood pressure in youth. Interventions need to focus on the reduction of fatness/BMI as a way to reduce the cardiovascular risk in youth.

Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

Directory of Open Access Journals (Sweden)

Katarzyna Taran

2016-02-01

Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

BMI, body fat and waist-to-height ratio of stunted v. non-stunted Indian children: a case-control study.

Science.gov (United States)

Savanur, Mitravinda S; Ghugre, Padmini S

2016-06-01

To compare the BMI, body fat and waist-to-height ratio (WHtR) of stunted and non-stunted children following different growth trajectories from low socio-economic strata in Mumbai, India. Cross-sectional, case-control study. Weight, height, skinfold thicknesses and waist circumference were measured. Information regarding the duration of breast-feeding, age at initiation of complementary feeding and income was obtained. Birth weight was obtained from records. BMI, body fat, WHtR and change in weight sd were calculated. Children who were beneficiaries of anganwadis, Mumbai city, India. Three hundred and thirty children aged 2-4 years were selected in each of the stunted and non-stunted groups after matching for age and sex. After adjusting for birth weight, change in weight sd, duration of breast-feeding, age at complementary feeding initiation and income, stunted children had significantly higher body fat, WHtR and BMI than the non-stunted (Pchildren were classified based on their change in weight sd. Stunted children with no change in weight sd had higher mean body fat, BMI (Pchildren had higher BMI and WHtR than the non-stunted (both Pchildren had higher BMI than the non-stunted (Pfat in young children. Such a tendency, if continued during later childhood and adolescence, can increase the risk of obesity and non-communicable diseases.

BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.

Science.gov (United States)

Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan

2006-01-01

Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.

BMI and Lifetime Changes in BMI and Cancer Mortality Risk

Science.gov (United States)

Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.

2015-01-01

Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129

BMI-1, a promising therapeutic target for human cancer

Science.gov (United States)

WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN

2015-01-01

BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537

BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.

Science.gov (United States)

Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G

2018-01-01

Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.

Dietary intake in the early years and its relationship to BMI in a bi-ethnic group: the Born in Bradford 1000 study.

Science.gov (United States)

Mahoney, Samuel; Bryant, Maria; Sahota, Pinki; Barber, Stuart

2018-04-02

To assess relationships between dietary intake at age 12, 18 and 36 months and BMI Z-scores at age 36 months in a bi-ethnic group. A prospective cohort study comparing cross-sectional and longitudinal data. Exposures included dietary intake at 12, 18 and 36 months (FFQ) with an outcome of BMI Z-score at age 36 months. Born in Bradford 1000 study, Bradford, UK. Infants at age 12 months (n 722; 44 % White British, 56 % Pakistani), 18 months (n 779; 44 % White British, 56 % Pakistani) and 36 months (n 845; 45 % White British, 55 % Pakistani). Diet at age 12 months was not associated with BMI Z-score at age 36 months. Higher consumption of vegetables at 18 and 36 months was associated with a lower BMI Z-score at 36 months (model coefficient (95 % CI): -0·20 (-0·36, -0·03) and -0·16 (-0·31, -0·02), respectively). Higher consumption of high-fat chips at age 36 months was associated with a lower BMI Z-score at age 36 months (-0·16 (-0·32, 0·00)). Overall, White British children had higher 36-month BMI Z-scores than Pakistani children (adjusted mean difference (95 % CI): 0·21 (0·02, 0·41)). Our findings indicate that dietary intake at 18 and 36 months was somewhat related to BMI Z-score at age 36 months and suggest the importance of early interventions aimed at establishing healthy eating behaviours.

The Role of BMI in Hip Fracture Surgery.

Science.gov (United States)

Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry

2018-01-01

Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.

BMI Trajectories from Birth to Young Adulthood.

Science.gov (United States)

McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K

2018-04-19

This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.

Expression of Bmi-1 is a prognostic marker in bladder cancer

Directory of Open Access Journals (Sweden)

Xu Li-Hua

2009-02-01

Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.

A low or high BMI is a risk factor for renal hematoma after extracorporeal shock wave lithotripsy for kidney stones.

Science.gov (United States)

Nussberger, Fabio; Roth, Beat; Metzger, Tobias; Kiss, Bernhard; Thalmann, George N; Seiler, Roland

2017-06-01

The purpose of this study was to evaluate risk factors for renal hematoma after extracorporeal shock wave lithotripsy (SWL) for kidney stones in a matched case-control analysis of a subgroup of patients recruited from a prospective randomized cohort. Between 06/2010 and 03/2013, 418 patients underwent SWL with the MODULITH ® -SLX-F2-lithotripter for kidney stones. In 39/418 patients (9 %), ultrasound at post-treatment day 1 revealed renal hematomas. For 37 of these patients, a matched group without hematoma could be selected according to the following matching criteria: age, gender, number and energy of shock waves, stone burden and localization. Risk factors for renal hematoma after SWL were compared between the two groups. The rates of diabetes, stopped anticoagulant/antiplatelet medications and arterial hypertension were not different between the two groups (p > 0.2). The skin-kidney distance was virtually the same in both groups (p = 0.5). In the hematoma group, significantly more patients had a high (>30: n = 16) as well as a low (hematomas after SWL. Patients with a high (>30) or low (<21.5) BMI had a higher risk for renal damage after SWL. Therefore, alternative endoscopic treatment options should be considered in these patients.

Ethnicity influences BMI as evaluated from reported serum lipid values in Inuit and non-Inuit: raised upper limit of BMI in Inuit?

Science.gov (United States)

Noahsen, Paneeraq; Andersen, Stig

2013-01-01

To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.

Variations in BMI and prevalence of health risks in diverse racial and ethnic populations.

Science.gov (United States)

Stommel, Manfred; Schoenborn, Charlotte A

2010-09-01

When examining health risks associated with the BMI, investigators often rely on the customary BMI thresholds of the 1995 World Health Organization report. However, within-interval variations in morbidity and mortality can be substantial, and the thresholds do not necessarily correspond to identifiable risk increases. Comparing the prevalence of hypertension, diabetes, coronary heart disease (CHD), asthma, and arthritis among non-Hispanic whites, blacks, East Asians and Hispanics, we examine differences in the BMI-health-risk relationships for small BMI increments. The analysis is based on 11 years of data of the National Health Interview Survey (NHIS), with a sample size of 337,375 for the combined 1997-2007 Sample Adult. The analysis uses multivariate logistic regression models, employing a nonparametric approach to modeling the BMI-health-risk relationship, while relying on narrowly defined BMI categories. Rising BMI levels are associated with higher levels of chronic disease burdens in four major racial and ethnic groups, even after adjusting for many socio-demographic characteristics and three important health-related behaviors (smoking, physical activity, alcohol consumption). For all population groups, except East Asians, a modestly higher disease risk was noted for persons with a BMI ethnic groups regardless of BMI levels, the evidence presented here does not support the notion that the BMI-health-risk profile of East Asians and others warrants race-specific BMI cutoff points.

Investigation of the effect of body mass index (BMI) on semen parameters and male reproductive system hormones.

Science.gov (United States)

Keskin, Mehmet Zeynel; Budak, Salih; Aksoy, Evrim Emre; Yücel, Cem; Karamazak, Serkan; Ilbey, Yusuf Ozlem; Kozacıoğlu, Zafer

2017-10-03

To evaluate the effects of body mass index (BMI) ratio on semen parameters and serum reproductive hormones. The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC), normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165), Group 2 (n = 222) and Group 3 (n = 56). There was no statistically significant difference in terms of all variables between the groups. We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.

Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer

Science.gov (United States)

2011-01-01

Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi

About BMI for Adults

Science.gov (United States)

... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...

Maternal Pre-pregnancy BMI and Reproductive Health of Daughters in Young Adulthood

DEFF Research Database (Denmark)

Mariansdatter, Saga Elise; Ernst, Andreas; Toft, Gunnar

2016-01-01

Objective To investigate the possible associations between maternal pre-pregnancy body mass index (BMI) and daughters' age of menarche and subsequent markers of reproductive health. Methods Nine hundred eighty-five pregnant women (80 %) were enrolled at their routine 30th week examinations in 1988...... dehydroepiandrosterone-sulphate (DHEAS), estradiol, and free estrogen index (FEI), compared to the middle BMI tertile. This was supported by a sub-analysis using the WHO classification (underweight, BMI obese, BMI ≥ 25.00 kg/m2) as exposure groups, in which daughters...... of overweight mothers had lower levels of DHEAS and estradiol, and lower FEI compared to daughters of normal weight mothers. No associations were found for ovarian follicle count in any of the groups. Conclusions for Practice We found that higher maternal BMI is associated with earlier age of menarche...

Inter-individual inequality in BMI: An analysis of Indonesian Family Life Surveys (1993–2007

Directory of Open Access Journals (Sweden)

Masoud Vaezghasemi

2016-12-01

Full Text Available Widening inequalities in mean Body Mass Index (BMI between social and economic groups are well documented. However, whether changes in mean BMI are followed by changes in dispersion (or variance and whether these inequalities are also occurring within social groups or across individuals remain understudied. In addition, a substantial body of literature exists on the global increase in mean BMI and prevalence of overweight and obesity. However, whether this weight gain is shared proportionately across the whole spectrum of BMI distribution, also remains understudied. We examined changes in the distribution of BMI at the population level over time to understand how changes in the dispersion reflect between-group compared to within-group inequalities in weight gain. Moreover, we investigated the entire distribution of BMI to determine in which percentiles the most weight gain is occurring over time. Utilizing four waves (from 1993 to 2007 of Indonesian Family Life Surveys (IFLS, we estimated changes in the mean and the variance of BMI over time and across various socioeconomic groups based on education and households’ expenditure per capita in 53,648 men and women aged 20–50 years. An increase in mean and standard deviation was observed among men (by 4.3% and 25%, respectively and women (by 7.3% and 20%, respectively over time. Quantile-Quantile plots showed that higher percentiles had greater increases in BMI compared to the segment of the population at lower percentiles. While between socioeconomic group differences decreased over time, within-group differences increased and were more prominent among individuals with poor education and lower per capita expenditures. Population changes in BMI cannot be fully described by average trends or single parameters such as the mean BMI. Moreover, greater increases in within-group dispersion compared with between-group differences imply that growing inequalities are not merely driven by these

Reduction of snapshots for MIMO radar detection by block/group orthogonal matching pursuit

KAUST Repository

Ali, Hussain El Hosiny

2014-10-01

Multiple-input multiple-output (MIMO) radar works on the principle of transmission of independent waveforms at each element of its antenna array and is widely used for surveillance purposes. In this work, we investigate MIMO radar target localization problem with compressive sensing. Specifically, we try to solve the problem of estimation of target location in MIMO radar by group and block sparsity algorithms. It will lead us to a reduced number of snapshots required and also we can achieve better radar resolution. We will use group orthogonal matching pursuit (GOMP) and block orthogonal matching pursuit (BOMP) for our problem. © 2014 IEEE.

Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.

Science.gov (United States)

Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran

2018-03-01

High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.

Investigation of the effect of body mass index (BMI on semen parameters and male reproductive system hormones

Directory of Open Access Journals (Sweden)

Mehmet Zeynel Keskin

2017-10-01

Full Text Available Aim: To evaluate the effects of body mass index (BMI ratio on semen parameters and serum reproductive hormones. Materials and methods: The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. Results: The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC, normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165, Group 2 (n = 222 and Group 3 (n = 56. There was no statistically significant difference in terms of all variables between the groups. Conclusions: We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.

[Body image dissatisfaction as a mediator of the association between BMI, self-esteem and mental health in early adolescents: a multiple-group path analysis across gender].

Science.gov (United States)

Jang, Mi Heui; Lee, Gyungjoo

2013-04-01

This study was done to examine not only the relationships between body mass index (BMI), self-esteem, body image dissatisfaction (BID) and mental health, according to gender, but the mediating role of BID on mental health in relation to BMI and self-esteem among early adolescents. Data from 576 (296 boys and 280 girls) elementary school students in grades 5 to 6 were collected. A multiple-group path analysis was utilized to examine the relationships between BMI, self-esteem, BID and mental health by gender. In the path analysis for all students, poor mental health was related directly to BID, while it was indirectly related to BMI and self-esteem. In the multiple-group path analysis of both genders, BID was found to have a significant direct and indirect effect on mental health for girls alone. The findings suggested that BID should be examined early to prevent poor mental health in early adolescent girls. This study helps to elucidate the role of early adolescent BID on mental health and provides insight for further prevention and intervention programs in school and community mental health settings.

Expression of Bmi-1 is a prognostic marker in bladder cancer

International Nuclear Information System (INIS)

Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing

2009-01-01

The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer

Attenuation of doxorubicin-induced cardiotoxicity by esculetin through modulation of Bmi-1 expression.

Science.gov (United States)

Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan

2017-09-01

The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.

Penetrating Osseous Spicules Causing High-Flow Ventral CSF Leaks in the Setting of Relatively Low BMI : A Preliminary Study.

Science.gov (United States)

Rosebrock, Richard E; Diehn, Felix E; Luetmer, Patrick H; Wald, John T; Lane, John I; Morris, Jonathan M; Lehman, Vance T; Carr, Carrie M; Mokri, Bahram; Thielen, Kent R

2017-05-16

We have anecdotally observed patients with high-flow ventral cerebrospinal fluid (CSF) leaks resulting from penetrating osseous spicules or calcified discs to be relatively thin. The purpose of this study was to explore the validity of this observation and determine if a potential association exists between low body mass index (BMI) and high-flow spinal ventral CSF leaks resulting from such dura-penetrating lesions. Sixteen consecutive patients with precisely localized high-flow ventral spinal CSF leaks on dynamic myelography were identified. The cause of the CSF leak was determined. The BMI on the date nearest to and within 2 weeks of myelography was recorded. Utilizing exact sign test, the body mass index was compared to the average BMI from the National Health and Nutrition Examination Survey (Centers for Disease Control), matched to sex and age-range. The cohort consisted of 10 males (63%) and 6 females with a mean age of 54 years (range 37-72 years). In all patients, a spiculated osteophyte/calcified disc was identified at the site of the leak. Fourteen patients (88%) had a BMI below the matched national average, while only two patients (13%) had values above the national average (p = 0.004). Patients with high-flow ventral CSF leaks resulting from spiculated osteophyte or calcified disc as identified by dynamic myelography are more likely to have a BMI below the U.S. national average, matched for gender and age-range. This exploratory analysis requires confirmation as well as further characterization of potential pathophysiologic mechanisms and impact on radiographic and clinical assessments.

Early childhood BMI trajectories in monogenic obesity due to leptin, leptin receptor, and melanocortin 4 receptor deficiency.

Science.gov (United States)

Kohlsdorf, Katja; Nunziata, Adriana; Funcke, Jan-Bernd; Brandt, Stephanie; von Schnurbein, Julia; Vollbach, Heike; Lennerz, Belinda; Fritsch, Maria; Greber-Platzer, Susanne; Fröhlich-Reiterer, Elke; Luedeke, Manuel; Borck, Guntram; Debatin, Klaus-Michael; Fischer-Posovszky, Pamela; Wabitsch, Martin

2018-02-27

To evaluate whether early childhood body mass index (BMI) is an appropriate indicator for monogenic obesity. A cohort of n = 21 children living in Germany or Austria with monogenic obesity due to congenital leptin deficiency (group LEP, n = 6), leptin receptor deficiency (group LEPR, n = 6) and primarily heterozygous MC4 receptor deficiency (group MC4R, n = 9) was analyzed. A control group (CTRL) was defined that consisted of n = 22 obese adolescents with no mutation in the above mentioned genes. Early childhood (0-5 years) BMI trajectories were compared between the groups at selected time points. The LEP and LEPR group showed a tremendous increase in BMI during the first 2 years of life with all patients displaying a BMI >27 kg/m 2 (27.2-38.4 kg/m 2 ) and %BMI P95 (percentage of the 95th percentile BMI for age and sex) >140% (144.8-198.6%) at the age of 2 years and a BMI > 33 kg/m 2 (33.3-45.9 kg/m 2 ) and %BMI P95  > 184% (184.1-212.6%) at the age of 5 years. The MC4R and CTRL groups had a later onset of obesity with significantly lower BMI values at both time points (p BMI trajectories in this pediatric cohort with monogenic obesity we suggest that BMI values >27.0 kg/m 2 or %BMI P95  > 140% at the age of 2 years and BMI values >33.0 kg/m 2 or %BMI P95  > 184% at the age of 5 years may be useful cut points to identify children who should undergo genetic screening for monogenic obesity due to functionally relevant mutations in the leptin gene or leptin receptor gene.

Behavioural patterns only predict concurrent BMI status and not BMI trajectories in a sample of youth in Ontario, Canada.

Science.gov (United States)

Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T

2018-01-01

Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.

Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.

Science.gov (United States)

Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo

2017-05-01

Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.

Eating tasty food to cope. Longitudinal association with BMI.

Science.gov (United States)

Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D

2015-04-01

The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.

The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.

Science.gov (United States)

Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale

2018-02-01

Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.

Associations of maternal macronutrient intake during pregnancy with infant BMI peak characteristics and childhood BMI.

Science.gov (United States)

Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng

2017-03-01

Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT

Maternal and offspring intelligence in relation to BMI across childhood and adolescence.

Science.gov (United States)

Wraw, Christina; Deary, Ian J; Der, Geoff; Gale, Catharine R

2018-01-30

The present study tested the association between both mothers' and offspring's intelligence and offspring's body mass index (BMI) in youth. Participants were members of the National Longitudinal Survey of Youth 1979 (NLSY-79) Children and Young Adults cohort (n = 11,512) and their biological mothers who were members of the NLSY-79 (n = 4932). Offspring's IQ was measured with the Peabody Individual Achievement Test (PIAT). Mothers' IQ was measured with the Armed Forces Qualification Test (AFQT). A series of regression analyses tested the association between IQ and offspring's BMI by age group, while adjusting for pre-pregnancy BMI and family SES. The analyses were stratified by sex and ethnicity (non-Black and non-Hispanic, Black, and Hispanic). The following associations were observed in the fully adjusted analyses. For the non-Blacks and non-Hispanics, a SD increment in mothers' IQ was negatively associated with daughters' BMI across all age-groups, ranging from β = -0.12 (95% CI -0.22 to -0.02, p = 0.021) in late childhood, to β = -0.17 (95% C.I. -0.27 to -0.07, p = 0001), in early adolescence and a SD increment in boys' IQ was positively associated with their BMI in early adolescence β = 0.09 (95% CI 0.01-0.18, p = 0.031). For Blacks, there was a non-linear relationship between mothers' IQ and daughters' BMI across childhood and between girls' IQ and BMI across adolescence. There was a positive association between mothers' IQ and sons' BMI in early adolescence (β = 0.17, 95% CI 0.02-0.32, p = 0.030). For Hispanic boys, there was a positive IQ-BMI association in late childhood (β = 0.19, 95% CI 0.05-0.33, p = 0.008) and early adolescence (β = 0.17, 95% CI 0.04-0.31, p = 0.014). Mothers' IQ and offspring's IQ were associated with offspring's BMI. The relationships varied in direction and strength across ethnicity, age group and sex. Obesity interventions may benefit from acknowledging the heterogeneous

Attitudes toward obesity in obese persons: A matched comparison of obese women with and without binge eating

Science.gov (United States)

Puhl, R.M.; Masheb, R.M.; White, M.A.; Grilo, C.M.

2013-01-01

No research has compared expressions of weight bias across different subgroups of obese individuals. This study compared attitudes toward and beliefs about obesity in women with and without binge eating disorder (BED) and examined whether these attitudes are related to psychological factors. Fifty obese women with BED were compared with an age- and body mass index (BMI)-matched group of 50 obese women without BED on a battery of established measures of anti-fat attitudes and beliefs about weight controllability and psychological factors (self-esteem, depression, and eating disorder features). The age-and BMI-matched groups did not differ with respect to beliefs about obesity or attitudes toward obese persons, or in self-esteem or depression. Correlational analyses conducted separately within each group revealed that women with BED who reported more favorable attitudes towards obese persons had higher self-esteem and lower levels of depression, whereas there were no significant associations between these variables among women without BED. In addition, weight controllability beliefs and eating disorder features were unrelated to self-esteem and depression in both groups. These findings suggest that stigmatizing attitudes endorsed by obese persons are neither tempered nor worsened by psychological distress or eating pathology. Given that stigmatizing attitudes did not differ between obese women with and without BED, it may be that obesity itself, rather than psychological features or disordered eating, increases vulnerability to negative weight-based attitudes. Potential implications for stigma reduction efforts and clinical practice are discussed. PMID:20124783

Associations between parity and maternal BMI in a population-based cohort study.

Science.gov (United States)

Iversen, Ditte S; Kesmodel, Ulrik S; Ovesen, Per G

2018-02-07

We aimed to investigate the change in prevalence of overweight and obesity in pregnant Danish women from 2004 to 2012, and investigate whether increasing parity was associated with a change in body mass index (BMI) prevalence. We obtained a population-based cohort from the Danish Medical Birth Registry consisting of all Danish women giving birth in 2004-2012 (n = 572 321). This registry contains information on 99.8% of all births in Denmark. We calculated the overall change in prepregnancy BMI status among pregnant women in Denmark, and a multiple linear regression model with adjustment for several potential confounders was used to examine the change in prepregnancy BMI with increasing parity. In 2004, the prevalence of prepregnancy overweight and obesity (BMI ≥ 25) and obesity alone (BMI ≥ 30) was 31.9 and 11%, respectively. In 2012, the prevalence had reached 34.2 and 12.8%. The mean BMI increased for every additional parity from 23.80 (95% CI 23.77-23.82) in parity group 1 to 26.70 (26.52-26.90) in parity group 5+. A multiple linear regression adjusted for potential confounders showed that women on average gained 0.62 (0.58-0.65) BMI units after every additional birth. This study showed a 7.2% increase in overweight and obesity (BMI ≥ 25) and a 16.4% increase in obesity alone (BMI ≥ 30) for pregnant women in Denmark from 2004 to 2012. In addition, an increase in interpregnancy BMI was seen at every additional delivery, suggesting that obesity is an increasing challenge in obstetrics. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.

Human milk insulin is related to maternal plasma insulin and BMI: but other components of human milk do not differ by BMI.

Science.gov (United States)

Young, B E; Patinkin, Z; Palmer, C; de la Houssaye, B; Barbour, L A; Hernandez, T; Friedman, J E; Krebs, N F

2017-09-01

The impact of maternal BMI and insulin sensitivity on bioactive components of human milk (HM) is not well understood. As the prevalence of obesity and diabetes rises, it is increasingly critical that we understand how maternal BMI and hormones associated with metabolic disease relate to concentrations of bioactive components in HM. This longitudinal cohort design followed 48 breastfeeding mothers through the first four months of lactation, collecting fasting morning HM samples at 2-weeks and 1, 2, 3 and 4-months, and fasting maternal blood at 2-weeks and 4-months. Insulin, glucose, adipokines leptin and adiponectin, appetite regulating hormone ghrelin, marker of oxidative stress 8OHdG and inflammatory cytokines (IL-6, IL-8, and TNF-a) were measured in HM and maternal plasma. A total of 26 normal weight (NW) (BMI=21.4±2.0 kg/m 2 ) and 22 overweight/obese (OW/Ob) (BMI=30.4±4.2 kg/m 2 ) were followed. Of all HM analytes measured, only insulin and leptin were different between groups - consistently higher in the OW/Ob group (leptin: P<0.001; insulin: P<0.03). HM insulin was 98% higher than maternal plasma insulin at 2-weeks and 32% higher at 4-months (P<0.001). Maternal fasting plasma insulin and HOMA-IR were positively related to HM insulin at 2-weeks (P<0.001, R 2 ⩾0.38, n=31), and 4-months (P⩽0.005, R 2 ⩾0.20, n=38). The concentrations of insulin in HM are higher than in maternal plasma and are related to maternal BMI and insulin sensitivity. With the exception of leptin, there were minimal other differences observed in HM composition across a wide range in maternal BMI.

Correlation between BMI and motor coordination in children.

Science.gov (United States)

Lopes, Vítor P; Stodden, David F; Bianchi, Mafalda M; Maia, Jose A R; Rodrigues, Luis P

2012-01-01

To analyze the association between motor coordination (MC) and body mass index (BMI) across childhood and early adolescence. This study is cross-sectional. Data were collected in 7175 children (boys n=3616, girls n=3559), ages 6-14 years. BMI was calculated from measured height and weight [body mass (kg)/height (m(2))]. Motor coordination was evaluated using Kiphard-Schilling's body coordination test (KTK). Spearman's rank correlation was used to study the association between BMI and MC. A Kruskal-Wallis test was used to analyze the differences in MC between children of normal weight, overweight and obese children. Correlations between MC and BMI were negative and varied between 0.05 and 0.49. The highest negative correlations for both boys and girls was at 11 years of age. There was a general pattern of increasing negative correlations in both genders from 6 to 11 years of age and then a decrease in correlation strengths through 14 years of age. In both boys (χ(2)((2))=324.01; p<0.001) and girls (χ(2)((2))=291.20; p<0.001) there were significant differences in MC between the three groups' weight status. Normal weight children of both sexes demonstrated significantly higher MC scores than overweight. Obese children in both sexes had the lowest MC scores among all three groups. Motor coordination demonstrated an inverse relationship with BMI across childhood and into early adolescence. The strength of the inverse relation increased during childhood, but decreased through early adolescence. Overweight and obese children of both sexes demonstrated significantly lower MC than normal weight children. Copyright © 2011 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

Early miscarriage rate in lean polycystic ovary syndrome women after euploid embryo transfer - a matched-pair study.

Science.gov (United States)

Luo, Lu; Gu, Fang; Jie, Huying; Ding, Chenhui; Zhao, Qiang; Wang, Qiong; Zhou, Canquan

2017-11-01

The early miscarriage rate is reported to be higher in patients with polycystic ovary syndrome (PCOS) compared with non-PCOS patients. However, whether PCOS is an independent risk factor for early miscarriage is still controversial; to what extent embryonic aneuploidy accounts for miscarriages of PCOS is still unknown. In this 1:3 matched-pair study, 67 lean PCOS patients and 201 controls matched for age, body mass index (BMI) and embryo scores undergoing a single euploid blastocyst transfer in vitrified-warmed cycles were analysed. Clinical pregnancy, early miscarriage and live birth rates were compared. Logistic regression analysis was performed to further evaluate the factors associated with early miscarriage and live birth. Clinical pregnancy rates were 50.7% in PCOS and 55.2% in control groups. Early miscarriage rate was significantly (P = 0.029) increased in the PCOS group compared with controls; non-PCOS patients had a significantly higher live birth rate than PCOS patients, P PCOS was significantly associated with a higher risk of early miscarriage and decreased chance of live birth. In conclusion, PCOS in women undergoing pre-implantation genetic diagnosis may, independently from BMI and karyotype, increase the risk of miscarriage. Copyright © 2017 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

Clinical implications of gait analysis in the rehabilitation of adult patients with "Prader-Willi" Syndrome: a cross-sectional comparative study ("Prader-Willi" Syndrome vs matched obese patients and healthy subjects

Directory of Open Access Journals (Sweden)

Baccalaro Gabriele

2007-05-01

Full Text Available Abstract Background Being severely overweight is a distinctive clinical feature of Prader-Willi Syndrome (PWS. PWS is a complex multisystem disorder, representing the most common form of genetic obesity. The aim of this study was the analysis of the gait pattern of adult subjects with PWS by using three-Dimensional Gait Analysis. The results were compared with those obtained in a group of obese patients and in a group of healthy subjects. Methods Cross-sectional, comparative study: 19 patients with PWS (11 males and 8 females, age: 18–40 years, BMI: 29.3–50.3 kg/m2; 14 obese matched patients (5 males and 9 females, age: 18–40 years, BMI: 34.3–45.2 kg/m2; 20 healthy subjects (10 males and 10 females, age: 21–41 years, BMI: 19.3–25.4 kg/m2. Kinematic and kinetic parameters during walking were assessed by an optoelectronic system and two force platforms. Results PWS adult patients walked slower, had a shorter stride length, a lower cadence and a longer stance phase compared with both matched obese, and healthy subjects. Obese matched patients showed spatio-temporal parameters significantly different from healthy subjects. Furthermore, Range Of Motion (ROM at knee and ankle, and plantaflexor activity of PWS patients were significantly different between obese and healthy subjects. Obese subjects revealed kinematic and kinetic data similar to healthy subjects. Conclusion PWS subjects had a gait pattern significantly different from obese patients. Despite that, both groups had a similar BMI. We suggest that PWS gait abnormalities may be related to abnormalities in the development of motor skills in childhood, due to precocious obesity. A tailored rehabilitation program in early childhood of PWS patients could prevent gait pattern changes.

Longitudinal weight differences, gene expression, and blood biomarkers in BMI discordant identical twins

Science.gov (United States)

van Dongen, Jenny; Willemsen, Gonneke; Heijmans, Bastiaan T.; Neuteboom, Jacoline; Kluft, Cornelis; Jansen, Rick; Penninx, Brenda W.J.; Slagboom, P. Eline; de Geus, Eco J.C.; Boomsma, Dorret I.

2015-01-01

Background BMI discordant monozygotic (MZ) twins allows an examination of the causes and consequences of adiposity in a genetically controlled design. Few studies have examined longitudinal BMI discordance in MZ pairs. Objectives To study the development over time of BMI discordance in adolescent and adult MZ twin pairs, and to examine lifestyle, metabolic, inflammatory, and gene expression differences associated with concurrent and long-term BMI discordance in MZ pairs. Subjects/Methods BMI data from 2775 MZ twin pairs, collected in eight longitudinal surveys and a biobank project between 1991 and 2011, were analyzed to characterize longitudinal discordance. Lifestyle characteristics were compared within discordant pairs (ΔBMI ≥ 3 kg/m2) and biomarkers (lipids, glucose, insulin, CRP, fibrinogen, IL-6, TNF-α and sIL-6R and liver enzymes AST, ALT and GGT) and gene expression were compared in peripheral blood from discordant pairs who participated in the NTR biobank project. Results The prevalence of discordance ranged from 3.2% in 1991 (mean age=17, SD=2.4) to 17.4% (N=202 pairs) in 2009 (mean age=35, SD=15), and was 16.5% (N=174) among pairs participating in the biobank project (mean age=35, SD=12). Of 699 MZ with BMI data from 3-5 time points, 17 pairs (2.4%) were long-term discordant (at all available time points; mean follow-up range=6.4 years). Concurrently discordant pairs showed significant differences in self-ratings of which twin eats most (p=2.3×10−13), but not in leisure time exercise activity (p=0.28) and smoking (p>0.05). Ten out of 14 biomarkers showed significantly more unfavorable levels in the heavier of twin of the discordant pairs (p-values BMI discordance is uncommon in adolescent identical pairs but increases with higher pair-mean of BMI at older ages, although long-term BMI discordance is rare. In discordant pairs, the heavier twin had a more unfavorable blood biomarker profile than the genetically matched leaner twin, in support of

Gender expression associated with BMI in a prospective cohort study of US adolescents.

Science.gov (United States)

Bryn Austin, S; Ziyadeh, Najat J; Calzo, Jerel P; Sonneville, Kendrin R; Kennedy, Grace A; Roberts, Andrea L; Haines, Jess; Scherer, Emily A

2016-02-01

To examine the relationship between gender expression (GE) and BMI in adolescence. Repeated measures of weight-related behaviors and BMI were collected from 1996 to 2011 via annual/biennial self-report surveys from youth aged 10 to 23 years (6,693 females, 2,978 males) in the longitudinal Growing Up Today Study. GE (very conforming [referent], mostly conforming, nonconforming) was assessed in 2010/11. Sex-stratified, multivariable linear models estimated GE group differences in BMI and the contribution of sexual orientation and weight-related exposures to group differences. Models for males included interaction terms for GE with age. In females, mostly conforming youth had 0.53 kg m(-2) and nonconforming had 1.23 kg m(-2) higher BMI; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 8% and remained statistically significant. In males, mostly conforming youth had -0.67 kg m(-2) and nonconforming had -1.99 kg m(-2) lower BMI (age [in years]) interactions were between -0.09 and -0.14 kg m(-2) ; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 11% and remained statistically significant. GE is a strong independent predictor of BMI in adolescence. Obesity prevention and treatment interventions with youth must address ways that gender norms may reinforce or undermine healthful behaviors. © 2016 The Obesity Society.

Memory and phonological awareness in children with Benign Rolandic Epilepsy compared to a matched control group.

Science.gov (United States)

Northcott, Ellen; Connolly, Anne M; Berroya, Anna; McIntyre, Jenny; Christie, Jane; Taylor, Alan; Bleasel, Andrew F; Lawson, John A; Bye, Ann M E

2007-06-01

In a previous study we demonstrated children with Benign Rolandic Epilepsy have normal intelligence and language ability. However, difficulties in verbal and visual memory and aspects of phonological awareness were found compared to normative data. To address the methodological limitations related to the use of normative data, we compared the same cohort of children with Benign Rolandic Epilepsy to a matched control group. Controls (n=40) matched on age and gender to the Benign Rolandic Epilepsy cohort underwent neuropsychological assessment. The life functioning of the control group was assessed using a modified version of the Quality of Life in Childhood Epilepsy Questionnaire (QOLCE). The study confirmed the previous findings of memory and phonological awareness difficulties. In addition, the children with Benign Rolandic Epilepsy had significantly lower IQ scores than the matched control group. Paired sample t-tests showed that on 8 of 11 QOLCE scales, children with Benign Rolandic Epilepsy were rated by parents as having poorer life functioning compared to matched controls, including lower parental ratings on the subscales of memory and language. Benign Rolandic Epilepsy has an excellent seizure prognosis, but this study further emphasizes potential cognitive difficulties. Using an age and gender matched control group, the previous findings of memory and phonological awareness difficulties were validated. These problems in cognition were also identified by parents of children with Benign Rolandic Epilepsy as problematic and impacting upon the child's quality of life.

Overexpression of microRNA-132 enhances the radiosensitivity of cervical cancer cells by down-regulating Bmi-1.

Science.gov (United States)

Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan

2017-10-06

We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.

The impact of serum adropin and ischemia modified albumin levels based on BMI in PCOS.

Science.gov (United States)

Inal, Zeynep Ozturk; Erdem, Sami; Gederet, Yavuz; Duran, Cevdet; Kucukaydin, Zehra; Kurku, Huseyin; Sakarya, Derya Kilic

2018-02-21

The aim of this study was to evaluate the effects of polycystic ovary syndrome (PCOS) and body mass index (BMI) on serum adropin and ischemia modified albumin (IMA) levels. This prospective cross-sectional study was performed with a total of 120 women [group1; non-PCOS = 60 (BMI PCOS = 60 (BMI PCOS and non-PCOS patients in the lean and overweight groups (pPCOS group were lower than in the lean non-PCOS group (pPCOS group than in the overweight non-PCOS group (pPCOS group than in the non-PCOS group in both the lean and overweight groups (pPCOS group, IMA levels increased. Further studies are needed to determine the effects of adropin and IMA in women with PCOS and to use a new marker to monitorize treatment outcomes.

The effect of prenatal maternal cigarette smoking on children's BMI z-score with SGA as a mediator.

Science.gov (United States)

Salahuddin, Meliha; Pérez, Adriana; Ranjit, Nalini; Hoelscher, Deanna M; Kelder, Steven H

2018-02-21

The goal of this study was to assess the effect of prenatal maternal cigarette smoking on children's BMI z-score trajectories, and to evaluate whether small-for-gestational-age (SGA) acts as a potential mediator between prenatal maternal cigarette smoking and child's BMI z-score at 4 years of age. Group-based trajectory modeling (GBTM) methods were employed to describe and classify developmental BMI z-score trajectories (the outcome of interest) in children from 9 months to 4 years of age (n = 5221) in the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B) study (2001-2005). Further analysis examined whether the identified BMI z-score trajectories varied with the exposure, prenatal maternal cigarette smoking. Mediation analyses were utilized to examine whether being SGA (binary measure) acted as a potential mediator in the relationship between prenatal maternal cigarette smoking and BMI z-score among 4-year-old children. Using GBTM, two BMI z-score trajectory groups were identified: normal BMI z-score (57.8%); and high BMI z-score (42.2%). Children of mothers who smoked cigarettes during pregnancy were 2.1 times (RR 95% CI: 1.1-4.0, P value = 0.023) more at risk of being in the high BMI z-score trajectory group. Prenatal cigarette smoking was positively related to SGA at birth, but SGA was inversely related to BMI z-score at 4 years. The direct effect (0.19, 95% CI: 0.18, 0.19; P value BMI z-score among 4-year-old children was stronger and in the opposite direction of the indirect effect (-0.04, 95% CI: -0.04, -0.04; P value BMI z-score group, as well with SGA. The effects of prenatal smoking on BMI z-score at 4 years appears to act through pathways other than SGA.

2-Year BMI Changes of Children Referred for Multidisciplinary Weight Management

Directory of Open Access Journals (Sweden)

Jennifer K. Cheng

2014-01-01

Full Text Available Objective. To examine body mass index (BMI changes among pediatric multidisciplinary weight management participants and nonparticipants. Design. In this retrospective database analysis, we used multivariable mixed effect models to compare 2-year BMI z-score trajectories among 583 eligible overweight or obese children referred to the One Step Ahead program at the Boston Children’s Primary Care Center between 2003 and 2009. Results. Of the referred children, 338 (58% attended the program; 245 (42% did not participate and were instead followed by their primary care providers within the group practice. The mean BMI z-score of program participants decreased modestly over a 2-year period and was lower than that of nonparticipants. The group-level difference in the rate of change in BMI z-score between participants and nonparticipants was statistically significant for 0–6 months (P=0.001 and 19–24 months (P=0.008; it was marginally significant for 13–18 months (P=0.051 after referral. Younger participants (<5 years had better outcomes across all time periods examined. Conclusion. Children attending a multidisciplinary program experienced greater BMI z-score reductions compared with usual primary care in a real world practice; younger participants had significantly better outcomes. Future research should consider early intervention and cost-effectiveness analyses.

The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

Science.gov (United States)

Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

2016-01-01

The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

Do substantial BMI reduction episodes among Swedish schoolchildren have any impact on their final height?

Science.gov (United States)

Nilsen, Bente B; Yngve, Agneta; Werner, Bo

2018-02-06

This study investigated whether substantial body mass index (BMI) reductions in Swedish schoolchildren aged seven years to 19 years, caused by disease, healthy or unhealthy behaviour, had any impact on their final height. We used height and weight data on 6572 subjects from two nationally representative longitudinal samples of Swedish children born in 1973 and 1981. These provided information on their final height and any BMI reduction episodes. Of the 6572 subjects (50.9% boys), among individuals with information on final height, 1118 had a BMI reduction of 5% and BMI reduction of 10% or more. On a group level, there was no statistically significant difference in the final height of individuals with BMI reductions of 10% or more and those without. The findings were independent of age and the subject's BMI at the start of the reduction episode. However, there were a number of cases where a substantial BMI reduction probably had an impact on the subject's final height. Our study found no evidence that a substantial BMI reduction had any impact on final height on a group level, but further analyses of specific case studies are necessary to determine whether substantial BMI reduction might have an impact on final height. ©2018 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.

Science.gov (United States)

Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori

2017-04-01

We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Body mass index (BMI) in the Saudi population of Gassim.

Science.gov (United States)

Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H

1998-01-01

In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.

Food marketing towards children: brand logo recognition, food-related behavior and BMI among 3-13-year-olds in a south Indian town.

Directory of Open Access Journals (Sweden)

Peter Ueda

Full Text Available OBJECTIVES: To assess exposure to marketing of unhealthy food products and its relation to food related behavior and BMI in children aged 3-13, from different socioeconomic backgrounds in a south Indian town. METHODS: Child-parent pairs (n=306 were recruited at pediatric clinics. Exposure to food marketing was assessed by a digital logo recognition test. Children matched 18 logos of unhealthy food (high in fat/sugar/salt featured in promotion material from the food industry to pictures of corresponding products. Children's nutritional knowledge, food preferences, purchase requests, eating behavior and socioeconomic characteristics were assessed by a digital game and parental questionnaires. Anthropometric measurements were recorded. RESULTS: Recognition rates for the brand logos ranged from 30% to 80%. Logo recognition ability increased with age (p<0.001 and socioeconomic level (p<0.001 comparing children in the highest and lowest of three socioeconomic groups. Adjusted for gender, age and socioeconomic group, logo recognition was associated with higher BMI (p=0.022 and nutritional knowledge (p<0.001 but not to unhealthy food preferences or purchase requests. CONCLUSIONS: Children from higher socioeconomic groups in the region had higher brand logo recognition ability and are possibly exposed to more food marketing. The study did not lend support to a link between exposure to marketing and poor eating behavior, distorted nutritional knowledge or increased purchase requests. The correlation between logo recognition and BMI warrants further investigation on food marketing towards children and its potential role in the increasing burden of non-communicable diseases in this part of India.

HLA AND CROSS·REACTIVE ANTIGEN GROUP MATCHING FOR CADAVER KIDNEY ALLOCATION1

Science.gov (United States)

Starzl, Thomas E.; Eliasziw, Michael; Gjertson, David; Terasaki, Paul I.; Fung, John J.; Trucco, Massimo; Martell, Joan; McMichael, John; Scantlebury, Velma; Shapiro, Ron; Donner, Allan

2010-01-01

Background Allocation of cadaver kidneys by graded human leukocyte antigen (HLA) compatibility scoring arguably has had little effect on overall survival while prejudicing the transplant candidacy of African-American and other hard to match populations. Consequently, matching has been proposed of deduced amino acid residues of the individual HLA molecules shared by cross-reactive antigen groups (CREGs). We have examined the circumstances under which compatibility with either method impacted graft survival. Methods Using Cox proportional hazards regression modeling, we studied the relationship between levels of conventional HLA mismatch and other donor and recipient factors on primary cadaver kidney survival between 1981 and 1995 at the University of Pittsburgh (n=1,780) and in the United Network for Organ Sharing (UNOS) Scientific Registry during 1991–1995 (n=31,291). The results were compared with those obtained by the matching of amino acid residues that identified CREG-compatible cases with as many as four (but not five and six) HLA mismatches. Results With more than one HLA mismatch (>85% of patients in both series), most of the survival advantage of a zero mismatch was lost. None of the HLA loci were “weak.” In the UNOS (but not Pittsburgh) category of one-HLA mismatch (n=1334), a subgroup of CREG-matched recipients (35.3%) had better graft survival than the remaining 64.7%, who were CREG-mismatched. There was no advantage of a CREG match in the two- to four-HLA incompatibility tiers. Better graft survival with tacrolimus was observed in both the Pittsburgh and UNOS series. Conclusions Obligatory national sharing of cadaver kidneys is justifiable only for zero-HLA-mismatched kidneys. The potential value of CREG matching observed in the one-HLA-mismatched recipients of the UNOS (but not the Pittsburgh) experience deserves further study. PMID:9381546

Association between Dental Caries and BMI in Children: A Systematic Review and Meta-Analysis.

Science.gov (United States)

Chen, Dongru; Zhi, Qinghui; Zhou, Yan; Tao, Ye; Wu, Liping; Lin, Huancai

2018-01-01

Research on the association between dental caries and body mass index (BMI) in children has shown contradictory results; thus we aimed to examine the association between dental caries and the full range of BMI classes among children. We comprehensively searched PubMed, Embase, and the Cochrane Library for studies published prior to March 2017. Articles comparing dental caries among the full range of BMI classes for children below 18 years of both genders were included. Fourteen studies were eligible for this study. Basic information - i.e., first author, published year, study design, country, sample size, age, type of dental caries index and BMI, main results and conclusions, and means and standard deviations of the dental caries indexes used - was pooled. The weighted mean differences and corresponding 95% confidence intervals for dental caries between children with abnormal weight and those with normal weight were analyzed. Generally, no significant differences in caries were found between any abnormal-weight group and the normal-weight group for both primary and permanent teeth. Sensitivity analyses showed that the obese group had more caries than the normal-weight group in their primary teeth. Significantly more caries was found among the overweight and obese children in both primary and permanent teeth in high-income countries, but not in low- and middle-income countries. We recommend that further studies use suitable sample sizes, unify the criteria for BMI categorization and the dental caries index, and investigate the confounding factors that might influence dental caries and BMI. © 2018 S. Karger AG, Basel.

Reduced cortical thickness associated with visceral fat and BMI

Directory of Open Access Journals (Sweden)

Ralf Veit

2014-01-01

Full Text Available Structural brain imaging studies have shown that obesity is associated with widespread reductions in gray matter (GM volume. Although the body mass index (BMI is an easily accessible anthropometric measure, substantial health problems are more related to specific body fat compartments, like visceral adipose tissue (VAT. We investigated cortical thickness measures in a group of 72 healthy subjects (BMI range 20–35 kg/m2, age range 19–50 years. Multiple regression analyses were performed using VAT and BMI as predictors and age, gender, total surface area and education as confounds. BMI and VAT were independently associated with reductions in cortical thickness in clusters comprising the left lateral occipital area, the left inferior temporal cortex, and the left precentral and inferior parietal area, while the right insula, the left fusiform gyrus and the right inferior temporal area showed a negative correlation with VAT only. In addition, we could show significant reductions in cortical thickness with increasing VAT adjusted for BMI in the left temporal cortex. We were able to detect widespread cortical thinning in a young to middle-aged population related to BMI and VAT; these findings show close resemblance to studies focusing on GM volume differences in diabetic patients. This may point to the influence of VAT related adverse effects, like low-grade inflammation, as a potentially harmful factor on brain integrity already in individuals at risk of developing diabetes, metabolic syndromes and arteriosclerosis.

Increased Coagulation and Decreased Fibrinolysis as Measured with Overall Hemostatic Potential Are Dependent on BMI and Not Associated with PCOS.

Science.gov (United States)

Rakusa, Matej; Jensterle, Mojca; Božič-Mijovski, Mojca; Janez, Andrej

2017-05-01

Overall hemostatic potential (OHP) captures all factors that affect coagulation and fibrinolysis cascade. It has not yet been assessed in polycystic ovary syndrome (PCOS). The aim of the study was to identify the relationship of OHP with a syndrome per se and body mass index (BMI). In 90 women with PCOS aged 30.9 ± 8.1 years (50 obese, 13 overweight, and 27 lean) and 21 healthy age-matched controls (11 obese and 10 lean), OHP with overall coagulation potential (OCP) and overall fibrinolytic potential (OFP) was determined spectrophotometrically. OFP was calculated. OHP increased with BMI in PCOS (9.6 ± 2.3 in lean, 12.5 ± 5.1 in overweight, and 15.5 ± 3.8 Abs-sum in obese) and in controls (9.1 ± 1.0 in lean and 17.3 ± 4.6 Abs-sum in obese). There was significant difference between lean and obese PCOS (P PCOS (P PCOS (P PCOS did not differ significantly, while OHP for healthy obese was increased in comparison to overweight and lean PCOS (P PCOS was not associated with increased OHP compared with BMI and age-matched controls. However, increase in OHP was positively associated with BMI in PCOS and healthy women.

Increased BMI in children-an indicator for less compliance during orthodontic treatment with removable appliances.

Science.gov (United States)

von Bremen, Julia; Lorenz, Nathalie; Ludwig, Björn; Ruf, Sabine

2018-02-19

To assess whether or not childhood overweight is associated with lower levels of compliance during orthodontic therapy with removable appliances. Starting in 2011, all upper expansion plates and Sander II appliances were equipped with a Theramon® microsensor chip to assess appliance wear time objectively. According to their pre-treatment, BMI normal weight patients were matched to consecutively treated overweight or obese patients by gender, age, and appliance type. Cooperation was assessed with microelectronic wear time documentation over a period of at least 6 months. A total of 50 patients (25 overweight, 25 normal weight) with upper expansion plates and 64 patients (32 overweight, 32 normal weight) with Sander II appliances were analysed. Spearman Rho coefficients showed an indirect association between BMI and appliance wear time, indicating that the higher the BMI, the less the patients wore their appliances (P appliances (P appliance wear during orthodontic treatment with removable appliances. Additional factors which influenced cooperation during treatment with removable appliances were patient age and appliance type.

Effect of weight, height and BMI on injury outcome in side impact crashes without airbag deployment.

Science.gov (United States)

Pal, Chinmoy; Tomosaburo, Okabe; Vimalathithan, K; Jeyabharath, M; Muthukumar, M; Satheesh, N; Narahari, S

2014-11-01

A comprehensive analysis is performed to evaluate the effect of weight, height and body mass index (BMI) of occupants on side impact injuries at different body regions. The accident dataset for this study is based on the National Automotive Sampling System-Crashworthiness Data System (NASS-CDS) for accident year 2000-08. The mean BMI values for driver and front passenger are estimated from all types of crashes using NASS database, which clearly indicates that mean BMI has been increasing over the years in the USA. To study the effect of BMI in side impact injuries, BMI was split into three groups namely (1) thin (BMI30). For more clear identification of the effect of BMI in side impact injuries, a minimum gap of three BMI is set in between each adjacent BMI groups. Car model years from MY1995-1999 to MY2000-2008 are chosen in order to identify the degree of influence of older and newer generation of cars in side impact injuries. Impact locations particularly side-front (F), side-center (P) and side-distributed (Y) are chosen for this analysis. Direction of force (DOF) considered for both near side and far side occupants are 8 o'clock, 9 o'clock, 10 o'clock and 2 o'clock, 3 o'clock and 4 o'clock respectively. Age <60 years is also one of the constraints imposed on data selection to minimize the effect of bone strength on the occurrence of occupant injuries. AIS2+ and AIS3+ injury risk in all body regions have been plotted for the selected three BMI groups of occupant, delta-V 0-60kmph, two sets (old and new) of car model years. The analysis is carried with three approaches: (a) injury risk percentage based on simple graphical method with respect to a single variable, (b) injury distribution method where the injuries are marked on the respective anatomical locations and (c) logistic regression, a statistical method, considers all the related variables together. Lower extremity injury risk appears to be high for thin BMI group. It is found that BMI does not have much

Association of Group Prenatal Care With Gestational Weight Gain.

Science.gov (United States)

Kominiarek, Michelle A; Crockett, Amy; Covington-Kolb, Sarah; Simon, Melissa; Grobman, William A

2017-04-01

To compare gestational weight gain among women in group prenatal care with that of women in individual prenatal care. In this retrospective cohort study, women who participated in group prenatal care from 2009 to 2015 and whose body mass indexes (BMIs) and gestational weight gain were recorded were matched with the next two women who had the same payer type, were within 2-kg/m prepregnancy BMI and 2-week gestational age at delivery, and had received individual prenatal care. Bivariate comparisons of demographics and antenatal complications were performed for women in group and individual prenatal care, and weight gain was categorized as "below," "met," or "exceeded" goals according to the 2009 Institute of Medicine guidelines. Logistic regression analysis estimated the association between excessive weight gain and model of care, with adjustment for confounders, stratified by BMI. Women in group prenatal care (n=2,117) were younger and more commonly non-Hispanic black, nulliparous, and without gestational diabetes (P≤.005 for all). Women in group prenatal care more commonly exceeded the weight gain goals (55% compared with 48%, Pprenatal care, compared with individual prenatal care, is associated with excessive gestational weight gain.

Analysis list: BMI1 [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie

Correction of self-reported BMI based on objective measurements: a Belgian experience.

Science.gov (United States)

Drieskens, S; Demarest, S; Bel, S; De Ridder, K; Tafforeau, J

2018-01-01

Based on successive Health Interview Surveys (HIS), it has been demonstrated that also in Belgium obesity, measured by means of a self-reported body mass index (BMI in kg/m 2 ), is a growing public health problem that needs to be monitored as accurately as possible. Studies have shown that a self-reported BMI can be biased. Consequently, if the aim is to rely on a self-reported BMI, adjustment is recommended. Data on measured and self-reported BMI, derived from the Belgian Food Consumption Survey (FCS) 2014 offers the opportunity to do so. The HIS and FCS are cross-sectional surveys based on representative population samples. This study focused on adults aged 18-64 years (sample HIS = 6545 and FCS = 1213). Measured and self-reported BMI collected in FCS were used to assess possible misreporting. Using FCS data, correction factors (measured BMI/self-reported BMI) were calculated in function of a combination of background variables (region, gender, educational level and age group). Individual self-reported BMI of the HIS 2013 were then multiplied with the corresponding correction factors to produce a corrected BMI-classification. When compared with the measured BMI, the self-reported BMI in the FCS was underestimated (mean 0.97 kg/m 2 ). 28% of the obese people underestimated their BMI. After applying the correction factors, the prevalence of obesity based on HIS data significantly increased (from 13% based on the original HIS data to 17% based on the corrected HIS data) and approximated the measured one derived from the FCS data. Since self-reported calculations of BMI are underestimated, it is recommended to adjust them to obtain accurate estimates which are important for decision making.

Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.

Directory of Open Access Journals (Sweden)

Shunsuke Nakamura

Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.

Does BMI influence hospital stay and morbidity after fast-track hip and knee arthroplasty?

DEFF Research Database (Denmark)

Husted, Henrik; Jørgensen, Christoffer C; Gromov, Kirill

2016-01-01

Background and purpose - Body mass index (BMI) outside the normal range possibly affects the perioperative morbidity and mortality following total hip arthroplasty (THA) and total knee arthroplasty (TKA) in traditional care programs. We determined perioperative morbidity and mortality in such pat......Background and purpose - Body mass index (BMI) outside the normal range possibly affects the perioperative morbidity and mortality following total hip arthroplasty (THA) and total knee arthroplasty (TKA) in traditional care programs. We determined perioperative morbidity and mortality...... in such patients who were operated with the fast-track methodology and compared the levels with those in patients with normal BMI. Patients and methods - This was a prospective observational study involving 13,730 procedures (7,194 THA and 6,536 TKA operations) performed in a standardized fast-track setting....... Complete 90-day follow-up was achieved using national registries and review of medical records. Patients were grouped according to BMI as being underweight, of normal weight, overweight, obese, very obese, and morbidly obese. Results - Median length of stay (LOS) was 2 (IQR: 2-3) days in all BMI groups. 30...

Effects of social mobility from childhood to adolescence on BMI.

Science.gov (United States)

Muraro, Ana Paula; Gonçalves-Silva, Regina Maria Veras; Ferreira, Márcia Gonçalves; Sichieri, Rosely

2016-04-01

Little is known about the contribution of childhood socio-economic position (SEP) and social mobility to weight change. The present study evaluated the effect of family SEP during the pre-school years and social mobility on BMI between birth and adolescence. Longitudinal. The SEP of each child's family was classified according to an asset-based wealth index as low, medium or high. Four different categories of childhood-adolescence SEP groups were created in order to examine social mobility: low-medium/high, medium-medium, medium-high and high-high/medium. For each of these categories, BMI was tracked from birth to adolescence. Linear mixed-effects models were used to analyse the data. Cuiabá-MT, Brazil. A population-based cohort of children born between 1994 and 1999 was assessed between 1999 and 2000, and again between 2009 and 2011. A total of 1716 adolescents were followed from childhood to adolescence (71·4 % of baseline). The prevalence of overweight/obesity was 20·4 % in childhood and 27·7 % in adolescence. A higher SEP in childhood was associated with a greater prevalence of overweight in adolescence. Expressive upward social mobility occurred, mainly in the lowest SEP group. There was a greater rate of change in BMI between birth and adolescence among children with a higher SEP in childhood and children who remained in the higher SEP from childhood to adolescence. Individuals from a higher SEP in childhood and those who remained in the higher social classes showed greater rate of change in BMI. Thus, initial SEP was the major determinant of changes in BMI.

Gestational Weight Gain and Breastfeeding Outcomes in Group Prenatal Care.

Science.gov (United States)

Brumley, Jessica; Cain, M Ashley; Stern, Marilyn; Louis, Judette M

2016-09-01

This study sought to examine the differences in pregnancy outcomes with a focus on gestational weight gain for women attending group prenatal care compared to standard individual prenatal care. A matched case-control study was conducted including 65 women who chose group care and 130 women who chose standard individual care. Women were matched based on prepregnancy body mass index (BMI) category, eligibility for midwifery care, and age within 5 years. Women choosing group prenatal care and women choosing standard individual care had similar gestational weight gain, birth weight, gestational age at birth, and mode of birth. Women choosing group prenatal care did have a significantly higher rate of exclusive breastfeeding at 6 weeks postpartum (odds ratio [OR], 4.07; 95% confidence interval [CI], 1.81-9.15; P care. Group prenatal care participation resulted in equivalent gestational weight gain as well as pregnancy outcomes as compared to standard individual care. Breastfeeding rates were improved for women choosing group prenatal care. Randomized controlled trials are needed in order to eliminate selection bias. © 2016 by the American College of Nurse-Midwives.

Predictors of BMI Vary along the BMI Range of German Adults – Results of the German National Nutrition Survey II

Science.gov (United States)

Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid

2017-01-01

Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069

Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

Science.gov (United States)

Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

2007-07-01

Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

More heads choose better than one: Group decision making can eliminate probability matching.

Science.gov (United States)

Schulze, Christin; Newell, Ben R

2016-06-01

Probability matching is a robust and common failure to adhere to normative predictions in sequential decision making. We show that this choice anomaly is nearly eradicated by gathering individual decision makers into small groups and asking the groups to decide. The group choice advantage emerged both when participants generated responses for an entire sequence of choices without outcome feedback (Exp. 1a) and when participants made trial-by-trial predictions with outcome feedback after each decision (Exp. 1b). We show that the dramatic improvement observed in group settings stands in stark contrast to a complete lack of effective solitary deliberation. These findings suggest a crucial role of group discussion in alleviating the impact of hasty intuitive responses in tasks better suited to careful deliberation.

Cost of fertility treatment and live birth outcome in women of different ages and BMI.

Science.gov (United States)

Pandey, Shilpi; McLernon, David J; Scotland, Graham; Mollison, Jill; Wordsworth, Sarah; Bhattacharya, Siladitya

2014-10-10

What is the impact of different age and BMI groups on total investigation and treatment costs in women attending a secondary/tertiary care fertility clinic? Women in their early to mid-30s and women with normal BMI had higher cumulative investigation and treatment costs, but also higher probability of live birth. Female age and BMI have been used as criteria for rationing publically funded fertility treatments. Population-based data on the costs of investigating and treating infertility are lacking. A retrospective cohort study of 2463 women was conducted in a single secondary/tertiary care fertility clinic in Aberdeen, Scotland from 1998 to 2008. Participants included all women living in a defined geographical area referred from primary care to a specialized fertility clinic over an 11-year period. Women were followed up for 5 years or until live birth if this occurred sooner. Mean discounted cumulative National Health Service costs (expressed in 2010/2011 GBP) of fertility investigations, treatments (including all types of assisted reproduction), and pregnancy (including delivery episode) and neonatal admissions were calculated and summarized by age (≤ 30, 31-35, 36-40, >40 years) and BMI groupings (years, with 694 (55.1%) of these being natural conceptions. The live birth rate was highest among women in the youngest age group (64.3%), and lowest in those aged >40 years (13.4%). Overall live birth rates were generally lower in women with BMI >30 kg/m(2). The total costs of investigations were generally highest among women younger than 30 years (£491 in those with normal BMI), whilst treatment costs tended to be higher in 31-35 year olds (£1,840 in those with normal BMI). Multivariate modelling predicted a cost increase associated with treatment which was highest among women in the lowest BMI group (across all ages), and also highest among women aged 31-35 years. The increase in the predicted probability of live birth with exposure to treatment was consistent

Comparison of body mass index (BMI) with the CUN-BAE body adiposity estimator in the prediction of hypertension and type 2 diabetes

OpenAIRE

Martín, Vicente; Dávila Batista, Verónica; Castilla, Jesús; Godoy i García, Pere; Delgado Rodríguez, Miguel; Soldevila, Núria; Molina, Antonio J.; Fernandez Villa, Tania; Astray, Jenaro; Castro, Andy; Gonzalez-Candelas, Fernando; Mayoral, José María; Quintana, José María; Domínguez García, Àngela; Trilla García, Antoni

2016-01-01

Background Obesity is a world-wide epidemic whose prevalence is underestimated by BMI measurements, but CUN-BAE (Clínica Universidad de Navarra - Body Adiposity Estimator) estimates the percentage of body fat (BF) while incorporating information on sex and age, thus giving a better match. Our aim is to compare the BMI and CUN-BAE in determining the population attributable fraction (AFp) for obesity as a cause of chronic diseases. Methods We calculated the Pearson correlation coefficient betwe...

Concordance between self-reported pre-pregnancy body mass index (BMI) and BMI measured at the first prenatal study contact.

Science.gov (United States)

Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A

2016-07-26

The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).

Weight and body mass index (BMI): current data for Austrian boys and girls aged 4 to under 19 years.

Science.gov (United States)

Mayer, Michael; Gleiss, Andreas; Häusler, Gabriele; Borkenstein, Martin; Kapelari, Klaus; Köstl, Gerhard; Lassi, Michael; Schemper, Michael; Schmitt, Klaus; Blümel, Peter

2015-01-01

BMI reference charts are widely used to diagnose overweight, obesity and underweight in children and adolescents. To provide up-to-date national reference values for Austria. A cross-sectional sample of over 14 500 children and adolescents (4-19 years) stratified by provinces according to age- and sex-specific population proportions was drawn via schooling institutions (kindergartens, schools and vocational colleges). The generalized additive models for location, scale and shape were used for a flexible estimation of percentile curves. Austrian boys and girls have higher average weight compared with previous prevalence data. BMI centiles matching BMI values at age 18 years, which are used for defining thinness, overweight and obesity in adults, were calculated. In Austria, using reference values as thresholds, ∼18% of boys and 12% of girls are overweight (with thresholds passing through BMI 25.00-29.99 kg/m(2) in adults) and 5% of boys and 3% of girls are obese (with thresholds passing through BMI ≥30.00 kg/m(2) in adults). Overweight and obesity are common in Austria and their prevalence is increasing (using the same IOTF reference for international comparison). Up-to-date national BMI reference values are provided to classify children and adolescents according to the proposed overweight and obesity thresholds.

Effect of inhaled corticosteroid use on weight (BMI) in pediatric patients with moderate-severe asthma.

Science.gov (United States)

Han, Jennifer; Nguyen, John; Kim, Yuna; Geng, Bob; Romanowski, Gale; Alejandro, Lawrence; Proudfoot, James; Xu, Ronghui; Leibel, Sydney

2018-04-19

Assess the relationship between inhaled corticosteroid use (ICS) and weight (BMI) in pediatric patients with moderate-severe asthma. Assess if the number of emergency department (ED) visits correlates with overall BMI trajectory. Assess the trend of prescribing biologic therapy in pediatric patients with moderate-severe asthma and determine its relationship with weight (BMI). A retrospective chart review was performed on 93 pediatric patients with moderate-severe asthma to determine the relationship between ICS use and weight (BMI), biologic therapy and BMI, and number of ED visits and BMI trajectory. A mixed effects model was employed with the correlation between repeated measures accounted for through the random effects. There is a statistically significant increase of 0.369 kg/m 2 in BMI trajectory per year in subjects on high-dose steroids compared to an increase of 0.195 kg/m 2 in the low dose group (p BMI of subjects initiated on biologic therapy (omalizumab or mepolizumab) had a statistically significant decrease in BMI trajectory of 0.818 kg/m 2 per year (p BMI trajectory (p BMI trajectory; the higher the dose, the greater the projected BMI increase per year. Initiation of biologic therapy decreased BMI trajectory over time. Lastly, those with frequent ED visits had a higher BMI trend. Future prospective studies are warranted that further evaluate the potential metabolic impacts of ICS and assess the effects of biologic therapy on BMI.

Postnatal BMI changes in children with different birthweights: A trial study for detecting early predictive factors for pediatric obesity

Science.gov (United States)

Nakagawa, Yuichi; Nakanishi, Toshiki; Satake, Eiichiro; Matsushita, Rie; Saegusa, Hirokazu; Kubota, Akira; Natsume, Hiromune; Shibata, Yukinobu; Fujisawa, Yasuko

2018-01-01

Abstract. The purpose of this study was to clarify the degree of early postnatal growth by birthweight and detect early predictive factors for pediatric obesity. Body mass index (BMI) and degree of obesity were examined in children in the fourth year of elementary school and second year of junior high school. Their BMI at birth and three years of age were also examined. Based on birthweight, participants were divided into three groups: low ( 3500 g). Furthermore, according to the degree of obesity, they were divided into two groups: obese (20% ≤) and non-obese (20% >). The change of BMI from birth to three years of age (ΔBMI) showed a strong inverse relationship with birthweight and was significantly different among the three birthweight groups (low > middle > high). The ΔBMI and BMI at three years of age were higher in obese than in non-obese children and showed significant positive correlations with the degree of obesity. Early postnatal growth might be determined by birthweight and was higher in obese than in non-obese children. The ΔBMI from birth to three years of age and BMI at age of three years could be predictive factors for pediatric obesity. PMID:29403153

Long-term BMI and growth profiles in offspring of women with gestational diabetes.

Science.gov (United States)

Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W

2018-05-01

Gestational diabetes mellitus (GDM) is reported to be associated with childhood obesity, however the magnitude of this association and relation to intrauterine growth is uncertain. We, therefore, aimed to assess whether the growth trajectories of large for gestational age (LGA) and non-LGA offspring of mothers with GDM (OGDM) are different until early adolescence. We also aimed to explore whether growth trajectories of OGDM differ from those of offspring of mothers with type 1 or 2 diabetes (ODM1, ODM2). We studied height and BMI standard deviation score (SDS) of the OGDM group, up to the age of 14 years, with subgroup analysis comparing LGA with non-LGA at birth as a reflection of the intrauterine environment. All mothers with GDM who delivered at the University Medical Center Utrecht between 1990 and 2006 were contacted to participate; informed consent was received for 104 OGDM of 93 mothers. Offspring data were collected through Dutch infant welfare centres. Recorded height and weight were converted to BMI and age- and sex-specific SDS values for Dutch children. Additionally, we compared the OGDM group with ODM1 and ODM2 groups in order to identify those offspring with the highest risk of becoming overweight. Growth trajectories were compared between non-LGA and LGA OGDM and between OGDM, ODM1 and ODM2, using a random-effects model. In the longitudinal follow-up a mean of 7.4 ± 2 measurements per infant were available. Mothers had a prepregnancy BMI of 25.8 kg/m 2 and 24% of their infants were LGA at birth. Heights of OGDM were no different from those of the Dutch Growth Study. Non-LGA OGDM showed a BMI SDS comparable with that of the reference population, with a slight increase in early adolescence. LGA OGDM had a higher BMI SDS trajectory than non-LGA OGDM and the reference population, which plateaued at around 10 years of age. Comparison of growth trajectories of OGDM, ODM1 and ODM2 showed ODM2 to have the highest trajectory followed by ODM1 and OGDM

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Science.gov (United States)

Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

2015-01-01

BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Nutritional status in edentulous people as compared to age matched dentate individuals-a cross-sectional study

Directory of Open Access Journals (Sweden)

Sukhabogi Jagadeeswara Rao

2013-01-01

Full Text Available Objectives: To assess the nutritional status in completely edentulous subjects and to compare with age matched dentate individuals. Materials and Method: The study was carried out in 60 individuals divided into two groups. Group one consisted of 30 edentulous subjects and 30 dentate individuals formed the second group Body Mass Index (BMI, serum albumin and hemoglobin values were analyzed in both the groups. Independent sample t- test was employed to check for the difference between the groups and Pearson′s correlation was done to ascertain the association between the variables within the groups. Results: There was a significant difference in all the biomarkers evaluated in between the groups. The values were negatively correlated with the period of edentulism within the groups. Conclusion: Edentulous people had lower nutritional values than their dentate counterparts and maintaining a healthy and normal dentition may have significant bearing on the overall health of an individual. body mass index, serum albumin, malnutrition, edentulous, dental status

Dose monitoring using the DICOM structured report: assessment of the relationship between cumulative radiation exposure and BMI in abdominal CT

International Nuclear Information System (INIS)

Boos, J.; Lanzman, R.S.; Meineke, A.; Heusch, P.; Sawicki, L.M.; Antoch, G.; Kröpil, P.

2015-01-01

Aim: To perform a systematic, large-scale analysis using the Digital Imaging and Communication in Medicine structured report (DICOM-SR) to assess the relationship between body mass index (BMI) and radiation exposure in abdominal CT. Materials and methods: A retrospective analysis of DICOM-SR of 3121 abdominal CT examinations between April 2013 and March 2014 was performed. All examinations were conducted using a 128 row CT system. Patients (mean age 61 ± 15 years) were divided into five groups according to their BMI: group A <20 kg/m 2 (underweight), group B 20–25 kg/m 2 (normal weight), group C 25–30 kg/m 2 (overweight), group D 30–35 kg/m 2 (obese), and group E > 35 kg/m 2 (extremely obese). CT dose index (CTDI vol ) and dose–length product (DLP) were compared between all groups and matched to national diagnostic reference values. Results: The mean CTDI vol and DLP were 5.4 ± 2.9 mGy and 243 ± 153 mGy·cm in group A, 6 ± 3.6 mGy and 264 ± 179 mGy• cm in group B, 7 ± 3.6 mGy and 320 ± 180 mGy• cm in group C, 8.1 ± 5.2 mGy and 375 ± 306 mGy• cm in group D, and 10 ± 8 mGy and 476 ± 403 mGy• cm in group E, respectively. Except for group A versus group B, CTDI vol and DLP differed significantly between all groups (p<0.05). Significantly more CTDI vol values exceeded national diagnostic reference values in groups D and E (2.1% and 6.3%) compared to group B (0.5%, p<0.05). Conclusion: DICOM-SR is a comprehensive, fast, and reproducible way to analyse dose-related data at CT. It allows for automated evaluation of radiation dose in a large study population. Dose exposition is related to the patient's BMI and is increased by up to 96% for extremely obese patients undergoing abdominal CT. - Highlights: • DICOM-SR was used to implement automatic CT-dose monitoring. • DICOM-SR allowed for a fast and comprehensive analysis of CT dose data. • Radiation exposure for abdominal CT was increased by up to 96% for

The impact of follicular fluid adiponectin and ghrelin levels based on BMI on IVF outcomes in PCOS.

Science.gov (United States)

Inal, H A; Yilmaz, N; Gorkem, U; Oruc, A S; Timur, H

2016-04-01

This study aimed at evaluating the effects of polycystic ovary syndrome (PCOS) and body mass index (BMI) on follicular fluid (FF) adiponectin and ghrelin levels, and on in vitro fertilization outcomes in patients who underwent controlled ovarian hyperstimulation. This prospective cross-sectional study was performed with a total of 120 primary infertile women [group 1; non-PCOS = 60 (BMI PCOS = 60 (BMI lean PCOS group than the lean non-PCOS group (p = 0.001), and these levels were lower in the overweight non-PCOS group compared to lean non-PCOS group (0.001). However, there was no difference in the FF ghrelin levels between the groups. Additionally, we could not find a relationship between clinical pregnancy and adiponectin and ghrelin levels. The FF adiponectin and ghrelin levels have no effects on clinical pregnancy in PCOS. Therefore, further studies are needed to elucidate this issue.

The optimal value of BMI for the lowest risk of osteoporosis in postmenopausal women aged 40-88 years.

Science.gov (United States)

Skrzek, A; Kozieł, S; Ignasiak, Z

2014-06-01

The aim of this paper is to establish the optimal values of the body mass index (BMI) which would indicate the most favourable preservation of the bone mineral density in postmenopausal women. The material consists of the data of 369 healthy women aged between 40 and 88 years (mean age 67.84, SD=6.70) inhabitants of Wrocław, which were followed up between 2001 and 2006. The absolute measure of bone mineral density (BMD) of the femoral neck was assessed using dual energy X-ray absorptiometry (DEXA), expressed in g/(100mm(2)) and was transformed to T-score values. According to the value of BMI, the women were divided into eight groups, the reference group with value between 18.0 and 21.9kg/m(2) and seven other groups beginning with the value 22.0 with a 2-point interval. Postmenopausal status was defined according to the occurrence of menstruation within the last 360 days. The women with osteopenia and osteoporosis were pooled together and comprised the risk group, whereas the other women comprised the normal group (T-score values above -1.0). The adjusted odds ratio showed the highest value for intervals between 24.0 and 25.9 units of BMI, and the lowest value for interval 26.0-27.9 units of BMI. The Youden index showed the lowest value in the 26.0-27.9BMI kg/m(2) interval. For our sample the optimal value of BMI, with the lowest risk of osteopenia and/or osteoporosis was the value of 26.9kg/m(2). A further increase of BMI does not result in a favourable effect on the bones, it rather intensifies negative phenomena in the body resulting in the onset of many diseases. Copyright © 2014. Published by Elsevier GmbH.

The impact of sex and BMI on the clinical course of COPD and bronchial asthma

Directory of Open Access Journals (Sweden)

Krzysztof Wytrychowski

2016-09-01

Full Text Available Background. Bronchial asthma is a heterogeneous disease, and is one phenotype of asthma with obesity. Chronic obstructive pulmonary disease is the fourth most frequent cause of death in the world. Objectives. The aim of the study was to assess the influence of BMI and sex on the clinical course of uncontrolled asthma and COPD with moderate to severe airflow limitation. Material and methods . The study was performed on 2 groups. Group A: 72 adults suffering from asthma (38 F – females, 34 M – males with at least 1 exacerbation requiring treatment with systemic corticosteroids in the year before the study. Group B: 79 patients (34 F, 45 M with COPD Grades 2 and 3 according to GOLD. Data including age, gender, BMI, disease duration, treatment, concomitant diseases, pack-years, and number of exacerbations in the last year were collected. Asthma Control Questionnaire scores in group A and COPD Assessment Test scores in group B were collected. Pulmonary function tests were performed in both groups. Results . There were no differences between females and males in the analyzed variables in both groups. Obese patients (BMI > 30.0 kg/m2 were selected for analysis from group A (18 F, 10 M and from group B (13 F, 16 M. In group A, the number of exacerbations was significantly lower in males (M 1.3 vs. F 1.9; p = 0.01. In group B the age of obese patients was higher than in patients with BMI ≤ 30.0 (68.3 vs. 62.5; p = 0.002. Conclusion . Poorer control of asthma in obese patients was associated with the female gender. Age is a risk factor for obesity development in patients with COPD.

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Directory of Open Access Journals (Sweden)

Mehdi Hayat Shahi

Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Determination of the energy requirements in mechanically ventilated critically ill elderly patients in different BMI groups using the Harris–Benedict equation

Directory of Open Access Journals (Sweden)

Pi-Hui Hsu

2018-04-01

Full Text Available Background: Due to studies on calorie requirement in mechanically ventilated critically ill elderly patients are few, and indirect calorimetry (IC is not available in every intensive care unit (ICU. The aim of this study was to compare IC and Harris–Benedict (HB predictive equation in different BMI groups. Methods: A total of 177 mechanically ventilated critically ill elderly patients (≧65 years old underwent IC for measured resting energy expenditure (MREE. Estimated calorie requirement was calculated by the HB equation, using actual body weight (ABW and ideal body weight (IBW separately. Patients were divided into four BMI groups. One-way ANOVA and Pearson's correlation coefficient were used for statistical analyses. Results: The mean MREE was 1443.6 ± 318.2 kcal/day, HB(ABW was 1110.9 ± 177.0 kcal/day and HB(IBW was 1101.5 ± 113.1 kcal/day. The stress factor (SFA = MREE ÷ HB(ABW was 1.43 ± 0.26 for the underweight, 1.30 ± 0.27 for the normal weight, 1.20 ± 0.19 for the overweight, and 1.20 ± 0.31 for the obese. The SFI (SFI = MREE ÷ HB(IBW was 1.24 ± 0.24 for the underweight, 1.31 ± 0.26 for the normal weight, 1.36 ± 0.21 for the overweight, and 1.52 ± 0.39 for the obese. MREE had significant correlation both with REE(ABW = HB(ABW × SFA (r = 0.46; P < 0.0001 and REE(IBW = HB(IBW × SFI (r = 0.43; P < 0.0001. Conclusion: IC is the best accurate method for assessing calorie requirement of mechanically ventilated critically ill elderly patients. When IC is not available, using the predictive HB equation is an alternative choice. Calorie requirement can be predicted by HB(ABW × 1.20–1.43 for critically ill elderly patients according to different BMI groups, or using HB(IBW × 1.24–1.52 for patients with edema, ascites or no available body weight data. Keywords: Body Mass Index, Elderly critical care, Harris–Benedict equation, Indirect calorimetry

The impact of age and sex adjusted body mass index (ISO-BMI) in obese versus non-obese children and adolescents with cholecystectomy.

Science.gov (United States)

Kiuru, Eveliina; Kokki, Hannu; Juvonen, Petri; Lintula, Hannu; Paajanen, Hannu; Gissler, Mika; Eskelinen, Matti

2014-01-01

The impact of the age and sex adjusted body mass index (ISO-BMI) in the obese vs. non-obese children and adolescents with cholecystectomy for cholelithias is rarely reported. The national database was searched for cholecystectomies performed in paediatric patients between 1997 and 2011, and the 59 paediatric and adolescent patients having cholecystectomy in the Kuopio University Hospital district were divided in two groups by age and sex adjusted BMI (ISO-BMI) using the cut-off point of overweight (ISO-BMI 25 kg/m(2)) based on the Finnish growth standards. Nationwide a total of 840 cholecystectomies were performed during the 15 years study period in Finland, most of which included females (77%), resulting in a mean of annual frequency of 4.8 (range: 3.9-6.1) procedures/100,000 population. In the study sample, most of the patients with the cholelithiasis were female (50/59, 85%). The gender distribution was equal among the younger patients, but among adolescents 6/52 (12%) of the patients with cholelithiasis were boys and 46/52 (88%) of the patients with cholelithiasis were girls. Obesity did not affect on operative parameters. The median operative time was 70 min (range, 30-155) and 66 min (44-130) in the high ISO-BMI-group. The recovery was similar in the two groups: the median length of hospital stay was 4 days in both groups. The patients in the low ISO-BMI-group vs. high ISO-BMI-group had a trend of higher serum bilirubin (p=0.16) and serum AFOS values (p=0.19). In the histological examination of the gallbladders 19/28 (68%) patients in the low ISO-BMI-group had inflammation vs. 26/31 (84%) patients in the high ISO-BMI-group (p=0.15). Our results between obese and non-obese children and adolescents with cholelithiasis are not statistically significant. The obese adolescents with female gender are in greater risk for cholelithiasis. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

The Report Card on BMI Report Cards.

Science.gov (United States)

Thompson, Hannah R; Madsen, Kristine A

2017-06-01

Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.

Laparoscopic Sleeve Gastrectomy for Morbid Obesity in Patients After Orthotopic Liver Transplant: a Matched Case-Control Study.

Science.gov (United States)

Tsamalaidze, Levan; Stauffer, John A; Arasi, Lisa C; Villacreses, Diego E; Franco, Jose Salvador Serrano; Bowers, Steven; Elli, Enrique F

2018-02-01

Obesity is frequently encountered in patients with orthotopic liver transplant (OLT). The role of bariatric surgery is still unclear for this specific population. The aim of this study was to review our experience with laparoscopic sleeve gastrectomy (LSG) after OLT. We performed a retrospective case-control study of patients undergoing LSG after OLT from 2010 to 2016. OLT-LSG patients were matched by age, sex, body mass index (BMI), and year to non-OLT patients undergoing LSG. Demographics, operative variables, postoperative events, and long-term weight loss with comorbidity resolution were collected and compared between cases and controls. Of 303 patients undergoing LSG, 12 (4%) had previous OLT. They were matched to 36 non-OLT patients. No difference was found between groups in the American Society of Anesthesiologists class, mean operative time, or postoperative morbidity. The non-OLT group, however, had a significantly shorter mean hospital stay than the OLT group (1.7 vs 3.1 days; P OLT patients had significantly more excess body weight loss at 2 years (53.7 vs 45.2%; P OLT in appropriately selected patients appears to have similar outcomes to LSG in non-OLT patients.

Know Your Body Mass Index (BMI)

Science.gov (United States)

... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...

Changes in blood pressure, bmi and ecg patterns in women using low-dose contraceptives

International Nuclear Information System (INIS)

Syed, S.; Rahim, M.; Javed, M.; Qureshi, M.A.

2008-01-01

To determine the cardiovascular risk factors in users of second generation contraceptives by recording changes in body mass index, blood pressure and electrocardiogram. Sixty four women volunteered for this study (age range 20-35 years), belonging to low-income group with similar socio-cultural background. The Body Mass Index (BMI) was calculated by measuring height and weight of the subjects, systolic and diastolic blood pressure and ECG recording by standard method. The group means, standard deviations and coefficient correlation for interrelationship among variables in respective groups of subjects were calculated using relevant statistical method and software program. There was no significant difference between BMI of two types of contraceptive users as compared to non users, but BMI was significantly correlated with both systolic and diastolic blood pressures in injectable users as compared to controls. ECG alterations frequently observed in contraceptive users (40%) as compared to controls were normal findings. It was observed that women aged < 30 years and using contraceptives for more than three years had a tendency to gain weight and developed a mild increase in systolic and diastolic blood pressures. (author)

Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan

Directory of Open Access Journals (Sweden)

Naho Morisaki

2017-09-01

Full Text Available Background: The Institute of Medicine (IOM guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM recommendations. Methods: We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005–2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0–18.4, 18.5–19.9, 20–22.9, 23–24.9, and 25–27.4 kg/m2, we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications using multivariate regression. Results: Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m2, and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m2. Conclusion: Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines.

Pre-pregnancy BMI-specific optimal gestational weight gain for women in Japan.

Science.gov (United States)

Morisaki, Naho; Nagata, Chie; Jwa, Seung Chik; Sago, Haruhiko; Saito, Shigeru; Oken, Emily; Fujiwara, Takeo

2017-10-01

The Institute of Medicine (IOM) guidelines are the most widely used guidelines on gestational weight gain; however, accumulation of evidence that body composition in Asians differs from other races has brought concern regarding whether their direct application is appropriate. We aimed to study to what extent optimal gestational weight gain among women in Japan differs by pre-pregnancy body mass index (BMI) and to compare estimated optimal gestational weight gain to current Japanese and Institute of Medicine (IOM) recommendations. We retrospectively studied 104,070 singleton pregnancies among nulliparous women in 2005-2011 using the Japanese national perinatal network database. In five pre-pregnancy BMI sub-groups (17.0-18.4, 18.5-19.9, 20-22.9, 23-24.9, and 25-27.4 kg/m 2 ), we estimated the association of the rate of gestational weight gain with pregnancy outcomes (fetal growth, preterm delivery, and delivery complications) using multivariate regression. Weight gain rate associated with the lowest risk of adverse outcomes decreased with increasing BMI (12.2 kg, 10.9 kg, 9.9 kg, 7.7 kg, and 4.3 kg/40 weeks) for the five BMI categories as described above, respectively. Current Japanese guidelines were lower than optimal gains, with the lowest risk of adverse outcomes for women with BMI below 18.5 kg/m 2 , and current IOM recommendations were higher than optimal gains for women with BMI over 23 kg/m 2 . Optimal weight gain during pregnancy varies largely by pre-pregnancy BMI, and defining those with BMI over 23 kg/m 2 as overweight, as proposed by the World Health Organization, may be useful when applying current IOM recommendations to Japanese guidelines. Copyright © 2017 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

BMI, Overweight Status and Obesity Adjusted by Various Factors in All Age Groups in the Population of a City in Northeastern Brazil

Directory of Open Access Journals (Sweden)

Raquel Patrícia Ataíde Lima

2015-04-01

Full Text Available Objective: In Brazil, demographic, socioeconomic and epidemiological changes over time have led to a transition in nutritional standards, resulting in a gradual reduction of malnutrition and an increased prevalence of overweight and obese individuals, similar to the situation in developed countries in previous decades. This study assessed the body mass index (BMI and the prevalence of an overweight status and obesity, adjusted for various factors, in a population in northeastern Brazil including all age groups. Methods: This is a cross-sectional population-based epidemiological study using single sampling procedure composed of levels. Given the heterogeneity of the variable “income” and the relationship between income, prevalence of diseases and nutrition, a stratified sampling on blocks in the first level was used. In this, city districts were classified by income into 10 strata, according to information obtained from IBGE. A systematic sampling was applied on randomly selected blocks in order to choose the residences that would be part of the sample (second level, including 1165 participants from all age groups. Results and Discussion: The prevalence of an overweight status or obesity was adjusted for demographic, socioeconomic and lifestyle variables. When the Chi-square test was applied, a relationship was observed between the prevalence of an overweight status or obesity and the age group, gender, educational level and income of the participants. Regarding lifestyle parameters, only smoking was associated with the prevalence of an overweight status or obesity, in both adults and in the total sample. The results for the following groups were significant (p < 0.05: the age group from 20 to 59 years, when the individual presented an educational level greater than or equal to high school; and the age group ≥ 60 years, when the individual was female. It is noteworthy that educational level and being female were significant in adjusting for

Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

Science.gov (United States)

Lu, You-Wei; Li, Jin; Guo, Wei-Jian

2010-11-08

The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

Science.gov (United States)

2014-03-01

8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

Causal relationship between the AHSG gene and BMD through fetuin-A and BMI: multiple mediation analysis.

Science.gov (United States)

Sritara, C; Thakkinstian, A; Ongphiphadhanakul, B; Chailurkit, L; Chanprasertyothin, S; Ratanachaiwong, W; Vathesatogkit, P; Sritara, P

2014-05-01

Using mediation analysis, a causal relationship between the AHSG gene and bone mineral density (BMD) through fetuin-A and body mass index (BMI) mediators was suggested. Fetuin-A, a multifunctional protein of hepatic origin, is associated with bone mineral density. It is unclear if this association is causal. This study aimed at clarification of this issue. A cross-sectional study was conducted among 1,741 healthy workers from the Electricity Generating Authority of Thailand (EGAT) cohort. The alpha-2-Heremans-Schmid glycoprotein (AHSG) rs2248690 gene was genotyped. Three mediation models were constructed using seemingly unrelated regression analysis. First, the ln[fetuin-A] group was regressed on the AHSG gene. Second, the BMI group was regressed on the AHSG gene and the ln[fetuin-A] group. Finally, the BMD model was constructed by fitting BMD on two mediators (ln[fetuin-A] and BMI) and the independent AHSG variable. All three analyses were adjusted for confounders. The prevalence of the minor T allele for the AHSG locus was 15.2%. The AHSG locus was highly related to serum fetuin-A levels (P Multiple mediation analyses showed that AHSG was significantly associated with BMD through the ln[fetuin-A] and BMI pathway, with beta coefficients of 0.0060 (95% CI 0.0038, 0.0083) and 0.0030 (95% CI 0.0020, 0.0045) at the total hip and lumbar spine, respectively. About 27.3 and 26.0% of total genetic effects on hip and spine BMD, respectively, were explained by the mediation effects of fetuin-A and BMI. Our study suggested evidence of a causal relationship between the AHSG gene and BMD through fetuin-A and BMI mediators.

Effect of body weight and BMI on the efficacy of levonorgestrel emergency contraception.

Science.gov (United States)

Kapp, Nathalie; Abitbol, Jean Louis; Mathé, Henri; Scherrer, Bruno; Guillard, Hélène; Gainer, Erin; Ulmann, André

2015-02-01

To further evaluate the effect of weight and body mass index (BMI) on the efficacy of levonorgestrel emergency contraception. Data from two large, multicenter, randomized controlled trials designed to assess emergency contraceptive efficacy were pooled to evaluate the effect of weight and BMI on pregnancy rates among women who received levonorgestrel. Descriptive methods (comparison of means and distributions according to pregnancy status and pregnancy rates across weight and BMI categories) as well as cubic spline modeling were used to describe the relationship between pregnancy risk and weight/BMI. The analysis population comprised 1731 women, among whom 38 pregnancies were reported. Women for whom levonorgestrel was not effective in preventing pregnancy had a significantly higher mean body weight and BMI than women who did not become pregnant (76.7 vs. 66.4 kg, p85 kg groups, respectively. Statistical modeling demonstrated a steep increase in pregnancy risk starting from a weight near 70-75 kg to reach a risk of pregnancy of 6% or greater around 80 kg. Similar results were obtained for statistical modeling of BMI as well as when the two studies were analyzed individually. All analyses showed a significant drop in the efficacy of levonorgestrel emergency contraception with increasing body weight, with pregnancy risk in the higher weight categories similar to expected rates in the absence of contraception. Like body weight, increasing BMI was highly correlated with increased pregnancy risk. Copyright © 2015 Elsevier Inc. All rights reserved.

The Role of BMI1 in CRPC

Science.gov (United States)

2017-10-01

that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA

MATCHING IN INFORMAL FINANCIAL INSTITUTIONS.

Science.gov (United States)

Eeckhout, Jan; Munshi, Kaivan

2010-09-01

This paper analyzes an informal financial institution that brings heterogeneous agents together in groups. We analyze decentralized matching into these groups, and the equilibrium composition of participants that consequently arises. We find that participants sort remarkably well across the competing groups, and that they re-sort immediately following an unexpected exogenous regulatory change. These findings suggest that the competitive matching model might have applicability and bite in other settings where matching is an important equilibrium phenomenon. (JEL: O12, O17, G20, D40).

Quality of life in Arab Muslim cancer survivors following hematopoietic stem cell transplantation: comparison with matched healthy group.

Science.gov (United States)

Alaloul, Fawwaz; Brockopp, Dorothy Y; Andrykowski, Michael A; Hall, Lynne A; Al Nusairat, Taghreed S

2015-07-01

The aims of this study were to determine if quality of life (QOL) among Arab Muslim hematopoietic stem cell transplantation (HSCT) survivors differs from that of a healthy matched comparison group and to examine the relationships of demographic and medical variables and perceived social support with post-HSCT QOL. HSCT survivors (n = 63) were recruited from the King Hussein Cancer Center outpatient clinic. A matched (age, gender, education), healthy comparison group (n = 63) was recruited through public advertisements. Participants completed the EORTC-30 QOL scale and the Medical Outcomes Study Social Support Survey. Differences were found between the Arab Muslim HSCT survivor and healthy comparison groups for physical functioning (p Western HSCT survivors in the social and emotional QOL domains. Given growing numbers of Arab and Muslim cancer survivors in the USA and other Western countries, future research is warranted.

Smoking and Socio-demographic correlates of BMI

Directory of Open Access Journals (Sweden)

Peizhi Wang

2016-06-01

Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.

Association of Obesity, BMI, and Hispanic Ethnicity on Ambulatory Status in Children with Spinal Dysraphism followed near the California-Mexico Border.

Science.gov (United States)

McDonald, Michelle L; Huang, Andy; Proudfoot, James A; Le, Joan T; Chiang, George J; Bush, Ruth A

2016-01-01

Evaluate the relationship between body mass index (BMI), overweight status (OW), or obesity (OB) and ambulatory status in a predominantly Hispanic population of children with spinal dysraphism (SD). Retrospective data were extracted from records of 272 children and youth aged 0-24 years with a diagnosis of SD. Body mass index (BMI) and OW / OB rates were calculated for children 0-3 years, 4-11 years, and adolescents older than 11. Ethnicity was predominantly Hispanic (65.4%). No difference in mean BMI or OW / OB rate was found between ambulation groups (p = .20; p = .72). Mean BMI and OW / OB rate increased with increasing age in all groups (p < .001; p = .02). Forty-four percent of patients were OW / OB, which was greater among Hispanics (48.2%) compared with non-Hispanics [(35.2%), p = .03]. Female gender was a risk factor for increased BMI among Hispanics (p = .00). Despite no difference in ambulatory status, increasing BMI and OW / OB are associated with Hispanic ethnicity and increasing age.

Food and drinking patterns as predictors of 6-year BMI-adjusted changes in waist circumference

DEFF Research Database (Denmark)

Halkjær, Jytte; Sørensen, Thorkild I A; Tjønneland, Anne

2004-01-01

Few studies have investigated the prospective associations between diet or drinking patterns and abdominal obesity; we therefore investigated whether food and beverage groups or patterns predicted 6-year changes in waist circumference (WC) and whether these associations were independent...... of concurrent changes in BMI as a measure of general obesity. The subjects were 2300 middle-aged men and women with repeated measurements of dietary intake, BMI and WC from 1982 to 1993. Intakes from ten food groups and from coffee, tea, wine, beer and spirits were assessed; gender-specific food factors were......, but the associations were weakened, especially for women, after adjustment for BMI changes. None of the food factors was associated with WC changes. Based on the present study, we conclude that very few food items and no food patterns seem to predict changes in WC, whereas high intakes of beer and spirits among women...

The longitudinal BMI pattern and body composition of patients with anorexia nervosa who require urgent hospitalization: A case control study

Directory of Open Access Journals (Sweden)

Kawai Keisuke

2011-12-01

Full Text Available Abstract Background The prevention of serious physical complications in anorexia nervosa (AN patients is important. The purpose of this study is to clarify which physical and social factors are related to the necessity for urgent hospitalization of anorexia nervosa (AN patients in a long-term starvation state. We hypothesized that the change of longitudinal BMI, body composition and social background would be useful as an index of the necessity for urgent hospitalization. Methods AN patients were classified into; urgent hospitalization, due to disturbance of consciousness or difficulty walking(n = 17; planned admission (n = 96; and outpatient treatment only groups (n = 136. The longitudinal BMI pattern and the clinical features of these groups were examined. In the hospitalization groups, comparison was done of body composition variation and the social background, including the educational level and advice from family members. Results After adjusting for age and duration of illness, the BMI of the urgent hospitalization group was lower than that of the other groups at one year before hospitalization (P Conclusions The longitudinal pattern of BMI and FFM may be useful for understanding the severity in AN from the viewpoint of failure of the homeostasis system.

Differences in the association between childhood trauma and BMI in ...

African Journals Online (AJOL)

However,independent of BMI group, there were significant differences in socioeconomic status (SES) between black and white women (P<0.01). Total CTQ score, as well as the sub-scales, physical and emotional neglect, and physical and sexual abuse were higher in black than white women (all P<0.05), but these scores ...

Impact of Obesity on Surgical Treatment for Endometrial Cancer: A Multicenter Study Comparing Laparoscopy vs Open Surgery, with Propensity-Matched Analysis.

Science.gov (United States)

Uccella, Stefano; Bonzini, Matteo; Palomba, Stefano; Fanfani, Francesco; Ceccaroni, Marcello; Seracchioli, Renato; Vizza, Enrico; Ferrero, Annamaria; Roviglione, Giovanni; Casadio, Paolo; Corrado, Giacomo; Scambia, Giovanni; Ghezzi, Fabio

2016-01-01

To evaluate the impact of obesity on the outcomes of surgical treatment for endometrial cancer in general and also comparing laparoscopic and open abdominal approach. Retrospective case-control study (Canadian Task Force classification II-1). Obstetrics and Gynecology Department, University of Insubria, Varese, Catholic University of the Sacred Heart, Rome, International School of Surgical Anatomy, Sacred Heart Hospital, Negrar, and Sant'Orsola-Malpighi Hospital, Bologna, Italy. Data of consecutive patients who underwent surgery for endometrial cancer in 4 centers were reviewed. Univariate and multivariable analyses were performed. Adjustment for potential selection bias in surgical approach was made using propensity score (PS) matching. Laparoscopic or open surgical treatment for endometrial cancer. A total of 1266 patients were included, including 764 in the laparoscopy group and 502 in the open surgery group. A total of 391 patients (30.9%) were obese, including 238 (18.8%) with class I obesity, 89 (7%) with class II obesity, and 64 (5.1%) with class III obesity. The total number of complications, risk of wound complications, and venous thromboembolic events were higher in obese women compared with nonobese women. Blood transfusions, incidence/severity of postoperative complications, and postoperative hospital stay were significantly higher in the open surgery group compared with the laparoscopy group, irrespective of obesity. These differences remained significant in both multivariable analysis and PS-matched analysis. The percentage of patients who received lymphadenectomy declined significantly in patients with BMI ≥40 in both the laparoscopy and open surgery groups. Conversions from the initially intended minimally invasive approach to open surgery were 1.1% to 2.2% for women with BMI obese women in the laparoscopic group. Laparoscopy for endometrial cancer retains its advantages over open surgery, even in obese patients. However, operating on obese

Sickness Presenteeism Among Health Care Workers and the Effect of BMI, Cardiorespiratory Fitness, and Muscle Strength.

Science.gov (United States)

Christensen, Jeanette Reffstrup; Kongstad, Malte Bue; Sjøgaard, Gisela; Søgaard, Karen

2015-12-01

The primary objective of this study was to assess the relationship between sickness presenteeism and body mass index (BMI), cardiorespiratory fitness (CRF), and maximal voluntary contraction (MVC). Female health care workers (n = 139) were analyzed cross-sectional as well as longitudinal after 3 and 12-month follow-up. Sickness presenteeism was assessed as a summed score using validated questions from three questionnaires: Health and Work Performance Questionnaire, Work Ability Index, and Quantity and Quality Method. CRF was assessed by a maximal cycling test and MVC from four muscle groups. Significant relationships were found between sickness presenteeism and BMI as well as MVC both cross-sectional and as changes over 3 months. Participants with BMI more than 30  kg/m had significantly higher sickness presenteeism than those with BMI less than 25  kg/m. This study suggests that actions that decrease BMI and increase MVC decrease the amount of sickness presenteeism.

Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion

Directory of Open Access Journals (Sweden)

Lowell Evan Michael

2008-12-01

Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.

To Assess the Effect of Maternal BMI on Obstetrical Outcome

Science.gov (United States)

Lakhanpal, Shuchi; Aggarwal, Asha; Kaur, Gurcharan

2012-06-01

AIMS: To assess the effect of maternal BMI on complications in pregnancy, mode of delivery, complications of labour and delivery.METHODS:A crossectional study was carried out in the Obst and Gynae department, Kasturba Hospital, Delhi. The study enrolled 100 pregnant women. They were divided into 2 groups based on their BMI, more than or equal to 30.0 kg/m2 were categorized as obese and less than 30 kg/m2 as non obese respectively. Maternal complications in both types of patients were studied.RESULTS:CONCLUSION: As the obstetrical outcome is significantly altered due to obesity, we can improve maternal outcome by overcoming obesity. As obesity is a modifiable risk factor, preconception counseling creating awareness regarding health risk associated with obesity should be encouraged and obstetrical complications reduced.

BMI change during puberty and the risk of heart failure.

Science.gov (United States)

Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C

2018-03-12

Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.

Eating behaviour patterns and BMI in Portuguese higher education students.

Science.gov (United States)

Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora

2013-12-01

Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.

Can low BMI Chinese patients with type 2 diabetes benefit from laparoscopic Roux-en-Y gastric bypass surgery?

Science.gov (United States)

Wang, Guohui; Zhu, Liyong; Li, Weizheng; Yang, Xiangwu; Li, Pengzhou; Zhu, Shaihong

2016-12-01

The efficacy of laparoscopic Roux-en-Y gastric bypass (LRYGB) in type 2 diabetes mellitus (T2D) is closely associated with the preoperative body mass index (BMI) of the patient. There is a lack of long-term and large sampling evidence on the efficacy of LRYGB in T2D patients with low BMI in China. This retrospective study aimed to evaluate the efficacy of surgical treatment in a Chinese population with T2D (especially patients with BMIBMI≥27.5 kg/m 2 in group 1 (high BMI group) had significant improvements in waist circumference, blood glucose levels, homeostasis model assessment-insulin resistance index, and C-peptide levels after LRYGB (PBMIBMI group, including 19 T2D patients with BMIBMI<27.5 kg/m 2 in China. Copyright © 2016 American Society for Bariatric Surgery. Published by Elsevier Inc. All rights reserved.

Prospective associations between sedentary lifestyle and BMI in midlife

DEFF Research Database (Denmark)

Mortensen, Laust Hvas; Siegler, Ilene C; Barefoot, John C

2006-01-01

A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle.......A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle....

Food marketing towards children: brand logo recognition, food-related behavior and BMI among 3-13-year-olds in a south Indian town.

Science.gov (United States)

Ueda, Peter; Tong, Leilei; Viedma, Cristobal; Chandy, Sujith J; Marrone, Gaetano; Simon, Anna; Stålsby Lundborg, Cecilia

2012-01-01

To assess exposure to marketing of unhealthy food products and its relation to food related behavior and BMI in children aged 3-13, from different socioeconomic backgrounds in a south Indian town. Child-parent pairs (n=306) were recruited at pediatric clinics. Exposure to food marketing was assessed by a digital logo recognition test. Children matched 18 logos of unhealthy food (high in fat/sugar/salt) featured in promotion material from the food industry to pictures of corresponding products. Children's nutritional knowledge, food preferences, purchase requests, eating behavior and socioeconomic characteristics were assessed by a digital game and parental questionnaires. Anthropometric measurements were recorded. Recognition rates for the brand logos ranged from 30% to 80%. Logo recognition ability increased with age (pfood preferences or purchase requests. Children from higher socioeconomic groups in the region had higher brand logo recognition ability and are possibly exposed to more food marketing. The study did not lend support to a link between exposure to marketing and poor eating behavior, distorted nutritional knowledge or increased purchase requests. The correlation between logo recognition and BMI warrants further investigation on food marketing towards children and its potential role in the increasing burden of non-communicable diseases in this part of India.

Adrenocortical regulation, eating in the absence of hunger and BMI in young children.

Science.gov (United States)

Francis, L A; Granger, D A; Susman, E J

2013-05-01

The purpose of this study was to examine relations among adrenocortical regulation, eating in the absence of hunger, and body mass index (BMI) in children ages 5-9years (N=43). Saliva was collected before and after the Trier Social Stress Test for Children (TSST-C), and was later assayed for cortisol. Area under the curve with respect to increase (AUCi) was used as a measure of changes in cortisol release from baseline to 60min post-TSST-C. Age- and sex-specific BMI scores were calculated from measured height and weight, and eating in the absence of hunger was assessed using weighed food intake during a behavioral procedure. We also included a measure of parents' report of child impulsivity, as well as family demographic information. Participants were stratified by age into younger (5-7years) and older (8-9years) groups. In younger children, parents' reports of child impulsivity were significantly and positively associated with BMI; cortisol AUCi was not associated with BMI or eating in the absence of hunger. In older children, however, greater stress-related cortisol AUCi was related to higher BMI scores and greater energy intake in the absence of hunger. The results suggest that cortisol AUCi in response to psychosocial stress may be linked to problems with energy balance in children, with some variation by age. Published by Elsevier Ltd.

Work-family life courses and BMI trajectories in three British birth cohorts.

Science.gov (United States)

Lacey, R E; Sacker, A; Bell, S; Kumari, M; Worts, D; McDonough, P; Kuh, D; McMunn, A

2017-02-01

Combining work and family responsibilities has previously been associated with improved health in mid-life, yet little is known about how these associations change over time (both biographical and historical) and whether this extends to body mass index (BMI) trajectories for British men and women. The purpose of this study was to investigate relationships between work-family life courses and BMI trajectories across adulthood (16-42 years) for men and women in three British birth cohorts. Multiply imputed data from three nationally representative British birth cohorts were used-the MRC National Survey of Health and Development (NSHD; 1946 birth cohort, n=3012), the National Child Development Study (NCDS; 1958 birth cohort, n=9614) and the British Cohort Study (BCS; 1970 birth cohort, n=8140). A typology of work-family life course types was developed using multi-channel sequence analysis, linking annual information on work, partnerships and parenthood from 16 to 42 years. Work-family life courses were related to BMI trajectories using multi-level growth models. Analyses adjusted for indicators of prior health, birthweight, child BMI, educational attainment and socioeconomic position across the life course, and were stratified by gender and cohort. Work-family life courses characterised by earlier transitions to parenthood and weaker long-term links to employment were associated with greater increases in BMI across adulthood. Some of these differences, particularly for work-family groups, which are becoming increasingly non-normative, became more pronounced across cohorts (for example, increases in BMI between 16 and 42 years in long-term homemaking women: NSHD: 4.35 kg m -2 , 95% confidence interval (CI): 3.44, 5.26; NCDS: 5.53 kg m - 2 , 95% CI: 5.18, 5.88; BCS: 6.69 kg m - 2 , 95% CI: 6.36, 7.02). Becoming a parent earlier and weaker long-term ties to employment are associated with greater increases in BMI across adulthood in British men and women.

Fundamental movement skills in adolescents: Secular trends from 2003 to 2010 and associations with physical activity and BMI.

Science.gov (United States)

Huotari, P; Heikinaro-Johansson, P; Watt, A; Jaakkola, T

2018-03-01

The aim of this study was to examine the secular trends in fundamental movement skills (FMS) among 15- to 16-year-old adolescents at 2 assessment points scheduled in 2003 and 2010 and to investigate the associations between FMS, physical activity (PA), and body mass index (BMI). In 2003, self-reported PA, weight and height, and objective FMS scores were collected from 2390 students, and in 2010, similar data were generated from a second sample of 1346 students. FMS were assessed during both assessment phases using 3 identical objective FMS tests that were figure 8 dribbling, jumping laterally, and coordination track tests. This study indicated that the sum index of FMS did not change among the boys and the girls between 2 data collection points. However, findings demonstrated a secular decline in coordination test scores in both gender groups between 2 measurement points but an improvement in girls' object control skills between 2003 and 2010. The results also showed that FMS had a significant main effect on BMI in both gender groups, whereas the main effect of PA on BMI was not significant for either gender group. Results also demonstrated that there was no significant interaction effect between FMS and PA on BMI in either of the girls' or the boys' groups. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

BMI percentile-for-age overestimates adiposity in early compared with late maturing pubertal children

DEFF Research Database (Denmark)

Sørensen, Kaspar; Juul, Anders

2015-01-01

and bioelectric impedance analyses (BIA) were used to estimate adiposity. Clinical pubertal markers (Tanner stages and testicular volume) were evaluated. LH, FSH, estradiol, testosterone, SHBG and IGF1 levels were determined by immunoassays. RESULTS: In all age groups, higher BMI (all 1 year age-groups, P ≤ 0...

Time Course of Leptin in Patients with Anorexia Nervosa during Inpatient Treatment: Longitudinal Relationships to BMI and Psychological Factors.

Directory of Open Access Journals (Sweden)

Esther Stroe-Kunold

Full Text Available Leptin, a hormone secreted by adipose tissue, appears to play a major role in the homeostasis of body weight and psychobiological processes associated with anorexia nervosa (AN. However, there is scarce data on its exact influence on this disorder, in particular data over time.The present study addresses whether leptin changes during inpatient treatment play a role for treatment outcome and psychological factors in underweight AN patients.In order to understand whether leptin's role differs in relation to AN severity, data were assessed from 11 patients with a very low BMI and a higher chronicity (high severity group; HSS; mean BMI at the beginning of the study = 13.6; mean duration of illness = 5.1 years vs. nine with less severe symptoms (LSS; mean BMI = 16.2; mean duration of illness = 3.7 years. During the course of treatment, serum leptin concentrations were assessed weekly while weight (BMI was assessed twice per week. Concomitantly, psychological variables were obtained by means of electronic diaries. Unconditional linear growth models were calculated to evaluate the temporal course of leptin in relation to BMI. For HSS patients, two phases of treatment (BMI < 16 and BMI ≥ 16 kg/m2 were investigated.Leptin increased significantly with BMI in both groups of patients. For HSS patients, the increase of leptin in the first treatment phase did not predict later increases in BMI. Furthermore, the relationship of leptin and psychological factors was modulated by symptom severity. In HSS patients, higher leptin levels were associated with greater feelings of depression, anxiety, and stress whereas in LSS patients a higher leptin level showed the trend to be associated with lower psychological symptom burden.Our results suggest that leptin changes are differently associated with weight gain and psychological symptoms depending on the severity of starvation.

The longitudinal BMI pattern and body composition of patients with anorexia nervosa who require urgent hospitalization: A case control study.

Science.gov (United States)

Kawai, Keisuke; Yamashita, Sakino; Yamanaka, Takeharu; Gondo, Motoharu; Morita, Chihiro; Nozaki, Takehiro; Takakura, Shu; Hata, Tomokazu; Yamada, Yu; Matsubayashi, Sunao; Takii, Masato; Kubo, Chiharu; Sudo, Nobuyuki

2011-12-05

The prevention of serious physical complications in anorexia nervosa (AN) patients is important. The purpose of this study is to clarify which physical and social factors are related to the necessity for urgent hospitalization of anorexia nervosa (AN) patients in a long-term starvation state. We hypothesized that the change of longitudinal BMI, body composition and social background would be useful as an index of the necessity for urgent hospitalization. AN patients were classified into; urgent hospitalization, due to disturbance of consciousness or difficulty walking(n = 17); planned admission (n = 96); and outpatient treatment only groups (n = 136). The longitudinal BMI pattern and the clinical features of these groups were examined. In the hospitalization groups, comparison was done of body composition variation and the social background, including the educational level and advice from family members. After adjusting for age and duration of illness, the BMI of the urgent hospitalization group was lower than that of the other groups at one year before hospitalization (P < 0.01) and decreased more rapidly (P < 0.01). Urgent hospitalization was associated with the fat free mass (FFM) (P < 0.01). Between the groups, no considerable difference in social factors was found. The longitudinal pattern of BMI and FFM may be useful for understanding the severity in AN from the viewpoint of failure of the homeostasis system.

Genetic Influences on Growth Traits of BMI

DEFF Research Database (Denmark)

Hjelmborg, Jacob V B; Fagnani, Corrado; Silventoinen, Karri

2008-01-01

Objective:To investigate the interplay between genetic factors influencing baseline level and changes in BMI in adulthood.Methods and Procedures:A longitudinal twin study of the cohort of Finnish twins (N = 10,556 twin individuals) aged 20-46 years at baseline was conducted and followed up 15 years....... Data on weight and height were obtained from mailed surveys in 1975, 1981, and 1990.Results:Latent growth models revealed a substantial genetic influence on BMI level at baseline in males and females (heritability (h(2)) 80% (95% confidence interval 0.79-0.80) for males and h(2) = 82% (0.81, 0.......84) for females) and a moderate-to-high influence on rate of change in BMI (h(2) = 58% (0.50, 0.69) for males and h(2) = 64% (0.58, 0.69) for females). Only very weak evidence for genetic pleiotropy was observed; the genetic correlation between baseline and rate of change in BMI was very modest (-0.070 (-0.13, -0...

BMI-for-age in South Asian children of 0–20 years in the Netherlands: secular changes and misclassification by WHO growth references

NARCIS (Netherlands)

Wilde, J.A. de; Dekker, M.; Middelkoop, B.J.

2018-01-01

Background: South Asians are prone to cardiometabolic disease at lower BMI levels than most other ethnic groups, starting in childhood. The magnitude of BMI misclassifications is unknown. Aim: To compare the BMI distribution of contemporary South Asian 0–20 year olds in the Netherlands with: (1) The

Female fibromyalgia patients: lower resting metabolic rates than matched healthy controls.

Science.gov (United States)

Lowe, John C; Yellin, Jackie; Honeyman-Lowe, Gina

2006-07-01

Many features of fibromyalgia and hypothyroidism are virtually the same, and thyroid hormone treatment trials have reduced or eliminated fibromyalgia symptoms. These findings led the authors to test the hypothesis that fibromyalgia patients are hypometabolic compared to matched controls. Resting metabolic rate (RMR) was measured by indirect calorimetry and body composition by bioelectrical impedance for 15 fibromyalgia patients and 15 healthy matched controls. Measured resting metabolic rate (mRMR) was compared to percentages of predicted RMR (pRMR) by fat-free weight (FFW) (Sterling-Passmore: SP) and by sex, age, height, and weight (Harris-Benedict: HB). Patients had a lower mRMR (4,306.31+/-1077.66 kJ vs 5,411.59+/-695.95 kJ, p=0.0028) and lower percentages of pRMRs (SP: -28.42+/-15.82% vs -6.83+/-12.55%, pBMI) best accounted for variability in controls' RMRs, age and fat weight (FW) did for patients. In the patient group, TSH level accounted for 28% of the variance in pain distribution, and free T3 (FT3) accounted for 30% of the variance in pressure-pain threshold. Patients had lower mRMR and percentages of pRMRs. The lower RMRs were not due to calorie restriction or low FFW. Patients' normal FFW argues against low physical activity as the mechanism. TSH, FT4, and FT3 levels did not correlate with RMRs in either group. This does not rule out inadequate thyroid hormone regulation because studies show these laboratory values do not reliably predict RMR.

Diagnostic performance of BMI percentiles to identify adolescents with metabolic syndrome.

Science.gov (United States)

Laurson, Kelly R; Welk, Gregory J; Eisenmann, Joey C

2014-02-01

To compare the diagnostic performance of the Centers for Disease Control and Prevention (CDC) and FITNESSGRAM (FGram) BMI standards for quantifying metabolic risk in youth. Adolescents in the NHANES (n = 3385) were measured for anthropometric variables and metabolic risk factors. BMI percentiles were calculated, and youth were categorized by weight status (using CDC and FGram thresholds). Participants were also categorized by presence or absence of metabolic syndrome. The CDC and FGram standards were compared by prevalence of metabolic abnormalities, various diagnostic criteria, and odds of metabolic syndrome. Receiver operating characteristic curves were also created to identify optimal BMI percentiles to detect metabolic syndrome. The prevalence of metabolic syndrome in obese youth was 19% to 35%, compared with <2% in the normal-weight groups. The odds of metabolic syndrome for obese boys and girls were 46 to 67 and 19 to 22 times greater, respectively, than for normal-weight youth. The receiver operating characteristic analyses identified optimal thresholds similar to the CDC standards for boys and the FGram standards for girls. Overall, BMI thresholds were more strongly associated with metabolic syndrome in boys than in girls. Both the CDC and FGram standards are predictive of metabolic syndrome. The diagnostic utility of the CDC thresholds outperformed the FGram values for boys, whereas FGram standards were slightly better thresholds for girls. The use of a common set of thresholds for school and clinical applications would provide advantages for public health and clinical research and practice.

The Impact of Sleep-Disordered Breathing on Body Mass Index (BMI): The Sleep Heart Health Study (SHHS).

Science.gov (United States)

Brown, Mark A; Goodwin, James L; Silva, Graciela E; Behari, Ajay; Newman, Anne B; Punjabi, Naresh M; Resnick, Helaine E; Robbins, John A; Quan, Stuart F

2011-12-08

INTRODUCTION: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB). However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS) were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors. METHODS: A full-montage unattended home polysomnogram (PSG) and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI) was categorized using clinical thresholds: sleep apnea), and ≥ 15 (moderate to severe sleep apnea). Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates. RESULTS: Mean (SD) age was 62.2 years (10.14), 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD) change of 0.53 (2.62) kg/m(2) (p=0.071). A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m(2) (p=0.055) and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m(2) (plosing weight.

Socioeconomic differences in childhood BMI trajectories in Belarus.

Science.gov (United States)

Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M

2018-02-28

To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location,  children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic

Title: The Comparison of Anxiety Sensitivity and Happiness in Irritable Bowel Syndrome Patients with Normal Matched Group in Shiraz

Directory of Open Access Journals (Sweden)

2012-09-01

Full Text Available Background & Objective: The purpose of this study was the comparison of anxiety sensitivity and happiness between patients with Irritable Bowel Syndrome (IBS and normal matched group. Materials & Methods: The Subjects were 35 (21 females and 14 male IBS patients diagnosed by gastroenterologist and 35 (25 female and 10 males normal matched group all in 14– 63 old age. Anxiety Sensitivity Index (ASI-R, Oxford Happiness Questionnaire (OHQ, and a checklist applied as measures of anxiety sensitivity, happiness and demographic information. Results: Data analysis indicates that IBS patients significantly are higher than matched group in fear of publicly observable symptoms (P= 0.032, fear of cardiovascular symptoms (P= 0.01, fear of gastrointestinal symptoms (P= 0.001, fear of dissociative and neurological symptoms (P= 0.018, & general anxiety sensitivity (P= 0.003, and lower in joy (P= 0.005, control (P= 0.008, self- esteem (P= 0.001 calm (P= 0.006 and general happiness (P= 0.001. Although no significant differences were found in life satisfaction (P= 0.083 & efficacy (P= 0.09, fear of respiratory symptoms (P= 0.067, and fear of cognitive control deficiency (p= 0.097. Conclusion: As a psychological variable anxiety sensitivity can predict treatment seeking of IBS patient, and happiness negatively influenced by both anxiety sensitivity and IBS.

Food Marketing towards Children: Brand Logo Recognition, Food-Related Behavior and BMI among 3–13-Year-Olds in a South Indian Town

Science.gov (United States)

Ueda, Peter; Tong, Leilei; Viedma, Cristobal; Chandy, Sujith J.; Marrone, Gaetano; Simon, Anna; Stålsby Lundborg, Cecilia

2012-01-01

Objectives To assess exposure to marketing of unhealthy food products and its relation to food related behavior and BMI in children aged 3–13, from different socioeconomic backgrounds in a south Indian town. Methods Child-parent pairs (n = 306) were recruited at pediatric clinics. Exposure to food marketing was assessed by a digital logo recognition test. Children matched 18 logos of unhealthy food (high in fat/sugar/salt) featured in promotion material from the food industry to pictures of corresponding products. Children's nutritional knowledge, food preferences, purchase requests, eating behavior and socioeconomic characteristics were assessed by a digital game and parental questionnaires. Anthropometric measurements were recorded. Results Recognition rates for the brand logos ranged from 30% to 80%. Logo recognition ability increased with age (pfood preferences or purchase requests. Conclusions Children from higher socioeconomic groups in the region had higher brand logo recognition ability and are possibly exposed to more food marketing. The study did not lend support to a link between exposure to marketing and poor eating behavior, distorted nutritional knowledge or increased purchase requests. The correlation between logo recognition and BMI warrants further investigation on food marketing towards children and its potential role in the increasing burden of non-communicable diseases in this part of India. PMID:23082137

A Comparison of Cats (Felis silvestris catus Housed in Groups and Single Cages at a Shelter: A Retrospective Matched Cohort Study

Directory of Open Access Journals (Sweden)

Malini Suchak

2018-02-01

Full Text Available The merits of various housing options for domestic cats in shelters have been debated. However, comparisons are difficult to interpret because cats are typically not able to be randomly assigned to different housing conditions. In the current study, we attempted to address some of these issues by creating a retrospective matched cohort of cats in two housing types. Cats in group housing (GH were matched with cats in single housing (SH that were the same age, sex, breed, coat color, and size. Altogether we were able to find a match for 110 GH cats. We compared these two groups on several measures related to their experience at the shelter such as moves and the development of behavioral problems. We also compared these groups on outcomes including length of stay, live release, and returns after adoption. We found that while the frequency of moves was similar in both groups, SH cats were more likely to be moved to offsite facilities than GH cats. SH cats also spent a smaller proportion of time on the adoption floor. Length of stay and, live release and returns after adoption did not significantly differ across groups, however GH cats were two times as likely to be returned after adoption. Future research should look at the behavioral impacts of shelter decision-making regarding moving and management of cats in different housing systems.

Discordance Between Body Mass Index (BMI) and a Novel Body Composition Change Index (BCCI) as Outcome Measures in Weight Change Interventions.

Science.gov (United States)

Nugent, Stephen D; Kaats, Gilbert R; Preuss, Harry G

2018-01-01

A general assumption is that the body mass index (BMI) reflects changes in fat mass (FM). However, it fails to distinguish the type of weight that is lost or gained-fat mass (FM) or fat-free mass (FFM). The BMI treats both changes the same although they have opposite health consequences. The objective of this study was to propose a more precise measure, a body composition change index (BCCI), which distinguishes between changes in FM and FFM, and this study compares it with using the BMI as an outcome measure. Data were obtained from 3,870 subjects who had completed dual-energy x-ray absorptiometry (DEXA) total body scans at baseline and end-of-study when participating in a variety of weight-loss interventions. Since height remained constant in this adult cohort, changes in the BMI corresponded with scale weight changes (r = 0.994), allowing BMI changes to be converted to "lbs." to match the statistic used for calculation of the BCCI. The BCCI is calculated by scoring increases in FFM (lbs.) and decreases in FM (lbs.) as positive outcomes and scoring decreases in FFM and increases in FM as negative outcomes. The BCCI is the net sum of these calculations. Differences between scale weight changes and BCCI values were subsequently compared to obtain "discordance scores." Discordance scores ranged from 0.0 lbs. to >30.0 lbs. with a mean absolute value of between the two measures of 7.79 lbs. (99% confidence interval: 7.49-8.10, p BCCI and the BMI to evaluate the efficacy of weight loss interventions. If assessing changes in body composition is a treatment goal, use of the BMI could result in significantly erroneous conclusions.

Prospective associations between sedentary lifestyle and BMI in midlife.

Science.gov (United States)

Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A

2006-08-01

A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.

The Comparison of Sagittal Spinopelvic Parameters between Young Adult Patients with L5 Spondylolysis and Age-Matched Control Group

Science.gov (United States)

Oh, Young Min; Choi, Ha Young

2013-01-01

Objective To compare spinopelvic parameters in young adult patients with spondylolysis to those in age-matched patients without spondylolysis and investigate the clinical impact of sagittal spinopelvic parameters in patients with L5 spondylolysis. Methods From 2009 to 2012, a total of 198 young adult male patients with spondylolysis were identified. Eighty age-matched patients without spondylolysis were also selected. Standing lateral films that included both hip joints were obtained for each subject. Pelvic incidence (PI), sacral slope (SS), pelvic tilt, lumbar lordosis angle, sacral inclination, lumbosacral angle, and sacral table angle were measured in both groups. A comparative study of the spinopelvic parameters of these two groups was performed using SPSS 15.0 (SPSS Inc., Chicago, IL, USA). Results Among the aforementioned spinopelvic parameters, PI, SS and STA were significantly different between patients with spondylolysis and those without spondylolysis. PI and SS were higher in the spondylolysis group than in the control group, but STA was lower in the spondylolysis group than in the control group. Conclusion PI and SS were higher in the spondylolysis group than in the control group, but STA was lower in the spondylolysis group than in the control group. Patients with spondylolysis have low STA at birth, which remains constant during growth; a low STA translates into high SS. As a result, PI is also increased in accordance with SS. Therefore, we suggest that STA is an important etiologic factor in young adult patients with L5 spondylolysis. PMID:24278649

Prediction of BMI by impulsivity, eating behavior and activity level

Directory of Open Access Journals (Sweden)

Jiang Xiaxia

2016-01-01

Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.

Is BMI a valid measure of obesity in postmenopausal women?

Science.gov (United States)

Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew

2018-03-01

Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.

Analysis of the prognostic value of BMI and the difference in its impact according to age and sex in DLBCL patients.

Science.gov (United States)

Kanemasa, Yusuke; Shimoyama, Tatsu; Sasaki, Yuki; Tamura, Miho; Sawada, Takeshi; Omuro, Yasushi; Hishima, Tsunekazu; Maeda, Yoshiharu

2018-02-01

Studies that have evaluated the prognostic value of body mass index (BMI) in patients with diffuse large B-cell lymphoma have recently been reported. However, the impact of BMI on survival outcomes remains controversial. We retrospectively analyzed the data of 406 diffuse large B-cell lymphoma patients treated with R-CHOP or R-CHOP-like regimens. The number (%) of patients that were categorized into 1 of 4 groups according to BMI were underweight (BMI (BMI (≥25 kg/m 2 ) (5-y OS, 61.5% vs 85.7%; P = .039). In contrast, in young female patients (BMI had significantly better OS than those with a high BMI (5-y OS, 88.6% vs 46.4%; P BMI on OS between young and elderly patients. In this study, we demonstrated that being underweight and obese were independent prognostic factors compared with being normal weight. In female patients, BMI had a different impact on the prognosis of young and elderly patients, whereas in male patients, there was no difference in the effect of BMI on prognosis according to age. Copyright © 2017 John Wiley & Sons, Ltd.

Bmi-1 Regulates Extensive Erythroid Self-Renewal

Directory of Open Access Journals (Sweden)

Ah Ram Kim

2015-06-01

Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

Trends in BMI of urban Australian adults, 1980-2000

DEFF Research Database (Denmark)

Walls, Helen L; Wolfe, Rory; Haby, Michelle M

2010-01-01

of 7.4 kg/m2 at the higher end for women aged 55-64 years. While the prevalence of obesity (BMI >or= 30 kg/m2) doubled, the prevalence of obesity class III (BMI >or= 40 kg/m2) increased fourfold. CONCLUSIONS: BMI in urban Australian adults has increased and its distribution has become increasingly...... right-skewed. This has resulted in a large increase in the prevalence of obesity, particularly the more severe levels of obesity. It will be important to monitor changes in the different classes of obesity and the extent to which obesity interventions both shift the BMI distribution leftwards...

The decline in BMI among Japanese women after World War II.

Science.gov (United States)

Maruyama, Shiko; Nakamura, Sayaka

2015-07-01

The body mass index (BMI) of the Japanese is significantly lower than is found in other high-income countries. Moreover, the average BMI of Japanese women is lower than that of Japanese men, and the age-specific BMI of Japanese women has decreased over time. The average BMI of Japanese women at age 25 decreased from 21.8 in 1948 to 20.4 in 2010 whereas that of men increased from 21.4 to 22.3 over the same period. We examine the long-term BMI trend in Japan by combining several historical data sources spanning eleven decades, from 1901 to 2012, to determine not only when but also how the BMI decline among women began: whether its inception was period-specific or cohort-specific. Our nonparametric regression analysis generated five findings. First, the BMI of Japanese women peaked with the 1930s birth cohort. This means that the trend is cohort-specific. Second, the BMI of men outpaced that of women in the next cohort. Third, the BMI of Japanese children, boys and girls alike, increased steadily throughout the 20th century. Fourth, the gender difference in the BMI trend is due to a gender difference in the weight trend, not the height trend. Fifth, these BMI trends are observed in urban and rural populations alike. We conclude that the BMI decline among Japanese women began with those who were in their late teens shortly after World War II. Copyright © 2015 Elsevier B.V. All rights reserved.

Are BMI and Sedentariness Correlated? A Multilevel Study in Children

Directory of Open Access Journals (Sweden)

Thayse Natacha Gomes

2015-07-01

Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.

Social disparities in BMI trajectories across adulthood by gender, race/ethnicity and lifetime socio-economic position: 1986-2004.

Science.gov (United States)

Clarke, Philippa; O'Malley, Patrick M; Johnston, Lloyd D; Schulenberg, John E

2009-04-01

The prevalence of obesity and overweight is rapidly increasing in industrialized countries, with long-term health and social consequences. There is also a strong social patterning of obesity and overweight, with a higher prevalence among women, racial/ethnic minorities and those from a lower socio-economic position (SEP). Most of the existing work in this area, however, is based on cross-sectional data or single cohort studies. No national studies to date have examined how social disparities in obesity and overweight differ by age and historical period using longitudinal data with repeated measures. We used panel data from the nationally representative Monitoring the Future Study (1986-2004) to examine social disparities in trajectories of body mass index (BMI) over adulthood (age 18-45). Self-reported height and weight were collected in this annual US survey of high-school seniors, followed biennially since 1976. Using growth curve models, we analysed BMI trajectories over adulthood by gender, race/ethnicity and lifetime SEP (measured by parents' education and respondent's education). BMI trajectories exhibit a curvilinear rate of change from age 18 to 45, but there was a strong period effect, such that weight gain was more rapid for more recent cohorts. As a result, successive cohorts become overweight (BMI>25) at increasingly earlier points in the life course. BMI scores were also consistently higher for women, racial/ethnic minority groups and those from a lower SEP. However, BMI scores for socially advantaged groups in recent cohorts were actually higher than those for their socially disadvantaged counterparts who were born 10 years earlier. Results highlight the importance of social status and socio-economic resources for maintaining optimal weight. Yet, even those in advantaged social positions have experienced an increase in BMI in recent years.

BMI at birth and overweight at age four.

Science.gov (United States)

Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F

Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

Bmi-1: At the crossroads of physiological and pathological biology

Science.gov (United States)

Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar

2015-01-01

Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339

Plasma progranulin and relaxin levels in PCOS women with normal BMI compared to control healthy subjects

Directory of Open Access Journals (Sweden)

Samad Akbarzadeh

2013-09-01

Full Text Available Background: Poly Cystic Ovary Syndrome (PCOS is the most commonly encountered endocrine gland disease affecting 5-10 present of women at their reproductive age. This syndrome is associated with type 2 diabetes, dyslipidemia, and obesity. Progranulin and relaxin are adipokins that are related with carbohydrate and lipid metabolism. Due to limited data about progranulin and relaxin plasma levels´ in women with PCOS and normal BMI, this study was conducted. Material and Methods: This study is a cross-sectional. During the study 39 women with PCOS and BMI< 25 on the basis of Rotterdam criteria were chosen as the patient group and 38 healthy women were selected as the control group. The concentration of progranulin and relaxin were measured by ELISA technique. Results: The difference in Plasma concentration of progranulin and relaxin, and also some of the biochemical parameters in the patient group versus to the control group was not significant, but there was significant difference in the concentrations of VLDL, triglyceride (p=0.046, insulin (p=0.016, HOMA-IR (p=0.015, testosterone (p=0.01, and DHEAS (p=0.034 in the patients group compared to the control group. Conclusion: In this study, the difference in Plasma concentration of progranulin and relaxin in the patient group compared to the control group was not significant. It could be inferred that lack of change in plasma level of progranulin and relaxin in women with PCOS is related to BMI<25 and FBS<110. Moreoverestosterones, insulin, DHEAS and HOMA-IR changes could be better predictors of PCOS and its associated diabetes.

A Matched Case-Control Study of Risk Factors for Breast Cancer Risk in Vietnam

Directory of Open Access Journals (Sweden)

J. Nguyen

2016-01-01

Full Text Available Background. Vietnam has a low age-standardized incidence of breast cancer, but the incidence is rising rapidly with economic development. We report data from a matched case-control study of risk factors for breast cancer in the largest cancer hospital in Vietnam. Methods. 492 incident breast cancer cases unselected for family history or age at diagnosis and 1306 control women age 25–75 were recruited from the National Cancer Hospital (BVK, Hanoi. Structured interviews were conducted and pathology data was centrally reported at the National Cancer Hospital of Vietnam, in Hanoi. Results. Our analysis included 294 matched pairs. Mean age at diagnosis was 46.7 years. Lower mean parity, older age at first parity, increasing weight and BMI at age 18, and increasing BMI at diagnosis were positively correlated with breast cancer cases compared to controls. Age at first menarche and duration of breastfeeding were not statistically different between cases and controls. Conclusions. In this study we demonstrate that breast cancer in Vietnam is associated with some but not all of the published risk factors from Western populations. Our data is consistent with other studies of breast cancer in Asian populations.

Template matching via densities on the roto-translation group

NARCIS (Netherlands)

Bekkers, E.; Loog, M.; Romeny, B. ter Haar; Duits, R.

2018-01-01

We propose a template matching method for the detection of 2D image objects that are characterized by orientation patterns. Our method is based on data representations via orientation scores, which are functions on the space of positions and orientations, and which are obtained via a wavelet-type

Education modifies genetic and environmental influences on BMI

DEFF Research Database (Denmark)

Johnson, Wendy; Kyvik, Kirsten Ohm; Skytthe, Axel

2011-01-01

environmental correlations between education and BMI differed by level of education, analyzing women and men separately. Correlations between education and BMI were -.13 in women, -.15 in men. High BMI's were less frequent among well-educated participants, generating less variance. In women, this was due...... to restriction of all forms of variance, overall by a factor of about 2. In men, genetic variance did not vary with education, but results for shared and nonshared environmental variance were similar to those for women. The contributions of the shared environment to the correlations between education and BMI......Obesity is more common among the less educated, suggesting education-related environmental triggers. Such triggers may act differently dependent on genetic and environmental predisposition to obesity. In a Danish Twin Registry survey, 21,522 twins of same-sex pairs provided zygosity, height, weight...

Comparison of Efficacy and Safety of Liraglutide 3.0 mg in Individuals with BMI above and below 35 kg/m²: A Post-hoc Analysis

Science.gov (United States)

le Roux, Carel; Aroda, Vanita; Hemmingsson, Joanna; Cancino, Ana Paula; Christensen, Rune; Pi-Sunyer, Xavier

2018-01-01

Objective To investigate whether the efficacy and safety of liraglutide 3.0 mg differed between two subgroups, BMI 27 to 3.0 mg were evaluated by testing the interaction between treatment group and baseline BMI subgroup. Results Significantly greater weight loss (0–56 weeks) was observed with liraglutide 3.0 mg versus placebo in all patient groups while on treatment. There was no evidence that the weight-lowering effect of liraglutide 3.0 mg differed between BMI subgroups (interaction p > 0.05). Similarly, for most secondary endpoints significantly greater improvements were observed with liraglutide 3.0 mg versus placebo, with no indication treatment effects differing between subgroups. The safety profile of liraglutide 3.0 mg was broadly similar across BMI subgroups. Conclusion This post-hoc analysis did not indicate any differences in the treatment effects, or safety profile, of liraglutide 3.0 mg for individuals with BMI 27 to 3.0 mg can therefore be considered for individuals with a BMI of ≥35 as well as for those with a BMI of 27 to <35 kg/m². PMID:29145215

Are genes associated with energy metabolism important in asthma and BMI?

Science.gov (United States)

Szczepankiewicz, Aleksandra; Breborowicz, Anna; Sobkowiak, Paulina; Popiel, Anna

2009-02-01

Increased serum leptin levels have been observed in asthmatic patients. Leptin, via proliferation and activation of Th2 cells, may induce inflammation in asthma. It has also been demonstrated that leptin mRNA expression and protein levels increase in response to inflammatory stimuli. We hypothesized that polymorphisms in the leptin receptor, leptin and ghrelin genes, may affect their expression and, therefore, be responsible for altered response to increased leptin levels observed in asthma. To our knowledge, there were no studies on a potential role of LEPR, LEP, and GHRL polymorphisms in asthma. We analyzed 129 pediatric patients with asthma and 114 healthy children from the control group ranging from 6 to 18 years of age. The diagnosis of allergic asthma was based on clinical symptoms, the lung function test, and the positive skin prick test and/or increased immunoglobulin E (IgE) levels. Polymorphisms were genotyped by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Statistical analyses were performed with Statistica v.7.1 software (Statistica, StatSoft, Poland; available free at http://www.broad.mit.edu/mpg/haploview/index.php). Linkage disequilibrium analysis was performed with Haploview v.4.0. We observed a statistically significant association of the 3'UTR A/G and the -2549A/G polymorphisms of the leptin gene with asthma. No association with asthma was observed for the K109R and the Q223R polymorphisms of the LEPR gene and the Met72Leu polymorphism of the ghrelin gene. In the analysis of body mass index (BMI) stratified by genotype, we found an association of the -2549A/G LEP, but not of LEPR and GHRL polymorphisms, with higher BMI values in asthmatic patients. We found suggestive evidence for linkage between the two polymorphisms of the LEPR gene (D' = 0.84 CI: 0.71-0.92; r(2) = 0.29) in linkage disequilibrium analysis: The GG haplotype was more frequent in the control healthy group (p = 0.057). No linkage

Overweight or obese BMI is associated with earlier, but not later survival after common acute illnesses.

Science.gov (United States)

Prescott, Hallie C; Chang, Virginia W

2018-02-06

Obesity has been associated with improved short-term mortality following common acute illness, but its relationship with longer-term mortality is unknown. Observational study of U.S. Health and Retirement Study (HRS) participants with federal health insurance (fee-for-service Medicare) coverage, hospitalized with congestive heart failure (N = 4287), pneumonia (N = 4182), or acute myocardial infarction (N = 2001), 1996-2012. Using cox proportional hazards models, we examined the association between overweight or obese BMI (BMI ≥ 25.0 kg/m 2 ) and mortality to 5 years after hospital admission, adjusted for potential confounders measured at the same time as BMI, including age, race, sex, education, partnership status, income, wealth, and smoking status. Body mass index (BMI) was calculated from self-reported height and weight collected at the HRS survey prior to hospitalization (a median 1.1 year prior to hospitalization). The referent group was patients with a normal BMI (18.5 to BMI was associated with lower mortality at 1 year after hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction-with adjusted hazard ratios of 0.68 (95% CI 0.59-0.79), 0.74 (95% CI: 0.64-0.84), and 0.65 (95%CI: 0.53-0.80), respectively. Among participants who lived to one year, however, subsequent survival was similar between patients with normal versus overweight/obese BMI. In older Americans, overweight or obese BMI was associated with improved survival following hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction. This association, however, is limited to the shorter-term. Conditional on surviving to one year, we did not observe a survival advantage associated with excess weight.

Decoding of top-down cognitive processing for SSVEP-controlled BMI

Science.gov (United States)

Min, Byoung-Kyong; Dähne, Sven; Ahn, Min-Hee; Noh, Yung-Kyun; Müller, Klaus-Robert

2016-11-01

We present a fast and accurate non-invasive brain-machine interface (BMI) based on demodulating steady-state visual evoked potentials (SSVEPs) in electroencephalography (EEG). Our study reports an SSVEP-BMI that, for the first time, decodes primarily based on top-down and not bottom-up visual information processing. The experimental setup presents a grid-shaped flickering line array that the participants observe while intentionally attending to a subset of flickering lines representing the shape of a letter. While the flickering pixels stimulate the participant’s visual cortex uniformly with equal probability, the participant’s intention groups the strokes and thus perceives a ‘letter Gestalt’. We observed decoding accuracy of 35.81% (up to 65.83%) with a regularized linear discriminant analysis; on average 2.05-fold, and up to 3.77-fold greater than chance levels in multi-class classification. Compared to the EEG signals, an electrooculogram (EOG) did not significantly contribute to decoding accuracies. Further analysis reveals that the top-down SSVEP paradigm shows the most focalised activation pattern around occipital visual areas; Granger causality analysis consistently revealed prefrontal top-down control over early visual processing. Taken together, the present paradigm provides the first neurophysiological evidence for the top-down SSVEP BMI paradigm, which potentially enables multi-class intentional control of EEG-BMIs without using gaze-shifting.

Does more education cause lower BMI, or do lower-BMI individuals become more educated? Evidence from the National Longitudinal Survey of Youth 1979.

Science.gov (United States)

Benson, Rebecca; von Hippel, Paul T; Lynch, Jamie L

2017-03-21

More educated adults have lower average body mass index (BMI). This may be due to selection, if adolescents with lower BMI attain higher levels of education, or it may be due to causation, if higher educational attainment reduces BMI gain in adulthood. We test for selection and causation in the National Longitudinal Survey of Youth 1979, which has followed a representative US cohort from age 14-22 in 1979 through age 47-55 in 2012. Using ordinal logistic regression, we test the selection hypothesis that overweight and obese adolescents were less likely to earn high school diplomas and bachelor's degrees. Then, controlling for selection with individual fixed effects, we estimate the causal effect of degree completion on BMI and obesity status. Among 18-year-old women, but not among men, being overweight or obese predicts lower odds of attaining higher levels of education. At age 47-48, higher education is associated with lower BMI, but 70-90% of the association is due to selection. Net of selection, a bachelor's degree predicts less than a 1 kg reduction in body weight, and a high school credential does not reduce BMI. Copyright © 2017 Elsevier Ltd. All rights reserved.

Computed tomography of the brain in cases with venous vasculitis compared with an age-matched reference group

International Nuclear Information System (INIS)

Hannerz, J.; Ericson, K.; Bergstrand, G.; Berggren, B.M.; Edman, G.; Karolinska Sjukhuset, Stockholm; Karolinska Sjukhuset, Stockholm

1988-01-01

Patients with a particular, steroid-sensitive headache and often characteristic pathology at orbital phlebography, have been suggested to suffer from venous vasculitis. Fifty such patients were examined with computed tomography (CT) of the brain. The findings were compared with those of an age-matched reference group selected at random to represent normal subjects. The CT examinations were analyzed with respect to size of lateral ventricles and signs of atrophy. In both groups, there was a significant increase of atrophy with age. There was also a significantly higher degree of atrophy in the patient group as compared with the reference group. The findings indicate that the supposedly underlying venous vasculitis is related to early aging and atrophy of the brain. (orig.)

Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.

Science.gov (United States)

Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L

2018-02-01

Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.

Childhood BMI growth trajectories and endometrial cancer risk

DEFF Research Database (Denmark)

Aarestrup, Julie; Gamborg, Michael; Tilling, Kate

2017-01-01

Previously, we found that excess weight already in childhood has positive associations with endometrial cancer, however, associations with changes in body mass index (BMI) during childhood are not well understood. Therefore, we examined whether growth in childhood BMI is associated with endometrial...... cancer and its sub-types. A cohort of 155,505 girls from the Copenhagen School Health Records Register with measured weights and heights at the ages of 6 to 14 years and born 1930-89 formed the analytical population. BMI was transformed to age-specific z-scores. Using linear spline multilevel models......, each girl's BMI growth trajectory was estimated as the deviance from the average trajectory for three different growth periods (6.25-7.99, 8.0-10.99, 11.0-14.0 years). Via a link to health registers, 1020 endometrial cancer cases were identified, and Cox regressions were performed. A greater gain...

Emotional Self-Disclosure in Online Breast Cancer Support Groups: Examining Theme, Reciprocity, and Linguistic Style Matching.

Science.gov (United States)

Malloch, Yining Z; Taylor, Laramie D

2018-02-05

The present study investigated emotional self-disclosure (ESD) patterns and their effects in online support groups specific to different stages of breast cancer. Linguistic features of messages posted to an online breast cancer support group were analyzed. ESD was common, and was consistent across four stage forums. Emotional talk was linked to a variety of themes, but most prominently in the context of discussions about social connections rather than health or death. Linguistic style matching mediated the relationship between ESD in posts and reciprocal ESD in comments, suggesting a key role for mutual understanding and engagement between posters and commenters. Implications for health communication theory and practice were discussed.

Effects of injected dose, BMI and scanner type on NECR and image noise in PET imaging

International Nuclear Information System (INIS)

Chang Tingting; Chang Guoping; Clark, John W Jr; Kohlmyer, Steve; Rohren, Eric; Mawlawi, Osama R

2011-01-01

Noise equivalent count rate (NECR) and image noise are two different but related metrics that have been used to predict and assess image quality, respectively. The aim of this study is to investigate, using patient studies, the relationships between injected dose (ID), body mass index (BMI) and scanner type on NECR and image noise measurements in PET imaging. Two groups of 90 patients each were imaged on a GE DSTE and a DRX PET/CT scanner, respectively. The patients in each group were divided into nine subgroups according to three BMI (20-24.9, 25-29.9, 30-45 kg m -2 ) and three ID (296-444, 444-555, 555-740 MBq) ranges, resulting in ten patients/subgroup. All PET data were acquired in 3D mode and reconstructed using the VuePoint HD (registered) fully 3D OSEM algorithm (2 iterations, 21(DRX) or 20 (DSTE) subsets). NECR and image noise measurements for bed positions covering the liver were calculated for each patient. NECR was calculated from the trues, randoms and scatter events recorded in the DICOM header of each patient study, while image noise was determined as the standard deviation of 50 non-neighboring voxels in the liver of each patient. A t-test compared the NECR and image noise for different scanners but with the same BMI and ID. An ANOVA test on the other hand was used to compare the results of patients with different BMI but the same ID and scanner type as well as different ID but the same BMI and scanner type. As expected the t-test showed a significant difference in NECR between the two scanners for all BMI and ID subgroups. However, contrary to what is expected no such findings were observed for image noise measurement. The ANOVA results showed a statistically significant difference in both NECR and image noise among the different BMI for each ID and scanner subgroup. However, there was no statistically significant difference in NECR and image noise across different ID for each BMI and scanner subgroup. Although the GE DRX PET/CT scanner has better

The role of diabetes mellitus and BMI in the surgical treatment of ankle fractures.

Science.gov (United States)

Lanzetti, Riccardo Maria; Lupariello, Domenico; Venditto, Teresa; Guzzini, Matteo; Ponzo, Antonio; De Carli, Angelo; Ferretti, Andrea

2018-02-01

Open reduction and internal fixation is the standard treatment for displaced ankle fractures. However, the presence of comorbidities such as diabetes mellitus and body mass index (BMI) are associated with poor bone quality, and these factors may predict the development of postoperative complications. The study aim was to assess the role of diabetes mellitus and BMI in wound healing in patients younger than 65 years who were surgically treated for malleoli fractures. Ninety patients, aged from 18 to 65 years old, with surgically treated ankle fracture, were retrospectively enrolled. Patients were classified in two groups: patient with diabetes and patients without diabetes (insulin-dependent and noninsulin dependent). All patients were assessed for wound complications, Visual Analogue Scale and Foot and Ankle Disability Index (FADI) were assessed for all patients. Logistic regression was used to identify the risk of wound complications after surgery using the following factors as explanatory variables: age, gender, duration of surgery, BMI, hypercholesterolemia, smoking history, diabetes mellitus, and high blood pressure. In total, 38.9% of patients showed wound complications. Of them, 17.1% were nondiabetics and 82.9% were diabetics. We observed a significant association between DM and wound complications after surgery (P = .005). Logistic regression analysis revealed that DM (P BMI (P = .03) were associated with wound complications. The odds of having a postoperative wound complication were increased 0.16 times in the presence of diabetes and 1.14 times for increasing BMI. This study showed that diabetes mellitus and higher BMI delay the wound healing and increase the complication rate in young adult patients with surgically treated bimalleolar fractures. Copyright © 2017 John Wiley & Sons, Ltd.

Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

NARCIS (Netherlands)

Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

2008-01-01

Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

Reciprocal expression of Bmi1 and Mel-18 is associated with functioning of primitive hematopoietic cells.

Science.gov (United States)

Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao

2009-07-01

The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.

Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

Science.gov (United States)

Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

2016-01-01

Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

BMI-for-age graphs with severe obesity percentile curves: tools for plotting cross-sectional and longitudinal youth BMI data.

Science.gov (United States)

Racette, Susan B; Yu, Liyang; DuPont, Nicholas C; Clark, B Ruth

2017-05-24

Severe obesity is an important and distinct weight status classification that is associated with disease risk and is increasing in prevalence among youth. The ability to graphically present population weight status data, ranging from underweight through severe obesity class 3, is novel and applicable to epidemiologic research, intervention studies, case reports, and clinical care. The aim was to create body mass index (BMI) graphing tools to generate sex-specific BMI-for-age graphs that include severe obesity percentile curves. We used the Centers for Disease Control and Prevention youth reference data sets and weight status criteria to generate the percentile curves. The statistical software environments SAS and R were used to create two different graphing options. This article provides graphing tools for creating sex-specific BMI-for-age graphs for males and females ages 2 to obesity classes 2 and 3, the ability to plot individual data for thousands of children and adolescents on a single graph, and the ability to generate cross-sectional and longitudinal graphs. These new BMI graphing tools will enable investigators, public health professionals, and clinicians to view and present youth weight status data in novel and meaningful ways.

Maternal BMI during Pregnancy: Effect on trace elements Status and ...

African Journals Online (AJOL)

Maternal BMI was significantly positively related to age, parity and socioeconomic status. While a negative relationship was found between plasma copper and maternal BMI, significantly (p < 0.05) lower zinc levels were found in underweight and obese women when compared to women with normal BMI. Maternal anaemia ...

Shifting Patterns of BMI and Skinfold Fatness among US Children: 1985/87 vs. 2012

Directory of Open Access Journals (Sweden)

Yan Yang

2016-12-01

Full Text Available Background: Childhood obesity has been recognized as a major public health concern. The purpose of this study was to determine specific shifting patterns of BMI and skinfold fatness across different age and sex groups between 1985/87 and 2012. Methods: The data of 9,366 children aged 8-15 years from two nationally representative surveys, i.e., 1985/87 National Children and Youth Fitness Study I & II and 2012 National Health and Nutrition Examination Survey National Youth Fitness Survey, were analyzed. Specifically, changes of BMI-based obesity prevalence and shifting patterns of BMI, height, weight, skinfold body fat percentage (skinfold-fat%, subscapular skinfold, and triceps skinfold from 1985/87 to 2012 were estimated by age and sex using the 1985/87 quartiles as the baseline. Results: Significantly increased obesity prevalence were reconfirmed for both boys (12.12%, P <.001 and girls (3.53%, P <.001 from 1985/87 to 2012. Except for height, all other measures in 2012 experienced an unbalanced shifting pattern, mainly from other quartiles into the 4th quartile of 1985/87. Conclusion: The shifting of both boys’ and girls’ BMI and skinfold-fat% were all concentrated in the 4th quartile of 1985/87, indicating not only that there was a significant increase in BMI and skinfold-fat% in the U.S. children from 1985/87 to 2012, but also into the overweight and obese subgroups, which serves as a serious warning for childhood obesity epidemic and public health.

Parental nonstandard work schedules during infancy and children's BMI trajectories

Directory of Open Access Journals (Sweden)

Afshin Zilanawala

2017-09-01

Full Text Available Background: Empirical evidence has demonstrated adverse associations between parental nonstandard work schedules (i.e., evenings, nights, or weekends and child developmental outcomes. However, there are mixed findings concerning the relationship between parental nonstandard employment and children's body mass index (BMI, and few studies have incorporated information on paternal work schedules. Objective: This paper investigated BMI trajectories from early to middle childhood (ages 3-11 by parental work schedules at 9 months of age, using nationally representative cohort data from the United Kingdom. This study is the first to examine the link between nonstandard work schedules and children's BMI in the United Kingdom. Methods: We used data from the Millennium Cohort Study (2001‒2013, n = 13,021 to estimate trajectories in BMI, using data from ages 3, 5, 7, and 11 years. Joint parental work schedules and a range of biological, socioeconomic, and psychosocial covariates were assessed in the initial interviews at 9 months. Results: Compared to children in two-parent families where parents worked standard shifts, we found steeper BMI growth trajectories for children in two-parent families where both parents worked nonstandard shifts and children in single-parent families whose mothers worked a standard shift. Fathers' shift work, compared to standard shifts, was independently associated with significant increases in BMI. Conclusions: Future public health initiatives focused on reducing the risk of rapid BMI gain in childhood can potentially consider the disruptions to family processes resulting from working nonstandard hours. Contribution: Children in families in which both parents work nonstandard schedules had steeper BMI growth trajectories across the first decade of life. Fathers' nonstandard shifts were independently associated with increases in BMI.

Lymphocyte subtype dysregulation in a group of children with simple ...

African Journals Online (AJOL)

Ehab

for males and females respectively.6. Although obesity is primarily a ... children with a mean body mass index (BMI) of 39.2± 12.5 and 10 matched control subjects with ..... childhood obesity on the development of self-esteem. Health Rep 2009 ...

Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.

Science.gov (United States)

Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena

2016-04-01

While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.

Experience with multiple control groups in a large population-based case-control study on genetic and environmental risk factors.

Science.gov (United States)

Pomp, E R; Van Stralen, K J; Le Cessie, S; Vandenbroucke, J P; Rosendaal, F R; Doggen, C J M

2010-07-01

We discuss the analytic and practical considerations in a large case-control study that had two control groups; the first control group consisting of partners of patients and the second obtained by random digit dialling (RDD). As an example of the evaluation of a general lifestyle factor, we present body mass index (BMI). Both control groups had lower BMIs than the patients. The distribution in the partner controls was closer to that of the patients, likely due to similar lifestyles. A statistical approach was used to pool the results of both analyses, wherein partners were analyzed with a matched analysis, while RDDs were analyzed without matching. Even with a matched analysis, the odds ratio with partner controls remained closer to unity than with RDD controls, which is probably due to unmeasured confounders in the comparison with the random controls as well as intermediary factors. However, when studying injuries as a risk factor, the odds ratio remained higher with partner control subjects than with RRD control subjects, even after taking the matching into account. Finally we used factor V Leiden as an example of a genetic risk factor. The frequencies of factor V Leiden were identical in both control groups, indicating that for the analyses of this genetic risk factor the two control groups could be combined in a single unmatched analysis. In conclusion, the effect measures with the two control groups were in the same direction, and of the same order of magnitude. Moreover, it was not always the same control group that produced the higher or lower estimates, and a matched analysis did not remedy the differences. Our experience with the intricacies of dealing with two control groups may be useful to others when thinking about an optimal research design or the best statistical approach.

Impact of baseline BMI on glycemic control and weight change with metformin monotherapy in Chinese type 2 diabetes patients: phase IV open-label trial.

Directory of Open Access Journals (Sweden)

Linong Ji

Full Text Available Differences exist between treatment recommendations regarding the choice of metformin as first-line therapy for type 2 diabetes patients according to body mass index (BMI. This study compared the efficacy of metformin monotherapy among normal-weight, overweight, and obese patients with newly diagnosed type 2 diabetes.In this prospective, multicenter, open-label study in China, patients aged 23-77 years were enrolled 1∶1:1 according to baseline BMI: normal-weight (BMI 18.5-23.9 kg/m(2; n = 125; overweight (BMI 24.0-27.9 kg/m(2; n = 122 or obese (BMI ≥28 kg/m(2; n = 124. Extended-release metformin was administered for 16 weeks (500 mg/day, up-titrated weekly to a maximum 2,000 mg/day. The primary efficacy endpoint was the effect of baseline BMI on glycemic control with metformin monotherapy, measured as the change from baseline in glycosylated hemoglobin (HbA1c at week 16 compared among BMI groups using ANCOVA. Other endpoints included comparisons of metformin's effects on fasting plasma glucose (FPG, lipid levels and body weight.Mean HbA1c decreases at week 16, adjusted for baseline values, were -1.84%, -1.78% and -1.78% in normal-weight, overweight and obese patients, (P = 0.664; body weight decreased by 2.4%, 3.9% and 3.5%, respectively. FPG levels decreased similarly over time in all BMI groups (P = 0.461 and changes from baseline in high-density lipoprotein cholesterol (HDL-C and low-density lipoprotein cholesterol (LDL-C did not differ significantly among BMI groups at week 16 (P = 0.143 and 0.451, respectively.Baseline BMI had no impact on glycemic control, weight change or other efficacy measures with metformin monotherapy. These data suggest that normal-weight type 2 diabetes patients would derive the same benefits from first-line treatment with metformin as overweight and obese patients, and are not at increased risk of excess weight loss.ClinicalTrials.gov NCT00778622.

DOES PRESENTING PATIENT'S BMI INCREASE DOCUMENTATION OF OBESITY?

Directory of Open Access Journals (Sweden)

Norm Clothier, MD, M. Kim Marvel, PhD, Courtney S. Cruickshank, MS

2002-09-01

Full Text Available Purpose: Despite the associated health consequences, obesity is infrequently documented as a problem in medical charts. The purpose of this study is to determine whether a simple intervention (routine listing of the BMI on the medical chart will increase physician documentation of obesity in the medical record. Methods: Participants were resident physicians in a family medicine residency program. Participants were randomly assigned to either an experimental group or a control group. For experimental group physicians, the Body Mass Index was listed alongside other vital signs of patients seen in an ambulatory setting. Physician documentation of patient obesity was assessed by chart review after patient visits. Documentation was defined as inclusion of obesity on the problem list or in the progress note. Results: The intervention did not significantly increase the rate of documentation of obesity in the medical chart. Several reasons for the lack of change are explored, including the difficulty of treating obesity successfully.

Comparison of Efficacy and Safety of Liraglutide 3.0 mg in Individuals with BMI above and below 35 kg/m²: A Post-hoc Analysis.

Science.gov (United States)

le Roux, Carel; Aroda, Vanita; Hemmingsson, Joanna; Cancino, Ana Paula; Christensen, Rune; Pi-Sunyer, Xavier

2017-01-01

To investigate whether the efficacy and safety of liraglutide 3.0 mg differed between two subgroups, BMI 27 to 3.0 mg were evaluated by testing the interaction between treatment group and baseline BMI subgroup. Significantly greater weight loss (0-56 weeks) was observed with liraglutide 3.0 mg versus placebo in all patient groups while on treatment. There was no evidence that the weight-lowering effect of liraglutide 3.0 mg differed between BMI subgroups (interaction p > 0.05). Similarly, for most secondary endpoints significantly greater improvements were observed with liraglutide 3.0 mg versus placebo, with no indication treatment effects differing between subgroups. The safety profile of liraglutide 3.0 mg was broadly similar across BMI subgroups. This post-hoc analysis did not indicate any differences in the treatment effects, or safety profile, of liraglutide 3.0 mg for individuals with BMI 27 to 3.0 mg can therefore be considered for individuals with a BMI of ≥35 as well as for those with a BMI of 27 to <35 kg/m². © 2017 The Author(s) Published by S. Karger GmbH, Freiburg.

Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice

NARCIS (Netherlands)

Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M

2005-01-01

The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We

Outcomes of Osteochondral Allograft Transplantation With and Without Concomitant Meniscus Allograft Transplantation: A Comparative Matched Group Analysis.

Science.gov (United States)

Frank, Rachel M; Lee, Simon; Cotter, Eric J; Hannon, Charles P; Leroux, Timothy; Cole, Brian J

2018-03-01

Osteochondral allograft transplantation (OCA) is often performed with concomitant meniscus allograft transplantation (MAT) as a strategy for knee joint preservation, although to date, the effect of concomitant MAT on outcomes and failure rates after OCA has not been assessed. To determine clinical outcomes for patients undergoing OCA with MAT as compared with a matched cohort of patients undergoing isolated OCA. Control study; Level of evidence, 3. Patients who underwent OCA of the medial or lateral femoral condyle without concomitant MAT by a single surgeon were compared with a matched group of patients who underwent OCA with concomitant MAT (ipsilateral compartment). The patients were matched per age, sex, body mass index, and number of previous ipsilateral knee operations ±1. Patient-reported outcomes, complications, reoperations, and survival rates were compared between groups. One hundred patients undergoing OCA (50 isolated, 50 with MAT) with a mean ± SD follow-up of 4.9 ± 2.7 years (minimum, 2 years) were included (age, 31.7 ± 9.8 years; 52% male). Significantly more patients underwent OCA to the medial femoral condyle (n = 59) than the lateral femoral condyle (n = 41, P OCA. There were no significant differences between the groups regarding reoperation rate (n = 18 for OCA with MAT, n = 17 for OCA without MAT, P = .834), time to reoperation (2.2 ± 2.4 years for OCA with MAT, 3.4 ± 2.7 years for OCA without MAT, P = .149), or failure rates (n = 7 [14%] for OCA with MAT, n = 7 [14%] for OCA without MAT, P > .999). There were no significant differences in patient-reported clinical outcome scores between the groups at final follow-up. There was no significant difference in failure rates between patients undergoing medial femoral condyle OCA (n = 12, 15.3%) and lateral femoral condyle OCA (n = 5, 12.2%, P = .665). These results imply that with appropriate surgical indications to address meniscus deficiency in patients otherwise indicated for OCA and

Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

Science.gov (United States)

Liu, Jiaguo; Luo, Bin; Zhao, Meng

2017-01-01

Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

Positive parenting mitigates the effects of poor self-regulation on BMI trajectories from age 4 to 15 years

Science.gov (United States)

Connell, Lauren E.; Francis, Lori A.

2014-01-01

Objective This study sought to determine whether parenting style moderated the effects of delay of gratification on BMI trajectories from age 4 to 15 years. Methods Longitudinal data were analyzed on 778 children drawn from the Study of Early Child Care and Youth Development. Parenting style (authoritative, authoritarian, permissive, neglectful) was created from measures of mothers’ sensitivity and expectations for self-control when children were age 4 years. Self-regulation was also measured at 4 years using a well-known delay of gratification protocol. BMI was calculated from measured height and weight at each time point. Mixed modeling was used to test the interaction of parenting styles and ability to delay gratification on BMI trajectories from 4 to 15 years. Results There was a significant interaction effect of parenting and ability to delay on BMI growth from 4 to 15 years for boys. Boys who had authoritarian mothers and failed to delay gratification had a significantly steeper rate of growth in BMI from childhood through adolescence than children in any other parenting x delay group. Conclusions Authoritative and permissive parenting styles were protective against more rapid BMI gains for boys who could not delay gratification. Ability to delay gratification was protective against BMI gains for boys who had parents with authoritarian or neglectful parenting styles. PMID:23977874

Harassment and Mental Distress Among Adolescent Female Students by Sexual Identity and BMI or Perceived Weight Status.

Science.gov (United States)

Johns, Michelle Marie; Lowry, Richard; Demissie, Zewditu; Robin, Leah

2017-08-01

Sexual minority girls (lesbian/bisexual) and girls with overweight/obesity experience high rates of discrimination and mental distress. This study explored whether BMI or perceived weight status might compound sexual minority girls' risk for harassment and mental distress. Data on female students from the national 2015 Youth Risk Behavior Survey (n = 7,006) were analyzed. Logistic regression was used to examine differences in bullying, harassment, and mental distress across sexual identity/BMI groups: heterosexual/normal-weight, heterosexual/overweight, sexual minority/normal-weight, and sexual minority/overweight. Procedures were repeated with four analogous groups created from sexual identity and perceived weight. Across sexual identity/BMI groups, being overweight increased heterosexual females' odds of being bullied or experiencing suicidal thoughts and behaviors. Regardless of weight status, sexual minority females had greater odds for each outcome than heterosexual females. Sexual minority females who perceived themselves as overweight had greater odds of suicidality than all other sexual minority/perceived weight groups. Double jeopardy may exist for sexual minority female students who perceive themselves as overweight. Professional development with school staff on how to create a positive climate for sexual minorities and those with overweight/obesity and addressing positive identity and body image within school-based suicide prevention efforts may be important to the well-being of adolescent girls. © 2017 The Obesity Society.

Quantitative Analysis and Comparison of BMI among Han, Tibetan, and Uygur University Students in Northwest China

Directory of Open Access Journals (Sweden)

Bai Jingya

2013-01-01

Full Text Available Objectives. To fully analyze and compare BMI among Han, Tibetan, and Uygur university students, to discuss the differences in their physical properties and physical health, and thus to provide some theoretical suggestions for the improvement of students’ physical health. Methods. The cross-sectional random cluster sampling was used to investigate 10103 Han, Tibetan, and Uygur university students, aged 20–24 in Northwest China, and their height and weight were measured to calculate BMI. The BMI classification criteria for Chinese established by Work Group on Obesity in China (WGOC were used for screening. Results. Han, Tibetan, and Uygur university students show low obesity rates but high overweight rates. Han, Tibetan, and Uygur university students present a high rate of underweight, normal weight, and overweight, respectively. Female Han students show higher underweight and normal weight rates, but lower overweight and obesity rates, than male Han students. Female Tibetan students show higher normal weight rate, but lower overweight and obesity rates, than male Tibetan students. BMI increases with age for male students but decreases with age for female students. Male Uygur students show higher obesity rate than female Uygur students. Tibetan and Uygur university students have higher BMI than other minorities in South China.

Quantitative Analysis and Comparison of BMI among Han, Tibetan, and Uygur University Students in Northwest China

Science.gov (United States)

Jingya, Bai; Ye, He; Jing, Wang; Xi, Huanjiu; Tao, Hai

2013-01-01

Objectives. To fully analyze and compare BMI among Han, Tibetan, and Uygur university students, to discuss the differences in their physical properties and physical health, and thus to provide some theoretical suggestions for the improvement of students' physical health. Methods. The cross-sectional random cluster sampling was used to investigate 10103 Han, Tibetan, and Uygur university students, aged 20–24 in Northwest China, and their height and weight were measured to calculate BMI. The BMI classification criteria for Chinese established by Work Group on Obesity in China (WGOC) were used for screening. Results. Han, Tibetan, and Uygur university students show low obesity rates but high overweight rates. Han, Tibetan, and Uygur university students present a high rate of underweight, normal weight, and overweight, respectively. Female Han students show higher underweight and normal weight rates, but lower overweight and obesity rates, than male Han students. Female Tibetan students show higher normal weight rate, but lower overweight and obesity rates, than male Tibetan students. BMI increases with age for male students but decreases with age for female students. Male Uygur students show higher obesity rate than female Uygur students. Tibetan and Uygur university students have higher BMI than other minorities in South China. PMID:24453807

Physical activity modifies the FTO effect on BMI change in Japanese adolescents.

Science.gov (United States)

Shinozaki, Keiko; Okuda, Masayuki; Okayama, Naoko; Kunitsugu, Ichiro

2018-04-14

Evidence of the effects of fat mass and obesity-associated (FTO) gene variation and long-term effects of physical activity (PA) on adiposity in adolescents is largely scarce. This study aimed to investigate whether physical activity modulates the effects of the FTO gene on body mass index (BMI) changes in Japanese adolescents between the ages of 13 and 18 years. Data of 343 subjects (156 boys; 187 girls) who were enrolled in 2006 and 2007 from schools on Shunan City, Japan, were collected. Genotyping (rs1558902) was conducted, and anthropometric measurements and blood test results were recorded for subjects in the eighth grade. A second survey involving self-reporting of anthropometric measurements was conducted when the subjects were in the twelfth grade. PA was estimated using the International Physical Activity Questionnaire in this survey. BMI and the standard deviation score for BMI (BMI-SDS) were calculated. BMI changes and BMI-SDS changes were compared among FTO genotypes using a multivariate model. The effect of the interaction between PA and the FTO genotype on BMI changes was significant among boys but not girls. Among boys, PA had a significant negative influence on BMI-SDS changes in those with the AA genotype and a significant positive influence on BMI and BMI-SDS changes in those with the TT genotype. These data suggest that the influence of PA on BMI changes and BMI-SDS changes varied on the basis of genotype. PA modified the effect of the FTO gene on BMI changes in Japanese boys. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Definition of new cut-offs of BMI and waist circumference based on body composition and insulin resistance: differences between children, adolescents and adults.

Science.gov (United States)

Hübers, M; Pourhassan, M; Braun, W; Geisler, C; Müller, M J

2017-09-01

This study aims to determine associations between anthropometric traits, regional fat depots and insulin resistance in children, adolescents and adults to define new cut-offs of body mass index (BMI) or waist circumference (WC). Cross-sectional data were assessed in 433 children, adolescents and adults (aged: 6-60 years, BMI: 23.6 [21.0-27.7] kg m -2 ). Total adipose tissue (TAT), regional subcutaneous adipose tissue (SAT total , SAT trunk ) and visceral adipose tissue (VAT) were determined by whole-body magnetic resonance imaging, fat mass by air-displacement plethysmography. Insulin resistance was evaluated by homeostasis model assessment of insulin resistance (HOMA-IR). Bivariate as well as partial correlations and regression analyses were used. Cut-off values of BMI and WC related to regional fat depots and HOMA-IR were analysed by receiver operating characteristics curve. In adults, TAT, SAT total and SAT trunk increased linearly with increasing BMI and WC, whereas they followed a cubic function in children and adolescents with a steep increase at BMI and WC ≥1 standard deviation score and VAT at WC ≥2 standard deviation score. Sex differences were apparent in adults with women having higher masses of TAT and SAT and men having higher VAT. Using established BMI or WC cut-offs, correspondent masses of TAT, SAT total , SAT trunk and VAT increased from childhood to adulthood. In all age groups, there were positive associations between BMI, WC, SAT trunk , VAT and HOMA-IR. When compared with normative cut-offs of BMI or WC, HOMA-IR-derived cut-offs of regional fat depots were lower in all age groups. Associations between BMI, WC and regional fat depots varied between children, adolescents, young and older adults. When compared with BMI-derived and WC-derived values, an insulin resistance-derived cut-off corresponded to lower masses of regional fat depots. Thus, established BMI and WC cut-offs are not appropriate to assess metabolic disturbances associated

SHAM beyond clustering: new tests of galaxy–halo abundance matching with galaxy groups

Energy Technology Data Exchange (ETDEWEB)

Hearin, Andrew P.; Zentner, Andrew R.; Berlind, Andreas A.; Newman, Jeffrey A.

2013-05-27

We construct mock catalogs of galaxy groups using subhalo abundance matching (SHAM) and undertake several new tests of the SHAM prescription for the galaxy-dark matter connection. All SHAM models we studied exhibit significant tension with galaxy groups observed in the Sloan Digital Sky Survey (SDSS). The SHAM prediction for the field galaxy luminosity function (LF) is systematically too dim, and the group galaxy LF systematically too bright, regardless of the details of the SHAM prescription. SHAM models connecting r-band luminosity, Mr, to Vacc, the maximum circular velocity of a subhalo at the time of accretion onto the host, faithfully reproduce galaxy group abundance as a function of richness, g(N). However, SHAM models connecting Mr with Vpeak, the peak value of Vmax over the entire merger history of the halo, over-predict galaxy group abundance. Our results suggest that no SHAM model can simultaneously reproduce the observed g(N) and two-point projected galaxy clustering. Nevertheless, we also report a new success of SHAM: an accurate prediction for Phi(m12), the abundance of galaxy groups as a function of magnitude gap m12, defined as the difference between the r-band absolute magnitude of the two brightest group members. We show that it may be possible to use joint measurements of g(N) and Phi(m12) to tightly constrain the details of the SHAM implementation. Additionally, we show that the hypothesis that the luminosity gap is constructed via random draws from a universal LF provides a poor description of the data, contradicting recent claims in the literature. Finally, we test a common assumption of the Conditional Luminosity Function (CLF) formalism, that the satellite LF need only be conditioned by the brightness of the central galaxy. We find this assumption to be well-supported by the observed Phi(m12).

The impact of sleep-disordered breathing on body mass index (BMI: the sleep heart health study (SHHS

Directory of Open Access Journals (Sweden)

Robbins JA

2011-12-01

Full Text Available Introduction: It is well known that obesity is a risk factor for sleep-disordered breathing (SDB. However, whether SDB predicts increase in BMI is not well defined. Data from the Sleep Heart Health Study (SHHS were analyzed to determine whether SDB predicts longitudinal increase in BMI, adjusted for confounding factors.Methods: A full-montage unattended home polysomnogram (PSG and body anthropometric measurements were obtained approximately five years apart in 3001 participants. Apnea-hypopnea index (AHI was categorized using clinical thresholds: < 5 (normal, ≥ 5 to <15 (mild sleep apnea, and ³ 15 (moderate to severe sleep apnea. Linear regression was used to examine the association between the three AHI groups and increased BMI. The model included age, gender, race, baseline BMI, and change in AHI as covariates.Results: Mean (SD age was 62.2 years (10.14, 55.2% were female and 76.1% were Caucasian. Five-year increase in BMI was modest with a mean (SD change of 0.53 (2.62 kg/m2 (p=0.071. A multivariate regression model showed that subjects with a baseline AHI between 5-15 had a mean increase in BMI of 0.22 kg/m2 (p=0.055 and those with baseline AHI ≥ 15 had a BMI increase of 0.51 kg/m2 (p<0.001 compared to those with baseline AHI of <5.Conclusion: Our findings suggest that there is a positive association between severity of SDB and subsequent increased BMI over approximately 5 years. This observation may help explain why persons with SDB have difficulty losing weight.

Smoking and BMI as a risk factor of cardiovascular disease at a doctors in Tuzla canton

Directory of Open Access Journals (Sweden)

Merisa Imamović Kuluglić

2012-09-01

Full Text Available Introduction: Cardiovascular diseases are becoming the leading social and medical problem of civilization, given the trend indicates an increase of morbidity, disability and mortality from this diseases. The aim ofour study was to determine the frequency of smoking and increased BMI, as a risk factor for cardiovascular disease in doctors in the Tuzla Canton and correlate values of BMI by the doctor smokers and nonsmokers.Methods: The study was conducted in 13 medical centers in the area of Tuzla canton in the second quarter of 2009. Two groups were formed by randomization of 150 doctors non-smokers and 150 doctors smokersfrom a total of 366 doctors of both sexes, age over 25 years. The study involved doctors who smoke tobacco 5 or more years. The methods of anthropometric measurements and questionnaires were used in study.Results: The results showed that the total number of doctors surveyed, 44.81% were smokers, with more women smokers (28.7% than men (21.3% smokers (p=0.011. We found that there is a signifi cant statistical difference between subjects with BMI higher than 25 and subjects with normal weight, in the group of smokers (p = 0.0001.Conclusion: It can be concluded that the frequency of smoking in the total number of surveyed doctors, is signifi cant. The increased value of BMI (over 25 is present in large number of subjects (with the larger percentage subjects of smokers.

Association between BMI and Dental Caries among School Children and Adolescents in Jiangsu Province, China.

Science.gov (United States)

Li, Wei; Hussein Musa, Taha; Gao, Rong; Li, Xiao Shan; Wang, Wei Xiang; Hong, Lei; Wei, Ping Min

2017-10-01

Obesity and dental caries are increasing epidemics, especially among children and adolescents. This epidemiological observational cross-sectional study was conducted to assess the possible association between body mass index (BMI) and dental caries among 111,792 school children and adolescents in Jiangsu Province. We found that 13.14% participants of the study sample were overweight, and 7.37% were obese. The prevalence of dental caries was 12.95% in overweight and 7.89% in obese students. There were significant differences in caries prevalence by sex, region, age group, and BMI. Overweight and obesity statuses were associated with dental caries among the study population. BMI and dental caries present a continuous health problem. Thus, we recommend that oral health promotion be used for caries prevention and control. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons.

Directory of Open Access Journals (Sweden)

Mohamed Abdouh

Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.

Raised BMI cut-off for overweight in Greenland Inuit--a review.

Science.gov (United States)

Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter

2013-01-01

Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m(2) in Greenland Inuit may overestimate the number of individuals with elevated BMI.

Secular and race/ethnic trends in glycemic outcomes by BMI in US adults: The role of waist circumference.

Science.gov (United States)

Albrecht, Sandra S; Mayer-Davis, Elizabeth; Popkin, Barry M

2017-07-01

For the same body mass index (BMI) level, waist circumference (WC) is higher in more recent years. How this impacts diabetes and prediabetes prevalence in the United States and for different race/ethnic groups is unknown. We examined prevalence differences in diabetes and prediabetes by BMI over time, investigated whether estimates were attenuated after adjusting for waist circumference, and evaluated implications of these patterns on race/ethnic disparities in glycemic outcomes. Data came from 12 614 participants aged 20 to 74 years from the National Health and Nutrition Examination Surveys (1988-1994 and 2007-2012). We estimated prevalence differences in diabetes and prediabetes by BMI over time in multivariable models. Relevant interactions evaluated race/ethnic differences. Among normal, overweight, and class I obese individuals, there were no significant differences in diabetes prevalence over time. However, among individuals with class II/III obesity, diabetes prevalence rose 7.6 percentage points in 2007-2012 vs 1988-1994. This estimate was partly attenuated after adjustment for mean waist circumference but not mean BMI. For prediabetes, prevalence was 10 to 13 percentage points higher over time at lower BMI values, with minimal attenuation after adjustment for WC. All patterns held within race/ethnic groups. Diabetes disparities among blacks and Mexican Americans relative to whites remained in both periods, regardless of BMI, and persisted after adjustment for WC. Diabetes prevalence rose over time among individuals with class II/III obesity and may be partly due to increasing waist circumference. Anthropometric measures did not appear to account for temporal increases in prediabetes, nor did they attenuate race/ethnic disparities in diabetes. Reasons underlying these trends require further investigation. Copyright © 2017 John Wiley & Sons, Ltd.

Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency

Directory of Open Access Journals (Sweden)

Anthony Flamier

2018-05-01

Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.

BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.

Science.gov (United States)

Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian

2010-02-21

The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.

Intuitive eating: associations with physical activity motivation and BMI.

Science.gov (United States)

Gast, Julie; Campbell Nielson, Amy; Hunt, Anne; Leiker, Jason J

2015-01-01

To determine whether university women who demonstrated internal motivation related to eating behavior may also be internally motivated to participate in regular physical activity (PA) and have a lower body mass index (BMI) when controlling for age. Traditional approaches for health promotion related to healthy weight include restrictive eating and exercise prescription. Examining motivation for eating and PA may prove an effective alternative for achieving or maintaining healthy weight for university women. Design was a cross-sectional study. Study setting was a large, public university in the western United States. Subjects . Study subjects were 200 undergraduate women with a mean age of 19 years, mostly white (90%) and of healthy weight (69%, with a BMI range of 18.5-24.9). Study measures were the Intuitive Eating Scale and the Behavioral Regulation in Exercise Questionnaire. Correlations and regression models were used. Intuitive eating was examined in the sample as a whole and among subgroups of respondents grouped based on tertile rankings of intuitive eating scores. There was evidence that women who demonstrated internal motivation related to eating were also internally motivated to participate in regular PA. Women who reported being internally motivated to eat were significantly more likely to engage in PA for pleasure and to view PA as part of their self-concept. Women who reported high levels of intuitive eating had significantly lower BMI scores than those reporting medium or low levels when controlling for age. For women to achieve or maintain a healthy weight, it may be best for health professionals to examine motivation for eating and PA rather than the encouragement of restrictive eating and exercise prescriptions.

History of preeclampsia is more predictive of cardiometabolic and cardiovascular risk factors than obesity.

Science.gov (United States)

Heidema, Wieteke M; Scholten, Ralph R; Lotgering, Fred K; Spaanderman, Marc E A

2015-11-01

To determine to what extent a history of preeclampsia affects traditional cardiometabolic (insulin resistance and dyslipidemia) and cardiovascular (hypertension and micro-albuminuria) risk factors of the metabolic syndrome irrespective of BMI. In a retrospective case-control study we compared 90 formerly preeclamptic women, divided in 3 BMI-classes (BMI 19.5-24.9, 25.0-29.9, ≥30.0kg/m(2)) to 30 controls, matched for BMI, age and parity. Cardiometabolic and cardiovascular risk factors (WHO-criteria) were tested 6-18 months post partum. Statistical analysis included unpaired t-tests, Mann-Whitney U test, or Chi square test and two-way ANOVA. Constituents of the metabolic syndrome (glucose, insulin, HOMAIR, HDL-cholesterol, triglycerides, blood pressure, micro-albuminuria) were higher in formerly preeclamptic women than in BMI-matched controls. Resultantly, traditional risk factors were more prevalent in formerly preeclamptic women than in controls (insulin resistance 80% vs 30%, dyslipidemia 52% vs 3%, hypertension 24% vs 0%, micro-albuminuria 30% vs 0%). Cardiometabolic risk factors increased with BMI, to the same extent in both groups. Formerly preeclamptic women had metabolic syndrome more often than their BMI-matched controls (38% vs 3%, p<0.001). Traditional risk factors of the metabolic syndrome are more prevalent in formerly preeclamptic women than in BMI-matched controls and increase with BMI to the same extent in both groups. A history of preeclampsia seems to be a stronger indicator of cardiovascular risk than obesity per se. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

[Estimation of the population attributable fraction due to obesity in hospital admissions for flu valued according to Body Mass Index (BMI) and CUN-BAE].

Science.gov (United States)

Dávila-Batista, V; Carriedo, D; Díez, F; Pueyo Bastida, A; Martínez Durán, B; Martin, V

2018-03-01

The obesity pandemic together with the influenza pandemic could lead to a significant burden of disease. The body mass index (BMI) does not discriminate obesity appropriately. The CUN-BAE has recently been used as an estimate of body fatness for Caucasians, including BMI, gender, and age. The aim of this study is to assess the population attributable fraction of hospital admissions due to influenza, due to the body fatness measured with the BMI, and the CUN-BAE. A multicentre study was conducted using matched case-controls. Cases were hospital admissions with the influenza confirmed by the RT-PCR method between 2009 and 2011. The risk of hospital admission and the population attribuible fraction were calculated using the BMI or the CUN-BAE for each adiposity category in a conditional logical regression analysis adjusted for confounding variables. The analyzes were estimated in the total sample, in unvaccinated people, and those less than 65 years-old. A total of 472 hospitalised cases and 493 controls were included in the study. Compared to normal weight, the aOR of influenza hospital admissions increases with each level of BMI (aOR=1.26; 2.06 and 11.64) and CUN-BAE (aOR=2.78; 4.29; 5.43 and 15.18). The population attributable fraction of influenza admissions using CUN-BAE is 3 times higher than that estimated with BMI (0,72 vs. 0,27), with the differences found being similar the non-vaccinated and under 65 year-olds. The BMI could be underestimating the burden of disease attributable to obesity in individuals hospitalised with influenza. There needs to be an appropriate assessment of the impact of obesity and vaccine recommendation criteria. Copyright © 2017 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.

Bidirectional associations between mothers' and fathers' parenting consistency and child BMI.

Science.gov (United States)

Jansen, Pauline W; Giallo, Rebecca; Westrupp, Elizabeth M; Wake, Melissa; Nicholson, Jan M

2013-12-01

Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. Participants were 4002 children and their parents in the population-based Longitudinal Study of Australian Children. Mothers and fathers self-reported parenting consistency, and children's BMI was measured at 4 biennial waves starting at age 4 to 5 years in 2004. Bidirectionality between parenting and child BMI was examined by using regression analyses in cross-lagged models. The best-fitting models indicated a modest influence from parenting to child BMI, whereas no support was found for bidirectional influences. For mothers, higher levels of parenting consistency predicted lower BMI in children from Waves 1 to 2 and 3 to 4; for example, for every SD increase in mothers' parenting consistency at Wave 1, child BMIz fell by 0.025 in Wave 2 (95% confidence interval: -0.05 to -0.003). For fathers, higher levels of parenting consistency were associated with lower child BMI from Waves 1 to 2 and 2 to 3. Parenting inconsistency of mothers and fathers prospectively predicted small increases in offspring BMI over 2-year periods across middle childhood. However, child BMI did not appear to influence parenting behavior. These findings support recent calls for expanding childhood overweight interventions to address the broad parenting context while involving both mothers and fathers.

The Role of BMI1 in CRPC

Science.gov (United States)

2016-10-01

we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

Gene-diet interaction effects on BMI levels in the Singapore Chinese population.

Science.gov (United States)

Chang, Xuling; Dorajoo, Rajkumar; Sun, Ye; Han, Yi; Wang, Ling; Khor, Chiea-Chuen; Sim, Xueling; Tai, E-Shyong; Liu, Jianjun; Yuan, Jian-Min; Koh, Woon-Puay; van Dam, Rob M; Friedlander, Yechiel; Heng, Chew-Kiat

2018-02-24

Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population. We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies. Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10 - 15 ) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP interaction  = 0.043). The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.

Greater Glycaemic Response to an Oral Glucose Load in Healthy, Lean, Active and Young Chinese Adults Compared to Matched Caucasians

Directory of Open Access Journals (Sweden)

Trevor Simper

2018-04-01

Full Text Available There are ethnic differences recorded in glycaemic response and rates of type 2 diabetes mellitus (DM between Chinese and Caucasian populations. Whether these differences are evident in matched healthy, lean, active, young adults is unclear. This study compares the postprandial glycaemic response of a group of Chinese participants (n = 49 with a group of similar Caucasians, (n = 48 aged 23.8 (±4.35 years, body mass index (BMI 22.7 (±2.6 kg/m2, healthy (free from non-communicable disease, and lean (body fat % 23.28% (±5.04. Participants undertook an oral glucose tolerance test to identify any significant differences in postprandial blood glucose response. Body fat percentage, body mass, age, physical activity, baseline glucose and HbA1c did not significantly differ between groups. Data from food frequency questionnaires indicated that the Chinese participants consumed less starchy foods, candy and “other” sweets and sugary drinks, and more rice than the Caucasians (all p ≤ 0.001, but not a greater overall intake of carbohydrates or any other macronutrient (all p > 0.05. The two groups’ postprandial blood glucose responses and 2-h incremental area under the curve values (iAUC—156.67 (74.12 mmol/L 120 min for Caucasians versus 214.03 (77.49 mmol/L 120 min for Chinese—indicate significant differences (p = 0.003 and p < 0.001 respectively between groups. Findings suggest that the difference between the two groups’ iAUC values do not relate to obvious lifestyle factors. The Chinese group were eating the least sugary and starchy food but had the highest iAUC. It is argued that the Chinese group in this investigation have the most favourable BMI, body fat percentage, and body mass, yet “poorest” glycaemic response.

Reduction of radiation exposure and improvement of image quality with BMI-adapted prospective cardiac computed tomography and iterative reconstruction

International Nuclear Information System (INIS)

Hosch, Waldemar; Stiller, Wolfram; Mueller, Dirk; Gitsioudis, Gitsios; Welzel, Johanna; Dadrich, Monika; Buss, Sebastian J.; Giannitsis, Evangelos; Kauczor, Hans U.; Katus, Hugo A.; Korosoglou, Grigorios

2012-01-01

Purpose: To assess the impact of body mass index (BMI)-adapted protocols and iterative reconstruction algorithms (iDose) on patient radiation exposure and image quality in patients undergoing prospective ECG-triggered 256-slice coronary computed tomography angiography (CCTA). Methods: Image quality and radiation exposure were systematically analyzed in 100 patients. 60 Patients underwent prospective ECG-triggered CCTA using a non-tailored protocol and served as a ‘control’ group (Group 1: 120 kV, 200 mA s). 40 Consecutive patients with suspected coronary artery disease (CAD) underwent prospective CCTA, using BMI-adapted tube voltage and standard (Group 2: 100/120 kV, 100–200 mA s) versus reduced tube current (Group 3: 100/120 kV, 75–150 mA s). Iterative reconstructions were provided with different iDose levels and were compared to filtered back projection (FBP) reconstructions. Image quality was assessed in consensus of 2 experienced observers and using a 5-grade scale (1 = best to 5 = worse), and signal- and contrast-to-noise ratios (SNR and CNR) were quantified. Results: CCTA was performed without adverse events in all patients (n = 100, heart rate of 47–87 bpm and BMI of 19–38 kg/m 2 ). Patients examined using the non-tailored protocol in Group 1 had the highest radiation exposure (3.2 ± 0.4 mSv), followed by Group 2 (1.7 ± 0.7 mSv) and Group 3 (1.2 ± 0.6 mSv) (radiation savings of 47% and 63%, respectively, p < 0.001). Iterative reconstructions provided increased SNR and CNR, particularly when higher iDose level 5 was applied with Multi-Frequency reconstruction (iDose5 MFR) (14.1 ± 4.6 versus 21.2 ± 7.3 for SNR and 12.0 ± 4.2 versus 18.1 ± 6.6 for CNR, for FBP versus iDose5 MFR, respectively, p < 0.001). The combination of BMI adaptation with iterative reconstruction reduced radiation exposure and simultaneously improved image quality (subjective image quality of 1.4 ± 0.4 versus 1.9 ± 0.5 for Group 2 reconstructed using iDose5 MFR versus

Self-control mediates the relationship between time perspective and BMI.

Science.gov (United States)

Price, Menna; Higgs, Suzanne; Lee, Michelle

2017-01-01

Trait future time perspective measures the extent to which behaviour is dominated by a striving for future goals and rewards. Trait present time perspective measures orientation towards immediate pleasure. Previous research has explored the relationship between future and present time perspective and BMI with mixed findings. In addition, the psychological mechanism underlying this relationship is unclear. Self-control is a likely candidate, as it has been related to both BMI and time perspective, but the relationship between all of these concepts has not been examined in a single study. Therefore, the aim of this study was to examine if trait self-control mediates the relationship between time perspective (future and present) and BMI. Self-report time perspective (ZTPI), self-control (SCS) and height/weight data were collected using an online survey from a mixed student and community sample (N = 218) with wide ranging age (mean 29, SD 11, range 18-73 years) and BMI (mean 24, SD 4, range 15-43). The results of a structural equation model including both facets of time perspective suggested that the traits are related yet distinct measures that independently predict BMI through changes in self-control. Bootstrap mediation analysis showed that self-control mediated the relationship between both future time perspective (95% CI, -0.10 to -0.02) and present time perspective (95% CI, 0.03 to 0.17), and BMI in opposite directions. Participants with higher future time perspective scores (higher present time perspective scores) had higher (lower) self-control, which predicted lower (higher) BMI. These results are consistent with previous research suggesting an important role for time perspective in health outcomes. Self-control likely mediates the relationship between temporal perspectives and BMI, suggesting that time perspective may be a target for individualised interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients

Directory of Open Access Journals (Sweden)

Xiaodong Li

2016-11-01

Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.

The associations of Bmi-1 with progression of glomerular chronic kidney disease
.

Science.gov (United States)

Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren

2018-02-01

Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings.
.

Alternative regression models to assess increase in childhood BMI.

Science.gov (United States)

Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M

2008-09-08

Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.

Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma

International Nuclear Information System (INIS)

Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua

2010-01-01

Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis

Dinner rituals that correlate with child and adult BMI.

Science.gov (United States)

Wansink, Brian; van Kleef, Ellen

2014-05-01

What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.

Impact of baseline BMI and weight change in CCTG adjuvant breast cancer trials.

Science.gov (United States)

Yerushalmi, R; Dong, B; Chapman, J W; Goss, P E; Pollak, M N; Burnell, M J; Levine, M N; Bramwell, V H C; Pritchard, K I; Whelan, T J; Ingle, J N; Shepherd, L E; Parulekar, W R; Han, L; Ding, K; Gelmon, K A

2017-07-01

We hypothesized that increased baseline BMI and BMI change would negatively impact clinical outcomes with adjuvant breast cancer systemic therapy. Data from chemotherapy trials MA.5 and MA.21; endocrine therapy MA.12, MA.14 and MA.27; and trastuzumab HERA/MA.24 were analyzed. The primary objective was to examine the effect of BMI change on breast cancer-free interval (BCFI) landmarked at 5 years; secondary objectives included BMI changes at 1 and 3 years; BMI changes on disease-specific survival (DSS) and overall survival (OS); and effects of baseline BMI. Stratified analyses included trial therapy and composite trial stratification factors. In pre-/peri-/early post-menopausal chemotherapy trials (N = 2793), baseline BMI did not impact any endpoint and increased BMI from baseline did not significantly affect BCFI (P = 0.85) after 5 years although it was associated with worse BCFI (P = 0.03) and DSS (P = 0.07) after 1 year. BMI increase by 3 and 5 years was associated with better DSS (P = 0.01; 0.01) and OS (P = 0.003; 0.05). In pre-menopausal endocrine therapy trial MA.12 (N = 672), patients with higher baseline BMI had worse BCFI (P = 0.02) after 1 year, worse DSS (P = 0.05; 0.004) after 1 and 5 years and worse OS (P = 0.01) after 5 years. Increased BMI did not impact BCFI (P = 0.90) after 5 years, although it was associated with worse BCFI (P = 0.01) after 1 year. In post-menopausal endocrine therapy trials MA.14 and MA.27 (N = 8236), baseline BMI did not significantly impact outcome for any endpoint. BMI change did not impact BCFI or DSS after 1 or 3 years, although a mean increased BMI of 0.3 was associated with better OS (P = 0.02) after 1 year. With the administration of trastuzumab (N = 1395) baseline BMI and BMI change did not significantly impact outcomes. Higher baseline BMI and BMI increases negatively affected outcomes only in pre-/peri-/early post-menopausal trial patients. Otherwise, BMI

The relation between anxiety and BMI - is it all in our curves?

Science.gov (United States)

Haghighi, Mohammad; Jahangard, Leila; Ahmadpanah, Mohammad; Bajoghli, Hafez; Holsboer-Trachsler, Edith; Brand, Serge

2016-01-30

The relation between anxiety and excessive weight is unclear. The aims of the present study were three-fold: First, we examined the association between anxiety and Body Mass Index (BMI). Second, we examined this association separately for female and male participants. Next, we examined both linear and non-linear associations between anxiety and BMI. The BMI was assessed of 92 patients (mean age: M=27.52; 57% females) suffering from anxiety disorders. Patients completed the Beck Anxiety Inventory. Both linear and non-linear correlations were computed for the sample as a whole and separately by gender. No gender differences were observed in anxiety scores or BMI. No linear correlation between anxiety scores and BMI was observed. In contrast, a non-linear correlation showed an inverted U-shaped association, with lower anxiety scores both for lower and very high BMI indices, and higher anxiety scores for medium to high BMI indices. Separate computations revealed no differences between males and females. The pattern of results suggests that the association between BMI and anxiety is complex and more accurately captured with non-linear correlations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Body size estimation of self and others in females varying in BMI.

Directory of Open Access Journals (Sweden)

Anne Thaler

Full Text Available Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI, on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1, but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a. The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

Body size estimation of self and others in females varying in BMI.

Science.gov (United States)

Thaler, Anne; Geuss, Michael N; Mölbert, Simone C; Giel, Katrin E; Streuber, Stephan; Romero, Javier; Black, Michael J; Mohler, Betty J

2018-01-01

Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI), on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations) represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1), but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a). The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

Associations between Three School-Based Measures of Health: Is BMI Enough?

Science.gov (United States)

Morgan, Emily H.; Houser, Robert F.; Au, Lauren E.; Sacheck, Jennifer M.

2013-01-01

School-based body mass index (BMI) notification programs are often used to raise parental awareness of childhood overweight and obesity, but how BMI results are associated with physical fitness and diet is less clear. This study examined the relationship between BMI, fitness, and diet quality in a diverse sample of urban schoolchildren…

Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells

Energy Technology Data Exchange (ETDEWEB)

Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)

2012-08-24

Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.

ATLANTIC-DIP: raised maternal body mass index (BMI) adversely affects maternal and foetal outcomes in glucose tolerant women classified using International Association of Diabetes and Pregnancy Study Groups (IADPSG) criteria

LENUS (Irish Health Repository)

Dennedy, MC

2011-09-15

Background and aims: Raised maternal body mass index (BMI), in association with hyperglycaemia is associated with adverse pregnancy outcome. Whether BMI has an independent effect on adverse pregnancy outcome is not clear. We aimed to investigate the effects of raised maternal BMI on pregnancy outcome in glucose tolerant women, classified using the IADPSG criteria.\\r\

Trends in physical activity, sedentary behavior, diet, and BMI among US adolescents, 2001-2009.

Science.gov (United States)

Iannotti, Ronald J; Wang, Jing

2013-10-01

The high prevalence of adolescent obesity in the United States has been attributed to population changes in physical activity (PA), sedentary behaviors, and dietary behaviors. This study examines 8-year trends in these behaviors in US adolescents ages 11 to 16. Nationally representative samples of US students in grades 6 to 10 were recruited during the 2001-2002 (N = 14607), 2005-2006 (N = 9150), and 2009-2010 (N = 10848) school years by using multistage stratified designs, with census regions and grades as strata, and school districts as the primary sampling units. African-American and Hispanic students were oversampled to obtain better estimates for those groups. Using the Health Behavior in School-aged Children quadrennial surveys, identical questions assessed BMI, PA, and sedentary and dietary behaviors at each school year. Logistic and linear regression analyses were conducted taking into account the sampling design and controlling for age, gender, race/ethnicity, and family affluence. Across the quadrennial surveys, significant increases were identified in number of days with at least 60 minutes of PA, daily consumption of fruits and vegetables, eating breakfast on weekdays and weekends, and BMI. Television viewing and consumption of sweets and sweetened beverages decreased across this same period. These same patterns were seen in all racial/ethnic groups. These patterns suggest that public health efforts to improve the obesity-related behaviors of US adolescents may be having some success. However, alternative explanations for the increase in BMI over the same period need to be considered.

BMI is not a good indicator for metabolic risk in adolescent girls

Science.gov (United States)

BMI (kg/m2) does not provide information about body fat percentile.Adolescents with BMI girls with low BMI can have high body fat percentile. We hypothesized that these girls are already insulin resi...

Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?

Science.gov (United States)

Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J

2017-05-01

We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.

Assessment of Body Mass Index (BMI in 6-11 Years Old Primary School Children in Tabriz City, Iran

Directory of Open Access Journals (Sweden)

Nazila Farrin

2016-06-01

Full Text Available Background and Objectives: The prevalence of childhood overweight and obesity has been increasingly growing in many societies. The present study aimed to determine body mass index (BMI in primary school boys and girls in Tabriz city. Methods: This descriptive cross-sectional study was conducted on 857 primary school students of Tabriz city in 2012-2013. First, BMI of each person was calculated, and according to the NCHS standard curves, the values below the 5th percentile were considered as malnutrition and underweight, between the 85th-95th percentiles as overweight, and equal to or above the 95th percentile as obesity. Data were analyzed by one-sample t-test and t-test. The significance level was considered to be p<0.05. Results: According to the BMI data, the frequency of underweight, overweight, and obesity in the male students, were 20.9, 5.5, and 3.1%, and in female students were 18.8, 9.7, 0.9%, and in the total number of students were 20.1, 7.4, and 2.1%, respectively. Compared to the 50th percentile, the mean BMI in male students in the age group of 9 years was higher (p<0.01 and in the age group of 6 years was lower (p<0.05. This comparison in the female students indicated higher mean BMI in the age groups of 7, 9, 10, and 11 years compared to the 50th percentile (p<0.05. The frequency of overweight among female students (9.7% was higher than male students (5.5%. However, the frequency of obesity in the male students was approximately 3.5 times higher than female students (p<0.05. Conclusion: Given the existence of both malnutrition states of underweight and obesity in the students and also the significant effect of childhood body weight on chronic disorders in adulthood, proper nutrition planning is necessary at the school level.

Relation between Mammographic Parenchymal Patterns and Breast Cancer Risk: Considering BMI, Compressed Breast Thickness and Age of Women in Tabriz, Iran.

Science.gov (United States)

Mehnati, Parinaz; Alizadeh, Hamed; Hoda, Haleh

2016-01-01

Mammographic density determined according paranchymal patterns is a risk factor for breast cancer and its relationships with body and other breast characteristics of women is important. The purpose of the present study was to correlate breast parenchymal patterns and mammography abnormality findings with women's BMI, compressed breast thickness (CBT) and age in Tabriz city, Iran. From 1,100 mammograms interpreted by radiologists, breast parenchymal was classified into four categories from Types 1 (mostly fatty) through 4 (mostly fibroglandular tissue). Age, BMI, and CBT were recorded and their relation with risk for the development of breast abnormalities in mammograms was analyzed. In women with a mean age of 45.8±8.63 years 17.7% were in the high density group (Type 3 and 4). A comparison of four types of breast paranchymal with BMI, CBT and age showed inverse relations to breast density. Abnormal mammographic findings were 25.8% of all reported mammograms with a circular mass (12.7%) as the most common abnormality. About 21% abnormal cases were in less than 40 years. Increasing of BMI had significant relation with breast abnormality but in CBT was not observed. Measurement of women's body characteristics is useful for assistance in mammography diagnosis as well as selection of imaging instrument by high sensitivity for following patient in future. The effects of age, CBT and BMI groups on the breast paranchymal were significant.

BMI may underestimate the socioeconomic gradient in true obesity

NARCIS (Netherlands)

van den Berg, G.; van Eijsden, M.; Vrijkotte, T. G. M.; Gemke, R. J. B. J.

2013-01-01

Body mass index (BMI) does not make a distinction between fat mass and lean mass. In children, high fat mass appears to be associated with low maternal education, as well as low lean mass because maternal education is associated with physical activity. Therefore, BMI might underestimate true obesity

Relationship of glycemic and triglycerides with BMI in diabetic patients

International Nuclear Information System (INIS)

Parvez, A.; Ihsanullah; Rafiq, A.; Ahmad, N.; Khan, E.H.

2010-01-01

Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

Relationship of glycemic and triglycerides with BMI in diabetic patients

Energy Technology Data Exchange (ETDEWEB)

Parvez, A; Ihsanullah,; Rafiq, A; Ahmad, N; Khan, E H [Khyber Teaching Hospital, Peshawar (Pakistan). Department of Pathology

2010-04-15

Background: Diabetes mellitus (DM) is a metabolic disorder characterised by chronic hyperglycaemia with disturbances in carbohydrate, fat and protein metabolism arising from defect in insulin secretion or action or both. The clinical guidelines recommend measurement of BMI as vital signs for evaluating the obese and diabetic patients. Methods: This study was carried out on 160 diabetics, which were divided on the basis of BMI into obese (120) and non-obese (40) diabetics from Peshawar district. All patients had their triglycerides and glucose checked after over night fast. Results: The serum triglyceride in diabetics having BMI >30 (obese) was increased as compared to patients having BMI <30 (non-obese). The comparison of serum glucose level in obese diabetics was found to be significantly raised as compared to non-obese diabetics. Conclusions and Recommendations: It was concluded that dyslipidemia is common in all diabetics. The abnormal triglyceride level can improve with good glycemic control, but do not reach the normal state. Good glycaemic control, Reducing BMI, periodic checkups of lipids and blood glucose are recommended for all diabetics in order to avoid complications. (author)

Alternative regression models to assess increase in childhood BMI

Directory of Open Access Journals (Sweden)

Mansmann Ulrich

2008-09-01

Full Text Available Abstract Background Body mass index (BMI data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs, quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS. We analyzed data of 4967 children participating in the school entry health examination in Bavaria, Germany, from 2001 to 2002. TV watching, meal frequency, breastfeeding, smoking in pregnancy, maternal obesity, parental social class and weight gain in the first 2 years of life were considered as risk factors for obesity. Results GAMLSS showed a much better fit regarding the estimation of risk factors effects on transformed and untransformed BMI data than common GLMs with respect to the generalized Akaike information criterion. In comparison with GAMLSS, quantile regression allowed for additional interpretation of prespecified distribution quantiles, such as quantiles referring to overweight or obesity. The variables TV watching, maternal BMI and weight gain in the first 2 years were directly, and meal frequency was inversely significantly associated with body composition in any model type examined. In contrast, smoking in pregnancy was not directly, and breastfeeding and parental social class were not inversely significantly associated with body composition in GLM models, but in GAMLSS and partly in quantile regression models. Risk factor specific BMI percentile curves could be estimated from GAMLSS and quantile regression models. Conclusion GAMLSS and quantile regression seem to be more appropriate than common GLMs for risk factor modeling of BMI data.

Body Mass Index (BMI) and All-Cause Mortality Pooling Project

Science.gov (United States)

The BMI and All-Cause Mortality Pooling Project quantified the risk associated with being overweight and the extent to which the relationship between BMI and all-cause mortality varies by certain factors.

Hypertension and diabetes prevalence among adults with moderately increased BMI (23·0-24·9 kg/m2): findings from a nationwide survey in Bangladesh.

Science.gov (United States)

Rahman, Muntasirur; Williams, Gail; Mamun, Abdullah Al

2017-06-01

BMI is a proxy for fat accumulation in the body. Increased diabetes and CVD risks have been observed for Asian populations at lower BMI than the WHO-recommended BMI cut-off points for overweight (≥25·0 kg/m2) and obesity (≥30·0 kg/m2). The current study aimed to quantify the increased hypertension (HTN) and type 2 diabetes mellitus (T2DM) prevalence in Bangladeshi adults with moderately increased BMI (23·0-24·9 kg/m2). Data from the most recent Bangladesh Demographic and Health Survey (2011) were analysed. Modified Poisson regression models with robust error variance were used to calculate prevalence ratios (PR) for HTN or T2DM by BMI category, considering BMI=18·5-22·9 kg/m2 as the reference. All analyses incorporated the complex sampling design of the survey. BMI, blood pressure, blood sugar and related information were collected from a nationally representative sample. Adults (n 7433) aged≥35 years. About 12 % of Bangladeshi adults, both male and female, were within the BMI range 23·0-24·9 kg/m2 or moderately overweight. Compared with the reference BMI group (18·5-22·9 kg/m2), they had an increased PR for HTN (1·55-1·77) and T2DM (1·54-1·93). These increased PR are similar to those for the WHO-defined overweight group (BMI=25·0-29·9 kg/m2). Our findings support the recommendation that calls for setting the optimum BMI for Asian populations to 18·5-23·0 kg/m2 for health promotion and for public health interventions like leisure-time physical activity. WHO cut-off points for overweight (≥25 kg/m2) should be used to facilitate international comparisons.

Maternal depression and child BMI: longitudinal findings from a US sample.

Science.gov (United States)

Duarte, C S; Shen, S; Wu, P; Must, A

2012-04-01

To examine the association between maternal depression and child body mass index (BMI) from Kindergarten (K) to fifth grade. Analysis of four waves of data from the Early Childhood Longitudinal Study - Kindergarten spanning K to fifth grade. Maternal depressive symptoms (MDSs) were measured by a brief version of the Center for Epidemiological Studies Depression scale. Data were analyzed using multiple regression analyses, adjusting for key covariates and potential confounders. The analytic sample was restricted to children of normal birth weight. The relationship between MDS and child BMI varies by child gender and age. Among girls, severe MDS at K was related to lower BMI at third grade (but not later at fifth grade) and to an increase in BMI from K to third and K to fifth grades. Among boys, severe MDS at K was related to higher boys' BMI at fifth grade. When severe MDS occurred at third grade, it was related to higher BMI at fifth grade among girls whereas no statistically significant relationship was found for boys. Low levels of physical activity in comparison to peers at fifth grade and more screen time on weekends at third grade are likely mediators of the relationship between MDS and child BMI among girls, while among boys the relationship appears to be mediated by unhealthy eating habits. Our findings, indicating developmental and gender differences in the relationship between maternal depression and child BMI, if confirmed, suggest that interventions addressing maternal depression may have concomitant impact on childhood obesity. © 2012 The Authors. Pediatric Obesity © 2012 International Association for the Study of Obesity.

Infant BMI peak, breastfeeding, and body composition at age 3 y

DEFF Research Database (Denmark)

Jensen, Signe Marie; Ritz, Christian; Ejlerskov, Katrine Tschentscher

2015-01-01

BACKGROUND: With the increasing focus on obesity, growth patterns in infancy and early childhood have gained much attention. Although the adiposity rebound has been in focus because of a shown association with adult obesity, not much has been published about the infant peak in body mass index (BMI......) cohort were used to estimate BMI growth curves for the age span from 14 d to 19 mo by using a nonlinear mixed-effects model. BMI growth velocity before peak and age and BMI at peak were derived from the subject-specific models. Information about pregnancy and breastfeeding was assessed from background...

Differential models of twin correlations in skew for body-mass index (BMI).

Science.gov (United States)

Tsang, Siny; Duncan, Glen E; Dinescu, Diana; Turkheimer, Eric

2018-01-01

Body Mass Index (BMI), like most human phenotypes, is substantially heritable. However, BMI is not normally distributed; the skew appears to be structural, and increases as a function of age. Moreover, twin correlations for BMI commonly violate the assumptions of the most common variety of the classical twin model, with the MZ twin correlation greater than twice the DZ correlation. This study aimed to decompose twin correlations for BMI using more general skew-t distributions. Same sex MZ and DZ twin pairs (N = 7,086) from the community-based Washington State Twin Registry were included. We used latent profile analysis (LPA) to decompose twin correlations for BMI into multiple mixture distributions. LPA was performed using the default normal mixture distribution and the skew-t mixture distribution. Similar analyses were performed for height as a comparison. Our analyses are then replicated in an independent dataset. A two-class solution under the skew-t mixture distribution fits the BMI distribution for both genders. The first class consists of a relatively normally distributed, highly heritable BMI with a mean in the normal range. The second class is a positively skewed BMI in the overweight and obese range, with lower twin correlations. In contrast, height is normally distributed, highly heritable, and is well-fit by a single latent class. Results in the replication dataset were highly similar. Our findings suggest that two distinct processes underlie the skew of the BMI distribution. The contrast between height and weight is in accord with subjective psychological experience: both are under obvious genetic influence, but BMI is also subject to behavioral control, whereas height is not.

GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.

Directory of Open Access Journals (Sweden)

Bart A Westerman

Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.

Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma

Directory of Open Access Journals (Sweden)

Sara Badodi

2017-12-01

Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin

A single pre-operative antibiotic dose is as effective as continued antibiotic prophylaxis in implant-based breast reconstruction: A matched cohort study.

Science.gov (United States)

Townley, William A; Baluch, Narges; Bagher, Shaghayegh; Maass, Saskia W M C; O'Neill, Anne; Zhong, Toni; Hofer, Stefan O P

2015-05-01

Infections following implant-based breast reconstruction can lead to devastating consequences. There is currently no consensus on the need for post-operative antibiotics in preventing immediate infection. This study compared two different methods of infection prevention in this group of patients. A retrospective matched cohort study was performed on consecutive women undergoing implant-based breast reconstruction at University Health Network, Toronto (November 2008-December 2012). All patients received a single pre-operative intravenous antibiotic dose. Group A received minimal interventions and Group B underwent maximal prophylactic measures. Patient (age, smoking, diabetes, co-morbidities), oncologic and procedural variables (timing and laterality) were collected. Univariate and multivariate logistic regression were performed to compare outcomes between the two groups. Two hundred and eight patients underwent 647 implant procedures. After matching the two treatment groups by BMI, 94 patients in each treatment group yielding a total of 605 implant procedures were selected for analysis. The two groups were comparable in terms of patient and disease variables. Post-operative wound infection was similar in Group A (n = 11, 12%) compared with Group B (n = 9, 10%; p = 0.8). Univariate analysis revealed only pre-operative radiotherapy to be associated with the development of infection (0.004). Controlling for the effect of radiotherapy, multivariate analysis demonstrated that there was no statistically significant difference between the two methods for infection prevention. Our findings suggest that a single pre-operative dose of intravenous antibiotics is equally as effective as continued antibiotic prophylaxis in preventing immediate infection in patients undergoing implant-based breast reconstructions. Copyright © 2015 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

Association between mammographic density and pregnancies relative to age and BMI: a breast cancer case-only analysis.

Science.gov (United States)

Hack, Carolin C; Emons, Julius; Jud, Sebastian M; Heusinger, Katharina; Adler, Werner; Gass, Paul; Haeberle, Lothar; Heindl, Felix; Hein, Alexander; Schulz-Wendtland, Rüdiger; Uder, Michael; Hartmann, Arndt; Beckmann, Matthias W; Fasching, Peter A; Pöhls, Uwe G

2017-12-01

Percentage mammographic density (PMD) is a major risk factor for breast cancer (BC). It is strongly associated with body mass index (BMI) and age, which are themselves risk factors for breast cancer. This analysis investigated the association between the number of full-term pregnancies and PMD in different subgroups relative to age and BMI. Patients were identified in the breast cancer database of the University Breast Center for Franconia. A total of 2410 patients were identified, for whom information on parity, age, and BMI, and a mammogram from the time of first diagnosis were available for assessing PMD. Linear regression analyses were conducted to investigate the influence on PMD of the number of full-term pregnancies (FTPs), age, BMI, and interaction terms between them. As in previous studies, age, number of FTPs, and BMI were found to be associated with PMD in the expected direction. However, including the respective interaction terms improved the prediction of PMD even further. Specifically, the association between PMD and the number of FTPs differed in young patients under the age of 45 (mean decrease of 0.37 PMD units per pregnancy) from the association in older age groups (mean decrease between 2.29 and 2.39 PMD units). BMI did not alter the association between PMD and the number of FTPs. The effect of pregnancies on mammographic density does not appear to become apparent before the age of menopause. The mechanism that drives the effect of pregnancies on mammographic density appears to be counter-regulated by other influences on mammographic density in younger patients.

Association between Frequency of Consumption of Fruit, Vegetables, Nuts and Pulses and BMI: Analyses of the International Study of Asthma and Allergies in Childhood (ISAAC).

Science.gov (United States)

Wall, Clare R; Stewart, Alistair W; Hancox, Robert J; Murphy, Rinki; Braithwaite, Irene; Beasley, Richard; Mitchell, Edwin A

2018-03-07

Diets which emphasize intakes of plant-based foods are recommended to reduce disease risk and for promoting healthy weight. The aim of this study was to examine the association between fruit, vegetables, pulses and nut intake and body mass index (BMI) across countries in adolescents (13-14 years) and children (6-7 years). Data from the International Study of Asthma and Allergies in Childhood; 77,243 children's parents and 201,871 adolescents was used to examine the association between dietary intake (Food Frequency Questionnaire) and BMI using general linear models, adjusting for country gross national index. Adolescents who consumed fruit, vegetables, pulses and nuts three or more times a week had a lower BMI than the never or occasional group; eating nuts three or more times a week, was associated with a BMI value of 0.274 kg/m² lower than the never group ( p BMI of -0.079 kg/m². In this large global study, an inverse association was observed between BMI and the reported increasing intake of vegetables in 6-7 years old and fruit, vegetables, pulses and nuts in adolescents. This study supports current dietary recommendations which emphasize the consumption of vegetables, nut and pulses, although the effect sizes were small.

Does BMI influence hospital stay and morbidity after fast-track hip and knee arthroplasty?

DEFF Research Database (Denmark)

Husted, Henrik; Jørgensen, Christoffer C.; Gromov, Kirill

2016-01-01

-day re-admission rates were around 6% for both THA (6.1%) and TKA (5.9%), without any statistically significant differences between BMI groups in univariate analysis (p > 0.4), but there was a trend of a protective effect of overweight for both THA (p = 0.1) and TKA (p = 0.06). 90-day re...

Obstructive sleep apnea in postmenopausal women: a comparative study using drug induced sleep endoscopy

Directory of Open Access Journals (Sweden)

Soo Kweon Koo

Full Text Available Abstract Introduction: The key to successful treatment of OSAS is to individually tailor such treatment. Thus, it is very important to determine the severity of OSAS, its pattern, and the extent of collapse, by gender, age, and BMI. Objective: The objective of the study was to understand the characteristics of obstructive sleep apnea in postmenopausal women by comparing postmenopausal and premenopausal subjects, and men, using DISE. We hope that our work will help the medical community to consult on, diagnose, and treat OSAS more effectively. Methods: A total of 273 patients (195 males and 78 females diagnosed with OSAS were enrolled. Female patients were divided into pre-menopausal (n = 41 and post-menopausal patients (n = 37. The group of post-menopausal female patients was matched with a group of male patients with similar age and body mass index (BMI. DISE findings were compared between pre-menopausal female patients and post-menopausal female patients, and also between post-menopausal female patients and male patients matched for age and BMI. Results: Upon PSG examination, post-menopausal patients (who had a significantly higher BMI than did pre-menopausal patients; 25.6 kg/m2 vs. 23.5 kg/m2; p = 0.019 tended to have a higher AHI and a lower lowest SaO2, but the differences did not attain statistical significance. With DISE analysis, post-menopausal female patients showed higher values in all obstruction sites, with significantly higher value in lateral diameter of retropalatal (1.49 vs. 0.90; p = 0.001 and retrolingual levels (1.14 vs. 0.61; p = 0.003 compared to pre-menopausal females patients. Post-menopausal female patients showed significantly more retrolingual collapse (antero-posterior, AP, p ≤ 0.0001, and lateral diameter, p = 0.042 in the lower BMI group (BMI < 25 and more concentric retropalatal collapse (lateral diameter, p = 0.017 and tonsillar obstruction, p = 0.003 in higher BMI group (BMI ≥ 25 than BMI and age matched

Longitudinal associations between BMI, waist circumference, and cardiometabolic risk in US youth: monitoring implications.

Science.gov (United States)

Jago, R; Mendoza, J A; Chen, T; Baranowski, T

2013-03-01

This study examined whether change in body mass index (BMI) or waist circumference (WC) is associated with change in cardiometabolic risk factors and differences between cardiovascular disease specific and diabetes specific risk factors among adolescents. We also sought to examine any differences by gender or baseline body mass status. The article is a longitudinal analysis of pre- and post-data collected in the HEALTHY trial. Participants were 4,603 ethnically diverse adolescents who provided complete data at 6th and 8th grade assessments. The main outcome measures were percent change in the following cardiometabolic risk factors: fasting triglycerides, systolic and diastolic blood pressure, high density lipoprotein cholesterol, and glucose as well as a clustered metabolic risk score. Main exposures were change in BMI or WC z-score. Models were run stratified by gender; secondary models were additionally stratified by baseline BMI group (normal, overweight, or obese). Analysis showed that when cardiometabolic risk factors were treated as continuous variables, there was strong evidence (P fasting glucose and the combined risk factor score for both boys and girls. There was some evidence that change in WC z-score was associated with some cardiovascular risk factors, but change in WC z-score was consistently associated with changes in fasting glucose. In conclusion, routine monitoring of BMI should be continued by health professionals, but additional information on disease risk may be provided by assessing WC. Copyright © 2013 The Obesity Society.

Raised BMI cut-off for overweight in Greenland Inuit – a review

Science.gov (United States)

Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter

2013-01-01

Background Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI. PMID:23986904

Raised BMI cut-off for overweight in Greenland Inuit – a review

Directory of Open Access Journals (Sweden)

Stig Andersen

2013-08-01

Full Text Available Background. Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI, a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. Objective. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. Design and findings. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Conclusion. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m2 in Greenland Inuit may overestimate the number of individuals with elevated BMI.

Change in BMI accurately predicted by social exposure to acquaintances.

Science.gov (United States)

Oloritun, Rahman O; Ouarda, Taha B M J; Moturu, Sai; Madan, Anmol; Pentland, Alex Sandy; Khayal, Inas

2013-01-01

Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO) method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC) and R(2). This study found a model that explains 68% (pchange in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as close friends.

File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

Bmi1 overexpression in the cerebellar granule cell lineage of mice affects cell proliferation and survival without initiating medulloblastoma formation

Directory of Open Access Journals (Sweden)

Hourinaz Behesti

2013-01-01

BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.

The impact of BMI on sperm parameters and the metabolite changes of seminal plasma concomitantly.

Science.gov (United States)

Guo, Dan; Wu, Wei; Tang, Qiuqin; Qiao, Shanlei; Chen, Yiqiu; Chen, Minjian; Teng, Mengying; Lu, Chuncheng; Ding, Hongjuan; Xia, Yankai; Hu, Lingqing; Chen, Daozhen; Sha, Jiahao; Wang, Xinru

2017-07-25

The development of male infertility increased rapidly worldwide, which coinciding with the epidemic of obesity. However, the impact of weight abnormalities on sperm quality is still contestable. To assess the correlation between BMI and sperm parameters, we searched relevant articles in PubMed, Embase, Web of science, and Wanfang database published until June 2015 without language restriction. Otherwise, we also recruited some participants who attended fertility clinic as well as some general populations in this report. We performed a systematic review and meta-analysis about BMI and sperm parameters containing total sperm count, concentration, semen volume and sperm motility (overall and progressive). Metabolomic analysis of seminal plasma was performed to explore the mechanism from a new perspective. This study found standardized weighted mean differences (SMD) in sperm parameters (total sperm count, sperm concentration, and semen volume) of abnormal weight groups decreased to different degree compared to normal weight. Dose-response analysis found SMD of sperm count, sperm concentration and semen volume respectively fell 2.4%, 1.3% and 2.0% compared with normal weight for every 5-unit increase in BMI. Metabolomic analysis of seminal plasma showed that spermidine and spermine were likely to play a vital role in the spermatogenesis progress. This systematic review with meta-analysis has confirmed there was a relationship between BMI and sperm quality, suggesting obesity may be a detrimental factor of male infertility.

PPARγ gene polymorphism, C-reactive protein level, BMI and periodontitis in post-menopausal Japanese women.

Science.gov (United States)

Wang, Yangming; Sugita, Noriko; Yoshihara, Akihiro; Iwasaki, Masanori; Miyazaki, Hideo; Nakamura, Kazutoshi; Yoshie, Hiromasa

2016-03-01

Several studies have reported inconsistent results regarding the association between the PPARγPro12Ala polymorphism and obesity. Obese individuals had higher C-reactive protein (CRP) levels compared with those of normal weight, and PPARγ activation could significantly reduce serum high-sensitive CRP level. We have previously suggested that the Pro12Ala polymorphism represents a susceptibility factor for periodontitis, which is a known risk factor for increased CRP level. The aim was to investigate associations between PPARγ gene polymorphism, serum CRP level, BMI and/or periodontitis among post-menopausal Japanese women. The final sample in this study comprised 359 post-menopausal Japanese women. Periodontal parameters, including PD, CAL and BOP, were measured per tooth. PPARγPro12Ala genotype was determined by PCR-RFLP. Hs-CRP value was measured by a latex nephelometry assay. No significant differences in age, BMI or periodontal parameters were found between the genotypes. The percentages of sites with PD ≥ 4 mm were significantly higher among the hsCRP ≥ 1 mg/l group than the hsCRP periodontitis, serum CRP level or BMI in post-menopausal Japanese women. However, serum hsCRP level correlated with periodontitis in Ala allele carriers, and with BMI in non-carriers. © 2014 John Wiley & Sons A/S and The Gerodontology Society. Published by John Wiley & Sons Ltd.

BMI-for-age in South Asian children of 0-20 years in the Netherlands: secular changes and misclassification by WHO growth references.

Science.gov (United States)

de Wilde, J A; Dekker, M; Middelkoop, B J C

2018-03-01

South Asians are prone to cardiometabolic disease at lower BMI levels than most other ethnic groups, starting in childhood. The magnitude of BMI misclassifications is unknown. To compare the BMI distribution of contemporary South Asian 0-20 year olds in the Netherlands with: (1) The South Asian norm reference (secular trends); and (2) The WHO child growth standard and reference. The BMI-for-age distribution of 6677 routine measurements of 3322 South Asian children, aged 0-20 years, was described with the LMS method and BMI z-scores. The BMI distribution in South Asian 0-4 year olds was almost similar to the norm reference (mean BMI z-score = 0.11, skewness = 0.31, SD = 1.0), whereas in 5-19 year olds the distribution had shifted upwards (mean = 0.53) and widened (skewness = -0.12, SD = 1.08). Overweight (incl. obesity) and obesity peaked at 8-10 years, at 45-48% and 35-37%, respectively. Relative to the WHO references, the BMI distribution was left-shifted at ages 0-4 years (mean BMI z-score = -0.46, skewness = 0.23, SD = 0.98) and widened at ages 5-20 years (mean = 0.05; skewness = -0.02, SD = 1.40). At most ages, thinness rates were significantly higher and obesity rates lower than based on South Asian norms. A secular change of BMI-for-age in South Asian children mostly affected children >4 years. WHO references likely under-estimate overweight and obesity rates in South Asian children.

Gestational carrier BMI and reproductive, fetal and neonatal outcomes: are the risks the same with increasing obesity?

Science.gov (United States)

Coyne, K; Whigham, L D; O'Leary, K; Yaklic, J K; Maxwell, R A; Lindheim, S R

2016-01-01

Data suggest that female obesity impairs uterine receptivity and increases the risk of fetal and neonatal mortality. We analyzed the reproductive outcomes of gestational carriers (GCs) undergoing donated oocytes and assisted reproductive technology according to body mass index (BMI). A retrospective analysis of 163 GCs undergoing 226 in vitro fertilization (IVF) and embryo transfer cycles. GCs undergoing in vitro fertilization and embryo transfer cycles were analyzed and divided according to their BMI (healthy weight: 20-24.9 kg m(-2) (n=77 in 114 cycles); overweight: 25-29.9 kg m(-)(2) (n=55 in 71 cycles); and obese: 30-35 kg m(-)(2) (n=31 in 41 cycles)). All GCs underwent a complete medical evaluation and were cleared for pregnancy before being selected. Overweight and obese GCs also underwent a metabolic screening, including an oral glucose tolerance test and lipid profile. The main outcomes measured were clinical pregnancy and live birth rates, antenatal and neonatal outcomes. Clinical pregnancy and live birth rates were similar despite increasing BMI. There were no statistically significant differences in the implantation rates, clinical pregnancy rates or live birth rates per embryo transfer among patients in the three BMI groups. In the healthy weight, overweight and obese GCs, the clinical pregnancy rates per GC were 72%, 84% and 79%, and per embryo transfer rates were 52%, 49% and 56%, respectively; P=NS. The live birth rates per GC were 70%, 84% and 75%, and per embryo transfer rates were 50%, 49% and 53%, respectively; P=NS. Twin rates were similar between the groups (35%, 31% and 29%, respectively; P=NS). There were no differences in gestational diabetes, preterm admissions or cesarean section rates. Neonatal intensive care unit admissions were similar (11%, 13% and 12%, respectively; P=NS), and no maternal, neonatal or infant mortality occurred. These data show that increasing obesity does not impair the reproductive outcome in GC cycles

Associations between BMI Change and Cardiometabolic Risk in Retired Football Players.

Science.gov (United States)

Trexler, Eric T; Smith-Ryan, Abbie E; Defreese, J D; Marshall, Stephen W; Guskiewicz, Kevin M; Kerr, Zachary Y

2018-04-01

Elevated rates of cardiometabolic diseases have been observed in former American football players. The current study sought to determine whether change in body mass index (ΔBMI) after retirement influences the prevalence of CHD, diabetes, or high blood pressure (HBP) in former professional football players. Retired professional football players (n = 3729) were sent a survey with questions regarding health status, playing history, and demographic information. Self-reported BMI at the time of retirement was subtracted from current self-reported BMI to calculate ΔBMI. Prevalence of CHD, diabetes, and HBP were determined by asking participants if they had ever been diagnosed by a health care professional. Binomial regression with a Poisson residual and robust variance estimation was used to compute crude prevalence ratios (PR) and 95% confidence intervals (CI) for each outcome. Adjusted PR values were calculated by adjusting for BMI at the time of retirement, age, years of football experience, race, exercise habits, alcohol use, steroid history, smoking history, and playing position. Complete data were available for 2062 respondents. Prevalence of CHD increased 25%-31% for each five-point increase in ΔBMI after retirement (crude PR = 1.25, 95% CI = 1.03-1.52, P = 0.026; adjusted PR = 1.31, 95% CI = 1.11-1.55, P = 0.001). Diabetes prevalence increased 69%-88% for each five-point ΔBMI increase (crude = 1.88, 95% CI = 1.45-2.44, P football players.

Maternal Metabolic Health Parameters During Pregnancy in Relation to Early Childhood BMI Trajectories.

Science.gov (United States)

Montazeri, Parisa; Vrijheid, Martine; Martinez, David; Basterrechea, Mikel; Fernandez-Somoano, Ana; Guxens, Monica; Iñiguez, Carmen; Lertxundi, Aitana; Murcia, Mario; Tardon, Adonina; Sunyer, Jordi; Valvi, Damaskini

2018-03-01

The objective of this study was to evaluate the associations between maternal metabolic parameters and early childhood BMI trajectories. Two thousand two hundred fifty-one children born in Spain between 2004 and 2008 were analyzed. Five BMI z score trajectories from birth to age 4 years were identified by using latent class growth analysis. Multinomial regression assessed the associations between maternal metabolic parameters and offspring's BMI trajectories. Children in the reference BMI trajectory had average size at birth followed by a slower BMI gain. Maternal prepregnancy obesity was associated with trajectories of accelerated BMI gain departing from either higher (relative risk ratio [RRR] = 1.77; 95% CI: 1.07-2.91) or lower size at birth (RRR = 1.91; 95% CI: 1.17-3.12). Gestational weight gain (GWG) above clinical guidelines was associated with a trajectory of higher birth size followed by accelerated BMI gain (RRR = 2.14; 95% CI: 1.53-2.97). Maternal serum triglycerides were negatively associated with BMI trajectories departing from lower birth sizes. Gestational diabetes, maternal serum cholesterol, and C-reactive protein were unrelated to children's BMI trajectories. Maternal prepregnancy obesity, GWG, and serum triglycerides are associated with longitudinal BMI trajectories in early childhood that may increase disease risk in later life. Health initiatives should promote healthy weight status before and during pregnancy to improve maternal and child health. © 2018 The Obesity Society.

BMI in relation to sperm count

DEFF Research Database (Denmark)

Sermondade, N; Faure, C; Fezeu, L

2013-01-01

BACKGROUND The global obesity epidemic has paralleled a decrease in semen quality. Yet, the association between obesity and sperm parameters remains controversial. The purpose of this report was to update the evidence on the association between BMI and sperm count through a systematic review...... with meta-analysis. METHODS A systematic review of available literature (with no language restriction) was performed to investigate the impact of BMI on sperm count. Relevant studies published until June 2012 were identified from a Pubmed and EMBASE search. We also included unpublished data (n = 717 men...... studies were included in the meta-analysis, resulting in a sample of 13 077 men from the general population and attending fertility clinics. Data were stratified according to the total sperm count as normozoospermia, oligozoospermia and azoospermia. Standardized weighted mean differences in sperm...

Do sedentary behaviors mediate associations between socio-demographic characteristics and BMI in women living in socio-economically disadvantaged neighborhoods?

Science.gov (United States)

Compernolle, Sofie; De Cocker, Katrien; Abbott, Gavin; Verloigne, Maïté; Cardon, Greet; De Bourdeaudhuij, Ilse; Ball, Kylie

2015-04-09

Women living in deprived neighborhoods are a risk group for overweight and obesity, particularly during the childbearing years. Several socio-demographic characteristics may compound this risk, but little is known about why this might be the case. Sedentary behaviors are emerging as a socio-demographically patterned risk factor for obesity. The purpose of the present study was to assess socio-demographic differences in sedentary behaviors, and to examine whether these behaviors could explain the relation between socio-demographic variables and BMI (BMI) in this risk group. Women aged 18-46 years were recruited from 40 urban and 40 rural deprived neighborhoods in Victoria, Australia. In total, 3879 women reported socio-demographic variables (age, educational level, employment status, marital status, number of children, residential location and country of birth), sedentary behaviors (television time, computer time, total screen time and total sedentary time), physical activity, and height and weight, which were used to calculate BMI. For each socio-demographic variable, four single mediation models were conducted using two-level mixed-models regression analyses. Mediating effects were examined using the MacKinnon product-of-coefficients procedure and the Sobel test. All socio-demographic variables were significantly associated with sedentary behaviors. Single mediation analyses revealed that television time (αβ = 0.017, 95% CI = 0.000, 0.030) and total screen time (αβ = 0.006, 95% CI = 0.000, 0.012) mediated 14.1% and 4.9% of the relationship between educational level and BMI, respectively. Total screen time mediated 45.1% of the relationship between employment status and BMI (αβ = -0.020, 95% CI = -0.033, -0.006), and television time mediated 8.2% of the relationship between country of birth and BMI (αβ = -0.008, 95% CI = -0.016, -0.001). Sedentary behaviors differed depending on socio-demographic characteristics, and partly

Food brand recognition and BMI in preschoolers.

Science.gov (United States)

Harrison, Kristen; Moorman, Jessica; Peralta, Mericarmen; Fayhee, Kally

2017-07-01

Children's food brand recognition predicts health-related outcomes such as preference for obesogenic foods and increased risk for overweight. However, it is uncertain to what degree food brand recognition acts as a proxy for other factors such as parental education and income, child vocabulary, child age, child race/ethnicity, parent healthy eating guidance, child commercial TV viewing, and child dietary intake, all of which may influence or be influenced by food brand recognition. U.S. preschoolers (N = 247, average age 56 months) were measured for BMI and completed the Peabody Picture Vocabulary Test plus recognition and recall measures for a selection of U.S. food brands. Parents completed measures of healthy eating guidance, child dietary intake, child commercial TV viewing, parent education, household income, parent BMI, and child age and race/ethnicity. Controlling these variables, child food brand recognition predicted higher child BMI percentile. Further, qualitative examination of children's incorrect answers to recall items demonstrated perceptual confusion between brand mascots and other fantasy characters to which children are exposed during the preschool years, extending theory on child consumer development. Copyright © 2017 Elsevier Ltd. All rights reserved.

Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

Science.gov (United States)

Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

2017-12-01

This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

Does the cortisol awakening response link childhood adversity to adult BMI?

Science.gov (United States)

Miller, Kelly F; Arbel, Reout; Shapiro, Lauren S; Han, Sohyun C; Margolin, Gayla

2018-04-26

Childhood adversity is a risk factor for the development of obesity in adulthood. Dysregulated hypothalamic-pituitary-adrenal (HPA) activity, which has been associated separately with both adverse childhood experiences and obesity, has been posited as a mechanism by which stressful experiences influence body mass index (BMI); however, this mechanism has not yet been tested longitudinally. The present study uses multireporter, longitudinal data across three time points to test whether the adolescent cortisol awakening response (CAR), an index of diurnal HPA activity, mediates the association between adversity in childhood and BMI in adulthood. Eighty-two youth, mothers, and fathers reported on adverse childhood experiences from middle childhood to late adolescence. During adolescence, youth provided saliva samples three times each morning across three days, which were assayed for cortisol to calculate CAR. During early adulthood, youth reported height and weight to calculate BMI. Greater adversity predicted flatter CAR and higher young adult BMI. Flatter CAR partially mediated the association between childhood adversity and young adult BMI. Stress-related alterations to HPA activity account in part for the childhood adversity-adult obesity link. Findings are consistent with theoretical models implicating HPA alterations as linking childhood adversity to metabolic and behavioral determinants of BMI in adulthood. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

The dose-response analysis between BMI and common chronic diseases in northeast China.

Science.gov (United States)

Yu, Jianxing; Tao, Yuchun; Dou, Jing; Ye, Junsen; Yu, Yaqin; Jin, Lina

2018-03-09

High body mass index (BMI) predisposes to several chronic diseases, but a large-scale systematic and detailed study of dose-response relationship between BMI and chronic diseases has not been reported previously. In this study, we aimed to investigate the relationship between BMI and 3 chronic diseases (hypertension, dyslipidemia and MetS) in northeast China. A sample of 16412 participants aged 18~79 years old were included in Jilin province in 2012. The lambda-mu-sigma (LMS) method was applied to examine the trend of BMI by age, and the restricted cubic splines were used to investigate the non-linear associations (dose-response curve) between BMI and chronic diseases. It was pointed out that BMI increased rapidly when young, then kept steady in middle age, and finally declined slowly in old age, and accordingly age was divided into 3 segments, which were different by gender. The odds ratios (ORs) of BMI for the chronic diseases increased relatively slowly when young, then increased dramatically in middle-age and old population, especially for men. Further, the ORs of BMI among non-smokers were lower than those among smokers, and the same trend was shown to be more apparent among drinkers and non-drinkers. The risk of BMI for common chronic diseases increased dramatically in middle-aged, especially for men with drinking and smoking habits.

Reliable Line Matching Algorithm for Stereo Images with Topological Relationship

Directory of Open Access Journals (Sweden)

WANG Jingxue

2017-11-01

Full Text Available Because of the lack of relationships between matching line and adjacent lines in the process of individual line matching, and the weak reliability of the individual line descriptor facing on discontinue texture, this paper presents a reliable line matching algorithm for stereo images with topological relationship. The algorithm firstly generates grouped line pairs from lines extracted from the reference image and searching image according to the basic topological relationships such as distance and angle between the lines. Then it takes the grouped line pairs as matching primitives, and matches these grouped line pairs by using epipolar constraint, homography constraint, quadrant constraint and gray correlation constraint of irregular triangle in order. And finally, it resolves the corresponding line pairs into two pairs of corresponding individual lines, and obtains one to one matching results after the post-processing of integrating, fitting, and checking. This paper adopts digital aerial images and close-range images with typical texture features to deal with the parameter analysis and line matching, and the experiment results demonstrate that the proposed algorithm in this paper can obtain reliable line matching results.

File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

Adenoid and tonsil surgeries in children: How relevant is pre-operative blood grouping and cross-matching?

Directory of Open Access Journals (Sweden)

Lucky Onotai

2013-01-01

Full Text Available Background: As a part of pre-operative evaluation, several otolaryngologists group and cross-match blood routinely for children undergoing adenoid and tonsil surgeries. This practice has generated several debates either in support or against this practice. The aim of this study is to critically evaluate the incidence of post-tonsillectomy (with or without adenoidectomy bleeding and blood transfusions in otherwise healthy children with adenoid/tonsil pathologies conducted in the University of Port Harcourt Teaching Hospital (UPTH. Patients and Methods: A descriptive retrospective study of children who underwent adenoid and tonsil surgeries in the Department of Ear, Nose and Throat (ENT surgery of UPTH from January 2003 to December 2012. Children with family history of bleeding disorders and derangement of clotting profile as well as different co-morbidity like sickle cell disease were excluded from this study. The patients′ data were retrieved from the registers of ENT out-patient clinics, theatre registers and patients case notes. Demographic data, indications for surgery, preoperative investigations, complications and management outcomes were recorded and analyzed. Results: Out of 145 children that had adenoid and tonsil surgeries; only 100 met the criteria for this study. The study subjects included 65 males and 35 females (male: female ratio 1.9:1 belonging to 0-16 years age group (mean age: 3.46 ± 2.82 years. The age group of 3-5 years had the highest (n = 40, 40% number of surgeries. Adenotonsillectomy was the commonest (n = 85, 85% surgery performed on patients who had obstructive sleep apnea (OSA. The commonest (n = 6, 6% complication was haemorrhage, and only few (n = 3, 3% patients had blood transfusion. However, mortality was recorded in some (n = 3, 3% patients. Conclusion: This study confirms that the incidence of post adenoidectomy/tonsillectomy bleeding in otherwise healthy children is low and rarely requires blood transfusion

Using Multiple Control Groups and Matching to Address Unobserved Biases in Comparative Effectiveness Research: An Observational Study of the Effectiveness of Mental Health Parity.

Science.gov (United States)

Yoon, Frank B; Huskamp, Haiden A; Busch, Alisa B; Normand, Sharon-Lise T

2011-06-21

Studies of large policy interventions typically do not involve randomization. Adjustments, such as matching, can remove the bias due to observed covariates, but residual confounding remains a concern. In this paper we introduce two analytical strategies to bolster inferences of the effectiveness of policy interventions based on observational data. First, we identify how study groups may differ and then select a second comparison group on this source of difference. Second, we match subjects using a strategy that finely balances the distributions of key categorical covariates and stochastically balances on other covariates. An observational study of the effect of parity on the severely ill subjects enrolled in the Federal Employees Health Benefits (FEHB) Program illustrates our methods.

Relation of N-terminal pro-brain natriuretic peptide levels and their prognostic power in chronic stable heart failure to obesity status.

Science.gov (United States)

Frankenstein, Lutz; Remppis, Andrew; Nelles, Manfred; Schaelling, Bernd; Schellberg, Dieter; Katus, Hugo; Zugck, Christian

2008-11-01

To investigate the relationship between body mass index (BMI) and N-terminal pro-brain natriuretic peptide (NTproBNP) level and resultant prognostic capacity in chronic heart failure (CHF) controlled for known confounders. We formed 206 triplets of patients (n = 618) with stable systolic CHF matched with respect to age, sex, renal function (MDRD, modification of diet in renal disease formula), and NYHA class, each with a BMI >30 kg/m(2) (group 3), 20-24.9 kg/m(2) (group 1), and 25-29.9 kg/m(2) (group 2). BMI conveys a 4% drop in NTproBNP per unit increase. This influence remained significant after correction for age, sex, MDRD, NYHA, heart rate, rhythm, and ejection fraction. NTproBNP remained an independent predictor of adverse outcome after correction for age, sex, BMI, NYHA, MDRD, and ejection fraction. Despite numerical differences, prognostic power was comparable between BMI groups (log-transformed NTproBNP; group 1: hazard ratio (HR) 1.435, 95% CI 1.046-1.967, chi(2) 5.02, P = 0.03; group 2: HR 1.604, 95% CI 1.203-2.138, chi(2) 10.36, P = 0.001; group 3: HR 1.735, 95% CI 1.302-2.313, chi(2) 14.12, P = 0.0002) (P = NS, all). An NTproBNP correction factor was calculated. Even matched for NYHA, age, sex, and renal function, BMI exerts a significant and independent inverse influence on NTproBNP in patients with stable CHF. NTproBNP retained equal statistical power in all three BMI groups.

Obstructive sleep apnea in postmenopausal women: a comparative study using drug induced sleep endoscopy.

Science.gov (United States)

Koo, Soo Kweon; Ahn, Gun Young; Choi, Jang Won; Kim, Young Jun; Jung, Sung Hoon; Moon, Ji Seung; Lee, Young Il

The key to successful treatment of OSAS is to individually tailor such treatment. Thus, it is very important to determine the severity of OSAS, its pattern, and the extent of collapse, by gender, age, and BMI. The objective of the study was to understand the characteristics of obstructive sleep apnea in postmenopausal women by comparing postmenopausal and premenopausal subjects, and men, using DISE. We hope that our work will help the medical community to consult on, diagnose, and treat OSAS more effectively. A total of 273 patients (195 males and 78 females) diagnosed with OSAS were enrolled. Female patients were divided into pre-menopausal (n=41) and post-menopausal patients (n=37). The group of post-menopausal female patients was matched with a group of male patients with similar age and body mass index (BMI). DISE findings were compared between pre-menopausal female patients and post-menopausal female patients, and also between post-menopausal female patients and male patients matched for age and BMI. Upon PSG examination, post-menopausal patients (who had a significantly higher BMI than did pre-menopausal patients; 25.6kg/m 2 vs. 23.5kg/m 2 ; p=0.019) tended to have a higher AHI and a lower lowest SaO 2 , but the differences did not attain statistical significance. With DISE analysis, post-menopausal female patients showed higher values in all obstruction sites, with significantly higher value in lateral diameter of retropalatal (1.49 vs. 0.90; p=0.001) and retrolingual levels (1.14 vs. 0.61; p=0.003) compared to pre-menopausal females patients. Post-menopausal female patients showed significantly more retrolingual collapse (antero-posterior, AP, p≤0.0001, and lateral diameter, p=0.042) in the lower BMI group (BMI<25) and more concentric retropalatal collapse (lateral diameter, p=0.017 and tonsillar obstruction, p=0.003) in higher BMI group (BMI≥25) than BMI and age matched male patients. Post-menopausal female patients showed a different pattern of airway

Quantification of wear-time adherence of removable appliances in young orthodontic patients in relation to their BMI: a preliminary study.

Science.gov (United States)

Schott, Timm Cornelius; Ludwig, Björn

2014-01-01

The relationship between unhealthy body mass index (BMI) and adherence to orthodontic treatment with removable appliances has not previously been evaluated. The aim of this study was to quantify the association between BMI and wear time of removable orthodontic appliances and to evaluate BMI changes during orthodontic treatment. Fifty-three normal-weight and 39 overweight/obese children and adolescents (7-15 years old) undergoing orthodontic treatment with removable appliances were enrolled into the study. BMI categories were determined using standardized age-specific and sex-specific BMI criteria, using data measured at the beginning of therapy and once during orthodontic treatment. Wear times of removable appliances were measured at 15-minute intervals over a period of 5 months using implanted microelectronic sensors. Median wear-time values were used in the analysis with the Mann-Whitney U-test used to test statistical differences between groups. The median wear time of removable orthodontic appliances was 9.3 hours for normal-weight patients and 9.2 hours for overweight/obese patients. No statistically significant (P>0.05) or clinically relevant differences in usage or adherence were detected between normal-weight and overweight/obese patients. BMI did not influence wear time or behavior of removable orthodontic appliances by young patients. The majority of patients showed qualitative decreases in BMI during therapy. The orthodontic treatment of young patients with removable devices does not require BMI-dependent changes in the treatment strategy. However, the use of removable appliances during meal times raises the possibility of reducing food intake, and in this way the orthodontist may have an active role to play in weight reduction.

Sex differences in heritability of BMI

DEFF Research Database (Denmark)

Schousboe, Karoline; Willemsen, Gonneke; Kyvik, Kirsten O

2003-01-01

pairs (including opposite sex pairs) aged 20-29 and 30-39 from eight different twin registries participating in the GenomEUtwin project. Quantitative genetic analyses were conducted and sex differences were explored. Variation in BMI was greater for women than for men, and in both sexes was primarily...... explained by additive genetic variance in all countries. Sex differences in the variance components were consistently significant. Results from analyses of opposite sex pairs also showed evidence of sex-specific genetic effects suggesting there may be some differences between men and women in the genetic...... factors that influence variation in BMI. These results encourage the continued search for genes of importance to the body composition and the development of obesity. Furthermore, they suggest that strategies to identify predisposing genes may benefit from taking into account potential sex specific effects....

Orthorexia nervosa: Assessment and correlates with gender, BMI, and personality.

Science.gov (United States)

Oberle, Crystal D; Samaghabadi, Razieh O; Hughes, Elizabeth M

2017-01-01

This study investigated whether orthorexia nervosa (ON; characterized by an obsessive fixation on eating healthy) may be predicted from the demographics variables of gender and BMI, and from the personality variables of self-esteem, narcissism, and perfectionism. Participants were 459 college students, who completed several online questionnaires that assessed these variables. A principal components analysis confirmed that the Eating Habits Questionnaire (Gleaves, Graham, & Ambwani, 2013) assesses three internally-consistent ON components: healthy eating behaviors, problems resulting from those behaviors, and positive feelings associated with those behaviors. A MANOVA and its tests of between subjects effects then revealed significant interactions between gender and BMI, such that for men but not women, a higher BMI was associated with greater symptomatology for all ON components. Partial correlation analyses, after controlling for gender and BMI, revealed that both narcissism and perfectionism were positively correlated with all aspects of ON symptomatology. Copyright © 2016 Elsevier Ltd. All rights reserved.

Impact of Pre-Pregnancy BMI on B Vitamin and Inflammatory Status in Early Pregnancy: An Observational Cohort Study

Directory of Open Access Journals (Sweden)

Anne-Lise Bjørke-Monsen

2016-11-01

Full Text Available Maternal nutrition and inflammation have been suggested as mediators in the development of various adverse pregnancy outcomes associated with maternal obesity. We have investigated the relation between pre-pregnancy BMI, B vitamin status, and inflammatory markers in a group of healthy pregnant women. Cobalamin, folate, pyridoxal 5′-phosphate, and riboflavin; and the metabolic markers homocysteine, methylmalonic acid, and 3-hydroxykynurenine/xanthurenic acid ratio (HK/XA; and markers of cellular inflammation, neopterin and kynurenine/tryptophan ratio (KTR were determined in pregnancy week 18 and related to pre-pregnancy body mass index (BMI, in 2797 women from the Norwegian Mother and Child Cohort Study (MoBa. Pre-pregnancy BMI was inversely related to folate, cobalamin, pyridoxal 5′-phosphate (PLP, and riboflavin (p < 0.001, and associated with increased neopterin and KTR levels (p < 0.001. Inflammation seemed to be an independent predictor of low vitamin B6 status, as verified by low PLP and high HK/XA ratio. A high pre-pregnancy BMI is a risk factor for low B vitamin status and increased cellular inflammation. As an optimal micronutrient status is vital for normal fetal development, the observed lower B vitamin levels may contribute to adverse pregnancy outcomes associated with maternal obesity and B vitamin status should be assessed in women with high BMI before they get pregnant.

Change in BMI accurately predicted by social exposure to acquaintances.

Directory of Open Access Journals (Sweden)

Rahman O Oloritun

Full Text Available Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC and R(2. This study found a model that explains 68% (p<0.0001 of the variation in change in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as

File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

The Influence of Sweet Taste Perception on Dietary Intake in Relation to Dental Caries and BMI in Saudi Arabian Schoolchildren

Directory of Open Access Journals (Sweden)

Heba Ashi

2017-01-01

Full Text Available Objectives. The aim of the study was to evaluate the influence of sweet taste perception on dietary habits in Saudi schoolchildren. In addition, the relationship between dietary habits and both caries and BMI was studied. Methods. A cross-sectional observational study comprising 225 schoolchildren aged 13–15 years from Jeddah, Saudi Arabia, was conducted. The consumption frequency of certain food items was analysed from a beverage and snack questionnaire and a three-day estimated dietary record was obtained. The sweet taste perception level was determined as sweet taste threshold (TT and sweet taste preference (TP. Children were grouped into low, medium, and high, according to their sweet taste perception level. ICDAS and DMFS indices were used for caries registration and anthropometric measurements using BMI were collected. Results. Sweet taste perception was found to be negatively correlated to the number of main meals and positively correlated to both snack and sweet intake occasions. Statistically significant differences were found between the TT and TP groups with regard to the number of main meals and sweet intake (p≤0.01. No significant correlation between the dietary variables and caries or BMI was found. Conclusions. The dietary habits and sweet intake were found to be influenced by the sweet taste perception level, while the relation between the dietary habits and the caries and BMI was found insignificant.

The importance of BMI in dosimetry of 153Sm-EDTMP bone pain palliation therapy: A Monte Carlo study

International Nuclear Information System (INIS)

Fallahpoor, Maryam; Abbasi, Mehrshad; Asghar Parach, Ali; Kalantari, Faraz

2017-01-01

Using digital phantoms as an atlas compared to acquiring CT data for internal radionuclide dosimetry decreases patient overall radiation dose and reduces the required analysis effort and time for organ segmentation. The drawback is that the phantom may not match exactly with the patient. We assessed the effect of varying BMIs on dosimetry results for a bone pain palliation agent, 153 Sm-EDTMP. The simulation was done using the GATE Monte Carlo code. Female XCAT phantoms with the following different BMIs were employed: 18.6, 20.8, 22.1, 26.8, 30.3 and 34.7 kg/m 2 . S-factors (mGy/MBq.s) and SAFs (kg −1 ) were calculated for the dosimetry of the radiation from major source organs including spine, ribs, kidney and bladder into different target organs as well as whole body dosimetry from spine. The differences in dose estimates from different phantoms compared to those from the phantom with BMI of 26.8 kg/m 2 as the reference, were calculated for both gamma and beta radiations. The relative differences (RD) of the S-factors or SAFs from the values of reference phantom were calculated. RDs greater than 10% and 100% were frequent in radiations to organs for photon and beta particles, respectively. The relative differences in whole body SAFs from the reference phantom were 15.4%, 7%, 4.2%, −9.8% and −1.4% for BMIs of 18.6, 20.8, 22.1, 30.3 and 34.7 kg/m 2 , respectively. The differences in whole body S-factors for the phantoms with BMIs of 18.6, 20.8, 22.1, 30.3 and 34.7 kg/m 2 were 39.5%, 19.4%, 8.8%, −7.9% and −4.3%, respectively. The dosimetry of the gamma photons and beta particles changes substantially with the use of phantoms with different BMIs. The change in S-factors is important for dose calculation and can change the prescribed therapeutic dose of 153 Sm-EDTMP. Thus a phantom with BMI better matched to the patient is suggested for therapeutic purposes where dose estimates closer to those in the actual patient are required. - Highlights: • Internal

LACTATE PROFILE DURING GRECO-ROMAN WRESTLING MATCH

Directory of Open Access Journals (Sweden)

Ognjen Uljevic

2009-11-01

Full Text Available The objective of this study was to determine and compare lactate profile of two groups of Greco-Roman wrestlers with different competences and training experience. Study was conducted on 10 wrestles that were members of Croatian national team and 10 wrestlers that were members of Wrestling club Split. Lactate samples were collected at four intervals during control fights that were held according to international wrestling rules of World wrestling federation FILA. Values of lactate increased as competition progressed, and they were highest at the end of the match for both groups of wrestlers. According to this study there were no significant differences in lactate between two groups at the end of the match, while significant differences were noted during the match. The information about lactate profile presented in this study can be used by coaches and wrestlers to develop condition programs

Social disparities in body mass index (BMI) trajectories among Chinese adults in 1991-2011.

Science.gov (United States)

Fang, Changchun; Liang, Ying

2017-08-16

Obesity is a serious public health problem in China. The relationship between obesity and socio-economic status (SES) is changing and affected by uncertainty, particularly, in developing countries. The sex-related differences in body mass index (BMI) trajectories are controversial and require substantial empirical data for updating and enriching. This study examined the relationship between SES and BMI in Chinese adults from a dynamic perspective using longitudinal data (1991-2011) from the China Health and Nutrition Survey (CHNS). Then, sex-related differences were determined. A hierarchical linear model was used. SES positively affected the male BMI changes, with faster BMI growth rates in the high-SES males over the past 20 years. By contrast, female BMI was only affected by BMI baseline and residential area. Specifically, greater BMI baseline led to greater BMI growth rate and earlier BMI decline. In the past 20 years, the BMI growth rate has been greater in the urban females than in the rural females. The relationship between SES and obesity is complex in China, and a substantial sex-related difference exists. We argue that this large sex-related difference is due to the rapid economic and social changes that have affected national health and increased the gender inequality and social role restrictions in females. We provide insights for further research and policy recommendations.

Lower C-reactive protein and IL-6 associated with vegetarian diets are mediated by BMI.

Science.gov (United States)

Jaceldo-Siegl, K; Haddad, E; Knutsen, S; Fan, J; Lloren, J; Bellinger, D; Fraser, G E

2018-03-13

The mechanism by which vegetarian diets are associated with less inflammation is not clear. We investigated the role of BMI as a mediator in the relationship between vegetarian diet and concentrations of C-reactive protein (CRP), and the cytokines IL-6, IL-10 and TNF-α. We used data from participants of the Adventist Health Study 2 (AHS-2) Calibration (n = 893) and Biological Manifestations of Religion (n = 478) sub-studies. Vegetarian diet variations were determined based on reported intake of animal products assessed by FFQ. Combining all participants, the proportion of non-vegetarians (NVs), partial vegetarians (PVs), lacto-ovo vegetarians (LOVs), and strict vegetarians (SVs) was 44%, 16%, 31%, and 9%, respectively. NV and PV participants were older than other dietary groups, and non-vegetarians had the highest BMI. Mediation analyses supported the mediating effect of BMI in associations of vegetarian diet with CRP (p vegetarian diet and the biomarkers IL-10 and TNF-α. A direct pathway was significant only in the association between strict vegetarians and CRP (p = 0.017). The lower CRP and IL-6 concentrations among vegetarians may be mediated by BMI. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

Effect of BMI on quality of life and depression levels after bariatric surgery.

Science.gov (United States)

Sierżantowicz, Regina; Lewko, Jolanta; Hady, Hady Razak; Kirpsza, Bożena; Trochimowicz, Lech; Dadan, Jacek

2017-01-01

Studies conducted in Poland have found that 1% (~300,000) of Polish adults are obese. The degree of weight loss and reduction of discomfort associated with severe obesity are used to evaluate bariatric surgery outcomes. From the patient's point of view, QoL and mental health are the most important determinants of successful surgery, which is why interest in QoL assessment has increased. To assess the effect of BMI on quality of life and depression levels depending on the type of bariatric surgery. The group included 57 women and 43 men aged 20-60 years (mean age 40 years) with BMI from 36 to 40 (31%) and > 40 (69%). Twelve patients (12%) underwent laparoscopic adjustable gastric binding (LAGB), 58 (58%) sleeve gastrectomy, and 30 (30%) Roux-en-Y Gastric Bypass (RYGB). The Bariatric Analysis and Reporting Outcome System (BAROS) was used to assess QoL. The severity of mood disorders was assessed using the Self-Rating Scale of Depression and Anxiety. Six months or 1 year after bariatric surgery, the number of patients with BMI > 40 had decreased from 69 to 14%. We found that the time since bariatric surgery contributed to a significant (p bariatric surgery, including quality of life. Long-term monitoring will be essential in determining psychological changes and the degree of weight loss.

Alternative regression models to assess increase in childhood BMI

OpenAIRE

Beyerlein, Andreas; Fahrmeir, Ludwig; Mansmann, Ulrich; Toschke, André M

2008-01-01

Abstract Background Body mass index (BMI) data usually have skewed distributions, for which common statistical modeling approaches such as simple linear or logistic regression have limitations. Methods Different regression approaches to predict childhood BMI by goodness-of-fit measures and means of interpretation were compared including generalized linear models (GLMs), quantile regression and Generalized Additive Models for Location, Scale and Shape (GAMLSS). We analyzed data of 4967 childre...

Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.

Science.gov (United States)

Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio

2015-10-26

The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in

Impact and duration effect of telemonitoring on ΗbA1c, BMI and cost in insulin-treated Diabetes Mellitus patients with inadequate glycemic control: A randomized controlled study.

Science.gov (United States)

Fountoulakis, Stelios; Papanastasiou, Labrini; Gryparis, Alexandros; Markou, Athina; Piaditis, George

2015-01-01

To monitor and control the blood glucose levels in inefficiently insulin-treated patients with type 1 and 2 diabetes mellitus (DM) using a telemonitoring system and determine whether the improvement of HbA1c has a lasting effect following its discontinuation. Seventy inefficiently controlled insulin-treated DM patients using telemonitoring (telemonitoring group-TG) [HbA1c 9.9±2.3% (85±24.9mmol/mol)] and 35 age-, body mass index (BMI)- and Hba1c-matched insulin-treated patients receiving outpatient care (control group-CG) [HbA1c 9.7±2.1% (82±23.4mmol/mol)] were enrolled. Data of TG were transmitted from the glucose-meters to our computers via modem. Communication was achieved via e-mails and mobile phone text-messages through integrated software. HbA1c and BMI were evaluated at enrollment, 3 and 6 months, and 6 months after telemonitoring discontinuation. Frequency of hypo- and hyperglycemias and cost were also analyzed. Significant reduction in HbA1c was observed in TG both at 3 [7.1±1.0% (54±10.5mmol/mol) p<0.001] and 6 months [6.9±0.9% (52±9.5mmol/mol) p<0.001], compared to the CG group at the same timepoints. Significant reduction was also observed in the TG subgroups with ΗbA1c≥10% and 10>HbA1c≥7.5% at 3 and 6 months, compared to CG. No statistically significant differences in BMI were observed between TG and CG. Six months after telemonitoring discontinuation, HbA1c in TG was slightly increased [7.3±1.0% (56±10.4mol/mol)]. Attenuation was also observed in both TG subgroups. Compared to CG, the number of monthly hypo- and hyperglycemias was reduced in TG. The intervention had a financial benefit for patients living more than 100 km from the health care provider. Telemonitoring can result in reduction of HbA1c and frequency of hypo- and hyperglycemias. This beneficial effect is slightly attenuated 6 months after terminating telemonitoring.

BMI mediates the association between low educational level and higher blood pressure during pregnancy in Japan.

Science.gov (United States)

Jwa, Seung Chik; Fujiwara, Takeo; Hata, Akira; Arata, Naoko; Sago, Haruhiko; Ohya, Yukihiro

2013-04-25

Research investigating the association between socioeconomic status (SES) and blood pressure (BP) during pregnancy is limited and its underlying pathway is unknown. The aim of this study was to investigate the mediators of the association between educational level as an indicator of the SES and BP in early and mid-pregnancy among Japanese women. Nine hundred and twenty-three pregnant women in whom BP was measured before 16 weeks and at 20 weeks of gestation were enrolled in this study. Maternal educational levels were categorized into three groups: high (university or higher), mid (junior college), and low (junior high school, high school, or vocational training school). The low educational group had higher systolic (low vs. high, difference = 2.39 mmHg, 95% confidence interval [CI]: 0.59 to 4.19) and diastolic BP levels (low vs. high, difference = 0.74 mmHg, 95% CI: -0.52 to 1.99) in early pregnancy. However, the same associations were not found after adjustment for pre-pregnancy body mass index (BMI). BP reduction was observed in mid-pregnancy in all three educational groups and there was no association between educational level and pregnancy-induced hypertension. In Japanese women, the low educational group showed higher BP during pregnancy than the mid or high educational groups. Pre-pregnancy BMI mediates the association between educational level and BP.

Higher BMI Is Associated with Reduced Cognitive Performance in Division I Athletes

Directory of Open Access Journals (Sweden)

Andrew Fedor

2013-04-01

Full Text Available Objective: Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT in Division I collegiate athletes. Methods: Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Results: Regression analyses revealed that BMI incrementally predicted performance on visual memory (R2 change = 0.015, p = 0.026 beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17, visual memory (r = -0.16, and visual motor speed (r = -0.12. Conclusions: These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations.

Higher BMI is associated with reduced cognitive performance in division I athletes.

Science.gov (United States)

Fedor, Andrew; Gunstad, John

2013-01-01

Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT) in Division I collegiate athletes. Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Regression analyses revealed that BMI incrementally predicted performance on visual memory (R(2) change = 0.015, p = 0.026) beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17), visual memory (r = -0.16), and visual motor speed (r = -0.12). These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations. Copyright © 2013 S. Karger GmbH, Freiburg.

Comparison of BMI and physical activity between old order Amish children and non-Amish children.

Science.gov (United States)

Hairston, Kristen G; Ducharme, Julie L; Treuth, Margarita S; Hsueh, Wen-Chi; Jastreboff, Ania M; Ryan, Kathy A; Shi, Xiaolian; Mitchell, Braxton D; Shuldiner, Alan R; Snitker, Soren

2013-04-01

The Old Order Amish (OOA) is a conservative Christian sect of European origin living in Pennsylvania. Diabetes is rare in adult OOA despite a mean BMI rivaling that in the general U.S. non-Hispanic white population. The current study examines childhood factors that may contribute to the low prevalence of diabetes in the OOA by comparing OOA children aged 8-19 years with National Health and Nutrition Examination Survey (NHANES) data and children from Maryland's Eastern Shore (ES), a nearby, non-Amish, rural community. We hypothesized that pediatric overweight is less common in OOA children, that physical activity (PA) and BMI are inversely correlated, and that OOA children are more physically active than ES children. We obtained anthropometric data in 270 OOA children and 229 ES children (166 non-Hispanic white, 60 non-Hispanic black, 3 Hispanic). PA was measured by hip-worn accelerometers in all ES children and in 198 OOA children. Instrumentation in 43 OOA children was identical to ES children. OOA children were approximately 3.3 times less likely than non-Hispanic white ES children and NHANES estimates to be overweight (BMI ≥85th percentile, Centers for Disease Control and Prevention). Time spent in moderate/vigorous PA (MVPA) was inversely correlated to BMI z-score (r = -0.24, P = 0.0006). PA levels did not differ by ethnicity within the ES group, but OOA children spent an additional 34 min/day in light activity (442 ± 56 vs. 408 ± 75, P = 0.005) and, impressively, an additional 53 min/day in MVPA (106 ± 54 vs. 53 ± 32, P < 0.0001) compared with ES children. In both groups, boys were more active than girls but OOA girls were easily more active than ES boys. We confirmed all three hypotheses. Together with our previous data, the study implies that the OOA tend to gain their excess weight relatively late in life and that OOA children are very physically active, both of which may provide some long-term protection against diabetes.

The match-to-match variation of match-running in elite female soccer.

Science.gov (United States)

Trewin, Joshua; Meylan, César; Varley, Matthew C; Cronin, John

2018-02-01

The purpose of this study was to examine the match-to-match variation of match-running in elite female soccer players utilising GPS, using full-match and rolling period analyses. Longitudinal study. Elite female soccer players (n=45) from the same national team were observed during 55 international fixtures across 5 years (2012-2016). Data was analysed using a custom built MS Excel spreadsheet as full-matches and using a rolling 5-min analysis period, for all players who played 90-min matches (files=172). Variation was examined using co-efficient of variation and 90% confidence limits, calculated following log transformation. Total distance per minute exhibited the smallest variation when both the full-match and peak 5-min running periods were examined (CV=6.8-7.2%). Sprint-efforts were the most variable during a full-match (CV=53%), whilst high-speed running per minute exhibited the greatest variation in the post-peak 5-min period (CV=143%). Peak running periods were observed as slightly more variable than full-match analyses, with the post-peak period very-highly variable. Variability of accelerations (CV=17%) and Player Load (CV=14%) was lower than that of high-speed actions. Positional differences were also present, with centre backs exhibiting the greatest variation in high-speed movements (CV=41-65%). Practitioners and researchers should account for within player variability when examining match performances. Identification of peak running periods should be used to assist worst case scenarios. Whilst micro-sensor technology should be further examined as to its viable use within match-analyses. Copyright © 2017 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

Science.gov (United States)

Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

2017-12-01

Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

Attenuated associations between increasing BMI and unfavorable lipid profiles in Chinese Buddhist vegetarians.

Science.gov (United States)

Zhang, Hui-Jie; Han, Peng; Sun, Su-Yun; Wang, Li-Ying; Yan, Bing; Zhang, Jin-Hua; Zhang, Wei; Yang, Shu-Yu; Li, Xue-Jun

2013-01-01

Obesity is related to hyperlipidemia and risk of cardiovascular disease. Health benefits of vegetarian diets have well-documented in the Western countries where both obesity and hyperlipidemia were prevalent. We studied the association between BMI and various lipid/lipoprotein measures, as well as between BMI and predicted coronary heart disease probability in lean, low risk populations in Southern China. The study included 170 Buddhist monks (vegetarians) and 126 omnivore men. Interaction between BMI and vegetarian status was tested in the multivariable regression analysis adjusting for age, education, smoking, alcohol drinking, and physical activity. Compared with omnivores, vegetarians had significantly lower mean BMI, blood pressures, total cholesterol, low density lipoprotein cholesterol, high density lipoprotein cholesterol, total cholesterol to high density lipoprotein ratio, triglycerides, apolipoprotein B and A-I, as well as lower predicted probability of coronary heart disease. Higher BMI was associated with unfavorable lipid/lipoprotein profile and predicted probability of coronary heart disease in both vegetarians and omnivores. However, the associations were significantly diminished in Buddhist vegetarians. Vegetarian diets not only lower BMI, but also attenuate the BMI-related increases of atherogenic lipid/ lipoprotein and the probability of coronary heart disease.

EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer

NARCIS (Netherlands)

Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten

2008-01-01

Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that

Injury incidence, reactivity and ease of handling of horses kept in groups: A matched case control study in four Nordic countries

DEFF Research Database (Denmark)

Keeling, L.J.; Bøe, K.E.; Christensen, Janne Winther

2016-01-01

evaluated. It was hypothesized that a more socially variable group composition has beneficial effects on behaviour, ease of handling and reducing reactivity whereas frequent changes in group composition has negative consequences, resulting in more injuries. We found that differences in treatment effects...... horses from groups and horses’ reactivity to a fearful stimulus. Using a matched case control design, 61 groups of horses were studied in Denmark, Norway, Finland and Sweden. They were allocated into groups of similar or different age and sex or where membership changed regularly or remained stable....... Injuries were recorded before mixing the horses into treatment groups, the day after mixing and four weeks later. Reactivity of horses to a moving novel object and the behaviour of a horse being removed from its group and the reactions of other group members towards this horse and the handler were...

Optimum BMI cut points to screen asian americans for type 2 diabetes.

Science.gov (United States)

Araneta, Maria Rosario G; Kanaya, Alka M; Hsu, William C; Chang, Healani K; Grandinetti, Andrew; Boyko, Edward J; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; McNeely, Marguerite J; Onishi, Yukiko; Sato, Kyoko K; Fujimoto, Wilfred Y

2015-05-01

Asian Americans manifest type 2 diabetes at low BMI levels but may not undergo diagnostic testing for diabetes if the currently recommended BMI screening cut point of ≥25 kg/m(2) is followed. We aimed to ascertain an appropriate lower BMI cut point among Asian-American adults without a prior diabetes diagnosis. We consolidated data from 1,663 participants, ages ≥45 years, without a prior diabetes diagnosis, from population- and community-based studies, including the Mediators of Atherosclerosis in South Asians Living in America study, the North Kohala Study, the Seattle Japanese American Community Diabetes Study, and the University of California San Diego Filipino Health Study. Clinical measures included a 2-h 75-g oral glucose tolerance test, BMI, and glycosylated hemoglobin (HbA1c). Mean age was 59.7 years, mean BMI was 25.4 kg/m(2), 58% were women, and type 2 diabetes prevalence (American Diabetes Association 2010 criteria) was 16.9%. At BMI ≥25 kg/m(2), sensitivity (63.7%), specificity (52.8%), and Youden index (0.16) values were low; limiting screening to BMI ≥25 kg/m(2) would miss 36% of Asian Americans with type 2 diabetes. For screening purposes, higher sensitivity is desirable to minimize missing cases, especially if the diagnostic test is relatively simple and inexpensive. At BMI ≥23 kg/m(2), sensitivity (84.7%) was high in the total sample and by sex and Asian-American subgroup and would miss only ∼15% of Asian Americans with diabetes. The BMI cut point for identifying Asian Americans who should be screened for undiagnosed type 2 diabetes should be <25 kg/m(2), and ≥23 kg/m(2) may be the most practical. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

Meta-analysis of genome-wide linkage studies in BMI and obesity.

Science.gov (United States)

Saunders, Catherine L; Chiodini, Benedetta D; Sham, Pak; Lewis, Cathryn M; Abkevich, Victor; Adeyemo, Adebowale A; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S; Blangero, John; Boehnke, Michael; Borecki, Ingrid B; Chagnon, Yvon C; Chen, Wei; Comuzzie, Anthony G; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F; Froguel, Philippe; Hanson, Robert L; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H; Li, Weidong; Luke, Amy; Martin, Lisa J; Nash, Matthew; Ohman, Miina; Palmer, Lyle J; Peltonen, Leena; Perola, Markus; Price, R Arlen; Redline, Susan; Srinivasan, Sathanur R; Stern, Michael P; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A

2007-09-01

The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. We identified 37 published studies containing data on over 31,000 individuals from more than >10,000 families and obtained genome-wide logarithm of the odds (LOD) scores, non-parametric linkage (NPL) scores, or maximum likelihood scores (MLS). BMI was analyzed in a pooled set of all studies, as a subgroup of 10 studies that used BMI-defined obesity, and for subgroups ascertained through type 2 diabetes, hypertension, or subjects of European ancestry. Bins at chromosome 13q13.2- q33.1, 12q23-q24.3 achieved suggestive evidence of linkage to BMI in the pooled analysis and samples ascertained for hypertension. Nominal evidence of linkage to these regions and suggestive evidence for 11q13.3-22.3 were also observed for BMI-defined obesity. The FTO obesity gene locus at 16q12.2 also showed nominal evidence for linkage. However, overall distribution of summed rank p values <0.05 is not different from that expected by chance. The strongest evidence was obtained in the families ascertained for hypertension at 9q31.1-qter and 12p11.21-q23 (p < 0.01). Despite having substantial statistical power, we did not unequivocally implicate specific loci for BMI or obesity. This may be because genes influencing adiposity are of very small effect, with substantial genetic heterogeneity and variable dependence on environmental factors. However, the observation that the FTO gene maps to one of the highest ranking bins for obesity is interesting and, while not a validation of this approach, indicates that other potential loci identified in this study should be investigated further.

Association between Frequency of Consumption of Fruit, Vegetables, Nuts and Pulses and BMI: Analyses of the International Study of Asthma and Allergies in Childhood (ISAAC

Directory of Open Access Journals (Sweden)

Clare R. Wall

2018-03-01

Full Text Available Diets which emphasize intakes of plant-based foods are recommended to reduce disease risk and for promoting healthy weight. The aim of this study was to examine the association between fruit, vegetables, pulses and nut intake and body mass index (BMI across countries in adolescents (13–14 years and children (6–7 years. Data from the International Study of Asthma and Allergies in Childhood; 77,243 children’s parents and 201,871 adolescents was used to examine the association between dietary intake (Food Frequency Questionnaire and BMI using general linear models, adjusting for country gross national index. Adolescents who consumed fruit, vegetables, pulses and nuts three or more times a week had a lower BMI than the never or occasional group; eating nuts three or more times a week, was associated with a BMI value of 0.274 kg/m2 lower than the never group (p < 0.001. Compared to children who never or occasionally reported eating vegetables, those reporting that they ate vegetables three or more times per week had a lower BMI of −0.079 kg/m2. In this large global study, an inverse association was observed between BMI and the reported increasing intake of vegetables in 6–7 years old and fruit, vegetables, pulses and nuts in adolescents. This study supports current dietary recommendations which emphasize the consumption of vegetables, nut and pulses, although the effect sizes were small.

Initial experience of robotic versus laparoscopic colectomy for transverse colon cancer: a matched case-control study.

Science.gov (United States)

de'Angelis, Nicola; Alghamdi, Salah; Renda, Andrea; Azoulay, Daniel; Brunetti, Francesco

2015-10-09

Robotic surgery for transverse colon cancer has rarely been described. This study reports our initial experience in robotic resection for transverse colon cancer, by comparing robotic transverse colectomy (RC) to laparoscopic transverse colectomy (LC) in terms of safety, feasibility, short-term outcomes, and the surgeon's psychological stress and physical pain. The study population included the first 22 consecutive patients who underwent RC between March 2013 and December 2014 for histologically confirmed transverse colon adenocarcinoma. These patients were compared with 22 matched patients undergoing LC between December 2010 and February 2013. Patients were matched based on age, gender, body mass index (BMI), American Society of Anesthesiology (ASA) score, American Joint Committee on Cancer (AJCC) tumor stage, and tumor location (ratio 1:1). Mortality, morbidity, operative, and short-term oncologic outcomes were compared between groups. The operating surgeon's stress and pain were assessed before and after surgery on a 0-100-mm visual analog scale. The demographic and preoperative characteristics were comparable between RC and LC patients. No group difference was observed for intraoperative complications, blood loss, postoperative pain, time to flatus, time to regular diet, and hospital stay. RC was associated with longer operative time than LC (260 min vs. 225 min; p = 0.014), but the overall operative and robotic time in the RC group decreased over time reflecting the increasing experience in performing this procedure. No conversion to laparotomy was observed in the RC group, while two LC patients were converted due to uncontrolled bleeding and technically difficult middle colic pedicle dissection. Postoperative complications (Dindo-Clavien grade I or II) occurred in 11.3 % of patients with no group difference. Mortality was nil. All resections were R0, with >12 lymph nodes harvested in 90.9 % of RC and 95.5 % of LC patients. The surgeon's stress was

Nonlinear association of BMI with all-cause and cardiovascular mortality in type 2 diabetes mellitus: a systematic review and meta-analysis of 414,587 participants in prospective studies.

Science.gov (United States)

Zaccardi, Francesco; Dhalwani, Nafeesa N; Papamargaritis, Dimitris; Webb, David R; Murphy, Gavin J; Davies, Melanie J; Khunti, Kamlesh

2017-02-01

The relationship between BMI and mortality has been extensively investigated in the general population; however, it is less clear in people with type 2 diabetes. We aimed to assess the association of BMI with all-cause and cardiovascular mortality in individuals with type 2 diabetes mellitus. We searched electronic databases up to 1 March 2016 for prospective studies reporting associations for three or more BMI groups with all-cause and cardiovascular mortality in individuals with type 2 diabetes mellitus. Study-specific associations between BMI and the most-adjusted RR were estimated using restricted cubic splines and a generalised least squares method before pooling study estimates with a multivariate random-effects meta-analysis. We included 21 studies including 24 cohorts, 414,587 participants, 61,889 all-cause and 4470 cardiovascular incident deaths; follow-up ranged from 2.7 to 15.9 years. There was a strong nonlinear relationship between BMI and all-cause mortality in both men and women, with the lowest estimated risk from 31-35 kg/m 2 and 28-31 kg/m 2 (p value for nonlinearity 1) respectively. The risk of mortality at higher BMI values increased significantly only in women, whilst lower values were associated with higher mortality in both sexes. Limited data for cardiovascular mortality were available, with a possible inverse linear association with BMI (higher risk for BMI type 2 diabetes, BMI is nonlinearly associated with all-cause mortality with lowest risk in the overweight group in both men and women. Further research is needed to clarify the relationship with cardiovascular mortality and assess causality and sex differences.

Socioeconomic gradients in body mass index (BMI) in US immigrants during the transition to adulthood: examining the roles of parental education and intergenerational educational mobility.

Science.gov (United States)

Albrecht, Sandra S; Gordon-Larsen, Penny

2014-09-01

Despite comparatively lower socioeconomic status (SES), immigrants tend to have lower body weight and weaker SES gradients relative to US-born individuals. Yet, it is unknown how changes in SES over the life-course relate to body weight in immigrants versus US-born individuals. We used longitudinal data from a nationally representative, diverse sample of 13 701 adolescents followed into adulthood to investigate whether associations between SES mobility categories (educational attainment reported by individuals as adults and by their parents during adolescence) and body mass index (BMI) measured in adulthood varied by immigrant generation. Weighted multivariable linear regression models were adjusted for age, sex, race/ethnicity and immigrant generation. Among first-generation immigrants, although parental education was not associated with adult BMI, an immigrant's own education attainment was inversely associated with BMI (β=-2.6 kg/m(2); SE=0.9, peducational mobility was associated with lower adult mean BMI than remaining low SES (β=-2.5 kg/m(2); SE=1.2, pUS-born respondents, college education in adulthood did not attenuate the negative association between parental education and adult BMI. Although an SES gradient emerged in adulthood for immigrants, remaining low SES from adolescence to adulthood was not associated with loss of health advantage relative to US-born respondents of US-born parents of similar SES. Immigrants were able to translate higher SES in adulthood into a lower adult mean BMI regardless of childhood SES, whereas the consequences of lower childhood SES had a longer reach even among the upwardly mobile US born. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Mechanism by which BMI influences leisure-time physical activity behavior.

Science.gov (United States)

Godin, Gaston; Bélanger-Gravel, Ariane; Nolin, Bertrand

2008-06-01

The objective of this prospective study was to clarify the mechanism by which BMI influences leisure-time physical activity. This was achieved in accordance with the assumptions underlying the Theory of Planned Behavior (TPB), considered as one of the most useful theories to predict behavior adoption. At baseline, a sample of 1,530 respondents completed a short questionnaire to measure intention and perceived behavioral control (PBC), the two proximal determinants of behavior of TPB. Past behavior, sociodemographic variables, and weight and height were also assessed. The dependent variable, leisure-time physical activity was assessed 3 months later. Hierarchical multiple regression analyses revealed that BMI is a direct predictor of future leisure-time physical activity, not mediated by the variables of TPB. Additional hierarchical analyses indicated that BMI was not a moderator of the intention-behavior and PBC-behavior relationships. The results of this study suggest that high BMI is a significant negative determinant of leisure-time physical activity. This observation reinforces the importance of preventing weight gain as a health promotion strategy for avoiding a sedentary lifestyle.

Disentangling the associations between parental BMI and offspring body composition using the four‐component model

Science.gov (United States)

Grijalva‐Eternod, Carlos; Cortina‐Borja, Mario; Williams, Jane; Fewtrell, Mary; Wells, Jonathan

2016-01-01

ABSTRACT Objectives This study sets out to investigate the intergenerational associations between the body mass index (BMI) of parents and the body composition of their offspring. Methods The cross‐sectional data were analyzed for 511 parent–offspring trios from London and south‐east England. The offspring were aged 5–21 years. Parental BMI was obtained by recall and offspring fat mass and lean mass were obtained using the four‐component model. Multivariable regression analysis, with multiple imputation for missing paternal values was used. Sensitivity analyses for levels of non‐paternity were conducted. Results A positive association was seen between parental BMI and offspring BMI, fat mass index (FMI), and lean mass index (LMI). The mother's BMI was positively associated with the BMI, FMI, and LMI z‐scores of both daughters and sons and of a similar magnitude for both sexes. The father's BMI showed similar associations to the mother's BMI, with his son's BMI, FMI, and LMI z‐scores, but no association with his daughter. Sensitivity tests for non‐paternity showed that maternal coefficients remained greater than paternal coefficients throughout but there was no statistical difference at greater levels of non‐paternity. Conclusions We found variable associations between parental BMI and offspring body composition. Associations were generally stronger for maternal than paternal BMI, and paternal associations appeared to differ between sons and daughters. In this cohort, the mother's BMI was statistically significantly associated with her child's body composition but the father's BMI was only associated with the body composition of his sons. Am. J. Hum. Biol. 28:524–533, 2016. © 2016 The Authors American Journal of Human Biology Published by Wiley Periodicals, Inc. PMID:26848813

Deriving Prostate Alpha-Beta Ratio Using Carefully Matched Groups, Long Follow-Up and the Phoenix Definition of Biochemical Failure

International Nuclear Information System (INIS)

Shaffer, Richard; Pickles, Tom; Lee, Richard; Moiseenko, Vitali

2011-01-01

Purpose: Prior studies have derived low values of alpha-beta ratio (a/ss) for prostate cancer of approximately 1-2 Gy. These studies used poorly matched groups, differing definitions of biochemical failure, and insufficient follow-up. Methods and Materials: National Comprehensive Cancer Network low- or low-intermediate risk prostate cancer patients, treated with external beam radiotherapy or permanent prostate brachytherapy, were matched for prostate-specific antigen, Gleason score, T-stage, percentage of positive cores, androgen deprivation therapy, and era, yielding 118 patient pairs. The Phoenix definition of biochemical failure was used. The best-fitting value for a/ss was found for up to 90-month follow-up using maximum likelihood analysis, and the 95% confidence interval using the profile likelihood method. Linear quadratic formalism was applied with the radiobiological parameters of relative biological effectiveness = 1.0, potential doubling time = 45 days, and repair half-time = 1 hour. Bootstrap analysis was performed to estimate uncertainties in outcomes, and hence in a/ss. Sensitivity analysis was performed by varying the values of the radiobiological parameters to extreme values. Results: The value of a/ss best fitting the outcomes data was >30 Gy, with lower 95% confidence limit of 5.2 Gy. This was confirmed on bootstrap analysis. Varying parameters to extreme values still yielded best-fit a/ss of >30 Gy, although the lower 95% confidence interval limit was reduced to 0.6 Gy. Conclusions: Using carefully matched groups, long follow-up, the Phoenix definition of biochemical failure, and well-established statistical methods, the best estimate of a/ss for low and low-tier intermediate-risk prostate cancer is likely to be higher than that of normal tissues, although a low value cannot be excluded.

p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells

Science.gov (United States)

Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah

2015-01-01

Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797

A Multi-Component Day-Camp Weight-Loss Program Is Effective in Reducing BMI in Children after One Year: A Randomized Controlled Trial.

Directory of Open Access Journals (Sweden)

Kristian Traberg Larsen

Full Text Available The objective of the present study was to evaluate the effectiveness of a one-year multi-component immersive day-camp weight-loss intervention for children with overweight and obesity. The study design was a parallel-group randomized controlled trial. One hundred fifteen 11-13-year-old children with overweight and obesity were randomized into either: A six-week day-camp intervention arm focusing on increased physical activity, and healthy diet followed by a subsequent one-year family-based intervention, or a standard intervention arm consisting of one weekly exercise session for six weeks. Body mass index (BMI was the primary outcome. BMI z-score, clustered cardiovascular risk z-score, and body composition were secondary outcomes. All outcomes were measured at baseline, six week-, and 52 week follow-up. After six weeks, children from the day-camp intervention arm had improved their BMI (-2.2 kg/m2 (95% CI -2.6 to -1.7, P<0.001 and all secondary outcomes when compared to the children from the standard intervention arm. After 52 weeks, the day-camp intervention arm had a lower BMI (-1.2 kg/m2 (95% CI -1.8 to -0.5, P = 0.001, and BMI z-score (-0.20 (95% CI -0.35 to -0.05, P = 0.008, and clustered cardiovascular risk z-score (-0.23 (95% CI -0.37 to -0.08, P = 0.002 compared to the standard intervention arm. No group differences were detected in body composition after 52 weeks. This study shows that the day-camp intervention arm is effective in reducing BMI and improving the metabolic health of children with overweight and obesity. However, the effects seem to be diminishing over time.

Assessing the genetic overlap between BMI and cognitive function

Science.gov (United States)

Marioni, R E; Yang, J; Dykiert, D; Mõttus, R; Campbell, A; Ibrahim-Verbaas, Carla A; Bressler, Jan; Debette, Stephanie; Schuur, Maaike; Smith, Albert V; Davies, Gail; Bennett, David A; Deary, Ian J; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosely Jr, Thomas H; Davies, G; Hayward, C; Porteous, D J; Visscher, P M; Deary, I J

2016-01-01

Obesity and low cognitive function are associated with multiple adverse health outcomes across the life course. They have a small phenotypic correlation (r=−0.11; high body mass index (BMI)−low cognitive function), but whether they have a shared genetic aetiology is unknown. We investigated the phenotypic and genetic correlations between the traits using data from 6815 unrelated, genotyped members of Generation Scotland, an ethnically homogeneous cohort from five sites across Scotland. Genetic correlations were estimated using the following: same-sample bivariate genome-wide complex trait analysis (GCTA)–GREML; independent samples bivariate GCTA–GREML using Generation Scotland for cognitive data and four other samples (n=20 806) for BMI; and bivariate LDSC analysis using the largest genome-wide association study (GWAS) summary data on cognitive function (n=48 462) and BMI (n=339 224) to date. The GWAS summary data were also used to create polygenic scores for the two traits, with within- and cross-trait prediction taking place in the independent Generation Scotland cohort. A large genetic correlation of −0.51 (s.e. 0.15) was observed using the same-sample GCTA–GREML approach compared with −0.10 (s.e. 0.08) from the independent-samples GCTA–GREML approach and −0.22 (s.e. 0.03) from the bivariate LDSC analysis. A genetic profile score using cognition-specific genetic variants accounts for 0.08% (P=0.020) of the variance in BMI and a genetic profile score using BMI-specific variants accounts for 0.42% (P=1.9 × 10−7) of the variance in cognitive function. Seven common genetic variants are significantly associated with both traits at Pcognitive function. PMID:26857597

Food thought suppression: a matched comparison of obese individuals with and without binge eating disorder.

Science.gov (United States)

Barnes, Rachel D; Masheb, Robin M; Grilo, Carlos M

2011-12-01

Preliminary studies of non-clinical samples suggest that purposely attempting to avoid thoughts of food, referred to as food thought suppression, is related to a number of unwanted eating- and weight-related consequences, particularly in obese individuals. Despite possible implications for the treatment of obesity and eating disorders, little research has examined food thought suppression in obese individuals with binge eating disorder (BED). This study compared food thought suppression in 60 obese patients with BED to an age-, gender-, and body mass index (BMI)-matched group of 59 obese persons who do not binge eat (NBO). In addition, this study examined the associations between food thought suppression and eating disorder psychopathology within the BED and NBO groups and separately by gender. Participants with BED and women endorsed the highest levels of food thought suppression. Food thought suppression was significantly and positively associated with many features of ED psychopathology in NBO women and with eating concerns in men with BED. Among women with BED, higher levels of food thought suppression were associated with higher frequency of binge eating, whereas among men with BED, higher levels of food thought suppression were associated with lower frequency of binge eating. Our findings suggest gender differences in the potential significance of food thought suppression in obese groups with and without co-existing binge eating problems. Copyright © 2011 Elsevier Ltd. All rights reserved.

Body mass index and lung cancer risk in never smokers

International Nuclear Information System (INIS)

Kagohashi, K.; Satoh, H.; Kurishima, K.; Ishikawa, H.; Ohtsuka, M.

2006-01-01

Background. A relationship between body mass index (BMI) and lung cancer risk in never smokers has not been reported precisely. To evaluate the risk of lung cancer associated with BMI in never smokers, we conducted a case-control study. Methods. The relationship between BMI and the risk of lung cancer in never smokers was investigated in a study of 204 lung cancer cases and 398 controls admitted between 1987 and 2005. Controls were selected from hospitalized age-matched never-smoking patients with non-malignant respiratory disease. Results. When compared with BMI of the leanest group (BMI<20.8) in men, no inverse association between BMI and lung cancer was observed after the adjustment for age (the second BMI group: BMI≥ 20.8 to < 22.9; p=0.683, the third BMI group: BMI≥ 22.9 to < 24.9; p=0.745, and the highest BMI group: BMI≥ 25.0; p=0.327). Similarly, no association in women was found between BMI and lung cancer in these three BMI groups (the second group, p=0.639; the third group, p=0.667; the highest group, p=0.978) when compared with that of the leanest BMI group. Conclusions. Our present study indicated that the association between leanness and the risk of lung cancer might be influenced by other factors such as smoking. (author)

Recovery Kinetics of Knee Flexor and Extensor Strength after a Football Match

Science.gov (United States)

Draganidis, Dimitrios; Chatzinikolaou, Athanasios; Avloniti, Alexandra; Barbero-Álvarez, José C.; Mohr, Magni; Malliou, Paraskevi; Gourgoulis, Vassilios; Deli, Chariklia K.; Douroudos, Ioannis I.; Margonis, Konstantinos; Gioftsidou, Asimenia; Fouris, Andreas D.; Jamurtas, Athanasios Z.; Koutedakis, Yiannis; Fatouros, Ioannis G.

2015-01-01

We examined the temporal changes of isokinetic strength performance of knee flexor (KF) and extensor (KE) strength after a football match. Players were randomly assigned to a control (N = 14, participated only in measurements and practices) or an experimental group (N = 20, participated also in a football match). Participants trained daily during the two days after the match. Match and training overload was monitored with GPS devices. Venous blood was sampled and muscle damage was assessed pre-match, post-match and at 12h, 36h and 60h post-match. Isometric strength as well as eccentric and concentric peak torque of knee flexors and extensors in both limbs (dominant and non-dominant) were measured on an isokinetic dynamometer at baseline and at 12h, 36h and 60h after the match. Functional (KFecc/KEcon) and conventional (KFcon/KEcon) ratios were then calculated. Only eccentric peak torque of knee flexors declined at 60h after the match in the control group. In the experimental group: a) isometric strength of knee extensors and knee flexors declined (Pfootball-specific conditioning. Our data suggest that recovery kinetics of knee flexor and extensor strength after a football match demonstrate strength, limb and velocity specificity and may depend on match physical overload and players' physical conditioning level. PMID:26043222

Universal equation for estimating ideal body weight and body weight at any BMI.

Science.gov (United States)

Peterson, Courtney M; Thomas, Diana M; Blackburn, George L; Heymsfield, Steven B

2016-05-01

Ideal body weight (IBW) equations and body mass index (BMI) ranges have both been used to delineate healthy or normal weight ranges, although these 2 different approaches are at odds with each other. In particular, past IBW equations are misaligned with BMI values, and unlike BMI, the equations have failed to recognize that there is a range of ideal or target body weights. For the first time, to our knowledge, we merged the concepts of a linear IBW equation and of defining target body weights in terms of BMI. With the use of calculus and approximations, we derived an easy-to-use linear equation that clinicians can use to calculate both IBW and body weight at any target BMI value. We measured the empirical accuracy of the equation with the use of NHANES data and performed a comparative analysis with past IBW equations. Our linear equation allowed us to calculate body weights for any BMI and height with a mean empirical accuracy of 0.5-0.7% on the basis of NHANES data. Moreover, we showed that our body weight equation directly aligns with BMI values for both men and women, which avoids the overestimation and underestimation problems at the upper and lower ends of the height spectrum that have plagued past IBW equations. Our linear equation increases the sophistication of IBW equations by replacing them with a single universal equation that calculates both IBW and body weight at any target BMI and height. Therefore, our equation is compatible with BMI and can be applied with the use of mental math or a calculator without the need for an app, which makes it a useful tool for both health practitioners and the general public. © 2016 American Society for Nutrition.

Social modeling of eating mediated by mirror neuron activity: A causal model moderated by frontal asymmetry and BMI.

Science.gov (United States)

McGeown, Laura; Davis, Ron

2018-02-15

The social modeling of eating effect refers to the consistently demonstrated phenomenon that individuals tend to match their quantity of food intake to their eating companion. The current study sought to explore whether activity within the mirror neuron system (MNS) mediates the social modeling of eating effect as a function of EEG frontal asymmetry and body mass index (BMI). Under the guise of rating empathy, 93 female undergraduates viewed a female video confederate "incidentally" consume either a low or high intake of chips while electroencephalogram (EEG) activity was recorded. Subsequent ad libitum chip consumption was quantified. A first- and second-stage dual moderation model revealed that frontal asymmetry and BMI moderated an indirect effect of model consumption on participants' food consumption as mediated by MNS activity at electrode site C3, a 3 b 3 =-0.718, SE=0.365, 95% CI [-1.632, -0.161]. Left frontal asymmetry was associated with greater mu activity and a positive association between model and participant chip consumption, while right frontal asymmetry was associated with less mu activity and a negative association between model and participant consumption. Across all levels of frontal asymmetry, the effect was only significant among those with a BMI at the 50th percentile or lower. Thus, among leaner individuals, the MNS was demonstrated to mediate social modeling of eating, as moderated by frontal asymmetry. These findings are integrated within the normative account of social modeling of eating. It is proposed that the normative framework may benefit from consideration of both conscious and unconscious operation of intake norms. Copyright © 2017 Elsevier B.V. All rights reserved.

Fitness differences according to BMI categories: a new point of view.

Science.gov (United States)

Lovecchio, Nicola; Zago, Matteo

2018-03-06

Many studies have reported negative association between fitness level and BMI categories but the lack of body weight correction and and the systematic use of physical endurance test made these differences controversial. Thus, the aim of this study was the assessment of physical fitness level associated to BMI using alternative tests. BMI was calculated as body mass/stature2 while fitness level was assessed using field test. In particular, Sit and Reach (SAR), Standing Broad Jump (SBJ), Shuttle Run Test 5mx 10 (SHR), Sit ups (SUP), Bent arm hang (BAH) were assessed in 2545 students. Subsequently, normal weight/overweight/obesity/underweight/thinness students were classified according to the cut-off points defined in literature and then the relative fitness results. The performances in SBJ showed very low differences between BMI categories such as for SUP test. The effects size in SHR were low or close to moderate while in BAH thin students revealed high performance than normal/overweight peers. In SAR test no clear trends in the BMI categories were observed. All test (exluding BAH) were similar for normal, overweight and thin students. This finding can be useful to teachers to encourage over/under-weighted students to adopt active life style because they are close to normal weight counterparts.

The influence of successive matches on match-running performance during an under-23 international soccer tournament: The necessity of individual analysis.

Science.gov (United States)

Varley, Matthew C; Di Salvo, Valter; Modonutti, Mattia; Gregson, Warren; Mendez-Villanueva, Alberto

2018-03-01

This study investigated the effects of successive matches on match-running in elite under-23 soccer players during an international tournament. Match-running data was collected using a semi-automated multi-camera tracking system during an international under-23 tournament from all participating outfield players. Players who played 100% of all group stage matches were included (3 matches separated by 72 h, n = 44). Differences in match-running performance between matches were identified using a generalised linear mixed model. There were no clear effects for total, walking, jogging, running, high-speed running and sprinting distance between matches 1 and 3 (effect size (ES); -0.32 to 0.05). Positional analysis found that sprint distance was largely maintained from matches 1 to 3 across all positions. Attackers had a moderate decrease in total, jogging and running distance between matches 1 and 3 (ES; -0.72 to -0.66). Classifying players as increasers or decreasers in match-running revealed that match-running changes are susceptible to individual differences. Sprint performance appears to be maintained over successive matches regardless of playing position. However, reductions in other match-running categories vary between positions. Changes in match-running over successive matches affect individuals differently; thus, players should be monitored on an individual basis.

Metabolic power demands of rugby league match play.

Science.gov (United States)

Kempton, Tom; Sirotic, Anita Claire; Rampinini, Ermanno; Coutts, Aaron James

2015-01-01

To describe the metabolic demands of rugby league match play for positional groups and compare match distances obtained from high-speed-running classifications with those derived from high metabolic power. Global positioning system (GPS) data were collected from 25 players from a team competing in the National Rugby League competition over 39 matches. Players were classified into positional groups (adjustables, outside backs, hit-up forwards, and wide-running forwards). The GPS devices provided instantaneous raw velocity data at 5 Hz, which were exported to a customized spreadsheet. The spreadsheet provided calculations for speed-based distances (eg, total distance; high-speed running, >14.4 km/h; and very-high-speed running, >18.1 km/h) and metabolic-power variables (eg, energy expenditure; average metabolic power; and high-power distance, >20 W/kg). The data show that speed-based distances and metabolic power varied between positional groups, although this was largely related to differences in time spent on field. The distance covered at high running speed was lower than that obtained from high-power thresholds for all positional groups; however, the difference between the 2 methods was greatest for hit-up forwards and adjustables. Positional differences existed for all metabolic parameters, although these are at least partially related to time spent on the field. Higher-speed running may underestimate the demands of match play when compared with high-power distance-although the degree of difference between the measures varied by position. The analysis of metabolic power may complement traditional speed-based classifications and improve our understanding of the demands of rugby league match play.

BMI and obesity incidence in relation to food patterns of Polish older people

DEFF Research Database (Denmark)

Wadolowska, L.; Danowska-Oziewicz, M.; Niedzwiedzka, E.

2006-01-01

BMI differentiation and obesity incidence in relation to food patterns of Polish older people were analysed. The research included 422 people aged 65+ years. 21 food patterns were separated by the factor analysis. On the basis of the self-reported body mass and height, the BMI and percentages...... of overweight or obese people were calculated. The increase of the BMI and overweight and obesity incidence for both sexes was unequivocally connected with eating rye. The increase of the BMI and overweight and obesity incidence depended among women on consuming pork meat and alcoholic beverages. For men...

Meta-analysis of genome-wide linkage studies in BMI and obesity

NARCIS (Netherlands)

Saunders, Catherine L.; Chiodini, Benedetta D.; Sham, Pak; Lewis, Cathryn M.; Abkevich, Victor; Adeyemo, Adebowale A.; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S.; Blangero, John; Boehnke, Michael; Borecki, Ingrid B.; Chagnon, Yvon C.; Chen, Wei; Comuzzie, Anthony G.; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F.; Froguel, Philippe; Hanson, Robert L.; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H.; Li, Weidong; Luke, Amy; Martin, Lisa J.; Nash, Matthew; Ohman, Muena; Palmer, Lyle J.; Peltonen, Leena; Perola, Markus; Price, R. Arlen; Redline, Susan; Srinivasan, Sathanur R.; Stern, Michael P.; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A.

Objective: The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. Research Methods and Procedures: We identified 37 published studies containing data on over 31,000 individuals from more than >10,000

Association between Infancy BMI Peak and Body Composition and Blood Pressure at Age 5–6 Years

Science.gov (United States)

Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.

2013-01-01

Introduction The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and blood pressure at age 5–6 years were investigated. Methods Measurements from the Amsterdam Born Children and their Development (ABCD) study were available for this study. Blood pressure (systolic and diastolic) and body composition measures (BMI, waist-to-height ratio, fat percentage) were gathered during a health check at about 6 years of age (n = 2822). All children had multiple BMI measurements between the 0–4 years of age. For boys and girls separately, child-specific BMI peaks were extracted from mixed effect models. Associations between the estimated BMI peak and the health check measurements were analysed with linear models. In addition, we investigated the potential use of the BMI at 9 months as a surrogate measure for the magnitude of the BMI peak. Results After correction for the confounding effect of fetal growth, both timing and magnitude of the BMI peak were significantly and positively associated (pBMI peak showed no direct association with blood pressure at the age 5–6 year, but was mediated by the current BMI. The correlation between the magnitude of the BMI peak and BMI at 9 months was approximately 0.93 and similar associations with the measures at 5–6 years were found. Conclusion The magnitude of the BMI peak was associated with body composition measures at 5–6 years of age. Moreover, the BMI at 9 months could be used as surrogate measure for the magnitude of the BMI peak. PMID:24324605

Desirable factors for maintaining normal BMI of urban affluent women of Delhi.

Science.gov (United States)

Gupta, Anu Taneja; Siddhu, Anupa

2015-01-01

The study aimed to identify desirable social, familial, reproductive, dietary, and lifestyle factors for maintaining normal body mass index (BMI) of urban affluent women (25-45 years) in Delhi, India. A total of 387 urban affluent women with at least one living child participated in this cross-sectional study conducted from March 2008 to April 2010. Women were classified into four BMI categories on the basis of World Health Organization (WHO; 2004) classification for Asians. Significant factors for maintaining normal BMI were: Younger age, less parity, nuclear family, normal weight status of parents, postpartum weight gain between 2 and 3 kg, regularity in taking meals, fixed meal size, self-perceived normal weight, and shorter sitting time and television viewing time. Multivariate regression analysis identified five determining factors for maintaining BMI, which are normal weight of father, self-perceived normal weight, fixed meal size, sitting time less than 6 h/day, and television viewing time less than 1 h/day. By small lifestyle modifications, normal BMI can be maintained.

The Impact of Telephonic Wellness Coaching on Weight Loss: A “Natural Experiments for Translation in Diabetes (NEXT-D)” Study

Science.gov (United States)

Schmittdiel, Julie A.; Adams, Sara R.; Goler, Nancy; Sanna, Rashel S.; Boccio, Mindy; Bellamy, David J.; Brown, Susan D.; Neugebauer, Romain S.; Ferrara, Assiamira

2016-01-01

Objective To evaluate the impact of a population-based telephonic wellness coaching program on weight loss. Methods Individual-level segmented regression analysis of interrupted time series data comparing the BMI trajectories in the 12 months before vs. the 12 months after initiating coaching among a cohort of Kaiser Permanente Northern California (KPNC) members (n=954) participating in The Permanente Medical Group (TPMG) Wellness Coaching program in 2011. The control group was a 20:1 propensity-score matched control group (n=19,080) matched with coaching participants based on baseline demographic and clinical characteristics. Results Wellness coaching participants had a significant upward trend in BMI in the 12 months before their first Wellness coaching session, and a significant downward trend in BMI in the 12 months after their first session equivalent to a clinically significant reduction of greater than one unit of baseline BMI (pcoaching has a positive impact on BMI reduction that is both statistically and clinically significant. Future research and quality improvement efforts should focus on disseminating Wellness coaching for weight loss in diabetes patients and those at risk for developing the disease. PMID:28124501

Risk of a venous thromboembolic episode due to caesarean section and BMI

DEFF Research Database (Denmark)

Colmorn, Lotte Berdiin; Ladelund, S; Rasmussen, S

2014-01-01

BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery.......BMI significantly influences the risk of venous thromboembolism after emergency caesarean delivery compared with vaginal delivery....

Associations Between Parental BMI and the Family Nutrition and Physical Activity Environment in a Community Sample.

Science.gov (United States)

Williams, Joel E; Helsel, Brian; Griffin, Sarah F; Liang, Jessica

2017-12-01

The purpose of this study was to examine the relationship between parental BMI and the family environment and determine if differences exist in child diet and physical activity related parenting behaviors by parental BMI in a community sample of families recruited through elementary schools in a local school district. We found an association between parental BMI category and family nutrition and physical activity (FNPA) score. Families with an underweight or normal weight parent had a larger proportion (64.3%) of high (indicating a healthier family environment) FNPA scores and families with an overweight or obese parent had a smaller proportion (45.2%) of high FNPA scores (χ 2  = 5.247, P = 0.022). Families with a parent who was overweight or obese had 2.18 times the odds (95% CI 1.11-4.27) of being in the low FNPA ("less healthy" environment) group. Further, underweight/normal weight parents reported higher levels of monitoring of child diet (Z = -3.652, P authoritative parenting behaviors were associated with a less obesogenic home environment and a positive parenting style related to child eating and physical activity behaviors.

The Association between BMI and Different Frailty Domains: A U-Shaped Curve?

Science.gov (United States)

Rietman, M L; van der A, D L; van Oostrom, S H; Picavet, H S J; Dollé, M E T; van Steeg, H; Verschuren, W M M; Spijkerman, A M W

2018-01-01

Previous studies showed a U-shaped association between BMI and (physical) frailty. We studied the association between BMI and physical, cognitive, psychological, and social frailty. Furthermore, the overlap between and prevalence of these frailty domains was examined. Cross-sectional study. The Doetinchem Cohort Study is a longitudinal population-based study starting in 1987-1991 examining men and women aged 20-59 with follow-up examinations every 5 yrs. For the current analyses, we used data from round 5 (2008-2012) with 4019 participants aged 41-81 yrs. Physical frailty was defined as having ≥ 2 of 4 frailty criteria from the Frailty Phenotype (unintentional weight loss, exhaustion, physical activity, handgrip strength). Cognitive frailty was defined as the BMI was divided into four classes. Analyses were adjusted for sex, age, level of education, and smoking. A U-shaped association was observed between BMI and physical frailty, a small linear association for BMI and cognitive frailty and no association between BMI and psychological and social frailty. The four frailty domains showed only a small proportion of overlap. The prevalence of physical, cognitive and social frailty increased with age, whereas psychological frailty did not. We confirm that not only underweight but also obesity is associated with physical frailty. Obesity also seems to be associated with cognitive frailty. Further, frailty prevention should focus on multiple domains and target individuals at a younger age (<65yrs).

Increased genetic variance of BMI with a higher prevalence of obesity

DEFF Research Database (Denmark)

Rokholm, Benjamin; Silventoinen, Karri; Ängquist, Lars

2011-01-01

populations. Several recent studies suggest that the genetic effects on adiposity may be stronger when combined with presumed risk factors for obesity. We tested the hypothesis that a higher prevalence of obesity and overweight and a higher BMI mean is associated with a larger genetic variation in BMI....

The relation of weight suppression and BMI to bulimic symptoms.

Science.gov (United States)

Butryn, Meghan L; Juarascio, Adrienne; Lowe, Michael R

2011-11-01

High levels of weight suppression have been associated with greater binge eating and weight gain as well as poorer treatment outcome in bulimia nervosa. This study examined the relationship between weight suppression and bulimia nervosa symptoms and explored how weight suppression might interact with body mass index (BMI) in accounting for level of symptomatology at presentation for treatment. Participants were 64 women with threshold or sub-threshold bulimia nervosa. A clinical interview assessed binge eating and purging. Weight suppression and the interaction between BMI and weight suppression predicted frequency of binge eating such that participants with low BMI and high weight suppression engaged in the most binge eating. High levels of weight suppression also predicted more frequent purging. Additional research is warranted to examine mediators of these relationships. Copyright © 2010 Wiley Periodicals, Inc.

The oncoprotein and stem cell renewal factor BMI1 associates with poor clinical outcome in oesophageal cancer patients undergoing preoperative chemoradiotherapy

Directory of Open Access Journals (Sweden)

Yoshikawa Reigetsu

2012-10-01

Full Text Available Abstract Background The polycomb group (PcG family BMI1, acting downstream of the hedgehog (Hh pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated that Hh signalling activation can predict very earlier relapse of oesophageal cancers. As data were not available on the clinical role of BMI1 expression in oesophageal cancers after chemoradiotherapy (CRT, we analysed whether it could be also used to predict disease progression and prognosis in oesophageal cancer patients undergoing trimodality therapy of preoperative CRT and oesophagectomy. Methods Expressions of BMI1 and p16INK4A, a downstream target of PcG, were analysed in 78 patients with histologically confirmed oesophageal squamous cell carcinoma (ESCC after preoperative CRT by immunohistochemical staining. The association of BMI1 and p16INK4A expression with clinicopathologic characteristics was analysed by χ2-test. Survival analysis was carried out by the log-rank test using Kaplan-Meier method. Results Among 78 ESCC patients, 24 patients (30.8% showed BMI1 positivity, mainly localised in the nuclei of tumour cells. Patients harbouring BMI1-positive tumour cells showed significantly poorer prognoses than those without such cells or residual tumours (mean disease-free survival (DFS time 16.8 vs 71.2 months; 3-yr DFS 13.3% vs 49.9%, P=0.002; mean OS time 21.8 vs 76.6 months; 3-yr OS 16.2% vs 54.9%, P=0.0005. There was no significant correlation between p16INK4A expression and BMI1 expression. Conclusions Our study shows that BMI1 expression is a predictor of early relapse and poor prognosis in ESCC after CRT. These findings suggest that BMI1 signal activation might be involved in promoting cancer regrowth and progression after CRT, and might be indicative of emergence of ‘more aggressive’ cancer progenitor cells.

Relation between BMI and diabetes mellitus and its complications among US older adults.

Science.gov (United States)

Gray, Natallia; Picone, Gabriel; Sloan, Frank; Yashkin, Arseniy

2015-01-01

This study examined relations between elevated body mass index (BMI) and time to diagnosis with type 2 diabetes mellitus and its complications among older adults in the United States. Data came from the Medicare Current Beneficiary Survey, 1991-2010. A Cox proportional hazard model was used to assess relations between excess BMI at the first Medicare Current Beneficiary Survey interview and time to diabetes mellitus diagnosis, complications, and insulin dependence among Medicare beneficiaries, older than 65 years of age with no prior diabetes mellitus diagnosis, and who were not enrolled in Medicare Advantage (N = 14,657). Among individuals diagnosed as having diabetes mellitus, elevated BMIs were associated with a progressively higher risk of complications from diabetes mellitus. For women with a BMI ≥40, the risk of insulin dependence (hazard ratio [HR] 3.57; 95% confidence interval [CI] 2.36-5.39) was twice that for women with 25 ≤ BMI diabetes mellitus. For men, the increased risk of these complications occurred at higher BMI levels than in women. Ocular complications occurred at higher BMI levels than other complication types in both men and women.

No seasonality of birth in BMI at 7 years of age

DEFF Research Database (Denmark)

Jensen, Camilla Bjørn; Sørensen, Thorkild I.A.; Heitmann, Berit

2016-01-01

Seasonal variation in birth weight was found in a previous Danish study. In the present study we investigated if the seasonality in birth weight tracked into BMI at 7 years of age, but found no seasonality of birth in either BMI, overweight, or obesity. © 2016 Elsevier Ireland Ltd...

Outcomes associated with conventional versus lipid-based formulations of amphotericin B in propensity-matched groups

Directory of Open Access Journals (Sweden)

Campbell RS

2013-10-01

Full Text Available Rebecca S Campbell,1 Paresh Chaudhari,2 Harlen D Hays,1 Robert J Taylor,1 Brian H Nathanson,3 Samuel A Bozzette,1 David Horn4 1Cerner Research, Culver City, CA, USA; 2Astellas Scientific and Medical Affairs, Inc., Northbrook, IL, USA; 3OptiStatim, LLC, Longmeadow, MA, USA; 4David Horn LLC, Doylestown, PA, USA Background: Lipid-based formulations of amphotericin B (LF-AMB are indicated for treatment of invasive fungal infections in patients intolerant to conventional amphotericin B (CAB or with refractory infections. Physicians still may choose to administer CAB to such patients. We described the use of CAB and LF-AMB in this population and quantified differences in post-amphotericin B length of stay (LOS among survivors and hospital mortality in matched patients. Methods: Data were extracted from Health Facts (Cerner Corporation, Kansas City, MO, USA for a retrospective cohort analysis. Inpatients aged ≥18 years with evidence of fungal infection and with orders for LF-AMB or CAB on  ≥2 days from January 2001 to June 2010 were identified. Patients were required to have renal insufficiency or other relative contraindications to use of CAB, exposure to nephrotoxic agents, or evidence of a CAB-refractory infection. Multilevel (hierarchical mixed-effects logistic regression was used to determine factors associated with initial exposure to LF-AMB versus CAB. Multivariate adjustment of outcomes was done using propensity score matching. Results: 655 patients were identified: 322 patients initiated therapy with CAB and 333 initiated treatment with LF-AMB. Compared to those initiating CAB, patients initiating LF-AMB had greater acuity and underlying disease severity. In unadjusted analyses, hospital mortality was significantly higher in the LF-AMB group (32.2% versus 23.7%; P = 0.02. After propensity score matching and covariate adjustment, mortality equalized and observed differences in LOS after amphotericin B initiation decreased. Conclusion

MiR-218-targeting-Bmi-1 mediates the suppressive effect of 1,6,7-trihydroxyxanthone on liver cancer cells.

Science.gov (United States)

Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang

2015-01-01

Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.

Are associations between electronic media use and BMI different across levels of physical activity?

DEFF Research Database (Denmark)

Melkevik, Ole; Haug, Ellen; Rasmussen, Mette

2015-01-01

and girls who did not comply with physical activity guidelines. Among physically active adolescents, EM was found to be significantly associated with BMI or odds for overweight among girls, but not among boys. CONCLUSION: While the usage of EM appear to be inconsequential for BMI and the risk of overweight...... among physically active boys, we find evidence indicating that EM use is associated with BMI and risk for overweight among girls, including those who report complying with MVPA guidelines.......BACKGROUND: The use of electronic media has been found to be a risk factor for higher BMI and for being overweight. Physical activity has been found to be associated with lower BMI and lower risk for being overweight. Little is known about whether the associations between physical activity...

The association of plasma cysteine and gamma-glutamyltransferase with BMI and obesity.

LENUS (Irish Health Repository)

Elshorbagy, Amany K

2009-07-01

We recently reported a strong positive association of plasma total cysteine (tCys) with fat mass in over 5,000 subjects. As gamma-glutamyltransferase (GGT) enzyme increases cysteine availability by catalyzing glutathione breakdown and is positively associated with BMI and adiposity, we hypothesized that GGT might explain the association of tCys with adiposity. To study whether the associations of tCys and serum GGT with BMI and obesity were interrelated we conducted a cross-sectional study using data from 1,550 subjects recruited from nine European countries in the COMAC project. Multiple linear and logistic regression models and concentration-response curves were used. In age and sex-adjusted analyses, tCys showed strong positive associations with BMI (partial r = 0.19, P < 0.001), and obesity (odds ratio (OR) for 4th vs. 1st tCys quartile: 2.8; 95% confidence interval: 1.6-5.0, P < 0.001), both of which remained robust after adjustment for GGT and other metabolic and lifestyle confounders. Serum GGT was also a positive predictor of BMI (partial r = 0.17, P < 0.001) and obesity (OR for 4th vs. 1st GGT quartile: 4.8; 95% confidence interval: 2.5-9.2, P < 0.001), independent of tCys. However, the associations of GGT with BMI and obesity were weakened by adjustment for obesity-related factors such as serum lipids and blood pressure. These results indicate that tCys is a strong positive predictor of BMI and obesity, independent of GGT and other obesity-related factors. We also suggest that the association of serum GGT with BMI and obesity is unrelated to the role of GGT in cysteine turnover. The potential link between cysteine and fat metabolism should be further evaluated.

Difficulty buying food, BMI, and eating habits in young children.

Science.gov (United States)

Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S

2018-01-22

To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.

Matching theory

CERN Document Server

Plummer, MD

1986-01-01

This study of matching theory deals with bipartite matching, network flows, and presents fundamental results for the non-bipartite case. It goes on to study elementary bipartite graphs and elementary graphs in general. Further discussed are 2-matchings, general matching problems as linear programs, the Edmonds Matching Algorithm (and other algorithmic approaches), f-factors and vertex packing.

Characterization of IGF-II isoforms in binge eating disorder and its group psychological treatment.

Directory of Open Access Journals (Sweden)

Giorgio Tasca

Full Text Available Binge eating disorder (BED affects 3.5% of the population and is characterized by binge eating for at least 2 days a week for 6 months. Treatment options include cognitive behavioral therapy, interpersonal psychotherapy, and pharmacotherapy which are associated with varied success. Little is known about the biology of BED. Since there is evidence that the insulin like growth factor system is implicated in regulation of body weight, insulin sensitivity and feeding behavior, we speculated it may be involved in BED.A cross-sectional comparison was made between three groups of women: overweight with BED, overweight without BED and normal weight without BED. Women were assigned to Group Psychodynamic Interpersonal Psychotherapy. Blood was collected before therapy, at completion and at 6 months follow up for evaluation of IGF-II using Western blot.97 overweight women with BED contributed to the cross-sectional comparison. The two control groups comprised 53 overweight women without BED, and 50 age matched normal weight women without BED. Obese women had significantly lower Big IGF-II than normal weight women, p = .028; Overweight women with BED had higher Mature IGF-II than normal weight women, p<.05. Big IGF-II showed a significant decreasing slope from pre- to post- to six months post-group psychological treatment, unrelated to changes in BMI (p = .008.Levels of IGF-II isoforms differed significantly between overweight and normal weight women. Overweight women with BED display abnormal levels of circulating IGF-II isoforms. BED is characterized by elevated mature IGF-II, an isoform shown to carry significant bioactivity. This finding is not related to BMI or to changes in body weight. The results also provide preliminary evidence that BIG IGF-II is sensitive to change due to group psychological treatment. We suggest that abnormalities in IGF-II processing may be involved in the neurobiology of BED.

Metabolic health across the BMI spectrum in HIV-infected and HIV-uninfected men.

Science.gov (United States)

Lake, Jordan E; Li, Xiuhong; Palella, Frank J; Erlandson, Kristine M; Wiley, Dorothy; Kingsley, Lawrence; Jacobson, Lisa P; Brown, Todd T

2018-01-02

In the general population, metabolic health often declines as BMI increases. However, some obese individuals maintain metabolic health. HIV and antiretroviral therapy have been associated with metabolic disturbances. We hypothesized that HIV-infected (HIV) men on suppressive antiretroviral therapy experience less metabolic health than HIV-uninfected (HIV) men across all BMI categories. In a cross-sectional analysis of 1018 HIV and 1092 HIV men enrolled in the multicenter AIDS cohort study, Poisson regression with robust variance determined associations between HIV serostatus and metabolic health prevalence (defined as meeting ≤2 of 5 National Cholesterol Education Program Adult Treatment Panel III metabolic syndrome criteria), adjusting for age, race, BMI category, smoking, and hepatitis C virus infection status. HIV men were younger (54 vs. 59 years) and had lower median BMI (25 vs. 27 kg/m). Nonobese HIV men had lower metabolic health prevalence than HIV men (BMI ≤25 kg/m: 80 vs. 94%, P BMI 25-29 kg/m: 64 vs. 71%, P = 0.05), but metabolic health prevalence among obese men did not differ by HIV serostatus (BMI 30-34 kg/m: 35 vs. 39%, P = 0.48; BMI ≥35 kg/m: 27 vs. 25%, P = 0.79). In the adjusted model, nonobese HIV men were less likely to demonstrate metabolic health than nonobese HIV men. Among HIV men, per year darunavir, zidovudine, and stavudine use were associated with lower metabolic health likelihood. Metabolically healthy obesity prevalence does not differ by HIV serostatus. However, among nonobese men, HIV infection is associated with lower metabolic health prevalence, with associations between lack of metabolic health and darunavir and thymidine analog nucleoside reverse transcriptase inhibitor exposure observed.

ABO blood groups and risk for obesity in Arar, Northern Saudi Arabia.

Science.gov (United States)

Aboel-Fetoh, Nagah M; Alanazi, Arwa R; Alanazi, Abdullah S; Alruwili, Asma N

2016-12-01

ABO blood groups are associated with some important chronic diseases. Previous studies have observed an association between ABO blood group and risk for obesity. This study aimed to determine whether there is an association between ABO blood groups and obesity in apparently healthy attendees of primary healthcare (PHC) centers in Arar city, Northern Saudi Arabia. This cross-sectional study included 401 participants aged 15 years and older attending three randomly selected PHC centers in Arar city. Data were collected by means of personal interview using a predesigned questionnaire. Anthropometric examination included height and weight measurements with calculation of BMI. ABO and Rh blood groups were determined. The majority of the participants were female (70.8%). The mean±SD age was 28.6±9.1 years. Only 5.7% were underweight. Both normal and overweight participants were equal in number and constituted 28.4%, whereas obese individuals constituted 37.4% with a mean BMI of 28.56±8.0. Blood group O was the most common (44.1%), followed by A (30.9%), B (18.7%), and AB (6.2%). Rh-positive cases constituted 87.0%. Blood group O was the most common type among the obese individuals (44.7%), followed by A, B, and AB groups (30, 20, and 5.3%, respectively). BMI was highest (28.8±9.2) in blood group O. There were no statistically significant differences between different ABO blood groups as regards BMI, Rh, and sex. Moreover, there was no statistically significant difference between Rh type and BMI. The prevalence of obesity and overweight is high in the population attending PHC centers of Arar city, Northern Saudi Arabia. There is no association between overweight, obesity, and ABO blood groups or Rh.

BMI and waist circumference as indicators of health among Samoan women.

Science.gov (United States)

Novotny, Rachel; Nabokov, Vanessa; Derauf, Christopher; Grove, John; Vijayadeva, Vinutha

2007-08-01

High rates of obesity and chronic disease make establishment of effective indicators of risk for chronic disease important. The objective was to examine adequacy of anthropometric cut-off points as indicators of risk for chronic disease among Samoan women in Hawaii. A cross-sectional survey of 55 Samoan women 18 to 28 years of age that included blood lipids, cholesterol, and glucose (including after a 2-hour oral glucose test); anthropometry (weight, height, waist circumference); and DXA of body composition. Using the Centers for Disease Control and Prevention (CDC)/World Health Organization (WHO) cut-off points for BMI, 22% of women were overweight and 58% were obese. Cholesterol, lipid, and glucose values were all linearly related to DXA body fat, BMI, and waist circumference. BMI and waist circumference at WHO/NIH cut-off points predicted levels of blood lipids and glucose that indicate elevated risk for disease. WHO/NIH cut-off points for BMI and waist circumference reflect risk indicators of chronic disease among young Samoan women in Hawaii.

Football match spectator sound exposure and effect on hearing: A ...

African Journals Online (AJOL)

This was a one-group pretest–post-test design of football spectators attending a premier soccer league match at a designated FIFA 2010 training stadium in Gauteng, South Africa. Individual spectator noise exposure for the duration of the football match and post-match changes in hearing thresholds were measured with ...

Representativeness and optimal use of body mass index (BMI) in the UK Clinical Practice Research Datalink (CPRD)

Science.gov (United States)

Bhaskaran, Krishnan; Forbes, Harriet J; Douglas, Ian; Leon, David A; Smeeth, Liam

2013-01-01

Objectives To assess the completeness and representativeness of body mass index (BMI) data in the Clinical Practice Research Datalink (CPRD), and determine an optimal strategy for their use. Design Descriptive study. Setting Electronic healthcare records from primary care. Participants A million patient random sample from the UK CPRD primary care database, aged ≥16 years. Primary and secondary outcome measures BMI completeness in CPRD was evaluated by age, sex and calendar period. CPRD-based summary BMI statistics for each calendar year (2003–2010) were age-standardised and sex-standardised and compared with equivalent statistics from the Health Survey for England (HSE). Results BMI completeness increased over calendar time from 37% in 1990–1994 to 77% in 2005–2011, was higher among females and increased with age. When BMI at specific time points was assigned based on the most recent record, calendar–year-specific mean BMI statistics underestimated equivalent HSE statistics by 0.75–1.1 kg/m2. Restriction to those with a recent (≤3 years) BMI resulted in mean BMI estimates closer to HSE (≤0.28 kg/m2 underestimation), but excluded up to 47% of patients. An alternative strategy of imputing up-to-date BMI based on modelled changes in BMI over time since the last available record also led to mean BMI estimates that were close to HSE (≤0.37 kg/m2 underestimation). Conclusions Completeness of BMI in CPRD increased over time and varied by age and sex. At a given point in time, a large proportion of the most recent BMIs are unlikely to reflect current BMI; consequent BMI misclassification might be reduced by employing model-based imputation of current BMI. PMID:24038008

Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.

Science.gov (United States)

Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K

2010-12-16

Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared

Exercise mitigates cumulative associations between stress and BMI in girls age 10–19

Science.gov (United States)

Prather, Aric A.; Epel, Elissa S.; Loharuka, Sheila; Adler, Nancy E.; Laraia, Barbara

2015-01-01

Objective Long-term psychological stress is associated with BMI increases in children as they transition to adulthood, while long-term maintenance of physical activity can slow excess weight gain. We hypothesized that in addition to these main effects, long-term physical activity mitigates the relationship between long-term stress and BMI increase. Methods The NHLBI Growth and Health Study enrolled 2,379 10-year-old Black and White girls, following them annually for 10 measurement points. Growth curve modeling captured the dynamics of BMI, measured yearly, and stress and physical activity, measured every other year. Results At average levels of activity and stress, with all covariates remaining fixed, average BMI at baseline was 19.74 (SE = 0.38) and increased 0.64 BMI (SE= 0.01, p psychological stress. PMID:26301595

Association between infancy BMI peak and body composition and blood pressure at age 5-6 years

NARCIS (Netherlands)

Hof, Michel H. P.; Vrijkotte, Tanja G. M.; de Hoog, Marieke L. A.; van Eijsden, Manon; Zwinderman, Aeilko H.

2013-01-01

The development of overweight is often measured with the body mass index (BMI). During childhood the BMI curve has two characteristic points: the adiposity rebound at 6 years and the BMI peak at 9 months of age. In this study, the associations between the BMI peak and body composition measures and

Palo Verde Unit 3 BMI nozzle modification

International Nuclear Information System (INIS)

Waskey, D.

2015-01-01

The 61 BMI (Bottom Mount Instrumentation) nozzles of the unit 3 of the Palo Verde plant have been examined through ASME Code Case N722. The nozzle 3 was the only one with leakage noted. The ultrasound testing results are characteristic of PWSCC (Primary Water Stress Corrosion Cracking). The initiation likely occurred at a weld defect which was exposed to the primary water environment resulting in PWSCC. All other nozzles (60) showed no unacceptable indications. Concerning nozzle 3 one crack in J-groove weld connected large defect to primary water. An environmental model has been used to simulate and optimize the repair. The AREVA crew was on site 18 days after contract award and the job was completed in 12 days, 30 hours ahead of baseline schedule. This series of slides describes the examination of the BMI nozzles, the repair steps, and alternative design concepts

A coarse to fine minutiae-based latent palmprint matching.

Science.gov (United States)

Liu, Eryun; Jain, Anil K; Tian, Jie

2013-10-01

With the availability of live-scan palmprint technology, high resolution palmprint recognition has started to receive significant attention in forensics and law enforcement. In forensic applications, latent palmprints provide critical evidence as it is estimated that about 30 percent of the latents recovered at crime scenes are those of palms. Most of the available high-resolution palmprint matching algorithms essentially follow the minutiae-based fingerprint matching strategy. Considering the large number of minutiae (about 1,000 minutiae in a full palmprint compared to about 100 minutiae in a rolled fingerprint) and large area of foreground region in full palmprints, novel strategies need to be developed for efficient and robust latent palmprint matching. In this paper, a coarse to fine matching strategy based on minutiae clustering and minutiae match propagation is designed specifically for palmprint matching. To deal with the large number of minutiae, a local feature-based minutiae clustering algorithm is designed to cluster minutiae into several groups such that minutiae belonging to the same group have similar local characteristics. The coarse matching is then performed within each cluster to establish initial minutiae correspondences between two palmprints. Starting with each initial correspondence, a minutiae match propagation algorithm searches for mated minutiae in the full palmprint. The proposed palmprint matching algorithm has been evaluated on a latent-to-full palmprint database consisting of 446 latents and 12,489 background full prints. The matching results show a rank-1 identification accuracy of 79.4 percent, which is significantly higher than the 60.8 percent identification accuracy of a state-of-the-art latent palmprint matching algorithm on the same latent database. The average computation time of our algorithm for a single latent-to-full match is about 141 ms for genuine match and 50 ms for impostor match, on a Windows XP desktop system with 2

BMI modulates calorie-dependent dopamine changes in accumbens from glucose intake.

Directory of Open Access Journals (Sweden)

Gene-Jack Wang

Full Text Available Dopamine mediates the rewarding effects of food that can lead to overeating and obesity, which then trigger metabolic neuroadaptations that further perpetuate excessive food consumption. We tested the hypothesis that the dopamine response to calorie intake (independent of palatability in striatal brain regions is attenuated with increases in weight.We used positron emission tomography with [11C]raclopride to measure dopamine changes triggered by calorie intake by contrasting the effects of an artificial sweetener (sucralose devoid of calories to that of glucose to assess their association with body mass index (BMI in nineteen healthy participants (BMI range 21-35.Neither the measured blood glucose concentrations prior to the sucralose and the glucose challenge days, nor the glucose concentrations following the glucose challenge vary as a function of BMI. In contrast the dopamine changes in ventral striatum (assessed as changes in non-displaceable binding potential of [11C]raclopride triggered by calorie intake (contrast glucose - sucralose were significantly correlated with BMI (r = 0.68 indicating opposite responses in lean than in obese individuals. Specifically whereas in normal weight individuals (BMI <25 consumption of calories was associated with increases in dopamine in the ventral striatum in obese individuals it was associated with decreases in dopamine.These findings show reduced dopamine release in ventral striatum with calorie consumption in obese subjects, which might contribute to their excessive food intake to compensate for the deficit between the expected and the actual response to food consumption.

Characteristics of screen media use associated with higher BMI in young adolescents.

Science.gov (United States)

Bickham, David S; Blood, Emily A; Walls, Courtney E; Shrier, Lydia A; Rich, Michael

2013-05-01

This study investigates how characteristics of young adolescents' screen media use are associated with their BMI. By examining relationships between BMI and both time spent using each of 3 screen media and level of attention allocated to use, we sought to contribute to the understanding of mechanisms linking media use and obesity. We measured heights and weights of 91 13- to 15-year-olds and calculated their BMIs. Over 1 week, participants completed a weekday and a Saturday 24-hour time-use diary in which they reported the amount of time they spent using TV, computers, and video games. Participants carried handheld computers and responded to 4 to 7 random signals per day by completing onscreen questionnaires reporting activities to which they were paying primary, secondary, and tertiary attention. Higher proportions of primary attention to TV were positively associated with higher BMI. The difference between 25th and 75th percentiles of attention to TV corresponded to an estimated +2.4 BMI points. Time spent watching television was unrelated to BMI. Neither duration of use nor extent of attention paid to video games or computers was associated with BMI. These findings support the notion that attention to TV is a key element of the increased obesity risk associated with TV viewing. Mechanisms may include the influence of TV commercials on preferences for energy-dense, nutritionally questionable foods and/or eating while distracted by TV. Interventions that interrupt these processes may be effective in decreasing obesity among screen media users.

Is a reduction in distance to nearest supermarket associated with BMI change among type 2 diabetes patients?

Science.gov (United States)

Zhang, Y Tara; Laraia, Barbara A; Mujahid, Mahasin S; Blanchard, Samuel D; Warton, E Margaret; Moffet, Howard H; Karter, Andrew J

2016-07-01

We examined whether residing within 2 miles of a new supermarket opening was longitudinally associated with a change in body mass index (BMI). We identified 12 new supermarkets that opened between 2009 and 2010 in 8 neighborhoods. Using the Kaiser Permanente Northern California Diabetes Registry, we identified members with type 2 diabetes residing continuously in any of these neighborhoods 12 months prior to the first supermarket opening until 10 months following the opening of the last supermarket. Exposure was defined as a reduction (yes/no) in travel distance to the nearest supermarket as a result of a new supermarket opening. First difference regression models were used to estimate the impact of reduced supermarket distance on BMI, adjusting for longitudinal changes in patient and neighborhood characteristics. Among patients in the exposed group, new supermarket openings reduced travel distance to the nearest supermarket by 0.7 miles on average. However, reduced distance to nearest supermarket was not associated with BMI changes. Overall, we found no evidence that reduced supermarket distance was associated with reduced levels of obesity for residents with type 2 diabetes. Published by Elsevier Ltd.

Predictors of Success in Bariatric Surgery: the Role of BMI and Pre-operative Comorbidities.

Science.gov (United States)

da Cruz, Magda Rosa Ramos; Branco-Filho, Alcides José; Zaparolli, Marília Rizzon; Wagner, Nathalia Farinha; de Paula Pinto, José Simão; Campos, Antônio Carlos Ligocki; Taconeli, Cesar Augusto

2017-11-10

This is a retrospective review of 204 patients who underwent bariatric surgery. The impact of weight regain (WR), pre-operative comorbidities and BMI values on the recurrence of comorbidities was evaluated, and an equation was elaborated to estimate BMI at 5 years of bariatric surgery. Pre-operative data, after 1 year and after 5 years, was collected from the medical records. Descriptive analyses and bivariate hypothesis tests were performed first, and then, a generalised linear regression model with Tweedie distribution was adjusted. The hit rate and the Kendall coefficient of concordance (Kendall's W) of the equation were calculated. At the end, the Mann-Whitney test was performed between the BMI, WR and the presence of comorbidities, after a post-operative period of 5 years. The adjustment of the model resulted in an equation that estimates the mean value of BMI 5 years after surgery. The hit rate was 82.35% and the value of Kendall's W was 0.85 for the equation. It was found that patients with comorbidities presented a higher median WR (10.13%) and a higher mean BMI (30.09 kg/m 2 ) 5 years after the surgery. It is concluded that the equation is useful for estimating the mean BMI at 5 years of surgery and that patients with low pre-operative HDL and folic acid levels, with depression and/or anxiety and a higher BMI, have a higher BMI at 5 years of surgery and higher incidence of comorbid return and dissatisfaction with post-operative results.

Correlation of endoscopic severity of gastroesophageal reflux disease (gerd) with body mass index (bmi)

International Nuclear Information System (INIS)

Zafar, S.; Haq, I.U.; Butt, A.R.; Shafiq, F.; Huda, G.; Mirza, G.; Rehman, A.U.

2007-01-01

To assess the correlation of endoscopic severity of Gastroesophageal Reflux Disease (GERD) with Body Mass Index (BMI). This study was conducted on 203 patients, who presented with upper GI symptoms. Patients who fulfilled the symptom criteria were referred for endoscopy. Classification of GERD was done according to LA Grading classification system. Body mass index (BMI) was calculated as Body Weight (BW) in kilograms (kg) divided by the square of the body height (BH) in meter (m2). Patient data was analyzed using SPSS 12 software. Statistical evaluation was done using non-parametric Wilcoxon's-sign Rank test. P-value <0.05 was considered to be statistically significant. Distribution of GERD was as follows: GERD-A subjects 65 (32%), GERD B subjects 72 (35.4%), GERD-C subjects 23 (11.3%), GERD-D subjects 10 (4.92%), while Non-Erosive Reflux Disease (NERD) was present in 33 subjects (16.2%). Mean BMI was 27+5.02SD (range of 18.2-38.3). BMI of patients having NERD was in normal range but patients who were having advanced disease i.e. Grade C-D were in obese range of BMI, while those who were having LA grade A-B were in overweight BMI range. When regrouped as mild GERD (grade A-B) and NERD versus severe GERD (grade C-D), there was a strong significant correlation between severity of GERD and BMI, as detected by Wilcoxon's signed Rank test (p=0.001). Higher BMI seems to be associated with higher degree of endoscopic GERD severity. (author)

Process Optimization of Bismaleimide (BMI) Resin Infused Carbon Fiber Composite

Science.gov (United States)

Ehrlich, Joshua W.; Tate, LaNetra C.; Cox, Sarah B.; Taylor, Brian J.; Wright, M. Clara; Caraccio, Anne J.; Sampson, Jeffery W.

2013-01-01

Bismaleimide (BMI) resins are an attractive new addition to world-wide composite applications. This type of thermosetting polyimide provides several unique characteristics such as excellent physical property retention at elevated temperatures and in wet environments, constant electrical properties over a vast array of temperature settings, and nonflammability properties as well. This makes BMI a popular choice in advance composites and electronics applications [I]. Bismaleimide-2 (BMI-2) resin was used to infuse intermediate modulus 7 (IM7) based carbon fiber. Two panel configurations consisting of 4 plies with [+45deg, 90deg]2 and [0deg]4 orientations were fabricated. For tensile testing, a [90deg]4 configuration was tested by rotating the [0deg]4 configirration to lie orthogonal with the load direction of the test fixture. Curing of the BMI-2/IM7 system utilized an optimal infusion process which focused on the integration of the manufacturer-recommended ramp rates,. hold times, and cure temperatures. Completion of the cure cycle for the BMI-2/IM7 composite yielded a product with multiple surface voids determined through visual and metallographic observation. Although the curing cycle was the same for the three panellayups, the surface voids that remained within the material post-cure were different in abundance, shape, and size. For tensile testing, the [0deg]4 layup had a 19.9% and 21.7% greater average tensile strain performance compared to the [90deg]4 and [+45deg, 90deg, 90deg,-45degg] layups, respectively, at failure. For tensile stress performance, the [0deg]4 layup had a 5.8% and 34.0% greater average performance% than the [90deg]4 and [+45deg, 90deg, 90deg,-45deg] layups.

MUSCLE DAMAGE AFTER A TENNIS MATCH IN YOUNG PLAYERS

Directory of Open Access Journals (Sweden)

R.V. Gomes

2014-07-01

Full Text Available The present study investigated changes in indirect markers of muscle damage following a simulated tennis match play using nationally ranked young (17.6 ± 1.4 years male tennis players. Ten young athletes played a 3-hour simulated match play on outdoor red clay courts following the International Tennis Federation rules. Muscle soreness, plasma creatine kinase activity (CK, serum myoglobin concentration (Mb, one repetition maximum (1RM squat strength, and squat jump (SJ and counter movement jump (CMJ heights were assessed before, immediately after, and 24 and 48 h after the simulated match play. All parameters were also evaluated in a non-exercised group (control group. A small increase in the indirect markers of muscle damage (muscle soreness, CK and Mb was detected at 24-48 hours post-match (p<0.05. A marked acute decrement in neuromuscular performance (1RM squat strength: -35.2 ± 10.4%, SJ: -7.0 ± 6.0%, CMJ: -10.0 ± 6.3% was observed immediately post-match (p<0.05. At 24 h post-match, the 1RM strength and jump heights were not significantly different from the baseline values. However, several players showed a decrease of these measures at 24 h after the match play. The simulated tennis match play induced mild muscle damage in young players. Coaches could monitor changes in the indirect markers of muscle damage to assess athletes’ recovery status during training and competition.

Changes in Adult BMI and Waist Circumference Are Associated with Increased Risk of Advanced Colorectal Neoplasia.

Science.gov (United States)

Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F

2017-11-01

Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2  = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2  = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.

Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation

DEFF Research Database (Denmark)

Sharp, Gemma C; Salas, Lucas A; Monnereau, Claire

2017-01-01

-analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1......,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (.... Adjustment for estimated cell proportions greatly attenuated the number of significant CpGs to 104, including 86 sites common to the unadjusted model. At 72/86 sites, the direction of the association was the same in newborns and adolescents, suggesting persistence of signals. However, we found evidence...

Predictors of increasing BMI during the course of diabetes in children and adolescents with type 1 diabetes: data from the German/Austrian DPV multicentre survey.

Science.gov (United States)

Fröhlich-Reiterer, Elke E; Rosenbauer, Joachim; Bechtold-Dalla Pozza, Susanne; Hofer, Sabine E; Schober, Edith; Holl, Reinhard W

2014-08-01

Increased weight gain has been reported prior to disease onset (accelerator hypothesis) and as a side effect of intensified insulin therapy in type 1 diabetes (T1D). Paediatric studies are complicated by the age-dependency and gender-dependency of BMI, and also by a trend towards obesity in the general population. The aim of this study was to evaluate factors related to the increase in BMI during the course of diabetes in children and adolescents with T1D in a large multicentre survey. Within the DPV database (Diabetespatienten Verlaufsdokumentation) a standardised, prospective, computer-based documentation programme, data of 53,108 patients with T1D, aged 12,774 patients (53% male, mean age 13.4±3.9, mean diabetes duration 4.7±3.0 years and mean age at diabetes onset 8.7±4.0 years) were included in this analysis. Population-based German reference data were used to calculate BMI-SDS and define overweight and obesity. 12.5% of T1D patients were overweight and 2.8% were obese. Multiple longitudinal regression analysis revealed that female gender, low BMI at diabetes onset, intensified insulin therapy and higher insulin dose, as well as pubertal diabetes onset, long diabetes duration and onset in earlier calendar years among girls, were related to higher BMI-SDS increase during the course of diabetes (p1; all). Intensified insulin regimen is associated with weight gain during T1D treatment, in addition to demographic variables. Optimisation of diabetes management, especially in females, might limit weight gain in order to reduce overweight and obesity together with comorbidities among paediatric T1D patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

The Effects of Aerobic and Anaerobic Training Programs Applied to Elite Wrestlers on Body Mass Index (BMI) and Blood Lipids

Science.gov (United States)

Demirel, Nurcan; Özbay, Serhat; Kaya, Fatih

2018-01-01

The purpose of this study is to analyse the effects of aerobic and anaerobic training programs applied to elite wrestlers on body mass index (BMI) and blood lipids. 20 elite wrestlers, whose average age is (experimental group; 15.20 ± 4.61, n = 10), control group; 15.90 ± 2.08, n = 10), participated in the study and they were randomly divided into…

In-Stent Restenosis of Drug-Eluting Stents Compared With a Matched Group of Patients With De Novo Coronary Artery Stenosis.

Science.gov (United States)

Buchanan, Kyle D; Torguson, Rebecca; Rogers, Toby; Xu, Linzhi; Gai, Jiaxiang; Ben-Dor, Itsik; Suddath, William O; Satler, Lowell F; Waksman, Ron

2018-03-13

Drug-eluting stents (DES) significantly reduced the incidence of in-stent restenosis (ISR). However, ISR still exists in the contemporary DES era. Previously deemed to be a benign process, ISR leads to complex presentation and intervention. This study aimed to compare the presentation and outcome of DES-ISR versus de novo lesions. We performed a retrospective analysis of 11,666 patients receiving percutaneous coronary intervention from 2003 to 2017 and divided them into 2 groups by de novo stenosis and ISR. They were matched based on common cardiovascular risk factors at a 4:1 ratio, respectively. After matching, a total of 1,888 patients with 3,126 de novo lesions and 472 patients with 508 ISR lesions were analyzed. Patients with ISR presented more often with unstable angina (61% vs 45%, p stent technique and should motivate the continued development of fully bioresorbable scaffolds. Copyright © 2018 Elsevier Inc. All rights reserved.

Impact of non-physician health professionals' BMI on obesity care and beliefs.

Science.gov (United States)

Bleich, Sara N; Bandara, Sachini; Bennett, Wendy L; Cooper, Lisa A; Gudzune, Kimberly A

2014-12-01

Examine the impact of non-physician health professional body mass index (BMI) on obesity care, self-efficacy, and perceptions of patient trust in weight loss advice. A national cross-sectional Internet-based survey of 500 US non-physician health professionals specializing in nutrition, nursing, behavioral/mental health, exercise, and pharmacy collected between January 20 and February 5, 2014 was analyzed. Normal-BMI professionals were more likely than overweight/obese professionals to report success in helping patients achieve clinically significant weight loss (52% vs. 29%, P = 0.01). No differences by health professional BMI about the appropriate patient body weight for weight-related care (initiate weight loss discussions and success in helping patients lose weight), confidence in ability to help patients lose weight, or in perceived patient trust in their advice were observed. Most health professionals (71%) do not feel successful in helping patients lose weight until they are morbidly obese, regardless of BMI. Normal-BMI non-physician health professionals report being more successful than overweight and obese health professionals at helping obese patients lose weight. More research is needed to understand how to improve self-efficacy for delivering obesity care, particularly among overweight and class I obese patients. © 2014 The Obesity Society.

Longitudinal association between marital disruption and child BMI and obesity.

Science.gov (United States)

Arkes, Jeremy

2012-08-01

This research examines whether family disruptions (i.e., divorces and separation) contribute to children's weight problems. The sample consists of 7,299 observations for 2,333 children, aged 5-14, over the 1986-2006 period, from a US representative sample from the Child and Young Adult Survey accompanying the National Longitudinal Survey of Youth (NLSY). The study uses individual-fixed-effects models in a longitudinal framework to compare children's BMI and weight problems before and after a disruption. Furthermore, besides doing a before-after comparison for children, the study also estimates the effects at various periods relative to the disruption in order to examine whether children are affected before the disruption and whether any effects change as time passes from the disruption, as some effects may be temporary or slow to develop. Despite having a larger sample than the previous studies, the results provide no evidence that, on average, children's BMI and BMI percentile scores (measured with continuous outcomes) are affected before the disruption, after the disruption, and as time passes from the disruption, relative to a baseline period a few years before the disruption. However, children experiencing a family disruption do have an increased risk of obesity (having a BMI percentile score of 95 or higher) in the two years leading up to the disruption as well as after the disruption, and as time passes from the disruption.

Association of eating three meals irregularly with changes in BMI and weight among young Japanese men and women: A 2-year follow-up.

Science.gov (United States)

Ibe, Yoko; Miyakawa, Happei; Fuse-Nagase, Yasuko; Hirose, Ayumi Sugawara; Hirasawa, Reiko; Yachi, Yoko; Fujihara, Kazuya; Kobayashi, Kazuto; Shimano, Hitoshi; Sone, Hirohito

2016-09-01

Epidemiological longitudinal investigations of the association between not eating three meals regularly and changes in BMI and weight are scarce. The aim of this study was to investigate whether or not regularly eating three meals was associated with changes in BMI and weight in young Japanese men and women. Study participants were 1241 men and 897 women aged 19.0±1.2 and 18.8±0.8years, respectively, who underwent health checkups at a university in Japan in 2001 as the baseline and subsequently in 2003. Weight and height were measured at baseline and 2years later. Whether an individual ate three meals regularly was determined by a self-report questionnaire in 2001. During the 2-year follow-up, the BMI gain was 0.347 for men and 0.067 for women. In the logistic regression analysis, for men, eating three meals irregularly was significantly associated with a 4% BMI gain (OR 1.60, CI 1.11-2.30), 6% BMI gain (OR 1.72, CI 1.12-2.63), 4kg weight gain (OR 2.01, CI 1.29-3.13), 6kg weight gain (OR 1.86, CI 1.02-3.37), and incidence of obesity (BMI ≧ 25)(OR 2.96, CI 1.22-7.17). For women, eating three meals irregularly was significantly associated with a 4% BMI loss (OR 1.99, CI 1.01-3.94), 6% BMI loss (OR 2.79, CI 1.29-6.03), 4kg weight loss (OR 3.85, CI 1.62-9.12), 6kg weight loss (OR 7.65, CI 2.06-28.46), and the incidence of underweight (OR 3.95, CI 1.32-11.89). The current results suggested that eating three meals irregularly was associated with subsequent BMI and weight gains for men and subsequent BMI and weight losses for women; both groups were around 20years of age. Self-reported eating behavior in this study might be used to screen and evaluate young Japanese men and women at high risk for changes in BMI and weight in a practical clinical setting. Copyright © 2016 Elsevier Inc. All rights reserved.

Image noise-based dose adaptation in dynamic volume CT of the heart: dose and image quality optimisation in comparison with BMI-based dose adaptation

Energy Technology Data Exchange (ETDEWEB)

Odedra, Devang [Queen' s University, School of Medicine, Kingston, ON (Canada); Blobel, Joerg [Toshiba Medical Systems Europe BV, Zoetermeer (Netherlands); University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada); AlHumayyd, Saad; Durand, Miranda; Jimenez-Juan, Laura; Paul, Narinder [University of Toronto, Division of Cardiothoracic Imaging, Department of Medical Imaging, Toronto General Hospital, Toronto, ON (Canada)

2014-01-15

To compare the image quality and radiation dose using image-noise (IN)-based determination of X-ray tube settings compared with a body mass index (BMI)-based protocol during CT coronary angiography (CTCA). Two hundred consecutive patients referred for CTCA to our institution were divided into two groups: BMI-based, 100 patients had CTCA with the X-ray tube current adjusted to the patient's BMI while maintaining a fixed tube potential of 120 kV; IN-based, 100 patients underwent imaging with the X-ray tube current and voltage adjusted to the IN measured within the mid-left ventricle on a pre-acquisition trans-axial image. Two independent cardiac radiologists performed blinded image quality assessment with quantification of the IN and signal-to-noise ratio (SNR) from the mid-LV and qualitative assessment using a three-point score. Radiation dose (CTDI and DLP) was recorded from the console. Results showed: IN (HU): BMI-based, 30.1 ± 9.9; IN-based, 33.1 ± 6.7; 32 % variation reduction (P = 0.001); SNR: BMI-based, 18.6 ± 7.1; IN-based, 15.4 ± 3.7; 48 % variation reduction (P < 0.0001). Visual scores: BMI-based, 2.3 ± 0.6; IN-based, 2.2 ± 0.5 (P = 0.54). Radiation dose: CTDI (mGy), BMI-based, 22.68 ± 8.9; IN-based, 17.16 ± 7.6; 24.3 % reduction (P < 0.001); DLP (mGy.cm), BMI-based, 309.3 ± 127.5; IN-based, 230.6 ± 105.5; 25.4 % reduction (P < 0.001). Image-noise-based stratification of X-ray tube parameters for CTCA results in 32 % improvement in image quality and 25 % reduction in radiation dose compared with a BMI-based protocol. (orig.)

Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.

Science.gov (United States)

Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M

Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for

Exclusive image guided IMRT vs. radical prostatectomy followed by postoperative IMRT for localized prostate cancer: a matched-pair analysis based on risk-groups

International Nuclear Information System (INIS)

Azelie, Caroline; Créhange, Gilles; Gauthier, Mélanie; Mirjolet, Céline; Cormier, Luc; Martin, Etienne; Peignaux-Casasnovas, Karine; Truc, Gilles; Chamois, Jérôme; Maingon, Philippe

2012-01-01

To investigate whether patients treated for a localized prostate cancer (PCa) require a radical prostatectomy followed by postoperative radiotherapy or exclusive radiotherapy, in the modern era of image guided IMRT. 178 patients with PCa were referred for daily exclusive image guided IMRT (IG-IMRT) using an on-line 3D ultra-sound based system and 69 patients were referred for postoperative IMRT without image guidance after radical prostatectomy (RP + IMRT). Patients were matched in a 1:1 ratio according to their baseline risk group before any treatment. Late toxicity was scored using the CTV v3.0 scale. Biochemical failure was defined as a postoperative PSA ≤ 0.1 ng/mL followed by 1 consecutive rising PSA for the postoperative group of patients and by the Phoenix definition (nadir + 2 ng/mL) for the group of patients treated with exclusive radiotherapy. A total of 98 patients were matched (49:49). From the start of any treatment, the median follow-up was 56.6 months (CI 95% = [49.6-61.2], range [18.2-115.1]). No patient had late gastrointestinal grade ≥ 2 toxicity in the IG-IMRT group vs. 4% in the RP + IMRT group. Forty two percent of the patients in both groups had late grade ≥ 2 genitourinary toxicity. The 5-year FFF rates in the IG-IMRT group and in the RP + IMRT groups were 93.1% [80.0-97.8] and 76.5% [58.3-87.5], respectively (p = 0.031). Patients with a localized PCa treated with IG-IMRT had better oncological outcome than patients treated with RP + IMRT. Further improvements in postoperative IMRT using image guidance and dose escalation are urgently needed

Behavioural measures of child's eating temperament and their link with BMI.

Science.gov (United States)

Godefroy, Valérie; Trinchera, Laura; Darcel, Nicolas; Rigal, Natalie

2017-03-01

Rothbart's model of temperament, defined as individual differences in reactivity and self-regulation, has a strong heuristic value with applications in a wide variety of children's outcomes. Our objective was to test Rothbart's model applied to children's food behaviours and BMI outcome through behavioural measures. Our hypotheses, according to Rothbart's model, were as follows: (i) self-regulation in eating modulates appetite reactivity; (ii) appetite reactivity increases the risk of excess BMI, whereas self-regulation in eating limits this risk. One hundred and four children aged between 7 and 12 years completed four behavioural tasks to assess scores for two components of appetite reactivity (i.e. appetite arousal and appetite persistence) and two components of self-regulation in eating (i.e. self-regulation in eating without hunger and self-regulation in eating speed). Their heights and weights were measured in order to calculate their BMI-for-age. T-tests and regression analysis were used to verify our hypotheses. None of the scores of self-regulation in eating was directly associated with BMI but we observed a significant impact of self-regulation in eating without hunger on appetite arousal (p-value = 0.04), together with a modest but significant association between appetite persistence and BMI (p-value = 0.02). We can thus conclude that our behavioural measures could be used for the determination of the child's eating temperament. Further studies are needed to investigate how to use these measures to improve the treatment of overweight in children. Copyright © 2016 Elsevier Ltd. All rights reserved.

Bidirectional associations between mothers' and fathers' parenting consistency and child bmi

OpenAIRE

Jansen, Pauline; Giallo, Rebecca; Westrupp, Elizabeth; Wake, Melissa; Nicholson, Jan

2013-01-01

textabstractBACKGROUND: Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. METHODS: Participants were 4002 children and their parents in the population-based Longitudinal Study of...

Nutritional status (BMI in children suffering from asthma

Directory of Open Access Journals (Sweden)

Šćepanović Anđelka

2013-01-01

Full Text Available The research encompassed 708 children of both genders, aged 6 to 15. Three hundred and fifty four of the total number had been diagnosed with Asthma bronchiale, whereas the other half of the children were healthy and served as a control group. Their nutritional condition was determined on the basis of the percentile value of their BMI. Recent studies on the level of nutrition and its connection to asthma have shown contradictory results. This paper was aimed at estimating the nutritional level of sick children in relation to healthy ones. The data were analyzed in relation to group, gender and age by means of descriptive methods, univariate (analysis of variance - ANOVA and multivariate (multivariate analysis of variance - MANOVA, whereas the results were tested by Roy’s test (Pearson contingency coefficient χ, coefficient of multiple correlation R. It was determined that male children more frequently suffer from this disease than female children do. Both healthy and sick children were normally nourished. However, as regards the sick, the number of normally nourished was considerably lower, whereas the number of underweight was considerably higher, as well as those that were overweight. Intergroup differences in the distribution of certain levels of nutrition of male and female children occurred in only two non-sequential age groups, being later in boys than in girls. This uneven distribution is probably a consequence of the joint effects of environment factors, sickness and therapy.

Prediction of BMI at age 11 in a longitudinal sample of the Ulm Birth Cohort Study.

Directory of Open Access Journals (Sweden)

Hanna Christiansen

Full Text Available Obesity is one of the greatest public health challenges in the world with childhood prevalence rates between 20-26% and numerous associated health risks. The aim of the current study was to analyze the 11-year follow-up data of the Ulm Birth Cohort Study (UBCS, to identify whether abnormal eating behavior patterns, especially restrained eating, predict body mass index (BMI at 11 years of age and to explore other factors known to be longitudinally associated with it. Of the original UBCS, n = 422 children (~ 40% of the original sample and their parents participated in the 11-year follow-up. BMI at age 8 and 11 as well as information on restrained eating, psychological problems, depressive symptoms, lifestyle, and IQ at age 8 were assessed. Partial Least Squares Structural Equation Modeling (PLS-SEM was used to predict children's BMI scores at age 11. PLS-SEM explained 68% of the variance of BMI at age 11, with BMI at age 8 being the most important predictor. Restrained eating, via BMI at age 8 as well as parental BMI, had further weak associations with BMI at age 11; no other predictor was statistically significant. Since established overweight at age 8 already predicts BMI scores at age 11 longitudinally, obesity interventions should be implemented in early childhood.

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

Directory of Open Access Journals (Sweden)

Tenna Ruest Haarmark Nielsen

Full Text Available The body mass index (BMI standard deviation score (SDS may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment.876 children and adolescents (498 girls with overweight/obesity, median age 11.2 years (range 1.6-21.7, and median BMI SDS 2.8 (range 1.3-5.7 were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4. Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC, low-density lipoprotein (LDL, high-density lipoprotein (HDL, non-HDL, and triglycerides (TG were available in 469 individuals (264 girls. Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations.At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4 and positively with TG (p = 9.7*10-6. Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10-16 and percent truncal body fat (p<2*10-16. Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001. Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations.Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma

BMI and WHR Are Reflected in Female Facial Shape and Texture: A Geometric Morphometric Image Analysis.

Directory of Open Access Journals (Sweden)

Christine Mayer

Full Text Available Facial markers of body composition are frequently studied in evolutionary psychology and are important in computational and forensic face recognition. We assessed the association of body mass index (BMI and waist-to-hip ratio (WHR with facial shape and texture (color pattern in a sample of young Middle European women by a combination of geometric morphometrics and image analysis. Faces of women with high BMI had a wider and rounder facial outline relative to the size of the eyes and lips, and relatively lower eyebrows. Furthermore, women with high BMI had a brighter and more reddish skin color than women with lower BMI. The same facial features were associated with WHR, even though BMI and WHR were only moderately correlated. Yet BMI was better predictable than WHR from facial attributes. After leave-one-out cross-validation, we were able to predict 25% of variation in BMI and 10% of variation in WHR by facial shape. Facial texture predicted only about 3-10% of variation in BMI and WHR. This indicates that facial shape primarily reflects total fat proportion, rather than the distribution of fat within the body. The association of reddish facial texture in high-BMI women may be mediated by increased blood pressure and superficial blood flow as well as diet. Our study elucidates how geometric morphometric image analysis serves to quantify the effect of biological factors such as BMI and WHR to facial shape and color, which in turn contributes to social perception.

Muscle mass, BMI, and mortality among adults in the United States: A population-based cohort study.

Science.gov (United States)

Abramowitz, Matthew K; Hall, Charles B; Amodu, Afolarin; Sharma, Deep; Androga, Lagu; Hawkins, Meredith

2018-01-01

The level of body-mass index (BMI) associated with the lowest risk of death remains unclear. Although differences in muscle mass limit the utility of BMI as a measure of adiposity, no study has directly examined the effect of muscle mass on the BMI-mortality relationship. Body composition was measured by dual-energy x-ray absorptiometry in 11,687 participants of the National Health and Nutrition Examination Survey 1999-2004. Low muscle mass was defined using sex-specific thresholds of the appendicular skeletal muscle mass index (ASMI). Proportional hazards models were created to model associations with all-cause mortality. At any level of BMI ≥22, participants with low muscle mass had higher body fat percentage (%TBF), an increased likelihood of diabetes, and higher adjusted mortality than other participants. Increases in %TBF manifested as 30-40% smaller changes in BMI than were observed in participants with preserved muscle mass. Excluding participants with low muscle mass or adjustment for ASMI attenuated the risk associated with low BMI, magnified the risk associated with high BMI, and shifted downward the level of BMI associated with the lowest risk of death. Higher ASMI was independently associated with lower mortality. Effects were similar in never-smokers and ever-smokers. Additional adjustment for waist circumference eliminated the risk associated with higher BMI. Results were unchanged after excluding unintentional weight loss, chronic illness, early mortality, and participants performing muscle-strengthening exercises or recommended levels of physical activity. Muscle mass mediates associations of BMI with adiposity and mortality and is inversely associated with the risk of death. After accounting for muscle mass, the BMI associated with the greatest survival shifts downward toward the normal range. These results provide a concrete explanation for the obesity paradox.

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

Science.gov (United States)

Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian

2018-01-01

The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (pobesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition and lipid concentrations may improve.

Adult BMI and Access to Built Environment Resources in a High-Poverty, Urban Geography.

Science.gov (United States)

Tung, Elizabeth L; Peek, Monica E; Makelarski, Jennifer A; Escamilla, Veronica; Lindau, Stacy T

2016-11-01

The purpose of this study is to examine the relationship between BMI and access to built environment resources in a high-poverty, urban geography. Participants (aged ≥35 years) were surveyed between November 2012 and July 2013 to examine access to common health-enabling resources (grocers, outpatient providers, pharmacies, places of worship, and physical activity resources). Survey data were linked to a contemporaneous census of built resources. Associations between BMI and access to resources (potential and realized) were examined using independent t-tests and multiple linear regression. Data analysis was conducted in 2014-2015. Median age was 53.8 years (N=267, 62% cooperation rate). Obesity (BMI ≥30) prevalence was 54.9%. BMI was not associated with potential access to resources located nearest to home. Nearly all participants (98.1%) bypassed at least one nearby resource type; half bypassed nearby grocers (realized access >1 mile from home). Bypassing grocers was associated with a higher BMI (p=0.03). Each additional mile traveled from home to a grocer was associated with a 0.9-higher BMI (95% CI=0.4, 1.3). Quality and affordability were common reasons for bypassing resources. Despite potential access to grocers in a high-poverty, urban region, half of participants bypassed nearby grocers to access food. Bypassing grocers was associated with a higher BMI. Copyright © 2016 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

Effects of BMI, Fat Mass, and Lean Mass on Asthma in Childhood: A Mendelian Randomization Study

Science.gov (United States)

Granell, Raquel; Henderson, A. John; Evans, David M.; Smith, George Davey; Ness, Andrew R.; Lewis, Sarah; Palmer, Tom M.; Sterne, Jonathan A. C.

2014-01-01

Background Observational studies have reported associations between body mass index (BMI) and asthma, but confounding and reverse causality remain plausible explanations. We aim to investigate evidence for a causal effect of BMI on asthma using a Mendelian randomization approach. Methods and Findings We used Mendelian randomization to investigate causal effects of BMI, fat mass, and lean mass on current asthma at age 7½ y in the Avon Longitudinal Study of Parents and Children (ALSPAC). A weighted allele score based on 32 independent BMI-related single nucleotide polymorphisms (SNPs) was derived from external data, and associations with BMI, fat mass, lean mass, and asthma were estimated. We derived instrumental variable (IV) estimates of causal risk ratios (RRs). 4,835 children had available data on BMI-associated SNPs, asthma, and BMI. The weighted allele score was strongly associated with BMI, fat mass, and lean mass (all p-valuesBMI on asthma was 1.55 (95% CI 1.16–2.07) per kg/m2, p = 0.003. This effect appeared stronger for non-atopic (1.90, 95% CI 1.19–3.03) than for atopic asthma (1.37, 95% CI 0.89–2.11) though there was little evidence of heterogeneity (p = 0.31). The estimated causal RRs for the effects of fat mass and lean mass on asthma were 1.41 (95% CI 1.11–1.79) per 0.5 kg and 2.25 (95% CI 1.23–4.11) per kg, respectively. The possibility of genetic pleiotropy could not be discounted completely; however, additional IV analyses using FTO variant rs1558902 and the other BMI-related SNPs separately provided similar causal effects with wider confidence intervals. Loss of follow-up was unlikely to bias the estimated effects. Conclusions Higher BMI increases the risk of asthma in mid-childhood. Higher BMI may have contributed to the increase in asthma risk toward the end of the 20th century. Please see later in the article for the Editors' Summary PMID:24983943

Associations between toddlers' and parents' BMI, in relation to family socio-demography: a cross-sectional study.

Science.gov (United States)

Lindkvist, Marie; Ivarsson, Anneli; Silfverdal, Sven Arne; Eurenius, Eva

2015-12-17

It is well established that the pregnancy and the first years of life are important for future childhood health and body weight. Even though current evidence suggests that both parents are important for childhood health, the influence that parents' BMI and socio-demography has on toddlers' BMI has so far received little attention. This study aimed to increase our knowledge on the association between toddlers' and parents' BMI, in relation to family socio-demography. Further, the aim was to investigate the interaction between the mothers' and fathers' BMI in relation to their child's BMI. A total of 697 children with a median age of 18 months (range 16-24 months) participated in the study along with their mothers (n = 697) and fathers (n = 674). As regards representability, our parental sample had a lower proportion of immigrants and the parents were more gainfully employed compared to parents in the rest of Sweden (when the child was 18 months old). The parents completed a questionnaire on parental and child health. Data on parental weight, height, and socio-demographics were recorded along with the child's weight and height measured at an ordinary child health care visit. We used the thresholds for children's BMI that were recommended for surveillance by the Royal College of Paediatrics and Child Health in 2012 based on the WHO reference population. Among the toddlers, 33 % had a BMI above the WHO 85(th) percentile and 14 % had a BMI above the WHO 95(th) percentile. The probability of a toddler having a BMI above the WHO 95(th) percentile was significantly increased if either the mother or father was overweight (BMI ≥ 25 kg/m(2)). Furthermore, we found a positive synergistic effect between the mother and father being overweight and their child having a BMI above the WHO 85(th) percentile. No associations were found between the toddlers' BMI and the family's socio-demographics, but there were associations between the parents' BMI and the family

Microaggressions, Discrimination, and Phenotype among African Americans: A Latent Class Analysis of the Impact of Skin Tone and BMI.

Science.gov (United States)

Keith, Verna M; Nguyen, Ann W; Taylor, Robert Joseph; Mouzon, Dawne M; Chatters, Linda M

2017-05-01

Data from the 2001-2003National Survey of American Life are used to investigate the effects of phenotype on everyday experiences with discrimination among African Americans (N=3343). Latent class analysis is used to identify four classes of discriminatory treatment: 1) low levels of discrimination, 2) disrespect and condescension, 3) character-based discrimination, and 4) high levels of discrimination. We then employ latent class multinomial logistic regression to evaluate the association between skin tone and body weight and these four classes of discrimination. Designating the low level discrimination class as the reference group, findings revealed that respondents with darker skin were more likely to be classified into the disrespect/condescension and the high level microaggression types. BMI was unrelated to the discrimination type, although there was a significant interaction effect between gender and BMI. BMI was strongly and positively associated with membership in the disrespect and condescension type among men but not among women. These findings indicate that skin tone and body weight are two phenotypic characteristics that influence the type and frequency of discrimination experienced by African Americans.