The effect of cinnamon bark (Cinnamomum burmanii) essential oil microcapsules on vacuumed ground beef quality

Science.gov (United States)

Brilliana, I. N.; Manuhara, G. J.; Utami, R.; Khasanah, L. U.

2017-04-01

Ground beef has a short shelf life because it is susceptible to damage due to microbial contamination and lipid oxidation. So some sort of preservation method such as refrigerated storage, vacuum packaging or natural preservative addition is needed to extend the shelf life of ground beef. A natural preservative that can be used as a food preservative is the cinnamon bark (Cinnamomum burmanii) essential oil microcapsules. The aim of the research was to determine the influence of a cinnamon bark essential oil microcapsules (0%;0.5% and 1% w/w of the ground beef) on the Total Plate Count (TPC), Thiobarbituric Acid (TBA), pH and color of ground beef during refrigerated storage (4±1°C). The result showed that cinnamon bark essential oil microcapsules affected the TPC, TBA, pH and color of ground beef. The addition of the cinnamon bark essential oil microcapsules on ground beef can inhibit microbial growth, inhibit lipid oxidation, inhibit discoloration and lowering pH of fresh ground beef during refrigerated storage compared to the control sample. The higher of the microcapsules were added, the higher the inhibition of microbial growth, lipid oxidation and discoloration of ground beef, indicating better preservation effects.

Heat shock and thermotolerance of Escherichia coli O157:H7 in a model beef gravy system and ground beef.

Science.gov (United States)

Juneja, V K; Klein, P G; Marmer, B S

1998-04-01

Duplicate beef gravy or ground beef samples inoculated with a suspension of a four-strain cocktail of Escherichia coli O157:H7 were subjected to sublethal heating at 46 degrees C for 15-30 min, and then heated to a final internal temperature of 60 degrees C. Survivor curves were fitted using a linear model that incorporated a lag period (TL), and D-values and 'time to a 4D inactivation' (T4D) were calculated. Heat-shocking allowed the organism to survive longer than non-heat-shocked cells; the T4D values at 60 degrees C increased 1.56- and 1.50-fold in beef gravy and ground beef, respectively. In ground beef stored at 4 degrees C, thermotolerance was lost after storage for 14 h. However, heat-shocked cells appeared to maintain their thermotolerance for at least 24 h in ground beef held to 15 or 28 degrees C. A 25 min heat shock at 46 degrees C in beef gravy resulted in an increase in the levels of two proteins with apparent molecular masses of 60 and 69 kDa. These two proteins were shown to be immunologically related to GroEL and DnaK, respectively. Increased heat resistance due to heat shock must be considered while designing thermal processes to assure the microbiological safety of thermally processed foods.

Influence of Skin Packaging on Raw Beef Quality: A Review

Directory of Open Access Journals (Sweden)

S. Stella

2018-01-01

Full Text Available A detailed revision of several aspects related to the application of skin packaging to raw beef was considered. Skin packaging, a relatively new technique derived from vacuum packaging, was developed with the aim of retailing small portions of fresh meat, minced meat, or meat preparations. Above all, the influence of this typology of packaging on the microbial population of raw meat was studied, with particular attention to total viable count, aerobic spoilage bacteria, anaerobic bacteria, Enterobacteriaceae, Brochothrix thermosphacta, and lactic acid bacteria. Moreover, the effect on acidification by LAB was also deepened. As colour is the main characteristic influencing purchase decisions at the point of sale, the effect of skin packaging on this parameter was evaluated for raw meat but also for cooked meat. Tenderness, juiciness, and the ability to hold liquid of raw meat when packed in skin conditions were also considered. Furthermore, odour and flavour were considered as sensorial parameters possibly affected by skin packaging. Finally, acceptability by consumer was also investigated. In the studies considered, results showed that skin packaging is advantageous in terms of maintenance of meat quality and for prolonging shelf-life, improving the stability of the products.

PRODUCT SAFETY AND COLOR CHARACTERISTICS OF GROUND BEEF PROCESSED FROM BEEF TRIMMINGS TREATED WITH PEROXYACETIC ACID ALONE OR FOLLOWED BY NOVEL ORGANIC ACIDS

Directory of Open Access Journals (Sweden)

Fred Pohlman

2014-10-01

Full Text Available The objective of this study was to evaluate the effectiveness of antimicrobial interventions using peroxyacetic acetic acid (PAA followed by novel organic acids on beef trimmings prior to grinding with conventional spray (CS or electrostatic spray (ES on ground beef microbial populations and color. Beef trimmings (80/20; 25kg were inoculated with E. coli O157:H7, non- O157:H7 shiga toxin producing (STEC E. coli (EC and Salmonella spp. (SA at 105 CFU/g. Inoculated trimmings (1.5 kg /treatment/replicate, 2 replicates were treated with CS application of 0.02% PAA alone or followed by CS or ES application of 3% octanoic acid (PO, 3% pyruvic acid (PP, 3% malic acid (PM, saturated solution of fumaric acid (PF or deionized water (W. Findings from this study suggest that PA as a single or multiple chemical hurdle approach with malic, pyruvic, octanoic and fumaric acid on beef trimmings may be effective in reducing E. coli O157:H7 as well as non-STEC serotypes and Salmonella in ground beef up to day 2 of simulated retail display. Results of this study showed that instrumental color properties of ground beef treated with peroxyacetic acid followed by organic acids had little or no difference (P > 0.05 compared to the untreated un-inoculated control ground beef samples. The results also indicate that ES application of some organic acids may have similar or greater efficiency in controlling ground beef microbial populations compared to the CS application of the same acid providing a more economical and waste manageable decontamination approach.

Effects of ascorbic acid and antioxidants on color, lipid oxidation and volatiles of irradiated ground beef

International Nuclear Information System (INIS)

Ahn, D.U.; Nam, K.C.

2004-01-01

Beef loins with 3 different aging times after slaughter were ground, added with none, 0.1% ascorbic acid, 0.01% sesamol+0.01% α-tocopherol, or 0.1% ascorbic acid+0.01% sesamol+0.01% tocopherol. The meats were packaged in oxygen-permeable bags, irradiated at 2.5 kGy, and color, oxidation-reduction potential (ORP), lipid oxidation and volatile profiles were determined. Irradiation decreased the redness of ground beef, and visible color of beef changed from a bright red to a green/brown depending on the age of meat. Addition of ascorbic acid prevented color changes in irradiated beef, and the effect of ascorbic acid became greater as the age of meat or storage time after irradiation increased. The ground beef added with ascorbic acid had lower ORP than control, and the low ORP of meat helped maintaining the heme pigments in reduced form. During aerobic storage, S-volatiles disappeared while volatile aldehydes significantly increased in irradiated beef. Addition of ascorbic acid at 0.1% or sesamol+α-tocopherol at each 0.01% level to ground beef prior to irradiation were effective in reducing lipid oxidation and S-volatiles. As storage time increased, however, the antioxidant effect of sesamol+tocopherol in irradiated ground beef was superior to that of ascorbic acid

Effects of ascorbic acid and antioxidants on color, lipid oxidation and volatiles of irradiated ground beef

Energy Technology Data Exchange (ETDEWEB)

Ahn, D.U. E-mail: duahn@iastate.edu; Nam, K.C

2004-10-01

Beef loins with 3 different aging times after slaughter were ground, added with none, 0.1% ascorbic acid, 0.01% sesamol+0.01% {alpha}-tocopherol, or 0.1% ascorbic acid+0.01% sesamol+0.01% tocopherol. The meats were packaged in oxygen-permeable bags, irradiated at 2.5 kGy, and color, oxidation-reduction potential (ORP), lipid oxidation and volatile profiles were determined. Irradiation decreased the redness of ground beef, and visible color of beef changed from a bright red to a green/brown depending on the age of meat. Addition of ascorbic acid prevented color changes in irradiated beef, and the effect of ascorbic acid became greater as the age of meat or storage time after irradiation increased. The ground beef added with ascorbic acid had lower ORP than control, and the low ORP of meat helped maintaining the heme pigments in reduced form. During aerobic storage, S-volatiles disappeared while volatile aldehydes significantly increased in irradiated beef. Addition of ascorbic acid at 0.1% or sesamol+{alpha}-tocopherol at each 0.01% level to ground beef prior to irradiation were effective in reducing lipid oxidation and S-volatiles. As storage time increased, however, the antioxidant effect of sesamol+tocopherol in irradiated ground beef was superior to that of ascorbic acid.

Estimating animal abundance in ground beef batches assayed with molecular markers.

Directory of Open Access Journals (Sweden)

Xin-Sheng Hu

Full Text Available Estimating animal abundance in industrial scale batches of ground meat is important for mapping meat products through the manufacturing process and for effectively tracing the finished product during a food safety recall. The processing of ground beef involves a potentially large number of animals from diverse sources in a single product batch, which produces a high heterogeneity in capture probability. In order to estimate animal abundance through DNA profiling of ground beef constituents, two parameter-based statistical models were developed for incidence data. Simulations were applied to evaluate the maximum likelihood estimate (MLE of a joint likelihood function from multiple surveys, showing superiority in the presence of high capture heterogeneity with small sample sizes, or comparable estimation in the presence of low capture heterogeneity with a large sample size when compared to other existing models. Our model employs the full information on the pattern of the capture-recapture frequencies from multiple samples. We applied the proposed models to estimate animal abundance in six manufacturing beef batches, genotyped using 30 single nucleotide polymorphism (SNP markers, from a large scale beef grinding facility. Results show that between 411∼1367 animals were present in six manufacturing beef batches. These estimates are informative as a reference for improving recall processes and tracing finished meat products back to source.

Consumers' willingness to pay for irradiated prepared ground beef

International Nuclear Information System (INIS)

Nayga, R.M. Jr.; Woodward, R.; Aiew, W.

2009-01-01

This paper focuses on estimating willingness to pay for reducing the risk of contracting foodborne illness using a non-hypothetical experiment utilizing real food products (i.e. prepared ground beef), real cash and actual exchange in a market setting. Respondents were given positive information about the nature of food irradiation. Single bounded and one and one-half bounded models are developed using dichotomous choice experiments. The results indicate that individuals are willing to pay for a reduction in the risk of foodborne illness once informed about the nature of food irradiation. Respondents are willing to pay a premium of about US $0.77 for 450 g (1 pound) of irradiated ground beef, which is higher than the cost of irradiating the product. (author)

Irradiation of ground beef with the purpose of refrigerated storage

International Nuclear Information System (INIS)

Keskin, S.

1977-01-01

Ground beef packaged in polyethylene film was irradiated at different dose levels ranging from 0.25 to 1.0 Mrad and stored at 3+-1 0 C. Bacteriological and organoleptic evaluations were carried out immediately after irradiation and at weekly intervals thereafter. The red color of the meat was darker after irradiation and this darkening increased with radiation dose. This color change was limited to the surface of the samples. The results of the bacteriological and organoleptic examination indicate that irradiation at 0.25 Mrad permits refrigerated storage of ground beef for 3 weeks, 0,5 Mrad for 6 weeks. Coliforms were found only in non-irradiated samples [fr

Prevalence and distribution of Arcobacter spp. in raw milk and retail raw beef.

Science.gov (United States)

Shah, A H; Saleha, A A; Murugaiyah, M; Zunita, Z; Memon, A A

2012-08-01

A total of 106 beef samples which consisted of local (n = 59) and imported (n = 47) beef and 180 milk samples from cows (n = 86) and goats (n = 94) were collected from Selangor, Malaysia. Overall, 30.2% (32 of 106) of beef samples were found positive for Arcobacter species. Imported beef was significantly more contaminated (46.80%) than local beef (16.9%). Arcobacter butzleri was the species isolated most frequently from imported (81.8%) and local (60%) beef, followed by Arcobacter cryaerophilus in local (33.3%) and imported (18.2%) beef samples. Only one local beef sample (10%) yielded Arcobacter skirrowii. Arcobacter species were detected from cow's milk (5.8%), with A. butzleri as the dominant species (60%), followed by A. cryaerophilus (40%), whereas none of the goat's milk samples were found positive for Arcobacter. This is the first report of the detection of Arcobacter in milk and beef in Malaysia.

Changes in fat content of pork and beef after pan-frying under different conditions

DEFF Research Database (Denmark)

Clausen, Ina; Ovesen, Lars

2005-01-01

) gained 0.4 g. Similar results were obtained for low- (8%) and high-fat (12%) beef patties. Meatballs (7.5% fat initially) gained up to 2.4 g fat/100 g raw product depending on the cooking conditions. The greatest fat loss was 7.2 g for high fat ground beef (12% fat), which was pan-fried and then rinsed...

Shelf life extension of ground beef by radurization

International Nuclear Information System (INIS)

Holzapfel, W.H.; Niemand, J.G.

1982-01-01

Radurization was investigated as a technique in the shelf life extension of ground beef. Although radurization does not necessarily kill off all meat spoilage bacteria, this process may be used for extending the bacteriological keeping quality of fresh meat. The materials and methods used in the investigation are also discussed

Antibacterial effect of lactoferricin B on Escherichia coli O157:H7 in ground beef.

Science.gov (United States)

Venkitanarayanan, K S; Zhao, T; Doyle, M P

1999-07-01

The antibacterial activity of lactoferricin B on enterohemorrhagic Escherichia coli O157:H7 in 1% peptone medium and ground beef was studied at 4 and 10 degrees C. In 1% peptone medium, 50 and 100 microg of lactoferricin B per ml reduced E. coli O157:H7 populations by approximately 0.7 and 2.0 log CFU/ml, respectively. Studies comparing the antibacterial effect of lactoferricin B on E. coli O157:H7 in 1% peptone at pH 5.5 and 7.2 did not reveal any significant difference (P > 0.5) at the two pH values. Lactoferricin B (100 microg/g) reduced E. coli O157:H7 population in ground beef by about 0.8 log CFU/g (P 0.5) was observed in the total plate count between treatment and control ground beef samples stored at 4 and 10 degrees C. The antibacterial effect of lactoferricin B on E. coli O157:H7 observed in this study is not of sufficient magnitude to merit its use in ground beef for controlling the pathogen.

Escherichia coli O157:H7 outbreak associated with consumption of ground beef, June-July 2002.

Science.gov (United States)

Vogt, Richard L; Dippold, Laura

2005-01-01

A case-control and environmental study tested the hypothesis that purchasing and eating ground beef from a specific source was the cause of a cluster of cases of hemolytic uremic syndrome (HUS) and Escherichia coli (E. coli) O157:H7 gastroenteritis. A case-control study comparing risk factors was conducted over the telephone on nine case-patients with 23 selected controls. An environmental investigation was conducted that consisted of reviewing beef handling practices at a specific local supermarket and obtaining ground beef samples from the store and two households with case-patients. The analysis of the case-control study showed that eight case-patients (89%) purchased ground beef at Grocery Chain A compared with four controls who did not develop illness (17%) (matched odds ratio=undefined; 95% confidence interval 2.8, infinity; p=0.006). The environmental investigation showed that Grocery Chain A received meat from Meatpacker A. Laboratory analysis of meat samples from Meatpacker A and Grocery Chain A and stool samples from some patients recovered an identical strain of E. coli O157:H7 according to pulse-field gel electrophoresis. Both the case-control and environmental studies showed that purchasing ground beef at Grocery Chain A, which received ground beef from Meatpacker A, was the major risk factor for illness in eight case-patients; the ninth case-patient was found to be unrelated to the outbreak. Furthermore, meat from Meatpacker A was associated with a nationwide outbreak of E. coli O157:H7 illness that resulted in the second largest recall of beef in U.S. history at the time.

Preservation Effect of Two-Stage Cinnamon Bark (Cinnamomum Burmanii) Oleoresin Microcapsules On Vacuum-Packed Ground Beef During Refrigerated Storage

Science.gov (United States)

Irfiana, D.; Utami, R.; Khasanah, L. U.; Manuhara, G. J.

2017-04-01

The purpose of this study was to determine the effect of two stage cinnamon bark oleoresin microcapsules (0%, 0.5% and 1%) on the TPC (Total Plate Count), TBA (thiobarbituric acid), pH, and RGB color (Red, Green, and Blue) of vacuum-packed ground beef during refrigerated storage (at 0, 4, 8, 12, and 16 days). This study showed that the addition of two stage cinnamon bark oleoresin microcapsules affected the quality of vacuum-packed ground beef during 16 days of refrigerated storage. The results showed that the TPC value of the vacuum-packed ground beef sample with the addition 0.5% and 1% microcapsules was lower than the value of control sample. The TPC value of the control sample, sample with additional 0.5% and 1% microcapsules were 5.94; 5.46; and 5.16 log CFU/g respectively. The TBA value of vacuum-packed ground beef were 0.055; 0.041; and 0.044 mg malonaldehyde/kg, resepectively on the 16th day of storage. The addition of two-stage cinnamon bark oleoresin microcapsules could inhibit the growth of microbia and decrease the oxidation process of vacuum-packed ground beef. Moreover, the change of vacuum-packed ground beef pH and RGB color with the addition 0.5% and 1% microcapsules were less than those of the control sample. The addition of 1% microcapsules showed the best effect in preserving the vacuum-packed ground beef.

Volatile compounds and odor preferences of ground beef added with garlic and red wine, and irradiated with charcoal pack

International Nuclear Information System (INIS)

Lee, Kyung Haeng; Yun, Hyejeong; Lee, Ju Woon; Ahn, Dong Uk; Lee, Eun Joo; Jo, Cheorun

2012-01-01

Irradiation is the most efficient non-thermal technology for improving hygienic quality and extending the shelf-life of food products. One of the adverse effects of food irradiation, however, is off-flavor production, which significantly affects the sensory preferences for certain foods. In this study, garlic (5%, w/w) and red wine (1:1, w/w) were added to ground beef to increase the radiation sensitivity of pathogens and improve meat odor/flavor. Samples were irradiated at 0 or 5 kGy in the presence of charcoal pack. SPME-GC–MS analysis was performed to measure the changes in the volatile compounds and sensory characteristics of the samples. The amount of total volatile compounds produced from ground beef was greater when the sample was irradiated. When garlic and red wine were added to the ground beef, the amount of volatile compounds significantly increased, and the amount of volatile compounds increased even further after irradiation. However, when the samples were irradiated with charcoal pack, the amount of volatile compounds decreased significantly. Sensory evaluation indicated that charcoal pack significantly increased the odor preferences for both irradiated and non-irradiated ground beef added with garlic. These results indicated that addition of charcoal pack to ground beef could reduce off-odor problems induced by irradiation, and this effect was consistent even when certain additives such as garlic and red wine were added. - Highlights: ► Garlic and red wine were added to ground beef and irradiated at 5 kGy in the presence of charcoal pack. ► When the samples were irradiated with charcoal pack, the amount of volatile compounds decreased significantly and it affected sensory score. ► Thus, addition of charcoal pack to ground beef could reduce off-odor problems induced by irradiation. ► This effect was consistent when additives, such as garlic and red wine, were added into ground beef.

On-line, proximate analysis of ground beef directly at a meat grinder outlet.

Science.gov (United States)

Isaksson, T; Nilsen, B N; Tøgersen, G; Hammond, R P; Hildrum, K I

1996-07-01

The fat, moisture and protein contents of ground beef were determined on-line by a diffuse reflectance near infrared (NIR) spectroscopy instrument at the outlet of a meat grinder. Beef samples in the range of 6.2-21.7% fat, 59.6-72.9% moisture and 18.1-20.7% protein were studied. Calibrations from samples ground with hole diameters of 4, 8, 13 or 19 mm in the grinder plate were validated. In addition, calibrations of combinations of these samples from the different hole diameters were validated. Prediction errors, expressed as root mean square error of cross validation of the beef samples, were 0.73-1.50% for fat, 0.75-1.33% for moisture and 0.23-0.32% for protein, depending on the hole diameter of the grinder plate. Calibrations from samples ground with the smallest hole diameters gave lowest prediction errors. The present prediction error results are only slightly higher compared to reported prediction error results using conventional at- and off-line NIR instruments. It is concluded that the on-line NIR prediction results were acceptable for samples ground with grinder plates of 4, 8 or 13 mm hole diameter.

Brazilian ground beef authentication by multiplex polymerase chain reaction

Directory of Open Access Journals (Sweden)

Andrey Carlos do Sacramento de Oliveira

2018-02-01

Full Text Available ABSTRACT: The aim of the present study was to assess the efficacy ofmultiplex PCR in detecting the adulterationof commercially available ground beefvia addition and/orsubstitution ofground buffalo meat. Experimentally adulterated ground beefsamples were prepared in triplicate, and dilutions of DNA from Bos taurus and Bubalusbubalis were prepared to determine the detection limit of the method. Concurrently, 91 ground meatsamples sold as “ground beef” were collected from differentstores in northern Brazil andanalyzed bymultiplex PCR. Buffalo DNA was detected in 17.5% of the collected ground meat samples.Our results showed that multiplex PCR is an efficient method for detectingthe incorporation of groundbuffalo meatatpercentages ranging from 10 to 100% and the incorporation of beef at percentages ranging from0.1 to 100% intoground meat samples.

Microbiological and biochemical characteristics of ground beef as affected by gamma irradiation, food additives and edible coating film

Energy Technology Data Exchange (ETDEWEB)

Ouattara, B.; Giroux, M.; Yefsah, R.; Smoragiewicz, W.; Saucier, L.; Borsa, J.; Lacroix, M. E-mail: monique.lacroix@inrs-iaf.uquebec.ca

2002-03-01

The current interest in 'minimally processed foods' has attracted the attention for combination of mild treatments to improve food safety and shelf-life extension. The present study was conducted to evaluate the combined effect of gamma irradiation and incorporation of naturally occurring antimicrobial compounds on microbial and biochemistry characteristics of ground beef. Ground beef patties (23% fat ) were purchased from a local grocery store (IGA, Laval, Que., Canada) and divided into 3 separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid, and (iii) ground beef with 0.5% ascorbic acid and coated with a protein-based coating containing selected spices. Samples were irradiated at 0, 1, 2, and 3 kGy final dose at the CIC. Samples were stored at 4 deg. C and evaluated periodically for microbial growth, total thiobarbituric reactive substances (TBARS) and free sulfydryl content. At the end of the storage period, Enterobacteriaceae, Lactic acid bacteria, Pseudomonas and Brochothrix thermosphacta were enumerated. Regardless of the treatment group, irradiation significantly (p{<=}0.05) reduced the total aerobic plate counts (APC). Irradiation doses of 1, 2, and 3 kGy produced immediate reduction of 2, 3, and 4 log units of APCs, respectively. Also, shelf-life periods were higher for ground beef samples containing food additives. Lactic acid bacteria and Brochothrix thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. Concentration of TBARS and free sulfydryl concentrations were stabilized during post-irradiation storage for samples containing ascorbic acid and coated with the protein-based coating containing spices.

Microbiological and biochemical characteristics of ground beef as affected by gamma irradiation, food additives and edible coating film

International Nuclear Information System (INIS)

Ouattara, B.; Giroux, M.; Yefsah, R.; Smoragiewicz, W.; Saucier, L.; Borsa, J.; Lacroix, M.

2002-01-01

The current interest in 'minimally processed foods' has attracted the attention for combination of mild treatments to improve food safety and shelf-life extension. The present study was conducted to evaluate the combined effect of gamma irradiation and incorporation of naturally occurring antimicrobial compounds on microbial and biochemistry characteristics of ground beef. Ground beef patties (23% fat ) were purchased from a local grocery store (IGA, Laval, Que., Canada) and divided into 3 separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid, and (iii) ground beef with 0.5% ascorbic acid and coated with a protein-based coating containing selected spices. Samples were irradiated at 0, 1, 2, and 3 kGy final dose at the CIC. Samples were stored at 4 deg. C and evaluated periodically for microbial growth, total thiobarbituric reactive substances (TBARS) and free sulfydryl content. At the end of the storage period, Enterobacteriaceae, Lactic acid bacteria, Pseudomonas and Brochothrix thermosphacta were enumerated. Regardless of the treatment group, irradiation significantly (p≤0.05) reduced the total aerobic plate counts (APC). Irradiation doses of 1, 2, and 3 kGy produced immediate reduction of 2, 3, and 4 log units of APCs, respectively. Also, shelf-life periods were higher for ground beef samples containing food additives. Lactic acid bacteria and Brochothrix thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. Concentration of TBARS and free sulfydryl concentrations were stabilized during post-irradiation storage for samples containing ascorbic acid and coated with the protein-based coating containing spices

Antioxidant effects of soy sauce on color stability and lipid oxidation of raw beef patties during cold storage.

Science.gov (United States)

Kim, Hyun-Wook; Choi, Yun-Sang; Choi, Ji-Hun; Kim, Hack-Youn; Hwang, Ko-Eun; Song, Dong-Heon; Lee, Soo-Yoen; Lee, Mi-Ai; Kim, Cheon-Jei

2013-11-01

This study was conducted to evaluate the antioxidant effects of soy sauce on lipid oxidation and color stability of raw beef patties. Raw beef patties were formulated with four solutions such as NaCl (sodium chloride solution), NaCl/SS (1:1 ratio of sodium chloride and soy sauce solution), SS (soy sauce solution), or SS/A (soy sauce solution combined with 0.05% ascorbic acid) in the same salt concentration. Addition of soy sauce resulted in the decreased pH, lightness, and increased yellowness. Treatment SS/A had the lowest percent of metmyoglobin during storage (Psauce addition were observed in treatments SS and SS/A at the end of the storage period. There were no differences (P>0.05) in free fatty acid concentration at the end of storage. The combined addition of soy sauce and ascorbic acid greatly improved (P<0.05) color stability and retarded lipid oxidation. Copyright © 2013 Elsevier Ltd. All rights reserved.

75 FR 10460 - Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef Product

Science.gov (United States)

2010-03-08

... Tracing Procedures for E. coli O157:H7 Positive Raw Beef Product AGENCY: Food Safety and Inspection... has found positive for Escherichia coli (E. coli) O157:H7. FSIS will also discuss additional verification activities the Agency will conduct at suppliers in response to positive E. coli O157:H7 results...

Reduction of irradiation off-odor and lipid oxidation in ground beef by α-tocopherol addition and the use of a charcoal pack

International Nuclear Information System (INIS)

Sohn, S.H.; Jang, A.; Kim, J.K.; Song, H.P.; Kim, J.H.; Lee, M.; Jo, C.

2009-01-01

A combination of a charcoal pack during irradiation and α-tocopherol addition into ground beef was applied to eliminate an irradiation characteristic off-odor and to retard the lipid oxidation caused by the irradiation process. Ground beef was mixed with 200 ppm α-tocopherol and gamma irradiated with 0, 5, and 10 kGy with or without a charcoal pack present during the irradiation treatment. The pH of the control group was lower than that of α-tocopherol and charcoal pack treatment initially but increased rapidly and showed higher pH at day 7. Addition of α-tocopherol with or without charcoal pack addition showed lower 2-thiobarbituric acid reactive substances values in irradiated ground beef at days 3 and 7 compared to those without addition. The color of ground beef was not significantly affected by the treatment. However, odor preference result showed that 10 kGy-irradiated ground beef with a combination of charcoal pack and α-tocopherol addition had higher scores than the control group regardless of irradiation. Solid-phase microextraction (SPME) gas chromatograph/mass spectrometry (GC/MS) analysis identified various volatile compounds that were created by irradiation of ground beef. These compounds were reduced or eliminated when a charcoal pack was used during the irradiation process. The results of the present study imply that combination of packaging with a charcoal pack during the irradiation process and addition of α-tocopherol into ground beef is a good method to effectively eliminate an irradiation off-odor and retard the lipid oxidation development in ground beef caused by irradiation

Reduction of irradiation off-odor and lipid oxidation in ground beef by {alpha}-tocopherol addition and the use of a charcoal pack

Energy Technology Data Exchange (ETDEWEB)

Sohn, S.H. [Busan Regional Food and Drug Administration, Busan 608-829 (Korea, Republic of); Jang, A. [National Institute of Animal Science, RDA, Suwon 441-706 (Korea, Republic of); Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, J.K. [Cooperative Research, Extension, and Education Service, Northern Marianas College, Saipan, MP 96950 (Korea, Republic of); Song, H.P. [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, J.H. [Cooperative Research, Extension, and Education Service, Northern Marianas College, Saipan, MP 96950 (Korea, Republic of); Lee, M. [Department of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Jo, C. [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)], E-mail: cheorun@cnu.ac.kr

2009-02-15

A combination of a charcoal pack during irradiation and {alpha}-tocopherol addition into ground beef was applied to eliminate an irradiation characteristic off-odor and to retard the lipid oxidation caused by the irradiation process. Ground beef was mixed with 200 ppm {alpha}-tocopherol and gamma irradiated with 0, 5, and 10 kGy with or without a charcoal pack present during the irradiation treatment. The pH of the control group was lower than that of {alpha}-tocopherol and charcoal pack treatment initially but increased rapidly and showed higher pH at day 7. Addition of {alpha}-tocopherol with or without charcoal pack addition showed lower 2-thiobarbituric acid reactive substances values in irradiated ground beef at days 3 and 7 compared to those without addition. The color of ground beef was not significantly affected by the treatment. However, odor preference result showed that 10 kGy-irradiated ground beef with a combination of charcoal pack and {alpha}-tocopherol addition had higher scores than the control group regardless of irradiation. Solid-phase microextraction (SPME) gas chromatograph/mass spectrometry (GC/MS) analysis identified various volatile compounds that were created by irradiation of ground beef. These compounds were reduced or eliminated when a charcoal pack was used during the irradiation process. The results of the present study imply that combination of packaging with a charcoal pack during the irradiation process and addition of {alpha}-tocopherol into ground beef is a good method to effectively eliminate an irradiation off-odor and retard the lipid oxidation development in ground beef caused by irradiation.

Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.

Science.gov (United States)

Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott

2014-02-05

Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.

Effect of freezing rate and storage time on shelf-life quality of hot boned and conventionally boned ground beef

International Nuclear Information System (INIS)

Gapud, V.G.; Schlimme, D.V.

1986-01-01

Commercially processed, 80% lean, chub packaged ground beef (both conventionally boned and hot boned) was frozen to O F (-18 0 C) at three rates: 72, 96, and 120 hours before storage at O F (-18 0 C). The meat was examined after 0, 1.5, 3, 6, 9, and 12 months storage for the following attributes: psychrophile and aerobic plate counts, free fatty acid (FFA) and thiobarbituric acid (TBA) values, niacin content, raw and cooked color, moisture, fat and protein contents, and cook shrink and texture of cooked patties. Freezing rates had no significant effect on microbial load, niacin content, color, or cook shrink and texture. Freezing rate had a significant effect upon TBA and FFA values. Niacin, cook shrink and moisture values declined and TBA and FFA values increased with storage. Raw meat Hunter L value increased and Hunter a/b value declined during storage. Substantial quality differences between meat types were found

Effects of irradiation on trans fatty acids formation in ground beef

International Nuclear Information System (INIS)

Brito, M.S.; Villavicencio, A.L.C.H.; Mancini-filho, Jorge

2002-01-01

In order to give the consumer the assurance that meat processed by irradiation is a safe product, a great deal of research has been developed in the world. The effect of irradiation on the hygienic quality of meat and meat products is considered as related to the control of meat-borne parasites of humans; elimination of pathogens from fresh meat and poultry; and elimination of pathogens from processed meat. Lipid oxidation and associated changes are the major causes of the quality deterioration of meat during storage. Irradiation of lipids induces the production of free radicals, which react with oxygen, leading to the formation of carbonyls, responsible for alterations in food nutritional and sensorial characteristics. Trans fatty acids are present in ground beef and can also be formed during its processing. Interestingly, the trans fatty acids, due to their chemical and physical characteristics, show more resistance to the oxidizing process. This property motivated us to investigate the level of the trans fatty acids, as well as the level of oxidation in irradiated ground beef. Irradiation of ground beef was performed by gamma rays from a 60 Co source. The applied radiation doses were 0; 1.0; 2.0; 3.0; 4.0; 5.0; 6.0; 7.0 and 8.0 kGy. Lipid peroxidation in terms of TBA number and carbonyl content was monitored during storage. The sample characteristics and trans fatty acids composition were measured, following irradiation and after 60 and 90 days of storage at -10 deg. C

Volatile compounds and odor preferences of ground beef added with garlic and red wine, and irradiated with charcoal pack

Science.gov (United States)

Lee, Kyung Haeng; Yun, Hyejeong; Lee, Ju Woon; Ahn, Dong Uk; Lee, Eun Joo; Jo, Cheorun

2012-08-01

Irradiation is the most efficient non-thermal technology for improving hygienic quality and extending the shelf-life of food products. One of the adverse effects of food irradiation, however, is off-flavor production, which significantly affects the sensory preferences for certain foods. In this study, garlic (5%, w/w) and red wine (1:1, w/w) were added to ground beef to increase the radiation sensitivity of pathogens and improve meat odor/flavor. Samples were irradiated at 0 or 5 kGy in the presence of charcoal pack. SPME-GC-MS analysis was performed to measure the changes in the volatile compounds and sensory characteristics of the samples. The amount of total volatile compounds produced from ground beef was greater when the sample was irradiated. When garlic and red wine were added to the ground beef, the amount of volatile compounds significantly increased, and the amount of volatile compounds increased even further after irradiation. However, when the samples were irradiated with charcoal pack, the amount of volatile compounds decreased significantly. Sensory evaluation indicated that charcoal pack significantly increased the odor preferences for both irradiated and non-irradiated ground beef added with garlic. These results indicated that addition of charcoal pack to ground beef could reduce off-odor problems induced by irradiation, and this effect was consistent even when certain additives such as garlic and red wine were added.

Pink slimed: Media framing of novel food technologies and risk related to ground beef and processed foods in the U.S.

Science.gov (United States)

Runge, Kristin K; Chung, Jennifer H; Su, Leona Yi-Fan; Brossard, Dominique; Scheufele, Dietram A

2018-09-01

In March 2012 ABC World News Report aired a series of reports on lean finely textured beef (LFTB) that resulted in a 10-year low for beef prices and the bankruptcy of a major firm that produced LFTB. Using a random sample survey, we tested the effects of the media frame "pink slime" and industry frame "lean finely textured beef," alongside media use, food-related knowledge, trust in food-related institutions and preference for local, fresh, organic and GMO-free foods on perceptions of risk related to ground beef containing pink slime/LFTB, processed foods and red meat. The "pink slime" frame was strongly and positively associated with risk related to ground beef, but not risk related to red meat or processed foods. Attention to news stories about pink slime/LFTB was strongly associated with risk related to ground beef and processed foods, but not red meat. We found varying effects of food values, knowledge and trust on all three dependent variables. Implications are discussed. Copyright © 2018 Elsevier Ltd. All rights reserved.

A comparison of mutagen production in fried ground chicken and beef: effect of supplemental creatine.

Science.gov (United States)

Knize, M G; Shen, N H; Felton, J S

1988-11-01

Ground chicken breast and ground beef with either endogenous or a 10-fold increase in the concentration of creatine were fried at 220 degrees C for 10 min per side. One patty (100 g) of chicken meat yielded 120,000 Salmonella (TA1538) revertants following metabolic activation. The pan residues had 39% of the total activity. Added creatine (10-fold the endogenous level) increased mutagen yields an average of 2-fold. Beef cooked under identical conditions yielded 150,000 revertants/100 g for the meat patties and pan residues combined. Added creatine to beef prior to cooking increased mutagen yields 3-fold. The mutagenic profiles following initial HPLC separation showed that chicken samples with endogenous or added creatine were remarkably similar. Chicken and beef HPLC mutagenicity profiles were also similar to each other, but not identical. This suggests that the general mutagen-forming reactions with the two different types of muscle are qualitatively similar with only minor quantitative differences. The pan residues from both meat types with and without added creatine showed some significant differences in the mutagen peak profile. This work suggests that the types of mutagens formed in chicken are similar to those formed in beef and that creatine appears to be involved in the formation of all the mutagenic compounds produced from fried muscle tissue.

Irradiated ground beef: sensory and quality changes during storage under various packaging conditions

International Nuclear Information System (INIS)

Murano, P.S.; Murano, E.A.; Olson, D.G.

1998-01-01

Ground beef patties (irradiated with 2 kGy and nonirradiated) were packaged using oxygen permeable (polyolefin) or oxygen impermeable material (polyethylene). Samples were irradiated in air and stored in air; irradiated under vacuum and stored under vacuum; or irradiated under vacuum and stored in air. Changes in flavor, texture, juiciness or aftertaste were evaluated after either 1 or 7 days storage at -25 degrees C prior to cooking. Irradiated 'Vac/Air' samples were more tender, irradiated 'Vac' samples were more moist, and irradiated 'Air' samples had the least aftertaste. A 3 log10 reduction in total aerobic counts was detected immediately after irradiation. No difference in lipid oxidation was found within the first week of storage, regardless of packaging atmosphere. Shelf life of ground beef patties was extended 55 days at 4 degrees C

Prevalence and antimicrobial resistance of Campylobacter species isolated from raw camel, beef, lamb, and goat meat in Iran.

Science.gov (United States)

Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza

2010-04-01

Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.

Encapsulated phosphates reduce lipid oxidation in both ground chicken and ground beef during raw and cooked meat storage with some influence on color, pH, and cooking loss.

Science.gov (United States)

Kılıç, B; Simşek, A; Claus, J R; Atılgan, E

2014-05-01

Effects of encapsulated sodium tripolyphosphate (STP), sodium hexametaphosphate (HMP) and sodium pyrophosphate (SPP) on lipid oxidation in uncooked (0, 2, 24h) and cooked (0, 1, 7 d) ground chicken and beef during storage were determined. Ten phosphate treatments included a control (no phosphate), three unencapsulated (u) at 0.5% and three encapsulated (e) phosphates (0.5%) each at a low (e-low) and high (e-high) coating level. Two heating rates (slow, fast) were investigated. Cooking loss (CL), pH, color, orthophosphate (OP), TBARS and lipid hydroperoxides (LPO) were determined. A fast heating and uSTP resulted in lower CL (pcooked samples. Not increased coating level but encapsulated phosphates decreased lipid oxidation in cooked samples (p<0.05). Copyright © 2014 Elsevier Ltd. All rights reserved.

Detection of horse meat contamination in raw and heat-processed meat products.

Science.gov (United States)

Hsieh, Yun-Hwa P; Ofori, Jack A

2014-12-31

Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.

Evidence for the benefits of food chain interventions on E. coli 0157:H7/NM prevalence in retail ground beef and human disease incidence: A success story.

Science.gov (United States)

Pollari, Frank; Christidis, Tanya; Pintar, Katarina D M; Nesbitt, Andrea; Farber, Jeff; Lavoie, Marie-Claude; Gill, Alex; Kirsch, Penelope; Johnson, Roger P

2017-04-20

Human infection with Escherichia coli O157:H7/NM has historically been associated with consumption of undercooked ground beef. The purpose of this paper is to investigate the correlation of the decline in E. coli O157:H7/NM infections in Canada with the introduction of control efforts in ground beef by industry. The human incidence of E. coli O157:H7/NM, prevalence in ground beef and interventions from 1996 to 2014 were analyzed. Pathogen prevalence data were obtained from federal government and industry surveillance and inspection/compliance programs. A survey of the largest ground beef producers in Canada was conducted to identify when interventions were implemented. The incidence of E. coli O157:H7/NM infections in Canada declined from ∼4 cases/100 000 to ∼1 case/100 000 from 2000 to 2010. Verotoxigenic Escherichia coli (VTEC) prevalence in ground beef sold at retail declined from about 30% around the year 2000 to <2% since 2012. Other measures of the prevalence of E. coli, VTEC, and E. coli O157:H7/NM in beef and ground beef also declined. The number and types of interventions implemented in the major beef processing establishments in Canada increased from 1996 to 2016. The observed decline in human illnesses and pathogen levels in relation to retail meats was associated with the introduction of control efforts by industry, federal and provincial/territorial governments, and the general population. Industry-led changes in beef processing along with the introduction of food safety policies, regulations, and public education have led to improved food safety in Canada.

Effect of gamma irradiation in presence of ascorbic acid on microbial composition and TBARS concentration of ground beef coated with an edible active coating

International Nuclear Information System (INIS)

Lacroix, M.; Ouattara, B.; Saucier, L.; Giroux, M.; Smoragiewicz, W.

2004-01-01

The present study was conducted to evaluate the combined effect of gamma irradiation in presence of ascorbic acid on the microbiological characteristics and thiobarbituric acid-reactive substances (TBARS) concentration of ground beef coated with an edible coating, crosslinked by gamma irradiation. The medium fat ground beef patties (23% fat ) were divided into two separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid. Meat samples were irradiated at doses of 0, 1, 2, and 3 kGy and stored at 4±2 deg. C. The content of TBARS was evaluated. After 7 days of storage, Enterobacteriaceae, presumptive Staphylococcus aureus, presumptive Pseudomonas spp., Brochothrix thermosphacta and lactic acid bacteria were enumerated. Results showed that lactic acid bacteria and Br. thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. The content in TBARS was stabilized during post-irradiation storage for samples containing ascorbic acid. Shelf life extension periods estimated on the basis of a limit level of 6 log CFU/g for APCs were 4, 7, and 10 days for samples irradiated at 1, 2, and 3 kGy, respectively. However, the incorporation of ascorbic acid in ground beef did not improve significantly (p>0.05) the inhibitory effect of gamma irradiation

Effect of gamma irradiation in presence of ascorbic acid on microbial composition and TBARS concentration of ground beef coated with an edible active coating

Energy Technology Data Exchange (ETDEWEB)

Lacroix, M. E-mail: monique.lacroix@inrs-iaf.uquebec.ca; Ouattara, B.; Saucier, L.; Giroux, M.; Smoragiewicz, W

2004-10-01

The present study was conducted to evaluate the combined effect of gamma irradiation in presence of ascorbic acid on the microbiological characteristics and thiobarbituric acid-reactive substances (TBARS) concentration of ground beef coated with an edible coating, crosslinked by gamma irradiation. The medium fat ground beef patties (23% fat ) were divided into two separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid. Meat samples were irradiated at doses of 0, 1, 2, and 3 kGy and stored at 4{+-}2 deg. C. The content of TBARS was evaluated. After 7 days of storage, Enterobacteriaceae, presumptive Staphylococcus aureus, presumptive Pseudomonas spp., Brochothrix thermosphacta and lactic acid bacteria were enumerated. Results showed that lactic acid bacteria and Br. thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. The content in TBARS was stabilized during post-irradiation storage for samples containing ascorbic acid. Shelf life extension periods estimated on the basis of a limit level of 6 log CFU/g for APCs were 4, 7, and 10 days for samples irradiated at 1, 2, and 3 kGy, respectively. However, the incorporation of ascorbic acid in ground beef did not improve significantly (p>0.05) the inhibitory effect of gamma irradiation.

Distribution of Escherichia coli O157:H7 in ground beef: Assessing the clustering intensity for an industrial-scale grinder and a low and localized initial contamination.

Science.gov (United States)

Loukiadis, Estelle; Bièche-Terrier, Clémence; Malayrat, Catherine; Ferré, Franck; Cartier, Philippe; Augustin, Jean-Christophe

2017-06-05

Undercooked ground beef is regularly implicated in food-borne outbreaks involving pathogenic Shiga toxin-producing Escherichia coli. The dispersion of bacteria during mixing processes is of major concern for quantitative microbiological risk assessment since clustering will influence the number of bacteria the consumers might get exposed to as well as the performance of sampling plans used to detect contaminated ground beef batches. In this study, batches of 25kg of ground beef were manufactured according to a process mimicking an industrial-scale grinding with three successive steps: primary grinding, mixing and final grinding. The ground beef batches were made with 100% of chilled trims or with 2/3 of chilled trims and 1/3 of frozen trims. Prior grinding, one beef trim was contaminated with approximately 10 6 -10 7 CFU of E. coli O157:H7 on a surface of 0.5cm 2 to reach a concentration of 10-100cells/g in ground beef. The E. coli O157:H7 distribution in ground beef was characterized by enumerating 60 samples (20 samples of 5g, 20 samples of 25g and 20 samples of 100g) and fitting a Poisson-gamma model to describe the variability of bacterial counts. The shape parameter of the gamma distribution, also known as the dispersion parameter reflecting the amount of clustering, was estimated between 1.0 and 1.6. This k-value of approximately 1 expresses a moderate level of clustering of bacterial cells in the ground beef. The impact of this clustering on the performance of sampling strategies was relatively limited in comparison to the classical hypothesis of a random repartition of pathogenic cells in mixed materials (purely Poisson distribution instead of Poisson-gamma distribution). Copyright © 2017 Elsevier B.V. All rights reserved.

Consumer sensory evaluation, fatty acid composition, and shelf-life of ground beef with subcutaneous fat trimmings from different carcass locations.

Science.gov (United States)

Kerth, Chris R; Harbison, Amanda L; Smith, Stephen B; Miller, Rhonda K

2015-06-01

Brisket, chuck, plate, flank, and round subcutaneous fat trim were used to produce ground beef patties then evaluated for color, lipid oxidation, fatty acid composition, volatile chemical compounds and consumer sensory evaluation. Color, TBARS, consumer sensory evaluation, and cook/freezer loss did not differ (P>0.05) among carcass fat locations. Percentage stearic acid was lower (P=0.044) in the ground beef using brisket fat than using the chuck and flank fat. Patties made with brisket fat were higher in cis-vaccenic acid (P=0.016) and the saturated to monounsaturated fatty acid ratio (P=0.018) than all other sources of subcutaneous fat. Butanedione was highest (P=0.013) in patties using flank and plate fat. Ground beef with brisket fat was higher (P=0.003) than all other sources for beefy aroma. Altering the profile of non-polar, triglyceride fatty acids has no effect on sensory flavor or major volatile chemical compounds. Copyright © 2015 Elsevier Ltd. All rights reserved.

Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

DEFF Research Database (Denmark)

Scullion, R.; Harrington, C.S.; Madden, R.H.

2006-01-01

A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

Effect of marination in gravy on the radio frequency and microwave processing properties of beef

OpenAIRE

Basaran-Akgul, Nese; Rasco, Barbara A.

2013-01-01

Dielectric properties (the dielectric constant (ε′) and the dielectric loss factor (ε″)) and the penetration depth of raw eye of round beef Semitendinosus muscle, raw beef marinated in gravy, raw beef cooked in gravy, and gravy alone were determined as a function of the temperature (20–130 °C) and frequency (27–1,800 MHz). Both ε′ and ε″ values increased as the temperature increased at low frequencies (27 and 40 MHz). At high frequencies (915 and 1,800 MHz), ε′ showed a 50 % decrease while ε″...

Prevalence and Antimicrobial Resistance of Campylobacter Isolated from Dressed Beef Carcasses and Raw Milk in Tanzania.

Science.gov (United States)

Kashoma, Isaac P; Kassem, Issmat I; John, Julius; Kessy, Beda M; Gebreyes, Wondwossen; Kazwala, Rudovick R; Rajashekara, Gireesh

2016-01-01

Campylobacter species are commonly transmitted to humans through consumption of contaminated foods such as milk and meat. The aim of this study was to investigate the prevalence, antimicrobial resistance, and genetic determinants of resistance of Campylobacter isolated from raw milk and beef carcasses in Tanzania. The antimicrobial resistance genes tested included blaOXA-61 (ampicillin), aph-3-1 (aminoglycoside), tet(O) (tetracycline), and cmeB (multi-drug efflux pump). The prevalence of Campylobacter was 9.5% in beef carcasses and 13.4% in raw milk, respectively. Using multiplex-polymerase chain reaction (PCR), we identified 58.1% of the isolates as Campylobacter jejuni, 30.7% as Campylobacter coli, and 9.7% as other Campylobacter spp. One isolate (1.6%) was positive for both C. jejuni and C. coli specific PCR. Antimicrobial susceptibility testing using the disk diffusion assay and the broth microdilution method showed resistance to: ampicillin (63% and 94.1%), ciprofloxacin (9.3% and 11.8%), erythromycin (53.7% and 70.6%), gentamicin (0% and 15.7%), streptomycin (35.2% and 84.3%), and tetracycline (18.5% and 17.7%), respectively. Resistance to azithromycin (42.6%), nalidixic acid (64.8%), and chloramphenicol (13%) was determined using the disk diffusion assay only, while resistance to tylosin (90.2%) was quantified using the broth microdilution method. The blaOXA-61 (52.6% and 28.1%), cmeB (26.3% and 31.3%), tet(O) (26.3% and 31.3%), and aph-3-1 (5.3% and 3.0%) were detected in C. coli and C. jejuni. These findings highlight the extent of antimicrobial resistance in Campylobacter occurring in important foods in Tanzania. The potential risks to consumers emphasize the need for adequate control approaches, including the prudent use of antimicrobials to minimize the spread of antimicrobial-resistant Campylobacter.

Chemistry in the kitchen. Making ground meat more healthful.

Science.gov (United States)

Small, D M; Oliva, C; Tercyak, A

1991-01-10

The National Cholesterol Education Program recommends a diet containing less than 30 percent of calories in the form of fat, less than 10 percent in the form of saturated fat, and less than 300 mg of cholesterol per day. Since Americans' diets generally exceed these recommendations, we wished to find an easy kitchen method to reduce substantially saturated fat and cholesterol in ground meat. Raw ground meat was heated in vegetable oil and rinsed with boiling water to extract fat and cholesterol. The fat-free broth was recombined with the meat to restore flavor. The amounts of total fat, saturated fat, and cholesterol in the meat after extraction were compared with the amounts in meat cooked as patties and in stir-fried, rinsed meat. When raw ground beef containing 9.6 to 20.8 percent fat was cooked as patties and the fat poured off, 6 to 17 percent of the fat and 1.3 to 4.3 percent of the cholesterol were lost. In stir-fried, rinsed ground beef, 23 to 59 percent of the fat and 9.0 to 18.8 percent of the cholesterol were lost. When vegetable oil was used to extract fat and cholesterol from beef containing 20.7 percent fat, a mean (+/- SD) of 67.7 +/- 1.6 percent of the fat and 39.2 +/- 5.1 percent of the cholesterol were lost. The differences between conventionally cooked meat and meat prepared by the extraction of fat were significant (P less than 0.001). An average of 43 percent (range, 38 to 49) of cholesterol was extracted from a wide variety of ground meats. Although conventional cooking produced no change in fatty-acid composition as compared with raw meat, our extraction process greatly increased the ratio of unsaturated to saturated fat, from 1.32 in conventionally cooked meat to 2.92 to 4.56 in meat after extraction. Extraction resulted in the loss of 72 to 87 percent of saturated fat. This method produces a tasty meat product that is much lower in saturated fat and cholesterol than conventionally cooked meat, and that can be used in sauces, soups, and

Consumer attitudes towards beef and acceptability of enhanced beef.

Science.gov (United States)

Robbins, K; Jensen, J; Ryan, K J; Homco-Ryan, C; McKeith, F K; Brewer, M S

2003-10-01

The objective of this study was to evaluate consumer quality characteristics of enhanced steaks and roasts derived from cattle supplemented with vitamin E during finishing, and to assess the attitudes of these consumers towards beef. Twelve steers were fed either a control (E-) diet or a diet supplemented with dl-alpha tocopheryl acetate (E+). Paired strip loins and rounds were either used as controls (C) or were pumped (P) to 110% of raw weight to contain 0.4% sodium chloride and 0.4% sodium tripolyphosphate in the final product. Consumers (n=103) evaluated roasts and steaks for juiciness, tenderness, saltiness, and overall acceptability on a 9-point hedonic scale. Enhanced steaks and roasts were more acceptable than non-enhanced controls; E+ steaks were less acceptable than E- steaks. A beef quality questionnaire revealed that color, price, visible fat and cut were the most important factors underlying beef steak purchase, while tenderness, flavor and juiciness were weighted most heavily with regard to eating satisfaction.

Comparison and improvement of chemical and physical characteristics of low- fat ground beef and buffalo meat patties at frozen storage

Directory of Open Access Journals (Sweden)

J. Uriyapongson

2010-02-01

Full Text Available A comparison of chemical and physical properties of beef and buffalo meat, and eight treatments of their ground meat patties was undertaken. Low-fat patties from both meat were prepared using two types of starches; corn and modified tapioca starch as binding ingredients in the ground meat, and methylcellulose (MC in the batter for patty coating. The patties were stored at -18ºC for 1, 15, 30 and 45 days, then deep fried and analyzed for color, % decrease in diameter and % gain in height, % oil absorption and texture. The results suggested that MC improved outside and inside color of patties (p≤0.05. There was no significant difference of cooking yield between beef and buffalo meat patties. Addition of modified starches and MC provided less % decrease in diameter after frying for frozen buffalo meat patties. Modified starch significantly improved % oil absorption in frozen beef and buffalo patties. Modified starch and MC gave both beef and buffalo meat patties more stable in hardness, chewiness and gumminess during the frozen storage. MC improved texture quality of frozen buffalo meat patties. Fried meat patties had high calories at 15 days of frozen storage.

A comparison of dioxins, dibenzofurans and coplanar PCBs in uncooked and broiled ground beef, catfish and bacon.

Science.gov (United States)

Schecter, A; Dellarco, M; Päpke, O; Olson, J

1998-01-01

The primary source of dioxins (PCDDs), dibenzofurans (PCDFs) and coplanar PCBs for the general population is food, especially meat, fish, and dairy products. However, most data on the levels of these chemicals is from food in the raw or uncooked state. We report here the effect of one type of cooking (broiling) on the levels of PCDDs, PCDFs, and coplanar PCBs in ground beef (hamburger), bacon and catfish. Samples of hamburger, bacon, and catfish were broiled and compared to uncooked samples in order to measure changes in the amounts of dioxins in cooked food. The total amount of PCDD, PCDF, and coplanar PCB TEQ decreased by approximately 50% on average for each portion as a result of broiling the hamburger, bacon and catfish specimens. The mean concentration (pg TEQ/kg, wet weight) of PCDDs, PCDFs, and coplanar PCBs, however, remained the same in the hamburger, increased by 83% in the bacon, and decreased by 34% in the catfish. On average, the total measured concentration (pg/kg) of the congeners of PCDDs, PCDFs, and coplanar PCBs increased 14% in the hamburger, increased 29% in the bacon, and decreased 33% in the catfish.

Effect of Gaseous Ozone Exposure on the Bacteria Counts and Oxidative Properties of Ground Hanwoo Beef at Refrigeration Temperature.

Science.gov (United States)

Cho, Youngjae; Muhlisin; Choi, Ji Hye; Hahn, Tae-Wook; Lee, Sung Ki

2014-01-01

This study was designed to elucidate the effect of ozone exposure on the bacteria counts and oxidative properties of ground Hanwoo beef contaminated with Escherichia coli O157:H7 at refrigeration temperature. Ground beef was inoculated with 7 Log CFU/g of E. coli O157:H7 isolated from domestic pigs and was then subjected to ozone exposure (10×10(-6) kg O3 h(-1)) at 4℃ for 3 d. E. coli O157:H7, total aerobic and anaerobic bacterial growth and oxidative properties including instrumental color changes, TBARS, catalase (CAT) and glutathione peroxidase (GPx) activity were evaluated. Ozone exposure significantly prohibited (pgenerator inside a refrigerator. Further studies regarding the ozone concentrations and exposure times are needed.

Survival of Listeria monocytogenes, Yersinia enterocolitica and Escherichia coli O157:H7 and quality changes after irradiation of beef steaks and ground beef

International Nuclear Information System (INIS)

Fu, A.H.; Sebranek, J.G.; Murano, E.A.

1995-01-01

Beef steaks and ground beef were inoculated with Listeria monocytogenes, Yersinia enterocolitica, or Escherichia coli O157:H7. Samples were packaged in air or under vacuum and irradiated at low (0.60 to 0.80 kGy) or medium (1.5 to 2.0 kGy) doses, with each dose delivered at either a low (2.8 M/min conveyor speed) or high (6.9 M/min) dose rate. Medium-dose irradiation accompanied by 7 degrees C storage resulted in no Y. enterocolitica or E. coli O157:H7 survivors being detected. There was no effect on survival of the pathogens by dose rate or storage atmosphere. No difference (P0.05) was observed in meat pH or color, but TBA values increased after 7 days storage

Detection of viable Escherichia coli O157:H7 in ground beef by propidium monoazide real-time PCR.

Science.gov (United States)

Liu, Yarui; Mustapha, Azlin

2014-01-17

Escherichia coli O157:H7 associated with food has caused many serious public health problems in recent years. However, only viable cells of this pathogen can cause infections, and false-positive detection caused by dead cells can lead to unnecessary product recalls. The objective of this study was to develop and optimize a method that combines propidium monoazide (PMA) staining with real-time PCR to detect only viable cells of E. coli O157:H7 in ground beef. PMA is a DNA intercalating dye that can penetrate compromised membranes of dead cells and bind to cellular DNA, preventing its amplification via a subsequent PCR. Three strains of E. coli O157:H7 (505B, G5310 and C7927) at concentrations of 10(0) to 10(8)CFU/mL were used as live cells. Dead cells were obtained by heating cell suspensions at 85°C for 15 min. Suspensions were treated with PMA and the optimized assay was applied to artificially contaminated ground beef with two different fat contents (10% and 27%). DNA was extracted and amplified by TaqMan® real-time PCR assay targeting the uidA gene for detection of E. coli O157:H7. Plasmid pUC19 was added as an internal amplification control (IAC). A treatment of 25 μM PMA with a 10-min light exposure on ice was sufficient to eliminate DNA from 10(8) dead E. coli O157:H7 cells/mL. The optimized assay could detect as low as 10(2) CFU/mL viable E. coli O157:H7 in pure culture and 10(5) CFU/g in ground beef, in the presence of 10(6)/mL or g of dead cells. With an 8-h enrichment, 1 CFU/g viable E. coli O157:H7 in ground beef was detectable without interference from 10(6) dead cells/g. In conclusion, the PMA real-time PCR could effectively detect viable E. coli O157:H7 without being compromised by dead cells. Copyright © 2013 Elsevier B.V. All rights reserved.

Escherichia coli O157:H7 Outbreak Associated with Restaurant Beef Grinding.

Science.gov (United States)

Torso, Lauren M; Voorhees, Ronald E; Forest, Stephen A; Gordon, Andrew Z; Silvestri, Sharon A; Kissler, Bonnie; Schlackman, Jessica; Sandt, Carol H; Toma, Paul; Bachert, Joel; Mertz, Kristen J; Harrison, Lee H

2015-07-01

Escherichia coli O157:H7 is a common cause of foodborne illness in the United States. Beef ground at establishments regulated by the U.S. Department of Agriculture, Food Safety and Inspection Service is routinely tested for E. coli O157:H7. Prior to December 2013, boxed beef product (wholesale cuts of beef, such as beef loin, packaged into bags and boxed for shipping) was not always tested for this pathogen. Downstream processors or retailers may grind the product; and, if the ground beef is not cooked to the recommended temperature, pathogens on the exterior of the beef introduced to the interior through grinding may survive. On 18 October 2013, the Allegheny County Health Department identified two E. coli O157:H7 cases, both of whom were food handlers at restaurant A, a restaurant that ground locally produced boxed beef for hamburgers on site. Case finding was conducted through public messaging, employee surveys, and disease surveillance. All potential cases were interviewed using a standard questionnaire. A confirmed case was defined as laboratory-confirmed E. coli O157:H7 with exposure to restaurant A. A probable case was defined as a patient with compatible symptoms and exposure to restaurant A but without laboratory confirmation. All human and food isolates were characterized by pulsed-field gel electrophoresis and multilocus variable-number tandem repeat analysis. The analysis identified 14 confirmed and 10 probable cases of E. coli; 18 nonintact ground beef samples tested positive for E. coli O157:H7. Nine confirmed cases were restaurant A employees. All confirmed cases recalled eating a restaurant A hamburger in the 10 days before illness onset; most cases reported consuming medium to rare hamburgers. Multiple pulsed-field gel electrophoresis and multilocus variable-number tandem repeat analysis patterns were identified among both the human and ground beef isolates, and the patient isolates matched those found in ground beef samples. Restaurant A

Inactivation of a diverse set of shiga toxin-producing Escherichia coli in ground beef by high pressure processing

Science.gov (United States)

Shiga Toxin-Producing Escherichia coli (STEC) are frequently implicated in foodborne illness outbreaks and recalls of ground beef. In this study we determined the High Pressure Processing (HPP) D-10 value (the processing conditions needed to reduce the microbial population by 1 log) of 39 individua...

Presence of Staphylococcus aureus and Shiga Toxigenic Escherichia coli O157:H7 in Raw Meat in Ağrı, Turkey

Directory of Open Access Journals (Sweden)

Naim Deniz Ayaz

2016-08-01

Full Text Available Background: Staphylococcus aureus and Shiga toxin producing Escherichia coli O157:H7 (EHEC are significant foodborne pathogens worldwide. While S. aureus can cause mild superficial skin infections or life-threatening bacteremia and endocarditis, as well as toxininduced cases such as toxic shock syndrome; E. coli O157:H7 can cause symptoms from mild diarrhea to severe hemorrhagic colitis (HC, hemolytic uremic syndrome (HUS, thrombotic thrombocytopenic purpura (TTP. Objectives: The objectives of this study were to find out the prevalence and seasonal distribution of S. aureus in 214 frozen raw meat (turkey, chicken and beef and the prevalence of E. coli O157:H7 in 70 raw beef with the characterization of the E. coli O157:H7 isolate by multiplex polymerase chain reaction (PCR. Materials and Methods: For the detection of S. aureus, a total of 214 frozen raw meat samples including 74 turkey meat, 70 chicken meat and 70 beef cuts (approximately 2 × 3 cm cubic parts; and for the detection of E. coli O157:H7, a total of 70 frozen raw beef samples that all were produced from national companies and consumed in Ağrı, Turkey were analyzed. Results: Out of 214 meat samples, 25.7 % (18/70 of the beef, 11.4 % (8/74 of the chicken meat, and 5.4 % (4/70 of the turkey meat samples were contaminated with S. aureus. Out of 70 frozen raw beef samples, only 1 (1.4% was identified as both Shiga toxin 1 and 2producing E. coli O157:H7 by the detection of stx1, stx2, eaeA, hly, and fliCh7 according to multiplex PCR analysis. Conclusion: Our findings demonstrate that occurrence frequency of S. aureus was higher in frozen raw beef than in raw chicken and turkey meat samples. Although the prevalence of E. coli O157:H7 was low in beef, the presence of virulence genes, especially toxin genesrema in a significant public health concern.

78 FR 15645 - Mandatory Country of Origin Labeling of Beef, Pork, Lamb, Chicken, Goat Meat, Wild and Farm...

Science.gov (United States)

2013-03-12

... Labeling of Beef, Pork, Lamb, Chicken, Goat Meat, Wild and Farm-Raised Fish and Shellfish, Perishable...), lamb, chicken, goat, and pork; ground beef, ground lamb, ground chicken, ground goat, and ground pork... The baseline for this analysis is the present state of the beef, chicken, goat, lamb and pork...

Detection of Shiga toxin-producing Escherichia coli (STEC) O157:H7, O26, O45, O103, O111, O121, and O145, and Salmonella in retail raw ground beef using the DuPont™ BAX® system.

Science.gov (United States)

Wasilenko, Jamie L; Fratamico, Pina M; Sommers, Christopher; DeMarco, Daniel R; Varkey, Stephen; Rhoden, Kyle; Tice, George

2014-01-01

Shiga toxin-producing Escherichia coli (STEC) and Salmonella are food-borne pathogens commonly associated with beef, and reliable methods are needed to determine their prevalence in beef and to ensure food safety. Retail ground beef was tested for the presence of E. coli O157:H7, STEC serogroups O26, O45, O103, O111, O121, and O145, and Salmonella using the DuPont™ BAX® system method. Ground beef (325 g) samples were enriched in 1.5 L of TSB with 2 mg/L novobiocin at 42°C for 18 h, and then evaluated using the BAX® System real-time PCR assays for E. coli O157:H7 and STEC suite, and the BAX® System standard PCR assays for E. coli O157:H7 MP and Salmonella. Samples positive for STEC target genes by the BAX® System assays were subjected to immunomagnetic separation (IMS) and plating onto modified Rainbow Agar O157. Enrichments that were PCR positive for Salmonella were inoculated into RV broth, incubated for 18 h at 42°C, and then plated onto XLT-4 agar. Presumptive positive STEC and Salmonella colonies were confirmed using the BAX® System assays. Results of the BAX® System STEC assays showed 20/308 (6.5%) of samples positive for both the Shiga toxin (stx) and intimin (eae) genes; 4 (1.3%) for stx, eae, and O26; 1 (0.3%) for stx, eae, and O45; 3 (1%) for stx, eae, and O103; and 1 (0.3%) for stx, eae, and O145. There were also 3 samples positive for stx, eae, and more than one STEC serogroup. Three (1.0%) of the samples were positive using the BAX® System real-time E. coli O157:H7 assay, and 28 (9.1%) were positive using the BAX® System Salmonella assay. STEC O103 and E. coli O157:H7 were isolated from 2/6 and 2/3 PCR positive samples, respectively. Salmonella isolates were recovered and confirmed from 27 of the 28 Salmonella PCR positive samples, and a portion of the isolates were serotyped and antibiotic resistance profiles determined. Results demonstrate that the BAX® System assays are effective for detecting STEC and Salmonella in beef.

Effect of marination in gravy on the radio frequency and microwave processing properties of beef.

Science.gov (United States)

Basaran-Akgul, Nese; Rasco, Barbara A

2015-02-01

Dielectric properties (the dielectric constant (ε') and the dielectric loss factor (ε″)) and the penetration depth of raw eye of round beef Semitendinosus muscle, raw beef marinated in gravy, raw beef cooked in gravy, and gravy alone were determined as a function of the temperature (20-130 °C) and frequency (27-1,800 MHz). Both ε' and ε″ values increased as the temperature increased at low frequencies (27 and 40 MHz). At high frequencies (915 and 1,800 MHz), ε' showed a 50 % decrease while ε″ increased nearly three fold with increasing temperature in the range from 20 to 130 °C. ε' increased gradually while ε″ increased five fold when the temperature increased from 20 to 130 °C. Both ε' and ε″ of all samples decreased with increase in frequency. Marinating the beef in gravy dramatically increased the ε″ values, particularly at the lower frequencies. Power penetration depth of all samples decreased with increase temperature and frequency. These results are expected to provide useful data for modeling dielectric heating processes of marinated muscle food.

Ground transport stress affects bacteria in the rumen of beef cattle: A real-time PCR analysis.

Science.gov (United States)

Deng, Lixin; He, Cong; Zhou, Yanwei; Xu, Lifan; Xiong, Huijun

2017-05-01

Transport stress syndrome often appears in beef cattle during ground transportation, leading to changes in their capacity to digest food due to changes in rumen microbiota. The present study aimed to analyze bacteria before and after cattle transport. Eight Xianan beef cattle were transported over 1000 km. Rumen fluid and blood were sampled before and after transport. Real-time PCR was used to quantify rumen bacteria. Cortisol and adrenocorticotrophic hormone (ACTH) were measured. Cortisol and ACTH were increased on day 1 after transportation and decreased by day 3. Cellulolytic bacteria (Fibrobacter succinogenes and Ruminococcus flavefaciens), Ruminococcus amylophilus and Prevotella albensis were increased at 6 h and declined by 15 days after transport. There was a significant reduction in Succinivibrio dextrinosolvens, Prevotella bryantii, Prevotella ruminicola and Anaerovibrio lipolytica after transport. Rumen concentration of acetic acid increased after transport, while rumen pH and concentrations of propionic and butyric acids were decreased. Body weight decreased by 3 days and increased by 15 days after transportation. Using real-time PCR analysis, we detected changes in bacteria in the rumen of beef cattle after transport, which might affect the growth of cattle after transport. © 2016 Japanese Society of Animal Science.

Comparative study of mineral composition of beef steak and pork chops depending on the thermal preparation method.

Science.gov (United States)

Goran, Gheorghe Valentin; Tudoreanu, Liliana; Rotaru, Elena; Crivineanu, Victor

2016-08-01

This study focuses on the effects of three different thermal preparation methods (roasting, boiling, and microwave cooking) on the mineral concentrations of beef and pork, as well as on the comparison of mineral levels between these two types of meat. In this study, raw and cooked beef and pork samples were selected and analyzed by ICP-OES in order to determine mineral concentrations. In general, thermal preparation clearly increased mineral concentrations in cooked samples compared to raw meat. The highest mineral concentration was identified in the roasted samples. Trace element concentrations in beef were significantly higher compared to pork. In pork, Na concentration decreased in all samples, suggesting that Na is lost with water. Zn mean content in cooked beef samples registered significant differences compared to pork cooked samples. The percentage of water loss during the microwave thermal preparation for beef samples was higher than the other two treatments. Copyright © 2016 Elsevier Ltd. All rights reserved.

Foodborne transmission of sorbitol-fermenting Escherichia coli O157:[H7] via ground beef: an outbreak in northern France, 2011.

Science.gov (United States)

King, L A; Loukiadis, E; Mariani-Kurkdjian, P; Haeghebaert, S; Weill, F-X; Baliere, C; Ganet, S; Gouali, M; Vaillant, V; Pihier, N; Callon, H; Novo, R; Gaillot, O; Thevenot-Sergentet, D; Bingen, E; Chaud, P; de Valk, H

2014-12-01

Sorbitol-fermenting Escherichia coli O157:[H7] is a particularly virulent clone of E. coli O157:H7 associated with a higher incidence of haemolytic uraemic syndrome and a higher case fatality rate. Many fundamental aspects of its epidemiology remain to be elucidated, including its reservoir and transmission routes and vehicles. We describe an outbreak of sorbitol-fermenting E. coli O157:[H7] that occurred in France in 2011. Eighteen cases of paediatric haemolytic uraemic syndrome with symptom onset between 6 June and 15 July 2011 were identified among children aged 6 months to 10 years residing in northern France. A strain of sorbitol-fermenting E. coli O157:[H7] stx2a eae was isolated from ten cases. Epidemiological, microbiological and trace-back investigations identified multiply-contaminated frozen ground beef products bought in a supermarket chain as the outbreak vehicle. Strains with three distinct pulsotypes that were isolated from patients, ground beef preparations recovered from patients' freezers and from stored production samples taken at the production plant were indistinguishable upon molecular comparison. This investigation documents microbiologically confirmed foodborne transmission of sorbitol-fermenting of E. coli O157 via beef and could additionally provide evidence of a reservoir in cattle for this pathogen. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Effect of the Programmed Nutrition Beef Program on moisture retention of cooked ground beef patties and enhanced strip loins.

Science.gov (United States)

2015-02-01

This study evaluated the influence of the Programmed Nutrition Beef Program and exogenous growth promotants (ExGP) on water holding capacity characteristics of enhanced beef strip loins. Sixty, frozen strip loins, arranged in a 2 × 2 factorial treatment arrangement with dietary program serving as the first factor and use of ExGP as the second factor, were thawed, injected with an enhancement solution, and stored for 7 days. Loins from ExGP cattle possessed the ability to bind more (P water before pumping and bind less (P water after pumping and storage. Loin pH across treatments was similar (P > 0.10) before injection, but increased post-injection and after storage (P 0.10). The Programmed Nutrition Beef Program and use of ExGPs minimally impacted water holding capacity of enhanced frozen/thawed beef strip loins.

On-line prediction of chemical composition of semi-frozen ground beef by non-invasive NIR spectroscopy.

Science.gov (United States)

Tøgersen, G; Arnesen, J F; Nilsen, B N; Hildrum, K I

2003-04-01

The chemical composition of industrial scale batches of frozen beef was measured on-line during grinding by near infrared (NIR) reflectance spectroscopy. The MM55E filter based non-contact NIR instrument was mounted at the outlet of a meat grinder, and the fat, moisture and protein contents determined from the average of each filter reading throughout the grinding of the batch. The filters were selected from full spectra measurements to be as insensitive to water crystallization as possible. For on-line calibration and prediction, 55 beef batches of 400-800 kg in the range of 7.66-22.91% fat, 59.36-71.48% moisture, and 17.04-20.76% protein, were ground through 4 or 13 mm hole plates. The regression results, presented as root mean square error of cross validation (RMSECV) were between 0.48 and 1.11% for fat, 0.43 and 0.97% for moisture and 0.41 and 0.47% for protein.

prevalence of escherichia coli 0157:h7 in fresh and roasted beef

African Journals Online (AJOL)

DR. AMINU

The prevalence of Enterohemorrhagic Escherichia coli 0157:H7 in 300 fresh beef and 150 roasted beef samples from ... likely cause of E. coli O157:H7 infection is undercooked ground beef. ..... coli O157:H7 in a sheep model. Appl. Environ.

Characterization of radiation-resistant vegetative bacteria in beef

International Nuclear Information System (INIS)

Welch, A.B.; Maxcy, R.B.

1975-01-01

Ground beef contains numerous microorganisms of various types. The commonly recognized bacteria are associated with current problems of spoilage. Irradiation, however, contributes a new factor through selective destruction of the microflora. The residual microorganisms surviving a nonsterilizing dose are predominantly gram-negative coccobacilli. Various classifications have been given, e.g., Moraxella, Acinetobacter, Achromobacter, etc. For a more detailed study of these radiation-resistant bacteria occurring in ground beef, an enrichment procedure was used for isolation. By means of morphological and biochemical tests, most of the isolates were found to be Moraxella, based on current classifications. The range of growth temperatures was from 2 to 50 C. These bacteria were relatively heat sensitive, e.g., D 10 of 5.4 min at 70 0 C or less. The radiation resistance ranged from D 10 values of 273 to 2,039 krad. Thus, some were more resistant than any presently recognized spores. A reference culture of Moraxella osloensis was irradiated under conditions comparable to the enrichment procedure used with the ground beef. The only apparent changes were in morphology and penicillin sensitivity. However, after a few subcultures these bacteria reverted to the characteristics of the parent strain. Thus, it is apparent that these isolates are a part of the normal flora of ground beef and not aberrant forms arising from the irradiation procedure. The significance, if any, of these bacteria is not presently recognized. (auth)

Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

Science.gov (United States)

Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

2010-11-01

The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

Physicochemical Characteristics of Protein-Enriched Restructured Beef Steaks with Phosphates, Transglutaminase, and Elasticised Package Forming

Directory of Open Access Journals (Sweden)

Sephora Baugreet

2018-01-01

Full Text Available Restructured beef steaks were formulated by adding protein-rich ingredients (pea protein isolate (PPI, rice protein (RP, and lentil flour (LF (at 4 and 8%, phosphate (0.2%, and two binding agents: 1% (TG and 0.15% (TS. The effects of their addition on the physicochemical properties of the beef steaks were investigated. Protein content of the RP8TG sample was significantly higher than that of the control in both the raw and cooked state. Raw LF4TS exhibited greater (P<0.01 a∗ values than the control; however, after the cooking process, L∗, a∗, and b∗ values were similar for all treatments. Textural assessment showed that elevating protein level increased (P<0.001 hardness, chewiness, cohesiveness, and gumminess in cooked restructured steaks. LF addition reduced all textural values assessed, indicating a strong plant protein effect on texture modification. The commercial binder produced a better bind in combination with protein ingredients. This facilitated the production of uniformed restructured beef steaks from low-value beef muscles with acceptable quality parameters using a novel process technology.

Valorization of functional properties of extract and powder of olive leaves in raw and cooked minced beef meat.

Science.gov (United States)

Aouidi, Fathia; Okba, Aicha; Hamdi, Moktar

2017-08-01

Olive leaves (OL), available in huge amounts from pruning, are known to be a useful source of biologically active compounds. This study investigated the potential application of OL as a supplement to minced beef meat in order to develop a functional product. The effect of OL extract or powder (100 and 150 µg phenols g -1 meat) on the quality and stability of raw and cooked meat during refrigerated storage was examined. Microwave drying at 600 W gave OL with the highest antioxidant quality (evaluated by TEAC/[phenols] (mg mg -1 ) and DPPH/[phenols] (mg mg -1 )) compared with other methods. OL showed an ability to inhibit (P production was 43-65% in control samples and 14-35% in treated samples). OL also improved the technological quality of the meat, decreasing (P functional meat products of good technological quality that remain stable during storage. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

BIODIESEL DARI CAMPURAN LEMAK SAPI (Beef Tallow DAN MINYAK SAWIT

Directory of Open Access Journals (Sweden)

Wara Dyah Pita Rengga

2013-05-01

Full Text Available Cadangan minyak bumi semakin menipis, sehingga dicari bahan bakar alternatif, salah satunya adalah biodiesel. Minyak nabati terutama minyak sawit merupakan bahan baku edible sedangkan lemak sapi merupakan bahan baku non-edible dengan biaya rendah dan memiliki ketersediaan tinggi pada produksi sapi. Pemanfaatan lemak sapi yang belum maksimal dapat digunakan bersama minyak sawit untuk menghasilkan biodiesel. Lemak sapi dicairkan supaya menjadi minyak sapi. Bahan baku minyak sapi dan minyak sawit dicampur dengan perban-dingan 3:1. Campuran minyak ditransesterifikasi dengan metanol dengan perbandingan molar (1:6 dan katalis NaOH. Proses dilakukan selama 90 menit pada suhu ±65°C. Hasil proses transesterifikasi adalah metil ester dan gliserol. Metil ester pada lapisan atas dipisahkan dari gliserol kemudian dilakukan pencucian. Metil ester atau biodiesel selanjutnya diuji angka asam, viskositas, densitas, dan analisis menggunakan GC-MS. Yield biodiesel yang dihasilkan dari campuran minyak sapi dan minyak sawit adalah 76%, angka asam 0,67124 mg-KOH/g, densitas 857,76 kg/cm³, dan viskositas 3,0074 mm2/s. Kesemua parameter tersebut sesuai dengan standart mutu SNI biodiesel. Kandungan metil ester dari minyak sawit dan lemak sapi adalah metiloleat dan metil palmitat. The availability of the fossil fuel is decreasing; hence the finding of an alternative fuels is very important. One of those alternative fuels is biodiesel. Vegetable oil, especially palm oil is the edible raw material, while the beef tallow is the non-edible raw material with low cost production and the availability is huge in the cattle production. The beef tallow mixed with palm oil can be used as raw material for producing biodiesel. Firstly, the beef tallow was melted into beef oil. The raw materials of beef tallow and palm oil were mixed with the composition ratio of 3:1. The resulted mixed-oil was transesterificated by adding methanol with molar ratio of 1:6 and NaOH as

Quantitative risk assessment for Escherichia coli O157:H7 in frozen ground beef patties consumed by young children in French households.

Science.gov (United States)

Delignette-Muller, M L; Cornu, M

2008-11-30

A quantitative risk assessment for Escherichia coli O157:H7 in frozen ground beef patties consumed by children under 10 years of age in French households was conducted by a national study group describing an outbreak which occurred in France in 2005. Our exposure assessment model incorporates results from French surveys on consumption frequency of ground beef patties, serving size and consumption preference, microbial destruction experiments and microbial counts on patties sampled from the industrial batch which were responsible for the outbreak. Two different exposure models were proposed, respectively for children under the age of 5 and for children between 5 and 10 years. For each of these two age groups, a single-hit dose-response model was proposed to describe the probability of hemolytic and uremic syndrome (HUS) as a function of the ingested dose. For each group, the single parameter of this model was estimated by Bayesian inference, using the results of the exposure assessment and the epidemiological data collected during the outbreak. Results show that children under 5 years of age are roughly 5 times more susceptible to the pathogen than children over 5 years. Exposure and dose-response models were used in a scenario analysis in order to validate the use of the model and to propose appropriate guidelines in order to prevent new outbreaks. The impact of the cooking preference was evaluated, showing that only a well-done cooking notably reduces the HUS risk, without annulling it. For each age group, a relation between the mean individual HUS risk per serving and the contamination level in a ground beef batch was proposed, as a tool to help French risk managers.

Identification and quantification of flavor attributes present in chicken, lamb, pork, beef, and turkey.

Science.gov (United States)

Maughan, Curtis; Martini, Silvana

2012-02-01

The objectives of this study were to use a meat flavor lexicon to identify and quantify flavor differences among different types of meats such as beef, chicken, lamb, pork, and turkey, and to identify and quantify specific flavor attributes associated with "beef flavor" notes. A trained descriptive panel with 11 participants used a previously developed meat lexicon composed of 18 terms to evaluate the flavor of beef, chicken, pork, turkey, and lamb samples. Results show that beef and lamb samples can be described by flavor attributes such as barny, bitter, gamey, grassy, livery, metallic, and roast beef. Inversely related to these samples were pork and turkey and those attributes that were closely related to them, namely brothy, fatty, salty, sweet, and umami. Chicken was not strongly related to the other types of meats or the attributes used. The descriptive panel also evaluated samples of ground beef mixed with chicken to identify and quantify flavor attributes associated with a "beef flavor." Meat patties for this portion consisted of ground beef mixed with ground chicken in varying amounts: 0%, 25%, 50%, 75%, and 100% beef, with the remainder made up of chicken. Beef and beef-rich patties (75% beef) were more closely related to flavor attributes such as astringent, bloody, fatty, gamey, metallic, livery, oxidized, grassy, and roast beef, while chicken was more closely associated with brothy, juicy, sour, sweet, and umami. This research provides information regarding the specific flavor attributes that differentiate chicken and beef products and provides the first set of descriptors that can be associated with "beefy" notes. POTENTIAL APPLICATION: The use of a standardized flavor lexicon will allow meat producers to identify specific flavors present in their products. The impact is to identify and quantify negative and positive flavors in the product with the ultimate goal of optimizing processing or cooking conditions and improve the quality of meat products. �

The effects of feeding broiler litter on microbial contamination of beef carcasses

Energy Technology Data Exchange (ETDEWEB)

Davis, J.R.; Apple, J.K.; Hellwig, D.H.; Kegley, E.B.; Pohlman, F.W. [University of Arkansas, Fayetteville, AR (United States). Department of Animal Science

2002-09-01

Two experiments were conducted to test the effects of feeding broiler litter, either directly in the diet or indirectly through pasture-fertilization, to beef cattle on the incidence of Salmonella typhimurium (S) and Escherichia coli O157:H7 (EC) contamination of carcasses and ground beef. In Experiment 1, beef cows (n=32) were allotted either ad libitum access to grass hay or a formulated diet (80% deep-stacked broiler litter and 20% corn). In Experiment 2, beef cows (n=32) were assigned to graze on pastures fertilized with a commercial fertilizer or fresh broiler litter. Cows in Experiment 1 were harvested following a 56-d feeding period; whereas, cows in Experiment 2 were harvested after 5, 10, 20, and 40 d of grazing pastures. All samples of muscle, purge, and ground beef were culture-negative for S and EC, suggesting that beef cattle may consume properly handled deep-stacked broiler litter, or pastures fertilized with fresh litter, without increasing the likelihood of carcass/meat contamination with S and (or) EC. (author)

Evaluation of beef trim sampling methods for detection of Shiga toxin-producing Escherichia coli (STEC)

Science.gov (United States)

Presence of Shiga toxin-producing Escherichia coli (STEC) is a major concern in ground beef. Several methods for sampling beef trim prior to grinding are currently used in the beef industry. The purpose of this study was to determine the efficacy of the sampling methods for detecting STEC in beef ...

Campylobacter fetus meningitis associated with eating habits of raw meat and raw liver in a healthy patient: A case report and literature review.

Science.gov (United States)

Ishihara, Ayaka; Hashimoto, Etaro; Ishioka, Haruhiko; Kobayashi, Hiroyuki; Gomi, Harumi

2018-01-01

Meningitis caused by the zoonotic pathogen Campylobacter fetus in immunocompetent adults is rare. We report a 48-year-old Japanese woman with no underlying disease who was found to have meningitis caused by C. fetus . Both C. fetus subsp. fetus and C. fetus subsp. venerealis were isolated from the cerebrospinal fluid culture. The mode of infection in our patient was considered to be associated with the consumption of raw beef and raw cattle liver on a regular basis. Public awareness and education to avoid the consumption of raw or undercooked meat might help prevent C. fetus meningitis.

GPM GROUND VALIDATION NOAA UHF 449 PROFILER RAW DATA SPC FORMAT MC3E V1

Data.gov (United States)

National Aeronautics and Space Administration — The GPM Ground Validation NOAA UHF 449 Profiler Raw Data SPC Format MC3E dataset was collected during the NASA supported Midlatitude Continental Convective Clouds...

Prevalence and Antibiotic Resistance against Tetracycline in Campylobacter jejuni and C. coli in Cattle and Beef Meat from Selangor, Malaysia.

Science.gov (United States)

Premarathne, Jayasekara M K J K; Anuar, Aimi S; Thung, Tze Young; Satharasinghe, Dilan A; Jambari, Nuzul Noorahya; Abdul-Mutalib, Noor-Azira; Huat, John Tang Yew; Basri, Dayang F; Rukayadi, Yaya; Nakaguchi, Yoshitsugu; Nishibuchi, Mitsuaki; Radu, Son

2017-01-01

Campylobacter is a major foodborne pathogen frequently associated with human bacterial gastroenteritis in the world. This study was conducted to determine the prevalence and antibiotic resistance of Campylobacter spp. in the beef food system in Malaysia. A total of 340 samples consisting of cattle feces ( n = 100), beef ( n = 120) from wet markets and beef ( n = 120) from hypermarkets were analyzed for Campylobacter spp. The overall prevalence of Campylobacter was 17.4%, consisting of 33% in cattle fecal samples, 14.2% in raw beef from wet market and 7.5% in raw beef from the hypermarket. The multiplex-polymerase chain reaction (PCR) identified 55% of the strains as C. jejuni , 26% as C. coli , and 19% as other Campylobacter spp. A high percentage of Campylobacter spp. were resistant to tetracycline (76.9%) and ampicillin (69.2%), whilst low resistance was exhibited to chloramphenicol (7.6%). The MAR Index of Campylobacter isolates from this study ranged from 0.09 to 0.73. The present study indicates the potential public health risk associated with the beef food system, hence stringent surveillance, regulatory measures, and appropriate interventions are required to minimize Campylobacter contamination and prudent antibiotic usage that can ensure consumer safety.

Modeling the inactivatin of Escherichia coli 0157:H7 and uropathogenic E. coli in ground beef by high pressure processing and citral

Science.gov (United States)

Disease causing Escherichia coli commonly found in meat and poultry include intestinal pathogenic E. coli (iPEC) as well as extraintestinal types such as the Uropathogenic E. coli (UPEC). In this study we compared the resistance of iPEC (O157:H7) to UPEC in ground beef using High Pressure Processing...

Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods.

Science.gov (United States)

Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z

2013-07-01

The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.

Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran

Directory of Open Access Journals (Sweden)

Mohammad Hossein Sarrafzadeh Zargar

2014-07-01

Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.

Survival of Escherichia coli O157:H7 in ground beef jerky assessed on two plating media.

Science.gov (United States)

Harrison, J A; Harrison, M A; Rose, R A

1998-01-01

Recent outbreaks of food-borne illness due to Salmonella spp. in beef jerky and Escherichia coli O157:H7 in venison jerky, coupled with the fact that a variety of preparation methods and dying procedures abound, raise concern over the safety of processed meat products made in the home. The potential of injured bacterial cells to regain the ability to cause illness is a particular threat with pathogens such as E. coli O157:H7, which is believed to have a low infectious dose. This study examined the efficacy of various methods of jerky preparation in reducing populations of E, coli O157:H7 in ground beef jerky and compared the recovery rate of E. coli O157:H7 on two selective plating media, modified sorbitol MacConkey agar (MSMA) and modified eosin methylene blue agar (MEMB). Populations of E. coli O157:H7 in both heated and unheated samples exhibited a greater decline during drying when a nitrite and salt cure mix was added during jerky preparation. When recovery of E. coli O157:H7 on MSMA and MEMB was compared, a trend toward slightly higher recovery rates with MEMB was observed. On the basis of these results, MEMB is a suitable alternative to MSMA for the recovery of E. coli O157:H7 from heated and dried meat samples similar to beef jerky.

Occurrence of Campylobacter spp. in raw and ready-to-eat foods and in a Canadian food service operation.

Science.gov (United States)

Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D

2008-10-01

The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.

Minerals Concentration and Textural Properties of Romanian Beef Row and Cooked Meat and Offal

Directory of Open Access Journals (Sweden)

Liliana Tudoreanu

2013-11-01

Full Text Available Introduction: Consumers preferences for solid food are, for the majority of foods groups, influenced by their textural properties. Romanian traditional cuisine is rich in meat foods and therefore this food group has an important contribution to the total mineral intake as well as the ingestion of potentially toxic metals such as Cd and Pb. Although beef liver is an important source of minerals for human consumption, its concentrations in Cd and Pb and heterogeneous textural properties may hinder its acceptability. Aims: The purpose of the work was to estimate raw and cooked beef meat and offal mineral quality including Cd and Pb concentrations and their contribution to a balanced human diet and health  as well as the influenced of thermal preparation on their mineral and textural properties. Materials and methods:  Beef liver, kidney and longissimus dorsi muscle were bought from local markets. Thermal preparation was conducted by microwave and boiling with no water contact. Texture profile analyses was conducted for quantifying textural properties such as  Hardness, Cohesiveness, Springiness, Springiness Index, Chewiness, Adhesiveness and Stiffness. The mineral concentrations of the raw and cooked samples were analyzed by ICP-MS. Conclusion: The offal textural parameters variability was very large within the same organ and compared to the muscle textural parameters variability too. Muscle and offal thermal preparation strongly influenced their minerals’ concentrations as well as their textural properties. Thermal preparation significantly decreased beef liver and kidney samples’ total K and Na concentrations. It is suggested that for improving beef liver acceptability, the consumer has to be advised on the influence of the thermal preparation on beef liver parts’ textural properties as well as minerals concentrations.

Prevalence and Antibiotic Resistance against Tetracycline in Campylobacter jejuni and C. coli in Cattle and Beef Meat from Selangor, Malaysia

Directory of Open Access Journals (Sweden)

Jayasekara M. K. J. K. Premarathne

2017-12-01

Full Text Available Campylobacter is a major foodborne pathogen frequently associated with human bacterial gastroenteritis in the world. This study was conducted to determine the prevalence and antibiotic resistance of Campylobacter spp. in the beef food system in Malaysia. A total of 340 samples consisting of cattle feces (n = 100, beef (n = 120 from wet markets and beef (n = 120 from hypermarkets were analyzed for Campylobacter spp. The overall prevalence of Campylobacter was 17.4%, consisting of 33% in cattle fecal samples, 14.2% in raw beef from wet market and 7.5% in raw beef from the hypermarket. The multiplex-polymerase chain reaction (PCR identified 55% of the strains as C. jejuni, 26% as C. coli, and 19% as other Campylobacter spp. A high percentage of Campylobacter spp. were resistant to tetracycline (76.9% and ampicillin (69.2%, whilst low resistance was exhibited to chloramphenicol (7.6%. The MAR Index of Campylobacter isolates from this study ranged from 0.09 to 0.73. The present study indicates the potential public health risk associated with the beef food system, hence stringent surveillance, regulatory measures, and appropriate interventions are required to minimize Campylobacter contamination and prudent antibiotic usage that can ensure consumer safety.

Quantifying the effect of hand wash duration, soap use, ground beef debris, and drying methods on the removal of Enterobacter aerogenes on hands.

Science.gov (United States)

Jensen, Dane A; Danyluk, Michelle D; Harris, Linda J; Schaffner, Donald W

2015-04-01

Hand washing is recognized as a crucial step in preventing foodborne disease transmission by mitigating crosscontamination among hands, surfaces, and foods. This research was undertaken to establish the importance of several keys factors (soap, soil, time, and drying method) in reducing microorganisms during hand washing. A nonpathogenic nalidixic acid-resistant Enterobacter aerogenes surrogate for Salmonella was used to assess the efficacy of using soap or no soap for 5 or 20 s on hands with or without ground beef debris and drying with paper towel or air. Each experiment consisted of 20 replicates, each from a different individual with ∼ 6 log CFU/ml E. aerogenes on their hands. A reduction of 1.0 ± 0.4 and 1.7 ± 0.8 log CFU of E. aerogenes was observed for a 5-s wash with no soap and a 20-s wash with soap, respectively. When there was no debris on the hands, there was no significant difference between washing with and without soap for 20 s (P > 0.05). Likewise, there was no significant difference in the reductions achieved when washing without soap, whether or not debris was on the hands (P > 0.05). A significantly greater reduction (P soap when there was ground beef debris on the hands. The greatest difference (1.1 log CFU greater average reduction) in effectiveness occurred when ground beef debris was on the hands and a 20-s wash with water was compared with a 20-s wash with soap. Significantly greater (P 4.0 log CFU per towel) when hands are highly contaminated. Our results support future quantitative microbial risk assessments needed to effectively manage risks of foodborne illness in which food workers' hands are a primary cause.

Variables affecting the acceptability of radappertized ground beef products. Effects of food grade phosphates, NaCl, fat level, and grinding methods

International Nuclear Information System (INIS)

Cohen, J.S.; Shults, G.W.; Mason, V.C.; Wierbicki, E.

1977-01-01

A series of experiments was conducted to determine the effect of different variables on the quality of an irradiated ground beef product. Factors studied included: different food-grade phosphates; NaCl content; fat content; and size of grind. The influence of these variables on the cooking loss (moisture retention), shear press values and sensory scores was studied. The addition of phosphates and NaCl was desirable in controlling cooking losses. The most effective phosphate was tetrasodium pyrophosphate. The addition of NaCl decreased the shear press force required to penetrate the beef patty, i.e., it tenderized the product. Phosphate addition did not affect the shear press force. Increased fat content increased the cooking losses, but did not affect the shear press force. Irradiation with sterilizing doses had a marked effect on decreasing the shear press force

Safety of street vended meat products - chicken and beef suya ...

African Journals Online (AJOL)

leftover, heated, spiced and roasted suya of the following day, were collected from three locations in Ibadan metropolis, to identify the specific microorganisms in street vended chicken and beef suya and measure the microbial count at each stage of handling from the raw state to marketing and consumption. The plate count ...

Exposure Assessment of Acetamide in Milk, Beef, and Coffee Using Xanthydrol Derivatization and Gas Chromatography/Mass Spectrometry.

Science.gov (United States)

Vismeh, Ramin; Haddad, Diane; Moore, Janette; Nielson, Chandra; Bals, Bryan; Campbell, Tim; Julian, Allen; Teymouri, Farzaneh; Jones, A Daniel; Bringi, Venkataraman

2018-01-10

Acetamide has been classified as a possible human carcinogen, but uncertainties exist about its levels in foods. This report presents evidence that thermal decomposition of N-acetylated sugars and amino acids in heated gas chromatograph injectors contributes to artifactual acetamide in milk and beef. An alternative gas chromatography/mass spectrometry protocol based on derivatization of acetamide with 9-xanthydrol was optimized and shown to be free of artifactual acetamide formation. The protocol was validated using a surrogate analyte approach based on d 3 -acetamide and applied to analyze 23 pasteurized whole milk, 44 raw sirloin beef, and raw milk samples from 14 different cows, and yielded levels about 10-fold lower than those obtained by direct injection without derivatization. The xanthydrol derivatization procedure detected acetamide in every food sample tested at 390 ± 60 ppb in milk, 400 ± 80 ppb in beef, and 39 000 ± 9000 ppb in roasted coffee beans.

Levels of 2-dodecylcyclobutanone in ground beef patties irradiated by low-energy X-ray and gamma rays.

Science.gov (United States)

Hijaz, Faraj M; Smith, J Scott

2010-01-01

Food irradiation improves food safety and maintains food quality by controlling microorganisms and extending shelf life. However, acceptance and commercial adoption of food irradiation is still low. Consumer groups such as Public Citizen and the Food and Water Watch have opposed irradiation because of the formation of 2-alkylcyclobutanones (2-ACBs) in irradiated, lipid-containing foods. The objectives of this study were to measure and to compare the level of 2-dodecylcyclobutanone (2-DCB) in ground beef irradiated by low-energy X-rays and gamma rays. Beef patties were irradiated by low-energy X-rays and gamma rays (Cs-137) at 3 targeted absorbed doses of 1.5, 3.0, and 5.0 kGy. The samples were extracted with n-hexane using a Soxhlet apparatus, and the 2-DCB concentration was determined with gas chromatography-mass spectrometry. The 2-DCB concentration increased linearly (P irradiation dose for gamma-ray and low-energy X-ray irradiated patties. There was no significant difference in 2-DCB concentration between gamma-ray and low-energy X-ray irradiated patties (P > 0.05) at all targeted doses. © 2010 Institute of Food Technologists®

Nutrient analysis of the Beef Alternative Merchandising cuts.

Science.gov (United States)

Desimone, T L; Acheson, R A; Woerner, D R; Engle, T E; Douglass, L W; Belk, K E

2013-03-01

The objective of this study was to generate raw and cooked nutrient composition data to identify Quality Grade differences in proximate values for eight Beef Alternative Merchandising (BAM) cuts. The data generated will be used to update the nutrient data in the USDA National Nutrient Database for Standard Reference (SR). Beef Rib, Oven-Prepared, Beef Loin, Strip Loin, and Beef Loin, Top Sirloin Butt subprimals were collected from a total of 24 carcasses from four packing plants. The carcasses were a combination of USDA Yield Grades 2 (n=12) and 3 (n=12), USDA Quality Grades upper two-thirds Choice (n=8), low Choice (n=8), and Select (n=8), and two genders, steer (n=16) and heifer (n=8). After aging, subprimals were fabricated into the BAM cuts, dissected, and nutrient analysis was performed. Sample homogenates from each animal were homogenized and composited for analysis of the following: proximate analysis, long chain and trans-fatty acids, conjugated linoleic acid, total cholesterol, vitamin B-12, and selenium. This study identified seven BAM cuts from all three Quality Grades that qualify for USDA Lean; seven Select cuts that qualify for USDA Extra Lean; and three Select cuts that qualify for the American Heart Association's Heart Healthy Check. Copyright © 2012 Elsevier Ltd. All rights reserved.

Detection of Escherichia coli O157:H7 and Salmonella in ground beef by a bead-free quantum dot-facilitated isolation method.

Science.gov (United States)

Wang, Luxin; Wu, Chung-Shieh; Fan, Xudong; Mustapha, Azlin

2012-05-01

The aims of this study were to introduce a new immunological bead-free cell detection method using quantum dots (QDs) as reporter markers for foodborne pathogen detection. QDs are nanosized particles with long-term photostability, high quantum yield, broad absorption spectra, and narrow, symmetric emission and high signal-to-noise ratio. The chemical compound [(1-ethyl-3-3-dimethylaminopropyl) carbodiimide hydrochloride] (EDC) and protein A were used as crosslinkers for manufacturing QD-antibody conjugates. To minimize the inhibition of QD fluorescence by the magnetic beads, the beads were removed after the primary pathogen isolation and before fluorescence measurement. Detection signals were increased four-fold after employing the bead-free isolation method. With a 24-h enrichment, the bead-free QD-facilitated detection method was able to detect 10 CFU/g Escherichia coli O157:H7 and Salmonella from artificially contaminated ground beef. To our knowledge, this detection method is the first research that combined a new EDC-protein A QD-labeling technique and bead-free fluorescence measurement to detect E. coli O157:H7 and Salmonella in ground beef. Copyright © 2012 Elsevier B.V. All rights reserved.

Tracking contamination through ground beef production and identifying points of recontamination using a novel green fluorescent protein (GFP) expressing, E. coli O103, non-pathogenic surrogate

Science.gov (United States)

Introduction: Commonly, ground beef processors conduct studies to model contaminant flow through their production systems using surrogate organisms. Typical surrogate organisms may not behave as Escherichia coli O157:H7 during grinding and are not easy to detect at very low levels. Purpose: Develop...

Detection of premature browning in ground beef with an integrated optical-fibre based sensor using reflection spectroscopy and fibre Bragg grating technology

International Nuclear Information System (INIS)

O'Farrell, M; Sheridan, C; Lewis, E

2007-01-01

This paper reports on an optical fibre based sensor system to detect the occurrence of premature browning in ground beef. Premature browning (PMB) occurs when, at a temperature below the pasteurisation temperature of 71 deg. C, there are no traces of pink meat left in the patty. PMB is more frequent if poorer quality beef or beef that has been stored under imperfect conditions. The experimental work pertaining to this paper involved cooking fresh meat and meat that has been stored in a freezer for, 1 week, 1 month and 3 months and recording the reflected spectra and temperature at the core of the product, during the cooking process, in order to develop a classifier based on the spectral response and using a Self-Organising Map (SOM) to classify the patties into one of four categories, based on their colour. Further tests were also carried out on developing an all-optical fibre sensor for measuring both the temperature and colour in a single integrated probe. The integrated probe contains two different sensor concepts, one to monitor temperature, based on Fibre Bragg Grating (FBG) technology and a second for meat quality, based on reflection spectroscopy in the visible wavelength range

Potential to curb the environmental burdens of American beef consumption using a novel plant-based beef substitute.

Directory of Open Access Journals (Sweden)

Benjamin Goldstein

Full Text Available The food demands of the United States (US impart significant environmental pressures. The high rate of consumption of beef has been shown to be the largest driver of food-borne greenhouse gas emissions, water use and land occupation in the US diet. The environmental benefits of substituting animal products with vegetal foods are well documented, but significant psychological barriers persist in reducing meat consumption. Here we use life cycle assessment to appraise the environmental performance of a novel vegetal protein source in the mean US diet where it replaces ground beef, and in vegetarian and vegan diets where it substitutes for legumes, tofu and other protein sources. We find that relative to the mean US diet, vegetarian and vegan diets significantly reduce per-capita food-borne greenhouse gas emission (32% and 67%, respectively, blue water use (70% and 75%, respectively and land occupation (70% and 79%, respectively, primarily in the form of rangeland. The substitution of 10%, 25% and 50% of ground beef with plant-based burger (PBB at the national scale results in substantial reductions in annual US dietary greenhouse gas emissions (4.55-45.42 Mt CO2 equivalents, water consumption (1.30-12.00 km3 and land occupation (22300-190100 km2. Despite PBB's elevated environmental pressures compared to other vegetal protein sources, we demonstrate that minimal risk exists for the disservices of PBB substitution in non-meat diets to outweigh the benefits of ground-beef substitution in the omnivorous American diet. Demand for plant-based oils in PBB production has the potential to increase land use pressures in biodiversity hotspots, though these could be obviated through responsible land stewardship. Although the apparent environmental benefits of the PBB are contingent on actual uptake of the product, this study demonstrates the potential for non-traditional protein substitutes to play a role in a transition towards more sustainable consumption

Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food

DEFF Research Database (Denmark)

Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask

2005-01-01

The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...

Transcriptome data of peripheral white blood cells from beef heifers collected at the time of artificial insemination

Directory of Open Access Journals (Sweden)

Sarah E. Dickinson

2018-06-01

Full Text Available The reproductive performance of heifers within their first breeding season influences the success of beef cattle operations. Therefore, a means to identify infertile and late breeding heifers before the start of the breeding season holds great promise for the future of the beef industry. Pubertal beef heifers were subjected to estrous synchronization and fixed time artificial insemination (FTAI. We collected peripheral blood from the heifers at the time of artificial insemination (AI and generated RNA sequencing data to characterize the transcriptome of peripheral white blood cells (PWBC. Following insemination, heifers were exposed to natural service for a defined breeding season, and pregnancy was evaluated to classify heifers into one of three groups: AI-pregnant, natural-bred (NB pregnant, and non-pregnant. The raw transcriptome data of PWBC is available on the NCBI GEO repository (GSE103628 where the reader can also find raw read counts and normalized gene expression data. The normalized data on transcript coverage can be visualized as a genome browser at HeiferFertilityRNAseq.org. Keywords: Biomarkers, Infertility, Pregnancy

Antibiotic of resistence profile of Salmonella spp. serotypes isolated from retail beef in Mexico City.

OpenAIRE

Nova Nayarit-Ballesteros; María Salud Rubio-Lozano; Enrique Delgado-Suárez; Danilo Méndez-Medina; Diego Braña-Varela; Oscar Rodas-Suárez

2016-01-01

Objective. To determine the serotype and antibiotic resistance profile of Salmonella spp. isolated from retail ground beef in Mexico City. Materials and methods. A total of 100 samples of ground beef were analyzed. The pathogen was isolated by conventional methods and confirmed by PCR (invA gene, 284 bp). The antibiotic resistance profile was determined by the Kirby-Bauer method while serotyping was performed according to the Kauffman-White scheme. Results. We isolated a total of 19 strains o...

Effects of conventional and grass-feeding systems on the nutrient composition of beef.

Science.gov (United States)

Leheska, J M; Thompson, L D; Howe, J C; Hentges, E; Boyce, J; Brooks, J C; Shriver, B; Hoover, L; Miller, M F

2008-12-01

The objectives of this study were to determine the nutrient composition of grass-fed beef in the United States for inclusion in the USDA National Nutrient Database for Standard Reference, and to compare the fatty acid composition of grass-fed and conventionally fed (control) beef. Ground beef (GB) and strip steaks (SS) were collected on 3 separate occasions from 15 grass-fed beef producers that represented 13 different states, whereas control beef samples were collected from 3 regions (Ohio, South Dakota, and Texas) of the United States on 3 separate occasions. Concentrations of minerals, choline, vitamin B(12), and thiamine were determined for grass-fed beef samples. Grass-fed GB samples had less Mg, P, and K (P < 0.05), and more Na, Zn, and vitamin B(12) (P < 0.05) than SS samples. Fat color, marbling, and pH were assessed for grass-fed and control SS. Subjective evaluation of the SS indicated that grass-fed beef had fat that was more yellow in color than control beef. Percentages of total fat, total cholesterol, and fatty acids along with trans fatty acids and CLA were determined for grass-fed and control SS and GB. Grass-fed SS had less total fat than control SS (P = 0.001), but both grass-fed and control SS were considered lean, because their total fat content was 4.3% or less. For both GB and SS, grass-fed beef had significantly less (P = 0.001 and P = 0.023, respectively) content of MUFA and a greater content of SFA, n-3 fatty acids, CLA, and trans-vaccenic acid than did the control samples. Concentrations of PUFA, trans fatty acids, n-6 fatty acids, and cholesterol did not differ between grass-fed and control ground beef. Trans-vaccenic acid (trans-11 18:1) made up the greatest concentration of the total trans fats in grass-fed beef, whereas CLA accounted for approximately 15% of the total trans fats. Although the fatty acid composition of grass-fed and conventionally fed beef was different, conclusions on the possible effects of these differences on human

Food poisoning prevention

Science.gov (United States)

... wash your hands before preparing or serving food. Cook eggs until they are solid, not runny. DO NOT eat raw ground beef, chicken, eggs, or fish. Heat all casseroles to ... Use a thermometer when cooking beef to at least 160°F (71.1° ...

The Sarcocystis-cyst containing beef and pork as the sources of natural intestinal sarcocystosis in Thai people.

Science.gov (United States)

Bunyaratvej, Sukhum; Unpunyo, Piyapong; Pongtippan, Atcharaporn

2007-10-01

Human intestinal sarcocystosis is a zoonotic disease caused by two coccidians, i.e. Sarcocystis fusiformis (syn. S. bovihominis, S. hominis) due to consumption of raw infected beef and Sarcocystis meischeriana (syn. S. suihominis) due to consumption of infected raw pork. In 1987, survey of the macroscopic S. fusiformis cysts in market beef mainly from old water buffalos aged more than 15 years were commonly observed in Bangkok. In 2005, the macroscopic cyst was no longer seen in beef of cattle and water buffalo aged less than three years. The epidemiological investigation of Sarcocystis spp. infected meat in Bangkok and Lampang. Samples for each of the tongue and beef of cattle and water buffalo, pork from Bangkok markets and pork of domestic swine from some remote villages in various subprovinces (Ampurs) in Lampang were obtained for microscopic examination by H and E and selectively by PAS staining. The microscopic S. fusiformis cysts were seen in all five specimens of tongues and ten specimens of muscles of cattle and water buffalo obtained from fresh-food markets in Bangkok. Ten samples of pork from Bangkok markets revealed no coccidian infection. The microscopic S. meischeriana cysts were seen in three specimens of swine muscles collected from two subprovinces in Lampang. The present merozoites in coccidian cysts retrieved from beef and pork are similar to those previously observed in human intestine. This may histologically indicate an invasive sarcocystosis by both species leading to a condition presently known as chronic inflammation of undetermined etiology in man.

Prospects of the "VT-Pro" series beef protein using in the sausages products technology

Directory of Open Access Journals (Sweden)

O. P. Dvoryaninova

2017-01-01

Full Text Available Recently, the negative attitude of consumers towards soy protein has been formed. Therefore, to increase the mass fraction of protein in the finished product, it is advisable to use animal proteins, the main advantage of which is multipurpose designation, easy use and the ability to ensure an increase in the finished products yield and high production profitability due to their use . The application of beef proteins from collagen-containing raw materials makes it possible to enrich meat products with dietary fiber, to improve the rheological properties of food products significantly, especially their consistency. High functional properties of animal proteins are manifested in their water-retaining capacity. The company "TRUMP Food Technologies" introduced several new positions into its assortment - beef proteins of the "VT-Pro" trade mark (fibrillar fraction collagen, the manufacturer of which is JSC "Verkhnevolzhsky tannery" (Tver region. Proteins of the "VT-Pro" trademark are unique in their characteristics and are natural, environmentally friendly products. Beef protein "VT-Pro" is suitable for the production of cooked sausage and ham products, semi-smoked and boiled-smoked sausages, canned goods, chopped semi-finished products and other meat products. It is used as a full-fledged stabilizing additive for the preparation of meat products with a specified yield and certain organoleptic characteristics (hydration 1: 10-15. It is determined that it is possible to use this protein in dry form, as a protein-fat emulsion, in the form of gel and granules. According to the pilot-industrial approbation under the conditions of AIC "PROMAGRO" LLC, it is possible to underline a number of advantages of beef protein "VT-Pro" using: it possesses high water-retaining and emulsifying ability; allows to process low-grade and fired raw materials and to replace expensive meat raw materials; it reduces the risk of broth-fat swelling; it improves the structure of

Authentication of beef versus horse meat using 60 MHz 1H NMR spectroscopy.

Science.gov (United States)

Jakes, W; Gerdova, A; Defernez, M; Watson, A D; McCallum, C; Limer, E; Colquhoun, I J; Williamson, D C; Kemsley, E K

2015-05-15

This work reports a candidate screening protocol to distinguish beef from horse meat based upon comparison of triglyceride signatures obtained by 60 MHz (1)H NMR spectroscopy. Using a simple chloroform-based extraction, we obtained classic low-field triglyceride spectra from typically a 10 min acquisition time. Peak integration was sufficient to differentiate samples of fresh beef (76 extractions) and horse (62 extractions) using Naïve Bayes classification. Principal component analysis gave a two-dimensional "authentic" beef region (p=0.001) against which further spectra could be compared. This model was challenged using a subset of 23 freeze-thawed training samples. The outcomes indicated that storing samples by freezing does not adversely affect the analysis. Of a further collection of extractions from previously unseen samples, 90/91 beef spectra were classified as authentic, and 16/16 horse spectra as non-authentic. We conclude that 60 MHz (1)H NMR represents a feasible high-throughput approach for screening raw meat. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Artificial neural network as the tool in prediction rheological features of raw minced meat

OpenAIRE

Edyta Balejko; Zbigniew Nowak; Jerzy A. Balejko

2012-01-01

  Background. The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. Material and methods. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed us...

Characterization of Listeria monocytogenes isolates from cattle and ground beef by pulsed-field gel electrophoresis Caracterización de aislamientos de Listeria monocytogenes obtenidos de ganado y de carne molida de vacuno por electroforesis de campo pulsado

Directory of Open Access Journals (Sweden)

Claudia Foerster

2012-09-01

Full Text Available The aims of this study were to determine the occurrence of Listeria monocytogenes in cattle feces and ground beef, to characterize these strains by pulsed-field gel electrophoresis and to compare them to three listeria strains found in humans. Cattle from different origins (n = 250 and ground beef obtained from supermarkets (n = 40 were sampled. The results show low occurrence in cattle feces (0.4 % but a higher presence in ground beef (37 %. An important part of the ground beef strains (80 % had > 95 % similarity with a strain isolated from a human sporadic case and the ATCC 19115 used as control. The strain isolated from cattle feces had 93 % similarity to clone 009, previously associated with a listeriosis outbreak related to cheese. Cattle and ground beef can harbor virulent L. monocytogenes strains. Further studies in animals and animal products are needed to improve listeriosis control.Los objetivos de este estudio fueron determinar la presencia de Listeria monocytogenes en el ganado y en la carne molida de vacuno comercializada en Chile, caracterizar los aislados mediante electroforesis de campo pulsado y compararlos con los obtenidos en tres cepas que han producido listeriosis en humanos, en ese país. Se tomaron muestras de heces de bovinos (n = 250 y de carne molida obtenida en supermercados (n = 40. Se encontró una baja incidencia de este patógeno en las heces de bovinos (0,4 %; un solo animal, pero mayores porcentajes en la carne molida (37 %. Gran parte de las cepas encontradas en la carne molida (80 % mostraron una similitud mayor del 95 % con un caso esporádico de listeriosis y con la cepa de referencia ATCC 19115. La cepa aislada de bovino tuvo un 93 % de similitud con el clon 009, responsable de un brote asociado al consumo de queso, ocurrido en 2008. Se concluye que el ganado y la carne molida pueden albergar cepas virulentas de L. monocytogenes. Se necesita un mayor número de estudios en animales y en los productos que se

Antibiotic of resistence profile of Salmonella spp. serotypes isolated from retail beef in Mexico City.

Directory of Open Access Journals (Sweden)

Nova Nayarit-Ballesteros

2016-05-01

Full Text Available Objective. To determine the serotype and antibiotic resistance profile of Salmonella spp. isolated from retail ground beef in Mexico City. Materials and methods. A total of 100 samples of ground beef were analyzed. The pathogen was isolated by conventional methods and confirmed by PCR (invA gene, 284 bp. The antibiotic resistance profile was determined by the Kirby-Bauer method while serotyping was performed according to the Kauffman-White scheme. Results. We isolated a total of 19 strains of Lomita (6, Derby (4, Senftenberg (2, Javiana and Cannsttat (1 and undeter- mined (5 serotypes. The strains showed a high resistance rate to ampicillin (18/19, carbenicillin (16/19, tetracyclin (13/19, and trimethoprim-sulfamethoxazole (13/19. Multidrug resistance was observed in 14 isolates. Conclusions. Several Salmonella spp. serotypes of public health significance are circulating in ground beef sold in the major Mexican city. Some of these strains are multi-drug resistance.

Development of chitosan-nanoparticle film based materials for controlled quality of minced beef during refrigerated storage

Science.gov (United States)

Erdawati

2010-10-01

Chitosan nanoparticles were prepared based on the ionic gelation of chitosan with tripolyphosphate anions. The physicochemical properties of the chitosan nanoparticles were determined by FTIR analysis, XRD pattern and TEM. The effects of chitosan nanoparticles treatment on the shelf-life extension of minced beef stored at 20±1° C were studied, including chemical and microbiological,. Results indicated that chitosan nanoparticle treatment reduced the total microbial load of fresh minced beef about 10-fold (from 3.2×104 CFU/g to 5.4×102 CFU/g) before storage and the microbial flora was different with that of raw samples. The wide-spectrum antibacterial property of chitosan against bacteria isolated from minced beef was confirmed, and chitosan concentration of 400 ppm was eventually determined for application in minced beef. Based on microbiological analysis, biochemical indices determination and sensory evaluation, shelf-lives of 2-3 days for control, 4-5 days for nanoparticle chitosan treatment samples, were observed, indicating that chitosan nanoparticle have a great potential for minced beef preservation.

9 CFR 319.313 - Beef with gravy and gravy with beef.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Beef with gravy and gravy with beef. 319.313 Section 319.313 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF... Dehydrated Meat Food Products § 319.313 Beef with gravy and gravy with beef. “Beef with Gravy” and “Gravy...

7 CFR 65.160 - Ground chicken.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground chicken. 65.160 Section 65.160 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.160 Ground chicken. Ground chicken means...

Quantification of meat proportions by measuring DNA contents in raw and boiled sausages using matrix-adapted calibrators and multiplex real-time PCR.

Science.gov (United States)

Köppel, René; Eugster, Albert; Ruf, Jürg; Rentsch, Jürg

2012-01-01

The quantification of meat proportions in raw and boiled sausage according to the recipe was evaluated using three different calibrators. To measure the DNA contents from beef, pork, sheep (mutton), and horse, a tetraplex real-time PCR method was applied. Nineteen laboratories analyzed four meat products each made of different proportions of beef, pork, sheep, and horse meat. Three kinds of calibrators were used: raw and boiled sausages of known proportions ranging from 1 to 55% of meat, and a dilution series of DNA from muscle tissue. In general, results generated using calibration sausages were more accurate than those resulting from the use of DNA from muscle tissue, and exhibited smaller measurement uncertainties. Although differences between uses of raw and boiled calibration sausages were small, the most precise and accurate results were obtained by calibration with fine-textured boiled reference sausages.

Authentication of beef versus horse meat using 60 MHz 1H NMR spectroscopy

Science.gov (United States)

Jakes, W.; Gerdova, A.; Defernez, M.; Watson, A.D.; McCallum, C.; Limer, E.; Colquhoun, I.J.; Williamson, D.C.; Kemsley, E.K.

2015-01-01

This work reports a candidate screening protocol to distinguish beef from horse meat based upon comparison of triglyceride signatures obtained by 60 MHz 1H NMR spectroscopy. Using a simple chloroform-based extraction, we obtained classic low-field triglyceride spectra from typically a 10 min acquisition time. Peak integration was sufficient to differentiate samples of fresh beef (76 extractions) and horse (62 extractions) using Naïve Bayes classification. Principal component analysis gave a two-dimensional “authentic” beef region (p = 0.001) against which further spectra could be compared. This model was challenged using a subset of 23 freeze–thawed training samples. The outcomes indicated that storing samples by freezing does not adversely affect the analysis. Of a further collection of extractions from previously unseen samples, 90/91 beef spectra were classified as authentic, and 16/16 horse spectra as non-authentic. We conclude that 60 MHz 1H NMR represents a feasible high-throughput approach for screening raw meat. PMID:25577043

7 CFR 65.170 - Ground lamb.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground lamb. 65.170 Section 65.170 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.170 Ground lamb. Ground lamb means comminuted...

7 CFR 65.165 - Ground goat.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground goat. 65.165 Section 65.165 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.165 Ground goat. Ground goat means comminuted...

Partial Replacement of Ground Corn with Glycerol in Beef Cattle Diets: Intake, Digestibility, Performance, and Carcass Characteristics.

Directory of Open Access Journals (Sweden)

Pedro Del Bianco Benedeti

Full Text Available The objective of this study was to evaluate the effects of replacing dry ground corn with crude glycerol on intake, apparent digestibility, performance, and carcass characteristics of finishing beef bulls. A completely randomized block design experiment with 25 d for adaptation and 100 d for data collection was conducted, in which 3,640 Nellore bulls (367 ± 36.8 kg; 18 ± 3 mo were blocked by body weight and assigned to 20 pens. Bulls were randomly assigned to one of four treatments: 0, 5, 10, and 15% (dry matter basis of crude glycerol in the diet. Initially, 20 bulls were slaughtered to serve as a reference to estimate initial empty body weight, which allowed for carcass gain calculation. Bulls were weighed at the beginning, at two-thirds, and at the end of the experiment for performance calculations. Carcass measurements were obtained by ultrasound. Fecal output was estimated using indigestible neutral detergent fiber as an internal marker. Data were analyzed using the mixed procedures in SAS 9.2 (SAS Institute Inc., Cary, NC. Intake of dry matter, organic matter, and neutral detergent fiber decreased linearly (P 0.05 intakes of crude protein, non-fiber carbohydrates, and total digestible nutrients. Digestibility of dry matter, organic matter, neutral detergent fiber, and total digestible nutrients increased quadratically (P 0.05. These results suggest that crude glycerol may be included in finishing beef diets at levels up to 15% without impairing performance and carcass characteristics.

Attachment of Escherichia coli O157:H7 in ground beef to meat grinders and survival after sanitation with chlorine and peroxyacetic acid.

Science.gov (United States)

Farrell, B L; Ronner, A B; Wong, A C

1998-07-01

The potential for transfer of Escherichia coli O157:H7 from contaminated ground beef to grinding equipment and the inactivation of attached cells during cleaning and sanitizing was examined. Chub-packed ground beef with lean:fat ratios of 75:25, 80:20 or 90:10 was inoculated with 6 log CFU/g or 2 log CFU/g E. coli O157:H7 strain FRIK 910. Samples were consecutively ground in a Hobart meat grinder with stainless steel (SS) chips (1 cm2) glued to the auger housing. Chips were harvested after grinding, detergent washing with or without manual scrubbing and rinsing, sanitizing in a chlorine or peroxyacetic acid sanitizer, and overnight storage. Survival of E. coli O157:H7 was evaluated both by plate count and enrichment in trypticase soy broth. Approximately 3 to 4 log CFU/cm2 were attached to the SS after grinding with all three fat contents. After washing and sanitizing in a chlorine or peroxyacetic acid sanitizer, viable bacteria were infrequently recovered by plate count. Enrichment of chips resulted in a higher survival rate with both sanitizing treatments, indicating that cell numbers below the limit of detection (5 CFU/cm2) or potentially injured organisms remained on the surface. Manual scrubbing during the washing step reduced the recovery rate. The scrubbing step also increased the number of passing scores assigned using an ATP bioluminescence assay of total residual soil on the chips sanitized in chlorine. The overall results indicate that plate counts alone may not be a reliable indicator of sanitation efficacy and may be validated by enrichment assay.

Nutrient Composition of Retail Samples of Australian Beef Sausages

Directory of Open Access Journals (Sweden)

Judy Cunningham

2015-11-01

Full Text Available Some nutrient data for beef sausages in Australia’s food composition table, NUTTAB 2010, is over 25 years old and may no longer reflect the composition of this popular food. To update this, 41 retail samples of fresh beef sausages were purchased in Melbourne, Australia, in May 2015. Each purchase was analysed, uncooked, for moisture, protein and fat. Sausages were then grouped by fat content into one of three composites and analysed for a wide range of nutrients, before and after dry heat cooking, the most popular sausage cooking method. Fat content in raw sausages averaged 14.9 g/100 g, 30% lower than NUTTAB values, varying from 7.3 to 22.6 g/100 g. This indicates it is possible to formulate leaner sausages that meet consumer expectations and may qualify for certain nutrition labelling statements. Under current Australian labelling requirements, two low fat sausages contain sufficient protein, B12, niacin, phosphorus and zinc to qualify as a good source of these nutrients and sufficient iron, selenium and vitamin A to qualify as a source of these. Sodium levels are higher than fresh beef, ranging from 680 to 840 mg/100 g. These data will be used to update NUTTAB and support product labelling and consumer education.

European consumers and beef safety

DEFF Research Database (Denmark)

Van Wezemael, Lynn; Verbeke, Wim; Kügler, Jens Oliver

2010-01-01

European beef consumption has been gradually declining during the past decades, while consumers' concerns about beef safety have increased. This paper explores consumer perceptions of and interest in beef safety and beef safety information, and their role in beef safety assessment and the beef...... consumption decision making process. Eight focus group discussions were performed with a total of 65 beef consumers in four European countries. Content analysis revealed that European consumers experienced difficulties in the assessment of the safety of beef and beef products and adopted diverging uncertainty...... reduction strategies. These include the use of colour, labels, brands and indications of origin as cues signalling beef safety. In general, consumer trust in beef safety was relatively high, despite distrust in particular actors....

Maintenance of safety and quality of refrigerated ready-to-cook seasoned ground beef product (meatball) by combining gamma irradiation with modified atmosphere packaging.

Science.gov (United States)

Gunes, Gurbuz; Ozturk, Aylin; Yilmaz, Neriman; Ozcelik, Beraat

2011-08-01

Meatballs were prepared by mixing ground beef and spices and inoculated with E. coli O157:H7, L. monocytogenes, and S. enteritidis before packaged in modified atmosphere (3% O₂ + 50% CO₂ + 47% N₂) or aerobic conditions. The packaged samples were irradiated at 0.75, 1.5, and 3 kGy doses and stored at 4 °C for 21 d. Survival of the pathogens, total plate count, lipid oxidation, color change, and sensory quality were analyzed during storage. Irradiation at 3 kGy inactivated all the inoculated (approximately 10⁶ CFU/g) S. enteritidis and L. monocytogenes cells in the samples. The inoculated (approximately 10⁶ CFU/g) E. coli O157:H7 cells were totally inactivated by 1.5 kGy irradiation. D¹⁰-values for E. coli O157:H7, S. enteritidis, and L. monocytogenes were 0.24, 0.43, and 0.41 kGy in MAP and 0.22, 0.39, and 0.39 kGy in aerobic packages, respectively. Irradiation at 1.5 and 3 kGy resulted in 0.13 and 0.36 mg MDA/kg increase in 2-thiobarbituric acid-reactive substances (TBARS) reaching 1.02 and 1.49 MDA/kg, respectively, on day 1. Irradiation also caused significant loss of color and sensory quality in aerobic packages. However, MAP effectively inhibited the irradiation-induced quality degradations during 21-d storage. Thus, combining irradiation (3 kGy) and MAP (3% O₂ + 50% CO₂ + 47% N₂) controlled the safety risk due to the potential pathogens and maintained qualities of meatballs during 21-d refrigerated storage. Combined use of gamma irradiation and modified atmosphere packaging (MAP) can maintain quality and safety of seasoned ground beef (meatball). Seasoned ground beef can be irradiated at 3 kGy and packaged in MAP with 3% O₂ + 50% CO₂ + 47% N₂ gas mixture in a high barrier packaging materials. These treatments can significantly decrease risk due to potential pathogens including E. coli O157:H7, L. monocytogenes, and S. enteritidis in the product. The MAP would reduce the undesirable effects of

Where's the beef? Retail channel choice and beef preferences in Argentina.

Science.gov (United States)

Colella, Florencia; Ortega, David L

2017-11-01

Argentinean beef is recognized and demanded internationally. Locally, consumers are often unable to afford certified beef products, and may rely on external cues to determine beef quality. Uncovering demand for beef attributes and marketing them accordingly, may require an understanding of consumers' product purchasing strategies, which involves retailer choice. We develop a framework utilizing latent class analysis to identify consumer groups with different retailer preferences, and separately estimate their demand for beef product attributes. This framework accounts for the interrelationship between consumers' choice of retail outlets and beef product preferences. Our analysis of data from the city of Buenos Aires identifies two groups of consumers, a convenience- (67%) and a service- (33%) oriented group. We find significant differences in demand for beef attributes across these groups, and find that the service oriented group, while not willing to pay for credence attributes, relies on a service-providing retailer-namely a butcher-as a source of product quality assurance. Copyright © 2017. Published by Elsevier Ltd.

Use of a novel medium, the Polymyxin Ceftazidime Oxford Medium, for isolation of Listeria monocytogenes from raw or non-pasteurized foods.

Science.gov (United States)

Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A

2016-05-01

Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

Partial Replacement of Ground Corn with Glycerol in Beef Cattle Diets: Intake, Digestibility, Performance, and Carcass Characteristics

Science.gov (United States)

Del Bianco Benedeti, Pedro; Paulino, Pedro Veiga Rodrigues; Marcondes, Marcos Inácio; Maciel, Ivan França Smith; da Silva, Matheus Custódio; Faciola, Antonio Pinheiro

2016-01-01

The objective of this study was to evaluate the effects of replacing dry ground corn with crude glycerol on intake, apparent digestibility, performance, and carcass characteristics of finishing beef bulls. A completely randomized block design experiment with 25 d for adaptation and 100 d for data collection was conducted, in which 3,640 Nellore bulls (367 ± 36.8 kg; 18 ± 3 mo) were blocked by body weight and assigned to 20 pens. Bulls were randomly assigned to one of four treatments: 0, 5, 10, and 15% (dry matter basis) of crude glycerol in the diet. Initially, 20 bulls were slaughtered to serve as a reference to estimate initial empty body weight, which allowed for carcass gain calculation. Bulls were weighed at the beginning, at two-thirds, and at the end of the experiment for performance calculations. Carcass measurements were obtained by ultrasound. Fecal output was estimated using indigestible neutral detergent fiber as an internal marker. Data were analyzed using the mixed procedures in SAS 9.2 (SAS Institute Inc., Cary, NC). Intake of dry matter, organic matter, and neutral detergent fiber decreased linearly (P 0.05) intakes of crude protein, non-fiber carbohydrates, and total digestible nutrients. Digestibility of dry matter, organic matter, neutral detergent fiber, and total digestible nutrients increased quadratically (P carcass gain, carcass dressing, gain-to-feed ratio, Longissimus thoracis muscle area, and back and rump fat thicknesses (P > 0.05). These results suggest that crude glycerol may be included in finishing beef diets at levels up to 15% without impairing performance and carcass characteristics. PMID:26820725

European beef consumers' interest in a beef eating-quality guarantee

DEFF Research Database (Denmark)

Verbeke, Wim; Van Wezemael, Lyn; de Barcellos, Marcia Dutra

2010-01-01

and Germany to assess their opinions about beef muscle profiling and their interest in a beef eating-quality guarantee. Findings indicate that both concepts are well accepted by European beef consumers, although not unconditional. Besides acknowledging the opportunity to purchase beef with guaranteed...... tenderness, consumers express some reserve related to the possible upgrading of lower value cuts, too much standardisation, and the fact that tenderness is to some extent subjective. They further require the system to be simple, sufficiently documented and independent-party controlled. The insights obtained...

Growth potential of Clostridium perfringens from spores in acidified beef, pork, and poultry products during chilling.

Science.gov (United States)

Juneja, Vijay K; Baker, David A; Thippareddi, H; Snyder, O Peter; Mohr, Tim B

2013-01-01

The ability of Clostridium perfringens to germinate and grow in acidified ground beef as well as in 10 commercially prepared acidified beef, pork, and poultry products was assessed. The pH of ground beef was adjusted with organic vinegar to achieve various pH values between 5.0 and 5.6; the pH of the commercial products ranged from 4.74 to 6.35. Products were inoculated with a three-strain cocktail of C. perfringens spores to achieve ca. 2-log (low) or 4-log (high) inoculum levels, vacuum packaged, and cooled exponentially from 54.4 to 7.2°C for 6, 9, 12, 15, 18, or 21 h to simulate abusive cooling; the U.S. Department of Agriculture, Food Safety and Inspection Service (USDA-FSIS) recommends a cooling time of 6.5 h. Total germinated C. perfringens populations were determined after plating on tryptose-sulfite-cycloserine agar and incubating the plates anaerobically at 37°C for 48 h. In addition, C. perfringens growth from spores was assessed at an isothermal temperature of 44°C. Growth from spores was inhibited in ground beef with a pH of 5.5 or below, even during extended cooling from 54.4 to 7.2°C in 21 h. In ground beef with a pH of 5.6, the growth was >1 log after 18 h of cooling from 54.4 to 7.2°C. However, 15 h of cooling controlled the growth to product with a pH ranging from 4.74 to 5.17, both during exponential abusive cooling periods of up to 21 h and during storage for 21 h at 44°C. While product cooled exponentially from 54.4 to 7.2°C in 15 h or less, the pH 6.35 product supported growth, even after 6 h of cooling from 54.4 to 7.2°C. These challenge tests demonstrate that adjustment of ground beef to pH of 5.5 or less and of barbeque products to pH of 5.63 or less inhibits C. perfringens spore germination and outgrowth during extended cooling periods from 54.4 to 7.2°C up to 15 h. Therefore, safe cooling periods for products with homogeneous, lower pHs can be substantially longer.

Consumer perceptions of beef healthiness

DEFF Research Database (Denmark)

Van Wezemael, Lynn; Verbeke, Wim; Dutra de Barcellos, Marcia

2010-01-01

of beef consumed. Focus group participants were not in favour of improving beef healthiness during processing, but rather focussed on appropriate consumption behaviour and preparation methods. CONCLUSIONS: The individual responsibility for health implies that consumers should be able to make correct......BACKGROUND: Consumer perception of the healthiness of beef is an important determinant of beef consumption. However, little is known about how consumers perceive the healthiness of beef. The aim of this study is to shed light on the associations between beef and health. METHODS: Eight focus group...... as well as negative effects of beef consumption on their health. Labelled, branded, fresh and lean beef were perceived as signalling healthful beef, in contrast with further processed and packaged beef. Consumers felt that their individual choices could make a difference with respect to the healthiness...

Prevalence and Antibiotic Susceptibility of Campylobacter species Isolated From Chicken and Beef Meat

Directory of Open Access Journals (Sweden)

Hossein Dabiri

2014-05-01

Full Text Available Background: To study prevalence of Campylobacter spp. in chicken and beef meat, and determine the drug susceptibility of strains, 450 samples in Tehran, Iran were investigated. Objectives: This study aimed to determine the prevalence and the antimicrobial resistance of entropathogenic Campylobacter strains ,especially C. jejuni isolated from raw chicken and beef meat in Tehran- Iran. Materials and Methods: Out of 250 chickens and 200 beef meats, 121(26.8 % contaminated cases with Campylobacter strains were isolated. Campylobacter was isolated from a significantly larger number of chickens (44% than beef meats (5.5 % (P < 0.05. Results: From all isolated Campylobacter organisms, 93 (76.8% species were identified as C. jejuni and 28 cases (23.1% as C. coli. Susceptibilities of 121 strains (93 C. jejuni and 28 C. coli were determined against 12 antimicrobial drugs using the disk agar diffusion method. Resistance to nalidixic acid (75% and ciprofloxacin (50% was an alarming finding, moreover, 32.6% of isolates was resistant to tetracycline, 10.8% to ampicillin, 29.3% to colisitin and 26.1% to amoxicillin. The highest sensitivity was seen to erythromycin (95 % and gentamicin (96%. Conclusions: These results showed that a high proportion of chicken and beef meat in Iran is contaminated with Campylobacter, particularly with Campylobacter jejuni. The high rate of contamination, especially chicken is a significant public health concern. Most of the isolates were resistant; therefore, human infection with Campylobacter spp. via consumption of these products is possible.

Evaluation of chemical immersion treatments to reduce microbial populations in fresh beef.

Science.gov (United States)

Kassem, Ahmed; Meade, Joseph; Gibbons, James; McGill, Kevina; Walsh, Ciara; Lyng, James; Whyte, Paul

2017-11-16

The aim of the current study was to assess the ability of a number of chemicals (acetic Acid (AA), citric acid (CA) lactic acid (LA), sodium decanoate (SD) and trisodium phosphate (TSP)) to reduce microbial populations (total viable count, Campylobacter jejuni, Escherichia coli, Salmonella typhimurium and Listeria monocytogenes) on raw beef using an immersion system. The following concentrations of each chemical were used: 3 & 5% for AA, CA, LA, SD and 10 &12% for TSP. Possible synergistic effects of using combinations of two chemicals sequentially (LA+CA and LA+AA) were also investigated. L*, a* and b* values were measured before and after treatments and ΔE* values were calculated in order to determine any changes in the color of meat due to the use of these chemicals. In general, all chemical treatments resulted in significantly (p0.05). The application of combinations of chemical immersion treatments (LA3%+AA3% and LA3%+CA3%) did not result in further significant reductions in microbial populations when compared to single chemical treatments (P3 immediately after treatment and after 24h storage. The remaining treatments did not result in significant changes to the color of raw beef. Copyright © 2017 Elsevier B.V. All rights reserved.

Quality of beef burger with addition of wet okara along the storage

Directory of Open Access Journals (Sweden)

Rafaela Bergmann Strada de Oliveira

Full Text Available ABSTRACT Combining the consuming of agricultural residues with satisfying consumers is a challenge that may result in financial income for the frozen meat industries, besides generating products with different nutritional value and satisfactory technological quality. Thus, we aimed at elaborating and assessing the physical, chemical and microbiological characteristics of frozen raw and fried beef hamburgers with addition of okara in its wet form throughout their storage over a period of 120 days. The inclusion of okara was proportional to the reduction in the content of protein, and to the increase of the lipid and moisture amount in the fried and raw formulations. Okara increased the luminosity and dimmed along the storage period. In the raw formulations at zero time lower values for b*, a* were observed when compared to the zero time of the fried hamburgers. This leaded to a light brown color and highlighting the clearing of the color due to the inclusion of okara. The fried hamburgers also featured this clearing, but they were darker brown. Chromaticity was greater with the inclusion of okara and with the passage of time. It can be concluded after 120 days storage the levels of protein, lipid and moisture of the formulations were according to the recommended by the Technical Regulation for Identity and Quality of Hamburgers and comply with the requirements of the Brazilian Law for microbiological standards. The brown colour changed with the inclusion of okara but without alterations in the characteristic colour for beef burguers.

Elimination of Pathogen Escherichia coli O157:H7 in Ground Beef by a Newly Isolated Strain of Lactobacillus acidophilus during Storage at 5°C

Directory of Open Access Journals (Sweden)

Alireza Goodarzi

2016-06-01

Full Text Available Background and Objective: Constant use of limited number of lactic acid bacteria species in biopreservation can cause genetic degradation and or rising resistance against food pathogens or antimicrobial substances they produce. For this objective, a newly isolated strain of Lactobacillus acidophilus possessing high antimicrobial activity was evaluated as a candidate for use in biopreservation.Materials and Methods: Antibacterial activity was evaluated by agar disk diffusion method. Hydrogen peroxide amount was measured by Merckoquant Peroxide test strips. Microbiological analysis of the ground beef infected by Escherichia coli O157:H7 and treated by Lactobacillus acidophilus GH 201was done by plating of serial dilution in physiological saline on Tryptose agar.Results and Conclusion: The cells (109 CFU ml-1 of Lactobacillus acidophilus produced significant amount of antibacterial substances mainly hydrogen peroxide (28 and 30 μg ml-1 in sodium phosphate buffer (0.2 M, pH 6.5 and LAPTg at 5°C during submerged cultivation with no growth, respectively. Submerged co-cultivation of Escherichia coli O157:H7 with lactobacilli in LAPTg broth at 5°C reduced the total number of the pathogen more than 2 log for 5 days. In case of solid state cultivation on agar-based medium, the maximum inhibitory zones on Escherichia coli O157:H7 lawn around the disks soaked by different amounts of washed Lactobacillus acidophilus cells appear for one-day cold exposition. The size of inhibition zone depends on the concentration of lactic acid bacteria cells. The cell suspension intended for treatment must contain 108-9CFU ml-1 of lactic acid bacteria. Lactobacillus acidophilus reduced the initial amount (2×105 CFU ml-1 of Escherichia coli O157:H7 in ground beef up to 2 log for 5 days of solid-state co-cultivation. The application of Lactobacillus acidophilus bacteria expanded the shelf-life of ground beef due to inhibition of

Consumer preferences for beef color and packaging did not affect eating satisfaction.

Science.gov (United States)

Carpenter, C E; Cornforth, D P; Whittier, D

2001-04-01

We investigated whether consumer preferences for beef colors (red, purple, and brown) or for beef packaging systems (modified atmosphere, MAP; vacuum skin pack, VSP; or overwrap with polyvinyl chloride, PVC) influenced taste scores of beef steaks and patties. To test beef color effects, boneless beef top loin steaks (choice) and ground beef patties (20% fat) were packaged in different atmospheres to promote development of red, purple, and brown color. To test effects of package type, steaks and patties were pre-treated with carbon monoxide in MAP to promote development of red color, and some meat was repackaged using VSP or PVC overwrap. The differently colored and packaged meats were separately displayed for members of four consumer panels who evaluated appearance and indicated their likelihood to purchase similar meat. Next, the panelists tasted meat samples from what they had been told were the packaging treatments just observed. However, the meat samples actually served were from a single untreated steak or patty. Thus, any difference in taste scores should reflect expectations established during the visual evaluation. The same ballot and sample coding were used for both the visual and taste evaluations. Color and packaging influenced (Ppurple >brown and PVC >VSP>MAP. Appearance scores and likelihood to purchase were correlated (r=0.9). However, color or packaging did not affect (P>0.5) taste scores. Thus, consumer preferences for beef color and packaging influenced likelihood to purchase, but did not bias eating satisfaction.

U.S. Food Safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: analysis of set results.

Science.gov (United States)

Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert

2006-11-01

The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.

Beef healthiness and nutritional enhancement in beef as perceived by European consumers

DEFF Research Database (Denmark)

de Barcellos, Marcia Dutra; Kügler, Jens Oliver; van Wezemael, Lynn

Introduction: A trend towards a higher awareness of health with respect to food intake has been noticed during the last years. This makes the concept of health in relation to beef production and consumption a highly relevant research topic. Objective: To investigate beef healthiness and nutritional...... discussions were based on a common topic guide, translated into each language. The guide consisted of several sections, including one designed to elicit information on their opinions about beef healthiness and nutritional enhancement of beef. Results: Consumers associated health with wellbeing, an absence...... of disease and a good quality of life. Healthy beef was associated with a certain bias towards a "romantic view", a concept of the traditional encompassing grass-fed beef, raised outdoors with natural food. A healthy cut of meat was expected to be natural and without additives and hormones that could affect...

Antibiotic Resistance Patterns of Enterococci and Occurrence of Vancomycin-Resistant Enterococci in Raw Minced Beef and Pork in Germany

Science.gov (United States)

Klein, Günter; Pack, Alexander; Reuter, Gerhard

1998-01-01

The food chain, especially raw minced meat, is thought to be responsible for an increase in the incidence of vancomycin-resistant enterococci (VRE) in human nosocomial infections. Therefore, 555 samples from 115 batches of minced beef and pork from a European Union-licensed meat-processing plant were screened for the occurrence of VRE. The processed meat came from 45 different slaughterhouses in Germany. Enterococci were isolated directly from Enterococcosel selective agar plates and also from Enterococcosel selective agar plates supplemented with 32 mg of vancomycin per liter. In addition, peptone broth was used in a preenrichment procedure, and samples were subsequently plated onto Enterococcosel agar containing vancomycin. To determine resistance, 209 isolates from 275 samples were tested with the glycopeptides vancomycin, teicoplanin, and avoparcin and 19 other antimicrobial substances by using a broth microdilution test. When the direct method was used, VRE were found in 3 of 555 samples (0.5%) at a concentration of 1.0 log CFU/g of minced meat. When the preenrichment procedure was used, 8% of the samples were VRE positive. Our findings indicate that there is a low incidence of VRE in minced meat in Germany. In addition, the resistance patterns of the VRE isolates obtained were different from the resistance patterns of clinical isolates. A connection between the occurrence of VRE in minced meat and nosocomial infections could not be demonstrated on the basis of our findings. PMID:9572958

Beef lovers

DEFF Research Database (Denmark)

de Barcellos, Marcia Dutra; Pedrozo, Eugenio A.; van der Lans, Ivo A.

2009-01-01

In this chapter we will explore beef consumption behaviour from a cross-cultural perspective. Data collected in Brazil, Australia and the Netherlands supports the main objectives of identifying consumers' anticipated emotions, degree of involvement, attitudes and main concerns towards beef...

Effect of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat during refrigerated storage.

Science.gov (United States)

Devatkal, Suresh K; Naveena, B M

2010-06-01

Effects of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat stored at 4+/-1 degrees C was evaluated. Five treatments evaluated include: control (only meat), MS (meat+2% salt), KRP (meat+2% salt+2% kinnow rind powder), PRP (meat+2% salt+2% pomegranate rind powder) and PSP (meat+2% salt+2% pomegranate seed powder). Addition of salt resulted in reduction of redness scores. Lightness increased in control and unchanged in others during storage. Redness scores declined and yellowness showed inconsistent changes during storage. Thiobarbituric acid reactive substances (TBARS) values were higher (PPRP>KRP>control>MS. Therefore, these powders have potential to be used as natural antioxidants to minimize the auto-oxidation and salt induced lipid oxidation in raw ground goat meat. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.

Anaerobic digestibility of beef hooves with swine manure or slaughterhouse sludge.

Science.gov (United States)

Xia, Yun; Wang, Ding-Kang; Kong, Yunhong; Ungerfeld, Emilio M; Seviour, Robert; Massé, Daniel I

2015-04-01

Anaerobic digestion is an effective method for treating animal by-products, generating at the same time green energy as methane (CH4). However, the methods and mechanisms involved in anaerobic digestion of α-keratin wastes like hair, nails, horns and hooves are still not clear. In this study we investigated the feasibility of anaerobically co-digesting ground beef hooves in the presence of swine manure or slaughterhouse sludge at 25 °C using eight 42-L Plexiglas lab-scale digesters. Our results showed addition of beef hooves statistically significantly increased the rate of CH4 production with swine manure, but only increased it slightly with slaughterhouse sludge. After 90-day digestion, 73% of beef hoof material added to the swine manure-inoculated digesters had been converted into CH4, which was significantly higher than the 45% level achieved in the slaughterhouse sludge inoculated digesters. BODIPY-Fluorescent casein staining detected proteolytic bacteria in all digesters with and without added beef hooves, and their relative abundances corresponded to the rate of methanogenesis of the digesters with the different inocula. Fluorescence in situ hybridization in combination with BODIPY-Fluorescent casein staining identified most proteolytic bacteria as members of genus Alkaliphilus in the subfamily Clostridiaceae 2 of family Clostridiaceae. They thus appear to be the bacteria mainly responsible for digestion of beef hooves. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

Occurrence of Salmonella in retail beef and related meat products in Zaria, Nigeria

DEFF Research Database (Denmark)

Tafida, S.Y.; Kabir, J.; Kwaga, J.K.P.

2013-01-01

Salmonella is among the most important food borne pathogens worldwide contaminating a wide range of animal products including meat products. Human illnesses due to this pathogen are attributed to poor biosecurity in production, improper processing and handling of meat and meat products....... This is more likely where surveillance and regulatory control is weak. There is however limited information on the occurrence of these pathogens in foods in Nigeria. The extent of contamination of retail-beef and related meat products with Salmonellae in Zaria was evaluated. A total of 435 retailed beef...... and related meat products consisting of muscle meat, offal and processed meat products were tested for the presence of Salmonella species. Sample types included raw meat, ‘suya’ (roasted meat), ‘balangu’ (barbequed meat), ‘Kilishi’ (spiced sun dried meat) and ‘dambu’ (shredded fried meat). Samples were...

Antibacterial effects of roselle calyx extracts and protocatechuic acid in ground beef and apple juice.

Science.gov (United States)

Chao, Che-Yi; Yin, Mei-Chin

2009-03-01

The antibacterial effects of roselle calyx aqueous and ethanol extracts and protocatechuic acid against food spoilage bacteria Salmonella typhimurium DT104, Escherichia coli O157:H7, Listeria monocytogenes, Staphylococcus aureus, and Bacillus cereus were examined. Minimal inhibitory concentrations of roselle calyx aqueous and ethanol extracts and protocatechuic acid against these bacteria were in the range of 112-144, 72-96, and 24-44 microg/mL, respectively. Protocatechuic acid content in roselle calyx aqueous and ethanol extracts was 2.8 +/- 0.7 and 11.9 +/- 1.2 mg/g, respectively. Antibacterial activity of roselle calyx ethanol extract and protocatechuic acid was not affected by heat treatments from 25 degrees to 75 degrees C and 25 degrees to 100 degrees C, respectively. After 3 days storage at 25 degrees C, the addition of roselle calyx extracts and protocatechuic acid exhibited dose-dependent inhibitory effects against test bacteria in ground beef and apple juice, in which the roselle calyx ethanol extract showed greater antibacterial effects than the aqueous extract. These data suggest that roselle calyx ethanol extract and protocatechuic acid might be potent agents as food additives to prevent contamination from these bacteria.

Variables affecting the propensity to buy branded beef among groups of Australian beef buyers.

Science.gov (United States)

Morales, L Emilio; Griffith, Garry; Wright, Victor; Fleming, Euan; Umberger, Wendy; Hoang, Nam

2013-06-01

Australian beef consumers have different preferences given their characteristics and the effect on expected quality of cues related to health, production process and eating experience. Beef brands using Meat Standards Australia (MSA) grades can help to signal quality and reduce consumers' uncertainty when shopping. The objective of this study is to identify the characteristics of beef buyers and their perceptions about product attributes that affect the propensity to buy branded beef. Binary logistic models were applied identifying differences between all respondents and the potential target market, including buyers in medium to high income segments, and between buyers in the target market who would buy branded beef for taste and health reasons. Variables increasing the propensity to buy branded beef include previous experience, appreciation for branded cuts and concern about quality more than size. Finally, variations in preferences for marbling and cut were found between buyers who would buy branded beef for taste and health reasons. Copyright © 2013 Elsevier Ltd. All rights reserved.

Environmental sustainability of beef

Science.gov (United States)

A national assessment of the sustainability of beef is being conducted in collaboration with the National Cattlemen’s Beef Association through the support of the Beef Checkoff. This includes surveys and visits to cattle operations throughout the U.S. to gather production information. With this infor...

Consumer and trained panel evaluation of beef strip steaks of varying marbling and enhancement levels cooked to three degrees of doneness.

Science.gov (United States)

Lucherk, L W; O'Quinn, T G; Legako, J F; Rathmann, R J; Brooks, J C; Miller, M F

2016-12-01

The palatability of USDA graded beef strip loins of seven treatments [High Enhanced (HE: 112% of raw weight) Select, Low Enhanced (LE: 107% of raw weight) Select, Prime, upper 2/3 Choice (Top Choice), lower 1/3 Choice (Low Choice), Select, and Standard] cooked to three degrees of doneness [DOD; rare (60°C), medium (71°C), or well-done (77°C)] was evaluated by consumer and trained sensory panelists. For consumers, Select HE steaks rated higher (P0.05) were observed between Select LE and Prime samples for most traits evaluated. The effect of USDA grade and enhancement on trained panel palatability scores was independent of DOD for all traits other than juiciness, with the role of marbling in juiciness increasing as DOD increased from rare to well-done. These results indicate enhancement as an effective method to improve the palatability of lower grading beef. Copyright © 2016 Elsevier Ltd. All rights reserved.

Nutrients and sediment in frozen-ground runoff from no-till fields receiving liquid-dairy and solid-beef manures

Science.gov (United States)

Komiskey, Matthew J.; Stuntebeck, Todd D.; Frame, Dennis R.; Madison, Fred W.

2011-01-01

Nutrients and sediment in surface runoff from frozen agricultural fields were monitored within three small (16.0 ha [39.5 ac] or less), adjacent basins at a no-till farm in southwest Wisconsin during four winters from 2003 to 2004 through 2006 to 2007. Runoff depths and flow-weighted constituent concentrations were compared to determine the impacts of surface-applied liquid-dairy or solid-beef manure to frozen and/or snow-covered ground. Despite varying the manure type and the rate and timing of applications, runoff depths were not significantly different among basins within each winter period. Sediment losses were low (generally less than 22 kg ha−1 [20 lb ac−1] in any year) and any statistical differences in sediment concentrations among basins were not related to the presence or absence of manure or the amount of runoff. Concentrations and losses of total nitrogen and total phosphorus were significantly increased in basins that had either manure type applied less than one week preceding runoff. These increases occurred despite relatively low application rates. Lower concentrations and losses were measured in basins that had manure applied in fall and early winter and an extended period of time (months) had elapsed before the first runoff event. The highest mean, flow-weighted concentrations of total nitrogen (31.8 mg L−1) and total phosphorus (10.9 mg L−1) occurred in winter 2003 to 2004, when liquid-dairy manure was applied less than one week before runoff. On average, dissolved phosphorus accounted for over 80% of all phosphorus measured in runoff during frozen-ground periods. The data collected as part of this study add to the limited information on the quantity and quality of frozen-ground runoff at field edges, and the results highlight the importance of manure management decisions during frozen-ground periods to minimize nutrients lost in surface runoff.

BeefTracker: Spatial Tracking and Geodatabase for Beef Herd Sustainability and Lifecycle Analysis

Science.gov (United States)

Oltjen, J. W.; Stackhouse, J.; Forero, L.; Stackhouse-Lawson, K.

2015-12-01

We have developed a web-based mapping platform named "BeefTracker" to provide beef cattle ranchers a tool to determine how cattle production fits within sustainable ecosystems and to provide regional data to update beef sustainability lifecycle analysis. After initial identification and mapping of pastures, herd data (class and number of animals) are input on a mobile device in the field with a graphical pasture interface, stored in the cloud, and linked via the web to a personal computer for inventory tracking and analysis. Pasture use calculated on an animal basis provides quantifiable data regarding carrying capacity and subsequent beef production to provide more accurate data inputs for beef sustainability lifecycle analysis. After initial testing by university range scientists and ranchers we have enhanced the BeefTracker application to work when cell service is unavailable and to improve automation for increased ease of use. Thus far experiences with BeefTracker have been largely positive, due to livestock producers' perception of the need for this type of software application and its intuitive interface. We are now in the process of education to increase its use throughout the U.S.

Anti-Toxoplasma gondii antibodies in beef cattle slaughtered in the metropolitan region of Belém, Brazilian Amazon

Directory of Open Access Journals (Sweden)

Ediclei Lima do Carmo

Full Text Available Abstract The relevance of consuming raw or undercooked beef in the transmission of toxoplasmosis is unclear due to the high resistance of cattle to infection. However, this possibility needs to be considered in endemic areas, such as the Amazon, where the consumption of beef is frequent. The objective of this study was to determine the frequency of anti-Toxoplasma gondii IgG antibodies in beef cattle slaughtered in the metropolitan region of Belem, Pará state, Brazil. Blood samples were collected from 500 animals of both genders in a licensed slaughterhouse in Belém. Anti-T. gondii IgG antibodies were detected by an indirect immunofluorescence assay (IFA with a cut-off titer of 1:64. Anti-T. gondii antibodies were found in 203 animals (40.6%, with a titer of 64 in 112 animals (55.2%, 128 in 68 animals (33.5%, 256 in 15 animals (7.4%, 512 in 5 animals (2.5%, and 1,024 in 3 animals (1.4%. No significant difference was observed between males and females (p > 0.05. The high frequency of anti-T. gondii antibodies observed in beef cattle slaughtered in Belém indicates that the meat of these animals may be an important source of infection for humans and carnivorous domestic animals when inadequately cooked beef is consumed.

Golden flaxseed and its byproducts in beef patties: physico-chemical evaluation and fatty acid profile

Directory of Open Access Journals (Sweden)

Daiana Novello

2013-09-01

Full Text Available Flaxseed application in meat and meat products by adding not flesh ingredients has not yet been properly assessed. This technology strategy, if well optimized, could substantially improve the nutritional value of meat products and promote healthy appeals consistent. Knowing that, this study aimed to evaluate the effect of adding golden flaxseed oil, or flour, or seed in the physico-chemical properties and fatty acid profile of beef patties. Beef patties were prepared with 5.0% of oil (FO, or flour (FF, or seed (FS, plus a control formulation (FC. For raw products containing flaxseed, the moisture content (74.22 to 68.61% was decreased and the ash (1.61 to 2.00g 100g-1, protein (15.62 to 16.46g 100g-1, fat (6.20 to 9.74g 100g-1, carbohydrate (2.02 to 3.97 g 100g-1, and calorie (127.71 to 161.62kcal 100g-1 contents were increased. The raw and grilled samples containing golden flaxseed had increased beneficial omega-3 (n-3 fatty acids (0.85 a 2.98g 100g-1, a decreased n-6/n-3 ratio (0.50, thus improving the nutritional profile.

Evaluation of the performance of the IQ-check kits and the USDA microbiology laboratory guidebook methods for detection of Shiga Toxin-Producing E. coli (STEC) and STEC and Salmonella simultaneously in ground beef

Science.gov (United States)

Aims: To evaluate the performance of the IQ-Check kits and the USDA Microbiology Laboratory Guidebook (MLG) methods for detection of the top 7 Shiga toxin-producing E. coli (STEC) (O157:H7, O26, O45, O103, O111, O121, and O145) in ground beef and both STEC and Salmonella in co-inoculated samples. M...

A Weibull model to describe antimicrobial kinetics of oregano and lemongrass essential oils against Salmonella Enteritidis in ground beef during refrigerated storage.

Science.gov (United States)

de Oliveira, Thales Leandro Coutinho; Soares, Rodrigo de Araújo; Piccoli, Roberta Hilsdorf

2013-03-01

The antimicrobial effect of oregano (Origanum vulgare L.) and lemongrass (Cymbopogon citratus (DC.) Stapf.) essential oils (EOs) against Salmonella enterica serotype Enteritidis in in vitro experiments, and inoculated in ground bovine meat during refrigerated storage (4±2 °C) for 6 days was evaluated. The Weibull model was tested to fit survival/inactivation bacterial curves (estimating of p and δ parameters). The minimum inhibitory concentration (MIC) value for both EOs on S. Enteritidis was 3.90 μl/ml. The EO concentrations applied in the ground beef were 3.90, 7.80 and 15.60 μl/g, based on MIC levels and possible activity reduction by food constituents. Both evaluated EOs in all tested levels, showed antimicrobial effects, with microbial populations reducing (p≤0.05) along time storage. Evaluating fit-quality parameters (RSS and RSE) Weibull models are able to describe the inactivation curves of EOs against S. Enteritidis. The application of EOs in processed meats can be used to control pathogens during refrigerated shelf-life. Copyright © 2012 Elsevier Ltd. All rights reserved.

SAR Raw Data Generation for Complex Airport Scenes

Directory of Open Access Journals (Sweden)

Jia Li

2014-10-01

Full Text Available The method of generating the SAR raw data of complex airport scenes is studied in this paper. A formulation of the SAR raw signal model of airport scenes is given. Via generating the echoes from the background, aircrafts and buildings, respectively, the SAR raw data of the unified SAR imaging geometry is obtained from their vector additions. The multipath scattering and the shadowing between the background and different ground covers of standing airplanes and buildings are analyzed. Based on the scattering characteristics, coupling scattering models and SAR raw data models of different targets are given, respectively. A procedure is given to generate the SAR raw data of airport scenes. The SAR images from the simulated raw data demonstrate the validity of the proposed method.

Prevalence and antimicrobial susceptibility of Salmonella isolated from a variety of raw meat sausages in Gaborone (Botswana) retail stores.

Science.gov (United States)

Samaxa, Ronald Gaelekolwe; Matsheka, Maitshwarelo Ignatius; Mpoloka, Sununguko Wata; Gashe, Berhanu Abegaz

2012-04-01

The objective of the study was to provide baseline data on the prevalence and antimicrobial susceptibility of Salmonella in different types of raw meat sausages directly accessible to the consumers in Gaborone, Botswana. A total of 300 raw sausages comprising 79 beef, 78 pork, 72 chicken, and 71 mutton samples were concurrently analyzed for the presence of Salmonella using a conventional culture method and a validated PCR method. The PCR assay results were in full concordance with those of the conventional culture method for the detection of Salmonella. Sixty-five (21.7%) of 300 samples were positive for Salmonella by both the conventional culture method and PCR assay. Even though more chicken samples contained Salmonella than did any other sausage type, the difference in the presence of Salmonella among the four sausages types was not significant. Eleven serotypes were identified, and Salmonella enterica subsp. salamae II was most prevalent in all the sausage types. Beef sausages generally had higher mesophilic bacterial counts than did the other three sausage types. However, higher microbial counts were not reflective of the presence of salmonellae. Susceptibility of the Salmonella enterica serotypes to 20 antimicrobial agents was determined, and Salmonella Muenchen was resistant to the widest array of agents and was mostly isolated from chicken sausages. Regardless of the meat of origin, all 65 Salmonella isolates were resistant to at least four antimicrobial agents: amikacin, gentamicin, cefuroxime, and tombramycin. This resistance profile group was the most common in all four sausage types, comprising 90% of all Salmonella isolates from beef, 71% from pork, 63% from mutton, and 35% from chicken. These results suggest that raw sausages pose a risk of transmitting multidrug-resistant Salmonella isolates to consumers.

Feeding value of whole raw soya beans as a protein supplement for beef cattle consuming low-quality forages.

Science.gov (United States)

Arelovich, H M; Lagrange, S; Torre, R; Martinez, M F; Laborde, H E

2018-02-01

Experiments (Exp) I and II were conducted to compare raw whole soya beans (WSB), roasted (rWSB) or other protein sources as supplements of low-quality forages fed ad libitum to beef cattle, upon DM intake (DMI), ruminal and blood parameters, and animal performance. Exp I: treatments for wheat straw fed to four ruminally cannulated steers were (i) Control-WS: no supplement; (ii) WSB-WS: whole soya beans; (iii) rWSB-WS: roasted WSB; and (iv) SBM-WS: soybean meal-wheat midds mixture; all fed at 1.4 kg DM/day. Exp II: 12 steers grazed deferred grain sorghum (DS) receiving these treatments: (i) Control-DS: no supplement; (ii) WSB-DS: 1.26 kg DM/day whole soya beans; and (iii) SFM-DS: 1.35 kg DM/day of sunflower meal. In Exp I, WS DMI resulted 47, 52 and 41% greater for WSB-WS, rWSB-WS and SBM-WS, respectively, than Control-WS (p < .05). In Exp II, the DMI of DS was unaffected by supplementation; a substitution of DS by supplement was found for WSB-DS (p < .05); however, total diet and digestible DMI increased with supplementation (p < .05). Rumen pH in Exp I remained unaffected by supplementation, but N-NH 3 as well as blood urea-N in Exp II increased (p < .05). In Exp II, average daily weight gains improved similarly with both supplements compared with Control-DS. Additionally, feed-to-gain ratio decreased (p < .05), being lower for WSB-DS (8.3) vs. SFM-DS (9.9). Roasting effects of WSB as a supplement for low-quality forages were not detected, and all protein sources increased total diet DMI and forage utilization. Only moderate cattle weight gains could be expected for unsupplemented DS. © 2017 Blackwell Verlag GmbH.

Identifying consumer preferences for specific beef flavor characteristics in relation to cattle production and postmortem processing parameters.

Science.gov (United States)

O'Quinn, T G; Woerner, D R; Engle, T E; Chapman, P L; Legako, J F; Brooks, J C; Belk, K E; Tatum, J D

2016-02-01

Sensory analysis of ground LL samples representing 12 beef product categories was conducted in 3 different regions of the U.S. to identify flavor preferences of beef consumers. Treatments characterized production-related flavor differences associated with USDA grade, cattle type, finishing diet, growth enhancement, and postmortem aging method. Consumers (N=307) rated cooked samples for 12 flavors and overall flavor desirability. Samples were analyzed to determine fatty acid content. Volatile compounds produced by cooking were extracted and quantified. Overall, consumers preferred beef that rated high for beefy/brothy, buttery/beef fat, and sweet flavors and disliked beef with fishy, livery, gamey, and sour flavors. Flavor attributes of samples higher in intramuscular fat with greater amounts of monounsaturated fatty acids and lesser proportions of saturated, odd-chain, omega-3, and trans fatty acids were preferred by consumers. Of the volatiles identified, diacetyl and acetoin were most closely correlated with desirable ratings for overall flavor and dimethyl sulfide was associated with an undesirable sour flavor. Copyright © 2015 Elsevier Ltd. All rights reserved.

RESEARCH OF MOISTURE MIGRATION DURING PARTIAL FREEZING OF GROUND BEEF

Directory of Open Access Journals (Sweden)

V. M. Stefanovskiy

2016-01-01

Full Text Available The concept of «ideal product» is proposed for the study of mass transfer during partial freezing of food products by freezing plate. The ideal product is a product, in which number of factors affecting the «real product» (meat are excluded. These factors include chemical composition of meat, quality grade of raw material (NOR, DFD, PSE, cryoscopic temperature that determines the degree of water transformation into ice, the phenomenon of osmosis, rate of freezing, etc. By using the concept of «ideal product» and its implementation in a physical experiment, it is proved that the “piston effect” causing the migration of moisture is due to frozen crust formation during partial freezing of the body. During partial freezing of the product by freezing plate, «ideal» and «real» food environment is transformed from closed system into open one with inflow of moisture to unfrozen part of the body. In the «ideal product», there is an expulsion of unfrozen moisture from freezing front, so the water appears on the body surface. Thus, the displacement of moisture increases by the same law, according to which the thickness (weight of frozen layer increases. During partial freezing of ground meat, moisture does not appear on the surface of the product, but hydrates the unfrozen part of meat. The reason of this phenomenon is the expulsion of water during formation of frozen crust and water-binding capacity of meat.

Characterization of beef tallow biodiesel and their mixtures with soybean biodiesel and mineral diesel fuel

Energy Technology Data Exchange (ETDEWEB)

Teixeira, Leonardo S.G. [Instituto de Quimica, Universidade Federal da Bahia, Campus Universitario de Ondina, 40.170-280, Salvador, Bahia (Brazil); INCT de Energia e Ambiente, Universidade Federal da Bahia, 40.170-280, Salvador, Bahia (Brazil); Couto, Marcelo B.; Filho, Miguel Andrade; Assis, Julio C.R.; Guimaraes, Paulo R.B.; Pontes, Luiz A.M.; Almeida, Selmo Q. [Departamento de Engenharia e Arquitetura, Universidade Salvador - UNIFACS, Av. Cardeal da Silva 132, 40.220-141, Salvador, Bahia (Brazil); Souza, Giancarlos S. [Instituto de Quimica, Universidade Federal da Bahia, Campus Universitario de Ondina, 40.170-280, Salvador, Bahia (Brazil); Teixeira, Josanaide S.R. [Instituto Federal de Educacao Ciencia e Tecnologica da Bahia - IFBAHIA, Rua Emidio de Morais S/N, 40.625-650, Salvador, Bahia (Brazil)

2010-04-15

Tallow is a raw material for biodiesel production that, due to their highly centralized generation in slaughter/processing facilities and historically low prices, may have energy, environmental, and economic advantages that could be exploited. However beef tallow biodiesel have unfavorable properties due the presence of high concentration of saturated fatty esters. One way to overcome these inconveniences is using blending procedures. In this way, blends of beef tallow biodiesel with soybean biodiesel and with conventional mineral diesel fuel were prepared and the quality of the mixtures was monitored with the purpose to study ideal proportions of the fuels. By measurement of the viscosity, density, cold filter plugging point, and flash point, it was demonstrated that tallow biodiesel can be blended with both mineral diesel and soybean biodiesel to improve the characteristics of the blend fuels, over that of the tallow. (author)

Microbial pathogens in raw pork, chicken, and beef: benefit estimates for control using irradiation

Energy Technology Data Exchange (ETDEWEB)

Roberts, T.

1985-12-01

Various control procedures have been suggested for reducing foodborne infectious diseases. Receiving considerable attention is irradiation. This report estimates the medical and wage (or productivity) benefits associated with prevention of five human diseases transmitted by beef, pork, and chicken. (These diseases can also be transmitted by other vectors, such as eggs, milk, and pets. But these sources are not included in the analysis.) All of these foodborne infectious diseases - salmonellosis, campylobacteriosis, trichinosis, tapeworm, and toxoplasmosis - could be significantly reduced by irradiating meat and poultry. The Food and Drug Administration (FDA) has just approved irradiation of pork to prevent trichinosis (50FR 29658-59) and is considering approval of irradiation of chicken to kill Salmonella. 22 references.

Microbial pathogens in raw pork, chicken, and beef: benefit estimates for control using irradiation

International Nuclear Information System (INIS)

Roberts, T.

1985-01-01

Various control procedures have been suggested for reducing foodborne infectious diseases. Receiving considerable attention is irradiation. This report estimates the medical and wage (or productivity) benefits associated with prevention of five human diseases transmitted by beef, pork, and chicken. (These diseases can also be transmitted by other vectors, such as eggs, milk, and pets. But these sources are not included in the analysis.) All of these foodborne infectious diseases - salmonellosis, campylobacteriosis, trichinosis, tapeworm, and toxoplasmosis - could be significantly reduced by irradiating meat and poultry. The Food and Drug Administration (FDA) has just approved irradiation of pork to prevent trichinosis (50FR 29658-59) and is considering approval of irradiation of chicken to kill Salmonella. 22 references

Application of Bayesian Techniques to Model the Burden of Human Salmonellosis Attributable to U.S. Food Commodities at the Point of Processing: Adaptation of a Danish Model

DEFF Research Database (Denmark)

Guo, Chuanfa; Hoekstra, Robert M.; Schroeder, Carl M.

2011-01-01

-of-processing foodborne illness attribution model by adapting the Hald Salmonella Bayesian source attribution model. Key model outputs include estimates of the relative proportions of domestically acquired sporadic human Salmonella infections resulting from contamination of raw meat, poultry, and egg products processed...... in the United States from 1998 through 2003. The current model estimates the relative contribution of chicken (48%), ground beef (28%), turkey (17%), egg products (6%), intact beef (1%), and pork (...

Bio-protective potential of lactic acid bacteria: Effect of and on changes of the microbial community in vacuum-packaged chilled beef

Directory of Open Access Journals (Sweden)

Yimin Zhang

2018-04-01

Full Text Available Objective This study was to determine the bacterial diversity and monitor the community dynamic changes during storage of vacuum-packaged sliced raw beef as affected by Lactobacillus sakei and Lactobacillus curvatus. Methods L. sakei and L. curvatus were separately incubated in vacuumed-packaged raw beef as bio-protective cultures to inhibit the naturally contaminating microbial load. Dynamic changes of the microbial diversity of inoculated or non-inoculated (control samples were monitored at 4°C for 0 to 38 days, using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE. Results The DGGE profiles of DNA directly extracted from non-inoculated control samples highlighted the order of appearance of spoilage bacteria during storage, showing that Enterbacteriaceae and Pseudomonas fragi emerged early, then Brochothrix thermosphacta shared the dominant position, and finally, Pseudomonas putida showed up became predominant. Compared with control, the inoculation of either L. sakei or L. curvatus significantly lowered the complexity of microbial diversity and inhibited the growth of spoilage bacteria (p<0.05. Interestingly, we also found that the dominant position of L. curvatus was replaced by indigenous L. sakei after 13 d for L. curvatus-inoculated samples. Plate counts on selective agars further showed that inoculation with L. sakei or L. curvatus obviously reduced the viable counts of Enterbacteraceae, Pseudomonas spp. and B. thermosphacta during later storage (p< 0.05, with L. sakei exerting greater inhibitory effect. Inoculation with both bio-protective cultures also significantly decreased the total volatile basic nitrogen values of stored samples (p<0.05. Conclusion Taken together, the results proved the benefits of inoculation with lactic acid bacteria especially L. sakei as a potential way to inhibit growth of spoilage-related bacteria and improve the shelf life of vacuum-packaged raw beef.

Beef, Real Food for Real People: An Industrial Analysis of the Beef Industry

Science.gov (United States)

1992-04-01

poultry . In 1989 Amrericans spent an average of $3.89 per person per week on beef products. Consumer bought $21 billion in beef products in 1989; they...or decreases in price. If the price of beef gets to high, consumers will switch their purchase to another red meat, poultry or seafood. TECHNOLOGY...The beginning of organized labor in meatpacking occurred with the -- •formation of the Amalgamated Meat Cutters and Butcher Workman of North America

77 FR 26725 - Changes to FSIS Traceback, Recall Procedures for Escherichia coli O157:H7 Positive Raw Beef...

Science.gov (United States)

2012-05-07

... employees, and is therefore likely to contaminate common conveyor belts and equipment. Also, such high rates.... Industry commenters noted that microbiological testing is not designed to test the safety of beef products... properly designing a sampling program.\\8\\ However, a national prevalence estimate is not sufficient...

Growth of non-toxigenic Clostridium botulinum mutant LNT01 in cooked beef: One-step kinetic analysis and comparison with C. sporogenes and C. perfringens.

Science.gov (United States)

Huang, Lihan

2018-05-01

The objective of this study was to investigate the growth kinetics of Clostridium botulinum LNT01, a non-toxigenic mutant of C. botulinum 62A, in cooked ground beef. The spores of C. botulinum LNT01 were inoculated to ground beef and incubated anaerobically under different temperature conditions to observe growth and develop growth curves. A one-step kinetic analysis method was used to analyze the growth curves simultaneously to minimize the global residual error. The data analysis was performed using the USDA IPMP-Global Fit, with the Huang model as the primary model and the cardinal parameters model as the secondary model. The results of data analysis showed that the minimum, optimum, and maximum growth temperatures of this mutant are 11.5, 36.4, and 44.3 °C, and the estimated optimum specific growth rate is 0.633 ln CFU/g per h, or 0.275 log CFU/g per h. The maximum cell density is 7.84 log CFU/g. The models and kinetic parameters were validated using additional isothermal and dynamic growth curves. The resulting residual errors of validation followed a Laplace distribution, with about 60% of the residual errors within ±0.5 log CFU/g of experimental observations, suggesting that the models could predict the growth of C. botulinum LNT01 in ground beef with reasonable accuracy. Comparing with C. perfringens, C. botulinum LNT01 grows at much slower rates and with much longer lag times. Its growth kinetics is also very similar to C. sporogenes in ground beef. The results of computer simulation using kinetic models showed that, while prolific growth of C. perfringens may occur in ground beef during cooling, no growth of C. botulinum LNT01 or C. sporogenes would occur under the same cooling conditions. The models developed in this study may be used for prediction of the growth and risk assessments of proteolytic C. botulinum in cooked meats. Published by Elsevier Ltd.

Effects of Flaxseed and pH on the Emulsion Properties of Beef by Using a Model System

OpenAIRE

Şükrü Kurt; Huriye Gözde Ceylan

2018-01-01

The effects of ground flaxseed (0-0.5%) and pH (3.88-8.12) on the emulsion properties of beef were studied using a model system. A central composite rotatable design was used to determine the response surface. pH, flaxseed and their interactions had significant effects on the emulsion properties of beef. pH and the interaction between pH and flaxseed increased emulsion capacity (EC). Flaxseed and pH increased emulsion stability (ES) until a critical point, which was reached at a flaxseed lev...

Consumer perception of Brazilian traced beef

Directory of Open Access Journals (Sweden)

Júlio Otávio Jardim Barcellos

2012-03-01

Full Text Available The objective of this study was to determine consumers understanding of beef traceability, identifying how consumers value this meat and traceability elements to be presented on retail shelves. The method used in this study was a survey through the internet applying the Sphinx software. The sample consisted of 417 consumers, mostly living in Porto Alegre, Brazil. Consumers are aware of certified beef, consider it important, but this is not a demand. As to traced beef, most consumers (62.4% are in favor of mandatory traceability of beef cattle in Brazil, but 86.6% disagree with the destination of traced beef only to the foreign market. The majority of people are willing to pay more for traced beef and consider traceability a market opportunity, used as a differentiating tool.

SUPPLY CHAIN MANAGEMENT OF IMPORTED FROZEN BEEF: AN ALTERNATIVE TO INTEGRATE WITH LOCAL BEEF SUPPLY CHAIN MANAGEMENT

Directory of Open Access Journals (Sweden)

Sani R.

2017-12-01

Full Text Available The purpose of this study is to describe the supply chain management of imported frozen beef from Australia to Indonesia; to analyze where the strengths, weaknesses, opportunities, and threats for the frozen meat distributor, and what strategy should be chosen; and to analyze alternatives of cooperation between imported frozen beef distribution with local beef distribution chain. The research approach is qualitative, and the research strategy is a case study. This research was conducted in Jakarta, data collecting technique by interview method and literature study. Data analysis techniques use supply chain management (SCM and strengths, weaknesses, opportunities, and threats (SWOT analysis. The results show that the distribution chain management of imported frozen beef needs to tripartite cooperation with government and local beef distributors to conduct joint marketing of imported frozen beef and cooler procurement to the point of retailers in traditional markets; expanding the market share of imported frozen beef to industrial segments (hotels, restaurant, catering company; and meat processing factories; and cooperate with imported beef suppliers to overcome the problem of taste flavor and lack of weight of imported frozen meat, and clarify halal certification.

Beef Species Symposium: an assessment of the 1996 Beef NRC: metabolizable protein supply and demand and effectiveness of model performance prediction of beef females within extensive grazing systems.

Science.gov (United States)

Waterman, R C; Caton, J S; Löest, C A; Petersen, M K; Roberts, A J

2014-07-01

Interannual variation of forage quantity and quality driven by precipitation events influence beef livestock production systems within the Southern and Northern Plains and Pacific West, which combined represent 60% (approximately 17.5 million) of the total beef cows in the United States. The beef cattle requirements published by the NRC are an important tool and excellent resource for both professionals and producers to use when implementing feeding practices and nutritional programs within the various production systems. The objectives of this paper include evaluation of the 1996 Beef NRC model in terms of effectiveness in predicting extensive range beef cow performance within arid and semiarid environments using available data sets, identifying model inefficiencies that could be refined to improve the precision of predicting protein supply and demand for range beef cows, and last, providing recommendations for future areas of research. An important addition to the current Beef NRC model would be to allow users to provide region-specific forage characteristics and the ability to describe supplement composition, amount, and delivery frequency. Beef NRC models would then need to be modified to account for the N recycling that occurs throughout a supplementation interval and the impact that this would have on microbial efficiency and microbial protein supply. The Beef NRC should also consider the role of ruminal and postruminal supply and demand of specific limiting AA. Additional considerations should include the partitioning effects of nitrogenous compounds under different physiological production stages (e.g., lactation, pregnancy, and periods of BW loss). The intent of information provided is to aid revision of the Beef NRC by providing supporting material for changes and identifying gaps in existing scientific literature where future research is needed to enhance the predictive precision and application of the Beef NRC models.

An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.

Science.gov (United States)

Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar

2016-11-01

Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.

Into beef consumers' mind

DEFF Research Database (Denmark)

de Barcellos, Marcia Dutra; Brei, Vinicius A.

indicated similarities amongst Brazilian and Australian consumers regarding their positive attitude towards beef and main concerns regarding its consumption. Dutch consumers, although presented negative attitudes, considered beef consumption as important. In general respondents presented a high degree...

Effects of irradiation dose and O(2) and CO(2) concentrations in packages on foodborne pathogenic bacteria and quality of ready-to-cook seasoned ground beef product (meatball) during refrigerated storage.

Science.gov (United States)

Gunes, Gurbuz; Yilmaz, Neriman; Ozturk, Aylin

2012-01-01

Combined effects of gamma irradiation and concentrations of O(2) (0, 5, 21%) and CO(2) (0, 50%) on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball) during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O(2) and CO(2) levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy) caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O(2), respectively, compared to 21% O(2). Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg(-1), respectively, compared to control. In reduced-O(2) packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO(2) or 5% O(2) + 50% CO(2) maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O(2) + 50% CO(2) combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality.

Effects of Irradiation Dose and O2 and CO2 Concentrations in Packages on Foodborne Pathogenic Bacteria and Quality of Ready-to-Cook Seasoned Ground Beef Product (Meatball) during Refrigerated Storage

Science.gov (United States)

Gunes, Gurbuz; Yilmaz, Neriman; Ozturk, Aylin

2012-01-01

Combined effects of gamma irradiation and concentrations of O2 (0, 5, 21%) and CO2 (0, 50%) on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball) during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O2 and CO2 levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy) caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O2, respectively, compared to 21% O2. Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg−1, respectively, compared to control. In reduced-O2 packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO2 or 5% O2 + 50% CO2 maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O2 + 50% CO2 combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality. PMID:22566763

Effects of Irradiation Dose and O2 and CO2 Concentrations in Packages on Foodborne Pathogenic Bacteria and Quality of Ready-to-Cook Seasoned Ground Beef Product (Meatball during Refrigerated Storage

Directory of Open Access Journals (Sweden)

Gurbuz Gunes

2012-01-01

Full Text Available Combined effects of gamma irradiation and concentrations of O2 (0, 5, 21% and CO2 (0, 50% on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O2 and CO2 levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O2, respectively, compared to 21% O2. Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg−1, respectively, compared to control. In reduced-O2 packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO2 or 5% O2 + 50% CO2 maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O2 + 50% CO2 combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality.

Do beef risk perceptions or risk attitudes have a greater effect on the beef purchase decisions of Canadian consumers?

Science.gov (United States)

Yang, Jun; Goddard, Ellen

2011-01-01

Cluster analysis is applied in this study to group Canadian households by two characteristics, their risk perceptions and risk attitudes toward beef. There are some similarities in demographic profiles, meat purchases, and bovine spongiform encephalopathy (BSE) media recall between the cluster that perceives beef to be the most risky and the cluster that has little willingness to accept the risks of eating beef. There are similarities between the medium risk perception cluster and the medium risk attitude cluster, as well as between the cluster that perceives beef to have little risk and the cluster that is most willing to accept the risks of eating beef. Regression analysis shows that risk attitudes have a larger impact on household-level beef purchasing decisions than do risk perceptions for all consumer clusters. This implies that it may be more effective to undertake policies that reduce the risks associated with eating beef, instead of enhancing risk communication to improve risk perceptions. Only for certain clusters with higher willingness to accept the risks of eating beef might enhancing risk communication increase beef consumption significantly. The different role of risk perceptions and risk attitudes in beef consumption needs to be recognized during the design of risk management policies.

Artificial neural network as the tool in prediction rheological features of raw minced meat.

Science.gov (United States)

Balejko, Jerzy A; Nowak, Zbigniew; Balejko, Edyta

2012-01-01

The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed using the artificial neural network module in Statistica 9.0 software. The model that reached the lowest training error was a multi-layer perceptron MLP with three neural layers and architecture 7:7-11-7:7. Correlation coefficients between the experimental and calculated values in training, verification and testing subsets were similar and rather high (around 0.65) which indicated good network performance. High percentage of the total variance explained in PCA analysis (73.5%) indicated that the percentage composition of raw minced meat can be successfully used in the prediction of its rheological features. Statistical analysis of the results revealed, that artificial neural network model is able to predict rheological parameters and thus a complete texture profile of raw minced meat.

Improvement of shelf stability and processing properties of meat products by gamma irradiation

International Nuclear Information System (INIS)

Byun, M.-W.; Lee, J.-W.; Yook, H.-S.; Lee, K.-H.; Kim, H.-Y.

2002-01-01

To evaluate the effects of gamma irradiation on the processing properties of meat products, emulsion-type sausage, beef patties and pork loin ham were manufactured. Most contaminated bacteria were killed by 3 kGy-irradiation to raw ground beef, and sausage can be manufactured with desirable flavor, a reduction of NaCl and phosphate, and extension of shelf life using gamma irradiation on the raw meat. The beef patties were manufactured with the addition of antioxidants (200 ppm), BHA, ascorbyl palmitate, α-tocopherol, or β-carotene, and gamma-irradiation. Retardation of lipid oxidation appeared at the patties with an antioxidant. A dose of 5 kGy was observed to be as effective as the use of 200 ppm NaNO 2 to provide and maintain the desired color of the product during storage. After curing, irradiation, heating and smoking could extensively prolong the shelf life of the hams

Improvement of shelf stability and processing properties of meat products by gamma irradiation

Science.gov (United States)

Byun, Myung-Woo; Lee, Ju-Woon; Yook, Hong-Sun; Lee, Kyong-Haeng; Kim, Hee-Yun

2002-03-01

To evaluate the effects of gamma irradiation on the processing properties of meat products, emulsion-type sausage, beef patties and pork loin ham were manufactured. Most contaminated bacteria were killed by 3 kGy-irradiation to raw ground beef, and sausage can be manufactured with desirable flavor, a reduction of NaCl and phosphate, and extension of shelf life using gamma irradiation on the raw meat. The beef patties were manufactured with the addition of antioxidants (200 ppm), BHA, ascorbyl palmitate, α-tocopherol, or β-carotene, and gamma-irradiation. Retardation of lipid oxidation appeared at the patties with an antioxidant. A dose of 5 kGy was observed to be as effective as the use of 200 ppm NaNO 2 to provide and maintain the desired color of the product during storage. After curing, irradiation, heating and smoking could extensively prolong the shelf life of the hams.

QUALITY MANAGEMENT IN ECOLOGICAL BEEF PRODUCTION

Directory of Open Access Journals (Sweden)

Cornelia Petroman

2012-09-01

Full Text Available Producing high quality beef asks for the implementation of a performing management of raising cattle ecologically. The main ways of improving beef quality management have a technical nature: sustaina ble grazing management to conserve floral diversity and to obtain ecological beef and rational distribution of the cattle over the grassland to facilitate vegetation recovery and to avoid the setting of invasive species. Implementing a sustainable manageme nt of the resources in the neighborhood of animal farms has beneficial effects on beef quality, brings good economic income through the practice of best beef quality management, protects the environment long - term, and reduces infrastructure expenses thus a voiding the risks of meat contamination.

DEMAND FOR BEEF IN THE PROVINCE OF YOGYAKARTA

Directory of Open Access Journals (Sweden)

Sulistiya

2014-07-01

Full Text Available RACT Protein consumption level of society in Yogyakarta Province has yet to meet the target, but the beef is a source of animal protein that is easily obtainable. Therefore, research on the analysis of demand for beef in this province needs to be done. Objective: (1 Determine the factors that affect the demand for beef in Yogyakarta. (2 Determine the own price elasticity and income elasticity of demand for beef in this province, and to know the cross-price elasticity of demand for beef to changes in the price of mutton, chicken, rice, and cooking oil. Metode: descriptive statistics, followed by inductive statistics , and hypothesis testing. The data used are primary and secondary data. Data were analyzed by multiple linear regression with the value of t and F tests, and analysis of the coefficient of determination. Results: Taken together, the factors that affect the demand for beef in the province is the price of beef, mutton, chicken, rice, cooking oil, income, number of inhabitants. Individually, beef demand is influenced by the price of beef and income residents. Beef inelastic demand means that beef is the daily necessities that are affordable and easy to obtain population of Yogyakarta Province. The increase in income population does not add to demand for beef. Substitutes of beef in the province is goat and chicken, while the complementary goods are rice and cooking oil.

Corned Beef: an Enigmatic Irish Dish

OpenAIRE

Mac Con Iomaire, Máirtín; Gallagher, Pádraic Óg

2011-01-01

Corned beef and cabbage, which is consumed in America in large quantities each Saint Patrick’s Day (17th March), is considered by most Americans to be the ultimate Irish dish. However, corned beef and cabbage is seldom eaten in modern day Ireland. It is widely reported that Irish immigrants replaced their beloved bacon and cabbage with corned beef and cabbage when they arrived in America, drawing on the corned beef supplied by their neighbouring Jewish butchers, but not all commentators beli...

Fluoroquinolone residues in raw meat from open markets in Ibadan, Southwest, Nigeria

Directory of Open Access Journals (Sweden)

Adekunbi Bridget Omotoso

2015-07-01

Full Text Available Misuse of fluoroquinolones in livestock production may lead to the presence of their residues in tissues of meat animals after slaughter, constituting health hazards to consumers. The present study was designed to screen for residues of three fluoroquinolones (ciprofloxacin, norfloxacin and ofloxacin in raw meat. Microbiological assay, followed by High Performance Liquid Chromatography (HPLC was used to screen three hundred and twenty samples of beef, chicken, pork and chevon purchased from open markets. Initial screening by microbiological assay revealed that 50%, 55%, 40% and 40% of beef, chicken, pork and chevon, respectively were positive for residues of antibiotics. Further analysis by HPLC with UV detection revealed the presence of ciprofloxacin, norfloxacin and ofloxacin at varying concentrations in the meat samples. Ofloxacin was the least in frequency and abundance in all meat types. Results obtained in this study have implications for public health and will lead to steps that will further enhance the safety of animal foods in order to protect consumers and the animal production industry

9 CFR 319.15 - Miscellaneous beef products.

Science.gov (United States)

2010-01-01

..., the amount of such cheek meat shall be limited to 25 percent; and if in excess of natural proportions..., binders, or extenders. Beef cheek meat (trimmed beef cheeks) may be used in the preparation of hamburger... levels of up to 65 ppm may be used as a binder. Beef cheek meat (trimmed beef cheeks) may be used in the...

Petrifilm rapid S. aureus Count Plate method for rapid enumeration of Staphylococcus aureus in selected foods: collaborative study.

Science.gov (United States)

Silbernagel, K M; Lindberg, K G

2001-01-01

A rehydratable dry-film plating method for Staphylococcus aureus in foods, the 3M Petrifilm Rapid S. aureus Count Plate method, was compared with AOAC Official Method 975.55 (Staphylococcus aureus in Foods). Nine foods-instant nonfat dried milk, dry seasoned vegetable coating, frozen hash browns, frozen cooked chicken patty, frozen ground raw pork, shredded cheddar cheese, fresh green beans, pasta filled with beef and cheese, and egg custard-were analyzed for S. aureus by 13 collaborating laboratories. For each food tested, the collaborators received 8 blind test samples consisting of a control sample and 3 levels of inoculated test sample, each in duplicate. The mean log counts for the methods were comparable for pasta filled with beef and cheese; frozen hash browns; cooked chicken patty; egg custard; frozen ground raw pork; and instant nonfat dried milk. The repeatability and reproducibility variances of the Petrifilm Rapid S. aureus Count Plate method were similar to those of the standard method.

Fate of gamma-irradiated Listeria monocytogenes during refrigerated storage on raw or cooked turkey breast meat

International Nuclear Information System (INIS)

Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.

1998-01-01

The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat

Phase I of The National Beef Quality Audit-2011: quantifying willingness-to-pay, best-worst scaling, and current status of quality characteristics in different beef industry marketing sectors.

Science.gov (United States)

Igo, J L; VanOverbeke, D L; Woerner, D R; Tatum, J D; Pendell, D L; Vedral, L L; Mafi, G G; Moore, M C; McKeith, R O; Gray, G D; Griffin, D B; Hale, D S; Savell, J W; Belk, K E

2013-04-01

The National Beef Quality Audit (NBQA)-2011 benchmarked the current status of and assessed progress being made toward quality and consistency of U.S. cattle, carcasses, and beef products after the completion of the first NBQA in 1991. Unlike previous NBQA, objectives of the 2011 Phase I study were to determine how each beef market sector defined 7 quality categories, estimate willingness-to-pay (WTP) for the same quality categories by market sector, and establish a best-worst (B/W) scaling for the quality categories. Structured face-to-face interviews were conducted and responses were recorded using dynamic routing software over an 11-mo period (February to December 2011) with decision makers in each of the following beef market sectors: Feeders (n = 59), Packers (n = 26), Food Service, Distribution, and Further Processors (n = 48), Retailers (n = 30), and Government and Allied Industries (n = 47). All respondents participated in a structured interview consisting of WTP and B/W questions that were tied to 7 quality categories and then were asked to "define" each of the 7 categories in terms of what the category meant to them, resulting in completely unbiased results. The 7 quality categories were a) how and where the cattle were raised, b) lean, fat, and bone, c) weight and size, d) cattle genetics, e) visual characteristics, f) food safety, and g) eating satisfaction. Overall, "food safety" and "eating satisfaction" were the categories of greatest and second most importance, respectively, to all beef market sectors except for Feeders. Feeders ranked "how and where the cattle were raised" and "weight and size" as the most important and second most important, respectively. Overall, "how and where the cattle were raised" had the greatest odds of being considered a nonnegotiable requirement before the raw material for each sector would be considered for purchase and was statistically more important (P market sectors were considered, "eating satisfaction" was shown to

BEEF MARKET IN ROMANIA

Directory of Open Access Journals (Sweden)

Elena SOARE

2015-04-01

Full Text Available This scientific paper presents the cattle market dynamics in Romania during 2007-2013. In order to realize this research there were used certain indicators, as following: herds of cattle, realized beef production, selling price, human consumption, import and export. The data were collected from the Ministry of Agriculture and Rural Development, National Institute of Statistics and Faostat. During the analysis, the presented indicators were modified from a period to another, because of both internal and external factors. Consumption demand is being influenced by: beef price, beef quality, price of other meat categories, consumers incomes, population’s food consumption pattern and so on.

9 CFR 319.81 - Roast beef parboiled and steam roasted.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Roast beef parboiled and steam roasted... beef parboiled and steam roasted. “Roast Beef Parboiled and Steam Roasted” shall be prepared so that... “Roast Beef Parboiled and Steam Roasted.” When beef cheek meat, beef head meat, or beef heart meat is...

A model for 'sustainable' US beef production.

Science.gov (United States)

Eshel, Gidon; Shepon, Alon; Shaket, Taga; Cotler, Brett D; Gilutz, Stav; Giddings, Daniel; Raymo, Maureen E; Milo, Ron

2018-01-01

Food production dominates land, water and fertilizer use and is a greenhouse gas source. In the United States, beef production is the main agricultural resource user overall, as well as per kcal or g of protein. Here, we offer a possible, non-unique, definition of 'sustainable' beef as that subsisting exclusively on grass and by-products, and quantify its expected US production as a function of pastureland use. Assuming today's pastureland characteristics, all of the pastureland that US beef currently use can sustainably deliver ≈45% of current production. Rewilding this pastureland's less productive half (≈135 million ha) can still deliver ≈43% of current beef production. In all considered scenarios, the ≈32 million ha of high-quality cropland that beef currently use are reallocated for plant-based food production. These plant items deliver 2- to 20-fold more calories and protein than the replaced beef and increase the delivery of protective nutrients, but deliver no B 12 . Increased deployment of rapid rotational grazing or grassland multi-purposing may increase beef production capacity.

Stable isotope variation as a tool to trace the authenticity of beef

International Nuclear Information System (INIS)

Boner, M.; Foerstel, H.

2004-01-01

Organic beef coming principally from Germany was analysed for the hydrogen, carbon, oxygen, nitrogen and sulfur stable isotopic composition to test the possibility of tracing back the geographical origin. Since there is a well-known pattern of D/H and 18 O/ 16 O in meteoric water and in ground water, there is an existing link to tissue water in the beef. By including the stable isotope ratios of the other elements of life further information is available: soils show different isotope ratios of 15 N/ 14 N and 34 S/ 32 S depending on the geological composition, cultivation and atmospheric sulfur deposition. As organic farming is mainly obliged to use only their produced fodder, that ratio is reflected in the beef as well. Different organic beef samples from various German farms have been collected and analysed over nearly two years. To check the differentiation of foreign beef, samples from Argentina and Chile were also included in the study. The analyses of meat samples indicate that it is possible to trace back the region (e.g. Argentina and Germany) by using isotopes of oxygen and hydrogen. A local geographical differentiation can be done by using the stable isotopes of nitrogen and sulfur, as was demonstrated for three farms in Colonia Bay. An optimal differentiation also depends on the quality of further information (e.g. the season, kind of cattle breeding or the declaration of the local geographical origin). Certainly authenticity of beef is not only linked with the geographical origin but can also reflect the differentiation of organic and conventional farming. The fodder of organic cattle farming consists mainly of C 3 plants and the use of C 4 plants is more usual in conventional cattle farming. A 13 C/ 12 C ratio above -20 permille appears as a limit for organic farming. Increased values have to be controlled based on their authenticity. (orig.)

Analysis of the possibility for obtaining oil from the spend coffee grounds as potential raw material for biodiesel production

Directory of Open Access Journals (Sweden)

Iličković Zoran

2012-01-01

Full Text Available The aim of this paper was to investigate the possibility of obtaining oil from spent coffee grounds, which are left behind after the coffee is prepared, as the potential feedstock for biodiesel production. The effect of process parameters, such as are the type of solvent, the ratio of spent coffee grounds/solvent and the extraction time on oil yielded from coffee grounds was examined. The oil was obtained by maceration and extraction in the Soxhlet apparatus. The obtain results show that the spent coffee grounds could be used as an alternative raw material for biodiesel production, because it contains a significant amount of oil that can be extracted. The oil yield depends on the extraction (maceration process parameters. The maximum oil yield obtained by the Soxhlet extraction with the n-hexane for the period of 5 h was 11.85% (the weight percentage of oil on dry mater, whereas with petroleum ether the oil yield was slightly lower and amounted to 10.44%. The yield of the oil extracted by maceration increases with the decrease of spent coffee grounds/solvent ratio from 1/3 to 1/7 g/cm3, and other parameters being constant. The oil yield increases with the duration of the maceration. Greater oil yield, ranging from 3 to 8.5%, can be obtained with n-hexane compared to the extraction with petroleum ether. Furthermore, n-hexane is less volatile and flammable, compared to petroleum ether, so it is more convenient to use.

MOET Utility in Beef Production Strategies

Directory of Open Access Journals (Sweden)

Marcel Theodor Paraschivescu

2012-10-01

Full Text Available The paper presents the reason of beef production for human food security and the necessity of special dairy and beefbreeds in order to balance the milk and the meat production in cattle farming. That is a difficult target for manycountries since they don’t dispose of large natural pastures to extensively feed the beef cattle herds. At the same timemany European countries breed only dual purpose cattle breeds. So the idea of intensive farming with beef breeds orcrosses is developed. To speed up this kind of programs Open MOET (Multiple Ovulation Embryo Transfer Farmtechnology is proposed and it is completed with the needed facilities for production and preservation of embryos.Concerning the MOET Farm which confers directly pure bred beef calves, emphases is put on veterinary quarantineand heifer receptors conditioning. Concerning embryo conservation the direct transfer (DT technique isrecommended. Modalities of integrating dairy farms and beef cattle farms are finally discussed as recommendedstrategy for Romanian Agriculture.

European consumers' acceptance of beef processing technologies

DEFF Research Database (Denmark)

de Barcellos, Marcia Dutra; Kügler, Jens Oliver; Grunert, Klaus G.

2010-01-01

The use of new technologies in beef production chains may affect consumers' opinion of meat products. A qualitative study was performed to investigate consumers' acceptance of seven beef processing technologies: marinating by injection aiming for increased 1) healthiness; 2) safety; and 3) eating...... adults (19-60 years old) participated in eight focus groups in Spain, France, Germany and the UK. Results suggested a relationship between acceptance of new beef products, technology familiarity and perceived risks related to its application. Excessive manipulation and fear of moving away from 'natural......' beef were considered negative outcomes of technological innovations. Beef processing technologies were predominantly perceived as valuable options for convenience shoppers and less demanding consumers. Overall, respondents supported the development of 'non-invasive' technologies that were able...

Caesalpinia decapetala Extracts as Inhibitors of Lipid Oxidation in Beef Patties

Directory of Open Access Journals (Sweden)

Maria G. Gallego

2015-07-01

Full Text Available In this study we investigated the effects of Caesalpinia decapetala (CD extracts on lipid oxidation in ground beef patties. Plant extracts and butylated hydroxytoluene (BHT were individually added to patties at both 0.1% and 0.5% (w/w concentrations. We assessed the antioxidant efficacy of CD by the ferric reducing antioxidant power (FRAP assay and evaluated their potential as natural antioxidants for meat preservation by thiobarbituric acid reactive substance (TBARS values, hexanal content, fatty acid composition and color parameters. These were tested periodically during 11 days of refrigerated storage. TBARS levels were significantly lower (p ≤ 0.05 in the samples containing plant extracts or BHT than in the non-treated control. In addition, the beef patties formulated with the selected plant extracts showed significantly (p ≤ 0.05 better color stability than those without antioxidants. These results indicate that edible plant extracts are promising sources of natural antioxidants and can potentially be used as functional preservatives in meat products.

Impact of product familiarity on beef quality perception

DEFF Research Database (Denmark)

Banovic, Marija; Fontes, Magda Aguiar; Barreira, Maria Madalena

2012-01-01

This study examines the use of intrinsic and extrinsic cues in beef quality perception at the point of purchase and upon consumption by consumers with varying levels of familiarity with a particular beef product. High-familiarity consumers tend to use the color of the meat to assess beef quality......, whereas low-familiarity consumers tend to believe that the brand is the most valid cue for assessing beef quality. However, due to the lack of consistency in sensory beef quality, high-familiarity consumers’ ability to form quality expectations that are predictive of their quality experience is no better...

IceBridge GPS L0 Raw Satellite Navigation Data

Data.gov (United States)

National Aeronautics and Space Administration — The NASA IceBridge GPS L0 Raw Satellite Navigation Data (IPUTG0) data set contains GPS readings, including latitude, longitude, track, ground speed, off distance,...

Validation of a One-Step Method for Extracting Fatty Acids from Salmon, Chicken and Beef Samples.

Science.gov (United States)

Zhang, Zhichao; Richardson, Christine E; Hennebelle, Marie; Taha, Ameer Y

2017-10-01

Fatty acid extraction methods are time-consuming and expensive because they involve multiple steps and copious amounts of extraction solvents. In an effort to streamline the fatty acid extraction process, this study compared the standard Folch lipid extraction method to a one-step method involving a column that selectively elutes the lipid phase. The methods were tested on raw beef, salmon, and chicken. Compared to the standard Folch method, the one-step extraction process generally yielded statistically insignificant differences in chicken and salmon fatty acid concentrations, percent composition and weight percent. Initial testing showed that beef stearic, oleic and total fatty acid concentrations were significantly lower by 9-11% with the one-step method as compared to the Folch method, but retesting on a different batch of samples showed a significant 4-8% increase in several omega-3 and omega-6 fatty acid concentrations with the one-step method relative to the Folch. Overall, the findings reflect the utility of a one-step extraction method for routine and rapid monitoring of fatty acids in chicken and salmon. Inconsistencies in beef concentrations, although minor (within 11%), may be due to matrix effects. A one-step fatty acid extraction method has broad applications for rapidly and routinely monitoring fatty acids in the food supply and formulating controlled dietary interventions. © 2017 Institute of Food Technologists®.

Postrigor citric acid enhancement can alter cooked color but not fresh color of dark-cutting beef.

Science.gov (United States)

Stackhouse, R J; Apple, J K; Yancey, J W S; Keys, C A; Johnson, T M; Mehall, L N

2016-04-01

In 2 experiments, dark-cutting (DC) beef strip loins were used to test the effects of citric acid-enhancement pH on visual and instrumental color of fresh and cooked steaks. In Exp. 1 and 2, each DC (mean pH = 6.57 and 6.65, respectively) and normal-pH, low USDA Choice (CH; mean pH = 5.48 and 5.51, respectively) strip loin was cut into 2 equal-length sections, and DC sections were injected to 111% of raw section weight with pH 3.5 to 5.0 (Exp. 1) or pH 2.0 to 3.5 (Exp. 2) solutions made by mixing citric acid in either 0.05% orthophosphate (PO) solution or tap water (HO) base solutions (Exp. 1) and 0.5% PO or 0.5% tripolyphosphate solution base solutions (Exp. 2). After enhancement, sections were cut into steaks, which were assigned to either 5 d of simulated retail display or cooked to 71°C for cooked color measurement. Postenhancement pH of DC steaks enhanced with pH 3.5 to 5.0 solutions did not ( ≥ 0.180) differ from that of nonenhanced DC steaks (Exp. 1) but linearly decreased ( citric acid enhancement over untreated DC steaks during the first 3 d of display, fresh steak color never ( citric acid enhancement solutions, regardless of base solution, were insufficient to improve the fresh color of DC beef; however, enhancement with pH 2.5 citric acid solutions effectively eliminated the persistent red cooked color typically associated with DC beef comparable with that of normal-pH beef.

Enzyme immunoassay and proteomic characterization of troponin I as a marker of mammalian muscle compounds in raw meat and some meat products.

Science.gov (United States)

Zvereva, Elena A; Kovalev, Leonid I; Ivanov, Alexei V; Kovaleva, Marina A; Zherdev, Anatoly V; Shishkin, Sergey S; Lisitsyn, Andrey B; Chernukha, Irina M; Dzantiev, Boris B

2015-07-01

The skeletal muscle protein troponin I (TnI) has been characterized as a potential thermally stable and species-specific biomarker of mammalian muscle tissues in raw meat and meat products. This study proposed a technique for the quantification of TnI comprising protein extraction and sandwich enzyme-linked immunosorbent assay (ELISA). The technique is characterized by a TnI detection limit of 4.8 ng/ml with quantifiable concentrations ranging from 8.7 to 52 ng/ml. The method was shown to be suitable for detection of TnI in mammalian (beef, pork, lamb, and horse) meat but not in poultry (chicken, turkey, and duck) meat. In particular, the TnI content in beef was 0.40 3 ± 0.058 mg/g of wet tissue. The TnI estimations obtained for the pork and beef samples using ELISA were comparable to the proteomic analysis results. Thus, the quantitative study of TnI can be a convenient way to assess the mammalian muscle tissue content of various meat products. Copyright © 2015. Published by Elsevier Ltd.

Beef Cattle: Selection and Evaluation.

Science.gov (United States)

Clemson Univ., SC. Vocational Education Media Center.

Designed for secondary vocational agriculture students, this text provides an overview of selecting and evaluating beef cattle in Future Farmers of America livestock judging events. The first of four major sections addresses topics such as the ideal beef animal, selecting steers, selecting breeding animals, studying the animal systematically, and…

Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef

Directory of Open Access Journals (Sweden)

Maíra Maciel Mattos de Oliveira

2013-12-01

Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.

Evaluation of the 3M™ Petrifilm™ Salmonella express system for the detection of Salmonella species in selected foods: collaborative study.

Science.gov (United States)

Bird, Patrick; Flannery, Jonathan; Crowley, Erin; Agin, James; Goins, David; Jechorek, Robert

2014-01-01

The 3M™ Petriflm™ Salmonella Express (SALX) System is a simple, ready-to-use chromogenic culture medium system for the rapid qualitative detection and biochemical confirmation of Salmonella spp. in food and food process environmental samples. The 3M Petrifilm SALX System was compared using an unpaired study design in a multilaboratory collaborative study to the U.S. Department of Agriculture/Food Safety and Inspection Service (USDA/FSIS) Microbiology Laboratory Guidebook (MLG) 4.07 (2013) Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg and Catfish Products and Carcass and Environmental Sponges for raw ground beef and the U.S. Food and Drug Administration Bacteriological Analytical Manual (FDA/BAM) Chapter 5, Salmonella (2011) reference method for dry dog food following the current AOAC validation guidelines. For this study, a total of 17 laboratories located throughout the continental United States evaluated 1872 test portions. For the 3M Petrifilm SALX System, raw ground beef was analyzed using 25 g test portions, and dry dog food was analyzed using 375 g test portions. For the reference methods, 25 g test portions of each inatrix were analyzed. The two matrices were artificially contaminated with Salmonella at three inoculation levels: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). Each inoculation level was statistically analyzed using the probability of detection statistical model. For the raw ground beef and dry dog food test portions, no significant differences at the 95% confidence interval were observed in the number of positive samples detected by the 3M Petrifilm SALX System versus either the USDA/FSIS-MLG or FDA/BAM methods.

Comparison of WindTrax and flux-gradient technique in determining PM10 emission rates from a beef cattle feedlot

Science.gov (United States)

Several emission estimation methods can be used to determine emission fluxes from ground-level area sources, including open-lot beef cattle feedlots. This research determined PM10 emission fluxes from a commercial cattle feedlot in Kansas using WindTrax, a backward Lagrangian stochastic-based atmosp...

IMPACT OF EXPORTS ON THE U.S. BEEF INDUSTRY

OpenAIRE

Van Eenoo, Edward, Jr.; Peterson, Everett B.; Purcell, Wayne D.

2000-01-01

Policy and programmatic decisions dealing with beef exports require good information as to the impact of exports on the domestic beef industry. This paper utilizes a partial equilibrium model of the world beef market to assess the impacts on the U.S. beef sector of increases in real income in major beef importing countries, the impacts of changes in the prices of pork and poultry products, and the impacts of changes in the price of feedgrains. A one percent increase in real GDP in Canada, Jap...

Assessment of Consumer Exposure to Salmonella spp., Campylobacter spp., and Shiga Toxin-Producing Escherichia coli in Meat Products at Retail in the City of Sao Paulo, Brazil.

Science.gov (United States)

Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Dos Santos, Luis Fernando; Jakabi, Miyoko; de Melo Franco, Bernadette Dora Gombossy

2017-08-01

Meat products may be vehicles of bacterial pathogens to humans, and Salmonella spp., Campylobacter spp., and Shiga toxin-producing Escherichia coli (STEC) are the most relevant. The aim of this study was to generate data on prevalence of these three pathogens in 552 samples of meat products (hot dogs, pork sausages, raw ground beef, and raw chicken legs) sold at retail in the city of Sao Paulo, Brazil. Salmonella spp. was detected in 5.8% (32/552) of samples, comprising pork sausages 62.5% (20/32) and chicken legs 37.5% (12/32). The counts of Salmonella spp. were low, ranging from Salmonella Typhimurium (28.1%), Salmonella I 4,[5],12:i:- (15.6%), Salmonella Enteritidis (12.5%), Salmonella Derby, and Salmonella Brandenburg (9.4%). Campylobacter spp. was detected in 33 samples (6.0%), comprising chicken legs (82%) and ground beef (18%). All samples were negative for STEC. These results suggest that meat products when subjected to inadequate cooking and/or cross-contamination with other products ready for consumption can lead to occurrence of outbreaks, highlighting the risks associated with them.

The North Dakota Beef Industry Survey: Implications for Extension

Science.gov (United States)

Dahlen, Carl R.; Hadrich, Joleen C.; Lardy, Gregory P.

2014-01-01

A portion of the North Dakota Beef Industry Survey was developed to determine how educational programs can evolve to meet future needs of North Dakota beef producers. Of the 2,500 surveys mailed out to beef producers, 527 responses were completed and returned. Results highlight the level of education of North Dakota beef producers, anticipated use…

The beef market in the European Union

DEFF Research Database (Denmark)

Nielsen, Niels Asger

small with the largest slaughtering company slaughtering only 3% of the total. 9. Relations between industry (slaughterhouses) and farmers tend to be much looser in the beef market than it is in other agricultural markets, eg the milk market. Cattle markets are still quite important although the share......'s share of total meat consumption 3. As a consequence of the consumers' demand for convenient shopping, butcher's share of total beef sales is rapidly decreasing in Europe. 4. Changes in meat consumption have traditionally been explained by relative price and per capita income, but these economic demand...... analyses can explain a rapidly decreasing share of the variation in beef consumption. 5. Studies show that beef consumption tends to increase with age; the heavy users are found among middle-aged men. Beef consumption also increases with income and social class. 6. The most important user-oriented quality...

Spanish, French and British consumers' acceptability of Uruguayan beef, and consumers' beef choice associated with country of origin, finishing diet and meat price.

Science.gov (United States)

Realini, C E; Font i Furnols, M; Sañudo, C; Montossi, F; Oliver, M A; Guerrero, L

2013-09-01

The effect of country of origin (local, Switzerland, Argentina, Uruguay), finishing diet (grass, grass plus concentrate, concentrate), and price (low, medium, high) on consumer's beef choice and segmentation was evaluated in Spain, France and United Kingdom. Sensory acceptability of Uruguayan beef from different production systems was also evaluated and contrasted with consumers' beef choices. Origin was the most important characteristic for the choice of beef with preference for meat produced locally. The second most important factor was animal feed followed by price with preference for beef from grass-fed animals and lowest price. The least preferred product was beef from Uruguay, concentrate-fed animals and highest price. Sensory data showed higher acceptability scores for Uruguayan beef from grass-fed animals with or without concentrate supplementation than animals fed concentrate only. Consumer segments with distinct preferences were identified. Foreign country promotion seems to be fundamental for marketing beef in Europe, as well as the development of different marketing strategies to satisfy each consumer segment. Copyright © 2013 Elsevier Ltd. All rights reserved.

Isolation and characterization of non-O157 Shiga toxin-producing Escherichia coli from beef carcasses, cuts and trimmings of abattoirs in Argentina

Science.gov (United States)

Brusa, Victoria; Restovich, Viviana; Galli, Lucía; Teitelbaum, David; Signorini, Marcelo; Brasesco, Hebe; Londero, Alejandra; García, Diego; Padola, Nora Lía; Superno, Valeria; Sanz, Marcelo; Petroli, Sandra; Costa, Magdalena; Bruzzone, Mariana; Sucari, Adriana; Ferreghini, Marcela; Linares, Luciano; Suberbie, Germán; Rodríguez, Ricardo

2017-01-01

Several foods contaminated with Shiga toxin-producing Escherichia coli (STEC) are associated with human diseases. Some countries have established microbiological criteria for non-O157 STEC, thus, the absence of serogroups O26, O45, O103, O104, O111, O121, and O145 in sprouts from the European Union or ground beef and beef trimmings from the United States is mandatory. While in Argentina screening for O26, O103, O111, O145 and O121 in ground beef, ready-to-eat food, sausages and vegetables is mandatory, other countries have zero-tolerance for all STEC in chilled beef. The aim of this study was to provide data on the prevalence of non-O157 STEC isolated from beef processed in eight Argentinean cattle slaughterhouses producing beef for export and local markets, and to know the non-O157 STEC profiles through strain characterization and genotypic analysis. Samples (n = 15,965) from 3,205 beef carcasses, 9,570 cuts and 3,190 trimmings collected between March and September 2014 were processed in pools of five samples each. Pools of samples (n = 3,193) from 641 carcasses, 1,914 cuts and 638 trimming were analyzed for non-O157 STEC isolation according to ISO/CEN 13136:2012. Of these, 37 pools of carcasses (5.8%), 111 pools of cuts (5.8%) and 45 pools of trimmings (7.0%) were positive for non-O157 STEC. STEC strains (n = 200) were isolated from 193 pools of samples. The most prevalent serotypes were O174:H21, O185:H7, O8:H19, O178:H19 and O130:H11, and the most prevalent genotypes were stx2c(vh-b) and stx2a/saa/ehxA. O103:H21 strain was eae-positive and one O178:H19 strain was aggR/aaiC-positive. The prevalence of non-O157 STEC in beef carcasses reported here was low. None of the non-O157 STEC strains isolated corresponded to the non-O157 STEC serotypes and virulence profiles isolated from human cases in Argentina in the same study period. The application of microbiological criteria for each foodstuff should be determined by risk analysis in order to have a stringent

Isolation and characterization of non-O157 Shiga toxin-producing Escherichia coli from beef carcasses, cuts and trimmings of abattoirs in Argentina.

Directory of Open Access Journals (Sweden)

Victoria Brusa

Full Text Available Several foods contaminated with Shiga toxin-producing Escherichia coli (STEC are associated with human diseases. Some countries have established microbiological criteria for non-O157 STEC, thus, the absence of serogroups O26, O45, O103, O104, O111, O121, and O145 in sprouts from the European Union or ground beef and beef trimmings from the United States is mandatory. While in Argentina screening for O26, O103, O111, O145 and O121 in ground beef, ready-to-eat food, sausages and vegetables is mandatory, other countries have zero-tolerance for all STEC in chilled beef. The aim of this study was to provide data on the prevalence of non-O157 STEC isolated from beef processed in eight Argentinean cattle slaughterhouses producing beef for export and local markets, and to know the non-O157 STEC profiles through strain characterization and genotypic analysis. Samples (n = 15,965 from 3,205 beef carcasses, 9,570 cuts and 3,190 trimmings collected between March and September 2014 were processed in pools of five samples each. Pools of samples (n = 3,193 from 641 carcasses, 1,914 cuts and 638 trimming were analyzed for non-O157 STEC isolation according to ISO/CEN 13136:2012. Of these, 37 pools of carcasses (5.8%, 111 pools of cuts (5.8% and 45 pools of trimmings (7.0% were positive for non-O157 STEC. STEC strains (n = 200 were isolated from 193 pools of samples. The most prevalent serotypes were O174:H21, O185:H7, O8:H19, O178:H19 and O130:H11, and the most prevalent genotypes were stx2c(vh-b and stx2a/saa/ehxA. O103:H21 strain was eae-positive and one O178:H19 strain was aggR/aaiC-positive. The prevalence of non-O157 STEC in beef carcasses reported here was low. None of the non-O157 STEC strains isolated corresponded to the non-O157 STEC serotypes and virulence profiles isolated from human cases in Argentina in the same study period. The application of microbiological criteria for each foodstuff should be determined by risk analysis in order to have a

Salmonella in beef and produce from honduras.

Science.gov (United States)

Maradiaga, Martha; Miller, Mark F; Thompson, Leslie; Pond, Ansen; Gragg, Sara E; Echeverry, Alejandro; Garcia, Lyda G; Loneragan, Guy H; Brashears, Mindy M

2015-03-01

Salmonella continues to cause a considerable number of foodborne illnesses worldwide. The sources of outbreaks include contaminated meat and produce. The purpose of this study was to establish an initial investigation of the burden of Salmonella in produce and beef from Honduras by sampling retail markets and abattoirs. Retail produce samples (cantaloupes, cilantro, cucumbers, leafy greens, peppers, and tomatoes; n = 573) were purchased in three major cities of Honduras, and retail whole-muscle beef (n = 555) samples were also purchased in four major cities. Additionally, both hide and beef carcass (n = 141) samples were collected from two Honduran abattoirs. Whole-muscle beef samples were obtained using a sponge hydrated with buffered peptone water, and 10 ml of the buffered peptone water rinsate of each produce sample was collected with a dry sponge and placed in a bag to be transported back to the United States. Salmonella was detected using a commercially available, closeplatform PCR system, and positive samples were subjected to culture on selective media to obtain isolates. Overall, the prevalence of Salmonella-positive samples, based on PCR detection in Honduras (n = 555) retail beef was 10.1% (95% confidence interval = 7.8, 12.9), whereas 7.8% (n = 141) of beef carcass and hides samples were positive in both beef plants. The overall Salmonella prevalence for all produce samples (n = 573) collected was 2.1% (95% confidence interval = 1.2, 3.6). The most common serotypes identified in Honduras were Salmonella Typhimurium followed by Derby. These results provide an indication of Salmonella contamination of beef and produce in Honduras. Developing a Salmonella baseline for Latin America through an initial investigation like the one presented here contributes to a broader global understanding of the potential exposure through food, thus providing insight into the needs for control strategies.

Antimicrobial resistance issues in beef production

Science.gov (United States)

Antimicrobial resistance threats to human health as identified have been recognized as a critical global public health concern. Linkage of some threats to beef production is discussed. The relevance to beef production of recent government actions will be examined. Prominent antimicrobial resistance ...

Raw beef bones as chewing items to reduce dental calculus in Beagle dogs.

Science.gov (United States)

Marx, F R; Machado, G S; Pezzali, J G; Marcolla, C S; Kessler, A M; Ahlstrøm, Ø; Trevizan, L

2016-01-01

Evaluate the effect of raw bovine cortical bone (CB) (medullary bone cross-sectioned) and marrow or epiphyseal 'spongy' bone (SB) as chew items to reduce dental calculus in adult dogs. Eight 3-year-old Beagle dogs were observed in two study periods. In the first study, the dogs each received a piece of bovine femur CB (122 ± 17 g) daily and in the second study, a piece of bovine femur SB (235 ± 27 g). The first study lasted 12 days and the second 20 days. Dental calculus was evaluated using image integration software. At the start of the studies, dental calculus covered 42.0% and 38.6% of the dental arcade areas, respectively. In study one, the chewing reduced the established dental calculus area to 27.1% (35.5% reduction) after 3 days and after 12 days the dental calculus covering was reduced to 12.3% (70.6% reduction). In study two, the dental calculus covered 16.8% (56.5% reduction) after 3 days, 7.1% (81.6% reduction) after 12 days and 4.7% (87.8% reduction) after 20 days. The CB remained largely intact after 24 h, but SB was reduced to smaller pieces and in some cases totally consumed after 24 h. No complications such as tooth fractures, pieces of bone stuck between teeth or intestinal obstructions were observed during the studies. Chewing raw bovine bones was an effective method of removing dental calculus in dogs. The SB bones removed dental calculus more efficiently in the short term. © 2016 Australian Veterinary Association.

Beef traders' and consumers' perceptions on the development of a ...

African Journals Online (AJOL)

Beef traders' and consumers' perceptions on the development of a natural pasture-fed beef (NPB) brand by smallholder cattle producers were investigated. In total, 18 meat traders (five abattoirs and 13 beef retailers) and 155 beef consumers were interviewed using structured questionnaires. All meat traders had the ...

Consumption of beef from cattle administered estrogenic growth promotants does not result in premature puberty and obesity using the swine model

Science.gov (United States)

The objective was to investigate the effects of ground beef from cattle administered commercial growth promotants on puberty attainment and body composition in female swine. Twenty-four gilts were selected based on strict selection criteria to reduce piglet variation. Treatments were randomly assign...

Improvements in Iron Status and Cognitive Function in Young Women Consuming Beef or Non-Beef Lunches

Directory of Open Access Journals (Sweden)

Cynthia Blanton

2013-12-01

Full Text Available Iron status is associated with cognitive performance and intervention trials show that iron supplementation improves mental function in iron-deficient adults. However, no studies have tested the efficacy of naturally iron-rich food in this context. This investigation measured the hematologic and cognitive responses to moderate beef consumption in young women. Participants (n = 43; age 21.1 ± 0.4 years were randomly assigned to a beef or non-beef protein lunch group [3-oz (85 g, 3 times weekly] for 16 weeks. Blood was sampled at baseline, and weeks 8 and 16, and cognitive performance was measured at baseline and week 16. Body iron increased in both lunch groups (p < 0.0001, with greater improvement demonstrated in women with lower baseline body iron (p < 0.0001. Body iron had significant beneficial effects on spatial working memory and planning speed (p < 0.05, and ferritin responders (n = 17 vs. non-responders (n = 26 showed significantly greater improvements in planning speed, spatial working memory strategy, and attention (p < 0.05. Lunch group had neither significant interactions with iron status nor consistent main effects on test performance. These findings support a relationship between iron status and cognition, but do not show a particular benefit of beef over non-beef protein consumption on either measure in young women.

HEDONIC DEMAND ANALYSIS FOR BEEF IN BENIN METROPOLIS

African Journals Online (AJOL)

BIUAGRIC2

2013-02-11

Feb 11, 2013 ... implicit demand for beef within the framework of a hedonic analysis, and the implicit or shadow price of beef were examined. Primary data ... results of the Hedonic analysis showed that, with an average unit price of N836.57 for beef, a consumer is strongly willing to pay ... method and strategies. Lancaster ...

Beef flavor: a review from chemistry to consumer.

Science.gov (United States)

Kerth, Chris R; Miller, Rhonda K

2015-11-01

This paper briefly reviews research that describes the sensation, generation and consumer acceptance of beef flavor. Humans sense the five basic tastes in their taste buds, and receptors in the nasal and sinus cavities sense aromas. Additionally, trigeminal senses such as metallic and astringent are sensed in the oral and nasal cavities and can have an effect on the flavor of beef. Flavors are generated from a complex interaction of tastes, tactile senses and aromas taken collectively throughout the tongue, nasal, sinus and oral cavities. Cooking beef generates compounds that contribute to these senses and result in beef flavor, and the factors that are involved in the cookery process determine the amount and type of these compounds and therefore the flavor generated. A low-heat, slow cooking method generates primarily lipid degradation products, while high-heat, fast cookery generates more Maillard reaction products. The science of consumer acceptance, cluster analyses and drawing relationships among all flavor determinants is a relatively new discipline in beef flavor. Consumers rate beef that has lipid degradation products generated from a low degree of doneness and Maillard flavor products from fast, hot cookery the highest in overall liking, and current research has shown that strong relationships exist between beef flavor and consumer acceptability, even more so than juiciness or tenderness. © 2015 Society of Chemical Industry.

Comparison of flavor changes in cooked-refrigerated beef, pork and chicken meat patties.

Science.gov (United States)

Rhee, K S; Anderson, L M; Sams, A R

2005-10-01

Beef and pork longissimus dorsi (LD) and semimembranosus (SM) and chicken breast (B) and thigh (T) muscles excised 24 h postmortem were ground by muscle/species group, formed into patties, pan-fried, refrigerated for 0, 3 or 6 days, and evaluated by a trained sensory panel for intensity of specific flavors. The rate of decline in species-specific natural meat flavor intensity and the rate of increase in "cardboard" (CBD) flavor intensity during the first half of the 6-day storage were fastest for beef, while such decline and increase during the entire storage period were slowest for chicken B. Overall trends of natural meat flavor and CBD intensity changes for chicken T appeared more like those for the red meats than chicken B. It was concluded that, while flavor deterioration can occur in cooked-stored meats from all the species, quantitative or the magnitude of differences between species would depend on muscle types and sensory terms/method used.

ROMANIAN BEEF AND VEAL MEAT MARKET ANALYSIS

Directory of Open Access Journals (Sweden)

ilvius T. STANCIU

2014-06-01

Full Text Available Current nutritional trends, oriented towards a healthy nutrition, lead to the re-evaluation of the share held by beef in the diet of the population. The demand for beef and veal at European and global market level can represent a significant opportunity to increase domestic producers’ business. Though cattle breeding is a traditional activity for the indigenous population from rural areas, livestock for slaughter have decreased steadily in the last years, thus the domestic market being dependent on imports. Romanian natural potential allows the achievement of sufficient production to meet domestic and export demand for beef, which brings high income for producers. The article proposes a review of the domestic production of beef and veal, their consumption and the origin of products on the domestic market in the European and international context.

Presence of Salmonella Spp and Escherichia Coli O157:H7 in Raw Meat, in São Paulo City, Brazil and Evaluation of Low Temperature (Refrigeration and Freezing) Resistance of these Bacteria

Energy Technology Data Exchange (ETDEWEB)

Jakabi, M.; Gelli, D. S.; Ristori, C. A.; De Paula, A. M.R.; Sakuma, H.; Lopez, G. I.S. [Seção de Microbiologia Alimentar (Brazil); Fernandes, S. A. [Seção de Bacteriologia Médica (Brazil); Luchesi, R. B. [Seção de Meios de Cultura (Brazil); Instituto Adolfo Lutz, São Paulo (Brazil)

2005-01-15

A total of 253 samples of raw meat (bovine, swine and poultry) were collected in local supermarkets in Sao Paulo, Brazil, and analysed for Salmonella and E. coli 0157:H7, in order to determine their microbiological quality and compliance with the established standards for these two bacteria. Additionally, samples of ground beef were artificially contaminated with S. enteritidis and E. coli 0157:H7, in order to determine the effect of refrigeration and freezing temperature during the storage period (4ºC for 5 days, and - 18ºC for 90 days, respectively). Twenty-three samples (9.1%) were positive to Salmonella and seven different serotypes were isolated, S. enteritidis being the most common serotype founded (34,8%). The results of the artificially contaminated samples showed that E. coli 0157:H7 was sensitive to refrigeration as well as freezing temperature. S. enteritidis was only affected by freezing temperature during the storage time. (author)

IceBridge GPS L0 Raw Satellite Navigation Data, Version 1

Data.gov (United States)

National Aeronautics and Space Administration — The NASA IceBridge GPS L0 Raw Satellite Navigation Data (IPUTG0) data set contains GPS readings, including latitude, longitude, track, ground speed, off distance,...

Current situation and future prospects for the Australian beef industry.

Science.gov (United States)

Greenwood, Paul Leo; Ferguson, Drewe M

2018-04-12

Beef production extends over almost half of Australia, with about 47,000 cattle producers that contribute about 20% ($A12.7 billion GVP) of the total value of farm production in Australia. Australia is one of the world's most efficient producers of cattle and was the world's third largest beef exporter in 2016. The Australian beef industry had 25 million head of cattle in 2016-17, with a national beef breeding herd of 11.5 million head. Australian beef production includes pasture based cow-calf systems, a backgrounding or grow-out period on pasture, and feedlot or pasture finishing. Feedlot finishing has assumed more importance in recent years to assure the eating quality of beef entering the relatively small Australian domestic market, and to enhance the supply of higher value beef for export markets. Maintenance of Australia's preferred status as a quality assured supplier of high value beef produced under environmentally sustainable systems from 'disease-free' cattle is of highest importance. Stringent livestock and meat quality regulations and quality assurance systems, and productivity growth and efficiency across the supply chain to ensure price competiveness, are crucial for continued export market growth in the face of increasing competition. Major industry issues, that also represent research, development and adoption priorities and opportunities for the Australian beef industry have been captured within exhaustive strategic planning processes by the red meat and beef industries. At the broadest level, these issues include consumer and industry support, market growth and diversification, supply chain efficiency, productivity and profitability, environmental sustainability, and animal health and welfare. This review provides an overview of the Australian beef industry including current market trends and future prospects, and major issues and opportunities for the continued growth, development and profitability of the industry.

Study of the combined effect of spices and marination on beef meat vacuum packaged

Directory of Open Access Journals (Sweden)

DANIELA ISTRATI

2011-12-01

Full Text Available Fresh beef slices were marinated by immersion in marinades based on dry red wine, lime-tree honey, salt, spices and seasoning plants as thyme (Thymus vulgaris, marjoram (Majorana hortensis, garlic (Allium sativum and horseradish (Armoracia rusticana. Control samples were represented by raw meat without marination treatment but stored in the same conditions as marinated samples. After marination, meat pieces were packed under vacuum and stored at refrigeration temperature of 4°C for 12 days. The influence of the combined effect of spices and marination on beef stability was evaluated by monitoring pH evolution, degree of lipid oxidation and by microbiological analysis. For control samples, a mean increase of 0.47 log CFU/g of total mesophilic aerobic bacteria was observed during the 48 h of storage, but for the samples marinated with the addition of spices was observed a decrease of 0.57 log CFU/g. The growth of LAB in control samples was generally limited and did not exceed 5 log CFU/g. During storage at 4°C, marination with the addition in the base marinade (wine, honey, garlic, pepper and salt of thyme, marjoram and horseradish separately inhibited the growth of LAB while marination with the addition in the base marinade of thyme, marjoram and horseradish together resulted in significantly lower levels of LAB. All marination treatments resulted in significantly lower TBA and POV values at the end of storage compared to the control. Marination with dry red wine, lime-tree honey, thyme marjoram, garlic, and horseradish can evidently control total mesophilic aerobic bacteria, lactic acid bacteria and oxidation of beef meat.

Incorporating reproductive management of beef heifers into a veterinary practice.

Science.gov (United States)

Poock, Scott E; Payne, Craig A

2013-11-01

Veterinarians play an important role in reproductive management of dairy herds across the United States; however, in many cases, their involvement in reproductive management of beef herds has been limited. The reasons for this vary; however, there are ways for veterinarians to become more actively involved in reproductive management of US beef herds. Veterinarians can have an impact on producers' profits by implementing their skills and knowledge to beef heifer development programs. This article provides an overview of the services veterinarians can provide to beef cattle producers that pertain to reproductive management of replacement beef heifers. Published by Elsevier Inc.

Optimal Replacement and Management Policies for Beef Cows

OpenAIRE

W. Marshall Frasier; George H. Pfeiffer

1994-01-01

Beef cow replacement studies have not reflected the interaction between herd management and the culling decision. We demonstrate techniques for modeling optimal beef cow replacement intervals and discrete management policies by incorporating the dynamic effects of management on future productivity when biological response is uncertain. Markovian decision analysis is used to identify optimal beef cow management on a ranch typical of the Sandhills region of Nebraska. Issues of breeding season l...

Comparison of external morphological traits of newborns to inner morpholical traits of the dam in the double-muscled Belgian Blue Beef breed.

NARCIS (Netherlands)

Coopman, F.; Gengler, N.; Groen, A.F.; Smet, de S.; Zeveren, van A.

2004-01-01

In the double-muscled (DM) Belgian Blue Beef (BBB) breed, caesarean section (CS) is used as a routine management tool to prevent dystocia. This practice is criticized on animal welfare grounds. With unassisted (natural) births, difficulties arise because of disproportion between the sizes of the

Legume finishing provides beef with positive human dietary fatty acid ratios and consumer preference comparable with grain-finished beef.

Science.gov (United States)

Chail, A; Legako, J F; Pitcher, L R; Griggs, T C; Ward, R E; Martini, S; MacAdam, J W

2016-05-01

Consumer liking, proximate composition, pH, Warner-Bratzler shear force, fatty acid composition, and volatile compounds were determined from the LM (longissimus thoracis) of cattle ( = 6 per diet) finished on conventional feedlot (USUGrain), legume, and grass forage diets. Forage diets included a condensed tannin-containing perennial legume, birdsfoot trefoil (; USUBFT), and a grass, meadow brome ( Rehmann; USUGrass). Moreover, representative retail forage (USDA Certified Organic Grass-fed [OrgGrass]) and conventional beef (USDA Choice, Grain-fed; ChGrain) were investigated ( = 6 per retail type). The ChGrain had the greatest ( 0.05) to that of both USUGrain and USUGrass. Both grain-finished beef treatments were rated greater ( Consumer liking of USUBFT beef tenderness, fattiness, and overall liking were comparable ( > 0.05) with that of USUGrain and ChGrain. Flavor liking was rated greatest ( 0.05) to those of ChGrain, USUGrass, and OrgGrass. Cumulative SFA and MUFA concentrations were greatest ( 0.05) to those of USUGrain and USUGrass. Each forage-finished beef treatment, USUGrass, OrgGrass, and USUBFT, had lower ( < 0.001) ratios of -6:-3 fatty acids. Hexanal was the most numerically abundant volatile compound. The concentration of hexanal increased with increasing concentrations of total PUFA. Among all the lipid degradation products (aldehydes, alcohols, furans, carboxylic acids, and ketones) measured in this study, there was an overall trend toward greater quantities in grain-finished products, lower quantities in USUGrass and OrgGrass, and intermediate quantities in USUBFT. This trend was in agreement with IMF content, fatty acid concentrations, and sensory attributes. These results suggest an opportunity for a birdsfoot trefoil finishing program, which results in beef comparable in sensory quality with grain-finished beef but with reduced -6 and SFA, similar to grass-finished beef.

77 FR 12752 - Beef Promotion and Research; Amendment to the Order

Science.gov (United States)

2012-03-02

... possessing the requisite experience, skills and information related to the marketing of beef and beef..., skills and information related to the marketing of beef and beef products, as is intended under the Act... DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 1260 [Doc. No. AMS-LS-11-0086...

Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

International Nuclear Information System (INIS)

Castejón, David; García-Segura, Juan Manuel; Escudero, Rosa; Herrera, Antonio; Cambero, María Isabel

2015-01-01

In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by "1H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

Energy Technology Data Exchange (ETDEWEB)

Castejón, David [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); García-Segura, Juan Manuel [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Escudero, Rosa [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain); Herrera, Antonio [Departamento de Química Orgánica, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Cambero, María Isabel, E-mail: icambero@vet.ucm.es [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain)

2015-12-11

In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by {sup 1}H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

Factors influencing intention to purchase beef in the Irish market.

Science.gov (United States)

McCarthy, M; de Boer, M; O'Reilly, S; Cotter, L

2003-11-01

This paper reports on the findings of a study into consumer perceptions towards beef and the influence of these perceptions on consumption. Fishbein and Ajzen's [Belief, attitude, intention and behaviour. An introduction to theory and research (1995) Reading, MA: Addison-Wesley] Theory of Reasoned Action (TRA) provided a useful framework for this analysis. The influence of attitudes and important others (subjective norm) on intention to consume beef were explored. The findings support the usefulness of this model in understanding behaviour towards beef. In this study both attitude and the subjective norm influenced intention to consume beef, but it was attitude that was of greater importance. Health, eating enjoyment and safety were most important determinants of attitude with price, environment and animal welfare less so. An evaluation of the impact of the introduction of new information which related to one belief (health) was also conducted. Those indicating that they would consider increasing their consumption of beef had a more positive attitude towards beef and had more positive health and eating enjoyment beliefs about beef than the 'no' group who had significantly higher safety concerns.

Classification and characterization of Japanese consumers' beef preferences by external preference mapping.

Science.gov (United States)

Sasaki, Keisuke; Ooi, Motoki; Nagura, Naoto; Motoyama, Michiyo; Narita, Takumi; Oe, Mika; Nakajima, Ikuyo; Hagi, Tatsuro; Ojima, Koichi; Kobayashi, Miho; Nomura, Masaru; Muroya, Susumu; Hayashi, Takeshi; Akama, Kyoko; Fujikawa, Akira; Hokiyama, Hironao; Kobayashi, Kuniyuki; Nishimura, Takanori

2017-08-01

Over the past few decades, beef producers in Japan have improved marbling in their beef products. It was recently reported that marbling is not well correlated with palatability as rated by Japanese consumers. This study sought to identify the consumer segments in Japan that prefer sensory characteristics of beef other than high marbling. Three Wagyu beef, one Holstein beef and two lean imported beef longissimus samples were subjected to a descriptive sensory test, physicochemical analysis and a consumer (n = 307) preference test. According to consumer classification and external preference mapping, four consumer segments were identified as 'gradual high-fat likers', 'moderate-fat and distinctive taste likers', 'Wagyu likers' and 'distinctive texture likers'. Although the major trend of Japanese consumers' beef preference was 'marbling liking', 16.9% of the consumers preferred beef samples that had moderate marbling and distinctive taste. The consumers' attitudes expressed in a questionnaire survey were in good agreement with the preference for marbling among the 'moderate-fat and distinctive taste likers'. These results indicate that moderately marbled beef is a potent category in the Japanese beef market. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Modelling of beef sensory quality for a better prediction of palatability.

Science.gov (United States)

Hocquette, Jean-François; Van Wezemael, Lynn; Chriki, Sghaier; Legrand, Isabelle; Verbeke, Wim; Farmer, Linda; Scollan, Nigel D; Polkinghorne, Rod; Rødbotten, Rune; Allen, Paul; Pethick, David W

2014-07-01

Despite efforts by the industry to control the eating quality of beef, there remains a high level of variability in palatability, which is one reason for consumer dissatisfaction. In Europe, there is still no reliable on-line tool to predict beef quality and deliver consistent quality beef to consumers. Beef quality traits depend in part on the physical and chemical properties of the muscles. The determination of these properties (known as muscle profiling) will allow for more informed decisions to be made in the selection of individual muscles for the production of value-added products. Therefore, scientists and professional partners of the ProSafeBeef project have brought together all the data they have accumulated over 20 years. The resulting BIF-Beef (Integrated and Functional Biology of Beef) data warehouse contains available data of animal growth, carcass composition, muscle tissue characteristics and beef quality traits. This database is useful to determine the most important muscle characteristics associated with a high tenderness, a high flavour or generally a high quality. Another more consumer driven modelling tool was developed in Australia: the Meat Standards Australia (MSA) grading scheme that predicts beef quality for each individual muscle×specific cooking method combination using various information on the corresponding animals and post-slaughter processing factors. This system has also the potential to detect variability in quality within muscles. The MSA system proved to be effective in predicting beef palatability not only in Australia but also in many other countries. The results of the work conducted in Europe within the ProSafeBeef project indicate that it would be possible to manage a grading system in Europe similar to the MSA system. The combination of the different modelling approaches (namely muscle biochemistry and a MSA-like meat grading system adapted to the European market) is a promising area of research to improve the prediction

The effect of technology information on consumer expectations and liking of beef

DEFF Research Database (Denmark)

van Wezemael, Lynn; Ueland, Øydis; Rødbotten, Rune

2012-01-01

European consumers increasingly attach value to process characteristics of food. Although beef technologies are hardly communicated to consumers, providing consumer-oriented information about technology application might increase perceived transparency and consumer acceptance. This study...... investigates how information about beef technologies influences consumer expectations and liking of beef. Beef consumers in Belgium (n=108) and Norway (n=110) participated in an information experiment combined with sensory testing in which each consumer tasted three beef muscles treated with different...... technologies: unprocessed tenderloin M. Psoas major, muscle profiled M. Infraspinatus, and marinated (by injection) M. Semitendinosus. The findings indicate that detailed information about beef technologies can enhance consumers' expectations and liking of beef. However, this effect differs between countries...

PREFERENCES AND BUYING BEHAVIOUR OF BEEF CONSUMERS IN TUSCANY

Directory of Open Access Journals (Sweden)

Marija RADMAN

2005-07-01

Full Text Available Tuscany, probably the most famous Italian region, is known because of many typical food specialities. One of them is the “fi orentina” - a thick, fi rst quality beef, called after the name of the city of Florence. However, recent trends in consumers’ behaviour and the BSE crisis have affected the attitude of consumers toward such products. In this study are presented the results of a mail survey about beef consumption and preferences that was conducted in Tuscany in May 2002. The survey showed that, despite recent food scares and new consumption behaviour, Tuscany consumers still like and prefer beef that has guarantees of quality. Therefore, there are good market opportunities for the Italian and foreign beef producers in Tuscany if they will provide consumers with not only good quality beef, but also more information about the meat.

The Influence of Moderate Pressure and Subzero Temperature on the Shelf Life of Minced Cod, Salmon, Pork and Beef Meat

Directory of Open Access Journals (Sweden)

Ilona Kołodziejska

2013-01-01

Full Text Available The effect of moderate pressure at subzero temperature on natural microflora of minced cod, salmon, pork and beef meat was studied. Pressure of 193 MPa at –20 °C caused the reduction of total bacterial count in pork and beef meat by 1.1 and 0.6 log cycles, respectively, and by about 1.5 log cycles in fish meat. Under these conditions the psychrophilic and psychrotrophic bacteria were below the detection limit (<10 CFU/g of sample in pork and beef meat, while in cod and salmon meat they were reduced only by 1.3 and 2.0 log cycles, respectively. In all tested samples of meat treated with the pressure of 193 MPa at –20 °C, the number of coliforms was below 10 CFU/g. Under these conditions a significant reduction in the number of coagulase-positive Staphylococcus was also observed. During storage of samples at 4 °C after pressurization at 193 MPa and –20 °C, the inhibition of growth of all tested groups of bacteria was observed. Moderate pressure at subzero temperature does not ensure complete inactivation of bacteria; however, it allows the improvement of microbiological quality and extension of shelf life of food, which depends on the level of bacterial contamination of the initial raw material.

Improvement of beef cattle genetics provided increasing sustainability of beef cattle production and protein consumption in Thailand

Energy Technology Data Exchange (ETDEWEB)

Boonyanuwat, K. [Beef Cattle Research and Development Group, Division of Animal Husbandry, Department of Livestock Development, Bangkok (Thailand)], E-mail: kalayabo@yahoo.com; Sirisom, P [Tak Livestock Breeding and Research Center, Meung (Thailand); Putharatanung, A [Nongkwang Livestock Research and Breeding Center, Photharam (Thailand)

2009-07-01

The rural innovation research and development (R and D) in beef cattle genetics, biotechnology, climate science and production systems, supported profitable and sustainable beef cattle production in Thailand. Department of Livestock Development (DLD) undertakes R and D to achieve continuous improvement in genetics, production technologies to improve productivity, profitability and sustainability of beef cattle production and quality of products. Efficiencies were achieved through improvements in genetics, nutrition and grazing management, use of information, meat science, and reduction in ruminant methane production. This function was essential to maintain long-term production competitiveness and achieve sustained economic growth in rural Thailand, where the beef cattle production was the important livestock production, accounting for 36.99% of the value of livestock production in Thailand. Molecular, quantitative genetics, and biotechnology tool were being combined in the development of genetic improvement. In 2006, beef meat was imported 1,842.53 thousand tons (0.41% of all consumption, 120.84 baht/kg). For the big size cattle, such as Tak cattle, Kabinburi cattle (Thai synthetic breeds by DLD, Tak = 62.5 Charoles-Brahman, Kabinburi = 50 Simental- Brahman), and cross breed cattle, they were in fattening period for 6-12 month. Fattening group, they were raised for restaurant, hotel, super market, and steak house. Data were collected from 2 parts: 1) 354 cattle of experimental trial in DLD part, and 2) 492 fattening cattle of small holders in Tak province and Nakorn Pathom province during October 2004-September 2007. Data collecting was separated into 2 parts (performance data and reference). Data were adjusted by group location month and year to analyze for growth, carcass performance and economic performances). There were 5 breeds of fattening beef cattle: 1) Thai Native, 2) Thai Brahman, 3) Kabinburi, 4) Tak, and 5) Tajima-Native. The first group was around 41

Environmentally Optimal, Nutritionally Aware Beef Replacement Plant-Based Diets.

Science.gov (United States)

Eshel, Gidon; Shepon, Alon; Noor, Elad; Milo, Ron

2016-08-02

Livestock farming incurs large and varied environmental burdens, dominated by beef. Replacing beef with resource efficient alternatives is thus potentially beneficial, but may conflict with nutritional considerations. Here we show that protein-equivalent plant based alternatives to the beef portion of the mean American diet are readily devisible, and offer mostly improved nutritional profile considering the full lipid profile, key vitamins, minerals, and micronutrients. We then show that replacement diets require on average only 10% of land, 4% of greenhouse gas (GHG) emissions, and 6% of reactive nitrogen (Nr) compared to what the replaced beef diet requires. Applied to 320 million Americans, the beef-to-plant shift can save 91 million cropland acres (and 770 million rangeland acres), 278 million metric ton CO2e, and 3.7 million metric ton Nr annually. These nationwide savings are 27%, 4%, and 32% of the respective national environmental burdens.

SMART GROUND Project: SMART data collection and inteGRation platform to enhance availability and accessibility of data and infOrmation in the EU territory on SecoNDary Raw Materials

Science.gov (United States)

Rossetti, Piergiorgio; Antonella Dino, Giovanna; de la Feld, Marco; Pizza, Antonietta; Coulon, Frederic; Wagland, Stuart; Gomes, Diogo

2016-04-01

The issue of resource security has come to the forefront of the debate over recent years, partly due to considerable concern over the security of supply of the so called 'critical' materials, with rare earths attracting the greatest attention in the press. Their supply is fundamental to maintain and develop EU economy and its industries relied on a steady supply of Raw Materials. Thus considering the increasing scarcity and raising prices of both, energy raw materials and other raw materials, such as metals and minerals, the recycling and recovery of these materials from anthropogenic deposits such as landfills is of increasing relevance. Europe has somewhere between 150,000 and 500,000 landfill sites, with an estimated 90% of them being "non-sanitary" pre-dating the EU Landfill Directive of 1999. Thus historical background makes the numerous old waste dumps as possible sources of critical and secondary raw materials (SRM and CRM). However, to date there is no inventory available of SRM and CRM present in EU landfills, and best management practices to recover SRM from landfill activities are inefficient. In this context, the EU SMART GROUND (SG) project (Grant Agreement No 641988) intends to foster resource recovery in landfills by improving both the availability and the accessibility of data and information on SRM in the EU and creating synergies among the different stakeholders involved in the SRM value chain. To do so, the project aims to collect and integrate in a single EU databank (SMART GROUND Data Bank) all the data from existing databases and new information retrieved during project activities. Such data will be collected from the different waste streams including municipal, industrial and mining wastes across EU landfills. It will improve data gathering on SRM from different types of waste, by defining new and integrated data acquisition methods and standards. At last, but not least, the project will also improve the SRM economic and employment potential

Toxinotyping and antimicrobial susceptibility of enterotoxigenic Clostridium perfringens isolates from mutton, beef and chicken meat.

Science.gov (United States)

Khan, Madiha; Nazir, Jawad; Anjum, Aftab Ahmad; Ahmad, Mansur-Ud-Din; Nawaz, Muhammad; Shabbir, Muhammad Zubair

2015-08-01

A total of 300 meat samples comprising mutton, beef, and chicken meat (n = 100) collected from either local butcher shops or large meat outlets situated at various areas of Lahore City located in Punjab province of Pakistan were tested for the isolation of Clostridium perfringens. Prevalence of the organism was highest in the chicken (6 %) followed by mutton (5 %) and beef (1 %). Contamination level was high (10/150) in the samples collected from local butcher shops in comparison to the samples collected from large meat outlets (2/150). All of the raw meat samples were negative for the presence of alpha, beta and epsilon toxins of C. perfringens as detected through ELISA. Out of a total number of 12 isolates only half were capable of producing enterotoxins when cultured in trypticase glucose yeast (TGY) broth. Toxinotyping of the isolates showed that 3 were of type A while one each of the remaining three belonged to type B, C, and D. Antibiotic susceptibility testing of the toxin producing isolates revealed that C. perfringens were susceptible to chloramphenicol, ciprofloxacin, metronidazole, and ceftriaxone. All of the other drugs were relatively less effective with a least activity of amoxicillin against the isolates.

The effect of technology information on consumer expectations and liking of beef.

Science.gov (United States)

Van Wezemael, Lynn; Ueland, Øydis; Rødbotten, Rune; De Smet, Stefaan; Scholderer, Joachim; Verbeke, Wim

2012-02-01

European consumers increasingly attach value to process characteristics of food. Although beef technologies are hardly communicated to consumers, providing consumer-oriented information about technology application might increase perceived transparency and consumer acceptance. This study investigates how information about beef technologies influences consumer expectations and liking of beef. Beef consumers in Belgium (n = 108) and Norway (n = 110) participated in an information experiment combined with sensory testing in which each consumer tasted three beef muscles treated with different technologies: unprocessed tenderloin M. Psoas major, muscle profiled M. Infraspinatus, and marinated (by injection) M. Semitendinosus. The findings indicate that detailed information about beef technologies can enhance consumers' expectations and liking of beef. However, this effect differs between countries and beef technologies. Information becomes either less relevant when the product is actually tasted, as indicated by the findings in Norway, or more relevant when information is confirmed by own experience during tasting, as indicated by the findings in Belgium. Copyright © 2011 Elsevier Ltd. All rights reserved.

Evaluation of 3M molecular detection assay (MDA) Salmonella for the detection of Salmonella in selected foods: collaborative study.

Science.gov (United States)

Bird, Patrick; Fisher, Kiel; Boyle, Megan; Huffman, Travis; Benzinger, M Joseph; Bedinghaus, Paige; Flannery, Jonathan; Crowley, Erin; Agin, James; Goins, David; Benesh, DeAnn; David, John

2013-01-01

The 3M Molecular Detection Assay (MDA) Salmonella is used with the 3M Molecular Detection System for the detection of Salmonella spp. in food, food-related, and environmental samples after enrichment. The assay utilizes loop-mediated isothermal amplification to rapidly amplify Salmonella target DNA with high specificity and sensitivity, combined with bioluminescence to detect the amplification. The 3M MDA Salmonella method was compared using an unpaired study design in a multilaboratory collaborative study to the U.S. Department of Agriculture/Food Safety and Inspection Service-Microbiology Laboratory Guidebook (USDA/FSIS-MLG 4.05), Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg and Catfish Products for raw ground beef and the U.S. Food and Drug Administration/Bacteriological Analytical Manual (FDA/BAM) Chapter 5 Salmonella reference method for wet dog food following the current AOAC guidelines. A total of 20 laboratories participated. For the 3M MDA Salmonella method, raw ground beef was analyzed using 25 g test portions, and wet dog food was analyzed using 375 g test portions. For the reference methods, 25 g test portions of each matrix were analyzed. Each matrix was artificially contaminated with Salmonella at three inoculation levels: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). In this study, 1512 unpaired replicate samples were analyzed. Statistical analysis was conducted according to the probability of detection (POD). For the low-level raw ground beef test portions, the following dLPOD (difference between the POD of the reference and candidate method) values with 95% confidence intervals were obtained: -0.01 (-0.14, +0.12). For the low-level wet dog food test portions, the following dLPOD with 95% confidence intervals were obtained: -0.04 (-0.16, +0.09). No significant differences were observed in the number of positive

Whole or ground millet grain provided in two supplementation frequencies for grazing beef cattle: nutritional parameters

Directory of Open Access Journals (Sweden)

João Marcos Beltrame Benatti

2014-05-01

Full Text Available The objective of this study was to evaluate the processing of millet grain provided at two supplementation frequencies for grazing beef cattle during the dry season on nutritional parameters. Five rumen-cannulated crossbred steers, with 24 to 26 months of age and average body weight of 428.6±26.06 kg, were assigned to a Latin square design (5 × 5 in a 2 × 2 + 1 factorial arrangement, as follows: two forms of millet grain (whole grains - or ground; WG - GG, two strategies of concentrate supplementation (daily distribution - 7X; or three times a week - 3X and a control treatment (mineral mixture - MM. Animals were kept in five paddocks of 0.24 ha each with Marandu grass pastures. Concentrate supplements were supplied at 2.00 and 4.66 kg/animal/day for treatments 7X and 3X, respectively. The concentrate supplementation enhanced the intake of total dry matter (DM and organic matter (OM and nutrients compared with mineral supplementation. No differences were found between dry matter intake and forage organic matter intake. The values of digestibility coefficients of DM, OM, ether extract, total carbohydrates and non-fiber carbohydrates were increased by concentrate supplementation. Regarding concentrations of rumen ammonia nitrogen, the interactions among time × treatment × day and day × treatment had effects on the measurements of ruminal pH. Plasma urea nitrogen, urinary urea excretion and urinary urea N excretion differed only between MM treatment and the others, with no interference of grain physical form and supplementation frequency on those variables. The millet grain processing does not alter forage intake, but improves digestibility. Daily supplementation increases digestibility of dry matter and neutral detergent fiber.

Feeding value of field pea as a protein source in forage-based diets fed to beef cattle.

Science.gov (United States)

Soto-Navarro, S A; Encinias, A M; Bauer, M L; Lardy, G P; Caton, J S

2012-02-01

Three studies were conducted to evaluate the feasibility of field peas as a protein source in diets for beef cattle. In the first study, 4 cultivars of field pea were incubated in situ to determine rate and extent of CP disappearance. Results indicate that field pea cultivars vary in CP content (22.6, 26.1, 22.6, and 19.4%, DM basis for Profi, Arvika, Carneval, and Trapper, respectively). Soluble protein fraction ranged from 34.9% for Trapper to 54.9% for Profi. Degradable CP fraction was greater (P = 0.01) for Trapper compared with the other cultivars, and no differences (P ≥ 0.25) were observed among Profi, Arvika, and Carneval. Rate of CP degradation differed (P ≤ 0.03) for all cultivars, with Profi being the greatest and Trapper the smallest (10.8, 10.0, 8.1, and 6.3 ± 1.4%/h for Profi, Carneval, Arvika, and Trapper, respectively). Estimated RDP was not different (P = 0.21) for all 4 cultivars. In the second study, 30 crossbred beef steers (301 ± 15 kg) were individually fed and used to evaluate effects of field pea processing (whole, rolled, or ground) on steer performance. Diets contained 40% field pea grain. Growing steers consuming whole field pea had greater ADG (P = 0.08) than those consuming processed field pea (1.69, 1.52, and 1.63 ± 0.05 kg/d, for whole, rolled, and ground, respectively). However, DMI (kg/d and as % of BW) and G:F were not different (P ≥ 0.24). In the third study, 35 individually fed gestating beef cows (694 ± 17 kg) were used to evaluate the use of field pea as a protein supplement for medium quality grass hay (9.3% CP). Treatments consisted of whole field peas at 1) 0 g (CON), 2) 680 g (FP680), 3) 1,360 g (FP1360), and 4) 2,040 g (FP2040), and 5) 1,360 g of 74% barley and 26% canola meal (BCM). Total intake (forage + supplement) of gestating beef cows increased with increasing field pea level (linear, P = 0.01; supplemented vs. nonsupplemented, P = 0.01). In summary, protein quantity and rate of ruminal protein degradation

Consumer perceptions of beef healthiness: results from a qualitative study in four European countries.

Science.gov (United States)

Van Wezemael, Lynn; Verbeke, Wim; de Barcellos, Marcia D; Scholderer, Joachim; Perez-Cueto, Federico

2010-06-15

Consumer perception of the healthiness of beef is an important determinant of beef consumption. However, little is known about how consumers perceive the healthiness of beef. The aim of this study is to shed light on the associations between beef and health. Eight focus group discussions were conducted in four European countries (France, UK, Germany, Spain), each consisting of seven to nine participants. A content analysis was performed on the transcripts of these discussions. Although beef was generally perceived as healthful, focus group participants expected positive as well as negative effects of beef consumption on their health. Labelled, branded, fresh and lean beef were perceived as signalling healthful beef, in contrast with further processed and packaged beef. Consumers felt that their individual choices could make a difference with respect to the healthiness of beef consumed. Focus group participants were not in favour of improving beef healthiness during processing, but rather focussed on appropriate consumption behaviour and preparation methods. The individual responsibility for health implies that consumers should be able to make correct judgements about how healthful their food is. However, the results of this study indicate that an accurate assessment of beef healthiness is not always straightforward. The presented results on consumer perceptions of beef healthiness provide insights into consumer decision making processes, which are important for the innovation and product differentiation in the European beef sector, as well as for public health policy decisions related to meat consumption in general and beef consumption in particular.

Mukhabarah as Sharia Financing Model in Beef Cattle Farm Entrepise

Science.gov (United States)

Asnawi, A.; Amrawaty, A. A.; Nirwana

2018-02-01

Financing constraints on beef cattle farm nowadays have received attention by the government through distributed various assistance programs and program loans through implementing banks. The existing financing schemes are all still conventional yet sharia-based. The purpose of this research is to formulate financing pattern for sharia beef cattle farm. A qualitative and descriptive approach is used to formulate the pattern by considering the profit-sharing practices of the beef cattle farmers. The results of this study have formulated a financing pattern that integrates government, implementing banks, beef cattle farmers group and cooperative as well as breeders as its members. This pattern of financing is very accommodating of local culture that develops in rural communities. It is expected to be an input, especially in formulating a business financing policy Sharia-based beef cattle breeding.

Use of high irradiation doses for preservation of canned beef

International Nuclear Information System (INIS)

Hammad, A.A.I; Salem, F.A.; El-Sahy, K.M.; Rady, A.; Badr, H.H.

1997-01-01

The effect of high irradiation doses (11.25,22.5 and 45 KGy) on the bacteriology, organoleptic quality and shelf - life extension of beef meat that are hermetically sealed in metal cans was investigated in comparison with commercial heat sterilization. The unirradiated cans of pre cooked (enzyme inactivated) unirradiated beef were swollen after only one month of storage at ambient temperature (20-30 degree). Application of 11.25 and 22.5 kGy to vacuum packed and enzyme inactivated beef was not enough for sterilization and only delayed swelling of beef cans. Application of 45 KGy irradiation dose prevented swelling of beef vans up to 12 months at ambient temperature and provided meat product, similar to the commercial heat sterilized one, organoleptically acceptable and microbiologically safe. Running title: Radiation sterilization of meat

Irradiation of refrigerated corned beef for shelf-life extension

International Nuclear Information System (INIS)

Sallam, Y.I.; El-Magoli, S.B.M.; Mohamed, H.H.; El-Mongy, T.M.

2000-01-01

The development of the microflora of unirradiated and irradiated cowed beef was followed during storage at 5 degree. The total aerobic counts in unirradiated corned beef samples reached x 10 7 cfu/g after 10 days and after 15, 20 , 25 and 30 days of cold storage in irradiated samples at 2, 4, 6, 8 kGy, respectively, accompanied with obvious organoleptic evidence of microbial. Radiation doses up to 8 kGy and cold storage (5 degree) of cowed beef had no effect on the major constituents (moisture, protein and lipids) of these products. During storage, total volatile bases nitrogen (TVBN) and thiobarbituric acid (TBA) values tended to increase; the Ph of corned beef fall down to ca. 5. 7. Increasing the radiation dose level to 6 and 8 kGy, to increase the product shelf-life, affects generally the physical properties of the corned beef samples, and therefore, it could be concluded that the radiation dose level should be chosen to inhibit public health concern bacteria and reduce spoilage organisms, and at the same time preserve the natural properties of the food. At the present study a dose level of 4 kGy was found to be quite enough to reach such requirements for corned beef samples

Inactivation of the Radiation-Resistant Spoilage Bacterium Micrococcus radiodurans

Science.gov (United States)

Duggan, D. E.; Anderson, A. W.; Elliker, P. R.

1963-01-01

A simplified technique permitting the pipetting of raw puréed meats for quantitative bacteriological study is described for use in determining survival of these non-sporing bacteria, which are exceptionally resistant to radiation. Survival curves, using gamma radiation as the sterilizing agent, were determined in raw beef with four strains of Micrococcus radiodurans. Survival curves of the R1 strain in other meat substrates showed that survival was significantly greater in raw beef and raw chicken than in raw fish or in cooked beef. Resistance was lowest in the buffer. Cells grown in broth (an artificial growth medium) and resuspended in beef did not differ in resistance from cells that had been grown and irradiated in beef. Survival rate was statistically independent of the initial cell concentration, even though there appeared to be a correlation between lower death rate and lower initial cell concentrations. The initial viable count of this culture of the domesticated R1 strain in beef was reduced by a factor of about 10-5 by 3.0 megarad, and 4.0 megarad reduced the initial count by a factor of more than 10-9. Data suggest that M. radiodurans R1 is more resistant to radiation than spore-forming spoilage bacteria for which inactivation rates have been published. PMID:14063780

People on the Farm: Raising Beef Cattle.

Science.gov (United States)

Crain, Robert L.

This booklet provides information on raising beef cattle through profiles of two families, the Ritschards of Colorado and the Schuttes of Missouri. Through descriptions of daily life for these families, the booklet discusses the way of life on modern beef cattle farms and the problems and decisions faced by farmers. The booklet explains how…

Current situation and future prospects for beef production in Europe.

Science.gov (United States)

Hocquette, Jean-Francois; Ellies-Oury, Marie-Pierre; Lherm, Michel; Pineau, Christele; Deblitz, Claus; Farmer, Linda

2018-05-24

The European Union (EU) is the world's third largest producer of beef. This contributes to the economy, rural development, social life, culture and gastronomy of Europe. The diversity of breeds, animal types (cows, bulls, steers, heifers) and farming systems (intensive, extensive on permanent or temporary pastures, mixed, breeders, feeders, etc) is a strength, and a weakness as the industry is often fragmented and poorly connected. There are also societal concerns regarding animal welfare and environmental issues, despite some positive environmental impacts of farming systems. The EU is amongst the most efficient for beef production as demonstrated by a relative low production of greenhouse gases. Due to regional differences in terms of climate, pasture availability, livestock practices and farms characteristics, productivity and incomes of beef producers vary widely across regions, being among the lowest of the agricultural systems. The beef industry is facing unprecedented challenges related to animal welfare, environmental impact, origin, authenticity, nutritional benefits and eating quality of beef. These may affect the whole industry, especially its farmers. It is therefore essential to bring the beef industry together to spread best practice and better exploit research in order to maintain and develop an economically viable and sustainable beef industry. Meeting consumers' expectations may be achieved by a better prediction of beef palatability using a modelling approach, such as in Australia. There is a need for accurate information and dissemination on the benefits and issues of beef for human health and for environmental impact. A better objective description of goods and services derived from livestock farming is also required. Putting into practice "agroecology" and organic farming principles are other potential avenues for the future. Different future scenarios can be written depending on the major driving forces, notably meat consumption, climate

Reproduction performance of beef cattle mated naturally following ...

African Journals Online (AJOL)

mgrobler

2014-08-24

Aug 24, 2014 ... The estimated calving percentage of beef cattle is 62% in the commercial sector of South ... Cows that calve early also have a better chance of conceiving in the next ..... reproductive tract scoring in beef heifers in South Africa.

78 FR 53017 - Changes to the Salmonella Verification Sampling Program: Analysis of Raw Beef for Shiga Toxin...

Science.gov (United States)

2013-08-28

... evaluated the FSIS Salmonella detection method (FSIS Microbiology Laboratory Guidebook Chapter 4.06) using... prevalence estimates, FSIS defines prevalence as the proportion of applicable product that would test... that is intended for use as raw, non-intact product tests positive for STEC, the product is adulterated...

Mexican consumers at the point of meat purchase. Beef choice.

Science.gov (United States)

Ngapo, T M; Braña Varela, D; Rubio Lozano, M S

2017-12-01

Within-consumer preference replication achieved through systematic image manipulation was used in consumer surveys in four cities across Mexico (Mexico City, n=195; Guadalajara, n=100; Hermosillo, n=132; Veracruz, n=61) to study beef preferences. Images of beef steaks controlled for lean and fat colour, fat cover and marbling were presented to consumers to determine the characteristics used in beef choice and the levels of preference of these characteristics. The most important choice criteria were fat cover (62% preferring little fat cover) and marbling (59% preferring non-marbled). Lean colour was also important with 24% and 29% choosing light and dark red beef, respectively. Fat colour was the least important of the four attributes studied (18% and 19% choosing white and yellow, respectively), but was nevertheless important given that 43% of consumers used three or four characteristics to make their choice. Imported and domestic beef in the Mexican marketplace appear to respond to the range of consumers' beef preferences at the point of purchase. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Interlaboratory evaluation of the AOAC method and the A-1 procedure for recovery of fecal coliforms from foods.

Science.gov (United States)

Andrews, W H; Wilson, C R; Poelma, P L; Bullock, L K; McClure, F D; Gentile, D E

1981-09-01

An interlaboratory evaluation was made of the 96 h AOAC method and the 24 h A-1 procedure for the enumeration of fecal coliforms in samples of yellow corn meal, rye flour, mung beans, raw ground beef, and raw oyster homogenate. Results indicated that the efficiency of the A-1 procedure, measured in terms of recovery of fecal coliforms, and the reproducibility of that recovery were dependent on the particular food being analyzed. Accordingly, until its efficiency can be more fully demonstrated, the A-1 procedure is recommended only as a screening procedure for fecal coliforms in foods.

Mitigating greenhouse gas emissions from beef cattle housing

Science.gov (United States)

Beef cattle are potential sources of greenhouse gases (GHG). These emissions include methane produced by fermentation within the gut (enteric), and methane and nitrous oxide emissions from manure. Life Cycle Analysis of North American (NA) beef cattle production systems consistently indicate that...

Relationship between colorimetric (instrumental) evaluation and consumer-defined beef colour acceptability.

Science.gov (United States)

Holman, Benjamin W B; Mao, Yanwei; Coombs, Cassius E O; van de Ven, Remy J; Hopkins, David L

2016-11-01

The relationship between instrumental colorimetric values (L*, a*, b*, the ratio of reflectance at 630nm and 580nm) and consumer perception of acceptable beef colour was evaluated using a web-based survey and standardised photographs of beef m. longissimus lumborum with known colorimetrics. Only L* and b* were found to relate to average consumer opinions of beef colour acceptability. Respondent nationality was also identified as a source of variation in beef colour acceptability score. Although this is a preliminary study with the findings necessitating additional investigation, these results suggest L* and b* as candidates for developing instrumental thresholds for consumer beef colour expectations. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

Characteristics and Health Benefit of Highly Marbled Wagyu and Hanwoo Beef

Science.gov (United States)

Gotoh, Takafumi

2016-01-01

This review addresses the characteristics and health benefit of highly marbled Wagyu and Hanwoo beef. Marbling of Wagyu and Hanwoo beef has been increased in Japan and Korea to meet domestic consumer preferences. Wagyu and Hanwoo cattle have high potential of accumulating intramuscular fat (IMF) and producing highly marbled beef. The IMF content varies depending on the feeding of time, finishing diet, and breed type. IMF increases when feeding time is increased. The rate of IMF increase in grain-fed cattle is faster than that in pasture-fed cattle. Fatty acid composition are also different depending on breeds. Highly marbled Wagyu and Hanwoo beef have higher proportions of monounsaturated fatty acid (MUFA) due to higher concentrations of oleic acid. MUFAs have little effect on total cholesterol. They are heart-healthy dietary fat because they can lower low-density lipoprotein (LDL)-cholesterol while increasing high-density lipoprotein (HDL)-cholesterol. Clinical trials have indicated that highly marbled beef does not increase LDL-cholesterol. This review also emphasizes that high oleic acid beef such as Wagyu and Hanwoo beef might be able to reduce risk factors for cardiovascular disease. PMID:28115881

Effects of replacing beef fat with pre-emulsified pumpkin seed oil on some quality characteristics of model system chicken meat emulsions

Science.gov (United States)

Serdaroğlu, M.; Nacak, B.; Karabıyıkoğlu, M.; Tepe, M.; Baykara, I.; Kökmen, Y.

2017-09-01

In this study, the effects of adding pumpkin seed oil (PSO) in water emulsion to model system chicken meat emulsions (MSME) on product quality and oxidative stability were investigated. MSME were produced by replacing 25% (P25) and 50% (P50) of beef fat with PSO-in-water emulsion (PSO/W) while control treatment was prepared with only beef fat. Addition of PSO/W to the formulation resulted in significant differences in chemical composition and pH values of both raw and cooked MSME treatments. The use of PSO/W produced significant improvements to emulsion stability, oxidative stability and cooking yield of MSME. It was determined that the use of PSO/W formulation results in decreased total expressible fluid values and increased cooking yields of the emulsions. It was observed that the highest cooking yield and the lowest total expressible fluid were found in the sample containing 50% PSO/W. It should be a feasible strategy to produce fat-reduced meat products with healthier lipid profiles by using PSO/W.

77 FR 52597 - Beef Promotion and Research; Amendment to the Order

Science.gov (United States)

2012-08-30

... experience, skills and information related to the marketing of beef and beef products, as is intended under... DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 1260 [Doc. No. AMS-LS-11-0086] Beef Promotion and Research; Amendment to the Order AGENCY: Agricultural Marketing Service, USDA...

Application of Technology on Improving Beef Cattle Productivity in East Nusa Tenggara

Directory of Open Access Journals (Sweden)

Wirdahayati R B

2010-03-01

Full Text Available The Province of East Nusa Tenggara (NTT had been one of the major beef cattle suppliers under traditional management system in Indonesia. The beef cattle farming that based on grazing native pasture and the introduction of shrub legumes (Leucaena leucocephala may contribute to around 15 – 50% of the farmers’ household income. In the last few years, supply of beef cattle tended to decline due to the decrease in cattle population in NTT. Some basic improvements in management and feeding toward increasing beef cattle productivities had been carried out in Nusa Tenggara, such as a baseline survey on Cattle Health and Productivity Survey (CHAPS conducted in 1990 – 1992. The objective of the program was to identify the existing beef cattle productivity and health condition throughout Nusa Tenggara. A collaborative research with the Ministry of Research and Technology (Integrated Prime Research had also been carried out and the result showed that early weaning in Bali calves that can be practised as early as 3 – 6 months to prevent calves losses during the dry season. A program of the Assessment on Beef Cattle Base Farming Activities had also been conducted to improve fattening and breeding practices through the improvement in beef cattle management and feeding systems. At the latest development, fattening scheme has been introduced under a partnership approach involving private sectors and cooperatives. This needs to be facilitated by the government to accelerate the program such as access to capital and intensive extension services to build farmers awareness toward profit oriented beef cattle farming. Optimalization of the available potential resources and technology in NTT, will be an opportunity to enhance beef cattle production and gains back the reputation as one of the major producing beef cattle in the past. This will also support the national livestock program nowadays, called Beef Cattle Self Sufficiency Program 2014.

Incidence of Shiga toxin-producing Escherichia coli strains in beef, pork, chicken, deer, boar, bison, and rabbit retail meat.

Science.gov (United States)

Magwedere, Kudakwashe; Dang, Huu Anh; Mills, Edward W; Cutter, Catherine N; Roberts, Elisabeth L; DeBroy, Chitrita

2013-03-01

The objective of the current study was to determine the incidence of contamination by the top 7 Shiga toxin-producing Escherichia coli (STEC) O-groups, responsible for the majority of E. coli infections in human beings, in retail meat from different animal species. Samples from ground beef (n = 51), ground pork (n = 16), ground chicken (n = 16), and game meat (deer, wild boar, bison, and rabbit; n = 55) were collected from retail vendors for the detection of 7 STEC O-groups (O26, O45, O103, O111, O121, O145, and O157). Meat samples were tested by using a multiplex polymerase chain reaction assay targeting the wzx gene of O antigen gene clusters of the 7 STEC O-groups. The positive samples were further tested for Shiga toxin genes (stx1 and stx2). Out of a total of 83 ground beef, pork, and chicken samples, 17 (20%) carried O121, 9 (10%) carried O45, 8 (9%) carried O157, 3 (3%) carried O103, and 1 (1%) carried O145. None of the samples were positive for O26, O111, or the stx gene. All 3 white-tailed deer samples (100%) were positive for O45, O103, or both, 2 (10%) out of 20 red deer samples exhibited the presence of O103, and all 3 bison samples were contaminated with either O121, O145, or O157. One sample from ground deer, contaminated with E. coli O45, carried the stx1 gene. This preliminary investigation illustrates the importance of microbiological testing of pathogens in meat products, as well as the recognized need for increased surveillance and research on foodborne pathogens.

Antimicrobial usage and resistance in beef production

OpenAIRE

Cameron, Andrew; McAllister, Tim A.

2016-01-01

Antimicrobials are critical to contemporary high-intensity beef production. Many different antimicrobials are approved for beef cattle, and are used judiciously for animal welfare, and controversially, to promote growth and feed efficiency. Antimicrobial administration provides a powerful selective pressure that acts on the microbial community, selecting for resistance gene determinants and antimicrobial-resistant bacteria resident in the bovine flora. The bovine microbiota includes many harm...

The Food Safety of Livestock Products (Meatball, Corned Beef, Beef Burger and Sausage Studied from Heavy Metal Residues Contamination

Directory of Open Access Journals (Sweden)

E Harlia

2010-01-01

Full Text Available The aims of animal husbandry improvements are to increase both the quality and the quantity of livestock production and to ensure the safety of the product. It is necessarry for consumers to pay attention to the food safety of livestock product because it is related to human's health. The research was conducted to determine the food safety of livestock product condition by detecting heavy metal residues on several food products from livestock like meatball, corned beef, burger’s beef, and sausages. This research was explored by using survey's method and purposive technique sampling, then the resulted data were descriptively analyzed. The observed variables were heavy metal contents such as Plumbum (Pb and Cadmium (Cd in which being measured by using AAS (Atomic Absorption Spectrophotometri . The result showed that in general, heavy metal residue of Pb from several livestock products (meatball, corned beef, beef burger, and sausages were smaller than Maximum Residue Limit (MRL, while the Cd’s residue was partly over the MRL concentration, therefore further action has to be taken as it affects the human's health. (Animal Production 12(1: 50-54 (2010 Key words : food safety, MRL, heavy metal Pb, Cd.

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia.

Science.gov (United States)

Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

2013-12-01

A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

Nutrients Composition in Fit Snacks Made from Ostrich, Beef and Chicken Dried Meat.

Science.gov (United States)

Zdanowska-Sąsiadek, Żaneta; Marchewka, Joanna; Horbańczuk, Jarosław Olav; Wierzbicka, Agnieszka; Lipińska, Paulina; Jóźwik, Artur; Atanasov, Atanas G; Huminiecki, Łukasz; Sieroń, Aleksander; Sieroń, Karolina; Strzałkowska, Nina; Stelmasiak, Adrian; De Smet, Stefaan; Van Hecke, Thomas; Hoffman, Louwrens C

2018-05-25

The aim of the study was to compare three types of meat snacks made from ostrich, beef, and chicken meat in relation to their nutrients content including fat, fatty acids, heme iron, and peptides, like anserine and carnosine, from which human health may potentially benefit. Dry meat samples were produced, from one type of muscle, obtained from ostrich ( m. ambiens ), beef ( m. semimembranosus ), and broiler chicken meat ( m. pectoralis major ). The composition of dried ostrich, beef, and chicken meat, with and without spices was compared. We show that meat snacks made from ostrich, beef, and chicken meat were characterized by high concentration of nutrients including proteins, minerals (heme iron especially in ostrich, than in beef), biologically active peptides (carnosine-in beef, anserine-in ostrich then in chicken meat). The, beneficial to human health, n -3 fatty acids levels differed significantly between species. Moreover, ostrich jerky contained four times less fat as compared to beef and half of that in chicken. In conclusion we can say that dried ostrich, beef, and chicken meat could be a good source of nutritional components.

Nutrients Composition in Fit Snacks Made from Ostrich, Beef and Chicken Dried Meat

Directory of Open Access Journals (Sweden)

Żaneta Zdanowska-Sąsiadek

2018-05-01

Full Text Available The aim of the study was to compare three types of meat snacks made from ostrich, beef, and chicken meat in relation to their nutrients content including fat, fatty acids, heme iron, and peptides, like anserine and carnosine, from which human health may potentially benefit. Dry meat samples were produced, from one type of muscle, obtained from ostrich (m. ambiens, beef (m. semimembranosus, and broiler chicken meat (m. pectoralis major. The composition of dried ostrich, beef, and chicken meat, with and without spices was compared. We show that meat snacks made from ostrich, beef, and chicken meat were characterized by high concentration of nutrients including proteins, minerals (heme iron especially in ostrich, than in beef, biologically active peptides (carnosine—in beef, anserine—in ostrich then in chicken meat. The, beneficial to human health, n-3 fatty acids levels differed significantly between species. Moreover, ostrich jerky contained four times less fat as compared to beef and half of that in chicken. In conclusion we can say that dried ostrich, beef, and chicken meat could be a good source of nutritional components.

Alpharma Beef Cattle Nutrition Symposium: implications of nutritional management for beef cow-calf systems.

Science.gov (United States)

Funston, R N; Summers, A F; Roberts, A J

2012-07-01

The beef cattle industry relies on the use of high-forage diets to develop replacement females, maintain the cow herd, and sustain stocker operations Forage quantity and quality fluctuate with season and environmental conditions Depending on class and physiological state of the animal, a forage diet may not always meet nutritional requirements, resulting in reduced ADG or BW loss if supplemental nutrients are not provided It is important to understand the consequences of such BW loss and the economics of providing supplementation to the beef production system Periods of limited or insufficient nutrient availability can be followed by periods of compensatory BW gain once dietary conditions improve This may have less impact on breeding animals, provided reproductive efficiency is not compromised, where actual BW is not as important as it is in animals destined for the feedlot A rapidly evolving body of literature is also demonstrating that nutritional status of cows during pregnancy can affect subsequent offspring development and production characteristics later in life The concept of fetal programming is that maternal stimuli during critical periods of fetal development have long-term implications for offspring Depending on timing, magnitude, and duration of nutrient limitation or supplementation, it is possible that early measures in life, such as calf birth BW, may be unaffected, whereas measures later in life, such as weaning BW, carcass characteristics, and reproductive traits, may be influenced This body of research provides compelling evidence of a fetal programming response to maternal nutrition in beef cattle Future competitiveness of the US beef industry will continue to be dependent on the use of high-forage diets to meet the majority of nutrient requirements Consequences of nutrient restriction or supplementation must be considered not only on individual animal performance but also the developing fetus and its subsequent performance throughout life.

Contamination of beef products with staphylococcal classical enterotoxins in Egypt and Saudi Arabia

Directory of Open Access Journals (Sweden)

Shawish, Reyad R.

2016-04-01

Full Text Available Food-borne pathogens are of high concern for public health and food safety. food poisoning is one of the most economically devastating types of food poisoning globally. The purpose of this study was to detect staphylococcal classical enterotoxins (SEs in processed beef from Kingdom of Saudi Arabia (KSA and Egypt. In the present investigation a total of 250 random processed meat samples (50 each of minced meat, beef burger, beef sausage, beef kofta and beef luncheon were collected from different super markets in the study area. Using conventional cultural methods, samples were cultured for isolation and identification of . Multiplex PCR was used to detect SEs of the classical type SEA, SEB, SEC and SED from isolates.The percentage presence of in minced meat, beef burger, beef sausage, beef kofta and beef luncheon was 38%, 22%, 30%, 32% and 12%, respectively. Multiplex PCR indicated that all examined samples contain different types of classical staphylococcal enterotoxins and only minced meat samples contained all four types of toxins. Multiplex PCR is efficient in detection of SEs from food and may be used in tracing of toxins to promote food hygiene. Implications of contamination of processed meat to food hygiene in the study area are highlighted.

Identification of Social Capital on Beef Cattle Farmers Group

Science.gov (United States)

Lestari, V. S.; Sirajuddin, S. N.; Abdullah, A.

2018-02-01

Social capital plays an important role in the development of beef cattle farms in South Sulawesi. The aim of this research was to know the social capital of beef cattle farmers in South Sulawesi. Population of this research was 31 beef cattle farmers. Variable of social capital was mutual trust, norms and linkage. The data were collected from observation and depth interview by using questionnaire. There were 10 questions which were adopted from Australian Center for International Agriculture Research. The answer was scored by using Likert scale ranging from 1 refer to strongly disagree; 2 refer to disagree; 3 refer to not sure; 4 refer to agree and 5 refer to strongly agree. The data were analyzed descriptively by using frequency distribution. The research revealed that the social capital of beef cattle farmers was categorized as “high”.

Color, sensory and textural attributes of beef frankfurter, beef ham and meat-free sausage containing tomato pomace.

Science.gov (United States)

Savadkoohi, Sobhan; Hoogenkamp, Henk; Shamsi, Kambiz; Farahnaky, Asgar

2014-08-01

The present investigation focuses on the textural properties, sensory attributes and color changes of beef frankfurter, beef ham and meat-free sausage produced by different levels of bleached tomato pomace. The texture and color profile were performed using an instrumental texture analyzer and colorimeter. The findings indicated that tomato pomace-added sausages had higher water holding capacity (WHC) compared to that of commercial samples. The frankfurters containing 5 and 7% (w/w) tomato pomace had the highest redness (a*), chroma (C*) and color differences (ΔE) values, while the meat-free sausages containing 7% (w/w) tomato pomace had significant (p0.05) color differences between beef ham samples (with and without tomato pomace). A significant progression in the textural hardness and chewiness of systems containing tomato pomace was observed as well as higher sensory scores by panelists. According to sensorial evaluations, bleached tomato pomace improved the consumer acceptability and preference. Copyright © 2014 Elsevier Ltd. All rights reserved.

Relationships between sensory evaluations of beef tenderness, shear force measurements and consumer characteristics.

Science.gov (United States)

Van Wezemael, Lynn; De Smet, Stefaan; Ueland, Øydis; Verbeke, Wim

2014-07-01

The supply of tender beef is an important challenge for the beef industry. Knowledge about the profile of consumers who are more optimistic or more accurate in their tenderness evaluations is important for product development and beef marketing purposes. Central location tests of beef steaks were performed in Norway and Belgium (n=218). Instrumental and sensorial tenderness of three muscles from Belgian Blue and Norwegian Red cattle was reported. Consumers who are optimistically evaluating tenderness were found to be more often male, less food neophobic, more positive towards beef healthiness, and showed fewer concerns about beef safety. No clear profile emerged for consumers who assessed tenderness similar to shear force measurements, which suggests that tenderness is mainly evaluated subjectively. The results imply a window of opportunities in tenderness improvements, and allow targeting a market segment which is less critical towards beef tenderness. © 2013 Elsevier Ltd. All rights reserved.

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

Science.gov (United States)

Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

2013-01-01

A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

Directory of Open Access Journals (Sweden)

Chee Hao Kuan

2013-12-01

Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

The GENOTEND chip: a new tool to analyse gene expression in muscles of beef cattle for beef quality prediction

Directory of Open Access Journals (Sweden)

Hocquette Jean-Francois

2012-08-01

Full Text Available Abstract Background Previous research programmes have described muscle biochemical traits and gene expression levels associated with beef tenderness. One of our results concerning the DNAJA1 gene (an Hsp40 was patented. This study aims to confirm the relationships previously identified between two gene families (heat shock proteins and energy metabolism and beef quality. Results We developed an Agilent chip with specific probes for bovine muscular genes. More than 3000 genes involved in muscle biology or meat quality were selected from genetic, proteomic or transcriptomic studies, or from scientific publications. As far as possible, several probes were used for each gene (e.g. 17 probes for DNAJA1. RNA from Longissimus thoracis muscle samples was hybridised on the chips. Muscles samples were from four groups of Charolais cattle: two groups of young bulls and two groups of steers slaughtered in two different years. Principal component analysis, simple correlation of gene expression levels with tenderness scores, and then multiple regression analysis provided the means to detect the genes within two families (heat shock proteins and energy metabolism which were the most associated with beef tenderness. For the 25 Charolais young bulls slaughtered in year 1, expression levels of DNAJA1 and other genes of the HSP family were related to the initial or overall beef tenderness. Similarly, expression levels of genes involved in fat or energy metabolism were related with the initial or overall beef tenderness but in the year 1 and year 2 groups of young bulls only. Generally, the genes individually correlated with tenderness are not consistent across genders and years indicating the strong influence of rearing conditions on muscle characteristics related to beef quality. However, a group of HSP genes, which explained about 40% of the variability in tenderness in the group of 25 young bulls slaughtered in year 1 (considered as the reference group, was

The GENOTEND chip: a new tool to analyse gene expression in muscles of beef cattle for beef quality prediction.

Science.gov (United States)

Hocquette, Jean-Francois; Bernard-Capel, Carine; Vidal, Veronique; Jesson, Beline; Levéziel, Hubert; Renand, Gilles; Cassar-Malek, Isabelle

2012-08-15

Previous research programmes have described muscle biochemical traits and gene expression levels associated with beef tenderness. One of our results concerning the DNAJA1 gene (an Hsp40) was patented. This study aims to confirm the relationships previously identified between two gene families (heat shock proteins and energy metabolism) and beef quality. We developed an Agilent chip with specific probes for bovine muscular genes. More than 3000 genes involved in muscle biology or meat quality were selected from genetic, proteomic or transcriptomic studies, or from scientific publications. As far as possible, several probes were used for each gene (e.g. 17 probes for DNAJA1). RNA from Longissimus thoracis muscle samples was hybridised on the chips. Muscles samples were from four groups of Charolais cattle: two groups of young bulls and two groups of steers slaughtered in two different years. Principal component analysis, simple correlation of gene expression levels with tenderness scores, and then multiple regression analysis provided the means to detect the genes within two families (heat shock proteins and energy metabolism) which were the most associated with beef tenderness. For the 25 Charolais young bulls slaughtered in year 1, expression levels of DNAJA1 and other genes of the HSP family were related to the initial or overall beef tenderness. Similarly, expression levels of genes involved in fat or energy metabolism were related with the initial or overall beef tenderness but in the year 1 and year 2 groups of young bulls only. Generally, the genes individually correlated with tenderness are not consistent across genders and years indicating the strong influence of rearing conditions on muscle characteristics related to beef quality. However, a group of HSP genes, which explained about 40% of the variability in tenderness in the group of 25 young bulls slaughtered in year 1 (considered as the reference group), was validated in the groups of 30 Charolais young

Using instrumental (CIE and reflectance) measures to predict consumers' acceptance of beef colour.

Science.gov (United States)

Holman, Benjamin W B; van de Ven, Remy J; Mao, Yanwei; Coombs, Cassius E O; Hopkins, David L

2017-05-01

We aimed to establish colorimetric thresholds based upon the capacity for instrumental measures to predict consumer satisfaction with beef colour. A web-based survey was used to distribute standardised photographs of beef M. longissimus lumborum with known colorimetrics (L*, a*, b*, hue, chroma, ratio of reflectance at 630nm and 580nm, and estimated deoxymyoglobin, oxymyoglobin and metmyoglobin concentrations) for scrutiny. Consumer demographics and perceived importance of colour to beef value were also evaluated. It was found that a* provided the most simple and robust prediction of beef colour acceptability. Beef colour was considered acceptable (with 95% acceptance) when a* values were equal to or above 14.5. Demographic effects on this threshold were negligible, but consumer nationality and gender did contribute to variation in the relative importance of colour to beef value. These results provide future beef colour studies with context to interpret objective colour measures in terms of consumer acceptance and market appeal. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Financial feasibility analysis, small business farm beef cattle livestock in Gorontalo District

Directory of Open Access Journals (Sweden)

Amir Halid

2017-12-01

Full Text Available The objectives of this research are: 1 analyze the responses of farmers on small business farm beef cattle livestock in Gorontalo District, 2 analyze the feasibility of small business farm beef cattle livestock in Gorontalo District, 3 analyze the estimated increase of beef cattle production in Gorontalo District. The research method that used is survey method. The data analysis used in this research are descriptive analysis, feasibility analysis, and forecasting analysis. The result of this research showed: 1 The development of beef cattle business is an industry in the field of agribusiness with no limited. Beef cattle farmers said this business could give a huge profits. It can be seen from people welfare that increased, this business does not require a large cost from the technical point of view (cost of facilities and infrastructure, 2 Based on financial analysis aspect of beef cattle livestock is feasible to develop. 3 The result of forecasting analysis can be seen that there will be increased production for the Year 2017-2019 at all intervals except at 1-2cows. Keyword: Financial Feasibility, Beef Cattle, Agribusiness

The Development of National Beef-Cattle Population in Relation to Beef-Cattle Population at the Centre and Non Centre Area, and the Policy of National Development Program

Directory of Open Access Journals (Sweden)

A Sodiq

2006-09-01

Full Text Available The objectives of this research were (1 to find out the development of beef-cattle population at national level, at the Centre Area of Population (CAP and Non Centre Area of Population (NCAP, (2 to assess the relation between population of national beef-cattle and beef-cattle population at CAP and NCAP, (3 to study the policy of beef-cattle development program in Indonesia. The target of this study addressed to the Directorate General of Livestock Services, Republic of Indonesia. A literature review and communication methods were applied in this study. Descriptive and regression analysis were used for data analysis.  The study revealed that: (1 During 1995-2005, beef-cattle population at national level, CAP and NCAP were unstable.  Due to financial crises (1997, the population at national and CAP tended to decrease, but the population at NCAP was relatively constant.  During 2003-2005, national population tended to increase (0.83% per year, and that figure was less than national target (1.05%,  (2 Population of national beef-cattle (Y was highly related (r2: 0,95; MSE: 108508 to the population of beef-cattle at NCAP (X;  Y = 4764492 + 0.896 X;  (3 An increase in beef-cattle population during 2000-2005 was due to an increase in calving and cattle importation. Slaughtering of cows should be controlled to increase calving. The evaluation results of beef self-sufficiency program revealed that there were failures in achieving main goals of the program. It is recommended that to improve the contribution of CAP to national needs, the development of cattle population should be focused in those areas.  The evaluation results of beef self-sufficiency program could be considered in the future policy in term of the development cattle population. Some causes of the policy failures: (1 the formulated policy was not equipped with detailed operation plans. The program formulation was limited to title and goal without elaborating the way to achieve the

The Economic Effects of New-Product Beef Promotion in Guatemala

OpenAIRE

Leister, Amanda M.; Capps, Oral, Jr.; Rosson, C. Parr, III

2010-01-01

The implementation of the Central America-Dominican Republic Free Trade Agreement (CAFTA-DR) has expanded trade opportunities for U.S. agricultural producers. U.S. beef is an important product affected by the agreement, and the United States Meat Export Federation (USMEF) invested in a new product promotion program to increase exports of U.S. beef to Guatemala. Consumer responsiveness and the effectiveness of the U.S. branded beef promotion program are analyzed in this study. Demand responses...

Effect of composting on the fate of steroids in beef cattle manure

Science.gov (United States)

In this study, the fate of steroid hormones in beef cattle manure composting is evaluated. The fate of 16 steroids and metabolites was evaluated in composted manure from beef cattle administered growth promotants and from beef cattle with no steroid hormone implants. The fate of estrogens (primary...

Beef identification in industrial slaughterhouses using machine vision techniques

Directory of Open Access Journals (Sweden)

J. F. Velez

2013-10-01

Full Text Available Accurate individual animal identification provides the producers with useful information to take management decisions about an individual animal or about the complete herd. This identification task is also important to ensure the integrity of the food chain. Consequently, many consumers are turning their attention to issues of quality in animal food production methods. This work describes an implemented solution for individual beef identification, taking in the time from cattle shipment arrival at the slaughterhouse until the animals are slaughtered and cut up. Our beef identification approach is image-based and the pursued goals are the correct automatic extraction and matching between some numeric information extracted from the beef ear-tag and the corresponding one from the Bovine Identification Document (BID. The achieved correct identification results by our method are near 90%, by considering the practical working conditions of slaughterhouses (i.e. problems with dirt and bad illumination conditions. Moreover, the presence of multiple machinery in industrial slaughterhouses make it difficult the use of Radio Frequency Identification (RFID beef tags due to the high risks of interferences between RFID and the other technologies in the workplace. The solution presented is hardware/software since it includes a specialized hardware system that was also developed. Our approach considers the current EU legislation for beef traceability and it reduces the economic cost of individual beef identification with respect to RFID transponders. The system implemented has been in use satisfactorily for more than three years in one of the largest industrial slaughterhouses in Spain.

High-pressure effects on cooking loss and histological structure of beef muscle

Science.gov (United States)

Liu, Anjun; Zhan, Hu; Zheng, Jie; Liu, Dongyue; Jia, Peiqi

2010-12-01

In this study, we investigate the effects of high pressures (up to 600 MPa) applied at room temperature for 10 min on beef cooking loss and structure. The data on cooking loss, pH and protein solubility, as well as the electron microscopy, illustrate the changes in cooking loss and structure with high pressure processing (HPP). There is a significant reduction in cooking loss of beef with HPP. When the beef sample is imposed upon by 300 or 400 MPa, the cooking loss reduction is about 12%. Further, the pH of beef is dramatically increased as the pressure increases, and the pH increases by about 5% when imposed upon by 500 MPa. When a high pressure was applied at room temperature, the structure of the beef tissue apparently changed. Muscle fiber fragments gradually became slender and sarcomeres became lengthened. Our data indicated that high-pressure treatment on beef leads to stretching of the muscle fiber and an increase in the water-holding capacity.

Environmental consequences of different beef production systems in the EU

DEFF Research Database (Denmark)

Nguyen, T Lan T; Hermansen, John Erik; Mogensen, Lisbeth

2010-01-01

The aim of this paper is to examine the environmental consequences of beef meat production in the EU, using a life cycle approach. Four beef production systems were studied - three from intensively reared dairy calves and one from suckler herds. According to the results of the analysis......, the contributions from the production of 1 kg beef meat (slaughter weight) to global warming, acidification, eutrophication, land use and non-renewable energy use were lower for beef from dairy calves than from suckler herds (16.0-19.9 versus 27.3 kg CO2e, 101-173 versus 210 g SO2e, 622-1140 versus 1651 g NO3e, 16.......5-22.7 versus 42.9 m2year, and 41.3-48.2 versus 59.2 MJ, respectively). The breakdown analysis helped identify the key areas in the "cradle to farm gate" beef production system where sustainable management strategies are needed to improve environmental performance. The study also included a sensitivity analysis...

Assessment of hardened characteristics of raw fly ash blended self-compacting concrete

Directory of Open Access Journals (Sweden)

B. Mahalingam

2016-09-01

Full Text Available Fly ash is widely used as a supplementary cementitious material in concrete. Due to the implementation of new thermal power plants as a consequence of electricity demand, generation of fly ash is noticeably increased. In addition to pozzolana blended cement production, it is very imperative to use raw fly ash in concrete. Earlier research studies investigated the performance of processed fly ash in blended cement production as well as in concrete. In general, ground fly ash is used in blended cement production. A comprehensive study on the performance evaluation of raw fly ash in self-compacting concrete is not available in the existing literature. Moreover, utilization of raw fly ash in special concrete such as self-compacting concrete is essential to comprehend the performance of raw fly ash blended concrete compared to ordinary Portland concrete. Additionally, it will help to achieve maximum utilization of raw fly ash as a supplementary cementitious material rather than disposal as a waste, which eventually leads to several environmental issues. In the study, raw fly ash was collected and is directly used in development of self-compacting concrete. Two mixes were cast and hardened characteristics of blended concrete were investigated. Results from the study showed comparable performance with control concrete. Furthermore, significant reduction in chloride permeability was observed for raw fly ash blended concrete.

Effects of Tannic Acid on Lipid and Protein Oxidation, Color, and Volatiles of Raw and Cooked Chicken Breast Meat during Storage

Directory of Open Access Journals (Sweden)

Marwan Al-Hijazeen

2016-06-01

Full Text Available The objective of this study was to determine the effect of tannic acid (TA on the oxidative stability and the quality characteristics of ground chicken breast meat. Five treatments including (1 control (none added, (2 2.5 ppm TA, (3 5 ppm TA, (4 10 ppm TA, and (5 5 ppm butylated hydroxyanisole (BHA were added to boneless, skinless ground chicken breast meat, and used for both raw and cooked meat studies. For the raw meat study, the ground chicken breast meat was packaged in oxygen-permeable bags and stored at 4 °C for 7 days. For the cooked study, raw ground meat samples were vacuum-packaged in oxygen-impermeable vacuum bags, cooked in-bag to the internal temperature of 75 °C, re-packaged in oxygen-permeable bags, and then stored. Both raw and cooked meats were analyzed for lipid and protein oxidation, color, and volatiles (cooked meat only at 0, 3, and 7 days of storage. Raw meats with 10 ppm of TA added had significantly (p ≤ 0.05 lower lipid and protein oxidation than other treatments during storage. In addition, TA at 10 ppm level maintained the highest color a*- and L*-values during storage. Cooked chicken breast meat with 5 and 10 ppm TA added produced significantly (p ≤ 0.05 lower amounts of off-odor volatiles than other treatments. Among the volatile compounds, the amount of hexanal increased rapidly during storage for cooked meat. However, meats with 5 and 10 ppm TA added showed the lowest amount of hexanal and other aldehydes related to lipid oxidation, indicating a strong antioxidant effect of TA in cooked chicken breast meat. Furthermore, the differences in aldehydes among the treatments were bigger in cooked than in raw meat, indicating that the antioxidant effect of TA in cooked meat was greater than that in raw meat. Therefore, TA at >5 ppm can be used as a good natural preservative in cooked chicken meat to maintain its quality during storage.

Planning Of Beef Cattle Development in District Blora, Central Java, Indonesia

Directory of Open Access Journals (Sweden)

Santoso Budi

2018-01-01

Full Text Available Continuity of meat supply availability is generally related to the number and production of livestock in a region. Therefore, a framework of sustainable livestock development is needed to increase the production and productivity of livestock. Blora Regency is one of the areas in the Province of Central Java with the largest number of large livestock, primarily beef cattle. Blora Regency has a population of 199.584 beef cattle. Agricultural waste results in Blora Regency can be used as supporting the availability of feed for livestock sector. This is supported by the availability of forage feed which is very abundant.Based on these potentials, it is necessary to assess the characteristics of natural land for the development of beef cattle farms. Therefore, the objectives of this study are (1 to assess the environmental suitability of the environment for the development of cattle ranching that is grazed and stacked; (2 to analyze the potential of forage source of fodder and bearing capacity for beef cattle farming; (3 to analyze the centers of activity of development of beef cattle; (4 to prepare direction and strategy of beef cattle development in Blora Regency.

Planning Of Beef Cattle Development in District Blora, Central Java, Indonesia

Science.gov (United States)

Santoso, Budi; Prasetiyono, Bambang Waluyo Hadi Eko

2018-02-01

Continuity of meat supply availability is generally related to the number and production of livestock in a region. Therefore, a framework of sustainable livestock development is needed to increase the production and productivity of livestock. Blora Regency is one of the areas in the Province of Central Java with the largest number of large livestock, primarily beef cattle. Blora Regency has a population of 199.584 beef cattle. Agricultural waste results in Blora Regency can be used as supporting the availability of feed for livestock sector. This is supported by the availability of forage feed which is very abundant.Based on these potentials, it is necessary to assess the characteristics of natural land for the development of beef cattle farms. Therefore, the objectives of this study are (1) to assess the environmental suitability of the environment for the development of cattle ranching that is grazed and stacked; (2) to analyze the potential of forage source of fodder and bearing capacity for beef cattle farming; (3) to analyze the centers of activity of development of beef cattle; (4) to prepare direction and strategy of beef cattle development in Blora Regency.

Bill E. Kunkle Interdisciplinary Beef Symposium: Practical developments in managing animal welfare in beef cattle: what does the future hold?

Science.gov (United States)

Lyles, J L; Calvo-Lorenzo, M S

2014-12-01

Interest in the welfare of cattle in the beef industry has intensified over time because of ethical concerns and varying societal perceptions that exist about the treatment and living conditions of farm animals. The definition of welfare will vary according to an individual's philosophies (how one defines and prioritizes what is "good"), experiences (societal and cultural influences of animal roles and relationships), and involvement in the livestock industry (knowledge of how livestock operations work and why). Many welfare concerns in the beef industry could be mitigated by enhancing traditional husbandry practices that utilize practical improvements to alleviate or eliminate heat stress, pain from routine husbandry procedures, negative cattle handling, and the transitional effects of weaning, dry feeding, transportation, and comingling of calves. Recent concerns about the potential welfare effects of feeding technologies such as β-adrenergic agonists (BAA) have emerged and led to industry-wide effects, including the removal of a single BAA product from the market and the development of BAA-specific welfare audits. Altogether, the beef industry continues to be challenged by welfare issues that question a large range of practices, from traditional husbandry to newer technological advancements. As welfare awareness increases, efforts to improve livestock care and management must focus on scientific investigations, practical solutions, consumer perceptions, and educational tools that advance knowledge and training in livestock welfare. Furthermore, the future of beef cattle welfare must align welfare concerns with other aspects of sustainable beef production such as environmental quality, profitability, food safety, and nutritional quality.

National Beef Market Basket Survey - 2006: External fat thickness measurements and separable component determinations for beef from US retail establishments.

Science.gov (United States)

Mason, C L; Nicholson, K L; Brooks, J C; Delmore, R J; Henning, W R; Johnson, D D; Lorenzen, C L; Maddock, R J; Miller, R K; Morgan, J B; Wasser, B E; Gwartney, B L; Harris, K B; Griffin, D B; Hale, D S; Savell, J W

2009-02-01

A market basket survey for beef retail cut composition at the retail level (four stores each from two chains in each city) was conducted in 11 US cities from January to March 2006. Beef cuts (n=17,495) were measured for external fat thickness with cuts from the chuck (0.05cm), round (0.05cm), and miscellaneous (0.04cm) having less (Pmarketing purposes.

Detection of Clostridium difficile in Retail Ground Meat Products in Manitoba

Directory of Open Access Journals (Sweden)

Monique Visser

2012-01-01

Full Text Available The aim of the present study was to determine whether Clostridium difficile was present in uncooked retail ground beef and ground pork products sold in Winnipeg, Manitoba. Using an alcohol treatment protocol and inoculation of cultures on C difficile Moxalactam Norfloxacin (CDMN, toxigenic C difficile was found in 6.3% of 48 meat samples. The C difficile isolates belonged to different pulsotypes, all of which had been previously isolated from the stool of Manitoba patients with C difficile disease. Because cooking of meat will not eradicate C difficile spores, this raises a concern regarding potential foodborne transmissibility of this organism.

Impacts of reproductive technologies on beef production in the United States.

Science.gov (United States)

Dahlen, Carl; Larson, Jamie; Lamb, G Cliff

2014-01-01

Estimations of world population growth indicate that by the year 2050 we will reach nine billion habitants on earth. These estimates impose a tremendous challenge in the current agricultural systems as food supply will need to increase by 100 % in the next 40 years (Food and Agriculture Organization of the United Nations 2009). Beef will be a primary protein source that will assist in meeting the requirements for a portion of the protein in diets of this expanding global populace. Beef is a high-quality protein that contains all essential amino acids for the human body and also contains additional essential nutrients such as iron, zinc, B vitamins, riboflavin, selenium, choline, and conjugated linoleic acid (CLA). Adopting reproductive technologies at greater rates than currently used is a viable method to dramatically enhance production efficiency of beef cattle enterprises.Artificial insemination (AI), estrous synchronization and fixed-time AI (TAI), semen and embryo cryopreservation, multiple ovulation and embryo transfer (MOET), in vitro fertilization, sex determination of sperm or embryos, and nuclear transfer are technologies that are used to enhance the production efficiency of beef operations. In many cases, the development of these technologies is responsible for significant changes to traditional livestock production practices. However, adoption of these technologies appears to has not grown at the same rate in the United States as other formidable beef producing nations. For example, sales of beef semen for AI increased from 3.3 to 11.9 million units between 1993 and 2011 in Brazil, whereas that in the United States has increased from 2.9 to 3.8 million units during the same period. The significant increases in adoption of reproductive technologies in developing countries is likely as a result of the development of practical estrous synchronization and TAI systems that have allowed beef producers the opportunity to eliminate detection of estrus in their

Cross-sectional study to estimate the prevalence of enterohaemorrhagic Escherichia coli on hides of market beef cows at harvest.

Science.gov (United States)

Schneider, L G; Stromberg, Z R; Lewis, G L; Moxley, R A; Smith, D R

2018-03-25

Cattle hides are an important source of enterohaemorrhagic Escherichia coli (EHEC) carcass contamination at slaughter. Seven EHEC serogroups are adulterants in raw, non-intact beef: EHEC O26, O45, O103, O111, O121, O145 and O157. The objective of this study was to estimate the probability for hide contamination with EHEC among US market beef cows at slaughter and to test the effects of season and geographic region on prevalence of hide contamination. Hides (n = 800) of market cows were swabbed at slaughter immediately after exsanguination, prior to hide removal. Cows were sampled from two geographically distinct beef packing plants during four seasons of 2015. Cattle source was categorized by northern or southern region. Samples were tested for EHEC by a molecular screening assay. The effects of region, season and their interaction on the probability of hide contamination by each EHEC serogroup were tested in separate multilevel multivariable logistic regression models, accounting for the random effect of clustering by plant. Statistical significance was set α = .05. Of 800 total samples, at least one EHEC was detected on 630 (79%) hides. Enterohaemorrhagic E. coli O26 was detected on 129 (16%) of all hides sampled, EHEC O45 on 437 (55%), EHEC O103 on 289 (36%), EHEC O111 on 189 (24%), EHEC O121 on 140 (18%), EHEC O145 on 171 (21%) and EHEC O157 on 89 (11%). Detection of EHEC O26 and EHEC O121 was associated with season. Season and region were associated with detecting EHEC O45 and EHEC O157. Season-by-region interactions were associated with the outcome of detecting EHEC O103, EHEC O111 and EHEC O145. Season, region of origin and the interaction of these factors affect hide contamination of market beef cattle at slaughter by EHEC, and each serogroup responds to these factors uniquely. © 2018 Blackwell Verlag GmbH.

THE EFFECT OF LOST EXPORTS ON U.S. BEEF PRICES

OpenAIRE

Mattson, Jeremy W.; Jin, Hyun Joung; Koo, Won W.

2005-01-01

Since the discovery of Bovine Spongiform Encephalopathy (BSE) in the United States in December 2003, U.S. beef exports have declined approximately 85 percent. A number of countries, including Japan and Korea (the top export markets for U.S. beef), have banned imports of beef from the United States, while U.S. exports to other important markets, such as Mexico and Canada, have been well below previous levels. Domestic demand in the United States was not significantly affected by the BSE discov...

Antagonism in the carbon footprint between beef and dairy ...

African Journals Online (AJOL)

The higher increase in production (milk) of intensive dairy cows, compared to the increase in production (calf weight) of intensive beef cows, explains the antagonism in the carbon footprint between different beef and dairy production systems. Unfortunately, carbon sequestration estimates have been neglected and thus the ...

Model system evaluation of the effects of pea and pH on the emulsion properties of beef

OpenAIRE

Kurt, Ş.; Ceylan, H. G.

2018-01-01

The effects of dried ground pea (0 - 1%) and pH (4.80 - 7.20) on the emulsion properties of beef were investigated using the model system. The study was designed according to the central composite rotatable design using the Response Surface Methodology. Pea had significant effects on emulsion activity and stability. The effects of pH on emulsion capacity, stability, activity, density, viscosity and apparent yield stress were significant. In addition, the interaction of both factors (pea and p...

Video image analysis as a potential grading system for Uruguayan beef carcasses.

Science.gov (United States)

Vote, D J; Bowling, M B; Cunha, B C N; Belk, K E; Tatum, J D; Montossi, F; Smith, G C

2009-07-01

A study was conducted in 2 phases to evaluate the effectiveness of 1) the VIAscan Beef Carcass System (BCSys; hot carcass system) and the CVS BeefCam (chilled carcass system), used independently or in combination, to predict Uruguayan beef carcass fabrication yields; and 2) the CVS BeefCam to segregate Uruguayan beef carcasses into groups that differ in the Warner-Bratzler shear force (WBSF) values of their LM steaks. The results from the meat yield phase of the present study indicated that the prediction of saleable meat yield percentages from Uruguayan beef carcasses by use of the BCSys or CVS BeefCam is similar to, or slightly better than, the use of USDA yield grade calculated to the nearest 0.1 and was much more effective than prediction based on Uruguay National Institute of Meat (INAC) grades. A further improvement in fabrication yield prediction could be obtained by use of a dual-component video image analysis (VIA) system. Whichever method of VIA prediction of fabrication yield is used, a single predicted value of fabrication yield for every carcass removes an impediment to the implementation of a value-based pricing system. Additionally, a VIA method of predicting carcass yield has the advantage over the current INAC classification system in that estimates would be produced by an instrument rather than by packing plant personnel, which would appeal to cattle producers. Results from the tenderness phase of the study indicated that the CVS BeefCam output variable for marbling was not (P > 0.05) able to segregate steer and heifer carcasses into groups that differed in WBSF values. In addition, the results of segregating steer and heifer carcasses according to muscle color output variables indicate that muscle maturity and skeletal maturity were useful for segregating carcasses according to differences in WBSF values of their steaks (P > 0.05). Use of VIA to predict beef carcass fabrication yields could improve accuracy and reduce subjectivity in comparison

Hedonic Retail Beef and Pork Product Prices

OpenAIRE

Parcell, Joseph L.; Schroeder, Ted C.

2007-01-01

Consumer-level hedonic models are estimated to determine factors affecting retail pork and beef meat cuts. Results indicate that brand premium and discount varies across private, national, and store brands and that brand premium varies across meat cuts carrying the same brand name. Product size discounts are linear for beef and nonlinear for pork, meat items on sale are significantly discounted to non-sale items, specialty stores typically will not garner higher prices than supermarket/grocer...

The role of food standards on international trade: assessing the Brazilian beef chain

Directory of Open Access Journals (Sweden)

Luciana Marques Vieira

2006-01-01

Full Text Available The purpose of this paper is to identify how Brazilian beef managers have responded to a rapid expansion and intensification of standards for beef exports. This issue relates to how some Brazilian beef exporters are strategically repositioning themselves in the supply chains. The literature of this study reviews global chain governance and international standards. The method uses case studies consisting of six medium and large scale beef exporters who export fresh beef to the European Union. The main findings describe the kinds of governance that stimulate upgrading and transferral of the best practices and, consequently, full compliance with mandatory standards. This study suggests that standards do matter for companies trying to increase international competitiveness. These results contribute an understanding of the Brazilian beef chain, and also of other supply chains coping with demanding and changing international markets. Managerial implications show the challengesfacing Brazilian beef exporters in their efforts to sustain exports to the European Union and how they are using chain governance to improve their compliance with international standards and increase competitiveness.

Inhibition of Listeria monocytogenes by Lactobacillus bavaricus MN in beef systems at refrigeration temperatures.

OpenAIRE

Winkowski, K; Crandall, A D; Montville, T J

1993-01-01

The ability of Lactobacillus bavaricus, a meat isolate, to inhibit the growth of three Listeria monocytogenes strains was examined in three beef systems: beef cubes, beef cubes in gravy, and beef cubes in gravy containing glucose. The beef was minimally heat treated, inoculated with L. bavaricus at 10(5) or 10(3) CFU/g and L. monocytogenes at 10(2) CFU/g, vacuum sealed, and stored at 4 or 10 degrees C. The meat samples were monitored for microbial growth, pH, and bacteriocin production. The p...

Tapeworm infection - beef or pork

Science.gov (United States)

Teniasis; Pork tapeworm; Beef tapeworm; Tapeworm; Taenia saginata; Taenia solium; Taeniasis ... undercooked meat of infected animals. Cattle usually carry Taenia saginata ( T saginata ). Pigs carry Taenia solium (T ...

Influence of mitochondrial efficiency on beef lean color stability

Science.gov (United States)

Loss of electrons in the electron transport chain has been implicated as a source of variation in feed efficiency of meat producing animals. The present study was conducted to evaluate the effects of electron loss during electron transport on beef lean color stability. Beef carcasses (n = 91) were...

Industrial development of beef and pork cecina with different flavors

Directory of Open Access Journals (Sweden)

Francisco A. Nuñez-Gonzalez

2013-12-01

Full Text Available Cecina used traditional technique for salting and preserving meat as well as to impart flavor; however, addition of spices is a viable alternative to diversify the flavors of the product. The objective of this research was to develop beef and pork cecina of flavors and evaluate lipid oxidation after 30 days of storage. Beef and pork cecina were distributed independently in four treatments: Formulation 1 or base (10.7% salt, 1.3% sugar, 0.5% nitrite and seasoning 0.1%; formulation 2, base plus 10 g of mixture of coriander, celery, parsley dehydrated/kg meat; formulation 3, base plus 10 g dry mirasol chilli/kg of meat and liquid smoke (2 mL/L and formulation 4, base plus 0.80 mL of essential oregano oil/L. Beef cecina was dried at 80 °C for 150 minutes and pork cecina for 180 minutes until these achieved a water activity (aw of 0.75. Beef cecina was packaged in cellophane bag, while for pork cecina in vacuum bags. Lipid oxidation was determined using thiobarbituric acid test (TBA. The results revealed that only beef cecina presented fat rancidity.

Physical chemistry and microscopic characteristics of matured beef peccary (Tayassu tajacu

Directory of Open Access Journals (Sweden)

Hugo Rangel Fernandes

2015-06-01

Full Text Available ABSTRACT. Fernandes H.R., Oliveira L.C., Ribeiro S.C.A. & Lourenço L.F.H. [Physical chemistry and microscopic characteristics of matured beef peccary (Tayassu tajacu.] Características físicas e microscópicas da carne maturada de caititu (Tayassu tajacu. Revista Brasileira de Medicina Veterinária, 37(2:167-172, 2015. Universidade do Estado do Pará, Travessa Enéas Pinheiro, 2626, Marco, Belém, PA 66113-200, Brasil. Email: suziar@yahoo.com The objective of this article was to analyze the physical and microscopic matured beef peccary. Were performed analyses of shear force, water holding capacity, weight loss by cooking and scanning electron microscopy in matured beef. The matured beef presented values of shear force between 3.76 and 5.26 %, water activity between 0,96 to 0,98 and weight loss by cooking between 19,46 and 21,17%. Therefore, it was found that the matured beef peccary, were considered soft according to analysis of shear force. The matured beef at 0ºC for 12 days was considered the best product for having less weight loss by cooking and softness according to analysis of shear force and scanning electron microscopy.

Intensive vs. free-range organic beef. A preference study through consumer liking and conjoint analysis.

Science.gov (United States)

García-Torres, S; López-Gajardo, A; Mesías, F J

2016-04-01

This paper evaluates consumer liking and preferences towards organic beef from two production systems allowed by EU regulation: i) free-range and ii) intensive (fattened in feed-lot with organic feedstuff) as compared with conventionally produced beef. Data were obtained in April-May 2014 with a sample of 150 regular beef consumers who completed two tasks: firstly a sensory test where consumers tasted and rated the meats and secondly a conjoint analysis to study beef purchasing preferences. Willingness-to-pay for the different meats was also calculated from conjoint results. Results show that consumers preferred organic-from-concentrate beef at sensory level while organic beef from animals fed on grass was preferred when process characteristics (i.e. farming system) or attributes perceived at the point of purchase (i.e. colour) were evaluated. It was also found that the price-premium for organic beef is over 40%, with organic-fed-on grass beef preferred slightly over that fed-on-concentrate. Copyright © 2015 Elsevier Ltd. All rights reserved.

Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health.

Science.gov (United States)

Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O

2016-09-24

The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.

The environmental and economic impact of removing growth-enhancing technologies from U.S. beef production.

Science.gov (United States)

Capper, J L; Hayes, D J

2012-10-01

The objective of this study was to quantify the environmental and economic impact of withdrawing growth-enhancing technologies (GET) from the U.S. beef production system. A deterministic model based on the metabolism and nutrient requirements of the beef population was used to quantify resource inputs and waste outputs per 454 × 10(6) kg of beef. Two production systems were compared: one using GET (steroid implants, in-feed ionophores, in-feed hormones, and beta-adrenergic agonists) where approved by FDA at current adoption rates and the other without GET use. Both systems were modeled using characteristic management practices, population dynamics, and production data from U.S. beef systems. The economic impact and global trade and carbon implications of GET withdrawal were calculated based on feed savings. Withdrawing GET from U.S. beef production reduced productivity (growth rate and slaughter weight) and increased the population size required to produce 454 × 10(6) kg beef by 385 × 10(3) animals. Feedstuff and land use were increased by 2,830 × 10(3) t and 265 × 10(3) ha, respectively, by GET withdrawal, with 20,139 × 10(6) more liters of water being required to maintain beef production. Manure output increased by 1,799 × 10(3) t as a result of GET withdrawal, with an increase in carbon emissions of 714,515 t/454 × 10(6) kg beef. The projected increased costs of U.S. beef produced without GET resulted in the effective implementation of an 8.2% tax on beef production, leading to reduced global trade and competitiveness. To compensate for the increase in U.S. beef prices and maintain beef supply, it would be necessary to increase beef production in other global regions, with a projected increase in carbon emissions from deforestation, particularly in Brazil. Withdrawing GET from U.S. beef production would reduce both the economic and environmental sustainability of the industry.

Evaluation of Modification of the 3M™ Molecular Detection Assay (MDA) Salmonella Method (2013.09) for the Detection of Salmonella in Selected Foods: Collaborative Study.

Science.gov (United States)

Bird, Patrick; Fisher, Kiel; Boyle, Megan; Huffman, Travis; Benzinger, M Joseph; Bedinghaus, Paige; Flannery, Jonathon; Crowley, Erin; Agin, James; Goins, David; Benesh, DeAnn; David, John

2014-01-01

The 3M(™) Molecular Detection Assay (MDA) Salmonella utilizes isothermal amplification of nucleic acid sequences with high specificity, efficiency, rapidity and bioluminescence to detect amplification of Salmonella spp. in food, food-related, and environmental samples after enrichment. A method modification and matrix extension study of the previously approved AOAC Official Method(SM) 2013.09 was conducted, and approval of the modification was received on March 20, 2014. Using an unpaired study design in a multilaboratory collaborative study, the 3M MDA Salmonella method was compared to the U.S. Department of Agriculture/Food Safety and Inspection Service (USDA/FSIS) Microbiology Laboratory Guidebook (MLG) 4.05 (2011), Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg, and Catfish Products for raw ground beef and the U.S. Food and Drug Administration (FDA)/Bacteriological Analytical Manual (BAM) Chapter 5, Salmonella reference method for wet dog food following the current AOAC guidelines. A total of 20 laboratories participated. For the 3M MDA Salmonella method, raw ground beef was analyzed using 25 g test portions, and wet dog food was analyzed using 375 g test portions. For the reference methods, 25 g test portions of each matrix were analyzed. Each matrix was artificially contaminated with Salmonella at three inoculation levels: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). In this study, 1512 unpaired replicate samples were analyzed. Statistical analysis was conducted according to the probability of detection (POD). For the low-level raw ground beef test portions, the following dLPOD (difference between the LPODs of the reference and candidate method) values with 95% confidence intervals were obtained: -0.01 (-0.14, +0.12). For the low-level wet dog food test portions, the following dLPOD with 95% confidence intervals were

VALUE OF BEEF STEAK BRANDING: HEDONIC ANALYSIS OF RETAIL SCANNER DATA

OpenAIRE

Schulz, Lee L.; Schroeder, Ted C.; White, Katharine L.

2010-01-01

Consumers rely on experience and credence attributes when purchasing beef from retailers. It is essential for all beef industry sectors to recognize the complexity of consumer buying behavior. A hedonic model is estimated to determine if there are incentives to brand beef steaks, the types of brands that entertain price premiums, and the level of existing premiums. Most branded steaks garnered premiums along with organic claims, religious processing claims, and premium cuts. Factors influenci...

Effect of Repeated Freeze-Thaw Cycles on Beef Quality and Safety

Science.gov (United States)

Rahman, Mohammad Hafizur; Hossain, Mohammad Mujaffar; Rahman, Syed Mohammad Ehsanur; Hashem, Mohammad Abul

2014-01-01

The objectives of this study were to know the effect of repeated freeze-thaw cycles of beef on the sensory, physicochemical quality and microbiological assessment. The effects of three successive freeze-thaw cycles on beef forelimb were investigated comparing with unfrozen fresh beef for 75 d by keeping at −20±1℃. The freeze-thaw cycles were subjected to three thawing methods and carried out to know the best one. As the number of freeze-thaw cycles increased color and odor declined significantly before cook within the cycles and tenderness, overall acceptability also declined among the cycles after cook by thawing methods. The thawing loss increased and dripping loss decreased significantly (pcycles and then decreased. Cooking loss increased in cycle 1 and 3, but decreased in cycle 2. pH decreased significantly (pcycles. Moreover, drip loss, cooking loss and WHC were affected (pcycles. 2-Thiobarbituric acid (TBARS) value increased (pcycles and among the cycles by thawing methods. Total viable bacteria, total coliform and total yeast-mould count decreased significantly (pcycles in comparison to the initial count in repeated freeze-thaw cycles. As a result, repeated freeze-thaw cycles affected the sensory, physicochemical and microbiological qua- lity of beef, causing the deterioration of beef quality, but improved the microbiological quality. Although repeated freeze-thaw cycles did not affect much on beef quality and safety but it may be concluded that repeated freeze and thaw should be minimized in terms of beef color for commercial value and WHC and tenderness/juiciness for eating quality. PMID:26761286

An environmental assessment of grass-finishing beef operations in Pennsylvania

Science.gov (United States)

Concern for the environmental sustainability of traditional beef production has increased consumer interest in alternatively produced beef products perceived to be more environmentally friendly. This includes those marketed under “grassfed beef” labels. However, little information exists on the env...

Photoshop CS3 RAW Transforming your RAW data into works of art

CERN Document Server

Aaland, Mikkel

2008-01-01

Because RAW files remain virtually untouched by in-camera processing, working with them has given digital photographers greater flexibility and control during the editing process -- for those who are familiar enough with the format. Camera RAW, the plug in for Adobe Photoshop CS3, has emerged as one of the best and most familiar tools for editing RAW images, and the best way to master this workflow is with Photoshop CS3 RAW. Award-winning author Mikkel Aaland explores the entire RAW process, from the practical reasons to shoot RAW, to managing the images with the new features of Bridge 2.0 n

Inhibitory Effects of Several Essential Oils towards Salmonella typhimurium, Salmonella paratyphi A and Salmonella paratyphi B

Directory of Open Access Journals (Sweden)

S.F. Mazhar

2014-09-01

Full Text Available Plant essential oils are natural products extracted from plants and because of their antimicrobial properties can be used as natural additives in foods. They are also useful for decontamination of food-borne pathogens and can be a safe additive in foods. The antimicrobial activities of essential oils belonging to Saturiea hortensis, Thymus vulgaris, Mentha polegium, Cuminum cyminum, Lavandula officinalis and Mentha viridis L. (spearmint were investigated at different concentrations (0.1, 0.3, 0.5, 1, 2, 5 and 10%v/v against Salmonella typhimurium, Salmonella paratyphi A and Salmonella paratyphi B by using the agar well diffusion method. Essential oils showed inhibitory effect on Salmonella spp. in the agar well diffusion assay. In addition, the capability of essential oils for decontamination of minced row beef, ground beef, minced raw chicken and minced raw fish inoculated with Salmonella spp. at 0.1 and 0.5%v/v were assessed. Reduction of the Salmonella spp. population was observed following the inoculation of the cultures with 0.1 and 0.5%v/v essential oils.

Nanopurification of semen improves AI pregnancy rates in beef cattle

Science.gov (United States)

Reproductive efficiency is several times more important than any other factor affecting economic efficiency in beef production. Multiple studies have been conducted to improve fertility of beef cows, but few studies have been conducted to improve fertility in sires. Also, with current improvements...

Environmental Awareness on Beef Cattle Technology

Directory of Open Access Journals (Sweden)

Abdullah M Bamualim

2008-09-01

Full Text Available The acceleration program to meet beef self sufficient in 2010 is expected to increase animal protein consumption of Indonesian people in order to be equal with other countries as well as to improve the livestock farmer’s income. The main objective of the program is to increase cattle population. Since the availability of forage and grassland is limited, beef cattle development is driven to the crop and plantation integration approach by using their by-product as cattle feed. Crop and plantation by-products, generally are considered to be fiber source with high lignocellulose’s and low nutritive value. Feeding high fiber would increase methane gas production, and faeces and grass cultivation also contributed on greenhouse emission. Methane is one of the main greenhouse gases contributed by agriculture sector; increasing beef cattle population using high fiber feed is predicted to increase methane production. Good management is expected to improve productivity and to reduce methane production on livestock. Some efforts could be done such as good feeding management and nutrition manipulation, environment friendly cattle waste management, improving management on roughage cultivation, and improving management on cattle production.

MODEL SYSTEM EVALUATIONS OF MEAT EMULSIONS PREPARED WITH DIFFERENT EDIBLE BEEF BY PRODUCTS AND FATS AND OIL

Directory of Open Access Journals (Sweden)

Mustafa KARAKAYA

1997-02-01

Full Text Available Emulsion parameters of different meat by-products (beef head-meat, beef heart and liver and animal fats and oil (beef fat, mutton fat, sheep tail-fat and corn oil were studied in a model system. The results of the study showed that the highest emulsion capacity (EC was with the heart meat and beef fat emulsion while the lowest EC was measured in the beef head-meat and sheep tail-fat combination. Corn oil gave the best emulsification with beef head-meat and liver, and beef fat resulted the second best results. Beef head-meat gave the most stable emulsion with all fats, but the emulsions prepared with heart and liver were generally unstable.

Failure of irradiated beef and ham to induce genetic aberrations of Drosophila

International Nuclear Information System (INIS)

Mittler, S.

1979-01-01

Ham that had been irradiated by electrons and beef which had been exposed to gamma rays from 60 Co were fed to Drosophila melanogaster to determine whether meat sterilized by these methods would induce genetic aberrations. The results showed that for yB/sc 8 y + Y males, fed on irradiated ham or beef, thermally preserved beef or frozen beef for their entire larval life, there was no significant increase in the loss of X or Y chromosomes or non-disjunction of these chromosomes; there was also no significant increase in any of the broods. Similarly for the Oregon R males, there was no significant increase in yield of sex-linked recessive lethals. Thus feeding of irradiated ham and beef to Drosophila males did not induce significant increases in genetic aberrations. The present findings are discussed in relation to the conflicting results of previous studies. (U.K.)

ISMRM Raw data format: A proposed standard for MRI raw datasets

DEFF Research Database (Denmark)

Inati, Souheil; Naegle, Joseph; R. Zwart, Nicholas

2016-01-01

programming languages (C++, MATLAB, Python). Results Images were obtained by reconstructing the raw data from all vendors. The source code, raw data, and images comprising this work are shared online, serving as an example of an image reconstruction project following a paradigm of reproducible research......Purpose This work proposes the ISMRM Raw Data format as a common MR raw data format, which promotes algorithm and data sharing. Methods A file format consisting of a flexible header and tagged frames of k-space data was designed. Application Programming Interfaces were implemented in C/C++, MATLAB......, and Python. Converters for Bruker, General Electric, Philips, and Siemens proprietary file formats were implemented in C++. Raw data were collected using magnetic resonance imaging scanners from four vendors, converted to ISMRM Raw Data format, and reconstructed using software implemented in three...

The complete raw workflow guide how to get the most from your raw images in Adobe Camera Raw, Lightroom, Photoshop, and Elements

CERN Document Server

Andrews, Philip

2007-01-01

One of the most important technologies a photographer can master is shooting and working with raw images. However, figuring out the best way to work with raw files can be confusing and overwhelming. What's the advantage to working in raw? How do you manage, organize, and store raw files? What's the best way to process your files to meet your photographic needs? How do Photoshop, Lightroom and Adobe Camera Raw work together? Is it possible to keep your photos in the raw format and still enhance them extensively? Philip Andrews answers these questions and more in his all-new essential raw workfl

Amylolysis of raw corn by Aspergillus niger for simultaneous ethanol fermentation

Energy Technology Data Exchange (ETDEWEB)

Han, I.Y.; Steinberg, M.P.

1987-01-01

The novelty of this approach was hydrolysis of the raw starch in ground corn to fermentable sugars that are simultaneously fermented to ethanol by yeast in a nonsterile environment. Thus, the conventional cooking step can be eliminated for energy conservation. A koji of Aspergillus niger grown on whole corn for 3 days was the crude enzyme source. A ratio of 0.2 g dry koji/g total solids was found sufficient. Optimum pH was 4.2. Ethanol concentration was 7.7% (w/w) in the aqueous phase with 92% raw starch conversion. Agitation increased rate. Sacharification was the rate-limiting step. The initial ethanol concentration preventing fermentation was estimated to be 8.3% by weight. (Refs. 96).

9 CFR 94.27 - Importation of whole cuts of boneless beef from Japan.

Science.gov (United States)

2010-01-01

... beef from Japan. 94.27 Section 94.27 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION... IMPORTATIONS § 94.27 Importation of whole cuts of boneless beef from Japan. Notwithstanding any other... slaughtered in Japan may be imported into the United States under the following conditions: (a) The beef is...

Detection of chicken contamination in beef meatball using duplex-PCR Cyt b gene

Science.gov (United States)

Sari, E. P.; Kartikasari, L. R.; Cahyadi, M.

2017-04-01

Beef is one of expensive animal protein sources compared to other meats, on the other hand, chicken is cheap animal protein source. Mixing of chicken into beef meatball is possibly performed to decrease production cost. The aim of this study was to detect chicken contamination in beef meatball using Cytochrome b (Cyt b) gene by duplex-PCR. Sample was designed and prepared as follows, 100% of chicken meatball, 100% of beef meatball and serial level of chicken contaminations in beef meatball (1, 5, 10 and 25%, respectively). Isolation of DNA genome from meatball was according to the guideline of gSYNCTM DNA Extraction Kit for animal tissue. The PCR reaction was carried out using KAPA2G Fast Multiplex Mix. This study found that the DNA genome was succesfully extracted. Moreover, chicken contamination in beef meatball was indicated by the presence of 227 bp DNA band on 2% of agarose gels. Current study revealed that duplex-PCR using Cyt b gene as a genetic marker was able to detect chicken contamination in beef meatball until 1% of chicken meat in the sample. It can be effectively used to identify contamination and also authenticate species origin in animal products to protect consumer from undesirable contents in the food.

A SUPPORTING AID FOR BEEF CATTLE INVESTMENT OF FARM HOUSEHOLD IN CENTRAL JAVA

Directory of Open Access Journals (Sweden)

T. Ekowati

2014-10-01

Full Text Available The research was conducted to analyze some factors influencing production, income, farmhousehold consumption and investment of farm household beef cattle in Central Java. Five districts werepurposively chosen for research location based on the number of beef cattle population, namelyRembang, Blora, Grobogan, Boyolali and Wonogiri. Forty respondents of each district were chosenrandomly using quota sampling. Data were analyzed through Simultaneous Regression and estimated byTwo Stage Least Square (TSLS. The results showed that independent variables were simultaneouslysignificant to dependent variables (production, income, farm household consumption and investmentwith the Probability F test 0.0000 and adjusted R2 were 91%; 89%; 96%; 62%, respectively. Thesimulation’s analysis of agribusiness implementation consisted of 1 decreasing 15% of service perconception, 2 increasing of beef cattle breed and number of beef cattle 15% respectively, 3 raising ofprice of rice and number of household member 15% respectively and 4 increasing of income and priceof beef cattle 10% respectively influenced to farm household consumption and investment 0.446% and5.14%, respectively, meanwhile production and income did not change. The research can be concludedthat the independent variables simultaneously significant influenced to production, income, farmhousehold consumption and beef cattle investment. The simulation of changing usage of input factor andprice significantly influenced to farm household consumption and beef cattle investment.

A simple method for the comparison of commercially available ATP hygiene-monitoring systems.

Science.gov (United States)

Colquhoun, K O; Timms, S; Fricker, C R

1998-04-01

The purpose of this study was to evaluate a methodology which could easily be used in any test laboratory in a uniform and consistent way for determining the sensitivity and reproducibility of results obtained with three ATP hygiene-monitoring systems. The test protocol discussed here allows such comparison to be made, thereby establishing a method of benchmarking both new systems and developments of existing systems. The sensitivity of the LUMINOMETER K, PocketSwab (Charm Sciences) was found to be between 0.4 and 4.0 nmol of ATP with poor reproducibility at the 40.0 nmol level (CV, 35%). The sensitivity of the IDEXX LIGHTING system and the Biotrace UNILITE Xcel were both between 0.04 and 0.4 nmol with coefficients of variation (CVs) of between 9% at 0.04 nmol and 10% at 0.4 nmol for the IDEXX system and 17% at 0.04 nmol and 21% at 0.4 nmol for the Biotrace system. The three systems were tested with a range of dilutions of different food residues: orange juice, raw milk, and ground beef slurry. All three test systems allowed detection of orange juice and raw milk at dilutions of 1:1,000, although the CV of results from the Charm system (54 and 74% respectively) was poor at this dilution for both residues. The sensitivity of the test systems was poorer for ground beef slurry than it was for orange juice and raw milk. Both the Biotrace and IDEXX systems were able to detect a 1:100 dilution of beef slurry (with CVs of 17 and 10% respectively), whilst at this dilution results from the Charm system had a CV of 55%. It was possible by using the method described in this paper to rank in order of sensitivity and reproducibility the three single-shot ATP hygiene-monitoring systems investigated, with the IDEXX LIGHTNING being the best, followed by the Biotrace UNILITE Xcel, and then the charm LUMINOMETER K, PocketSwab.

Value-added beef products (Productos Carnicos con Valor Agregado)

Science.gov (United States)

Mac Donaldson; Will Holder; Jan Holder

2006-01-01

I'm speaking for Will and Jan Holder, who couldn't be here. I happen to be familiar with Will and Jan's company, Ervin's Natural Beef, and its program because I've sold them cattle. Will and Jan's value-added beef program is based on their family ranch in the area known as The Blue, in the mountains of eastern Arizona.

Factors affecting beef consumption in the valley of Mexico

Directory of Open Access Journals (Sweden)

Ricardo Tellez Delgado

2015-10-01

Full Text Available ABSTRACTThe objective of this study was to know the factors that determine the consumption of beef in the Metropolitan Area of the Valley of Mexico, using logit and probit modeling (nominal variable with 400 surveys. The results showed that significant variables that determine the probability of purchasing beef are schooling, number of members per family, meat preference, family income, and presence of disease in the individual. The largest marginal effects on the purchase decision were provided by the income and the meat preference variables, while the price was not significant. The main factors that determine the consumption of beef are schooling and the number of members in the family, while the meat preference and income are dismissed.

Development of a modified dry curing process for beef.

Science.gov (United States)

Hayes, J E; Kenny, T A; Ward, P; Kerry, J P

2007-11-01

The development of a dry curing process using physical treatments to promote the diffusion of the cure ingredients was studied. Vacuum pulsing with and without tumbling, continuous vacuum, and tumbling only treatments were compared with a conventional static dry cure control method on beef M. supraspinatus. Vacuum tumble and tumble only treatments gave highest core salt content after 7 days conditioning (3.3% and 3.1%, respectively). All test treatments resulted in higher colour uniformity and lower % cook loss in comparison to control (PCured beef slices were stored in modified atmosphere packs (MAP) (80%N(2):20%CO(2)) for up to 28 day at 4°C. Redness (a(∗), Pcured beef products with enhanced organoleptic quality and increased yields.

Qualitative and quantitative assessment of DNA quality of frozen beef based on DNA yield, gel electrophoresis and PCR amplification and their correlations to beef quality.

Science.gov (United States)

Zhao, Jing; Zhang, Ting; Liu, Yongfeng; Wang, Xingyu; Zhang, Lan; Ku, Ting; Quek, Siew Young

2018-09-15

Freezing is a practical method for meat preservation but the quality of frozen meat can deteriorate with storage time. This research investigated the effect of frozen storage time (up to 66 months) on changes in DNA yield, purity and integrity in beef, and further analyzed the correlation between beef quality (moisture content, protein content, TVB-N value and pH value) and DNA quality in an attempt to establish a reliable, high-throughput method for meat quality control. Results showed that frozen storage time influenced the yield and integrity of DNA significantly (p quality degraded dramatically with the increased storage time based on gel electrophoresis results. Polymerase chain reaction (PCR) products from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were observed in all frozen beef samples. Using real-time PCR for quantitative assessment of DNA and meat quality revealed that correlations could be established successfully with mathematical models to evaluate frozen beef quality. Copyright © 2018 Elsevier Ltd. All rights reserved.

[Study of biological value of beef produced by interspecies hybrids of domestic cattle and wild yaks].

Science.gov (United States)

Bagirov, V A; Chernukha, I M; Lisitsin, A V; Zinovieva, N A

2014-01-01

The comparative study of the chemical composition and biological values of beef produced by hybrids of Angus cattle with wild yaks (hybrid beef) and pure-bred Angus cattle (traditional beef) has been carried out. Longissimus muscle samples were used for analysis. It was observed, that the hybrid beef samples had the practically equal protein content comparing to traditional beef (21.1 vs. 21.6 per cent) but were characterized by the lower fat content (1.2 vs. 2.5 per cent). The higher biological value of hybrid beef comparing to traditional beef has been shown. The value of protein-quality index, calculated as the ratio of tryptophan amino acid to oxyprolin and characterizing the ratio of high biological value proteins to low biological value proteins was 8.1 vs. 5.7. The values of amino acid indexes [ratio of essential amino acids (EAA) to non-essential amino acids (NAA) and ratio of EAA to the total amount of amino acids (TAA)] were EAA/NAA = 0.77 vs. 0.65 and EAA/TAA = 0.43 vs. 0.39. The protein of hybrid beef was characterized by the higher content of a number of the essential amino acids: by a factor of 1, 77 for threonin, 1.23--for valin, 1.09--for lysin, 1.17--for leucine and 1.19--for tryptophan. The amount of the essential amino acids in 1 gram of protein of the hybrid beef was 434.7 mg against 393.1 mg for traditional beef It has been shown, that the protein of the hybrid beef comparing to traditional beef is characterized by the higher values of the amino acid scores calculated for EAA.

An overview of microbial food safety programs in beef, pork, and poultry from farm to processing in Canada.

Science.gov (United States)

Rajić, Andrijana; Waddell, Lisa A; Sargeant, Jan M; Read, Susan; Farber, Jeff; Firth, Martin J; Chambers, Albert

2007-05-01

Canada's vision for the agri-food industry in the 21st century is the establishment of a national food safety system employing hazard analysis and critical control point (HACCP) principles and microbiological verification tools, with traceability throughout the gate-to-plate continuum. Voluntary on-farm food safety (OFFS) programs, based in part on HACCP principles, provide producers with guidelines for good production practices focused on general hygiene and biosecurity. OFFS programs in beef cattle, swine, and poultry are currently being evaluated through a national recognition program of the Canadian Food Inspection Agency. Mandatory HACCP programs in federal meat facilities include microbial testing for generic Escherichia coli to verify effectiveness of the processor's dressing procedure, specific testing of ground meat for E. coli O157:H7, with zero tolerance for this organism in the tested lot, and Salmonella testing of raw products. Health Canada's policy on Listeria monocytogenes divides ready-to-eat products into three risk categories, with products previously implicated as the source of an outbreak receiving the highest priority for inspection and compliance. A national mandatory identification program to track livestock from the herd of origin to carcass inspection has been established. Can-Trace, a data standard for all food commodities, has been designed to facilitate tracking foods from the point of origin to the consumer. Although much work has already been done, a coherent national food safety strategy and concerted efforts by all stakeholders are needed to realize this vision. Cooperation of many government agencies with shared responsibility for food safety and public health will be essential.

Carbon footprint and ammonia emissions of California beef production systems.

Science.gov (United States)

Stackhouse-Lawson, K R; Rotz, C A; Oltjen, J W; Mitloehner, F M

2012-12-01

Beef production is a recognized source of greenhouse gas (GHG) and ammonia (NH(3)) emissions; however, little information exists on the net emissions from beef production systems. A partial life cycle assessment (LCA) was conducted using the Integrated Farm System Model (IFSM) to estimate GHG and NH(3) emissions from representative beef production systems in California. The IFSM is a process-level farm model that simulates crop growth, feed production and use, animal growth, and the return of manure nutrients back to the land to predict the environmental impacts and economics of production systems. Ammonia emissions are determined by summing the emissions from animal housing facilities, manure storage, field applied manure, and direct deposits of manure on pasture and rangeland. All important sources and sinks of methane, nitrous oxide, and carbon dioxide are predicted from primary and secondary emission sources. Primary sources include enteric fermentation, manure, cropland used in feed production, and fuel combustion. Secondary emissions occur during the production of resources used on the farm, which include fuel, electricity, machinery, fertilizer, and purchased animals. The carbon footprint is the net exchange of all GHG in carbon dioxide equivalent (CO(2)e) units per kg of HCW produced. Simulated beef production systems included cow-calf, stocker, and feedlot phases for the traditional British beef breeds and calf ranch and feedlot phases for Holstein steers. An evaluation of differing production management strategies resulted in ammonia emissions ranging from 98 ± 13 to 141 ± 27 g/kg HCW and carbon footprints of 10.7 ± 1.4 to 22.6 ± 2.0 kg CO(2)e/kg HCW. Within the British beef production cycle, the cow-calf phase was responsible for 69 to 72% of total GHG emissions with 17 to 27% from feedlot sources. Holstein steers that entered the beef production system as a by-product of dairy production had the lowest carbon footprint because the emissions

Beef Quality Identification Using Thresholding Method and Decision Tree Classification Based on Android Smartphone

Directory of Open Access Journals (Sweden)

Kusworo Adi

2017-01-01

Full Text Available Beef is one of the animal food products that have high nutrition because it contains carbohydrates, proteins, fats, vitamins, and minerals. Therefore, the quality of beef should be maintained so that consumers get good beef quality. Determination of beef quality is commonly conducted visually by comparing the actual beef and reference pictures of each beef class. This process presents weaknesses, as it is subjective in nature and takes a considerable amount of time. Therefore, an automated system based on image processing that is capable of determining beef quality is required. This research aims to develop an image segmentation method by processing digital images. The system designed consists of image acquisition processes with varied distance, resolution, and angle. Image segmentation is done to separate the images of fat and meat using the Otsu thresholding method. Classification was carried out using the decision tree algorithm and the best accuracies were obtained at 90% for training and 84% for testing. Once developed, this system is then embedded into the android programming. Results show that the image processing technique is capable of proper marbling score identification.

Comparative analysis of the demand for beef and mutton among ...

African Journals Online (AJOL)

Beef and mutton are meat types derived from cattle and sheep respectively. They are popular meat sources for households in Enugu metropolis Nigeria, although in ... that was significant in explaining the household expenditure on mutton. The expenditure elasticity for beef was 0.885, while that of mutton was 0.00073.

Evaluation of bull fertility in dairy and beef cattle using cow field data.

Science.gov (United States)

Berry, D P; Evans, R D; Mc Parland, S

2011-01-01

A successful outcome to a given service is a combination of both male and female fertility. Despite this, most national evaluations for fertility are generally confined to female fertility with evaluations for male fertility commonly undertaken by individual breeding organisations and generally not made public. The objective of this study was to define a pertinent male fertility trait for seasonal calving production systems, and to develop a multiple regression mixed model that may be used to evaluate male fertility at a national level. The data included in the study after editing consisted of 361,412 artificial inseminations from 206,683 cow-lactations (134,911 cows) in 2,843 commercial dairy and beef herds. Fixed effects associated with whether a successful pregnancy ensued (pregnant = 1) or not (pregnant = 0) from a given service were year by month of service, day of the week, days since calving, cow parity, level of calving difficulty experienced, whether or not the previous calving was associated with perinatal mortality, and age of the service bull at the date of insemination. Non-additive genetic effects such as heterosis and recombination loss as well as inbreeding level of the service bull, dam or mating were not associated with a successful pregnancy; there was no difference in pregnancy rate between fresh or frozen semen. Random effects included in the model were the additive genetic effect of the cow, as well as a within lactation and across lactation permanent environmental effect of the cow; pedigree group effects based on cow breed were also included via the relationship matrix. Temporal differences in the AI technician and service bull were also included as random effects. A difference in five percentage units in male fertility was evident between the average effects of different dairy and beef breeds. The correlation between raw pregnancy rates for bulls with more than 100 services (n = 431) and service bull solutions from the mixed model analysis

Effect of chronological age of beef steers of different maturity types ...

African Journals Online (AJOL)

Effect of chronological age of beef steers of different maturity types on their growth ... and carcass studies have been conducted in the sourveld regions of the country. ... different beef maturity types which differ in body frame size were used, viz.

The beef market in the European Union

DEFF Research Database (Denmark)

Nielsen, Niels Asger; Jeppesen, Lisbeth Fruensgaard

characteristics determining the consumers' value perception of a piece of meat appear to be fat, tenderness, taste and freshness. 7. The primary production of beef is fragmented in most European countries and the average number of cattle at a European cattle farm is only slowly rising. Two thirds of the cows...... of cattle going through markets is declining. 10. Product quality has been very difficult to control in the beef sector. The cattle supplied for slaughtering is of a very varying quality with regard to important consumer-oriented quality characteristics like tenderness and taste, and the lack...

Temperament affects rangeland use patterns and reproductive performance of beef cows

Science.gov (United States)

• The American beef industry is paying more attention to cattle temperament, but studies examining relationships between temperaments and grazing behavior or animal performance on rangelands are limited. • We studied range beef cow temperaments using the behavioral syndromes framework. Cows classifi...

Identification of offal adulteration in beef by laser induced breakdown spectroscopy (LIBS).

Science.gov (United States)

Velioglu, Hasan Murat; Sezer, Banu; Bilge, Gonca; Baytur, Süleyman Efe; Boyaci, Ismail Hakki

2018-04-01

Minced meat is the major ingredient in sausages, beef burgers, and similar products; and thus it is the main product subjected to adulteration with meat offal. Determination of this kind of meat adulteration is crucial due to religious, economic and ethical concerns. The aim of the present study is to discriminate the beef meat and offal samples by using laser induced breakdown spectroscopy (LIBS). To this end, LIBS and multivariate data analysis were used to discriminate pure beef and offal samples qualitatively and to determine the offal mixture adulteration quantitatively. In this analysis, meat samples were frozen and LIBS analysis were performed. The results indicate that by using principal component analysis (PCA), discrimination of pure offal and offal mixture adulterated beef samples can be achieved successfully. Besides, adulteration ratio can be determined using partial least square analysis method (PLS) with 0.947 coefficient of determination (R 2 ) and 3.8% of limit of detection (LOD) values for offal mixture adulterated beef samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

01 Nsoso - A survey of traditional beef cattle farmers....…

African Journals Online (AJOL)

annaline

The aims of this survey were to characterise traditional beef cattle farmers and evaluate the adoption of certain improved ... The survey was conducted from March 2002 to October 2002. Beef cattle farmers from fifty (50) .... The most important advantages of using AI in traditional farming in Botswana is that it would lead to ...

RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

Directory of Open Access Journals (Sweden)

A. Y. Prosekov

2016-01-01

Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

Ecosystems Potency of Small and Outer Islands of Indonesia for Beef Cattle Farming Development

Directory of Open Access Journals (Sweden)

Ismeth Inounu

2007-12-01

Full Text Available Indonesian archipelago consists of five main islands and more than seventeen thousand of small islands. These small islands are very effective as natural barrier to the spread of contagious animal diseases. This situation is very advantageous to develop many programs such as beef cattle farming to support beef self sufficient program in 2010. However, there are some constraints in developing of these small islands, namely human resources, natural resources, infrastructure, mean of communications and transportations and lack of intra sector integrated coordination. In taking the advantageous of developing small islands as a screening base and quarantine area, animal production technologies and veterinary science are much needed. The development can be done in integration with transmigration development program so that the beef cattle development could become source of income and job opportunity for the transmigran and local inhabitant as well. Beef cattle farming scheme are recommended by doing cow-calf operation or fattening. Political support from government and legislative are needed in establishment of infrastructure in the area chosen as beef cattle farming location. Besides, it need facilitations in land procurement for beef cattle farming, legal aspect, supports of law enforcement, simple regulation in land used and zone management planning, regulation in controlling beef importation, and credit with minimum interest rate.

Meat Science and Muscle Biology Symposium: Escherichia coli O157:H7, diet, and fecal microbiome in beef cattle.

Science.gov (United States)

Wells, J E; Kim, M; Bono, J L; Kuehn, L A; Benson, A K

2014-04-01

Shiga-toxigenic Escherichia coli, such as E. coli O157:H7, are foodborne zoonotic pathogens that can cause severe illness and death in humans. The gastrointestinal tract of ruminant animals has been identified as a primary habitat for E. coli O157:H7 and, in cattle, the hindgut tract appears to be a primary site for colonization. This pathogen has been found in cattle feces, on cattle hides, and in the production environment, and transmission to humans has occurred as a result of consumption of contaminated ground beef, water, and produce. Interventions to reduce the pathogen at beef harvest have significantly reduced the occurrence of the pathogen, but outbreaks and recalls due to the pathogen still occur for beef products. Interventions in the feedyard before harvest have had little success, but critical control points for implementing interventions are limited compared with the beef abattoir. The percentage of animals shedding E. coli O157:H7 in the feces can be highly variable from pen to pen, and the levels in the feces can vary from animal to animal. Animals colonized and shedding E. coli O157:H7 at high levels are a small fraction of animals in a pen but are important source for transferring the pathogen amongst the penmates. Recent research has indicated that diet may greatly influence the shedding of E. coli O157:H7. In addition, diet can influence the microbiota composition of the feces. However, little is known about the interaction between the indigenous microbiota and fecal shedding of E. coli O157:H7. Understanding the influence of indigenous microbiota on the colonization and shedding of E. coli O157:H7 will provide a potential avenue for intervention in the preharvest production environment not yet exploited.

A Review of Sustainability Enhancements in the Beef Value Chain: State-of-the-Art and Recommendations for Future Improvements

Science.gov (United States)

Maia de Souza, Danielle; Petre, Ruaraidh; Jackson, Fawn; Hadarits, Monica; Pogue, Sarah; Carlyle, Cameron N.; Bork, Edward; McAllister, Tim

2017-01-01

Simple Summary To better address consumer concerns, the beef sector is working on strategies to enhance the sustainability of all aspects of the beef supply chain. Among these strategies are (1) the development of science-based frameworks and indicators capable of measuring progress at all stages of beef production; (2) the engagement of different stakeholders along the beef supply chain at regional and global levels; and (3) the improvement of communication among stakeholders and transparency towards consumers. Progress on these three fronts was presented during the 2nd Global Conference on Sustainable Beef, hosted by the Global and Canadian Roundtables for Sustainable Beef. During the event, there was a clear understanding that the beef industry is substantially advancing efforts to continuously improve its sustainability, both at regional and global levels, by developing assessment frameworks and indicators to measure progress. However, it is also clear that the beef sector has a need to more clearly define the concept of beef sustainability, strengthen cooperation and exchange of information among national roundtables for sustainable beef, as well as improve the flow of information along the supply chain. An improved transparency in the beef sector will help consumers make more informed decisions about food products. Abstract The beef sector is working towards continually improving its sustainability in order to achieve environmentally, socially and economically desirable outcomes, all of which are of increasing concern to consumers. In this context, the Global Roundtable for Sustainable Beef (GRSB) provides guidance to advance the sustainability of the beef industry, through increased stakeholder engagement and the formation of national roundtables. Recently, the 2nd Global Conference on Sustainable Beef took place in Banff, Alberta, Canada, hosted by the GRSB and the Canadian Roundtable for Sustainable Beef. Conference attendees discussed the various

Genotype x Nutritional Environment Interaction in a Composite Beef Cattle Breed

Science.gov (United States)

Environmental effects have been shown to influence several economically important traits in beef cattle. In this study, genetic x nutritional environment interaction has been evaluated in a composite beef cattle breed(50% Red Angus, 25% Charolais, 25% Tarentaise).Cows were randomly assigned to be fe...

Parsing and Quantification of Raw Orbitrap Mass Spectrometer Data Using RawQuant.

Science.gov (United States)

Kovalchik, Kevin A; Moggridge, Sophie; Chen, David D Y; Morin, Gregg B; Hughes, Christopher S

2018-06-01

Effective analysis of protein samples by mass spectrometry (MS) requires careful selection and optimization of a range of experimental parameters. As the output from the primary detection device, the "raw" MS data file can be used to gauge the success of a given sample analysis. However, the closed-source nature of the standard raw MS file can complicate effective parsing of the data contained within. To ease and increase the range of analyses possible, the RawQuant tool was developed to enable parsing of raw MS files derived from Thermo Orbitrap instruments to yield meta and scan data in an openly readable text format. RawQuant can be commanded to export user-friendly files containing MS 1 , MS 2 , and MS 3 metadata as well as matrices of quantification values based on isobaric tagging approaches. In this study, the utility of RawQuant is demonstrated in several scenarios: (1) reanalysis of shotgun proteomics data for the identification of the human proteome, (2) reanalysis of experiments utilizing isobaric tagging for whole-proteome quantification, and (3) analysis of a novel bacterial proteome and synthetic peptide mixture for assessing quantification accuracy when using isobaric tags. Together, these analyses successfully demonstrate RawQuant for the efficient parsing and quantification of data from raw Thermo Orbitrap MS files acquired in a range of common proteomics experiments. In addition, the individual analyses using RawQuant highlights parametric considerations in the different experimental sets and suggests targetable areas to improve depth of coverage in identification-focused studies and quantification accuracy when using isobaric tags.

Evaluation of a cross contamination model describing transfer of salmonella spp. and listeria monocytogenes during grinding of pork and beef

DEFF Research Database (Denmark)

Møller, Cleide Oliveira de Almeida; Hansen, Tina Beck; Aabo, Søren

2015-01-01

Introduction: The cross contamination model (Møller et al. 2012) was evaluated to investigate its capability of describing transfer of Salmonella spp. and Listeria monocytogenes during grinding of pork and beef of varying sizes (50 – 324 g) and numbers of pieces to be ground (10 – 100), in two...... processing. QMRA risk estimates and TTP both revealed that risk attribution from grinding was mainly influenced by sharpness of grinder knife > specific grinder > grinding temperature whereas the specific pathogen was of minor importance....

GPM GROUND VALIDATION NOAA UHF 449 PROFILER RAW DATA SPC FORMAT MC3E V1

Data.gov (United States)

National Aeronautics and Space Administration — The NOAA UHF 449 Profiler Raw SPC foramt data was collected during the NASA supported Midlatitude Continental Convective Clouds Experiment (MC3E). The Ultra High...

Sequencing and Characterization of Divergent Marbling Levels in the Beef Cattle ( Muscle Transcriptome

Directory of Open Access Journals (Sweden)

Dong Chen

2015-02-01

Full Text Available Marbling is an important trait regarding the quality of beef. Analysis of beef cattle transcriptome and its expression profile data are essential to extend the genetic information resources and would support further studies on beef cattle. RNA sequencing was performed in beef cattle using the Illumina High-Seq2000 platform. Approximately 251.58 million clean reads were generated from a high marbling (H group and low marbling (L group. Approximately 80.12% of the 19,994 bovine genes (protein coding were detected in all samples, and 749 genes exhibited differential expression between the H and L groups based on fold change (>1.5-fold, p<0.05. Multiple gene ontology terms and biological pathways were found significantly enriched among the differentially expressed genes. The transcriptome data will facilitate future functional studies on marbling formation in beef cattle and may be applied to improve breeding programs for cattle and closely related mammals.

Quality factors in beef, pork, and lamb cooked by microwaves.

Science.gov (United States)

Korschgen, B M; Baldwin, R E; Snider, S

1976-12-01

Three cooking treatments were applied to the longissimus muscle of beef and of pork and to deboned leg of lamb. Cooking treatments included: Intermittent energy application (3-min. cycle) with a microwave range operated at 220V and intermittent energy application (6-min. cycle) with a microwave range operated at 115V. Control roasts were cooked in a conventional gas oven (163+/-3 degrees C.). Cooking was adjusted so that roasts achieved an internal temperature of 70 degrees C. when cut for analyses. Cooking losses were significantly greater for microwave than for conventionally cooked beef. However, microwave cooking resulted in beef, pork, and lamb roasts with flavor of interior portions similar to those prepared conventionally. Flavor differences in samples from the edge of the slices of lamb and of pork and tenderness of lamb appeared to be related to cooking method. For these attributes, meat cooked conventionally was superior. In contrast, patterns in significant differences in tenderness and juiciness of beef and of pork were not consistent and were not related solely to method of cookery. Neither creatine nor creatinine was a good index of flavor of meat cooked by these methods. Aside from the time-saving aspect of microwave heating, there was no major advantage of one method of cooking over another. Thus, either high- or low- powered microwave equipment, operated at 2450 MHz, can be used satisfactorily for cooking tender cuts of beef, pork, and lamb.

European consumers' acceptance and rejection of novel beef technologies

DEFF Research Database (Denmark)

de Barcellos, Marcia Dutra; Kügler, Jens Oliver; Grunert, Klaus G.

As part of ProSafeBeef, an integrated research project funded by the European Commission, the present qualitative study was carried out with European consumers to obtain insights into their acceptance or rejection of eight selected novel beef production and processing technologies, identified here...... capital cities: Madrid, Paris, Berlin and London. A common and translated topic guide was developed prior to the field work. A ranking exercise was applied, where the participants classified the technologies into accepted, neutral or rejected concepts, after discussing the perceived benefits and risks...... in society, global warming crisis, disease outbreaks and degradation of the environment are shaping consumers' opinion in regard to food production. There was a severe criticism about too much intervention in food and a strong desire to keep food and beef processing as simple and natural as possible....

Beef Cattle Production. An Instructional Unit for Teachers of Adult Vocational Education in Agriculture.

Science.gov (United States)

Metzger, Bruce; Iverson, Maynard J.

The unit on beef cattle production is designed primarily for the adult farmer program in Kentucky as an aid to making the beef enterprise more profitable. It is aimed primarily at the commercial producer. The lessons center on some of the more important economic points in beef cattle production. Ten lessons comprise the unit, which can be adapted…

Environmental impacts of beef production

NARCIS (Netherlands)

Gerber, P.J.; Mottet, Anne; Opio, C.I.; Falcucci, Alessandra; Teillard, Félix

2015-01-01

Beef makes a substantial contribution to food security, providing protein, energy and also essential micro-nutrients to human populations. Rumination allows cattle - and other ruminant species - to digest fibrous feeds that cannot be directly consumed by humans and thus to make a net positive

Rosemary and Pitanga Aqueous Leaf Extracts On Beef Patties Stability under Cold Storage

Directory of Open Access Journals (Sweden)

Flávia Carolina Vargas

Full Text Available ABSTRACT Because processing and storage conditions affect several beef quality attributes, the food industry uses a variety of synthetic antioxidants. However, some synthetic antioxidants have been questioned regarding its safety, and thus the interest in using natural antioxidants in food products is increasing. This paper aimed at assessing leaf aqueous extracts of Rosemary (Rosmarinus officinalis Linnaeus and Pitanga (Eugenia uniflora Linnaeus as antioxidants in beef cold storage. After 48h storage, patties added of Rosemary leaf extracts showed increased pH. Patties added of Pitanga extracts had the lowest a* color values. Oxymyoglobin levels were significantly higher for Negative control, than for Pitanga treatment. The 10% extract addition increased lipid oxidation of beef patties. Correlation coefficients between lipid and myoglobin oxidations were all above 0.85. Pitanga leaf extracts negatively influenced beef color, probably because of its higher chlorophyll content. Lipid oxidation of beef patties was increased with the addition of leaf extracts. The inclusion of 10% leaf extract into beef patties seems not suitable, because it may enhance the amount of prooxidant compounds, as well as the amount of substances capable of reacting with lipid secondary products. Correlations between lipid and myoglobin oxidations demonstrated strong relationship.

Strategic raw materials. Risk management

International Nuclear Information System (INIS)

Bertau, Martin; Matschullat, Joerg; Kausch, Peter

2014-01-01

This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de

Effect of ageing time on consumer-perceived quality of Italian Simmental beef

Directory of Open Access Journals (Sweden)

Luisa Antonella Volpelli

2010-01-01

Full Text Available The aim of the experiment was to provide an objective indication on the optimal ageing time of meat from ItalianSimmental (IS young bulls, the most important commercial category of the breed. The research was carried out on 10young bulls slaughtered at the average weight of 688 kg (SE: 7.3 kg. The right side of each carcass was stored for 7days and the left one for further 7 days, at normal refrigeration temperatures. At the end of the ageing period, the sideswere sampled at the loin for meat pH, color, cooking loss and shear force measurement. A central location, affective testinvolving 74 consumers was carried out to measure the degree of liking for grilled beef aged 7 or 14 days.The pH and color parameters were not significantly affected by the duration of post-mortem storage, while cooking lossincreased (31.4 vs 32.6 %; Pincreased from 7 to 14 days. The degree of liking by the untrained respondents for the two types of cooked meat wasdifferent, considering that consumers gave the highest hedonistic scores to beef aged 14 days. Tenderness was the sensoryattribute that allowed the best discrimination between beef stored for periods of different length. In fact, while thedifference between 14-day-aged and 7-day-aged beef for flavour ratings (7.0 vs 6.9 did not reach the threshold of significance,the former meat was perceived as significantly finer than the latter regarding tenderness (6.5 vs 5.6; P= 0.01and marginally preferred in overall terms (6.9 vs 6.5; P= 0.07. The classification test, carried out at the end of the quantitativetest by asking consumers to select from a list the most appropriate attributes describing the stimuli associatedwith meat consumption, confirmed the effectiveness of texture attributes in ranking different-aged beef acceptability. Infact, the number of ticks reported for chewiness and juiciness descriptors were different for the two types of meat: the14-day-aged beef was perceived as easier to chew (57 vs 34 ticks

Molecular Method Development to Identify Foodborne Sarcocystishominis in Raw Beef Commercial Hamburger

Directory of Open Access Journals (Sweden)

Bahador Hajimohammadi

2014-11-01

Full Text Available Background: Sarcocystisspp. is zoonotic parasitic pathogen endangering safety of meat and derived meat products such as hamburgers which is among the most popular fast foods worldwide. Objectives: The current study aimed to design a protocol for molecular identification of Sarcocystis hominis in commercial hamburgers using PCR-RFLP with target of 18S rRNA. Materials and Methods: A total of 25 raw commercial hamburger samples were randomly collected from supermarkets of Yazd city, Iran. Five mm slices from different parts of each sample were selected, well mixed, and then preserved in ethanol 70% at -20°C for the next steps. The genomic DNA was extracted using salting out method. Detection and identification of Sarcocystis isolates were performed using PCR RFLP. The 18s rRNA gene sequence was mined from GenBank and the specific primer pair was designed using Primer3 software. Restriction fragment length polymorphims (RFLP analysis was performed using BfaI and RsaI restriction enzymes. The digestion was analyzed, using agarose gel electrophoresis alongside 100base pair DNA ladder. Results: Among 25 commercial hamburger samples, 17 samples showed a PCR product around 900 bp which could detect Sarcocyst Spp. After RFLP with BfaI, the restriction fragments of 376 bp and 397 bp detected S. hominis or S. hirsuta and fragments of 184 bp, 371 bp and 382 bp detected S. cruzi. After RFLP with RsaI, the restriction fragments of 376 bp and 557 bp detected S. hirsuta and fragment of 926 bp, without any digestion, detected S. hominis. For verification, each species detected in samples was randomly selected and sent for sequencing and the results were analyzed with BLAST. Conclusions: In conclusion, the current study developed a practical technique to detect the prevalence of S. hominis in meat products such as hamburgers.

GPM GROUND VALIDATION NOAA S-BAND PROFILER RAW DATA NETCDF FORMAT MC3E V1

Data.gov (United States)

National Aeronautics and Space Administration — The S-band Profiler Raw dataset was saved in two data formats: netCDF anda proprietary Vaisala SPC format. The numeric values in both formats are exactly the same....

Food Safety and Raw Milk

Science.gov (United States)

... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

Whole maae versus ground matze in fattening diets for beef steers

African Journals Online (AJOL)

Beide groepe is vir 105 dae teen ad libitum peile gevoer. Geen statisties betekenisvolle verskille, in terme van groei- en doeltreffendheidsparameters, kon tussen die twee .... to that of the complete diet based on ground maue. The added advantage of savings in processing of the maizr, protein and roughage would therefore.

Possibility of introducing Smallholder Beef Cattle Farmer’s Association as a starting point to develop the beef cattle chain and improve their income in Arua district, Uganda

NARCIS (Netherlands)

Candia, A.

2008-01-01

The theme of the research is “Possibility of introducing smallholder Beef Cattle Farmers Association as a starting point to develop the beef chain and improve their income in Arua district, Uganda”. The study was carried out in two Sub Counties of Arua district, Uganda. The objective was to

Transport of Cryptosporidium parvum oocysts in soil columns following applications of raw and separated liquid slurry

DEFF Research Database (Denmark)

Petersen, Heidi Huus; Enemark, Heidi L.; Olsen, Annette

2012-01-01

to determine the effectiveness of different slurry separation technologies to remove oocysts and other pathogens, as well as whether application of separated liquid slurry to agricultural land may represent higher risks for ground water contamination as compared to application of raw slurry.......The potential for transport of viable Cryptosporidium parvum oocysts through soil to land drains and groundwater was studied using simulated rainfall and intact soil columns which were applied raw slurry or separated liquid slurry. Following irrigation and weekly samplings over a four week period......, C. parvum oocysts were detected from all soil columns regardless of slurry type and application method although recovery rates were low (liquid slurry leached 73% and 90% more oocysts compared with columns with injected and surface applied raw slurry, respectively...

The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

Directory of Open Access Journals (Sweden)

Christian James

2015-01-01

Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

A nationwide survey on seroprevalence of Neospora caninum infection in beef cattle in Uruguay.

Science.gov (United States)

Bañales, Pedro; Fernandez, Leandro; Repiso, María V; Gil, Andres; Dargatz, David A; Osawa, Takeshi

2006-06-30

Bovine abortions due to Neospora caninum infection have been reported worldwide and its economic impact on the beef industry has been acknowledged as a problem. Uruguay has the largest export value of beef per acre in South America. However, no data on the prevalence of N. caninum infection have been available in this country. The objective of this study was to estimate the prevalence and distribution of N. caninum infection in beef cattle in Uruguay through a nationwide survey. A two stage sampling design was used with farms being selected in stage one and animals being selected in stage two. A brief questionnaire was administered on each farm. Seroprevalence of N. caninum in 4444 beef cattle from 229 farms in all the counties, except Montevideo, of Uruguay was determined by an ELISA. The data were then analyzed to identify associations between infection and variables such as type of animal (cow or heifer), herd size, use of veterinary advice, productivity of the soil in relation to the national average, use of improved grass, use of mineral salts, use of supplemental feed, and presence of a dog(s) on the farm. The estimated proportion of positive farms for all the beef cattle operations was 69.2% (95% confidence interval [CI], 53.7-84.7). The overall cattle seroprevalence was estimated as 13.9% (95% CI, 11.6-16.3). The prevalence estimation by animal category was 14.3% (95% CI, 11.4-17.2) for beef cows and 12.9% (95% CI, 10.0-15.8) for beef heifers. There was no significant difference in the estimated prevalence between the two animal types. There was no significant difference in the animal level prevalence of N. caninum infection among different herd sizes. None of the herd demographic or management variables was significantly associated with the seropositivity to N. caninum infection. In conclusion, these results show that N. caninum infection is common among beef herds across Uruguay. Since the beef industry is one of the key industries in Uruguay, the

Sensory quality of beef from different finishing diets.

Science.gov (United States)

Resconi, V C; Campo, M M; Font i Furnols, M; Montossi, F; Sañudo, C

2010-11-01

Beef production under different local husbandry systems might have meat sensory quality implications for the marketing of these products abroad. In order to assess the effect of finishing diet systems on beef quality, a trained sensory taste panel assessed meat aged for 20 days from 80 Uruguayan Hereford steers that were finished on one of the following diets: T1=Pasture [4% of animal live weight (LW)], T2=Pasture [3% LW plus concentrate (0.6% LW)], T3=Pasture [3% LW plus concentrate (1.2% LW)], or T4=Concentrate plus hay ad libitum. Beef odour and flavour intensities decreased with an increase in the energy content of the diet. The meat from T2 had the lowest acid flavour and strange odours intensities. In general, steers fed only concentrate plus hay (T4) produced meat that had an inferior sensory quality because they had more pronounced off-flavours and was tougher. Copyright © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.

Physical and sensory characterization and consumer preference of corn and barley-fed beef.

Science.gov (United States)

Wismer, W V; Okine, E K; Stein, A; Seibel, M R; Goonewardene, L A

2008-11-01

Steaks from corn-fed and barley-fed beef were characterized by a trained panel, which rated corn-fed beef higher (pconsumers preferred (pconsumers showed no preference (p>0.05) for either type of finished beef. Japanese consumers showed a preference (ppreference for cooked corn-fed steaks (p0.05) were observed for Warner-Bratzler shear, marbling scores, cooking losses or Hunter colorimeter values. There was a trend for higher concentrations (p0.10) in mono or polyunsaturated fatty acids.

Impacts of glutathione Maillard reaction products on sensory characteristics and consumer acceptability of beef soup.

Science.gov (United States)

Hong, J H; Jung, D W; Kim, Y S; Lee, S M; Kim, K O

2010-10-01

The sensory characteristics and consumer acceptability of beef soup with added glutathione Maillard reaction products (GMRPs) were investigated to examine the effects of the GMRPs on beef-soup flavor compared to soups made with glutathione (GSH) and monosodium glutamate (MSG), a control (CON), or a control soup made with 150% beef content (CON150). The sensory characteristics of the beef soups were examined by descriptive analysis. The overall acceptabilities of the beef soups were rated by consumers. Principal component analysis was performed on descriptive data as explanatory variables with overall acceptability as a supplementary variable to observe the relationships between the descriptive data and consumer acceptability, as well as the relationships between the beef-soup samples and their sensory attributes. The samples containing GMRPs had "beef flavor" that was stronger than the CON and MSG samples, and comparable to that of the GSH sample and CON150. The GMRP samples had stronger "green onion flavor,"garlic flavor," and "boiled egg white flavor" than the other samples. The beef soup containing MSG was preferred to CON, CON150, and GSH. The samples with GMRPs were least favored because of their pronounced metallic and astringent notes. The results of this study imply the feasibility of GMRPs as a flavor enhancer since the soups containing these compounds showed more complex flavor profiles than GSH. However, future studies are required to optimize the MR conditions that produce GMRPs without undesirable characteristics. Practical Application: This study examined the practicability of the Maillard reaction products between glutathione (GSH) and glucose (GP) or fructose (FP) as a flavor enhancer by investigating the sensory characteristics and consumer acceptability evoked by them in a beef-soup system. This study helps flavor and food industry to develop a new flavor enhancer by providing practical information, such as beef flavor-enhancing effect of FP and

Optimal Stochastic Advertising Strategies for the U.S. Beef Industry

OpenAIRE

Kun C. Lee; Stanley Schraufnagel; Earl O. Heady

1982-01-01

An important decision variable in the promotional strategy for the beef sector is the optimal level of advertising expenditures over time. Optimal stochastic and deterministic advertising expenditures are derived for the U.S. beef industry for the period `1966 through 1980. They are compared with historical levels and gains realized by optimal advertising strategies are measured. Finally, the optimal advertising expenditures in the future are forecasted.

Suckling behaviour and fertility in beef cows on pasture 2. Influence ...

African Journals Online (AJOL)

For two weeks prior to the start of the breeding season, the sucklingbehaviour of beef calves, separated from their dams for 12 h out of ..... BARB., C.R.. 1986. Naloxone infusion increases pulsatile luteinizing hormone release in post partum beef cows. Dom. Anim. Endocrin. 3, 49. WILLIAMS. G.L., KOTWICA. 1., SLANGER ...

The effects of skeletal separation and moisture enhancement for improving the eating quality of cull cow beef.

Science.gov (United States)

Streiter, P J; Campbell, C P; Mandell, I B

2012-12-01

Sixty-two cull beef cows were slaughtered to investigate effects of skeletal separation and moisture enhancement on beef eating quality. Muscles from each carcass side were randomly assigned to 1) no postmortem processing (NPP), 2) prerigor skeletal separation (SS), 3) moisture enhancement (ME) using calcium ascorbate or 4) a combination of SS and ME (SS/ME). Postmortem processing treatment (PPT) by ageing (PM) interactions (Padditive effect of combining SS and ME improved palatability traits versus SS or ME alone. Panellists found no differences (P>0.14) in softness and tenderness between SS/ME and Canadian AA or AAA beef. Postmortem processing of beef cows may produce beef as tender and juicy as beef from younger carcasses. Copyright © 2012 Elsevier Ltd. All rights reserved.

REDISTILAT ASAP CAIR CANGKANG KELAPA SAWIT SEBAGAI BAHAN PENGAWET BAKSO SAPI [Redistilled Liquid Smoke of Oil-Palm Shells as a Preservative for Beef Meatballs

Directory of Open Access Journals (Sweden)

Suminar Setiati Achmadi

2015-06-01

Full Text Available Liquid smoke has been used to extend the shelf life of food. However, its composition varies considerably depending on the type of raw materials used and preparation precedure. Liquid smoke derived from palm oil shell is potential due to the abundance of its byproduct sources in the palm oil industry. This study thus aims to prepare the best fraction of liquid smoke that can extend the shelf life of beef meatballs at room temperature. The raw liquid smoke was redistilled at 80, 90, and 100°C and was used as an ingredient in the beef meatballs production. The gas chromatography-mass spectrometry identification showed that there were no harmful compounds such as derivatives of tar and polycyclic aromatic hydrocarbons. Liquid smoke produced from redistillation at 80°C had the best result for providing higher acid value and lower pH, i.e. 5.14% and 2.26, respectively. The LC50 value of the redistilled liquid smoke in brine shrimp lethality assay was 0.16%. Inhibition zones of 0.1 and 0.8% redistilled liquid smoke on the antibacterial test against Staphylococcus aureus were both 6.10 mm, while the zones of inhibition for Escherichia coli were 0 and 7.0 mm, respectively. These resulting inhibition zones were less effective than that of 100 ppm chloramphenicol, i.e. 14.2 mm on S. aureus and 12.6 mm on E. coli. The usage of redistilled liquid smoke at concentration of 0.8% in meatballs was found to inhibit total microbial growth greater than that of the addition at 0.1%. Moreover, the addition of redistilled liquid smoke inhibited the growth of microbial up to 18 hours at room temperature.

Flavor Characteristics of Hanwoo Beef in Comparison with Other Korean Foods

Directory of Open Access Journals (Sweden)

Hoa Van Ba

2012-03-01

Full Text Available The present study identified volatile flavor components of Hanwoo longissimus muscle and other Korean foods (Doenjang, Chungukjang, sesame oil and their traits were compared in relation with flavor precursors that include fatty acids and protein degradation products. Hanwoo longissimus muscle was purchased from a commercial abattoir while the other foods were sampled from three separate households. The results showed totals of 68 (9.94 μg/g, 60 (15.75 μg/g, 49 (107.61 μg/ml and 50 (7.20 μg/g volatile components for Doenjang, Chungukjang, sesame oil and Hanwoo beef longissimus, respectively (p<0.05. Aldehydes were the most predominant components in beef, but alcohols, acids and esters, and pyrazines are probably the major contributors to the flavor characteristics of other foods. SDS-PAGE revealed that beef longissimus muscle and Doenjang showed higher protein degradation than other foods which could be likely related to chiller ageing and ripening process. The total polyunsaturated fatty acids were approximately 50, 60, 41 and 5% for Doenjang, Chungukjang, sesame oil and beef longissimus muscle, respectively. Based on the mechanism(s of generation of the volatile compounds and the chemical composition of each food sample, differences and traits of volatile flavor components among the four food types are likely due to fatty acid profiles, proteolytic activity and processing conditions. Aroma intense compounds like pyrazines and sulfur-containing compounds were limited in cooked beef in the current experimental condition (i.e., relatively low heating temperature. This suggests that higher heating temperature as in the case of roasting is needed for the generation of high aroma notes in meat. Furthermore, proteolytic activity and stability of fatty acids during ageing have a great influence on the generation of flavor components in cooked beef.

A comparison of gamma-irradiation and microwave treatments on the lipids and microbiological pattern of beef liver

International Nuclear Information System (INIS)

Farag, R.S.; Daw, Z.Y.; Farag, S.A.; Abd El-Wahab, S.A.E.

2000-01-01

The effects of gamma-irradiation treatments (0, 2.5, 5 and, 10 kGy) and microwaves generated from an oven at low and defrost settings for 0.5, 1 and 2 min on the chemical composition and microbiological aspects of beef liver samples were studied. The chemical and microbiological analyses were performed on the non-treated and treated beef liver immediately after treatments and during frozen storage (-18 degree) for 3 months. The chemical analyses of beef liver lipids showed that acid, peroxide and TBA ( Thiobarbituric acid) values were slightly increased after irradiation treatments and also during frozen storage (-18 degree c). On the contrary, iodine value of the treated beef liver was decreased. Irradiation treatments remarkably reduced the total bacterial counts in beef liver. The percent reduction of bacterial load for beef liver exposed to microwaves generated from an oven at defrost mode for 2 min and after 3 months at (-18 degree c) was 62%. The bacterial load for beef liver exposed to gamma-irradiation at 10 kGy after 3 months at -18 degree c was decreased by 98%. Hence, gamma-irradiation treatment was far better than microwave treatment for inhibiting the multiplication of the associated microorganisms with beef liver. Salmonellae was not detected in non-irradiated and irradiated beef liver throughout the storage period

Inactivation of Escherichia coli O157:H7 in moisture-enhanced nonintact beef by pan-broiling or roasting with various cooking appliances set at different temperatures.

Science.gov (United States)

Shen, Cangliang; Geornaras, Ifigenia; Belk, Keith E; Smith, Gary C; Sofos, John N

2011-01-01

This study evaluated inactivation of Escherichia coli O157:H7 in moisture-enhanced restructured nonintact beef cooked to 65 °C using different cooking appliances set at different temperatures. Batches (2 kg) of coarse-ground beef (approximately 5% fat) were mixed with an 8-strain composite (100 mL) of rifampicin-resistant E. coli O157:H7 (6.4 ± 0.1 log CFU/g) and a solution (100 mL) of sodium chloride plus sodium tripolyphosphate to yield concentrations (wt/wt) of 0.5% and 0.25%, respectively, in the final product. Beef portions of 2.54 cm thickness (15 cm dia) were prepared and were vacuum-packaged and frozen (-20 °C, 42 h). Partially thawed (-2.5 ± 1.0 °C) portions were pan-broiled (Presto electric skillet and Sanyo grill) or roasted (Oster toaster oven and Magic Chef kitchen oven) to 65 °C. The appliances were set at, and preheated before cooking to 149 or 204 °C (electric skillet), 149 or 218 °C (grill), 149 or 232 °C (toaster oven), and 149, 204, or 260 °C (kitchen oven). Temperatures of appliances and beef samples were monitored with thermocouples, and meat samples were analyzed for surviving microbial populations. In general, the higher the appliance temperature setting, the shorter the time needed to reach 65 °C, and the higher the edge and surface temperatures of the meat samples. Temperatures of 204 to 260 °C, regardless of appliance, resulted in greater (P kitchen oven set at 260 °C. The results should be useful to the food service industry for selection of effective nonintact beef cooking protocols, and for use in risk assessments for nonintact meat products. Practical Application: Results of this study should be useful for developing cooking recommendations to enhance the safety of nonintact beef products, and for use in risk assessments of such products.

Scientific and technical factors affecting the setting of Salmonella criteria for raw poultry: a global perspective

NARCIS (Netherlands)

Mead, G.; Lammerding, A.M.; Cox, N.; Doyle, M.P.; Humbert, F.; Kulikovskiy, A.; Panin, A.; Pinheiro do Nascimento, V.; Wierup, M.; Zwietering, M.H.

2010-01-01

Concerns about foodborne salmonellosis have led many countries to introduce microbiological criteria for certain food products. If such criteria are not well-grounded in science, they could be an unjustified obstacle to trade. Raw poultry products are an important part of the global food market.

Raw material versus processing

International Nuclear Information System (INIS)

Berg, E.A.T.

1989-01-01

Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt

Veal Calves Produce Less Antibodies against C. Perfringens Alpha Toxin Compared to Beef Calves

Directory of Open Access Journals (Sweden)

Bonnie R. Valgaeren

2015-07-01

Full Text Available Enterotoxaemia is a disease with a high associated mortality rate, affecting beef and veal calves worldwide, caused by C. perfringens alpha toxin and perfringolysin. A longitudinal study was conducted to determine the dynamics of antibodies against these toxins in 528 calves on 4 beef and 15 veal farms. The second study aimed to determine the effect of solid feed intake on the production of antibodies against alpha toxin and perfringolysin. The control group only received milk replacer, whereas in the test group solid feed was provided. Maternal antibodies for alpha toxin were present in 45% of the veal calves and 66% of the beef calves. In beef calves a fluent transition from maternal to active immunity was observed for alpha toxin, whereas almost no veal calves developed active immunity. Perfringolysin antibodies significantly declined both in veal and beef calves. In the second study all calves were seropositive for alpha toxin throughout the experiment and solid feed intake did not alter the dynamics of alpha and perfringolysin antibodies. In conclusion, the present study showed that veal calves on a traditional milk replacer diet had significantly lower alpha toxin antibodies compared to beef calves in the risk period for enterotoxaemia, whereas no differences were noticed for perfringolysin.

Veal Calves Produce Less Antibodies against C. Perfringens Alpha Toxin Compared to Beef Calves

Science.gov (United States)

Valgaeren, Bonnie R.; Pardon, Bart; Goossens, Evy; Verherstraeten, Stefanie; Roelandt, Sophie; Timbermont, Leen; Van Der Vekens, Nicky; Stuyvaert, Sabrina; Gille, Linde; Van Driessche, Laura; Haesebrouck, Freddy; Ducatelle, Richard; Van Immerseel, Filip; Deprez, Piet

2015-01-01

Enterotoxaemia is a disease with a high associated mortality rate, affecting beef and veal calves worldwide, caused by C. perfringens alpha toxin and perfringolysin. A longitudinal study was conducted to determine the dynamics of antibodies against these toxins in 528 calves on 4 beef and 15 veal farms. The second study aimed to determine the effect of solid feed intake on the production of antibodies against alpha toxin and perfringolysin. The control group only received milk replacer, whereas in the test group solid feed was provided. Maternal antibodies for alpha toxin were present in 45% of the veal calves and 66% of the beef calves. In beef calves a fluent transition from maternal to active immunity was observed for alpha toxin, whereas almost no veal calves developed active immunity. Perfringolysin antibodies significantly declined both in veal and beef calves. In the second study all calves were seropositive for alpha toxin throughout the experiment and solid feed intake did not alter the dynamics of alpha and perfringolysin antibodies. In conclusion, the present study showed that veal calves on a traditional milk replacer diet had significantly lower alpha toxin antibodies compared to beef calves in the risk period for enterotoxaemia, whereas no differences were noticed for perfringolysin. PMID:26184311

Veal Calves Produce Less Antibodies against C. Perfringens Alpha Toxin Compared to Beef Calves.

Science.gov (United States)

Valgaeren, Bonnie R; Pardon, Bart; Goossens, Evy; Verherstraeten, Stefanie; Roelandt, Sophie; Timbermont, Leen; Van Der Vekens, Nicky; Stuyvaert, Sabrina; Gille, Linde; Van Driessche, Laura; Haesebrouck, Freddy; Ducatelle, Richard; Van Immerseel, Filip; Deprez, Piet

2015-07-10

Enterotoxaemia is a disease with a high associated mortality rate, affecting beef and veal calves worldwide, caused by C. perfringens alpha toxin and perfringolysin. A longitudinal study was conducted to determine the dynamics of antibodies against these toxins in 528 calves on 4 beef and 15 veal farms. The second study aimed to determine the effect of solid feed intake on the production of antibodies against alpha toxin and perfringolysin. The control group only received milk replacer, whereas in the test group solid feed was provided. Maternal antibodies for alpha toxin were present in 45% of the veal calves and 66% of the beef calves. In beef calves a fluent transition from maternal to active immunity was observed for alpha toxin, whereas almost no veal calves developed active immunity. Perfringolysin antibodies significantly declined both in veal and beef calves. In the second study all calves were seropositive for alpha toxin throughout the experiment and solid feed intake did not alter the dynamics of alpha and perfringolysin antibodies. In conclusion, the present study showed that veal calves on a traditional milk replacer diet had significantly lower alpha toxin antibodies compared to beef calves in the risk period for enterotoxaemia, whereas no differences were noticed for perfringolysin.

Gelatine-Based Antioxidant Packaging Containing Caesalpinia decapetala and Tara as a Coating for Ground Beef Patties

Directory of Open Access Journals (Sweden)

María Gabriela Gallego

2016-03-01

Full Text Available The development of antioxidant-active packaging has numerous advantages, such as the reduction of synthetic additives in food, the reduction of plastic waste and food protection against oxidation reactions. Different concentrations of extracts of the plants Caesalpinia decapetala (CD and Caesalpinia spinosa “Tara” (CS were incorporated into gelatine films as natural antioxidants. The physical, mechanical and antioxidant properties of these films were studied. Films containing plant extracts at a high concentration had lower tensile strength with higher elongation at break points, compared to the control film (p < 0.05. Films exhibited antioxidant activity in the oxygen radical absorbance capacity (ORAC and Trolox equivalence antioxidant capacity (TEAC assays when added at 0.2%. The application of gelatine film containing CD and CS was found to be effective in delaying lipid oxidation and deterioration of beef patty quality during storage. Therefore, the films prepared in this study offered an alternative edible coating for the preservation of fresh food.

Meat Standards Australia as an Innovation in the Australian Beef Production and Marketing System

OpenAIRE

Griffith, Garry R.; Thompson, John M.; Polkinghorne, Rod; Gunner, Richard

2010-01-01

Variable eating quality was identified as a major contributor to declining Australian beef consumption in the early 1990s. The primary issue was the inability to predict the eating quality of cooked beef before consumption. A R&D program funded by industry and Meat and Livestock Australia investigated the relationships between critical control points along the supply chain, cooking methods and beef palatability. These relationships were underpinned by extensive consumer taste panels. Out of t...

Genetic improvement of beef cattle in the United States: cattle, people and their interaction.

Science.gov (United States)

Willham, R L

1982-03-01

The purpose of this essay is to develop a historic perspective of the beef cattle population and the legion of people directing its genetic change so that future leadership can increase the rate of breeding technology assimilation. Use of cattle for beef to feed millions is relatively recent. The beef industry of the United States has a rich, romantic heritage that combined Spanish exploitation with British tradition. Spanish cattle became adapted as the Texas longhorn and the European cattle became indigenous. Breeds developed in Britain replaced both. The Zebu was introduced to produce cattle adapted to the Gulf Coast. Selection for early maturity in the British breeds promoted by livestock shows was ended by the dwarf gene. The Charolais breed demonstrated growth potential. Then in 1967, Continental European breeds were imported, given an array of biological types from which to select. Beef cattle breeding research expanded after the second world war through the three regional projects. Performance Registry International was the focal point for performance. The Beef Improvement Federation produced guidelines for recording beef performance including those for national sire evaluation. U.S. Meat Animal Research Center evaluated the several newly introduced breeds. To date, breeding researchers have developed breeding technology for the use by breeder. The major breed association are keeping and utilizing performance records. The genetic structure of the beef breeds is being altered by the use of AI such that genetic change can be made rapidly by the use of superior sires evaluated on their progeny in many herds.

A Contribution of Beef to Human Health: A Review of the Role of the Animal Production Systems

Directory of Open Access Journals (Sweden)

Dario Pighin

2016-01-01

Full Text Available Meat and meat products constitute important source of protein, fat, and several functional compounds. Although beef consumption may implicate possible negative impacts on human health, its consumption can also contribute to human health. Quality traits of beef, as well as its nutritional properties, depend on animal genetics, feeding, livestock practices, and post mortem procedures. Available data show that emerging beef production systems are able to improve both, quality and nutritional traits of beef in a sustainable way. In this context, Argentina’s actions are aimed at maximising beef beneficial effects and minimising its negative impact on human health, in a way of contributing to global food security.

In Vitro Iron Availability from Insects and Sirloin Beef.

Science.gov (United States)

Latunde-Dada, Gladys O; Yang, Wenge; Vera Aviles, Mayra

2016-11-09

Interest in the consumption of insects (entomophagy) as an alternative environmentally sustainable source of protein in the diet of humans has recently witnessed a surge. Knowledge of the nutrient composition and, in particular, the bioavailability of minerals from insects is currently sparse. This study evaluated the availability of Fe, Ca, Cu, Mg, Mn, and Zn from four commonly eaten insects and compared these to sirloin beef. Soluble iron from the samples was measured by inductively coupled plasma optical emission spectrometry (ICP-OES). Iron bioavailability was determined using an in vitro simulated peptic-pancreatic digestion, followed by measurement of ferritin (a surrogate marker for iron absorption) in Caco-2 cells. Cricket and sirloin beef had comparably higher levels of Fe, Ca, and Mn than grasshopper, meal, and buffalo worms. However, iron solubility was significantly higher from the insect samples than from beef. The complementation of whole-wheat flour with insect or beef protein resulted in overall decreases in mineral content and iron solubility in the composite mixtures. Collectively, the data show that grasshopper, cricket, and mealworms contain significantly higher chemically available Ca, Cu, Mg, Mn, and Zn than sirloin. However, buffalo worms and sirloin exhibited higher iron bioavailability comparable to that of FeSO 4 . Commonly consumed insect species could be excellent sources of bioavailable iron and could provide the platform for an alternative strategy for increased mineral intake in the diets of humans.

A Review of Sustainability Enhancements in the Beef Value Chain: State-of-the-Art and Recommendations for Future Improvements.

Science.gov (United States)

Maia de Souza, Danielle; Petre, Ruaraidh; Jackson, Fawn; Hadarits, Monica; Pogue, Sarah; Carlyle, Cameron N; Bork, Edward; McAllister, Tim

2017-03-22

The beef sector is working towards continually improving its sustainability in order to achieve environmentally, socially and economically desirable outcomes, all of which are of increasing concern to consumers. In this context, the Global Roundtable for Sustainable Beef (GRSB) provides guidance to advance the sustainability of the beef industry, through increased stakeholder engagement and the formation of national roundtables. Recently, the 2nd Global Conference on Sustainable Beef took place in Banff, Alberta, Canada, hosted by the GRSB and the Canadian Roundtable for Sustainable Beef. Conference attendees discussed the various initiatives that are being developed to address aspects of beef sustainability. This paper reviews the main discussions that occurred during this event, along with the key lessons learned, messages, and strategies that were proposed to improve the sustainability of the global beef industry.

Validation of the detection of STEC (O26, O45, O103, O111, O121, O145 and O157 in raw burgers using real-time PCR (BAX® System Q7, DuPont in “WET POOLS”

Directory of Open Access Journals (Sweden)

Paula Mussio

2014-12-01

Full Text Available Shiga toxin-producing Escherichia coli (STEC O157:H7 and no-O157:H7 have been identified as emerging foodborne pathogens responsible for an increasing number of outbreaks worldwide. Many foods have been associated to these outbreaks, mainly undercooked beef burgers. Due to the increasing production and consumption of burgers in our country, it is important to have a rapid technique to identify and isolate the most important STEC strains in foods matrixes.The objective of these investigation was to assess the sensitivity, specificity and limit detection for the screening of the most prevalent STEC in frozen raw beef burgers, using the "STEC Screening stx/eae " kit to detect the stx/eae genes and the "Panel 1 STEC E. coli O26, O111, O121" and "Panel 2 STEC E. coli O45, O103, O145" and "E. coli O157: H7 MP” (DuPont kits for the detection of the different serogroups. The use of composed samples (wet pools, the recovery of each strain from the positives samples on selective media after specified inmunoconcentration and the detection of stx/eae virulence genes in isolates by PCR were also evaluated. We validated a technique that allows the detection of the mentioned STEC strains with limits of detection between 1-5 CFU in 65 grams of raw frozen hamburgers, using wet pools. 

Comparing the environmental impacts of ethyl biodiesel production from soybean oil and beef tallow through lca for brazilian conditions

Directory of Open Access Journals (Sweden)

Rafael Alves Esteves

2017-12-01

Full Text Available The present paper sought compare the environmental impacts throughout the life cycle of biodiesel production obtained from the two raw materials most used in Brazil (soybean oil and beef tallow through the process ethyl transesterification in an alkaline medium. The reference flow adopted for the work was the generation of power supplied 1GJ from the produced biodiesel. The data used in the inventory life cycle were calculated based on similar scientific papers. The method of assessment of environmental impacts chosen was the CML 2001 modified. Altogether, it were analyzed nine categories of environmental impacts for both processes (abiotic depletion (kg Sb eq, land use (m2a, global warming (kg CO2 eq, ozone layer depletion (kg CFC-11 eq, human toxicity (kg 1,4-DB eq, freshwater ecotoxicity (kg 1,4-DB eq, terrestrial ecotoxicity (kg 1,4-DB eq, acidification (kg SO2 eq and eutrophication (kg PO43- eq. The results of evaluation of environmental impacts show that the biodiesel production process from soybean oil presents major environmental damage in seven categories of analyzed impacts (destruction of abiotic resources, destruction of the ozone layer, human toxicity, freshwater ecotoxicity, terrestrial ecotoxicity, acidification and eutrophication. The production process of biodiesel from tallow presents major environmental damage in two categories of impacts analyzed (land use and global warming. However, the results show that the absolute values of environmental damage caused by impacts of the production process using beef tallow are much more aggressive.

Including carbon emissions from deforestation in the carbon footprint of Brazilian beef.

Science.gov (United States)

Cederberg, Christel; Persson, U Martin; Neovius, Kristian; Molander, Sverker; Clift, Roland

2011-03-01

Effects of land use changes are starting to be included in estimates of life-cycle greenhouse gas (GHG) emissions, so-called carbon footprints (CFs), from food production. Their omission can lead to serious underestimates, particularly for meat. Here we estimate emissions from the conversion of forest to pasture in the Legal Amazon Region (LAR) of Brazil and present a model to distribute the emissions from deforestation over products and time subsequent to the land use change. Expansion of cattle ranching for beef production is a major cause of deforestation in the LAR. The carbon footprint of beef produced on newly deforested land is estimated at more than 700 kg CO(2)-equivalents per kg carcass weight if direct land use emissions are annualized over 20 years. This is orders of magnitude larger than the figure for beef production on established pasture on non-deforested land. While Brazilian beef exports have originated mainly from areas outside the LAR, i.e. from regions not subject to recent deforestation, we argue that increased production for export has been the key driver of the pasture expansion and deforestation in the LAR during the past decade and this should be reflected in the carbon footprint attributed to beef exports. We conclude that carbon footprint standards must include the more extended effects of land use changes to avoid giving misleading information to policy makers, retailers, and consumers.

Beef customer satisfaction: factors affecting consumer evaluations of clod steaks.

Science.gov (United States)

Goodson, K J; Morgan, W W; Reagan, J O; Gwartney, B L; Courington, S M; Wise, J W; Savell, J W

2002-02-01

An in-home beef study evaluated consumer ratings of clod steaks (n = 1,264) as influenced by USDA quality grade (Top Choice, Low Choice, High Select, and Low Select), city (Chicago and Philadelphia), consumer segment (Beef Loyals, who are heavy consumers of beef; Budget Rotators, who are cost-driven and split meat consumption between beef and chicken; and Variety Rotators, who have higher incomes and education and split their meat consumption among beef, poultry, and other foods), degree of doneness, and cooking method. Consumers evaluated each steak for Overall Like, Tenderness, Juiciness, Flavor Like, and Flavor Amount using 10-point scales. Grilling was the predominant cooking method used, and steaks were cooked to medium-well and greater degrees of doneness. Interactions existed involving the consumer-controlled factors of degree of doneness and(or) cooking method for all consumer-evaluated traits for the clod steak (P affect any consumer evaluation traits or Warner-Bratzler shear force values (P > 0.05). One significant main effect, segment (P = 0.006), and one significant interaction, cooking method x city (P = 0.0407), existed for Overall Like ratings. Consumers in the Beef Loyals segment rated clod steaks higher in Overall Like than the other segments. Consumers in Chicago tended to give more uniform Overall Like ratings to clod steaks cooked by various methods; however, consumers in Philadelphia gave among the highest ratings to clod steaks that were fried and among the lowest to those that were grilled. Additionally, although clod steaks that were fried were given generally high ratings by consumers in Philadelphia, consumers in Chicago rated clod steaks cooked in this manner significantly lower than those in Philadelphia. Conversely, consumers in Chicago rated clod steaks that were grilled significantly higher than consumers in Philadelphia. Correlation and stepwise regression analyses indicated that Flavor Like was driving customer satisfaction of the

Effect of castration and carcass suspension method on the quality and fatty acid profile of beef from male dairy cattle.

Science.gov (United States)

Nian, Yingqun; Allen, Paul; Harrison, Sabine M; Kerry, Joseph P

2018-02-12

The use of bulls rather than steers for beef production offers some considerable advantages; however, the eating quality of bull beef is an issue of marketing concern. This study assessed the physicochemical characteristics of young Holstein-Friesian (HF) bull and steer beef. Steer carcasses were suspended by the Achilles tendon (AS) and by pelvic suspension (PS). HF steer beef had higher redness, yellowness and chroma values, whereas bulls had higher ultimate pH and darker muscle. Warner-Bratzler shear force, cook loss at different ageing times, moisture, and insoluble and total collagen were higher for HF bull beef, whereas intramuscular fat, soluble collagen and collagen solubility were higher for steer beef. HF steer beef had a higher proportion of saturated fatty acids (SFA) and monounsaturated fatty acids (MUFA), whereas bull beef had higher proportions of polyunsaturated fatty acids (PUFA), PUFA/SFA and n-6/n-3 PUFA ratios. In comparison to AS, PS increased redness and chroma after 24 h blooming; PS improved tenderness up to 7 days of ageing and accelerated the ageing process. For young dairy cattle, steer beef would likely have superior eating quality but a relatively less favourable nutritional fatty acid profile to bull beef. Suspension method affected the tenderness and colour intensity of dairy steer beef at different ageing times. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

A Review of Sustainability Enhancements in the Beef Value Chain: State-of-the-Art and Recommendations for Future Improvements

Directory of Open Access Journals (Sweden)

Danielle Maia de Souza

2017-03-01

Full Text Available The beef sector is working towards continually improving its sustainability in order to achieve environmentally, socially and economically desirable outcomes, all of which are of increasing concern to consumers. In this context, the Global Roundtable for Sustainable Beef (GRSB provides guidance to advance the sustainability of the beef industry, through increased stakeholder engagement and the formation of national roundtables. Recently, the 2nd Global Conference on Sustainable Beef took place in Banff, Alberta, Canada, hosted by the GRSB and the Canadian Roundtable for Sustainable Beef. Conference attendees discussed the various initiatives that are being developed to address aspects of beef sustainability. This paper reviews the main discussions that occurred during this event, along with the key lessons learned, messages, and strategies that were proposed to improve the sustainability of the global beef industry.

Technical Efficiency of Beef Cattle Breeding Business in East Java Province

Directory of Open Access Journals (Sweden)

L. S. Kalangi

2014-08-01

Full Text Available The objectives of this research were to compare technical efficiency of beef cattle business operating in lowland and upland areas of East Java and to identify and analyze factors affecting the technical efficiency as well as inefficiency of that business. A survey was conducted to 89 farmers in the lowland area of Probolinggo District and 97 farmers in the upland areas of Malang Districts during the period of February-March 2013. Results of stochastic frontier production function with MLE method showed that the average technical efficiency in lowland area was higher (80% compared to that in upland area (64%. The results indicated that beef cattle production was highly significant and positively influenced by total of grasses and forages, rice straw, feed supplements, stock of cattle, labor time allocation and service per conception. However, location of the business, whether in lowland and upland areas was a significant factor that could increase the efficiency. Some factors that could significantly reduce the technical inefficiency of beef cattle business were: labor force in family, education level, proportion of beef cattle income to total household income, age of cattle sold, cattle health examination, ownership status of the cattle, and gender. Therefore, (1 the existing farmers group should be improved their role to facilitate trading of cattle feed, and (2 the government should facilitate the farmers in the provision of funding tu buy beef cattle with a subsidized interest rate, so the farmers will be more enthusiast in taking care of their cattle, thus could improve their production efficiency.

Prevalence and antibiotic resistance of Enterococcus spp. isolated from retail cheese, ready-to-eat salads, ham, and raw meat.

Science.gov (United States)

Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A

2014-08-01

Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.

Short communication. Sensory evaluation of commercial beef produced in Uruguay and three European countries

OpenAIRE

San-Julián, R.; Campo, M. M.; Nute, G.; Montossi, F.; Font-i-Furnols, M.; Guerrero, L.; Oliver, M. A.; Sañudo, C.

2012-01-01

The main goal of this study was to characterize and compare the organoleptic quality of beef from Uruguay and from three European countries. In Uruguay, 40 Hereford steers were raised exclusively under grazing conditions up to either two or three years old. Meat samples were aged for 20 days, matching commercial conditions. In Europe, one commercial local beef type, with two ageing times (7 and 20 days), from Germany, Spain and the United Kingdom were compared with Uruguayan beef samples, usi...

Raman spectroscopic differentiation of beef and horse meat using a 671 nm microsystem diode laser

Science.gov (United States)

Ebrahim, Halah Al; Sowoidnich, Kay; Kronfeldt, Heinz-Detlef

2013-11-01

A non-invasive Raman spectroscopic approach for meat species identification and quality detection was successfully demonstrated for the two closely related species beef and horse. Fresh beef and horse muscles were cut and ice-stored at 5 °C, and time-dependent Raman measurements were performed daily up to 12 days postmortem. Applying a 671 nm microsystem diode laser and a laser power of 50 mW, spectra were recorded with integration times of 1-4 s. A pronounced offset of the Raman spectra was observed between horse and beef, with high fluorescence background for horse compared to beef for all days of storage. Principal components analysis was applied for data evaluation revealing a clear distinction between beef and horse meat which can be attributed to differences in the myoglobin content of both species. Furthermore, separations according to aging and spoilage for the two species could be identified simultaneously. Therefore, Raman spectroscopy might be an efficient test method for meat species identification in combination with spoilage detection.

Effects of crossing of domestic breed with beef breeds on the quality of meat in PR China and Republic of Serbia

OpenAIRE

Aleksić, S.; Fang, Sun; Di, Liu; Petrović, M.M.; Pantelić, V.; Stanišić, N.; Ostojić-Andrić, D.; Petričević, M.; Nikšić, D.; Delić, N.

2013-01-01

This paper presents the results of crossing Domestic Spotted breed with beef cattle breeds in the People's Republic of China and the Republic of Serbia. China is a big country of beef production and consumption. In 2012, beef production in China was 5,540,000 tons, which accounted for 9.7% of the global beef production, ranking the third in the world. The main sources of China’s beef are from crossbreeding cattle (native breed crossbred with foreign beef ca...

Management practices to control gastrointestinal parasites in dairy and beef goats in Minas Gerais; Brazil.

Science.gov (United States)

Guimarães, Alessandro de Sá; Gouveia, Aurora Maria Guimarães; do Carmo, Filipe Borges; Gouveia, Gabriela Canabrava; Silva, Marcos Xavier; Vieira, Luiz da Silva; Molento, Marcelo Beltrão

2011-03-10

Parasitic infection is recognized worldwide as a limiting factor in the production of goats, and various control methods are used to reduce economic losses, often without considering the epidemiology of the parasites. This has led to the development of highly tolerant parasite populations and the presence of chemical residues in the beef and milk. The objective of this study was to determine the level of knowledge of goat farmers about parasitic diseases and to correlate this with the epidemiology of endoparasites and parasite control practices in goat farms in the state of Minas Gerais, Brazil. The analysis was based on a questionnaire applied by trained veterinarians. The sample was homogeneous throughout the state, covering 18.4% (157/853) of municipalities. Eighty-four dairy goat farms in 81 municipalities and 200 properties with beef goats in 76 municipalities were evaluated. The herd size per goat farm ranged from 4 to 57 (average 24) for beef herds and from 2 to 308 (average 63) for dairy farms. The majority of the beef herd production was extensive and semi-extensive (98.5%), while the dairy herds were maintained under intensive farming (98.8%). The mixed production of goats and sheep was reported by 36.5% of beef goat farmers and by 20.2% of dairy goat farmers. Among the beef goats farms on which the technological level was determined, 2.0% were categorized as having high technological level, 34.5% as medium, and 63.5% as low. Of the 84 dairy farms, 30% operated at a high, 47% at a medium, and 23% at a low technological level. The adoption of practices to reduce parasitism, such as the quarantine of animals, treatment of newly arrived animals, regular cleaning of the floor, and technical assistance, was significantly higher on dairy farms than on beef farms. Although 85.7% of dairy farmers and 83% of beef farmers medicate their animals, the treatments were performed without technical criteria, and deworming intervals ranged from 30 to 120 days or more. The

A qualitative study of Southern U.S. consumers' top of the mind beliefs about the safety of local beef.

Science.gov (United States)

Telligman, Amy L; Worosz, Michelle R; Bratcher, Christy L

2017-02-01

Following the Reasoned Action Approach, the aim of this study was to explore consumers' top-of-mind food safety beliefs about local beef. Beef consumers recruited from farmers' markets (N = 101) and grocery stores (N = 174) across the state of Alabama participated in face-to-face intercept surveys. The survey included closed- and open-ended questions designed to elicit consumers' food safety beliefs about local beef. Results indicate that beef safety was not a top-of-mind concern for a majority of participants, however of the total number of participants familiar with the term "local beef" (n = 168, 61%), a majority (n = 105, 63%) associated local beef with improved food safety. Content analysis of verbatim text revealed that consumers believed local beef was safer because they possess greater knowledge about the product and less shipping was involved. Respondents also believe that locally processed meat is derived from small-scale operations which provided the assurance that local beef is more likely to meet U.S. regulatory standards and therefore be safer. Consumers believe they have more oversight of local beef due to both their relationships with supply chain actors and proximity which also provided food safety assurances. Copyright © 2016 Elsevier Ltd. All rights reserved.

Documentation of 50% water conservation in a single process at a beef abattoir

Science.gov (United States)

Beef slaughter is water intensive due to stringent food safety requirements. We conducted a study at a commercial beef processor to demonstrate water conservation by modifying the mechanical head wash. We documented the initial nozzle configuration (112 nozzles), water pressure (275 kPa), and flowra...

Will intensification of beef production deliver conservation outcomes in the Brazilian Amazon?

Directory of Open Access Journals (Sweden)

Frank Merry

2017-05-01

Full Text Available The intensification of beef production has become a conservation target based on the idea of land sparing and the assumption that in order to contain deforestation and meet increasing beef demand we must increase productivity. There is also increasing attention and conservation credit being given to supply chain management in beef production. Based on a historical comparison between the US, a fully intensive system, and Brazil, one moving in that direction, we suggest that cattle ranching will intensify as a result of conservation investments (reductions in capital and land subsidies rather than intensifying in order to produce conservation results. If the comparison holds, the new intensive system, however, will continue to require large natural resource inputs, government subsidies, and be plagued by social and conservation problems. It will also be held in thrall by a few large processing companies, which exert undue influence over both producers and consumers. Therefore, we suggest that closer attention be paid to attribution in the claim of conservation outcomes from intensive beef production.

Progress in the molecular and genetic modification breeding of beef cattle in China.

Science.gov (United States)

Tong, Bin; Zhang, Li; Li, Guang-Peng

2017-11-20

The studies of beef cattle breeding in China have been greatly improved with the rapid development of the international beef cattle industrialization. The beef cattle breeding technologies have rapidly transformed from traditional breeding to molecular marker-assisted breeding, genomic selection and genetic modification breeding. Hundreds of candidate genes and molecular markers associated with growth, meat quality, reproduction performance and diseases resistance have been identified, and some of them have already been used in cattle breeding. Genes and molecular markers associated with growth and development are focused on the growth hormone, muscle regulatory factors, myostatin and insulin-like growth factors. Meat quality is mediated by fatty acid transport and deposition related signals, calpains and calpain system, muscle regulatory factors and muscle growth regulation pathways. Reproduction performance is regulated by GnRH-FSH-LH, growth differentiation factor 9, prolactin receptor and forkhead box protein O1. Disease resistance is modulated by the major histocompatibility complex gene family, toll-like receptors, mannose-binding lectin and interferon gene signals. In this review, we summarize the most recent progress in beef cattle breeding in marker-assisted selection, genome-wide selection and genetic modification breeding, aiming to provide a reference for further genetic breeding research of beef cattle in China.

Concentrations in beef and lamb of taurine, carnosine, coenzyme Q(10), and creatine.

Science.gov (United States)

Purchas, R W; Rutherfurd, S M; Pearce, P D; Vather, R; Wilkinson, B H P

2004-03-01

Levels of taurine, carnosine, coenzyme Q(10), and creatine were measured in beef liver and several muscles of beef and lamb and in cooked and uncooked meat. The amino acid taurine has numerous biological functions, the dipeptide carnosine is a buffer as well as an antioxidant, coenzyme Q(10) is also an antioxidant present within mitochondria, and creatine along with creatine phosphate is involved with energy metabolism in muscle. Large differences were shown for all compounds between beef cheek muscle (predominantly red fibres) and beef semitendinosus muscle (mainly white fibres), with cheek muscle containing 9.9 times as much taurine, and 3.2 times as much coenzyme Q(10), but only 65% as much creatine and 9% as much carnosine. Levels in lamb relative to beef semitendinosus muscles were higher for taurine but slightly lower for carnosine, coenzyme Q(10) and creatine. Values for all the compounds varied significantly between eight lamb muscles, possibly due in part to differences in the proportion of muscle fibre types. Slow cooking (90 min at 70 °C) of lamb longissimus and semimembranosus muscles led to significant reductions in the content of taurine, carnosine, and creatine (Plamb, but that these levels vary between muscles, between animals, and with cooking.

Determination of Total Volatile Basic Nitrogen (TVB-N Content in Beef by Hyperspectral Imaging Technique

Directory of Open Access Journals (Sweden)

Liu Shanmei

2016-01-01

Full Text Available Non-destructive determination of TVB-N content in beef using hyperspectral imaging (HSI technique was evaluated. In order to create a robust model to predict the TVB-N content in beef, partition of sample set, spectral pretreatment, and the optimum wavelength selection were discussed. After the beef sample set was parted by concentration gradient (CG algortithm, and the spectra of beef samples were preprocessed by standard normalized variate (SNV combined with auto scale(AS, the partial least square regression (PLSR model was established using the full spectral range, which had the best prediction abilities with Rcv2 of 0.9124, Rp2 of 0.8816, RMSECV of 1.5889, and RMSEP of 1.7719, respectively. After the optimum wavelengths which is closely related to the TVB-N content of beef samples was obtained using the competitive adaptive re-weighted (CARS algorithm, a new PLSR model was established using the optimum wavelengths, which had outstanding prediction abilities with Rcv2 of 0.9235, Rp2 of 0.9241, RMSECV of 1.4881, and RMSEP of 1.4882, respectively.The study showed that HSI is a powerful technique to predict the TVB-N content in beef by a nondestructive way.

Farm-scale anaerobic digestion of beef and dairy cattle manure for energy cogeneration at two farms in Canada

Energy Technology Data Exchange (ETDEWEB)

Patni, N.; Monreal, C. [Agriculture and Agri-Food Canada, Quebec City, PQ (Canada); Li, X. [Highmark Renewables Research, Calgary, AB (Canada); Crolla, A.; Kinsley, C. [Guelph Univ., Alfred Campus, Alfred, ON (Canada); Barclay, J. [Environment Canada, Ottawa, ON (Canada). Emerging Fuel Issues Div.

2010-07-01

This paper reported on a study that was conducted in 2003 to 2005 at beef and diary cattle farms in Canada, where cattle manure was anaerobically digested for biogas production. The biogas was used for electrical and thermal energy cogeneration. Manure from about 7500 beef cattle at a feedlot was digested at a thermophilic temperature of 55 degrees C in two 1800 m{sup 3} above-ground digesters with a hydraulic retention time (HRT) of 14 days. The biogas had an average 58 per cent methane content and was combusted in a General Electric Jenbacher 999 kW cogeneration system. At the second farm, manure from about 165 lactating cows, 110 heifers and 40 calves was digested at a mesophilic temperature of 40 degrees C in a 500 m{sup 3} below-ground digester with a HRT of 28 days. The unique feature of this digester was that it was retrofitted in a pre-existing larger slurry storage tank. The biogas had an average 65 per cent methane content and was combusted in a 75 kW Perkins dual fuel diesel engine connected to a 65 kW Schnell generator. In 2007, when fats, oils and grease (FOG) from restaurant waste residue was added to the manure, biogas production increased by about 300 per cent and electrical energy generation increased by 180 per cent. Both systems have operated year-round from December to February at average ambient temperatures that ranged from -9 to -12 degrees Celsius. This paper addressed the long-term sustainability options for animal farm operations in terms of biogas production for electricity and thermal energy cogeneration.

Space Weather: Where Is The Beef?

Science.gov (United States)

Koskinen, H. E. J.

Space weather has become a highly fashionable topic in solar-terrestrial physics. It is perhaps the best tool to popularise the field and it has contributed significantly to the dialogue between solar, magnetospheric, and ionospheric scientist, and also to mu- tual understanding between science and engineering communities. While these are laudable achievements, it is important for the integrity of scientific space weather re- search to recognise the central open questions in the physics of space weather and the progress toward solving them. We still lack sufficient understanding of the solar physics to be able to tell in advance when and where a solar eruption will take place and whether it will turn to a geoeffective event. There is much to do to understand ac- celeration of solar energetic particles and propagation of solar mass ejecta toward the Earth. After more than 40 years of research scientific discussion of energy and plasma transfer through the magnetopause still deals mostly with qualitative issues and the rapid acceleration processes in the magnetosphere are not yet explained in a satisfac- tory way. Also the coupling to the ionosphere and from there to the strong induction effects on ground is another complex of research problems. For space weather science the beef is in the investigation of these and related topics, not in marketing half-useful space weather products to hesitant customers.

Fatty acid profile of zebu beef cattle from the Central African sub ...

African Journals Online (AJOL)

Additionally, based on the polyunsaturated FA (PUFA) proportion, 13.9% of the total lipids and n-6/n-3 PUFA ratio, 1.95, consumption of beef from these breeds could be beneficial to human health. This is possibly owing to the pasture feeding and low fat content of the beef. Keywords: Intramuscular fat; fatty acid composition ...

NITROUS OXIDE EMISSIONS FROM SOUTHERN HIGH PLAINS BEEF CATTLE FEEDYARDS: MEASUREMENT AND MODELING

Science.gov (United States)

Predictive models for nitrous oxide emission are crucial for assessing the greenhouse gas footprint of beef cattle production. The Texas Panhandle produces approximately 42% of finished beef in the U.S. and cattle production is estimated to contribute 8 Tg carbon dioxide equivalents from nitrous oxi...

76 FR 76890 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products...

Science.gov (United States)

2011-12-09

.... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... major cuts of single-ingredient, raw meat and poultry products and ground or chopped meat and poultry... Ground or Chopped Meat and Poultry Products'' in the Federal Register (75 FR 82148) that, among other...

The study of heavy metals and microbial content in beef bowel and red meat

International Nuclear Information System (INIS)

Harsojo; Darsono

2013-01-01

Indonesia's population has increased every year so the need for food increased, especially the availability of nutritious foods such as red meat. Red meat is one of the foods that contain sufficient elements of protein, but it was likely to contain heavy metals and bacterial contamination that has met the threshold standards. On the otherhand, beef bowels are very popular among Indonesian consumers, but many heavy metlas could accumulated into the bowels. The purpose of this research are to study the content of heavy metals and bacterial contamination on beef bowel from some places of slaughtering houses and some red meats from the market in Jakarta. The beef bowels are lung, tripe, intestine and liver while the red meats were veal and tender loin. Parameter of heavy metals measured are As, Cd and Hg, while for the initial bacterial contamination are total number of aerobic bacteria, total amount of coliform, Escherichia coli, Staphylococcus sp and Salmonella contamination. The heavy metals were analyzed using Neutron Activation Analysis, and for the total number of bacteria is using Total Plate Count. Result of research shows the As content in lung and tripe as well as the mercuric content in bowel has exceeded in the normal level such as 1.0 and 0.03 ppm, respectively. On the other hand, no heavy metals were detected in all red meats. The total microbes in beef bowel have exceeded allowable limit (1.0 x 10 6 cfu/g). No Salmonella was detected in all beef bowels and red meats observed. Nuclear technique are very helpful analysis of the heavy metas content in bowel dan red meats beef. The cleanliness slaughtering house of animals are remarkably ascertaining the quality of the beef bowel and red meats who will be sent. (author)

Increasing beef production could lower greenhouse gas emissions in Brazil if decoupled from deforestation

Science.gov (United States)

de Oliveira Silva, R.; Barioni, L. G.; Hall, J. A. J.; Folegatti Matsuura, M.; Zanett Albertini, T.; Fernandes, F. A.; Moran, D.

2016-05-01

Recent debate about agricultural greenhouse gas emissions mitigation highlights trade-offs inherent in the way we produce and consume food, with increasing scrutiny on emissions-intensive livestock products. Although most research has focused on mitigation through improved productivity, systemic interactions resulting from reduced beef production at the regional level are still unexplored. A detailed optimization model of beef production encompassing pasture degradation and recovery processes, animal and deforestation emissions, soil organic carbon (SOC) dynamics and upstream life-cycle inventory was developed and parameterized for the Brazilian Cerrado. Economic return was maximized considering two alternative scenarios: decoupled livestock-deforestation (DLD), assuming baseline deforestation rates controlled by effective policy; and coupled livestock-deforestation (CLD), where shifting beef demand alters deforestation rates. In DLD, reduced consumption actually leads to less productive beef systems, associated with higher emissions intensities and total emissions, whereas increased production leads to more efficient systems with boosted SOC stocks, reducing both per kilogram and total emissions. Under CLD, increased production leads to 60% higher emissions than in DLD. The results indicate the extent to which deforestation control contributes to sustainable intensification in Cerrado beef systems, and how alternative life-cycle analytical approaches result in significantly different emission estimates.

What Brings People to Leadership Roles: A Phenomenological Study of Beef Industry Leaders

Science.gov (United States)

Gordon, B. Lynn; Ellis, Jason D.

2013-01-01

Leadership has been deeply studied in the literature; however, little research exists studying the role of volunteer peer leaders in non-formalized leadership roles in membership-based organizations. This phenomenological study was designed to explore the experience of beef industry leaders in leadership roles. Twelve active beef industry…

Is the Grass Always Greener? Comparing the Environmental Impact of Conventional, Natural and Grass-Fed Beef Production Systems

Directory of Open Access Journals (Sweden)

Judith L. Capper

2012-04-01

Full Text Available This study compared the environmental impact of conventional, natural and grass-fed beef production systems. A deterministic model based on the metabolism and nutrient requirements of the beef population was used to quantify resource inputs and waste outputs per 1.0 × 109 kg of hot carcass weight beef in conventional (CON, natural (NAT and grass-fed (GFD production systems. Production systems were modeled using characteristic management practices, population dynamics and production data from U.S. beef production systems. Increased productivity (slaughter weight and growth rate in the CON system reduced the cattle population size required to produce 1.0 × 109 kg of beef compared to the NAT or GFD system. The CON system required 56.3% of the animals, 24.8% of the water, 55.3% of the land and 71.4% of the fossil fuel energy required to produce 1.0 × 109 kg of beef compared to the GFD system. The carbon footprint per 1.0 × 109 kg of beef was lowest in the CON system (15,989 × 103 t, intermediate in the NAT system (18,772 × 103 t and highest in the GFD system (26,785 × 103 t. The challenge to the U.S beef industry is to communicate differences in system environmental impacts to facilitate informed dietary choice.

HS-SPME GC/MS characterization of volatiles in raw and dry-roasted almonds (Prunus dulcis).

Science.gov (United States)

Xiao, Lu; Lee, Jihyun; Zhang, Gong; Ebeler, Susan E; Wickramasinghe, Niramani; Seiber, James; Mitchell, Alyson E

2014-05-15

A robust HS-SPME and GC/MS method was developed for analyzing the composition of volatiles in raw and dry-roasted almonds. Almonds were analyzed directly as ground almonds extracted at room temperature. In total, 58 volatiles were identified in raw and roasted almonds. Straight chain aldehydes and alcohols demonstrated significant but minimal increases, while the levels of branch-chain aldehydes, alcohols, heterocyclic and sulfur containing compounds increased significantly (500-fold) in response to roasting (palmonds) to 315.8±70.0 ng/g (averaged across the roasting treatments evaluated i.e. 28, 33 and 38 min at 138 °C) after roasting. Pyrazines were detected in only the roasted almonds, with the exception of 2,5-dimethylpyrazine, which was also found in raw almonds. The concentration of most alcohols increased in the roasted samples with the exception of 2-methyl-1-propanol, 3-methyl-1-butanol and 2-phenylethyl alcohol, which decreased 68%, 80%, and 86%, respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.

Determination of Optimum Condition of Leucine Content in Beef Protein Hydrolysate using Response Surface Methodology

International Nuclear Information System (INIS)

Siti Roha Ab Mutalib; Zainal Samicho; Noriham Abdullah

2016-01-01

The aim of this study is to determine the optimum condition of leucine content in beef hydrolysate. Beef hydrolysate was prepared by enzymatic hydrolysis using bromelain enzyme produced from pineapple peel. Parameter conditions such as concentration of bromelain, hydrolysis temperature and hydrolysis time were assessed to obtain the optimum leucine content of beef hydrolysate according to experimental design which was recommended by response surface methodology (RSM). Leucine content in beef hydrolysate was determined using AccQ. Tag amino acid analysis method using high performance liquid chromatography (HPLC). The condition of optimum leucine content was at bromelain concentration of 1.38 %, hydrolysis temperature of 42.5 degree Celcius and hydrolysis time of 31.59 hours with the predicted leucine content of 26.57 %. The optimum condition was verified with the leucine value obtained was 26.25 %. Since there was no significant difference (p>0.05) between the predicted and verified leucine values, thus it indicates that the predicted optimum condition by RSM can be accepted to predict the optimum leucine content in beef hydrolysate. (author)

Consumers' attitudes toward consumption of cloned beef. The impact of exposure to technological information about animal cloning.

Science.gov (United States)

Aizaki, Hideo; Sawada, Manabu; Sato, Kazuo

2011-10-01

Novel food technologies, such as cloning, have been introduced into the meat production sector; however, their use is not widely supported by many consumers. This study was designed to assess whether Japanese consumers' attitudes toward consumption of cloned beef (specifically, beef derived from bovine embryo and somatic cell-cloned cattle) would change after they were provided with technological information on animal cloning through a web-based survey. The results revealed that most respondents did not discriminate between their attitudes toward the consumption of the two types of cloned beef, and that most respondents did not change their attitudes toward cloned beef after receiving the technological information. The respondents' individual characteristics, including their knowledge about the food safety of cloned beef and their basic knowledge about animal cloning, influenced the likelihood of a change in their attitudes after they received the information. In conclusion, some consumers might become less uncomfortable about the consumption of cloned beef by the straightforward provision of technological information about animal cloning; however, most consumers are likely to maintain their attitudes. Copyright © 2011 Elsevier Ltd. All rights reserved.

Effects of gamma irradiation on the survival of Listeria monocytogenes and on its growth at refrigeration temperature in poultry and red meat

International Nuclear Information System (INIS)

Gursel, B.; Gurakan, G.C.

1997-01-01

Gamma irradiation sensitivity of a strain of Listeria monocytogenes was determined in trypticase soy broth supplemented with yeast extract (TSB-YE), in a slurry of chicken breast meat and in raw ground beef. D10 values in these different media were 0.364, 0.599, and 0.699 kGy, respectively. This organism appeared most sensitive in TSB-YE, more resistant in minced fresh chicken breast meat, and most resistant in fresh minced beef. It was found that irradiation at 2.5 kGy prior to refrigeration is an efficient way for the preservation of meat products contaminated at 10(3) to 10(4) per gram initial load of L. monocytogenes for about 7 d. However, with this initial load, the injured cells might repair themselves and cause a health hazard during storage at 4 C in the presence of air after 7 d

Use of irradiation to improve the safety and quality of ethnic South African foods. Part I: Combined edible coating and irradiation treatment on sensory and microbiological quality of moist beef biltong

International Nuclear Information System (INIS)

Minnaar, A.; Nortje, K.; Parry-Hanson, A.M.A.; Buys, E.M.

2009-01-01

South Africa is a multicultural country with different eating habits and food preferences. Traditional African foods such as bovine tripe form a part of the diet of black South Africans. These foods are laborious to prepare, not generally available commercially, and have a limited shelf life. Other popular ethnic foods in South Africa include meat products such as biltong, an intermediate moisture dried raw meat product. Moist beef biltong has the potential to cause food poisoning. The application of irradiation alone or in combination with other technologies can help solve these problems. Lean moist beef biltong (47% moisture, 3.7% NaCl, 1.5% crude fat, water activity 0.92) can be irradiated with doses up to 10 kGy without adversely affecting sensory acceptability, provided that the irradiation is performed under vacuum conditions and that the biltong is exposed to aerobic conditions after irradiation to dissipate off odour volatiles. However, low dose irradiation (≤4 kGy) was perceived to be more acceptable and preferable by consumers. Gamma irradiation of moist beef biltong (53.6% moisture, 1.91% NaCl, water activity 0.979) at doses between 4 and 5 kGy was adequate to ensure safety from Staphylococcus aureus even if contamination levels as high as 10 7 CFU/g were initially present. However, doses up to 5 kGy were insufficient to prevent yeast and mould spoilage if initial fungal contamination levels were high (>10 3 CFU/g). Casein-whey protein edible coatings did not inhibit microbial growth on moist beef biltong, probably owing to diminished oxygen barrier properties resulting from the very high moisture content of the biltong. Ready-to-eat bovine tripe can be irradiated up to 9.3 kGy without affecting the consumer acceptance adversely. Gamma irradiation at a target dose of 9 kGy significantly reduced total bacteria counts and aerobic spore counts and extended the shelf life of ready-to-eat bovine tripe to at least 14 d at both 5 and 15 deg. C when aerobic

Modelling in support of decision-making for South African extensive beef farmers

Directory of Open Access Journals (Sweden)

D.H. Meyer

2003-12-01

Full Text Available In this study it is shown that it is possible to build a decision support system for the use of South African extensive beef farmers. Initially models for the key variables which affect extensive beef farmers are developed. These key variables include rainfall, beef, veal and weaner prices and the condition of the veld. This last key variable is monitored using the voluntary lick intake of the cattle and is modelled in terms of rainfall and stocking intensity. Particular attention is paid to the interrelationships between the key variables and to the distribution of modelling errors. The next stage of the study concerns the use of these models as a decision-support tool for extensive beef farmers. It is shown that Monte Carlo simulations and dynamic programming analyses can use these models to suggest how gross margins can be increased. At the same time these methods can be used to monitor the effect of management decisions on mean lick intake and, hence, the effect of these decisions on the condition of the veld. In particular the decisions of "what stocking intensity", "what cattle system", "when to sell" and "when to make a change" are addressed.

Association of microRNAs with antibody response to mycoplasma bovis in beef cattle

Science.gov (United States)

The objective of this study was to identify microRNAs associated with a serum antibody response to Mycoplasma bovis in beef cattle. Serum from sixteen beef calves was collected at three points: in summer after calves were born, in fall at weaning, and in the following spring. All sera collected in t...

Risk of Escherichia coli O157:H7 infection linked to the consumption of beef

Directory of Open Access Journals (Sweden)

Premarathne, J.M.K.J.K

2017-05-01

Full Text Available Escherichia coli O157:H7 is a major food-borne pathogen that has resulted in numerous outbreaks around the world. Widespread distribution of the organism in various ecological niches impedes the control measures. This study aimed to detect and quantify E. coli O157:H7 in beef sold in wet markets and hypermarkets in Malaysia and to determine the risk of E. coli O157:H7 infection linked to consumption of beef. The rfbO157 and flicH7 primers targeted on somatic antigen (O157 and flagellar antigen (H7 respectively of E. coli O157:H7 was used for the MPN-PCR method. A total of 99 beef samples were collected from local wet markets and hypermarkets. The highest E. coli O157:H7 contamination rate was observed in beef samples collected from wet markets (89.50%, whereas the contamination rate in hyper market A and B were compratively low (35.35 and 20% respectively. However, the microbial load was highest in the beef samples from hypermarket A (1100 MPN/g while E. coli O157:H7 bacterial load in beef samples from hypermarket B and wet market ranged from 3 to 93 MPN/g and 3 to 240 MPN/g, respectively. Using the Quantitative Microbial Risk Assessment (QMRA approach the risk was estimated incorporating the findings of the prevalence study and predictions based on home storage, cooking and consumption patterns. Three different exposure pathways were investigated to estimate the risk associated with contaminated beef and Monte Carlo simulation was used to determine the level of uncertainty. The developed model predicated that consumption of contaminated beef can be accountable for 1.83E+06 E. coli O157:H7 cases per year in Malaysia. The reliability of the model, data gaps and further research needs, is discussed. Through continuous improvement Quantitative Microbial Risk Assessment provides valuable insight into controlling and prevention strategies.

Factors Influencing Demand for a Producer-Owned Beef Retail Outlet

OpenAIRE

Lusk, Jayson L.; Cevallos, Edgar

2004-01-01

As the farm-to-retail price spread continues to grow, come cattle producers a beginning to consider integrating into the retail sector. Such a venture would require large investments in capital with uncertain return. This study seeks to determine the potential success of a stand-alone retail outlet selling “all natural†beef in an affluent area of Jackson, MS. Using choice-based conjoint analysis, demand for the new retail outlet is modeled as a function of the beef price at the store, dis...

Variation in bull beef quality due to ultimate muscle pH is correlated to endopeptidase and small heat shock protein levels.

Science.gov (United States)

Pulford, D J; Dobbie, P; Fraga Vazquez, S; Fraser-Smith, E; Frost, D A; Morris, C A

2009-09-01

This study set out to determine if ultimate pH (pH(u)) affected the performance of intracellular small heat shock protein and endopeptidase dynamics in muscle during beef ageing. Longissimus dorsi muscles from 39 Angus or Limousin×Angus bulls were examined to see if pH(u) achieved at 22h post mortem (rigor) affected tenderness and water holding capacity of beef. Samples were segregated into three pH(u) groups termed high (pH>6.3), intermediate (5.7pHpHpH(u) beef. More than 30% of bull beef did not achieve acceptable tenderness at 8 days post mortem with this ageing regime. No significant differences in calpain or cathepsin enzyme levels due to meat pH were observed until after 22h post mortem, but low pH(u) beef had elevated caspase 3/7 activity soon after slaughter. At 22h post mortem, greater levels of μ-calpain enzyme were found in the high and intermediate pH(u) beef and cathepsin B levels were superior in the low pH(u) beef after 2 days post mortem. Different rates of desmin and troponin T protein degradation were also observed in aged bull beef. Both proteins were degraded within 6h post mortem for high pH(u) beef, but took >3 days post mortem for intermediate pH(u) beef. High levels of alpha β-crystallin (aβC) at 22h post mortem coincided with delayed muscle protein degradation for low pH(u) beef. Our results support the hypothesis that aβC shields myofibrils and buffers against endopeptidase degradation of beef structure during ageing.

Characteristics of Fluid Composition of Left Displaced Abomasum in Beef Cattle Fed High-Starch Diets

Science.gov (United States)

ICHIJO, Toshihiro; SATOH, Hiroshi; YOSHIDA, Yuki; MURAYAMA, Isao; KIKUCHI, Tomoko; SATO, Shigeru

2014-01-01

ABSTRACT To clarify the pathophysiology of left displaced abomasum (LDA), beef cattle fed high-starch diets were examined. The abomasal pH in beef cattle with LDA was lower than that in non-LDA reference animals (data from beef cattle at an abattoir), suggesting that it facilitated acidity. Bacteriological examinations of the abomasal fluid in cattle with LDA revealed the presence of Pseudomonas spp., Clostridium spp. and Candida spp., presumably reflecting the accelerated influx of ruminal fluid into the abomasum. Biochemical analyses of serum revealed that LDA cattle had higher lactic acid and lower vitamin A and E levels than non-LDA reference animals. These results indicate that beef cattle with LDA may suffer from vitamin A and E deficiencies due to maldigestion of starch and the high acidity of abomasal fluid. PMID:24813464

Does Excluding Cross-commodity Interactions Matter? Beef and Lamb in Australia

OpenAIRE

Dent, Siobahn K.; Piggott, Roley R.; O'Donnell, Christopher J.; Griffith, Garry R.

2003-01-01

Australian broadacre agriculture is typified by strong cross-commodity relationships, where sheep and cattle grazing enterprises compete for pasture and both compete with wheat and other crops for land. Further, some commodities produced by multi-product farms are also used in the production of final products that are substitutes in demand, such as beef and lamb. Economic analyses of the beef market, for example, should also include consideration of the market for the related product, lamb. I...

Spatial variability in nitrous oxide and methane emissions from beef cattle feedyard pen surfaces

Science.gov (United States)

Greenhouse gas emissions from beef cattle feedlots include enteric carbon dioxide and methane, and manure-derived methane, nitrous oxide and carbon dioxide. Enteric methane comprises the largest portion of the greenhouse gas footprint of beef cattle feedyards. For the manure component, methane is th...

European citizen and consumer attitudes and preferences regarding beef and pork.

Science.gov (United States)

Verbeke, Wim; Pérez-Cueto, Federico J A; Barcellos, Marcia D de; Krystallis, Athanasios; Grunert, Klaus G

2010-02-01

This paper presents the combined mid-term findings of the consumer research components of two EU Sixth Framework Programme integrated projects concerning meat, ProSafeBeef and Q-PorkChains. The consumer pillar of ProSafeBeef carried out eight focus group discussions in May 2008, in France, Germany, Spain and the UK. Q-PorkChains conducted a large-scale, web-based, consumer survey in January 2008 in Belgium, Denmark, Germany, Greece and Poland. The first project provides a set of qualitative data from a small cohort of focus groups and the second a set of quantitative data from a larger consumer sample. This paper draws together the main findings of both projects and provides a comprehensive overview of European citizens' and consumers' attitudes towards and preferences regarding beef and pork. In general, consumers consider meat to be a healthy and important component of the diet. Consumers support the development of technologies that can improve the health attributes of meat products and guarantee eating quality, but they have a negative view of what they see to be excessive manipulation and lack of naturalness in the production and processing of beef products. In the Q-PorkChains study consumer and citizen segments are identified and profiled. Consumer segments were built upon the frequency and variety of pork consumption. The citizen segments were built upon their attitudes towards pig production systems. Overall, the relationship between individuals' views as citizens and their behaviour as consumers was found to be quite weak and did not appear to greatly or systematically influence meat-buying habits. Future studies in both projects will concentrate on consumers' acceptance of innovative meat product concepts and products, with the aim of boosting consumer trust and invigorating the European beef and pork industries.

9 CFR 319.312 - Pork with barbecue sauce and beef with barbecue sauce.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Pork with barbecue sauce and beef with barbecue sauce. 319.312 Section 319.312 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE..., Frozen, or Dehydrated Meat Food Products § 319.312 Pork with barbecue sauce and beef with barbecue sauce...

Effect of Novel Quick Freezing Techniques Combined with Different Thawing Processes on Beef Quality

Science.gov (United States)

Yoo, Seon-Mi; Han, Gui-Jung

2014-01-01

This study investigated the effect of various freezing and thawing techniques on the quality of beef. Meat samples were frozen using natural convection freezing (NF), individual quick freezing (IQF), or cryogenic freezing (CF) techniques, followed by natural convection thawing (NCT) or running water thawing (RT). The meat was frozen until the core temperature reached -12℃ and then stored at -24℃, followed by thawing until the temperature reached 5℃. Quality parameters, such as the pH, water binding properties, CIE color, shear force, and microstructure of the beef were elucidated. Although the freezing and thawing combinations did not cause remarkable changes in the quality parameters, rapid freezing, in the order of CF, IQF, and NF, was found to minimize the quality deterioration. In the case of thawing methods, NCT was better than RT and the meat quality was influence on the thawing temperature rather than the thawing rate. Although the microstructure of the frozen beef exhibited an excessive loss of integrity after the freezing and thawing, it did not cause any remarkable change in the beef quality. Taken together, these results demonstrate that CF and NCT form the best combination for beef processing; however, IQF and NCT may have practical applications in the frozen food industry. PMID:26761674

Evaluation of the 3M™ Molecular Detection Assay (MDA) 2 - Salmonella for the Detection of Salmonella spp. in Select Foods and Environmental Surfaces: Collaborative Study, First Action 2016.01.

Science.gov (United States)

Bird, Patrick; Flannery, Jonathan; Crowley, Erin; Agin, James R; Goins, David; Monteroso, Lisa

2016-07-01

The 3M™ Molecular Detection Assay (MDA) 2 - Salmonella uses real-time isothermal technology for the rapid and accurate detection of Salmonella spp. from enriched select food, feed, and food-process environmental samples. The 3M MDA 2 - Salmonella was evaluated in a multilaboratory collaborative study using an unpaired study design. The 3M MDA 2 - Salmonella was compared to the U.S. Food and Drug Administration Bacteriological Analytical Manual Chapter 5 reference method for the detection of Salmonella in creamy peanut butter, and to the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook Chapter 4.08 reference method "Isolation and Identification of Salmonella from Meat, Poultry, Pasteurized Egg and Catfish Products and Carcass and Environmental Samples" for the detection of Salmonella in raw ground beef (73% lean). Technicians from 16 laboratories located within the continental United States participated. Each matrix was evaluated at three levels of contamination: an uninoculated control level (0 CFU/test portion), a low inoculum level (0.2-2 CFU/test portion), and a high inoculum level (2-5 CFU/test portion). Statistical analysis was conducted according to the probability of detection (POD) statistical model. Results obtained for the low inoculum level test portions produced difference in collaborator POD values of 0.03 (95% confidence interval, -0.10 to 0.16) for raw ground beef and 0.06 (95% confidence interval, -0.06 to 0.18) for creamy peanut butter, indicating no statistically significant difference between the candidate and reference methods.

Minimising protein oxidation in retail-packed minced beef using three-gas MA-packaging

DEFF Research Database (Denmark)

Spanos, Dimitrios; Baussa Cano, Laura; Baron, Caroline P.

beef. To establish whether three-gas MAP (O2, CO2 and N2), instead of two-gas MAP (O2 and CO2), would affect sensory attributes, shelf life, protein and lipid oxidation, minced beef was packed in MAP with either 40%, 50% or 80% O2 and 20% or 40% CO2 with N2 as filler gas. When comparing traditional MA-packaging......Minced beef is usually packed in high oxygen modified atmosphere packaging (MAP) with a gas mixture consisting of 70-80% oxygen (O2) and 20-30% carbon dioxide (CO2). Unfortunately, this results in rubbery and less juicy beef patties with a more rancid flavour compared with fresh or nonoxygen packed...... (80% O2 + 20% CO2) with a low oxygen packaging atmosphere (40% O2 + 20% CO2 + 40% N2), the latter is seen to increase the meat oxidative stability during storage but decrease acceptability and shelf life. In contrast, high oxygen MAP (80% and 50% O2) results in more oxidation but a longer shelf life...

Effect of Gamma Irradiation and Marination on Microbial Load of Beef Meat

International Nuclear Information System (INIS)

Elhifnawi, H.N.

2010-01-01

This study was undertaken to determine if a combined treatment (marinating in natural plant extracts or air) with gamma irradiation could have a synergetic effect, in order to reduce the dose required for microbial decontamination of fresh beef meat. The effect of these combined treatments on the shelf-life extension was also evaluated. The marinating treatment have a synergistic effect with irradiation treatment to reduce the total microbial count and controlling proliferation during storage at 4 degree C for 6 days. Irradiation of fresh beef meat with a dose of 3.0 kGy in combination with marination appear to be able to extend the microbial shelf-life. The D10 values of Listeria monocytogenes inoculated onto un-marinated and marinated beef were 0.5 and 0.4 kGy, respectively

Derivation of economic values for veal, beef and milk production traits using profit equations.

NARCIS (Netherlands)

Bekman, H.; Arendonk, van J.A.M.

1993-01-01

In this study profit equations for milk, veal and beef bull production were developed to obtain economic values for different traits. Veal and beef production were described in terms of fat and protein daily gain. For categorical traits, dystocia and carcass quality traits, economic values were

An index for beef and veal characteristics in dairy cattle based on carcass traits.

NARCIS (Netherlands)

Werf, van der J.H.J.; Waaij, van der E.H.; Groen, A.F.; Jong, de G.

1998-01-01

Carcass data are nowadays routinely collected from Dutch slaughterhouses. The aim of this study was to develop a selection index for beef production traits in a dairy cattle population based upon such data. Records were available from three categories of animals: veal calves, beef bulls, and cows