WorldWideScience

Sample records for ground beef raw

  1. The antioxidant epazote effect (Chenopodium ambrosioides L.) on raw ground beef

    OpenAIRE

    Luz H. Villalobos-Delgado; Edith G. Gonzalez-Mondragon; Alma Yadira Salazar-Govea; Joaquin T. Santiago-Castro; Juana Ramirez-Andrade

    2016-01-01

    For this paper, solid-liquid extractions of epazote (Chenopodium ambrosioides L.) were carried out using water (IE) and ethanol (EtOHE) as solvents, with the objective of evaluating its antioxidant effect on raw ground beef stored at 4 °C for 9 days. The analysis was carried out under the following treatments: CTL (meat without antioxidants), CIE (meat with infusion of epazote), CEtOHE (meat with ethanolic extract of epazote) and ASC (meat with sodium ascorbate solution). The characteristics ...

  2. The antioxidant epazote effect (Chenopodium ambrosioides L. on raw ground beef

    Directory of Open Access Journals (Sweden)

    Luz H. Villalobos-Delgado

    2016-12-01

    Full Text Available For this paper, solid-liquid extractions of epazote (Chenopodium ambrosioides L. were carried out using water (IE and ethanol (EtOHE as solvents, with the objective of evaluating its antioxidant effect on raw ground beef stored at 4 °C for 9 days. The analysis was carried out under the following treatments: CTL (meat without antioxidants, CIE (meat with infusion of epazote, CEtOHE (meat with ethanolic extract of epazote and ASC (meat with sodium ascorbate solution. The characteristics determined for both IE and EtOHE before being added to the meat were pH, antioxidant activity (AA, total polyphenols (TP and total flavonoids (TF. The antioxidant effect on the ground beef was evaluated using the thiobarbituric acid reactive substances (TBARS method and instrumental color. EI showed the highest TF content. Meat with IE and EtOHE treatments had lower TBARS values than control meat, and higher of L* and b* values, which indicate greater clarity in both treatments. In conclusion, under these conditions, epazote has potential as a natural antioxidant in order to extend the shelf life of meat and meat products.

  3. Validation of mathematical models for Salmonella growth in raw ground beef under dynamic temperature conditions representing loss of refrigeration.

    Science.gov (United States)

    McConnell, Jennifer A; Schaffner, Donald W

    2014-07-01

    Temperature is a primary factor in controlling the growth of microorganisms in food. The current U. S. Food and Drug Administration Model Food Code guidelines state that food can be kept out of temperature control for up to 4 h without qualifiers, or up to 6 h, if the food product starts at an initial 41 °F (5 °C) temperature and does not exceed 70 °F (21 °C) at 6 h. This project validates existing ComBase computer models for Salmonella growth under changing temperature conditions modeling scenarios using raw ground beef as a model system. A cocktail of Salmonella serovars isolated from different meat products ( Salmonella Copenhagen, Salmonella Montevideo, Salmonella Typhimurium, Salmonella Saintpaul, and Salmonella Heidelberg) was made rifampin resistant and used for all experiments. Inoculated samples were held in a programmable water bath at 4.4 °C (40 °F) and subjected to linear temperature changes to different final temperatures over various lengths of time and then returned to 4.4 °C (40 °F). Maximum temperatures reached were 15.6, 26.7, or 37.8 °C (60, 80, or 100 °F), and the temperature increases took place over 4, 6, and 8 h, with varying cooling times. Our experiments show that when maximum temperatures were lower (15.6 or 26.7 °C), there was generally good agreement between the ComBase models and experiments: when temperature increases of 15.6 or 26.7 °C occurred over 8 h, experimental data were within 0.13 log CFU of the model predictions. When maximum temperatures were 37 °C, predictive models were fail-safe. Overall bias of the models was 1.11. and accuracy was 2.11. Our experiments show the U.S. Food and Drug Administration Model Food Code guidelines for holding food out of temperature control are quite conservative. Our research also shows that the ComBase models for Salmonella growth are accurate or fail-safe for dynamic temperature conditions as might be observed due to power loss from natural disasters or during transport out of

  4. Quantitative distribution of Salmonella spp. and Escherichia coli on beef carcasses and raw beef at retail establishments.

    Science.gov (United States)

    Martínez-Chávez, L; Cabrera-Diaz, E; Pérez-Montaño, J A; Garay-Martínez, L E; Varela-Hernández, J J; Castillo, A; Lucia, L; Ávila-Novoa, M G; Cardona-López, M A; Gutiérrez-González, P; Martínez-Gonzáles, N E

    2015-10-01

    Salmonella is a foodborne pathogen that commonly inhabits the gastrointestinal tract of a healthy feedlot cattle and can be transferred to the carcass surface during hide removal and evisceration procedures. Numerous investigations on Salmonella prevalence throughout different stages of the beef chain have been conducted. In contrast, limited studies are available on quantitative determinations of Salmonella at different steps in raw meat production. Quantitative data, particularly for pathogenic bacteria such as Salmonella are important for quantitative risk assessment. Salmonella spp. and Escherichia coli populations were enumerated on beef carcass samples collected at abattoirs and also in beef chunks and ground beef samples collected from butcher's shops at retail in Jalisco State, Mexico. Sponge samples from beef carcass sides (n=142) were collected immediately after final water wash and before chilling at three non-federally inspected abattoirs following USDA-FSIS sampling protocols. Beef chunks (n=84) and ground beef (n=65) samples were obtained from 86 butcher's shops. Salmonella enumeration was conducted by the Most Probable Number method and E. coli counts were determined using Petrifilm plates. Salmonella was isolated from 18% of beef carcasses, 39% of beef chunks and 71% of ground beef samples. Salmonella mean counts were 1.3±0.9 Log MPN/300 cm(2) on beef carcasses, 1.9±0.9 and 2.3±1.1 Log MPN/25 g in beef chunks and ground beef samples, respectively. Twenty-six Salmonella serotypes and 11 serogroups were identified among 432 isolates recovered. Salmonella typhimurium (14%), Salmonella sinstorf (12%) and S. Group E1 monophasic (10%) were the most frequent. Escherichia coli was present on 97, 84 and 100% of beef carcasses, beef chunks and ground beef samples, respectively. Escherichia coli mean counts were 3.2±0.7 Log CFU/300 cm(2), 3.9±1.1 and 4.5±1.2 Log CFU/25 g on beef carcasses, beef chunks and ground beef, respectively. Salmonella prevalence

  5. Ground Beef and Food Safety

    Science.gov (United States)

    ... torn. If possible, place the package in a plastic bag so leaking juices won't drip on other ... duty plastic wrap, aluminum foil, freezer paper, or plastic bags made for freezing. Ground beef is safe indefinitely ...

  6. 7 CFR 65.155 - Ground beef.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground beef. 65.155 Section 65.155 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.155 Ground beef. Ground beef has the...

  7. Detection of Shiga toxin-producing Escherichia coli (STEC) O157:H7, O26, O45, O103, O111, O121, and O145, and Salmonella in retail raw ground beef using the DuPont BAX system

    Science.gov (United States)

    Shiga toxin-producing Escherichia coli (STEC) and Salmonella are food-borne pathogens commonly associated with beef, and reliable methods are needed to determine their prevalence in beef and to ensure food safety. Retail ground beef was tested for the presence of E. coli O157:H7, STEC serogroups O2...

  8. 76 FR 72331 - Shiga Toxin-Producing Escherichia coli in Certain Raw Beef Products

    Science.gov (United States)

    2011-11-23

    ... Toxin-Producing Escherichia coli in Certain Raw Beef Products AGENCY: Food Safety and Inspection Service... methods for controlling non-O157 Shiga toxin-producing Escherichia coli in raw, intact and non-intact beef... Escherichia coli in raw, intact and non-intact beef products and product components on or before December...

  9. Encapsulated phosphates reduce lipid oxidation in both ground chicken and ground beef during raw and cooked meat storage with some influence on color, pH, and cooking loss.

    Science.gov (United States)

    Kılıç, B; Simşek, A; Claus, J R; Atılgan, E

    2014-05-01

    Effects of encapsulated sodium tripolyphosphate (STP), sodium hexametaphosphate (HMP) and sodium pyrophosphate (SPP) on lipid oxidation in uncooked (0, 2, 24h) and cooked (0, 1, 7 d) ground chicken and beef during storage were determined. Ten phosphate treatments included a control (no phosphate), three unencapsulated (u) at 0.5% and three encapsulated (e) phosphates (0.5%) each at a low (e-low) and high (e-high) coating level. Two heating rates (slow, fast) were investigated. Cooking loss (CL), pH, color, orthophosphate (OP), TBARS and lipid hydroperoxides (LPO) were determined. A fast heating and uSTP resulted in lower CL (pphosphate incorporation, slow heating and storage (pphosphates and increased coating level reduced OP (pphosphates and the greater coating level had no effect on the pH in cooked samples. Not increased coating level but encapsulated phosphates decreased lipid oxidation in cooked samples (p<0.05).

  10. Comparison of FoodChek E. coli test and AOAC Research Institute Performance Tested Method 010603 for detection of E. coli O157 in raw ground beef.

    Science.gov (United States)

    Flanagan, Richard J; Martinez, Gabriela

    2010-01-01

    The FoodChek E. coli P157 assay [AOAC Research Institute (RI) Performance Tested Method (PTM) 060902] is a rapid detection system that incorporates the use of antibody-coated superparamagnetic nanoparticles in a lateral flow immunoassay format. The system comprises a commercially available enrichment medium, a magnetic nanoparticle immunoassay, and an automated reader for detection. Assay detection threshold is improved relative to traditional immunoassays through use of a magnetic nanoparticle label and a highly sensitive magnetic particle detector. FoodChek E. coli O157 is a reintroduction of the previously certified AOAC PTM 010603. The original assay was evaluated and approved in internal and independent laboratory studies. Vacci-Test Corp. has contracted with the original supplier of the PTM to remanufacture the test under identical conditions and with identical raw materials. This report is intended to show that FoodChek E. coli is identical in performance to the previously approved PTM. The results showed no difference for the parameters evaluated. Three kit lots along with three lots of media and media supplement were compared in lot-to-lot and stability testing. The results indicated no difference in performance across the three lots. The results showed sensitivity of > 99% and a specificity rate of > 98% for the FoodChek method and a significantly higher sensitivity than the reference method.

  11. Quantitative Microbial Risk Assessment for Campylobacter Foodborne Illness in Raw Beef Offal Consumption in South Korea.

    Science.gov (United States)

    Jeong, Jiyeon; Lee, Jeeyeon; Lee, Heeyoung; Lee, Soomin; Kim, Sejeong; Ha, Jimyeong; Yoon, Ki-Sun; Yoon, Yohan

    2017-04-01

    This study evaluated the risk of Campylobacter foodborne illness caused by the intake of raw beef offal in South Korea. The prevalence of Campylobacter spp. in raw beef offal (liver and tripe) was investigated by plating samples on modified charcoal-cefoperazone-deoxycholate agar with Preston enrichment broth. Data were collected about storage temperature and length of storage of raw beef offal, and probabilistic distributions for the data were determined, using @RISK software. Predictive models were developed to describe the fate of Campylobacter in raw beef offal, and the amount and frequency of consumption and dose-response model were surveyed. Subsequently, these data were used to estimate the risk of Campylobacter foodborne illness caused by the intake of raw beef offal. Of 80 beef offal samples, 1 (1.25%) was contaminated with Campylobacter jejuni . Predictive models were used for exposure assessment. An exponential distribution was selected to represent beef offal consumption by people who eat this occasionally, with a mean of 60.2 g and 3.6% monthly consumption frequency. Simulations using @RISK predicted that the probability of Campylobacter foodborne illness per person per month is 1.56 × 10(-5) for home consumption and 1.74 × 10(-5) for restaurant consumption in South Korea, which indicates the risk of Campylobacter foodborne illness by intake of raw beef offal in South Korea.

  12. Non-O157 Shiga toxin-producing Escherichia coli in U. S. retail ground beef.

    Science.gov (United States)

    Liao, Yen-Te; Miller, Markus F; Loneragan, Guy H; Brooks, J Chance; Echeverry, Alejandro; Brashears, Mindy M

    2014-07-01

    Shiga toxin-producing Escherichia coli (STEC) serotype O157:H7 and serogroups O26, O45, O103, O111, O121, and O145 are the leading cause of STEC-associated infections in humans in the United States. In the United States, these organisms are considered adulterants in raw nonintact beef products and in intact beef destined to be made into or used in nonintact raw beef products. The objective of this study was to provide an estimate of the burden of the six serogroups of non-O157 STEC in ground beef obtained from retail stores across the United States. A convenience sample of commercial ground beef products (n = 1,129) were purchased from retail stores in 24 states from October 2011 to May 2012. The samples had various lean/fat proportions, muscle group of origin (chuck, round, sirloin, or not specified), and packaging types. For each ground beef sample, 25 g was inoculated in 225 ml of modified tryptic soy broth, stomached for 1 min, and then incubated at 41°C for 18 ± 2 h. These enrichment cultures were then screened for stx, eae, and O group genes using a commercially available, closed-platform PCR-based method. The potential positive samples were subjected to immunomagnetic separation and plated on modified Rainbow agar. Morphologically typical colonies were subjected to latex agglutination and PCR determination of stx and eae genes. Nine (0.8%) of the ground beef samples were potentially positive for at least one STEC serogroup after PCR screening. The serogroups detected by PCR assay were O26 (four samples), O103 (four samples), O145 (three samples), O45 (two samples), and O121 (one sample). No STEC isolates belonging to these serogroups were recovered from the sample cultures. The current research provides updated surveillance data for non-O157 STEC isolates among commercial ground beef products and information regarding the potential sources of contamination from different parts of beef trims destined for ground beef production.

  13. Prevalence and distribution of Arcobacter spp. in raw milk and retail raw beef.

    Science.gov (United States)

    Shah, A H; Saleha, A A; Murugaiyah, M; Zunita, Z; Memon, A A

    2012-08-01

    A total of 106 beef samples which consisted of local (n = 59) and imported (n = 47) beef and 180 milk samples from cows (n = 86) and goats (n = 94) were collected from Selangor, Malaysia. Overall, 30.2% (32 of 106) of beef samples were found positive for Arcobacter species. Imported beef was significantly more contaminated (46.80%) than local beef (16.9%). Arcobacter butzleri was the species isolated most frequently from imported (81.8%) and local (60%) beef, followed by Arcobacter cryaerophilus in local (33.3%) and imported (18.2%) beef samples. Only one local beef sample (10%) yielded Arcobacter skirrowii. Arcobacter species were detected from cow's milk (5.8%), with A. butzleri as the dominant species (60%), followed by A. cryaerophilus (40%), whereas none of the goat's milk samples were found positive for Arcobacter. This is the first report of the detection of Arcobacter in milk and beef in Malaysia.

  14. Decreased dosage of acidified sodium chlorite reduces microbial contamination and maintains organoleptic qualities of ground beef products.

    Science.gov (United States)

    Bosilevac, Joseph M; Shackelford, Steven D; Fahle, Rick; Biela, Timothy; Koohmaraie, Mohammad

    2004-10-01

    Acidified sodium chlorite (ASC) spray was evaluated at decreased dosages and application rates to determine its efficacy for reducing bacterial contamination on boneless beef trimmings used for production of raw ground beef products while maintaining desirable consumer qualities in the finished ground beef products. Two different applications of ASC (600 ppm applied at a rate of 1.3 oz/lb and 300 ppm applied at a rate of 1 oz/lb) were used to treat boneless beef trimmings before grinding. The effect of ASC treatment on 50/50 lean beef trimmings was greater than on 90/10 trimmings. ASC at 600 ppm reduced both the aerobic plate counts (APC) and Enterobacteriaceae counts (EBC) by 2.3 log CFU/g on 50/50 trimmings, whereas treatment with 300 ppm ASC reduced APC and EBC of 50/50 trimmings by 1.1 and 0.7 log CFU/g, respectively. Ground beef formulations of 90/10 and 73/27 were produced from the treated boneless beef trim and packaged in chubs and in modified atmosphere packaging. The efficacy of ASC spray treatment to inhibit APC and EBC over the shelf life of each ground beef product was monitored. The APC and EBC in ground beef chubs were reduced by 1.0 to 1.5 log CFU/g until day 20. The APC and EBC for products in modified atmosphere packaging were reduced 1.5 to 3.0 log CFU/g throughout their shelf life. Both decreased dosages of ASC were equally effective on 90/10 lean ground beef, but the 300 ppm ASC treatment was slightly better at reducing the EBC of 73/27 ground beef. The organoleptic qualities (color, odor, and taste) of the ground beef products treated with 300 ppm ASC were found to be superior to those treated with 600 ppm ASC. Our results indicated that decreased dosages of ASC reduce contamination and lengthen the shelf life of ground beef. Furthermore, the 300 ppm ASC treatment reduced bacterial counts while maintaining desirable organoleptic ground beef qualities.

  15. Aroma development in high pressure treated beef and chicken meat compared to raw and heat treated.

    Science.gov (United States)

    Schindler, Sabrina; Krings, Ulrich; Berger, Ralf G; Orlien, Vibeke

    2010-10-01

    Chicken breast and beef muscle were treated at 400 and 600 MPa for 15 min at 5 degrees C and compared to raw meat and a heated sample (100 degrees C for 15 min). Vacuum-packed beef meat with a smaller fraction of unsaturated fatty acids showed better oxidative stability during 14 days of cold storage, as shown by a low steady-state level of hydroperoxide values, than vacuum-packed chicken meat. Accordingly, the critical pressures of 400 MPa and 600 MPa for chicken breast and beef sirloin, respectively, were established. Volatiles released after opening of the meat bags or during storage of open meat bags, simulating consumer behaviour, were measured under conditions mimicking eating. Quantitative and olfactory analysis of pressurised meat gave a total of 46 flavour volatiles, mainly alcohols (11), aldehydes (15), and ketones (11), but all in low abundance after 14 days of storage. Overall, beef meat contained less volatiles and in lower abundance (factor of 5) compared to chicken meat. The most important odour active volatiles (GC-O) were well below the detection thresholds necessary to impart a perceivable off-flavour. Lipid oxidation was significantly accelerated during 24h of cold storage in both cooked chicken and beef when exposed to oxygen, while the pressurised and oxygen-exposed chicken and beef meat remained stable. Pressure treatment of beef and chicken did not induce severe changes of their raw aroma profiles.

  16. 75 FR 10460 - Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef Product

    Science.gov (United States)

    2010-03-08

    ... Food Safety Inspection Service Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef... raw beef product that FSIS has found positive for Escherichia coli (E. coli) O157:H7. FSIS will also... Agency procedures for identifying product that may be positive for E. coli O157:H7. DATES: The public...

  17. Thermal inactivation of Bacillus anthracis Sterne in irradiated ground beef heated in a water bath or cooked on commercial grills

    Science.gov (United States)

    The thermal stability of heat-shocked and non heat-shocked spores of the virulence-attenuated Sterne strain of Bacillus anthracis was evaluated at select temperatures in irradiated, raw ground beef (25% fat) heated in a water bath or cooked using two different commercial grills. For the former, 3-g ...

  18. Bio protection and preservation of raw beef meat using pungent aromatic plant substances.

    Science.gov (United States)

    Krishnan, Kesavan Radha; Babuskin, Srinivasan; Babu, Packirisamy Azhagu Saravana; Fayidh, Mohammed Abbas; Sabina, Kalleary; Archana, Ganesan; Sivarajan, Meenatchisundaram; Sukumar, Muthusamy

    2014-09-01

    This study examined the effectiveness of three individual spice (clove, cinnamon and oregano) extracts and their combinations in raw beef meat during refrigerated storage. Meat samples were monitored for microbiological (total viable count, Enterobacteriaceae, lactic acid bacteria, Brochothrix thermosphacta and Pseudomonas spp.) and physicochemical (pH, colour and thiobarbituric acid-reactive substances (TBARS)) attributes. Samples treated with the combination of all three spice extracts showed lower bacterial counts and better L*, a* and b* values among treated samples during the storage period. Positive and negative control samples had the highest TBARS values at the end of the storage period. With the addition of spice extracts, TBARS values in raw beef samples were retarded effectively (P meat. They also suggest that combinations of these extracts may have potential as natural preservatives in raw meat products. © 2014 Society of Chemical Industry.

  19. Prevalence and antimicrobial resistance profile of Staphylococcus species in chicken and beef raw meat in Egypt.

    Science.gov (United States)

    Osman, Kamelia M; Amer, Aziza M; Badr, Jihan M; Saad, Aalaa S A

    2015-05-01

    Coagulase-positive (CPS) and coagulase-negative (CNS) staphylococci cause staphylococcal food poisoning. Recently, CPS and CNS have received increasing attention due to their potential role in the dissemination of antibiotic resistance markers. The present study aimed to evaluate CPS and CNS species distribution and their antibiotic resistance profile isolated from chicken and beef meat. Fifty fresh, uncooked chicken parts and 50 beef meat cuts (local n=27; imported n=23) were used. One hundred staphylococcal isolates belonging to 11 species were isolated and identified from chicken (n=50) and beef (n=50) raw meat samples. Staphylococcus hyicus (26/100), lugdunensis (18/100), aureus (15/100) and epidermidis (14/100) were dominant. S. aureus was 100% resistant to penicillin and sulfamethoxazole/trimethoprim. Vancomycin-resistant S. aureus showed intermediate resistance (51%), which might indicate the dissemination of vancomycin resistance in the community and imply food safety hazards. The percentage of resistance to β-lactams was variable, with the highest resistance being to penicillin (94%) and lowest to ampicillin-sulbactam (22%). Antimicrobial resistance was mainly against penicillin (94%), clindamycin (90%) and sulfamethoxazole/trimethoprim (82%). The results indicate that chicken and beef raw meat are an important source of antibiotic-resistant CPS and CNS.

  20. Validation of the Thermo Scientific SureTect Escherichia coli O157:H7 Real-Time PCR Assay for Raw Beef and Produce Matrixes.

    Science.gov (United States)

    Cloke, Jonathan; Crowley, Erin; Bird, Patrick; Bastin, Ben; Flannery, Jonathan; Agin, James; Goins, David; Clark, Dorn; Radcliff, Roy; Wickstrand, Nina; Kauppinen, Mikko

    2015-01-01

    The Thermo Scientific™ SureTect™ Escherichia coli O157:H7 Assay is a new real-time PCR assay which has been validated through the AOAC Research Institute (RI) Performance Tested Methods(SM) program for raw beef and produce matrixes. This validation study specifically validated the assay with 375 g 1:4 and 1:5 ratios of raw ground beef and raw beef trim in comparison to the U.S. Department of Agriculture, Food Safety Inspection Service, Microbiology Laboratory Guidebook (USDS-FSIS/MLG) reference method and 25 g bagged spinach and fresh apple juice at a ratio of 1:10, in comparison to the reference method detailed in the International Organization for Standardization 16654:2001 reference method. For raw beef matrixes, the validation of both 1:4 and 1:5 allows user flexibility with the enrichment protocol, although which of these two ratios chosen by the laboratory should be based on specific test requirements. All matrixes were analyzed by Thermo Fisher Scientific, Microbiology Division, Vantaa, Finland, and Q Laboratories Inc, Cincinnati, Ohio, in the method developer study. Two of the matrixes (raw ground beef at both 1:4 and 1:5 ratios) and bagged spinach were additionally analyzed in the AOAC-RI controlled independent laboratory study, which was conducted by Marshfield Food Safety, Marshfield, Wisconsin. Using probability of detection statistical analysis, no significant difference was demonstrated by the SureTect kit in comparison to the USDA FSIS reference method for raw beef matrixes, or with the ISO reference method for matrixes of bagged spinach and apple juice. Inclusivity and exclusivity testing was conducted with 58 E. coli O157:H7 and 54 non-E. coli O157:H7 isolates, respectively, which demonstrated that the SureTect assay was able to detect all isolates of E. coli O157:H7 analyzed. In addition, all but one of the nontarget isolates were correctly interpreted as negative by the SureTect Software. The single isolate giving a positive result was an E

  1. Thermal inactivation and post-treatment growth during storage of multiple Salmonella serotypes in ground beef as affected by sodium lactate and oregano oil

    Science.gov (United States)

    We assessed the heat resistance of Salmonella in raw ground beef in both the absence and presence of sodium lactate or oregano oil, and with combinations of these two GRAS-listed ingredients, and determined their bactericidal or bacteriostatic activities during post-thermal treatment storage at 15C....

  2. Measurement of soy contents in ground beef using near-infrared spectroscopy

    Science.gov (United States)

    Models for determining contents of soy products in ground beef were developed using near-infrared (NIR) spectroscopy. Samples were prepared by mixing four kinds of soybean protein products (Arconet, toasted soy grits, Profam and textured vegetable protein (TVP)) with ground beef (content from 0%–100...

  3. The effect of cinnamon bark (Cinnamomum burmanii) essential oil microcapsules on vacuumed ground beef quality

    Science.gov (United States)

    Brilliana, I. N.; Manuhara, G. J.; Utami, R.; Khasanah, L. U.

    2017-04-01

    Ground beef has a short shelf life because it is susceptible to damage due to microbial contamination and lipid oxidation. So some sort of preservation method such as refrigerated storage, vacuum packaging or natural preservative addition is needed to extend the shelf life of ground beef. A natural preservative that can be used as a food preservative is the cinnamon bark (Cinnamomum burmanii) essential oil microcapsules. The aim of the research was to determine the influence of a cinnamon bark essential oil microcapsules (0%;0.5% and 1% w/w of the ground beef) on the Total Plate Count (TPC), Thiobarbituric Acid (TBA), pH and color of ground beef during refrigerated storage (4±1°C). The result showed that cinnamon bark essential oil microcapsules affected the TPC, TBA, pH and color of ground beef. The addition of the cinnamon bark essential oil microcapsules on ground beef can inhibit microbial growth, inhibit lipid oxidation, inhibit discoloration and lowering pH of fresh ground beef during refrigerated storage compared to the control sample. The higher of the microcapsules were added, the higher the inhibition of microbial growth, lipid oxidation and discoloration of ground beef, indicating better preservation effects.

  4. Development of a Rapid Immunodiagnostic Test for Pork Components in Raw Beef and Chicken Meats: a Preliminary Study

    Directory of Open Access Journals (Sweden)

    S. N. Depamede

    2011-08-01

    Full Text Available A rapid immunodiagnostic test that provides visual evidence of the presence of pork components in raw beef and chicken meats was developed. Colloidal gold was prepared and conjugated with anti-Swine IgG polyclonal antibody. Immunochromatographic test strips were produced, and then were used to test laboratory adulterated raw meat samples. The samples consisted adulteration meat, immunodiagnostic, pork, rapid test of pork-in-beef, or pork-in-chicken at 1/0; 1/100; 1/1,000; 1/5,000; 1/10,000 (w/w adulteration levels that were extracted in phosphate-buffered saline. Raw beef and chicken meats without pork were included as controls. Analysis was completed in 10 min. Detection limit was 1/5,000 (w/w, although 1/10,000 was also observed. This immunodiagnostic tests can be conveniently applied to detect low levels of pork components in raw beef and chicken meat products. For the commercial purposes, further studies need to be carried out.

  5. Effects of ascorbic acid and antioxidants on color, lipid oxidation and volatiles of irradiated ground beef

    Science.gov (United States)

    Ahn, D. U.; Nam, K. C.

    2004-09-01

    Beef loins with 3 different aging times after slaughter were ground, added with none, 0.1% ascorbic acid, 0.01% sesamol+0.01% α-tocopherol, or 0.1% ascorbic acid+0.01% sesamol+0.01% tocopherol. The meats were packaged in oxygen-permeable bags, irradiated at 2.5 kGy, and color, oxidation-reduction potential (ORP), lipid oxidation and volatile profiles were determined. Irradiation decreased the redness of ground beef, and visible color of beef changed from a bright red to a green/brown depending on the age of meat. Addition of ascorbic acid prevented color changes in irradiated beef, and the effect of ascorbic acid became greater as the age of meat or storage time after irradiation increased. The ground beef added with ascorbic acid had lower ORP than control, and the low ORP of meat helped maintaining the heme pigments in reduced form. During aerobic storage, S-volatiles disappeared while volatile aldehydes significantly increased in irradiated beef. Addition of ascorbic acid at 0.1% or sesamol+α-tocopherol at each 0.01% level to ground beef prior to irradiation were effective in reducing lipid oxidation and S-volatiles. As storage time increased, however, the antioxidant effect of sesamol+tocopherol in irradiated ground beef was superior to that of ascorbic acid.

  6. Effects of ascorbic acid and antioxidants on color, lipid oxidation and volatiles of irradiated ground beef

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, D.U. E-mail: duahn@iastate.edu; Nam, K.C

    2004-10-01

    Beef loins with 3 different aging times after slaughter were ground, added with none, 0.1% ascorbic acid, 0.01% sesamol+0.01% {alpha}-tocopherol, or 0.1% ascorbic acid+0.01% sesamol+0.01% tocopherol. The meats were packaged in oxygen-permeable bags, irradiated at 2.5 kGy, and color, oxidation-reduction potential (ORP), lipid oxidation and volatile profiles were determined. Irradiation decreased the redness of ground beef, and visible color of beef changed from a bright red to a green/brown depending on the age of meat. Addition of ascorbic acid prevented color changes in irradiated beef, and the effect of ascorbic acid became greater as the age of meat or storage time after irradiation increased. The ground beef added with ascorbic acid had lower ORP than control, and the low ORP of meat helped maintaining the heme pigments in reduced form. During aerobic storage, S-volatiles disappeared while volatile aldehydes significantly increased in irradiated beef. Addition of ascorbic acid at 0.1% or sesamol+{alpha}-tocopherol at each 0.01% level to ground beef prior to irradiation were effective in reducing lipid oxidation and S-volatiles. As storage time increased, however, the antioxidant effect of sesamol+tocopherol in irradiated ground beef was superior to that of ascorbic acid.

  7. Prevalence and Antimicrobial Resistance of Campylobacter Isolated from Dressed Beef Carcasses and Raw Milk in Tanzania.

    Science.gov (United States)

    Kashoma, Isaac P; Kassem, Issmat I; John, Julius; Kessy, Beda M; Gebreyes, Wondwossen; Kazwala, Rudovick R; Rajashekara, Gireesh

    2016-01-01

    Campylobacter species are commonly transmitted to humans through consumption of contaminated foods such as milk and meat. The aim of this study was to investigate the prevalence, antimicrobial resistance, and genetic determinants of resistance of Campylobacter isolated from raw milk and beef carcasses in Tanzania. The antimicrobial resistance genes tested included blaOXA-61 (ampicillin), aph-3-1 (aminoglycoside), tet(O) (tetracycline), and cmeB (multi-drug efflux pump). The prevalence of Campylobacter was 9.5% in beef carcasses and 13.4% in raw milk, respectively. Using multiplex-polymerase chain reaction (PCR), we identified 58.1% of the isolates as Campylobacter jejuni, 30.7% as Campylobacter coli, and 9.7% as other Campylobacter spp. One isolate (1.6%) was positive for both C. jejuni and C. coli specific PCR. Antimicrobial susceptibility testing using the disk diffusion assay and the broth microdilution method showed resistance to: ampicillin (63% and 94.1%), ciprofloxacin (9.3% and 11.8%), erythromycin (53.7% and 70.6%), gentamicin (0% and 15.7%), streptomycin (35.2% and 84.3%), and tetracycline (18.5% and 17.7%), respectively. Resistance to azithromycin (42.6%), nalidixic acid (64.8%), and chloramphenicol (13%) was determined using the disk diffusion assay only, while resistance to tylosin (90.2%) was quantified using the broth microdilution method. The blaOXA-61 (52.6% and 28.1%), cmeB (26.3% and 31.3%), tet(O) (26.3% and 31.3%), and aph-3-1 (5.3% and 3.0%) were detected in C. coli and C. jejuni. These findings highlight the extent of antimicrobial resistance in Campylobacter occurring in important foods in Tanzania. The potential risks to consumers emphasize the need for adequate control approaches, including the prudent use of antimicrobials to minimize the spread of antimicrobial-resistant Campylobacter.

  8. Effect of freezing rate and storage time on shelf-life quality of hot boned and conventionally boned ground beef

    Energy Technology Data Exchange (ETDEWEB)

    Gapud, V.G.; Schlimme, D.V.

    1986-01-01

    Commercially processed, 80% lean, chub packaged ground beef (both conventionally boned and hot boned) was frozen to O F (-18/sup 0/C) at three rates: 72, 96, and 120 hours before storage at O F (-18/sup 0/C). The meat was examined after 0, 1.5, 3, 6, 9, and 12 months storage for the following attributes: psychrophile and aerobic plate counts, free fatty acid (FFA) and thiobarbituric acid (TBA) values, niacin content, raw and cooked color, moisture, fat and protein contents, and cook shrink and texture of cooked patties. Freezing rates had no significant effect on microbial load, niacin content, color, or cook shrink and texture. Freezing rate had a significant effect upon TBA and FFA values. Niacin, cook shrink and moisture values declined and TBA and FFA values increased with storage. Raw meat Hunter L value increased and Hunter a/b value declined during storage. Substantial quality differences between meat types were found.

  9. Implementation of multivariate techniques for the selection of volatile compounds as indicators of sensory quality of raw beef.

    Science.gov (United States)

    Saraiva, Cristina; Oliveira, I; Silva, J A; Martins, C; Ventanas, J; García, C

    2015-06-01

    This study was performed in order to select volatile compounds to predict the off-odour and overall assessment of raw beef's freshness Maronesa breed, using multivariate analysis. M. longissimus dorsi packed in vacuum and MAP (70 % O2/20 % CO2/10 % N2) stored at 4 ºC were examined for off-odour perception as well as the overall assessment of freshness at 10 and 21 days post mortem. The results achieved in this study demonstrated that the selected volatile compounds could be considered as volatile indicators of beef spoilage, enclosing information for discrimination of Maronesa beef samples in sensory classes of odour corresponding to unspoiled and spoiled levels. Fifty-four volatile compounds were detected. A significant increase of aldehydes, ketones and alcohols were observed during storage in MAP. 2 and 3-methylbutanal, 2 and 3-methylbutanol, 1-pentanol, 1-hexanol, 2,3-octanedione, 3,5-octanedione, octanal and nonanal were suggested as indicators of beef spoilage. 3-methylpentane was considered as a marker in the first stages of spoilage in beef, decreasing during storage. Data were examined using PCR and PLSR models for different optimal subsets of volatile compounds. The simplicity and usefulness of the technique in using 0/1 data in preserving high levels of accuracy was also prevalent. The powerful analytical methodologies for reducing variables and the choice of optimal subsets could be advantageous in both basic research and the routine quality control of chilled beef.

  10. Isolation and characterization of Clostridium difficile associated with beef cattle and commercially produced ground beef

    Science.gov (United States)

    The incidence of Clostridium difficile infection has recently increased in North American and European countries. This pathogen has been isolated from retail pork, turkey, and beef products and reported associated with human illness. This increase in infections has been attributed to the emergence o...

  11. Salmonella spp. in lymph nodes of fed and cull cattle: Relative assessment of risk to ground beef

    Science.gov (United States)

    Ground beef products have been implicated as the vehicle for the transmission of Salmonella in a number of outbreaks. Although carcass surface interventions have proven effective, Salmonella contamination in ground beef still occurs. Recent studies indicate that deep tissue lymph nodes (DTLNs) may b...

  12. RESEARCH OF MOISTURE MIGRATION DURING PARTIAL FREEZING OF GROUND BEEF

    Directory of Open Access Journals (Sweden)

    V. M. Stefanovskiy

    2016-01-01

    Full Text Available The concept of «ideal product» is proposed for the study of mass transfer during partial freezing of food products by freezing plate. The ideal product is a product, in which number of factors affecting the «real product» (meat are excluded. These factors include chemical composition of meat, quality grade of raw material (NOR, DFD, PSE, cryoscopic temperature that determines the degree of water transformation into ice, the phenomenon of osmosis, rate of freezing, etc. By using the concept of «ideal product» and its implementation in a physical experiment, it is proved that the “piston effect” causing the migration of moisture is due to frozen crust formation during partial freezing of the body. During partial freezing of the product by freezing plate, «ideal» and «real» food environment is transformed from closed system into open one with inflow of moisture to unfrozen part of the body. In the «ideal product», there is an expulsion of unfrozen moisture from freezing front, so the water appears on the body surface. Thus, the displacement of moisture increases by the same law, according to which the thickness (weight of frozen layer increases. During partial freezing of ground meat, moisture does not appear on the surface of the product, but hydrates the unfrozen part of meat. The reason of this phenomenon is the expulsion of water during formation of frozen crust and water-binding capacity of meat.

  13. PRODUCT SAFETY AND COLOR CHARACTERISTICS OF GROUND BEEF PROCESSED FROM BEEF TRIMMINGS TREATED WITH PEROXYACETIC ACID ALONE OR FOLLOWED BY NOVEL ORGANIC ACIDS

    Directory of Open Access Journals (Sweden)

    Fred Pohlman

    2014-10-01

    Full Text Available The objective of this study was to evaluate the effectiveness of antimicrobial interventions using peroxyacetic acetic acid (PAA followed by novel organic acids on beef trimmings prior to grinding with conventional spray (CS or electrostatic spray (ES on ground beef microbial populations and color. Beef trimmings (80/20; 25kg were inoculated with E. coli O157:H7, non- O157:H7 shiga toxin producing (STEC E. coli (EC and Salmonella spp. (SA at 105 CFU/g. Inoculated trimmings (1.5 kg /treatment/replicate, 2 replicates were treated with CS application of 0.02% PAA alone or followed by CS or ES application of 3% octanoic acid (PO, 3% pyruvic acid (PP, 3% malic acid (PM, saturated solution of fumaric acid (PF or deionized water (W. Findings from this study suggest that PA as a single or multiple chemical hurdle approach with malic, pyruvic, octanoic and fumaric acid on beef trimmings may be effective in reducing E. coli O157:H7 as well as non-STEC serotypes and Salmonella in ground beef up to day 2 of simulated retail display. Results of this study showed that instrumental color properties of ground beef treated with peroxyacetic acid followed by organic acids had little or no difference (P > 0.05 compared to the untreated un-inoculated control ground beef samples. The results also indicate that ES application of some organic acids may have similar or greater efficiency in controlling ground beef microbial populations compared to the CS application of the same acid providing a more economical and waste manageable decontamination approach.

  14. The influence of forage diets and aging on beef palatability.

    Science.gov (United States)

    Jiang, T; Busboom, J R; Nelson, M L; O'Fallon, J; Ringkob, T P; Rogers-Klette, K R; Joos, D; Piper, K

    2010-11-01

    To investigate the influence of diet and aging on beef palatability, lipid oxidative stability, and fatty acid composition, crossbred steers were assigned to Feedlot S (alfalfa and grain), Forage TR (triticale and annual ryegrass), Forage TK (triticale and kale), or Forage+Feedlot (grazing ryegrass, fescue and orchardgrass, finished on alfalfa and grain) dietary treatments. Heifers were finished on Feedlot H (alfalfa and grain). Longissimus and tricep muscles were sampled from these animals for steaks and ground beef, respectively. Steaks were either dry- or wet-aged for 14 d. Ground beef was dry-aged, wet-aged for 14 d, or not aged. Trained sensory panelists evaluated palatability attributes of steaks and ground beef. Diet did not influence sensory attributes of steaks or ground beef. Aging impacted (Pbeef. Diet and aging had no impact on lipid oxidative stability but affected fatty acid composition of raw ground beef.

  15. Eff ects of natural antioxidants on colour stability, lipid oxidation and metmyoglobin reducing activity in raw beef patties

    Directory of Open Access Journals (Sweden)

    Fang Liu

    2015-03-01

    Full Text Available Background. Minced meats undergo oxidative changes and develop rancidity more quickly than intact muscle since grinding exposes more of the muscle surface to air and microbial contamination. Due to concerns about toxicological safety of synthetic antioxidants, recent studies have put more focus on natural antioxidant compounds derived from food components. Material and methods. The effects of four natural antioxidants (vitamin E, carnosine, grape seed extract and tea catechins on oxidative processes and metmyoglobin reducing activity in raw beef patties during refrigerated (4°C storage were investigated and the results were compared with butylated hydroxyanisole treatment patties. The correlation of lipid oxidation, colour and metmyoglobin reducing activity of beef patties were also studied. Results. Samples treated with carnosine had the highest redness values on the eighth day. Tea catechins, vitamin E and grape seed extract showed higher protective effect against lipid oxidation than carnosine. Metmyoglobin reducing activity increased greatly in all samples during the storage. Signifi cant correlation between redness value and lipid oxidation was demonstrated, while a weak correlation between metmyoglobin reducing activity and any other parameters was shown.

  16. On-line, proximate analysis of ground beef directly at a meat grinder outlet.

    Science.gov (United States)

    Isaksson, T; Nilsen, B N; Tøgersen, G; Hammond, R P; Hildrum, K I

    1996-07-01

    The fat, moisture and protein contents of ground beef were determined on-line by a diffuse reflectance near infrared (NIR) spectroscopy instrument at the outlet of a meat grinder. Beef samples in the range of 6.2-21.7% fat, 59.6-72.9% moisture and 18.1-20.7% protein were studied. Calibrations from samples ground with hole diameters of 4, 8, 13 or 19 mm in the grinder plate were validated. In addition, calibrations of combinations of these samples from the different hole diameters were validated. Prediction errors, expressed as root mean square error of cross validation of the beef samples, were 0.73-1.50% for fat, 0.75-1.33% for moisture and 0.23-0.32% for protein, depending on the hole diameter of the grinder plate. Calibrations from samples ground with the smallest hole diameters gave lowest prediction errors. The present prediction error results are only slightly higher compared to reported prediction error results using conventional at- and off-line NIR instruments. It is concluded that the on-line NIR prediction results were acceptable for samples ground with grinder plates of 4, 8 or 13 mm hole diameter.

  17. Detection of Ricin Contamination in Ground Beef by Electrochemiluminescence Immunosorbent Assay

    Directory of Open Access Journals (Sweden)

    David L. Brandon

    2011-04-01

    Full Text Available Ricin is a highly toxic protein present in the seeds of Ricinus communis (castor, grown principally as a source of high quality industrial lubricant and as an ornamental. Because ricin has been used for intentional poisoning in the past and could be used to contaminate food, there is a need for analytical methodology to detect ricin in food matrices. A monoclonal antibody-based method was developed for detecting and quantifying ricin in ground beef, a complex, fatty matrix. The limit of detection was 0.5 ng/g for the electrochemiluminescence (ECL method and 1.5 ng/g for enzyme-linked immunosorbent assay (ELISA. The detection of nanogram per gram quantities of ricin spiked into retail samples of ground beef provides approximately 10,000-fold greater sensitivity than required to detect a toxic dose of ricin (>1 mg in a 100 g sample.

  18. Feeding microalgae meal (All-G Rich; CCAP 4067/2) to beef heifers. II: Effects on ground beef color and palatability.

    Science.gov (United States)

    Phelps, K J; Drouillard, J S; O'Quinn, T G; Burnett, D D; Blackmon, T L; Axman, J E; Van Bibber-Krueger, C L; Gonzalez, J M

    2016-09-01

    The objective of this study was to examine the effects of feeding microalgae meal (All-G Rich, CCAP 4087/2; Alltech Inc., Nicholasville, KY) to finishing heifers on 85% lean and 15% fat (85/15) ground beef PUFA content, palatability, and color stability. Crossbred heifers ( = 288; 452 ± 23 kg initial BW) were allocated to pens (36 pens and 8 heifers/pen), stratified by initial pen BW (3,612 ± 177 kg), and randomly assigned within strata to 1 of 4 treatments: 0, 50, 100, and 150 g·heifer·d of microalgae meal. After 89 d of feeding, a subset of heifers (3/pen) was harvested and the rectus femoris, vastus lateralis, vastus medialis, and vastus intermedius were collected for processing into ground beef. At 42 d postmortem, 85/15 ground beef was formulated and formed into 112-g patties and fatty acid composition, subjective palatability, and 96-h retail color stability analyses were conducted. Increasing dietary microalgae meal concentration increased ground beef 20:5-3 and 22:6-3 fatty acids (quadratic, microalgae tended ( = 0.08) to decrease L*, but patties had similar L* values the remainder of display ( > 0.12). Feeding microalgae meal affected ( = 0.02) b* at 24 h and decreased (linear, = 0.08) b* at 48 h. From h 0 to 36 of display, microalgae affected redness of patties ( microalgae meal decreased a* value (linear, Microalgae meal did not impact sensory panel firmness, overall tenderness, or juiciness scores ( > 0.20) but tended to affect ( = 0.10) cohesiveness scores. As the amount of microalgae meal fed to heifers increased, beef flavor intensity decreased (linear, microalgae meal from 12 to 36 h of display ( microalgae meal to heifers decreased (linear, microalgae meal to heifers increases the PUFA content of 85/15 ground beef, there are undesirable effects on flavor and color stability.

  19. Determination of the effect of brand and product identification on consumer palatability ratings of ground beef patties.

    Science.gov (United States)

    Wilfong, A K; McKillip, K V; Gonzalez, J M; Houser, T A; Unruh, J A; Boyle, E A E; O'Quinn, T G

    2016-11-01

    The objective of this study was to determine the effect of brand and product identification on consumer palatability ratings of ground beef patties. Six treatments were used in the study: 90/10 Certified Angus Beef (CAB) ground sirloin, 90/10 ground beef, 80/20 CAB ground chuck, 80/20 ground chuck, 80/20 ground beef, and 73/27 CAB ground beef. Ground beef was processed into 151.2-g patties using a patty former with 2 consecutively formed patties assigned to blind consumer testing and the following 2 assigned to informed testing. Following cooking to 74°C, patties were cut into quarters and served to consumers. Consumers ( = 112) evaluated samples in 2 rounds for tenderness, juiciness, flavor liking, texture liking, and overall liking. Each trait was also rated as either acceptable or unacceptable. In the first round of testing, samples were blind evaluated, with no information about the treatments provided to consumers, but in the second round, product type and brand were disclosed prior to sample evaluation. Additionally, texture profile and shear force analyses were performed on patties from each treatment. Few differences were observed for palatability traits during blind consumer testing; however, during informed testing, 90/10 CAB ground sirloin was rated greatest ( brand disclosure. Increased ( branded product that received increased ( brand and product information, few consumers find differences in eating quality among ground beef treatments; however, when consumers are aware of the brand, fat level, and subprimal blend prior to sampling, these factors have a large impact on consumer eating satisfaction.

  20. Efficacies of soy sauce and wine base marinades for controlling spoilage of raw beef.

    Science.gov (United States)

    Kargiotou, C; Katsanidis, E; Rhoades, J; Kontominas, M; Koutsoumanis, K

    2011-02-01

    Fresh beef slices were marinated by immersion in marinades based on soy sauce without (SB) or with lactic acid (SBLA) or red wine base without (WB) or with 0.5% v/v oregano essential oil (WBO). For control samples (immersed in saline), a mean increase of 0.9log CFU/cm(2) in total viable counts (TVCs) occurred during the 24h treatment. During marination with WB and SB, mean TVC decreased by 0.7 and 0.3log CFU/cm(2), respectively. The mean decrease in TVC for samples marinated in WBO or SBLA was 1.2log CFU/cm(2). Subsequent storage of beef resulted in a rapid increase of TVC in control samples, to ≥9.5log CFU/cm(2) after 8 days at 5°C or 3 days at 15°C. Significant (PPseudomonas spp. All marinades also gave meat with significant lower TBARS values than the controls. There were no significant differences (P>0.05) in the toughness of the marinated samples compared to the control, except for SBLA samples which had significantly higher (Pspoilage and oxidation of meat.

  1. Microbial pathogens in raw pork, chicken, and beef: benefit estimates for control using irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, T.

    1985-12-01

    Various control procedures have been suggested for reducing foodborne infectious diseases. Receiving considerable attention is irradiation. This report estimates the medical and wage (or productivity) benefits associated with prevention of five human diseases transmitted by beef, pork, and chicken. (These diseases can also be transmitted by other vectors, such as eggs, milk, and pets. But these sources are not included in the analysis.) All of these foodborne infectious diseases - salmonellosis, campylobacteriosis, trichinosis, tapeworm, and toxoplasmosis - could be significantly reduced by irradiating meat and poultry. The Food and Drug Administration (FDA) has just approved irradiation of pork to prevent trichinosis (50FR 29658-59) and is considering approval of irradiation of chicken to kill Salmonella. 22 references.

  2. Raw Ground Penetrating Radar Data,Taku Glacier, Alaska; 2013

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Common-offset GPR surveys were conducted with a Sensors and Software 500-MHz Pulse Ekko Pro system. We collected data from the ground, towed behind a researcher on...

  3. Raw Ground Penetrating Radar Data, Valdez Glacier, Alaska; 2013

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Common-offset GPR surveys were conducted with a Sensors and Software 500-MHz Pulse Ekko Pro system. We collected data from the ground, towed behind a researcher on...

  4. Raw Ground Penetrating Radar Data, Wolverine Glacier, Alaska; 2013

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Common-offset GPR surveys were conducted with a Sensors and Software 500-MHz Pulse Ekko Pro system. We collected data from the ground, towed behind a researcher on...

  5. Raw Ground Penetrating Radar Data, Eureka Glacier, Alaska; 2013

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Common-offset GPR surveys were conducted with a Sensors and Software 500-MHz Pulse Ekko Pro system. We collected data from the ground, towed behind a researcher on...

  6. Raw Ground Penetrating Radar Data, Scott Glacier, Alaska; 2013

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Common-offset GPR surveys were conducted with a Sensors and Software 500-MHz Pulse Ekko Pro system. We collected data from the ground, towed behind a researcher on...

  7. Raw Ground Penetrating Radar Data, Eklutna Glacier, Alaska; 2013

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Common-offset GPR surveys were conducted with a Sensors and Software 500-MHz Pulse Ekko Pro system. We collected data from the ground, towed behind a researcher on...

  8. Raw Ground Penetrating Radar Data, Gulkana Glacier, Alaska; 2013

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Common-offset GPR surveys were conducted with a Sensors and Software 500-MHz Pulse Ekko Pro system. We collected data from the ground, towed behind a researcher on...

  9. Raw Ground Penetrating Radar Data, Wolverine Glacier, Alaska; 2013

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Common-offset GPR surveys were conducted with a Sensors and Software 500-MHz Pulse Ekko Pro system. We collected data from the ground, towed behind a researcher on...

  10. Volatile compounds and odor preferences of ground beef added with garlic and red wine, and irradiated with charcoal pack

    Science.gov (United States)

    Lee, Kyung Haeng; Yun, Hyejeong; Lee, Ju Woon; Ahn, Dong Uk; Lee, Eun Joo; Jo, Cheorun

    2012-08-01

    Irradiation is the most efficient non-thermal technology for improving hygienic quality and extending the shelf-life of food products. One of the adverse effects of food irradiation, however, is off-flavor production, which significantly affects the sensory preferences for certain foods. In this study, garlic (5%, w/w) and red wine (1:1, w/w) were added to ground beef to increase the radiation sensitivity of pathogens and improve meat odor/flavor. Samples were irradiated at 0 or 5 kGy in the presence of charcoal pack. SPME-GC-MS analysis was performed to measure the changes in the volatile compounds and sensory characteristics of the samples. The amount of total volatile compounds produced from ground beef was greater when the sample was irradiated. When garlic and red wine were added to the ground beef, the amount of volatile compounds significantly increased, and the amount of volatile compounds increased even further after irradiation. However, when the samples were irradiated with charcoal pack, the amount of volatile compounds decreased significantly. Sensory evaluation indicated that charcoal pack significantly increased the odor preferences for both irradiated and non-irradiated ground beef added with garlic. These results indicated that addition of charcoal pack to ground beef could reduce off-odor problems induced by irradiation, and this effect was consistent even when certain additives such as garlic and red wine were added.

  11. Efficient role of BacTN635 on the safety properties, sensory attributes, and texture profile of raw minced meat beef and chicken breast.

    Science.gov (United States)

    Smaoui, S; Elleuch, L; Ben Salah, R; Najah, S; Chakchouk-Mtibaa, A; Sellem, I; Besbes, S; Mellouli, L

    2014-01-01

    Bacteriocin BacTN635, produced by Lactobacillus plantarum sp. TN635, was purified and characterised in previous work. In this study we report the biotechnological application of this bacteriocin as a biopreservative during storage at 4°C of raw minced meat beef and chicken breast. Overall, the results obtained showed that the addition of the semi-purified BacTN635 at 500 or 1000 AU g(-1) in raw minced meat beef and chicken breast can delay the proliferation of spoilage microorganisms, suppress the growth of the pathogenic microorganism Listeria monocytogenes, improve sensory quality, texture attributes, and extend the shelf-life of these two meat products during refrigerated storage. BacTN635 at 1000 AU g(-1) could extend the shelf-life, and the meat showed good sensory characteristics. Therefore, treatment with semi-purified BacTN635 can be used as a safe method for preservation of raw minced meat beef and chicken breast.

  12. Validation of the use of organic acids and acidified sodium chlorite to reduce Escherichia coli O157 and Salmonella typhimurium in beef trim and ground beef in a simulated processing environment.

    Science.gov (United States)

    Harris, K; Miller, M F; Loneragan, G H; Brashears, M M

    2006-08-01

    A study was conducted to determine if acidified sodium chlorite (1,200 ppm) and acetic and lactic acids (2 and 4%) were effective in reducing foodborne pathogens in beef trim prior to grinding in a simulated processing environment. The reduction of Salmonella Typhimurium and Escherichia coli O157:H7 at high (4.0 log CFU/g) and low (1.0 log CFU/g) inoculation doses was evaluated at various processing steps, including the following: (i) in trim just after treatment application, (ii) in ground beef just after grinding, (iii) in ground beef 24 h after refrigerated storage, (iv) in ground beef 5 days after refrigerated storage, and (v) in ground beef 30 days after frozen storage. All antimicrobial treatments reduced the pathogens on the trim inoculated with the lower inoculation dose to nondetectable numbers in the trim and in the ground beef. There were significant reductions of both pathogens in the trim and in the ground beef inoculated with the high inoculation doses. On the trim itself, E. coli O157:H7 and Salmonella Typhimurium were reduced by 1.5 to 2.0 log cycles, with no differences among all treatments. In the ground beef, the organic acids were more effective in reducing both pathogens than the acidified sodium chlorite immediately after grinding, but after 1 day of storage, there were no differences among treatments. Overall, in the ground beef, there was a 2.5-log reduction of E. coli O157:H7 and a 1.5-log reduction of Salmonella Typhimurium that was sustained over time in refrigerated and frozen storage. Very few sensory differences between the control samples and the treated samples were detected by a consumer panel. Thus, antimicrobial treatments did not cause serious adverse sensory changes. Use of these antimicrobial treatments can be a promising intervention available to ground beef processors who currently have few interventions in their process.

  13. Effects of irradiation on trans fatty acids formation in ground beef

    Energy Technology Data Exchange (ETDEWEB)

    Brito, M.S. E-mail: msavoy@net.ipen.br; Villavicencio, A.L.C.H. E-mail: villavic@net.ipen.br; Mancini-filho, Jorge

    2002-03-01

    In order to give the consumer the assurance that meat processed by irradiation is a safe product, a great deal of research has been developed in the world. The effect of irradiation on the hygienic quality of meat and meat products is considered as related to the control of meat-borne parasites of humans; elimination of pathogens from fresh meat and poultry; and elimination of pathogens from processed meat. Lipid oxidation and associated changes are the major causes of the quality deterioration of meat during storage. Irradiation of lipids induces the production of free radicals, which react with oxygen, leading to the formation of carbonyls, responsible for alterations in food nutritional and sensorial characteristics. Trans fatty acids are present in ground beef and can also be formed during its processing. Interestingly, the trans fatty acids, due to their chemical and physical characteristics, show more resistance to the oxidizing process. This property motivated us to investigate the level of the trans fatty acids, as well as the level of oxidation in irradiated ground beef. Irradiation of ground beef was performed by gamma rays from a {sup 60}Co source. The applied radiation doses were 0; 1.0; 2.0; 3.0; 4.0; 5.0; 6.0; 7.0 and 8.0 kGy. Lipid peroxidation in terms of TBA number and carbonyl content was monitored during storage. The sample characteristics and trans fatty acids composition were measured, following irradiation and after 60 and 90 days of storage at -10 deg. C.

  14. Raw beef bones as chewing items to reduce dental calculus in Beagle dogs.

    Science.gov (United States)

    Marx, F R; Machado, G S; Pezzali, J G; Marcolla, C S; Kessler, A M; Ahlstrøm, Ø; Trevizan, L

    2016-01-01

    Evaluate the effect of raw bovine cortical bone (CB) (medullary bone cross-sectioned) and marrow or epiphyseal 'spongy' bone (SB) as chew items to reduce dental calculus in adult dogs. Eight 3-year-old Beagle dogs were observed in two study periods. In the first study, the dogs each received a piece of bovine femur CB (122 ± 17 g) daily and in the second study, a piece of bovine femur SB (235 ± 27 g). The first study lasted 12 days and the second 20 days. Dental calculus was evaluated using image integration software. At the start of the studies, dental calculus covered 42.0% and 38.6% of the dental arcade areas, respectively. In study one, the chewing reduced the established dental calculus area to 27.1% (35.5% reduction) after 3 days and after 12 days the dental calculus covering was reduced to 12.3% (70.6% reduction). In study two, the dental calculus covered 16.8% (56.5% reduction) after 3 days, 7.1% (81.6% reduction) after 12 days and 4.7% (87.8% reduction) after 20 days. The CB remained largely intact after 24 h, but SB was reduced to smaller pieces and in some cases totally consumed after 24 h. No complications such as tooth fractures, pieces of bone stuck between teeth or intestinal obstructions were observed during the studies. Chewing raw bovine bones was an effective method of removing dental calculus in dogs. The SB bones removed dental calculus more efficiently in the short term. © 2016 Australian Veterinary Association.

  15. Characterization of Shiga Toxin-Producing Escherichia coli Isolated from Ground Beef Collected in Different Socioeconomic Strata Markets in Buenos Aires, Argentina

    Directory of Open Access Journals (Sweden)

    Patricia Llorente

    2014-01-01

    Full Text Available Consumption of raw/undercooked ground beef is the most common route of transmission of Shiga toxin-producing E. coli (STEC. The aim of the study was to determine the STEC contamination level of the ground beef samples collected in 36 markets of different socioeconomic strata in Buenos Aires, Argentina, and the characterization of the isolated strains. Ninety-one out of 252 (36.1% samples were stx+. Fifty-seven STEC strains were recovered. Eleven STEC strains belonged to O157 serogroup, and 46 to non-O157 serogroups. Virulence markers of the 57 STEC were stx1, 5.3% (3/57; stx2, 86.0% (49/57; stx1/stx2, 8.8% (5/57; ehxA, 61.4% (35/57; eae, 26.3% (15/57; saa, 24.6% (14/57. Shiga toxin subtypes were stx2, 31.5% (17/54; stx2c-vhb, 24.1% (13/54; stx2c-vha, 20.4% (11/54; stx2/stx2c-vha, 14.8% (8/54; stx2/stx2c-vhb, 5.6% (3/54; stx2c-vha/vhb, 3.7% (2/54. Serotypes O178:H19 and O157:H7 were prevalent. Contamination rate of STEC in all strata was high, and the highest O157 contamination was observed at low strata at several sampling rounds. Persistence of STEC was not detected. Sixteen strains (28.1% were resistant to ampicillin, streptomycin, amikacin, or tetracycline. The STEC contamination level of ground beef could vary according to the sociocultural characteristics of the population.

  16. Microbiological and biochemical characteristics of ground beef as affected by gamma irradiation, food additives and edible coating film

    Science.gov (United States)

    Ouattara, B.; Giroux, M.; Yefsah, R.; Smoragiewicz, W.; Saucier, L.; Borsa, J.; Lacroix, M.

    2002-03-01

    The current interest in "minimally processed foods" has attracted the attention for combination of mild treatments to improve food safety and shelf-life extention. The present study was conducted to evaluate the combined effect of gamma irradiation and incorporation of naturally occurring antimicrobial compounds on microbial and biochemistry characteristics of ground beef. Ground beef patties (23% fat ) were purchased from a local grocery store (IGA, Laval, Que., Canada) and divided into 3 separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid, and (iii) ground beef with 0.5% ascorbic acid and coated with a protein-based coating containing selected spices. Samples were irradiated at 0, 1, 2, and 3 kGy final dose at the CIC. Samples were stored at 4°C and evaluated periodically for microbial growth, total thiobarbituric reactive substances (TBARS) and free sulfydryl content. At the end of the storage period, Enterobacteriaceae, Lactic acid bacteria, Pseudomonas and Brochothrix thermosphacta were enumerated. Regardless of the treatment group, irradiation significantly ( p⩽0.05) reduced the total aerobic plate counts (APC). Irradiation doses of 1, 2, and 3 kGy produced immediate reduction of 2, 3, and 4 log units of APCs, respectively. Also, shelf-life periods were higher for ground beef samples containing food additives. Lactic acid bacteria and Brochothrix thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. Concentration of TBARS and free sulfydryl concentrations were stabilized during post-irradiation storage for samples containing ascorbic acid and coated with the protein-based coating containing spices.

  17. Microbiological and biochemical characteristics of ground beef as affected by gamma irradiation, food additives and edible coating film

    Energy Technology Data Exchange (ETDEWEB)

    Ouattara, B.; Giroux, M.; Yefsah, R.; Smoragiewicz, W.; Saucier, L.; Borsa, J.; Lacroix, M. E-mail: monique.lacroix@inrs-iaf.uquebec.ca

    2002-03-01

    The current interest in 'minimally processed foods' has attracted the attention for combination of mild treatments to improve food safety and shelf-life extension. The present study was conducted to evaluate the combined effect of gamma irradiation and incorporation of naturally occurring antimicrobial compounds on microbial and biochemistry characteristics of ground beef. Ground beef patties (23% fat ) were purchased from a local grocery store (IGA, Laval, Que., Canada) and divided into 3 separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid, and (iii) ground beef with 0.5% ascorbic acid and coated with a protein-based coating containing selected spices. Samples were irradiated at 0, 1, 2, and 3 kGy final dose at the CIC. Samples were stored at 4 deg. C and evaluated periodically for microbial growth, total thiobarbituric reactive substances (TBARS) and free sulfydryl content. At the end of the storage period, Enterobacteriaceae, Lactic acid bacteria, Pseudomonas and Brochothrix thermosphacta were enumerated. Regardless of the treatment group, irradiation significantly (p{<=}0.05) reduced the total aerobic plate counts (APC). Irradiation doses of 1, 2, and 3 kGy produced immediate reduction of 2, 3, and 4 log units of APCs, respectively. Also, shelf-life periods were higher for ground beef samples containing food additives. Lactic acid bacteria and Brochothrix thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. Concentration of TBARS and free sulfydryl concentrations were stabilized during post-irradiation storage for samples containing ascorbic acid and coated with the protein-based coating containing spices.

  18. VALIDATION OF COOKING TIMES AND TEMPERATURES FOR THERMAL INACTIVATION OF YERSINIA PESTIS STRAINS KIM5 AND CDC-A1112 IN GROUND BEEF

    Science.gov (United States)

    The thermal stability of Yersinia pestis inoculated into retail ground beef (25 per cent fat) and heated in a temperature-controlled water bath or cooked on commercial grills was evaluated. Irradiated ground beef (3-g portions) was inoculated with ca. 6.7 log10 CFU/g of Y. pestis strain KIM5 and hea...

  19. Microbiological Testing Results of Boneless and Ground Beef Purchased for the National School Lunch Program, 2011 to 2014.

    Science.gov (United States)

    Doerscher, Darin R; Lutz, Terry L; Whisenant, Stephen J; Smith, Kerry R; Morris, Craig A; Schroeder, Carl M

    2015-09-01

    The Agricultural Marketing Service (AMS) purchases boneless and ground beef for distribution to recipients through federal nutrition assistance programs, including the National School Lunch Program, which represents 93% of the overall volume. Approximately every 2,000 lb (ca. 907 kg) of boneless beef and 10,000 lb (ca. 4,535 kg) of ground beef are designated a "lot" and tested for Escherichia coli O157:H7, Salmonella, standard plate count organisms (SPCs), E. coli, and coliforms. Any lot of beef positive for E. coli O157:H7 or for Salmonella, or any beef with concentrations of organisms exceeding critical limits for SPCs (100,000 CFU g(-1)), E. coli (500 CFU g(-1)), or coliforms (1,000 CFU g(-1)) is rejected for purchase by AMS and must be diverted from federal nutrition assistance programs. From July 2011 through June 2014, 537,478,212 lb (ca. 243,795,996 kg) of boneless beef and 428,130,984 lb (ca. 194,196,932 kg) of ground beef were produced for federal nutrition assistance programs. Of the 230,359 boneless beef samples collected over this period, 82 (0.04%) were positive for E. coli O157:H7, 924 (0.40%) were positive for Salmonella, 222 (0.10%) exceeded the critical limit for SPCs, 69 (0.03%) exceeded the critical limit for E. coli, and 123 (0.05%) exceeded the critical limit for coliforms. Of the 46,527 ground beef samples collected over this period, 30 (0.06%) were positive for E. coli O157:H7, 360 (0.77%) were positive for Salmonella, 20 (0.04%) exceeded the critical limit for SPCs, 22 (0.05%) exceeded the critical limit for E. coli, and 17 (0.04%) exceeded the critical limit for coliforms. Cumulatively, these data suggest beef produced for the AMS National School Lunch Program is done so under an adequate food safety system, as indicated by the low percentage of lots that were pathogen positive or exceeded critical limits for indicator organisms.

  20. Effect of mustard seed and sodium isoascorbate on lipid oxidation and colour of ground beef

    Directory of Open Access Journals (Sweden)

    Małgorzata Karwowska

    2013-12-01

    Full Text Available The aim of this study was to determine the effectiveness of the mustard seed in reducing lipid oxidation in ground beef compared to sodium isoascorbate. The research material were meat samples, prepared in four variants. The differentiating addition was ground white mustard (Sinapis alba, used in the native and autoclaved form. Reference were a control sample and a sample with the addition of sodium isoascorbate. The following were assayed during the study: TBARS value, redox potential, pH and colour parameters CIE L*a*b*. The addition of mustard had no effect on the pH value in comparison to the control sample and sodium isoascorbate. It has been shown that the use of mustard either native and autoclaved, decreased the value of TBARS ratio, and showed a similar effectiveness in preventing the oxidation of lipids as sodium isoascorbate.

  1. Evaluation of the Most Current and Effective Methods in the Analysis of Chlorinated Dioxins in Ground Beef

    Directory of Open Access Journals (Sweden)

    Ebere C. Anyanwu

    2003-01-01

    Full Text Available Chlorinated dioxins are the group of environmental pollutants consisting of 210 chlorinated dibenzo-p-dioxins and dibenzofurans. They are highly toxic and persistent. They are lipophilic and can easily biomagnify in the food chain, hence posing a serious threat to human health. The daily consumption of low-level contaminated food, mainly of animal origin, leads to the accumulation of dioxins in the human body. The exposures of the general human population to dioxins and the specific issues of a risk assessment of dioxin pose serious concerns in public environmental and nutritional health. This paper reviews the analysis of chlorinated dioxins in ground beef. The sources of contamination of chlorinated dioxins in ground beef are first reviewed to form a basis for a clear understanding of the health implications of chlorinated dioxins in the human food chain and why it is necessary to monitor the level of dioxins in animal food products, especially ground beef. The methods of collection, sampling, and processing of ground beef, and the methods of sample clean up prior to the analysis, are reviewed. Emphasis is laid on the new techniques that are available and that might be effective in the analysis of chlorinated dioxins in ground beef. Among these new methods and techniques are: the synergistic combination of ELISA/GC/MS, direct sample introduction to /GC/MS-MS, automated clean-up method, and the supercritical fluid extraction methods. The possible treatments of results from each method and technique are discussed and their respective efficiencies are compared. Finally, quality control and quality assurance parameters are evaluated for levels of accuracy, reproducibility, and precision.

  2. Antioxidant activities of Vine Tea (Ampelopsis grossedentata) extract and its major component dihydromyricetin in soybean oil and cooked ground beef.

    Science.gov (United States)

    Ye, Liyun; Wang, Hengjian; Duncan, Susan E; Eigel, William N; O'Keefe, Sean F

    2015-04-01

    Antioxidant activities of Ampelopsis grossedentata extract (EXT) and its major component dihydromyricetin (DHM) were analysed and compared with BHA in two model systems, soybean oil and cooked ground beef. Oxidation of soybean oil samples was measured using peroxide value, anisidine value, headspace volatiles and headspace oxygen content. TBARS (thiobarbituric acid reactive substances) test was used to measure the oxidation of cooked beef. DHM was more potent than BHA in preventing soybean oil oxidation. EXT was not as effective as BHA or DHM in soybean oil. In cooked beef, all three antioxidants significantly lowered oxidation compared to control, but there were no differences between the three. Mechanisms and potentials of EXT and DHM as natural food antioxidants need to be studied on a case-by-case basis.

  3. Spoilage of value-added, high-oxygen modified-atmosphere packaged raw beef steaks by Leuconostoc gasicomitatum and Leuconostoc gelidum.

    Science.gov (United States)

    Vihavainen, Elina J; Björkroth, K Johanna

    2007-11-01

    Moisture-enhancing and marinating of meats are commonly used by the meat industry to add value to raw, retail products. Recently in Finland, certain value-added beef steak products have proven to be unusually susceptible to microbial spoilage leading to untoward quality deteriorations during producer-defined shelf-life. This study was conducted to evaluate the role of lactic acid bacteria (LAB) in the premature spoilage of value-added beef packaged under high-oxygen modified atmospheres. Spoilage was characterised by green discolouration and a buttery off-odour. The predominant LAB in eight packages of spoiled, marinated or moisture-enhanced beef steaks were identified by reference to a 16 and 23S rRNA gene restriction fragment length polymorphism pattern (ribotype) database. Leuconostoc gasicomitatum, Leuconostoc gelidum, Lactobacillus algidus, Lactobacillus sakei and Carnobacterium divergens were found to predominate in the LAB populations at numbers above 10(8) CFU/g. Inoculation of moisture-enhanced steaks with LAB strains and strain mixtures originating from the spoiled products demonstrated the spoilage potential of L. gasicomitatum and L. gelidum isolates. These two species produced green surface discolouration and buttery off-odours similar to these found in the spoiled, commercial products.

  4. Use of mustard flour to inactivate Escherichia coli O157:H7 in ground beef under nitrogen flushed packaging.

    Science.gov (United States)

    Nadarajah, D; Han, J H; Holley, R A

    2005-04-01

    This study was undertaken to determine whether the glucosinolates naturally present in non-deheated mustard flour could serve as a source of allyl and other isothiocyanates in sufficient quantity to kill Escherichia coli O157:H7 inoculated in ground beef at three different levels, during refrigerated storage of the meat under nitrogen. Mustard flour was mixed at 5%, 10% or 20% (w/w) with freshly ground beef, then the beef was inoculated with a cocktail of five strains of E. coli O157:H7 at either 3, 6 or gas liquid chromatography. By 21 days, the levels present in treatments were not significantly different. After 21 days storage, there were 0.5, 3 and 5.4 log10 decreases in numbers of E. coli O157:H7 from the initial levels of 6 log10 cfu/g in meat containing 5%, 10% and 20% mustard flour, respectively. When inoculated at 3 log10 cfu/g, E. coli O157:H7 was reduced to undetectable levels after 18, 12 and 3 days with 5%, 10% and 20% mustard flour, respectively. When immunomagnetic separation (IMS) was used for E. coli recovery following its inoculation at vacuum packages was unaffected by the addition of 5% mustard flour but some inhibition was found at higher concentrations. Sensory evaluation of the cooked ground beef showed that there were no significant differences in the acceptability of meat treated with 5 or 10% mustard flour. However, panelists could distinguish untreated controls from mustard treatments, but considered the mustard-treated meat to be acceptable. These results showed that it is possible to use mustard flour at levels of >5-10% to eliminate E. coli O157:H7 from fresh ground beef.

  5. The use of oxygen scavengers to prevent the transient discolouration of ground beef packaged under controlled, oxygen-depleted atmospheres.

    Science.gov (United States)

    Gill, C O; McGinnis, J C

    1995-01-01

    Rates of O(2) absorption from air were determined for a type of commercial O(2) scavenger that is formulated for rapid O(2) absorption at chiller temperatures. Rates of O(2) absorption from N(2) atmospheres containing 600 ppm O(2) were determined for trays that each contained 350 g of ground beef. Packs with controlled atmospheres of N(2) that contained ground beef and O(2) scavengers were prepared, to determine the conditions under which the scavengers could prevent the transient discolouration of the meat which arises from its reaction with the residual O(2) initially present in pack atmospheres. The rates of O(2) absorption by individual scavengers varied from the average by ±50%. The rate of O(2) absorption declined with decreasing oxygen concentration, from an average value per scavenger of about 12 ml h(-1) when O(2) concentrations were between 20 and 10%. At O(2) concentrations absorption was directly proportioned to the O(2) concentration so that the O(2) concentration in an atmosphere in a gas-impermeable pouch declined exponentially with time. The absorption of O(2) by ground beef was similarly dependent on the O(2) concentration. At 2 °C, the transient discolouration of beef in atmospheres initially containing about 50 ppm O(2) was prevented by the presence of 17.5 scavengers per l of atmosphere. At -15 °C, discolouration was prevented by 5 scavengers per l. The findings indicate that the O(2) concentration in pack atmospheres has to be reduced below 10 ppm within 30 min at 2 °C, or 2 h at -1.5 °C if ground beef is not to transiently discolour. It is unlikely that the required rates of O(2) absorption could be obtained economically with currently available, commercial O(2) scavengers.

  6. Thermal destruction of Escherichia coli O157:H7 in sous-vide cooked ground beef as affected by tea leaf and apple skin powders.

    Science.gov (United States)

    Juneja, Vijay K; Bari, M L; Inatsu, Y; Kawamoto, S; Friedman, Mendel

    2009-04-01

    We investigated the heat resistance of a four-strain mixture of Escherichia coli O157:H7 in raw ground beef in both the absence and presence of white and green tea powders and an apple skin extract. Inoculated meat was cooked using the sous-vide technique, i.e., the meat was packaged in sterile bags and completely immersed in a circulating water bath at low temperature for a period of time. The bags were cooked for 1 h to an internal temperature of 55, 58, 60, or 62.5 degrees C, and then held from 240 min at 55 degrees C to 10 min at 62.5 degrees C. The surviving bacteria were enumerated by spiral plating onto tryptic soy agar overlaid with sorbitol-MacConkey agar. Inactivation kinetics of the pathogens deviated from first-order kinetics. D-values (time, in minutes, required for the bacteria to decrease by 90%) in the control beef ranged from 67.79 min at 55 degrees C to 2.01 min at 62.5 degrees C. D-values determined by a logistic model ranged from 36.22 (D1, the D-value of a major population of surviving cells) and 112.79 (D2, the D-value of a minor subpopulation) at 55 degrees C to 1.39 (D1) and 3.00 (D2) at 62.5 degrees C. A significant increase (P < 0.05) in the sensitivity of the bacteria to heat was observed with the addition of 3% added antimicrobials. D-value reductions of 62 to 74% were observed with apple powder and 18 to 58% with tea powders. Thermal death times from this study will assist the retail food industry to design cooking regimes that ensure the safety of beef contaminated with E. coli O157:H7.

  7. Comparison and improvement of chemical and physical characteristics of low- fat ground beef and buffalo meat patties at frozen storage

    Directory of Open Access Journals (Sweden)

    J. Uriyapongson

    2010-02-01

    Full Text Available A comparison of chemical and physical properties of beef and buffalo meat, and eight treatments of their ground meat patties was undertaken. Low-fat patties from both meat were prepared using two types of starches; corn and modified tapioca starch as binding ingredients in the ground meat, and methylcellulose (MC in the batter for patty coating. The patties were stored at -18ºC for 1, 15, 30 and 45 days, then deep fried and analyzed for color, % decrease in diameter and % gain in height, % oil absorption and texture. The results suggested that MC improved outside and inside color of patties (p≤0.05. There was no significant difference of cooking yield between beef and buffalo meat patties. Addition of modified starches and MC provided less % decrease in diameter after frying for frozen buffalo meat patties. Modified starch significantly improved % oil absorption in frozen beef and buffalo patties. Modified starch and MC gave both beef and buffalo meat patties more stable in hardness, chewiness and gumminess during the frozen storage. MC improved texture quality of frozen buffalo meat patties. Fried meat patties had high calories at 15 days of frozen storage.

  8. Comparison of conventional culture method and fluorescent in situ hybridization technique for detection of Listeria spp. in ground beef, turkey, and chicken breast fillets in İzmir, Turkey.

    Science.gov (United States)

    Baysal, Ayse Handan

    2014-12-01

    The occurrence of Listeria species in refrigerated fresh chicken breast fillet, turkey breast fillet, and ground beef was evaluated, comparing the conventional culture method and fluorescent in situ hybridization (FISH). FISH uses hybridization of a nucleic acid sequence target of a microorganism with a specific DNA probe labeled with a fluorochrome and imaging by a fluorescence microscope. First, Listeria was inoculated in chicken breast fillet, turkey breast fillet, or ground beef, and the applicability of the FISH method was evaluated. Second, Listeria was detected in fresh chicken breast fillet, turkey breast fillet, and ground beef by culture and FISH methods. Listeria was isolated from 27 (37.4%) of 216 samples by the standard culture method, whereas FISH detected 25 (24.7%) preenriched samples. Of these isolates, 17 (63%) were L. innocua, 6 (22%) L. welshimeri, and 4 (14.8%) L. seeligeri. Overall, the prevalences of Listeria spp. found with the conventional culture method in chicken breast fillet, turkey breast fillet, and ground beef were 9.7, 6.9, and 20.8%, whereas with the FISH technique these values were 11.1, 6.9, and 16.7%, respectively. The molecular FISH technique appears to be a cheap, sensitive, and time-efficient procedure that could be used for routine detection of Listeria spp. in meat. This study showed that retail raw meats are potentially contaminated with Listeria spp. and are, thus, vehicles for transmitting diseases caused by foodborne pathogens, underlining the need for increased precautions, such as implementation of hazard analysis and critical control points and consumer food safety education.

  9. Design of characteristics of optical filter set for prediction and visualization of fat content in raw beef cuts

    DEFF Research Database (Denmark)

    Kobayashi, Ken-ichi; Nishino, Ken; Dissing, Bjørn Skovlund

    2011-01-01

    imaging is however very expensive. We propose a way to design a simple measurement system consisting of a NIR sensitive monochrome camera together with a small set of optical filters to estimate and visualize a specific food compound without requiring a full hyperspectral device. Based on a set...... of hyperspectral measurements of beef and physical and chemical analysis of the fat within the beef, we propose a method to design a set of ideal Band Pass Filters (BPF), as small as possible while still maintaining predictability of fat content. The results show that 2 filters is a suitable amount of filters...

  10. Reduction of irradiation off-odor and lipid oxidation in ground beef by {alpha}-tocopherol addition and the use of a charcoal pack

    Energy Technology Data Exchange (ETDEWEB)

    Sohn, S.H. [Busan Regional Food and Drug Administration, Busan 608-829 (Korea, Republic of); Jang, A. [National Institute of Animal Science, RDA, Suwon 441-706 (Korea, Republic of); Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, J.K. [Cooperative Research, Extension, and Education Service, Northern Marianas College, Saipan, MP 96950 (Korea, Republic of); Song, H.P. [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, J.H. [Cooperative Research, Extension, and Education Service, Northern Marianas College, Saipan, MP 96950 (Korea, Republic of); Lee, M. [Department of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Jo, C. [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)], E-mail: cheorun@cnu.ac.kr

    2009-02-15

    A combination of a charcoal pack during irradiation and {alpha}-tocopherol addition into ground beef was applied to eliminate an irradiation characteristic off-odor and to retard the lipid oxidation caused by the irradiation process. Ground beef was mixed with 200 ppm {alpha}-tocopherol and gamma irradiated with 0, 5, and 10 kGy with or without a charcoal pack present during the irradiation treatment. The pH of the control group was lower than that of {alpha}-tocopherol and charcoal pack treatment initially but increased rapidly and showed higher pH at day 7. Addition of {alpha}-tocopherol with or without charcoal pack addition showed lower 2-thiobarbituric acid reactive substances values in irradiated ground beef at days 3 and 7 compared to those without addition. The color of ground beef was not significantly affected by the treatment. However, odor preference result showed that 10 kGy-irradiated ground beef with a combination of charcoal pack and {alpha}-tocopherol addition had higher scores than the control group regardless of irradiation. Solid-phase microextraction (SPME) gas chromatograph/mass spectrometry (GC/MS) analysis identified various volatile compounds that were created by irradiation of ground beef. These compounds were reduced or eliminated when a charcoal pack was used during the irradiation process. The results of the present study imply that combination of packaging with a charcoal pack during the irradiation process and addition of {alpha}-tocopherol into ground beef is a good method to effectively eliminate an irradiation off-odor and retard the lipid oxidation development in ground beef caused by irradiation.

  11. Inactivation of a diverse set of shiga toxin-producing Escherichia coli in ground beef by high pressure processing.

    Science.gov (United States)

    Sheen, Shiowshuh; Cassidy, Jennifer; Scullen, Butch; Sommers, Christopher

    2015-12-01

    Shiga toxin-producing Escherichia coli (STEC) are regularly implicated in foodborne illness outbreaks and recalls of ground beef. In this study we determined the High Pressure Processing (HPP) D10 value (the processing conditions needed to reduce the microbial population by 1 log) of 39 STEC isolates, including the "big six" serovars, O104 and O157:H7. STEC isolates included those isolated from animals and environmental sources in addition to those associated with illness in humans. Individual STEC were inoculated into 80% lean ground beef and treated with HPP (350 MPa, 4 °C, up to 40 min). The mean D10 was 9.74 min, with a range of 0.89-25.70 min. The D10 of the STEC involved in human illness was 9.25 vs. 10.40 min for those not involved in human illness (p > 0.05). The presence or absence of genes encoding virulence factors (e.g. Shiga toxin 1 or 2, intimin, or enterohemolysin) had no effect on the HPP D10 (p > 0.05). The high D10 of some STEC involved in human illness should be considered in selecting HPP processing parameters for ground beef. This study demonstrates the heterogeneity of STEC resistance to HPP. Risk assessors and the food industry can use this information to provide safer meat products to consumers.

  12. Effects of carbon monoxide treatment before vacuum packaging on the physical parameters and consumer evaluations of raw beef

    Directory of Open Access Journals (Sweden)

    Anna SAKOWSKA

    2016-01-01

    Full Text Available Abstract This study examined the color changes of packaged beef due to the effects of carbon monoxide exposure before vacuum packing and storage time, as well as consumers’ evaluations of that beef. In the experiment, 400 striploin steaks (M. longissimus dorsi were vacuum packed or after 48 hours of exposure to different concentrations of CO (0.1%, 0.3%, and 0.5% vacuum packed. The color measurements and consumer evaluations were conducted after 7, 10, 14, 17, and 21 days of storage in the dark at 2 ± 1 °C. Consumers evaluated the color, surface discoloration, attractiveness, and their willingness to buy the meat. The results showed that regardless of storage time, the color parameters (L*, a*, b*, C* were significantly higher for the steaks vacuum packed after exposure to carbon monoxide in comparison to those packaged in a vacuum without the use of CO. Based on the consumer evaluations, the most attractive steaks were those that had been exposed to 0.3% and 0.5% CO, which were characterized by bright red or cherry-red colors. Consumers did not accept the appearance of steaks packaged without the carbon monoxide pretreatment. Exposing meat to CO before packaging allows to obtain the attractive color of vacuum packed beef.

  13. Comparison of Dried Plum Puree, Rosemary Extract, and BHA/BHT as Antioxidants in Irradiated Ground Beef Patties.

    Science.gov (United States)

    Movileanu, Iulia; Núñez de González, Máryuri T; Hafley, Brian; Miller, Rhonda K; Keeton, Jimmy T

    2013-01-01

    Fresh ground beef patties with (1) no antioxidant (control), (2) 0.02% butylated hydroxyanisole/butylated hydroxytoluene (BHA/BHT), (3) 3% dried plum puree, or (4) 0.25% rosemary extract were aerobically packaged, irradiated at target doses of 0, 1.5, or 2.0 kGy (1.7 and 2.3 kGy actual doses), and stored at 4°C. The samples were evaluated for lipid oxidation on 0, 3, 7, 14, 21, and 28 days of storage after irradiation. When compared to the control, all antioxidant treatments were effective in retarding (P 0.05) as BHA/BHT in irradiated and nonirradiated beef patties, followed by the dried plum puree treatment. Irradiation increased TBARs values, but no differences were noted in oxidation between irradiation dose levels.

  14. 9 CFR 319.15 - Miscellaneous beef products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Miscellaneous beef products. 319.15... Miscellaneous beef products. (a) Chopped beef, ground beef. “Chopped Beef” or “Ground Beef” shall consist of chopped fresh and/or frozen beef with or without seasoning and without the addition of beef fat as...

  15. Whole or ground millet grain provided in two supplementation frequencies for grazing beef cattle: nutritional parameters

    Directory of Open Access Journals (Sweden)

    João Marcos Beltrame Benatti

    2014-05-01

    Full Text Available The objective of this study was to evaluate the processing of millet grain provided at two supplementation frequencies for grazing beef cattle during the dry season on nutritional parameters. Five rumen-cannulated crossbred steers, with 24 to 26 months of age and average body weight of 428.6±26.06 kg, were assigned to a Latin square design (5 × 5 in a 2 × 2 + 1 factorial arrangement, as follows: two forms of millet grain (whole grains - or ground; WG - GG, two strategies of concentrate supplementation (daily distribution - 7X; or three times a week - 3X and a control treatment (mineral mixture - MM. Animals were kept in five paddocks of 0.24 ha each with Marandu grass pastures. Concentrate supplements were supplied at 2.00 and 4.66 kg/animal/day for treatments 7X and 3X, respectively. The concentrate supplementation enhanced the intake of total dry matter (DM and organic matter (OM and nutrients compared with mineral supplementation. No differences were found between dry matter intake and forage organic matter intake. The values of digestibility coefficients of DM, OM, ether extract, total carbohydrates and non-fiber carbohydrates were increased by concentrate supplementation. Regarding concentrations of rumen ammonia nitrogen, the interactions among time × treatment × day and day × treatment had effects on the measurements of ruminal pH. Plasma urea nitrogen, urinary urea excretion and urinary urea N excretion differed only between MM treatment and the others, with no interference of grain physical form and supplementation frequency on those variables. The millet grain processing does not alter forage intake, but improves digestibility. Daily supplementation increases digestibility of dry matter and neutral detergent fiber.

  16. Effect of gamma irradiation in presence of ascorbic acid on microbial composition and TBARS concentration of ground beef coated with an edible active coating

    Energy Technology Data Exchange (ETDEWEB)

    Lacroix, M. E-mail: monique.lacroix@inrs-iaf.uquebec.ca; Ouattara, B.; Saucier, L.; Giroux, M.; Smoragiewicz, W

    2004-10-01

    The present study was conducted to evaluate the combined effect of gamma irradiation in presence of ascorbic acid on the microbiological characteristics and thiobarbituric acid-reactive substances (TBARS) concentration of ground beef coated with an edible coating, crosslinked by gamma irradiation. The medium fat ground beef patties (23% fat ) were divided into two separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid. Meat samples were irradiated at doses of 0, 1, 2, and 3 kGy and stored at 4{+-}2 deg. C. The content of TBARS was evaluated. After 7 days of storage, Enterobacteriaceae, presumptive Staphylococcus aureus, presumptive Pseudomonas spp., Brochothrix thermosphacta and lactic acid bacteria were enumerated. Results showed that lactic acid bacteria and Br. thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. The content in TBARS was stabilized during post-irradiation storage for samples containing ascorbic acid. Shelf life extension periods estimated on the basis of a limit level of 6 log CFU/g for APCs were 4, 7, and 10 days for samples irradiated at 1, 2, and 3 kGy, respectively. However, the incorporation of ascorbic acid in ground beef did not improve significantly (p>0.05) the inhibitory effect of gamma irradiation.

  17. Ground transport stress affects bacteria in the rumen of beef cattle: A real-time PCR analysis.

    Science.gov (United States)

    Deng, Lixin; He, Cong; Zhou, Yanwei; Xu, Lifan; Xiong, Huijun

    2016-10-03

    Transport stress syndrome often appears in beef cattle during ground transportation, leading to changes in their capacity to digest food due to changes in rumen microbiota. The present study aimed to analyze bacteria before and after cattle transport. Eight Xianan beef cattle were transported over 1000 km. Rumen fluid and blood were sampled before and after transport. Real-time PCR was used to quantify rumen bacteria. Cortisol and adrenocorticotrophic hormone (ACTH) were measured. Cortisol and ACTH were increased on day 1 after transportation and decreased by day 3. Cellulolytic bacteria (Fibrobacter succinogenes and Ruminococcus flavefaciens), Ruminococcus amylophilus and Prevotella albensis were increased at 6 h and declined by 15 days after transport. There was a significant reduction in Succinivibrio dextrinosolvens, Prevotella bryantii, Prevotella ruminicola and Anaerovibrio lipolytica after transport. Rumen concentration of acetic acid increased after transport, while rumen pH and concentrations of propionic and butyric acids were decreased. Body weight decreased by 3 days and increased by 15 days after transportation. Using real-time PCR analysis, we detected changes in bacteria in the rumen of beef cattle after transport, which might affect the growth of cattle after transport.

  18. Effects of potassium lactate, sodium metasilicate, peroxyacetic acid, and acidified sodium chlorite on physical, chemical, and sensory properties of ground beef patties.

    Science.gov (United States)

    Quilo, S A; Pohlman, F W; Brown, A H; Crandall, P G; Dias-Morse, P N; Baublits, R T; Aparicio, J L

    2009-05-01

    Beef trimmings were treated with 3% potassium lactate (KL), 4% sodium metasilicate (NMS), 0.02% peroxyacetic acid (PAA) or 0.1% acidified sodium chlorite (ASC) or left untreated (CON). Beef trimmings were ground, pattied, and sampled for 7 days. Under simulated retail display, instrumental color, sensory characteristics, TBARS, pH, and Lee-Kramer shear force were measured to evaluate the impact of the treatments on the quality attributes. The NMS and PAA patties were redder (a(∗), P0.05) off odor to CON on days 0-3. The NMS and PAA treated patties had lower (P<0.05) lipid oxidation than the CON at days 0, 3, and 7. Therefore, KL, NMS, PAA, and ASC treatments on beef trimmings can potentially improve or maintain quality attributes of beef patties.

  19. Tracking contamination through ground beef production and identifying points of recontamination using a novel green fluorescent protein (GFP) expressing, E. coli O103, non-pathogenic surrogate

    Science.gov (United States)

    Introduction: Commonly, ground beef processors conduct studies to model contaminant flow through their production systems using surrogate organisms. Typical surrogate organisms may not behave as Escherichia coli O157:H7 during grinding and are not easy to detect at very low levels. Purpose: Develop...

  20. Modeling the inactivatin of Escherichia coli 0157:H7 and uropathogenic E. coli in ground beef by high pressure processing and citral

    Science.gov (United States)

    Disease causing Escherichia coli commonly found in meat and poultry include intestinal pathogenic E. coli (iPEC) as well as extraintestinal types such as the Uropathogenic E. coli (UPEC). In this study we compared the resistance of iPEC (O157:H7) to UPEC in ground beef using High Pressure Processing...

  1. Partial Replacement of Ground Corn with Glycerol in Beef Cattle Diets: Intake, Digestibility, Performance, and Carcass Characteristics.

    Directory of Open Access Journals (Sweden)

    Pedro Del Bianco Benedeti

    Full Text Available The objective of this study was to evaluate the effects of replacing dry ground corn with crude glycerol on intake, apparent digestibility, performance, and carcass characteristics of finishing beef bulls. A completely randomized block design experiment with 25 d for adaptation and 100 d for data collection was conducted, in which 3,640 Nellore bulls (367 ± 36.8 kg; 18 ± 3 mo were blocked by body weight and assigned to 20 pens. Bulls were randomly assigned to one of four treatments: 0, 5, 10, and 15% (dry matter basis of crude glycerol in the diet. Initially, 20 bulls were slaughtered to serve as a reference to estimate initial empty body weight, which allowed for carcass gain calculation. Bulls were weighed at the beginning, at two-thirds, and at the end of the experiment for performance calculations. Carcass measurements were obtained by ultrasound. Fecal output was estimated using indigestible neutral detergent fiber as an internal marker. Data were analyzed using the mixed procedures in SAS 9.2 (SAS Institute Inc., Cary, NC. Intake of dry matter, organic matter, and neutral detergent fiber decreased linearly (P 0.05 intakes of crude protein, non-fiber carbohydrates, and total digestible nutrients. Digestibility of dry matter, organic matter, neutral detergent fiber, and total digestible nutrients increased quadratically (P 0.05. These results suggest that crude glycerol may be included in finishing beef diets at levels up to 15% without impairing performance and carcass characteristics.

  2. Bacteriophages reduce experimental contamination of hard surfaces, tomato, spinach, broccoli, and ground beef by Escherichia coli O157:H7.

    Science.gov (United States)

    Abuladze, Tamar; Li, Manrong; Menetrez, Marc Y; Dean, Timothy; Senecal, Andre; Sulakvelidze, Alexander

    2008-10-01

    A bacteriophage cocktail (designated ECP-100) containing three Myoviridae phages lytic for Escherichia coli O157:H7 was examined for its ability to reduce experimental contamination of hard surfaces (glass coverslips and gypsum boards), tomato, spinach, broccoli, and ground beef by three virulent strains of the bacterium. The hard surfaces and foods contaminated by a mixture of three E. coli O157:H7 strains were treated with ECP-100 (test samples) or sterile phosphate-buffered saline buffer (control samples), and the efficacy of phage treatment was evaluated by comparing the number of viable E. coli organisms recovered from the test and control samples. Treatments (5 min) with the ECP-100 preparation containing three different concentrations of phages (10(10), 10(9), and 10(8) PFU/ml) resulted in statistically significant reductions (P = E. coli O157:H7 organisms recovered from the glass coverslips. Similar treatments resulted in reductions of 100%, 95%, and 85%, respectively, in the number of E. coli O157:H7 organisms recovered from the gypsum board surfaces; the reductions caused by the two most concentrated phage preparations were statistically significant. Treatment with the least concentrated preparation that elicited significantly less contamination of the hard surfaces (i.e., 10(9) PFU/ml) also significantly reduced the number of viable E. coli O157:H7 organisms on the four food samples. The observed reductions ranged from 94% (at 120 +/- 4 h posttreatment of tomato samples) to 100% (at 24 +/- 4 h posttreatment of spinach samples). The data suggest that naturally occurring bacteriophages may be useful for reducing contamination of various hard surfaces, fruits, vegetables, and ground beef by E. coli O157:H7.

  3. Microbiological and organoleptic characteristics of beef trim and ground beef treated with acetic acid, lactic acid, acidified sodium chlorite, or sterile water in a simulated commercial processing environment to reduce Escherichia coli O157:H7 and Salmonella.

    Science.gov (United States)

    Harris, D; Brashears, M M; Garmyn, A J; Brooks, J C; Miller, M F

    2012-03-01

    The objective of this study was to validate the effectiveness of acetic and lactic acids (2% and 5%), acidified sodium chlorite (1000ppm), and sterile water in reducing Escherichia coli O157:H7 and Salmonella Typhimurium in inoculated beef trim in a simulated processing environment. Samples were collected to assess microbial characteristics at three processing points. Results from this study indicate that all treatments, including sterile water, reduced pathogen concentrations (P<0.05) of both E. coli O157:H7 and Salmonella Typhimurium in ground beef up to 0.5 and 0.6 log by 24h, respectively. In some cases, there were no significant differences between the antimicrobial treatments and the sterile water using this application method. Triangle sensory test results of non-inoculated beef indicated there were no differences (P<0.05) in the means of correct responses between controls or antimicrobial treatments at 6 or 24h. While interventions are important for beef trim, use of the interventions must be validated under industry conditions to ensure proper effectiveness. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Formation of mutagens in beef and beef extract during cooking.

    Science.gov (United States)

    Commoner, B; Vithayathil, A J; Dolara, P; Nair, S; Madyastha, P; Cuca, G C

    1978-09-08

    Mutagens, distinguishable from benzo[a]pyrene and from mutagenic amino acid and protein pyrolysis products, are formed when ground beef is cooked in a home hamburger cooking appliance or when beef stock is concentrated, by boiling, to a paste known commercially as beef extract. "Well-done" hamburgers contain about 0.14 part per million of the mutagens, and beef bouillon cubes which contain beef extract about 0.1 part per million. Since such mutagens may be potentially carcionogenic and are formed during ordinary cooking procedures, their occurrence raises questions about possible risks to human health.

  5. Effects of vacuum or modified atmosphere packaging in combination with irradiation for control of Escherichia coli O157:H7 in ground beef patties.

    Science.gov (United States)

    Kudra, Li L; Sebranek, Joseph G; Dickson, James S; Mendonca, Aubrey F; Larson, Elaine M; Jackson-Davis, Armitra L; Lu, Zheng

    2011-12-01

    The efficacy of controlling Escherichia coli O157:H7 in ground beef patties by combining irradiation with vacuum packaging or modified atmosphere packaging (MAP) was investigated. Fresh ground beef patties were inoculated with a five-strain cocktail of E. coli O157:H7 at 5 log CFU/g. Single patties, packaged with vacuum or high-CO(2) MAP (99.6% CO(2) plus 0.4% CO), were irradiated at 0 (control), 0.5, 1.0, or 1.5 kGy. The D(10)-value for this pathogen was 0.47 ± 0.02 kGy in vacuum and 0.50 ± 0.02 kGy in MAP packaging. Irradiation with 1.5 kGy reduced E. coli O157:H7 by 3.0 to 3.3 log, while 0.5 and 1.0 kGy achieved reductions of 0.7 to 1.0, and 2.0 to 2.2 log, respectively. After irradiation, the numbers of survivors of this pathogen on beef patties in refrigerated storage (4°C) did not change significantly for 6 weeks. Temperature abuse (at 25°C) resulted in growth in vacuum-packaged patties treated with 0.5 and 1.5 kGy, but no growth in MAP packages. This study demonstrated that combining irradiation with MAP was similar in effectiveness to irradiation with vacuum packaging for control of E. coli O157:H7 in ground beef patties during refrigerated storage. However, high-CO(2) MAP appeared to be more effective after temperature abuse.

  6. Foodborne transmission of sorbitol-fermenting Escherichia coli O157:[H7] via ground beef: an outbreak in northern France, 2011.

    Science.gov (United States)

    King, L A; Loukiadis, E; Mariani-Kurkdjian, P; Haeghebaert, S; Weill, F-X; Baliere, C; Ganet, S; Gouali, M; Vaillant, V; Pihier, N; Callon, H; Novo, R; Gaillot, O; Thevenot-Sergentet, D; Bingen, E; Chaud, P; de Valk, H

    2014-12-01

    Sorbitol-fermenting Escherichia coli O157:[H7] is a particularly virulent clone of E. coli O157:H7 associated with a higher incidence of haemolytic uraemic syndrome and a higher case fatality rate. Many fundamental aspects of its epidemiology remain to be elucidated, including its reservoir and transmission routes and vehicles. We describe an outbreak of sorbitol-fermenting E. coli O157:[H7] that occurred in France in 2011. Eighteen cases of paediatric haemolytic uraemic syndrome with symptom onset between 6 June and 15 July 2011 were identified among children aged 6 months to 10 years residing in northern France. A strain of sorbitol-fermenting E. coli O157:[H7] stx2a eae was isolated from ten cases. Epidemiological, microbiological and trace-back investigations identified multiply-contaminated frozen ground beef products bought in a supermarket chain as the outbreak vehicle. Strains with three distinct pulsotypes that were isolated from patients, ground beef preparations recovered from patients' freezers and from stored production samples taken at the production plant were indistinguishable upon molecular comparison. This investigation documents microbiologically confirmed foodborne transmission of sorbitol-fermenting of E. coli O157 via beef and could additionally provide evidence of a reservoir in cattle for this pathogen.

  7. Effects of buffered vinegar and sodium dodecyl sulfate plus levulinic acid on Salmonella Typhimurium survival, shelf-life, and sensory characteristics of ground beef patties.

    Science.gov (United States)

    Stelzleni, Alexander M; Ponrajan, Amudhan; Harrison, Mark A

    2013-09-01

    The inclusion of two sources of buffered vinegar and sodium dodecyl sulfate plus levulinic acid were studied as interventions for Salmonella Typhimurium and for their effect on shelf-life and sensory characteristics of ground beef. For the Salmonella challenge, beef trimmings (80/20) were inoculated then treated with 2% (w/v) liquid buffered vinegar (LVIN), 2.5% (w/w) powdered buffered vinegar (PVIN), a solution containing 1.0% levulinic acid plus 0.1% sodium dodecyl sulfate (SDLA) at 10% (w/v), or had no intervention applied (CNT). The same trim source and production methods were followed during production of patties for shelf-life and sensory testing without inoculation. SDLA patties had the largest reduction (PSalmonella. However, LVIN and PVIN had the least (Pcharacteristics, except PVIN exhibited stronger off-flavor (P<0.05).

  8. Exercise attenuates the increase in plasma monounsaturated fatty acids and high-density lipoprotein cholesterol but not high-density lipoprotein 2b cholesterol caused by high-oleic ground beef in women.

    Science.gov (United States)

    Gilmore, L Anne; Crouse, Stephen F; Carbuhn, Aaron; Klooster, Jennifer; Calles, José Antonio Elias; Meade, Thomas; Smith, Stephen B

    2013-12-01

    We hypothesized that dietary monounsaturated fatty acids (MUFA) and exercise increase high-density lipoprotein cholesterol (HDL-C) by independent mechanisms, so there would be additive effects between a single, intensive session of exercise and high-MUFA ground beef on HDL-C and blood risk factors for cardiovascular disease. Seventeen postmenopausal women completed a 2-way crossover design in which they consumed five 114-g ground beef patties per week for two 6-week periods separated by a 4-week washout (habitual diet) period. The ground beef patties contained 21% total fat with either 9.97 (low-MUFA) or 12.72 (high-MUFA) g total MUFA. Blood was taken at entry, at the end of each 6-week diet period, after the 4-week washout period, and 24 hours after aerobic exercise sessions (75% VO₂peak, 2.07 MJ). After the ground beef intervention, the high-MUFA ground beef increased plasma palmitoleic acid and oleic acid, low-density lipoprotein (LDL) particle density, HDL-C, and HDL2b-C (all P density. After the washout (habitual diet) period, the single exercise session increased serum LDL cholesterol, HDL-C, and HDL2a and decreased TAG and oleic acid. After the low-MUFA ground beef diet, exercise increased LDL size and HDL density and decreased LDL density and very low-density lipoprotein cholesterol, but had no effect on HDL-C fractions. After the high-MUFA ground beef intervention, exercise decreased palmitioleic acid, oleic acid, HDL-C, and HDL2a-C, but not HDL2b-C. Contrary to our hypothesis, the effects of exercise and a high-MUFA diet were not additive; instead, exercise attenuated the effects of the high-MUFA ground beef on HDL-C and plasma MUFAs. The differential effects of high-MUFA ground beef and exercise on HDL2a-C and HDL2b-C indicate that diet and exercise affect HDL-C by different mechanisms.

  9. Evaluation of the performance of the IQ-Check kits and the USDA Microbiology Laboratory Guidebook methods for detection of Shiga toxin-producing Escherichia coli (STEC) and STEC and Salmonella simultaneously in ground beef.

    Science.gov (United States)

    Baranzoni, G M; Fratamico, P M; Boccia, F; Bagi, L K; Kim, G-H; Anastasio, A; Pepe, T

    2017-03-01

    To evaluate the performance of the IQ-Check kits and the USDA Microbiology Laboratory Guidebook (MLG) methods for detection of the top seven Shiga toxin-producing Escherichia coli (STEC) (O157:H7, O26, O45, O103, O111, O121 and O145) in ground beef and both STEC and Salmonella in co-inoculated samples. Ground beef samples inoculated with ~10 CFU of STEC or both STEC and Salmonella Typhimurium were stored at 4°C for 72 h, followed by screening with the IQ-Check and BAX System kit (MLG) methods that employ different enrichment media. STEC and S. Typhimurium were detected after 12 and 18 h and their presence was confirmed by colony isolation. Both methods were able to detect STEC in ground beef after 12 h of enrichment in samples inoculated with low levels of the pathogen. STEC and S. Typhimurium can be detected and isolated in co-inoculated ground beef samples. The IQ-Check methods are comparable to the MLG methods for detection of STEC and simultaneous detection of STEC and S. Typhimurium in seeded ground beef after a short enrichment time, thus the IQ-Check method can be useful for the food industry for rapid detection of these pathogens. Published 2016. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  10. Thermal tolerance of O157 and non-O157 Shiga toxigenic strains of Escherichia coli, Salmonella, and potential pathogen surrogates, in frankfurter batter and ground beef of varying fat levels.

    Science.gov (United States)

    Vasan, Akhila; Geier, Renae; Ingham, Steve C; Ingham, Barbara H

    2014-09-01

    The non-O157 Shiga toxigenic Escherichia coli (STEC) serogroups most commonly associated with illness are O26, O45, O103, O111, O121, and O145. We compared the thermal tolerance (D55°C) of three or more strains of each of these six non-O157 STEC serogroups with five strains of O157:H7 STEC in 7% fat ground beef. D55°C was also determined for at least one heat-tolerant STEC strain per serogroup in 15 and 27% fat ground beef. D55°C of single-pathogen cocktails of O157 and non-O157 STEC, Salmonella, and potential pathogen surrogates, Pediococcus acidilactici and Staphylococcus carnosus, was determined in 7, 15, and 27% fat ground beef and in frankfurter batter. Samples (25 g) were heated for up to 120 min at 55°C, survivors were enumerated, and log CFU per gram was plotted versus time. There were significant differences in D55°C across all STEC strains heated in 7% fat ground beef (P < 0.05), but no non-O157 STEC strain had D55°C greater than the range observed for O157 STEC. D55°C was significantly different for strains within serogroups O45, O145, and O157 (P < 0.05). D55°C for non-O157 STEC strains in 15 and 27% fat ground beef were less than or equal to the range of D55°C for O157. D55°C for pathogen cocktails was not significantly different when measured in 7, 15, and 27% fat ground beef (P ≥ 0.05). D55°C of Salmonella in frankfurter batter was significantly less than for O157 and non-O157 STEC (P < 0.05). Thermal tolerance of pathogen cocktails in ground beef (7, 15, or 27% fat) and frankfurter batter was significantly less than for potential pathogen surrogates (P < 0.05). Results suggest that thermal processes in beef validated against E. coli O157:H7 have adequate lethality against non-O157 STEC, that thermal processes that target Salmonella destruction may not be adequate against STEC in some situations, and that the use of pathogen surrogates P. acidilactici and S. carnosus to validate thermal processing interventions in ground beef and

  11. Quantifying the effect of hand wash duration, soap use, ground beef debris, and drying methods on the removal of Enterobacter aerogenes on hands.

    Science.gov (United States)

    Jensen, Dane A; Danyluk, Michelle D; Harris, Linda J; Schaffner, Donald W

    2015-04-01

    Hand washing is recognized as a crucial step in preventing foodborne disease transmission by mitigating crosscontamination among hands, surfaces, and foods. This research was undertaken to establish the importance of several keys factors (soap, soil, time, and drying method) in reducing microorganisms during hand washing. A nonpathogenic nalidixic acid-resistant Enterobacter aerogenes surrogate for Salmonella was used to assess the efficacy of using soap or no soap for 5 or 20 s on hands with or without ground beef debris and drying with paper towel or air. Each experiment consisted of 20 replicates, each from a different individual with ∼ 6 log CFU/ml E. aerogenes on their hands. A reduction of 1.0 ± 0.4 and 1.7 ± 0.8 log CFU of E. aerogenes was observed for a 5-s wash with no soap and a 20-s wash with soap, respectively. When there was no debris on the hands, there was no significant difference between washing with and without soap for 20 s (P > 0.05). Likewise, there was no significant difference in the reductions achieved when washing without soap, whether or not debris was on the hands (P > 0.05). A significantly greater reduction (P soap when there was ground beef debris on the hands. The greatest difference (1.1 log CFU greater average reduction) in effectiveness occurred when ground beef debris was on the hands and a 20-s wash with water was compared with a 20-s wash with soap. Significantly greater (P 4.0 log CFU per towel) when hands are highly contaminated. Our results support future quantitative microbial risk assessments needed to effectively manage risks of foodborne illness in which food workers' hands are a primary cause.

  12. Detection of Shiga Toxin-Producing Escherichia coli in Ground Beef Using the GeneDisc Real-Time PCR System

    Directory of Open Access Journals (Sweden)

    Pina eFratamico

    2012-12-01

    Full Text Available Escherichia coli O157:H7 and certain non-O157 Shiga toxin-producing Escherichia coli (STEC serogroups have emerged as important public health threats. The development of methods for rapid and reliable detection of this heterogeneous group of pathogens has been challenging. GeneDisc real-time PCR assays were evaluated for detection of the stx1, stx2, eae, and ehx genes and a gene that identifies the O157 serogroup followed by a second GeneDisc assay targeting serogroup-specific genes of STEC O26, O45, O91, O103, O111, O113, O121, O145, and O157. The ability to detect the STEC serogroups in ground beef samples artificially inoculated at a level of ca. 2-20 CFU/25 g and subjected to enrichment in mTSB or BPW was similar. Following enrichment, all inoculated ground beef samples showed amplification of the correct set of target genes carried by each strain. Samples inoculated with STEC serogroups O26, O45, O103, O111, O121, O145, and O157 were subjected to immunomagnetic separation, and isolation was achieved by plating onto Rainbow agar O157. Colonies were confirmed by PCR assays targeting stx1, stx2, eae, and serogroup-specific genes. Thus, this work demonstrated that GeneDisc assays are rapid, sensitive, and reliable and can be used for screening ground beef and potentially other foods for STEC serogroups that are important food-borne pathogens worldwide.

  13. Levels of ground corn supplied to beef heifers at pasture during the rainy season: productive performance, intake, digestibility and microbial efficiency

    Directory of Open Access Journals (Sweden)

    Darcilene Maria de Figueiredo

    2011-11-01

    Full Text Available The objective was to evaluate the effect of four levels of ground corn supply on nutritional parameters, microbial synthesis efficiency and growing performance of beef heifers, at the rainy season. For such, 28 crossbred yearling heifers, with initial age of 16-17 months and initial weight of 255 ± 31.0 kg were distributed into five paddoks of B. decumbens, of 2.0 ha each, with average potentially digestible DM availability of 2,377.0 kg/ha. For each one of the lots, one of the following supplements was daily supplied: mineral mix exclusively or with ground corn at levels 0.25, 0.50, 0.75 or 1.00 kg/day. The experiment was arranged in completely randomized design with five treatments (supplements, five repetitions for the groups receiving exclusive mineral mix or mineral mix plus corn on the level of 0.50 kg/day and six repetitions for those receiving the other supplements. There was a response of 0.092 kg of weight gain for every 1 kg of ground corn supplied to the animals, and no substitution effect was verified on the dry matter intake of pasture. The increase in ground corn levels increased metabolizable energy intake, which is explained by the crescent linear effect on digestible dry matter intake, on apparent digestibility of dry matter and organic matter as well as on the levels of total digestible nutrients of the diet consistent with the increase in intake of the most digestible ingredient, ground corn. In the same way, there was a positive linear effect for apparent digestibility of neutral detergent fiber. The supplementation provided linear positive effect on the flow of microbial nitrogen compounds (MICN for the small intestine, and did not affect the microbial synthesis efficiency. The supply of energetic supplement for beef heifers, at pasture, during the rainy season increases the use of the forage and consequently, weight gain.

  14. The influence of atmosphere conditions on Escherichia coli and Salmonella typhi radiosensitization in irradiated ground beef containing carvacrol and tetrasodium pyrophosphate

    Science.gov (United States)

    Lacroix, M.; Borsa, J.; Chiasson, F.; Ouattara, B.

    2004-09-01

    The radiosensitization of Escherichia coli and Salmonella typhi in presence of carvacrol (1.0%) and tetrasodium pyrophosphate (0.1%) in ground beef packed under four different atmospheres (air; 100% CO 2; MAP : 60% O 2-30% CO 2-10% N 2 and vacuum) was determined. Medium fat ground beef containing carvacrol and tetrasodium pyrophosphate was inoculated with E. coli or S. typhi. Samples were packed under different atmospheres as described before and irradiated at doses from 0.1 to 0.6 kGy in presence of E. coli and from 0.50 to 2.0 kGy for S. typhi. Results indicated that the best increase in radiosensitization was observed in samples packed under MAP. The D10 values were 0.046 kGy for E. coli and 0.053 kGy for S. typhi. Both bacteria were more resistant to irradiation under air, in the absence of active compound. A D10 values of 0.126 kGy for E. coli and 0.526 kGy for S. typhi was observed.

  15. The influence of atmosphere conditions on Escherichia coli and Salmonella typhi radiosensitization in irradiated ground beef containing carvacrol and tetrasodium pyrophosphate

    Energy Technology Data Exchange (ETDEWEB)

    Lacroix, M. E-mail: monique.lacroix@inrs-iaf.uquebec.ca; Borsa, J.; Chiasson, F.; Ouattara, B

    2004-10-01

    The radiosensitization of Escherichia coli and Salmonella typhi in presence of carvacrol (1.0%) and tetrasodium pyrophosphate (0.1%) in ground beef packed under four different atmospheres (air; 100% CO{sub 2}; MAP : 60% O{sub 2}-30% CO{sub 2}-10% N{sub 2} and vacuum) was determined. Medium fat ground beef containing carvacrol and tetrasodium pyrophosphate was inoculated with E. coli or S. typhi. Samples were packed under different atmospheres as described before and irradiated at doses from 0.1 to 0.6 kGy in presence of E. coli and from 0.50 to 2.0 kGy for S. typhi. Results indicated that the best increase in radiosensitization was observed in samples packed under MAP. The D{sub 10} values were 0.046 kGy for E. coli and 0.053 kGy for S. typhi. Both bacteria were more resistant to irradiation under air, in the absence of active compound. A D{sub 10} values of 0.126 kGy for E. coli and 0.526 kGy for S. typhi was observed.

  16. Fiber-Optic Biosensor Employing Alexa-Fluor Conjugated Antibody for Detection of Escherichia coli O157:H7 from Ground Beef in Four Hours

    Directory of Open Access Journals (Sweden)

    Arun K. Bhunia

    2006-08-01

    Full Text Available Fiber optic biosensor has a great potential to meet the need for rapid, sensitive,and real-time microbial detection systems. We developed an antibody-based fiber-opticbiosensor to rapidly detect low levels of Escherichia coli O157:H7 cells in ground beef. Theprinciple of the sensor is a sandwich immunoassay using an antibody which is specific forE. coli O157:H7. A polyclonal antibody was first immobilized on polystyrene fiberwaveguides through a biotin-streptavidin reaction that served as a capture antibody. AnAlexa Fluor 647 dye-labeled antibody to E. coli O157:H7 was used to detect cells andgenerate a specific fluorescent signal, which was acquired by launching a 635 nm laser-lightfrom an Analyte-2000. Fluorescent molecules within several hundred nanometers of thefiber were excited by an evanescent wave, and a portion of the emission light fromfluorescent dye transmitted by the fiber and collected by a photodetector at wavelengths of670 to 710 nm quantitatively. This immunosensor was specific for E. coli O157:H7compared with multiple other foodborne bacteria. In addition, the biosensor was able todetect as low as 103 CFU/ml pure cultured E. coli O157:H7 cells grown in culture broth.Artificially inoculated E. coli O157:H7 at concentration of 1 CFU/ml in ground beef couldbe detected by this method after only 4 hours of enrichment.

  17. The impact of single antimicrobial intervention treatment with potassium lactate, sodium metasilicate, peroxyacetic acid, and acidified sodium chlorite on non-inoculated ground beef lipid, instrumental color, and sensory characteristics.

    Science.gov (United States)

    Quilo, S A; Pohlman, F W; Dias-Morse, P N; Brown, A H; Crandall, P G; Baublits, R T; Aparicio, J L

    2009-11-01

    The effect of using potassium lactate, sodium metasilicate, acidified sodium chlorite, or peroxyacetic acid as a single antimicrobial intervention on ground beef instrumental color, sensory color and odor characteristics, and lipid oxidation was evaluated. Prior to grinding, beef trimmings (90/10) were treated with 3% potassium lactate (KL), 4% sodium metasilicate (NMS), 200-ppm peroxyacetic acid (PAA), 1000-ppm acidified sodium chlorite (ASC), or left untreated (CON). Ground beef under simulated retail display was measured at 0, 1, 2, 3, and 7 of display for instrumental color, sensory characteristics, TBARS values, and pH to evaluate the impact of the treatments. The KL, NMS, PAA, and ASC were redder (a(∗); P<0.05) than CON. All treatments were scored by sensory panelists to have a brighter (P<0.05) red color than CON during days 1-3 of display. All treatments had less (P<0.05) lipid oxidation than CON on days 0, 3, and 7 of display. These results suggest that the use of these antimicrobial compounds on beef trimmings prior to grinding may not adversely affect, and may improve bulk packaged ground beef quality characteristics.

  18. Influence of dietary fiber type and amount on energy and nutrient digestibility, fecal characteristics, and fecal fermentative end-product concentrations in captive exotic felids fed a raw beef-based diet.

    Science.gov (United States)

    Kerr, K R; Morris, C L; Burke, S L; Swanson, K S

    2013-05-01

    Little nutritional or metabolic information has been collected from captive exotic cats fed raw diets. In particular, fiber types and concentrations for use in raw meat-based diets for captive exotic felids have not been well studied. Our objective was to evaluate the effects of fiber type and concentration on apparent total tract energy and macronutrient digestibility, fecal characteristics, and fecal fermentative end-products in captive exotic felids. Four animals of each captive exotic species (jaguar (Panthera onca), cheetah (Acinonyz jubatus), Malayan tiger (Panthera tigris corbetti), and Siberian tiger (Panthera tigris altaica) were randomized in four 4 × 4 Latin square designs (1 Latin square per species) to 1 of the 4 raw beef-based dietary treatments (94.7 to 96.7% beef trimmings): 2 or 4% cellulose or 2 or 4% beet pulp. Felid species, fiber type, and fiber concentration all impacted digestibility and fecal fermentative end-products. Inclusion of beet pulp increased (P ≤ 0.05) fecal short-chain fatty acids and fecal output in all cats. Inclusion of 2 and 4% cellulose, and 4% beet pulp increased (P ≤ 0.05) fecal bulk and diluted fecal branched-chain fatty acid concentrations compared with 2% beet pulp. Apparent total tract DM, OM, fat, and GE digestibility coefficients decreased (P ≤ 0.05) linearly with BW of cats. Additionally, fecal moisture, fecal score, and concentrations of fermentative end-products increased (P ≤ 0.05) with BW. Although the response of many outcomes was dependent on cat size, in general, beet pulp increased wet fecal weight, fecal scores, and fecal metabolites, and reduced fecal pH. Cellulose generally reduced DM and OM digestibility, but increased dry fecal weight and fecal percent DM. Although beet pulp and cellulose fibers were tested individually in this study, these data indicate that the optimum fiber type and concentration for inclusion in captive exotic felid diets is likely a combination of fermentable and

  19. Evaluation of the performance of the IQ-check kits and the USDA microbiology laboratory guidebook methods for detection of Shiga Toxin-Producing E. coli (STEC) and STEC and Salmonella simultaneously in ground beef

    Science.gov (United States)

    Aims: To evaluate the performance of the IQ-Check kits and the USDA Microbiology Laboratory Guidebook (MLG) methods for detection of the top 7 Shiga toxin-producing E. coli (STEC) (O157:H7, O26, O45, O103, O111, O121, and O145) in ground beef and both STEC and Salmonella in co-inoculated samples. M...

  20. Effect of adding essential oils of coriander (Coriandrum sativum L.) and hyssop (Hyssopus officinalis L.) on the shelf life of ground beef.

    Science.gov (United States)

    Michalczyk, Magdalena; Macura, Ryszard; Tesarowicz, Iwona; Banaś, Joanna

    2012-03-01

    This study examined the effect of adding essential oils of hyssop and coriander at the highest concentration (0.02% v/w) sensorially acceptable to a panel of assessors on the microbiological and biochemical characteristics of stored ground beef. Vacuum-packed meat was stored at 0.5±0.5°C and 6±1°C for 15days. The greatest beneficial effect of both additives was in inhibiting the development of undesirable sensory changes (extending acceptability by up to 3days) and the growth of Enterobacteriaceae (by up to approximately 1-2 log cycles compared with the controls). The effect on lactic acid bacteria, total viable bacterial count and other groups of microorganisms investigated was minor (up to 1 log cycle) and similar for both oils. Neither did these additives significantly affect amino nitrogen levels, protease activity, the proportions of meat pigments, protein electropherograms and pH levels. This indicates the limited effect of these essential oils in the concentrations applied on preserving vacuum-packed minced beef.

  1. Elimination of Pathogen Escherichia coli O157:H7 in Ground Beef by a Newly Isolated Strain of Lactobacillus acidophilus during Storage at 5°C

    Directory of Open Access Journals (Sweden)

    Alireza Goodarzi

    2016-06-01

    Full Text Available Background and Objective: Constant use of limited number of lactic acid bacteria species in biopreservation can cause genetic degradation and or rising resistance against food pathogens or antimicrobial substances they produce. For this objective, a newly isolated strain of Lactobacillus acidophilus possessing high antimicrobial activity was evaluated as a candidate for use in biopreservation.Materials and Methods: Antibacterial activity was evaluated by agar disk diffusion method. Hydrogen peroxide amount was measured by Merckoquant Peroxide test strips. Microbiological analysis of the ground beef infected by Escherichia coli O157:H7 and treated by Lactobacillus acidophilus GH 201was done by plating of serial dilution in physiological saline on Tryptose agar.Results and Conclusion: The cells (109 CFU ml-1 of Lactobacillus acidophilus produced significant amount of antibacterial substances mainly hydrogen peroxide (28 and 30 μg ml-1 in sodium phosphate buffer (0.2 M, pH 6.5 and LAPTg at 5°C during submerged cultivation with no growth, respectively. Submerged co-cultivation of Escherichia coli O157:H7 with lactobacilli in LAPTg broth at 5°C reduced the total number of the pathogen more than 2 log for 5 days. In case of solid state cultivation on agar-based medium, the maximum inhibitory zones on Escherichia coli O157:H7 lawn around the disks soaked by different amounts of washed Lactobacillus acidophilus cells appear for one-day cold exposition. The size of inhibition zone depends on the concentration of lactic acid bacteria cells. The cell suspension intended for treatment must contain 108-9CFU ml-1 of lactic acid bacteria. Lactobacillus acidophilus reduced the initial amount (2×105 CFU ml-1 of Escherichia coli O157:H7 in ground beef up to 2 log for 5 days of solid-state co-cultivation. The application of Lactobacillus acidophilus bacteria expanded the shelf-life of ground beef due to inhibition of

  2. Methicillin resistant Staphylococcus aureus isolated from meat raw in Cartagena, Colombia

    OpenAIRE

    Lersy López Gutierrez; Alfonso Bettin Martinez; Héctor Suárez Mahecha

    2017-01-01

    To determine the prevalence of Methicillin Resistant Staphylococcus aureus (MRSA) isolated in establishments that commercialize raw ground beef and pork chops in Cartagena- Colombia. 160 samples were analyzed through microbiological cultures in Baire Parcker agar, and it was determined the presence of mecA gen that codifies the methicillin resistance and the pvl that codifies the Panton- Valentine leukocidin toxin (PVL) by the multiplex PCR technique. The antibiotic susceptibility profile for...

  3. Species-specific expression of various proteins in meat tissue: proteomic analysis of raw and cooked meat and meat products made from beef, pork and selected poultry species.

    Science.gov (United States)

    Montowska, Magdalena; Pospiech, Edward

    2013-02-15

    The aim was to search for proteins differentiating the six species (cattle, pig, chicken, turkey, duck and goose) and relatively stable during the meat aging and only slightly degraded in ready-made products. The two-dimensional electrophoresis was used for analysis of the protein profiles from raw meat and frankfurters and sausages (15 products). The observed species-specific differences in protein expression in raw meat were retained in processed products after finishing the entire technological process. Regulatory proteins, metabolic enzymes, some myofibrillar and blood plasma proteins were identified, which were characterised by the electrophoretic mobility specific to the given species. Large differences in the primary structure were observed in serum albumin, apolipoprotein B, HSP27, H-FABP, ATP synthase, cytochrome bc-1 subunit 1 and alpha-ETF. Some of these proteins have potential to be used as markers in authentication of meat products. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Profile and activity of the bacterial biota of ground beef held from freshness to spoilage at 5-7 degrees C.

    Science.gov (United States)

    Jay, J M; Vilai, J P; Hughes, M E

    2003-03-15

    Four samples of fresh ground beef were stored aerobically and held at 5-7 degrees C for up to 28 days. Although one sample initially yielded 21 different genera of bacteria while two others yielded only seven, all four spoiled essentially in the same way as assessed by aerobic, psychrotrophic, and Gram-negative counts, and by extract-release volume (ERV) and pH values. Pseudomonas spp. was dominant in the spoilage of all samples. As to why this group is so consistently associated with the low-temperature aerobic spoilage of fresh meats, it is hypothesized that they possess the capacity to form a biofilm and that quorum sensing is involved in the overall biofilm forming and functioning processes.

  5. Gelatine-Based Antioxidant Packaging Containing Caesalpinia decapetala and Tara as a Coating for Ground Beef Patties.

    Science.gov (United States)

    Gallego, María Gabriela; Gordon, Michael H; Segovia, Francisco; Almajano Pablos, María Pilar

    2016-03-31

    The development of antioxidant-active packaging has numerous advantages, such as the reduction of synthetic additives in food, the reduction of plastic waste and food protection against oxidation reactions. Different concentrations of extracts of the plants Caesalpinia decapetala (CD) and Caesalpinia spinosa "Tara" (CS) were incorporated into gelatine films as natural antioxidants. The physical, mechanical and antioxidant properties of these films were studied. Films containing plant extracts at a high concentration had lower tensile strength with higher elongation at break points, compared to the control film (p Films exhibited antioxidant activity in the oxygen radical absorbance capacity (ORAC) and Trolox equivalence antioxidant capacity (TEAC) assays when added at 0.2%. The application of gelatine film containing CD and CS was found to be effective in delaying lipid oxidation and deterioration of beef patty quality during storage. Therefore, the films prepared in this study offered an alternative edible coating for the preservation of fresh food.

  6. Beef lovers

    DEFF Research Database (Denmark)

    de Barcellos, Marcia Dutra; Pedrozo, Eugenio A.; van der Lans, Ivo A.

    2009-01-01

    In this chapter we will explore beef consumption behaviour from a cross-cultural perspective. Data collected in Brazil, Australia and the Netherlands supports the main objectives of identifying consumers' anticipated emotions, degree of involvement, attitudes and main concerns towards beef...

  7. Gelatine-Based Antioxidant Packaging Containing Caesalpinia decapetala and Tara as a Coating for Ground Beef Patties

    Directory of Open Access Journals (Sweden)

    María Gabriela Gallego

    2016-03-01

    Full Text Available The development of antioxidant-active packaging has numerous advantages, such as the reduction of synthetic additives in food, the reduction of plastic waste and food protection against oxidation reactions. Different concentrations of extracts of the plants Caesalpinia decapetala (CD and Caesalpinia spinosa “Tara” (CS were incorporated into gelatine films as natural antioxidants. The physical, mechanical and antioxidant properties of these films were studied. Films containing plant extracts at a high concentration had lower tensile strength with higher elongation at break points, compared to the control film (p < 0.05. Films exhibited antioxidant activity in the oxygen radical absorbance capacity (ORAC and Trolox equivalence antioxidant capacity (TEAC assays when added at 0.2%. The application of gelatine film containing CD and CS was found to be effective in delaying lipid oxidation and deterioration of beef patty quality during storage. Therefore, the films prepared in this study offered an alternative edible coating for the preservation of fresh food.

  8. Sporadic salmonellosis in Lower Saxony, Germany, 2011-2013: raw ground pork consumption is associated with Salmonella Typhimurium infections and foreign travel with Salmonella Enteritidis infections.

    Science.gov (United States)

    Rettenbacher-Riefler, S; Ziehm, D; Kreienbrock, L; Campe, A; Pulz, M; Dreesman, J

    2015-10-01

    To investigate risk factors for sporadic salmonellosis, for each notified case four randomly selected population controls matched for age, sex and geographical region were interviewed via self-administered questionnaire. Conditional logistic regression analysis of 285 matched pairs revealed significant associations for raw ground pork consumption [odds ratio (OR) 6·0, 95% confidence interval (CI) 1·8-20·1], taking antacids (OR 5·8, 95% CI 1·4-24·5), eating meat outside the home (OR 5·7, 95% CI 2·2-14·6) and daily changing or cleaning of dishcloth (OR 2·1, 95% CI 1·2-3·9). Animal contact and ice cream consumption were negatively associated with salmonellosis (OR 0·5, 95% CI 0·2-1 and OR 0·3, 95% CI 0·1-0·6, respectively). S. Typhimurium infections were significantly associated with raw ground pork consumption (OR 16·7, 95% CI 1·4-194·4) and S. Enteritidis infections with having travelled abroad (OR 9·7, 95% CI 2·0-47·3). Raw egg consumption was not a risk factor, substantiating the success of recently implemented national control programmes in the poultry industry. Unexpectedly, hygienic behaviour was more frequently reported by cases, probably because they overestimated their hygiene precautions retrospectively. Although animal contact might enhance human immunocompetence, underreporting of salmonellosis by pet owners could have occurred. Eating raw pork products is the major risk factor for sporadic human S. Typhimurium infections in Lower Saxony.

  9. Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C.S.; Madden, R.H.

    2006-01-01

    A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk...... samples (n = 101) were kindly provided by the Milk Research Laboratory, Department of Agriculture and Rural Development, Belfast, Northern Ireland. Presumptive arcobacters were identified by previously described genus-specific and species-specific PCR assays. Arcobacter spp. were found to be common...... contaminants of retail raw meats and raw milk in Northern Ireland. Poultry meat (62%) had the highest prevalence, but frequent isolations were made from pork (35%), beef (34%), and raw milk (46%). Arcobacter butzleri was the predominant species isolated from retail raw meats and was the only species isolated...

  10. Enhancement of the nutritional status of beef patties by adding flaxseed flour.

    Science.gov (United States)

    Elif Bilek, A; Turhan, Sadettin

    2009-08-01

    Flaxseed flour was used as a functional ingredient in the production of beef patties. Beef patties were produced with five different formulations; the addition of 3%, 6%, 9%, 12% and 15% flaxseed flour. Control samples were formulated with 10% and 20% fat addition. Raw and cooked beef patties were analyzed for moisture, protein, fat, ash, pH, color parameters and fatty acid profiles. Beef patties were evaluated for cooking loss and sensory properties. Fat and ash content of raw patties increased, while moisture and protein content decreased with increased flaxseed flour. The same trend (except fat content) was also observed after cooking. The addition of flaxseed flour did not affect pH values of raw and cooked beef patties. The addition of flaxseed flour improved the cooking loss but, increased the energy value (as kcal/100g). L and a values of raw beef patties containing flaxseed flour were close to controls with 10% fat. α-linolenic acid content of raw and cooked beef patties increased as the level of flaxseed flour increased. The PUFA/SFA ratio increased from 0.04 in the control with 10% fat to 0.62 in the raw beef patties with 15% flaxseed flour. The n-6/n-3 ratio decreased from 5.76 in the control with 10% fat to 0.36 in the raw beef patties with 15% flaxseed flour. The nutritional status of beef patties was enhanced with minimal composition and sensory changes with 3% or 6% flaxseed flour addition.

  11. Effects of packaging systems and fat concentrations on microbiology, sensory and physical properties of ground beef stored at 4±1°C for 25 days.

    Science.gov (United States)

    Lavieri, N; Williams, S K

    2014-08-01

    This study evaluated effects of modified atmosphere (MAP, 0.4% carbon monoxide [CO], 30% carbon dioxide, and 69.6% nitrogen), vacuum (VP) and polyvinyl chloride (PVC) packaging systems and fat levels (10, 20 and 30% fat) on ground beef stored at 4 ± 1°C for 25 days for microbiology, sensory, pH, thiobarbituric acid reactive substances (TBARS), objective color, headspace and residual CO. As storage time increased, pH decreased (P< 0.05) for MAP and VP and increased (P < 0.05) for PVC. TBARS varied (P < 0.05) among MAP and VP treatments. Except for day 1, CO headspace concentrations were similar among fat concentrations, and residual CO absorption in meat increased (P < 0.05) for all MAP treatments. In all treatments, degree of lightness was similar, redness decreased and brown discoloration increased during storage. As psychrotrophic bacteria counts increased, panelists detected color and off-odor deterioration in all systems. The CO treatment had no effect on maintaining the carboxymyoglobin "cherry red" fresh meat color during meat spoilage.

  12. Evaluation of beef trim sampling methods for detection of Shiga toxin-producing Escherichia coli (STEC)

    Science.gov (United States)

    Presence of Shiga toxin-producing Escherichia coli (STEC) is a major concern in ground beef. Several methods for sampling beef trim prior to grinding are currently used in the beef industry. The purpose of this study was to determine the efficacy of the sampling methods for detecting STEC in beef ...

  13. Characterization of Listeria monocytogenes isolates from cattle and ground beef by pulsed-field gel electrophoresis Caracterización de aislamientos de Listeria monocytogenes obtenidos de ganado y de carne molida de vacuno por electroforesis de campo pulsado

    Directory of Open Access Journals (Sweden)

    Claudia Foerster

    2012-09-01

    Full Text Available The aims of this study were to determine the occurrence of Listeria monocytogenes in cattle feces and ground beef, to characterize these strains by pulsed-field gel electrophoresis and to compare them to three listeria strains found in humans. Cattle from different origins (n = 250 and ground beef obtained from supermarkets (n = 40 were sampled. The results show low occurrence in cattle feces (0.4 % but a higher presence in ground beef (37 %. An important part of the ground beef strains (80 % had > 95 % similarity with a strain isolated from a human sporadic case and the ATCC 19115 used as control. The strain isolated from cattle feces had 93 % similarity to clone 009, previously associated with a listeriosis outbreak related to cheese. Cattle and ground beef can harbor virulent L. monocytogenes strains. Further studies in animals and animal products are needed to improve listeriosis control.Los objetivos de este estudio fueron determinar la presencia de Listeria monocytogenes en el ganado y en la carne molida de vacuno comercializada en Chile, caracterizar los aislados mediante electroforesis de campo pulsado y compararlos con los obtenidos en tres cepas que han producido listeriosis en humanos, en ese país. Se tomaron muestras de heces de bovinos (n = 250 y de carne molida obtenida en supermercados (n = 40. Se encontró una baja incidencia de este patógeno en las heces de bovinos (0,4 %; un solo animal, pero mayores porcentajes en la carne molida (37 %. Gran parte de las cepas encontradas en la carne molida (80 % mostraron una similitud mayor del 95 % con un caso esporádico de listeriosis y con la cepa de referencia ATCC 19115. La cepa aislada de bovino tuvo un 93 % de similitud con el clon 009, responsable de un brote asociado al consumo de queso, ocurrido en 2008. Se concluye que el ganado y la carne molida pueden albergar cepas virulentas de L. monocytogenes. Se necesita un mayor número de estudios en animales y en los productos que se

  14. Predictive model for the reduction of heat resistance of Listeria monocytogenes in ground beef by the combined effect of sodium chloride and apple polyphenols.

    Science.gov (United States)

    Juneja, Vijay K; Altuntaş, Evrim Güneş; Ayhan, Kamuran; Hwang, Cheng-An; Sheen, Shiowshuh; Friedman, Mendel

    2013-06-03

    We investigated the combined effect of three internal temperatures (57.5, 60, and 62.5°C) and different concentrations (0 to 3.0 wt/wt.%) of sodium chloride (NaCl) and apple polyphenols (APP), individually and in combination, on the heat-resistance of a five-strain cocktail of Listeria monocytogenes in ground beef. A complete factorial design (3×4×4) was used to assess the effects and interactions of heating temperature, NaCl, and APP. All 48 combinations were tested twice, to yield 96 survival curves. Mathematical models were then used to quantitate the combined effect of these parameters on heat resistance of the pathogen. The theoretical analysis shows that compared with heat alone, the addition of NaCl enhanced and that of APP reduced the heat resistance of L. monocytogenes measured as D-values. By contrast, the protective effect of NaCl against thermal inactivation of the pathogen was reduced when both additives were present in combination, as evidenced by reduction of up to ~68% in D-values at 57.5°C; 65% at 60°C; and 25% at 62.5°C. The observed high antimicrobial activity of the combination of APP and low salt levels (e.g., 2.5% APP and 0.5% salt) suggests that commercial and home processors of meat could reduce the salt concentration by adding APP to the ground meat. The influence of the combined effect allows a reduction of the temperature of heat treatments as well as the salt content of the meat. Meat processors can use the predictive model to design processing times and temperatures that can protect against adverse effects of contaminated meat products. Additional benefits include reduced energy use in cooking, and the addition of antioxidative apple polyphenols may provide beneficial health affects to consumers.

  15. [Influence of below-freezing temperatures on the rate of post-mortem metabolism and the water-holding capacity in prerigor frozen beef muscles (author's transl)].

    Science.gov (United States)

    Fischer, C; Honikel, K O; Hamm, R

    1980-09-01

    Prerigor beef is very suitable for the production of "bruehwurst" (frankfurter and bologna type sausages) because of its high waterholding capacity (WHC). This high WHC can be preserved for several months by rapid freezing of prerigor beef either unsalted or salted. In order to elucidate the optimum conditions of frozen storage for the preservation of high WHC, intact beef muscle, ground beef and ground, salted (2% NaC1) beef (neck muscles) were frozen at - 18 degrees or --40 degrees C in a thin layer (0.5-1 cm) 30--60 min after slaugther and stored at various temperatures between --5 degrees and --40 degrees C. The changes of biochemical parameters (content of glycogen and lactate, R-value [it corresponds to ATP concentration] and pH) in the tissue and the WHC of raw and heated muscle homogenates, prepared from the frozen material and containing 2% NaC1, were measured and related to time and temperature of frozen storage. At storage temperature of --18 degrees and --40 degrees C no appreciable biochemical changes occur in intact and ground, unsalted tissue over a period of 10 months. Above 18 degrees C, however, rising temperature causes an increased rate of ATP turnover and glycolysis. In ground muscle higher rates of postmortem metabolism are generally found than in the intact tissue. In prerigor salted and frozen beef a faster drug of ATP concentration (increase of R-value) occurs whereas the breakdown of glycogen to lactate is inhibited. The WHC of raw and heated muscle homogenates depends on time and temperature of frozen storage. As soon as the ATP concentration in unsalted beef falls to a level, at which the onset of rigor mortis occurs, the WHC of homogenates decreases markedly. With beef, ground and salted in the prerigor state and than frozen muscle homogenates are obtained which show always a high WHC even after complete breakdown at ATP during frozen storage. These results have practical consequences with regard to processing of hot-deboned beef.

  16. Effect of Persimmon Peel (Diospyros kaki Thumb.) Extracts on Lipid and Protein Oxidation of Raw Ground Pork During Refrigerated Storage

    Science.gov (United States)

    Choe, Ju-Hui; Kim, Hack-Youn

    2017-01-01

    The inhibition effect of persimmon peel extracts (PPE) (0.05(PPE-0.05), 0.1(PPE-0.1), and 0.2 g(PPE-0.2) per meat sample) on lipid and protein oxidation of pork patties during chilled storage for 12 days were investigated and compared to ascorbic acid (As-0.05) and butylhydroxytoluene (BHT) (BHT-0.01). The meat samples treated with PPE had greater (pBHT-0.01 had the lowest in decrease rate of free thiol content (0.24 and 0.22 times) during chilled storage. Therefore, results of this study suggest that PPE can be considered a potential antioxidant against lipid and protein oxidation of raw meat products. PMID:28515649

  17. Cross-Laboratory Comparative Study of the Impact of Experimental and Regression Methodologies on Salmonella Thermal Inactivation Parameters in Ground Beef.

    Science.gov (United States)

    Hildebrandt, Ian M; Marks, Bradley P; Juneja, Vijay K; Osoria, Marangeli; Hall, Nicole O; Ryser, Elliot T

    2016-07-01

    Isothermal inactivation studies are commonly used to quantify thermal inactivation kinetics of bacteria. Meta-analyses and comparisons utilizing results from multiple sources have revealed large variations in reported thermal resistance parameters for Salmonella, even when in similar food materials. Different laboratory or regression methodologies likely are the source of methodology-specific artifacts influencing the estimated parameters; however, such effects have not been quantified. The objective of this study was to evaluate the effects of laboratory and regression methodologies on thermal inactivation data generation, interpretation, modeling, and inherent error, based on data generated in two independent laboratories. The overall experimental design consisted of a cross-laboratory comparison using two independent laboratories (Michigan State University and U.S. Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center [ERRC] laboratories), both conducting isothermal Salmonella inactivation studies (55, 60, 62°C) in ground beef, and each using two methodologies reported in prior studies. Two primary models (log-linear and Weibull) with one secondary model (Bigelow) were fitted to the resultant data using three regression methodologies (two two-step regressions and a one-step regression). Results indicated that laboratory methodology impacted the estimated D60°C- and z-values (α = 0.05), with the ERRC methodology yielding parameter estimates ∼25% larger than the Michigan State University methodology, regardless of the laboratory. Regression methodology also impacted the model and parameter error estimates. Two-step regressions yielded root mean square error values on average 40% larger than the one-step regressions. The Akaike Information Criterion indicated the Weibull as the more correct model in most cases; however, caution should be used to confirm model robustness in application to real-world data. Overall, the

  18. Effects of Irradiation Dose and O2 and CO2 Concentrations in Packages on Foodborne Pathogenic Bacteria and Quality of Ready-to-Cook Seasoned Ground Beef Product (Meatball during Refrigerated Storage

    Directory of Open Access Journals (Sweden)

    Gurbuz Gunes

    2012-01-01

    Full Text Available Combined effects of gamma irradiation and concentrations of O2 (0, 5, 21% and CO2 (0, 50% on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O2 and CO2 levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O2, respectively, compared to 21% O2. Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg−1, respectively, compared to control. In reduced-O2 packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO2 or 5% O2 + 50% CO2 maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O2 + 50% CO2 combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality.

  19. Effect of selected plant essential oils or their constituents and modified atmosphere packaging on the radiosensitivity of Escherichia coli O157:H7 and Salmonella typhi in ground beef.

    Science.gov (United States)

    Turgis, M; Borsa, J; Millette, M; Salmieri, S; Lacroix, M

    2008-03-01

    Twenty-six different essential oils were tested for their efficiency to increase the relative radiosensitivity of Escherichia coli and Salmonella Typhi in medium-fat ground beef (23% fat). Ground beef was inoculated with E. coli O157:H7 or Salmonella (10(6) CFU/g), and each essential oil or one of their main constituents was added separately at a concentration of 0.5% (wt/wt). Meat samples (10 g) were packed under air or under modified atmosphere and irradiated at doses from 0 to 1 kGy for the determination of the D10-value of E. coli O157:H7, and from 0 to 1.75 kGy for the determination of the D10-value of Salmonella Typhi. Depending on the compound tested, the relative radiation sensitivity increased from 1 to 3.57 for E. coli O157:H7 and from 1 to 3.26 for Salmonella Typhi. Addition of essential oils or their constituents before irradiation also reduced the irradiation dose needed to eliminate both pathogens. In the presence of Chinese cinnamon or Spanish oregano essential oils, the minimum doses required to eliminate the bacteria were reduced from 1.2 to 0.35 and from 1.4 to 0.5 for E. coli O157:H7 and Salmonella Typhi, respectively. Cinnamon, oregano, and mustard essential oils were the most effective radiosensitizers.

  20. Detection and isolation of the "Top 7" Shiga toxin-producing Escherichia coli in ground beef: comparison of the Rapidfinder kits to the USDA microbiology laboratory guidebook method

    Science.gov (United States)

    Shiga toxin-producing E. coli (STEC) O157:H7 and serogroups O26, O45, O103, O111, O121, and O145 are often referred to as the “top 7” STEC, and these have been declared as adulterants in beef by the USDA Food Safety and Inspection Service (FSIS). The aim of this work was to compare the methods des...

  1. Adsorption properties of kaolinite-based nanocomposites for Fe and Mn pollutants from aqueous solutions and raw ground water: kinetics and equilibrium studies.

    Science.gov (United States)

    Shaban, Mohamed; Hassouna, Mohamed E M; Nasief, Fadya M; AbuKhadra, Mostafa R

    2017-08-17

    Raw kaolinite was used in the synthesis of metakaolinite/carbon nanotubes (K/CNTs) and kaolinite/starch (K/starch) nanocomposites. Raw kaolinite and the synthetic composites were characterized using XRD, SEM, and TEM techniques. The synthetic composites were used as adsorbents for Fe and Mn ions from aqueous solutions and natural underground water. The adsorption by the both composites is highly pH dependent and achieves high efficiency within the neutral pH range. The experimental adsorption data for the uptake of Fe and Mn ions by K/CNTs were found to be well represented by the pseudo-second-order kinetic model rather than the intra-particle diffusion model or Elovich model. For the adsorption using K/starch, the uptake results of Fe ions was well fitted by the second-order model, whereas the uptake of Mn ions fitted well to the Elovich model rather than pseudo-second-order and intra-particle diffusion models The equilibrium studies revealed the excellent fitting of the removal of Fe and Mn ions by K/CNTs and Fe using K/starch with the Langmuir isotherm model rather than with Freundlich and Temkin models. But the adsorption of Mn ions by K/starch is well fitted with Freundlich rather than Temkin and Langmuir isotherm models. The thermodynamic studies reflected the endothermic nature and the exothermic nature for the adsorption by K/CNTs and K/starch nanocomposites, respectively. Natural ground water contaminated by 0.4 mg/L Fe and 0.5 mg/L Mn was treated at the optimum conditions of pH 6 and 120 min contact time. Under these conditions, 92.5 and 72.5% Fe removal efficiencies were achieved using 20 mg of K/CNTs and K/starch nanocomposites, respectively. Also, K/CNTs nanocomposite shows higher efficiency in the removal of Mn ions as compared to K/starch nanocomposite.

  2. Crisp Fried Beef Rolls(Xiangsu Niuroujuan)

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    300 grams ground beef 350 grams bread crumbs 2 eggs1 gram MSG2 grams salt10 grams (1 tbsp) cooking wine5 grams chopped spring onion5 grams chopped ginger10 grams (1 tbsp) cornslarch300 grams (3/5 cup) cooking oilMix ground beef with salt, MSG, cooking wine. chopped spring onion and ginger, and 5 grams of cornslarch. Beat eggs in a bowl.Make ground beef into three rolls, about 5 cm in diameter and 15 cm long. Place on a plate and steam until cooked. Coat the rolls in beaten egg and then in breadcrumbs.Heat oil in a wok. fry the rolls until brown. Cut the meat rolls into 3-cm sections, arrange on a plate, and serve.

  3. 77 FR 58091 - Risk-Based Sampling of Beef Manufacturing Trimmings for Escherichia coli (E. coli) O157:H7 and...

    Science.gov (United States)

    2012-09-19

    ... coli (E. coli) O157:H7 and Plans for Beef Baseline AGENCY: Food Safety and Inspection Service (FSIS), U... announcing its intention to redesign its E. coli O157:H7 verification testing program for beef manufacturing... prevalence estimates for E. coli O157:H7 in raw beef manufacturing trimmings. This notice also discusses FSIS...

  4. Environmental sustainability of beef

    Science.gov (United States)

    A national assessment of the sustainability of beef is being conducted in collaboration with the National Cattlemen’s Beef Association through the support of the Beef Checkoff. This includes surveys and visits to cattle operations throughout the U.S. to gather production information. With this infor...

  5. The effects of natural antioxidants on oxidative processes and metmyoglobin reducing activity in beef patties

    NARCIS (Netherlands)

    Bekhit, A.E.D.; Geesink, G.H.; Ilian, M.A.; Morton, J.D.; Bickerstaffe, R.

    2003-01-01

    The effects of antioxidants on oxidative processes and metmyoglobin-reducing activity in beef patties were investigated in two experiments. In the first experiment colour, colour stability, TBA values and MetMb-reducing activity were measured during storage, at 2 oC, of raw beef patties treated with

  6. The effects of natural antioxidants on oxidative processes and metmyoglobin reducing activity in beef patties

    NARCIS (Netherlands)

    Bekhit, A.E.D.; Geesink, G.H.; Ilian, M.A.; Morton, J.D.; Bickerstaffe, R.

    2003-01-01

    The effects of antioxidants on oxidative processes and metmyoglobin-reducing activity in beef patties were investigated in two experiments. In the first experiment colour, colour stability, TBA values and MetMb-reducing activity were measured during storage, at 2 oC, of raw beef patties treated with

  7. 7 CFR 1260.121 - Imported beef or beef products.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Imported beef or beef products. 1260.121 Section 1260... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Definitions § 1260.121 Imported beef or...

  8. Availability, brands, labelling and Salmonella contamination of raw pet food in the Minneapolis/St. Paul area.

    Science.gov (United States)

    Mehlenbacher, S; Churchill, J; Olsen, K E; Bender, J B

    2012-11-01

    The purpose of the study was to characterize the commercially available raw meat pet food diets in the Minneapolis/St. Paul area by (i) determining the number and types of available diets; (ii) assessing pet food stores and brand labels for the provision of precautionary statements regarding the risk of foodborne illness from raw meat; (ii) assessing the labels for Food and Drug Administration (FDA)/American Association of Feed Control Officials (AAFCO) required content and nutrient-related information; and (iv) culturing purchased diets for the presence of Salmonella. Sixty raw meat diets were purchased, representing 11 different brands from eight different stores. Diets were readily available in the form of raw-frozen, dehydrated or freeze-dried varieties from different protein sources, such as lamb, beef, chicken or duck. All stores promoted raw meat diets; however, none provided foodborne illness warnings. Brands varied greatly in their precautionary statements; none of the diets underwent feeding trials; and nutritional adequacy substantiation was through formulation only. The first five ingredients tended to consist of meat, organ meat (by-products), vegetables, grains and ground bones. Currently, it is required that pet foods have an AAFCO nutritional adequacy statement and provide a guaranteed analysis table. Three brands did not meet these FDA requirements. Thirty-one (51.7%) of the 60 raw meat diets underwent some degree of processing including dehydration, freeze-drying or high-pressure pasteurization. Four of the 60 raw diets (7%) tested positive for Salmonella. Analysis of raw meat pet food labels indicated a lack of foodborne illness warnings. Based on these findings, we recommend that warning statements similar to those required by the United States Department of Agriculture and placed on labels of raw meat intended for human consumption be provided on the labels of raw meat pet food diets. © 2012 Blackwell Verlag GmbH.

  9. Changes in fat content of pork and beef after pan-frying under different conditions

    DEFF Research Database (Denmark)

    Clausen, Ina; Ovesen, Lars

    2005-01-01

    ) gained 0.4 g. Similar results were obtained for low- (8%) and high-fat (12%) beef patties. Meatballs (7.5% fat initially) gained up to 2.4 g fat/100 g raw product depending on the cooking conditions. The greatest fat loss was 7.2 g for high fat ground beef (12% fat), which was pan-fried and then rinsed......Various meats differing in fat contents were pan-fried in margarine or oil under various conditions to determine how much fat was gained or lost in absolute terms based on an initial 100 g of product. Beefsteaks and pork leg schnitzel having about, respectively, 6% and 2% fat initially gained...... no more than 2 g fat/100 g raw meat, even when pan-fried in a relatively large amount of margarine. Slight differences were observed depending on the frying time, slice thickness, frying fat type (oil or margarine), quantity of frying fat, or "resting" on the pan. Breaded pork schnitzel gained up to 8 g...

  10. Testing for Salmonella in raw meat and poultry products collected at federally inspected establishments in the United States, 1998 through 2000.

    Science.gov (United States)

    Rose, Bonnie E; Hill, Walter E; Umholtz, Robert; Ransom, Gerri M; James, William O

    2002-06-01

    The Food Safety and Inspection Service (FSIS) issued Pathogen Reduction; Hazard Analysis and Critical Control Point (HACCP) Systems; Final Rule (the PR/HACCP rule) on 25 July 1996. To verify that industry PR/HACCP systems are effective in controlling the contamination of raw meat and poultry products with human disease-causing bacteria, this rule sets product-specific Salmonella performance standards that must be met by slaughter establishments and establishments producing raw ground products. These performance standards are based on the prevalence of Salmonella as determined from the FSIS's nationwide microbial baseline studies and are expressed in terms of the maximum number of Salmonella-positive samples that are allowed in a given sample set. From 26 January 1998 through 31 December 2000, federal inspectors collected 98,204 samples and 1,502 completed sample sets for Salmonella analysis from large, small, and very small establishments that produced at least one of seven raw meat and poultry products: broilers, market hogs, cows and bulls, steers and heifers, ground beef, ground chicken, and ground turkey. Salmonella prevalence in most of the product categories was lower after the implementation of PR/HACCP than in pre-PR/HACCP baseline studies and surveys conducted by the FSIS. The results of 3 years of testing at establishments of all sizes combined show that >80% of the sample sets met the following Salmonella prevalence performance standards: 20.0% for broilers, 8.7% for market hogs, 2.7% for cows and bulls, 1.0% for steers and heifers, 7.5% for ground beef, 44.6% for ground chicken, and 49.9% for ground turkey. The decreased Salmonella prevalences may partly reflect industry improvements, such as improved process control, incorporation of antimicrobial interventions, and increased microbial-process control monitoring, in conjunction with PR/HACCP implementation.

  11. Detection of horse meat contamination in raw and heat-processed meat products.

    Science.gov (United States)

    Hsieh, Yun-Hwa P; Ofori, Jack A

    2014-12-31

    Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.

  12. Evaluation of Rectoanal Mucosal Swab Sampling for Molecular Detection of Enterohemorrhagic Escherichia coli in Beef Cattle.

    Science.gov (United States)

    Agga, Getahun E; Arthur, Terrance M; Hinkley, Susanne; Bosilevac, Joseph M

    2017-04-01

    Cattle are a primary reservoir of enterohemorrhagic Escherichia coli (EHEC), and contaminated beef products are a source of human infections. The U.S. Department of Agriculture Food Safety and Inspection Service declared seven EHEC serogroups (O26, O45, O103, O111, O121, O145, and O157) as adulterants in raw ground beef. Sampling a large number of animals for EHEC surveillance or evaluations of EHEC-focused preharvest interventions requires a convenient and robust sampling method. We evaluated the diagnostic performance of rectoanal mucosal swab (RAMS) for the detection of the top seven EHEC serogroups. Paired fecal grab (FG) and RAMS samples were collected from 176 beef cattle and tested using the NeoSEEK Shiga toxin-producing E. coli (STEC) confirmation method. The prevalence of virulence-associated genes (stx1, stx2, stx2c, eae, and nleB) was higher in RAMS than in FG samples. The results of the two methods had poor agreement, as indicated by kappa statistics, for the detection of the seven serogroups. When FG and RAMS results were combined for comparison, RAMS was more sensitive than FG for the detection of serogroups O103 (82% versus 39%), O157 (75% versus 67%), and O45 (79% versus 73%) with similar sensitivity for the detection of serogroup O145 (67%). Serogroups O111 and O121 were detected from one and two samples, respectively, by FG and were not detected by RAMS. Serogroup O26 was not detected with either method. RAMS appears to be equivalent or superior to FG sampling for detection of the top seven EHEC serogroups in the feces of beef cattle with the NeoSEEK STEC confirmation test.

  13. Detection of Campylobacter jejuni in raw meat

    OpenAIRE

    Z Noori; SH Saadati; A. Mirsalehian; SH Shoeibi; N Rahimifard; Mehrangiz Mehdizadeh; M Pirali- Hamedani

    2009-01-01

    Background & Objectives: Campylobacter jejuni is a Gram negative, microaerophilic, non-spore-forming and a small"ncurved bacillus which is able to cause foodborne infection in human. In this study the occurrence of C. jejuni in poultry and"nbeef meat was investigated."nMaterials & Methods: Forty raw meat samples including 22 poultry samples and 18 beef samples were investigated for the"npresence of C. jejuni. To isolate the bacterium, the samples were initially enriched in Preston Bro...

  14. Antioxidative/Antimicrobial effects of galangal and alpha-tocopherol in minced beef.

    Science.gov (United States)

    Cheah, P B; Gan, S P

    2000-03-01

    The antioxidant and microbial stabilities of galangal (Alpinia galanga) extract in raw minced beef were examined at 4 +/- 1 degree C. Raw minced beef containing galangal extracts (0 to 0.10%, wt/wt) were prepared. Lipid oxidation during refrigerated storage was assessed by monitoring malonaldehyde formation, using the thiobarbituric acid reactive substances method. In minced beef, added galangal extract improved oxidative stability. Galangal extract at higher concentrations of 0.05% and 0.10% (wt/wt) were also found to extend the shelf-life of minced beef. Addition of alpha-tocopherol (0.02%, wt/wt) to galangal extract (0.05%, wt/wt) were observed to increase the oxidative but not the microbial stability of minced beef during the storage of 7 days. Galangal extract may prove useful in inhibiting lipid oxidation and increasing microbial stability of minced meat.

  15. European consumers and beef safety

    DEFF Research Database (Denmark)

    Van Wezemael, Lynn; Verbeke, Wim; Kügler, Jens Oliver

    2010-01-01

    consumption decision making process. Eight focus group discussions were performed with a total of 65 beef consumers in four European countries. Content analysis revealed that European consumers experienced difficulties in the assessment of the safety of beef and beef products and adopted diverging uncertainty......European beef consumption has been gradually declining during the past decades, while consumers' concerns about beef safety have increased. This paper explores consumer perceptions of and interest in beef safety and beef safety information, and their role in beef safety assessment and the beef...... reduction strategies. These include the use of colour, labels, brands and indications of origin as cues signalling beef safety. In general, consumer trust in beef safety was relatively high, despite distrust in particular actors....

  16. European consumers and beef safety

    DEFF Research Database (Denmark)

    Van Wezemael, Lynn; Verbeke, Wim; Kügler, Jens Oliver

    2010-01-01

    consumption decision making process. Eight focus group discussions were performed with a total of 65 beef consumers in four European countries. Content analysis revealed that European consumers experienced difficulties in the assessment of the safety of beef and beef products and adopted diverging uncertainty......European beef consumption has been gradually declining during the past decades, while consumers' concerns about beef safety have increased. This paper explores consumer perceptions of and interest in beef safety and beef safety information, and their role in beef safety assessment and the beef...... reduction strategies. These include the use of colour, labels, brands and indications of origin as cues signalling beef safety. In general, consumer trust in beef safety was relatively high, despite distrust in particular actors....

  17. Inhibition of Listeria monocytogenes growth by using combined bacteriocin-producing strains in raw beef%产抗菌素乳酸菌的组合应用对牛肉中李斯特菌污染的抑制作用研究

    Institute of Scientific and Technical Information of China (English)

    张佩华; 谷贵章; 张进杰; 陈健初

    2011-01-01

    The synergy inhibition of two lactic acid bacteria strains, Lactobacillus curvatus and Pediococcus acidilactici H,on the growth of Listeria monocytogenes in frozen beef was investigated. A Lactobacillus curvatus strain( producing the bacteriocin sakacin P)and a Pediococcus acidilactici H (producing bacteriocin pediocin AcH)were inoculated alone or together in a Listeria-seeded raw pork meat which was stored at 4℃ for 6 weeks.The growth of Listeria monocytogenes was controlled by adding either LAB strain alone,yet the rebound appeared after one-week storage. However,the time of inhibition was prolonged by adding combined these two LAB strains to 6 weeks, after when the Listeria monocytogenes had a rebound with the cfu count lower than 10cfu · g-1.Therefore, using the combined these two LAB strains can effectively delay the rebound of Listeria monocytogenes in the beef.%研究了弯曲乳酸杆菌和乳酸片球菌对低温冷藏牛肉中李斯特菌的混合协同抑制作用.李斯特菌、弯曲乳酸杆菌(产细菌素sakacin P)和乳酸片球菌(产生片球菌素AcH),单独或混合接种于冷鲜牛肉中,4℃下储藏6周.单一接种弯曲乳酸杆菌或乳酸片球菌均能对李斯特菌起到抑制作用,但一周后均出现李斯特菌再次污染现象;然而混合接种弯曲乳酸杆菌和乳酸片球菌能将对李斯特菌的抑制期延长至第六周,之后才出现反弹现象,且李斯特菌数低于10cfu·g-1.因此,应用组合产细菌素菌株能有效延长对李斯特菌的抑制作用.

  18. Electronic Inspection of Beef

    Science.gov (United States)

    Anselmo, Victor J.; Gammell, Paul M.; Clark, Jerry

    1987-01-01

    Two proposed methods for grading beef quality based on inspection by electronic equipment: one method uses television camera to generate image of a cut of beef as customer sees it; other uses ultrasonics to inspect live animal or unsliced carcasses. Both methods show promise for automated meat inspection.

  19. Effect of pH, sodium chloride and sodium pyrophosphate on the termal resistance of Escherichia coli O157:H7 in ground beef

    Science.gov (United States)

    Response to the Letter to the Editor: We have received with great satisfaction that our article “Modelling the effect of pH, sodium chloride and sodium pyrophosphate on the thermal resistance of Escherichia coli O157:H7 in ground beef” (Food Research International, 69:289-304; 2015) has awaken inte...

  20. SMART GROUND Project: SMART data collection and inteGRation platform to enhance availability and accessibility of data and infOrmation in the EU territory on SecoNDary Raw Materials

    Science.gov (United States)

    Rossetti, Piergiorgio; Antonella Dino, Giovanna; de la Feld, Marco; Pizza, Antonietta; Coulon, Frederic; Wagland, Stuart; Gomes, Diogo

    2016-04-01

    The issue of resource security has come to the forefront of the debate over recent years, partly due to considerable concern over the security of supply of the so called 'critical' materials, with rare earths attracting the greatest attention in the press. Their supply is fundamental to maintain and develop EU economy and its industries relied on a steady supply of Raw Materials. Thus considering the increasing scarcity and raising prices of both, energy raw materials and other raw materials, such as metals and minerals, the recycling and recovery of these materials from anthropogenic deposits such as landfills is of increasing relevance. Europe has somewhere between 150,000 and 500,000 landfill sites, with an estimated 90% of them being "non-sanitary" pre-dating the EU Landfill Directive of 1999. Thus historical background makes the numerous old waste dumps as possible sources of critical and secondary raw materials (SRM and CRM). However, to date there is no inventory available of SRM and CRM present in EU landfills, and best management practices to recover SRM from landfill activities are inefficient. In this context, the EU SMART GROUND (SG) project (Grant Agreement No 641988) intends to foster resource recovery in landfills by improving both the availability and the accessibility of data and information on SRM in the EU and creating synergies among the different stakeholders involved in the SRM value chain. To do so, the project aims to collect and integrate in a single EU databank (SMART GROUND Data Bank) all the data from existing databases and new information retrieved during project activities. Such data will be collected from the different waste streams including municipal, industrial and mining wastes across EU landfills. It will improve data gathering on SRM from different types of waste, by defining new and integrated data acquisition methods and standards. At last, but not least, the project will also improve the SRM economic and employment potential

  1. Outbreaks of Salmonella infections attributed to beef --United States, 1973-2011.

    Science.gov (United States)

    Laufer, A S; Grass, J; Holt, K; Whichard, J M; Griffin, P M; Gould, L H

    2015-07-01

    Non-typhoidal Salmonella is estimated to be the most common bacterial cause of foodborne illness in the United States, causing an estimated one million domestically acquired foodborne illnesses annually. Recent, large outbreaks have highlighted the importance of ground beef as an important source of multidrug-resistant Salmonella. We analysed the epidemiology of salmonellosis outbreaks that were attributed to beef in the United States reported to the Centers for Disease Control and Prevention (CDC) from 1973 to 2011. During 1973-2011, of the 1965 outbreaks of Salmonella where a food vehicle was implicated, 96 were attributed to beef, accounting for 3684 illnesses. We observed a shift in the type of beef implicated in salmonellosis outbreaks, from roast to ground beef. Delicatessen-style roast beef cooked in commercial processing establishments was the predominant type during the 1970s and early 1980s; regulations on cooking and processing essentially eliminated this problem by 1987. Ground beef emerged as an important vehicle in the 2000s; it was implicated in 17 (45%) of the 38 beef-attributed outbreaks reported during 2002-2011. Although this emergence was likely due in part to increased participation in CDC's PulseNet, which was established in 1996, and proactive decisions by the United States Department of Agriculture's Food Safety and Inspection Service, stronger measures are needed to decrease contamination of ground beef with Salmonella.

  2. Into beef consumers' mind

    DEFF Research Database (Denmark)

    de Barcellos, Marcia Dutra; Brei, Vinicius A.

    The objectives of this survey were to identify consumers' anticipated emotions, degree of involvement, attitude, and concerns in beef consumption. Data collection was carried out in 2005-2006 in Brazil, Australia and in the Netherlands 816 complete questionnaires were obtained. The results...... of involvement with beef consumption. Fulfillment and pleasantness were found to be positive emotions expected in special beef consumption situations. Relevant multicultural data were obtained. Segmented marketing campaigns and sales efforts can be market-driven towards consumers' needs and expectations....... indicated similarities amongst Brazilian and Australian consumers regarding their positive attitude towards beef and main concerns regarding its consumption. Dutch consumers, although presented negative attitudes, considered beef consumption as important. In general respondents presented a high degree...

  3. Raw and processed ground-penetrating radar and postprocessed differential global positioning system data collected from Assateague Island, Maryland, October 2014

    Science.gov (United States)

    Zaremba, Nicholas J.; Bernier, Julie C.; Forde, Arnell S.; Smith, Christopher G.

    2016-06-08

    Scientists from the U.S. Geological Survey, St. Petersburg Coastal and Marine Science Center acquired sediment cores, sediment surface grab samples, ground-penetrating radar (GPR) and Differential Global Positioning System (DGPS) data from Assateague Island, Maryland, in October 2014. The objectives were to identify washover deposits in the stratigraphic record to aid in understanding barrier island evolution.

  4. BEEF MARKET IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Elena SOARE

    2015-04-01

    Full Text Available This scientific paper presents the cattle market dynamics in Romania during 2007-2013. In order to realize this research there were used certain indicators, as following: herds of cattle, realized beef production, selling price, human consumption, import and export. The data were collected from the Ministry of Agriculture and Rural Development, National Institute of Statistics and Faostat. During the analysis, the presented indicators were modified from a period to another, because of both internal and external factors. Consumption demand is being influenced by: beef price, beef quality, price of other meat categories, consumers incomes, population’s food consumption pattern and so on.

  5. Prevalence and characteristics of Salmonella in the beef chain in the Republic of Ireland.

    Science.gov (United States)

    Khen, B K; Lynch, O A; Carroll, J; McDowell, D A; Duffy, G

    2014-12-01

    The study investigated the prevalence, concentration and characteristics of Salmonella spp. in the Irish beef chain. A total of 900 samples including bovine hides, carcasses and ground beef were examined for the pathogen over a 2-year study (July 2007-June 2009). Salmonella prevalence was low in all sample types; bovine hide (0.75%, 3 of 400); carcasses (0.25%, 1 of 400); and ground beef (3%, 3 of 100). All positive samples contained the pathogen in low concentrations (Salmonella can be found at low levels at all stages of beef chain production, processing and retail and that there is a need for multiple hurdle interventions and practices along the beef chain, which will reduce consumer exposure to this pathogen.

  6. Consumer perceptions of beef healthiness

    DEFF Research Database (Denmark)

    Van Wezemael, Lynn; Verbeke, Wim; Dutra de Barcellos, Marcia

    2010-01-01

    discussions were conducted in four European countries (France, UK, Germany, Spain), each consisting of seven to nine participants. A content analysis was performed on the transcripts of these discussions. RESULTS: Although beef was generally perceived as healthful, focus group participants expected positive...... as well as negative effects of beef consumption on their health. Labelled, branded, fresh and lean beef were perceived as signalling healthful beef, in contrast with further processed and packaged beef. Consumers felt that their individual choices could make a difference with respect to the healthiness...

  7. Detection of Campylobacter jejuni in raw meat

    Directory of Open Access Journals (Sweden)

    Z Noori

    2009-12-01

    Full Text Available Background & Objectives: Campylobacter jejuni is a Gram negative, microaerophilic, non-spore-forming and a small"ncurved bacillus which is able to cause foodborne infection in human. In this study the occurrence of C. jejuni in poultry and"nbeef meat was investigated."nMaterials & Methods: Forty raw meat samples including 22 poultry samples and 18 beef samples were investigated for the"npresence of C. jejuni. To isolate the bacterium, the samples were initially enriched in Preston Broth medium and subsequently"ntransferred to Campylobacter selective Agar containing defibrinated sheep blood and antibiotics. The biochemical tests were"nused for identification of isolated bacteria at species level."nResults: Three poultry samples were positive for C. jejuni."nConclusion: Alimentary tract of chickens contain high numbers of C. jejuni therefore, this bacterium can be easily found in"ntheir feces. It is recommended to use chlorinated water in birds’ feed and to perform slaughtering, skinning and evisceration"nunder aseptic conditions to prevent campylobacteriosis in human from poultry meat. None of the beef samples yielded any"nCampylobacter, this may be due to limited number of samples of beef meat analyzed in this study.

  8. 9 CFR 319.313 - Beef with gravy and gravy with beef.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Beef with gravy and gravy with beef... Dehydrated Meat Food Products § 319.313 Beef with gravy and gravy with beef. “Beef with Gravy” and “Gravy with Beef” shall not be made with beef which, in the aggregate for each lot contains more than...

  9. 7 CFR 1260.120 - Beef products.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Beef products. 1260.120 Section 1260.120 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Definitions § 1260.120 Beef products. Beef products means edible...

  10. 7 CFR 1260.119 - Beef.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Beef. 1260.119 Section 1260.119 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Definitions § 1260.119 Beef. Beef means flesh of cattle....

  11. Cooking Class: Pumpkin Beef

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    Slice the beef, mix with seasoning (1) and marinate for 10 minutes. Clean, peel and thickly slice the pumpkin. Put in a wok and fry in 2 tbsp cooking oil. Add the salt and soy sauce as per seasoning (2) plus 1/2 cup water. Bring to the boil, lower the heat and simmer for 10 minutes.

  12. Agriculture. Beef Livestock.

    Science.gov (United States)

    Michigan State Univ., East Lansing. Coll. of Agriculture and Natural Resources Education Inst.

    This task-based curriculum guide for agricultural production, specifically for beef livestock, is intended to help the teacher develop a classroom management system where students learn by doing. Introductory materials include a Dictionary of Occupational Titles job code and title sheet, a task sheet for developing leadership skills, and a task…

  13. Beef grading by ultrasound

    Science.gov (United States)

    Gammell, P. M.

    1981-01-01

    Reflections in ultrasonic A-scan signatures of beef carcasses indicate USDA grade. Since reflections from within muscle are determined primarily by fat/muscle interface, richness of signals is direct indication of degree of marbling and quality. Method replaces subjective sight and feel tests by individual graders and is applicable to grade analysis of live cattle.

  14. Creep Feeding Beef Calves

    OpenAIRE

    2005-01-01

    Creep feeding is the managerial practice of supplying supplemental feed (usually concentrates) to the nursing calf. Milk from a lactating beef cow furnishes only about 50 percent of the nutrients that a 3-4 month-old calf needs for maximum growth.

  15. Antioxidant potential of curry (Murraya koenigii L.) and mint (Mentha spicata) leaf extracts and their effect on colour and oxidative stability of raw ground pork meat during refrigeration storage.

    Science.gov (United States)

    Biswas, A K; Chatli, M K; Sahoo, J

    2012-07-15

    The aim of this study was to investigate the antioxidant activity of different solvent extracts of curry and mint leaf and their effect on colour and oxidative stability of raw ground pork meat stored at 4 ± 1°C. The results indicated that among the two individual leaf categories, the ethanol extract of curry leaf (EHEC) and the water extract of mint leaf (WEM) showed higher DPPH and ABTS(+) activity. EHEC also exhibited the highest total phenolic contents while these were the lowest for WEM. WEM showed the highest superoxide anionic scavenging activity (%). The pork meat samples treated with EHEC and WEM showed a decrease in the Hunter L- and a-values and a increase in b-value during storage at 4°C. However, the pH and TBARS values were higher in control samples irrespective of storage periods. In conclusion, EHEC and WEM have the potential to be used as natural antioxidants to minimise lipid oxidation of pork products. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. The Implementation of Indonesia’s Beef Self-Sufficiency Programme (BSSP) as Seen from a Farmer-Family Perspective

    DEFF Research Database (Denmark)

    Gayatri, Siwi; Vaarst, Mette

    2015-01-01

    Since around 1990, Indonesia had been importing about 40% of its entire beef consumption. To reduce its reliance on imports, Indonesia launched the beef selfsufficiency programme (BSSP), which operated between 2005 and 2014, with the aim being to reduce imports of beef cattle to 10% of national...... focus on the way in which the programme was implemented. The present study is based on the findings from 14 semi-structured qualitative interviews carried out with smallholder beef-cattle farmers from the Central Java Province in Indonesia. A modified grounded theory approach was used to analyze...

  17. Tapeworm infection - beef or pork

    Science.gov (United States)

    Teniasis; Pork tapeworm; Beef tapeworm; Tapeworm; Taenia saginata ; Taenia solium ; Taeniasis ... undercooked meat of infected animals. Cattle usually carry Taenia saginata ( T. saginata ). Pigs carry Taenia solium (T. ...

  18. Eating quality prediction of beef from Italian Simmental cattle based on experts' steak assessment.

    Science.gov (United States)

    Borgogno, Monica; Saccà, Elena; Corazzin, Mirco; Favotto, Saida; Bovolenta, Stefano; Piasentier, Edi

    2016-08-01

    The experiment aimed at defining a grading scheme for Italian Simmental (IS) beef linked to objective measure of eating quality. Four experts developed a meat quality grid based on the assessment of the steak between the 8th and 9th ribs (reference steak). The grid was tested on the reference steak of 29 IS young-bulls. Rib-eye dimension, meat colour, marbling, meat firmness and fat cover highly contributed to overall quality. Two classes of IS beef quality were identified: standard and high. The results were associated with the sensory profile of Longissimus thoracis muscle from the reference steaks performed by a trained panel. The differences in quality highlighted by experts in raw steak accounted for most of the relevant information regarding the sensory properties of cooked beef. The accuracy of predictive model was 96.6%. The developed scheme is a helpful tool for valuing the eating quality of beef. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Frozen storage stability of beef patties incorporated with extracts from ulam raja leaves (Cosmos caudatus).

    Science.gov (United States)

    Reihani, S F S; Tan, Thuan-Chew; Huda, Nurul; Easa, Azhar Mat

    2014-07-15

    In Malaysia, fresh ulam raja leaves (Cosmos caudatus) are eaten raw with rice. In this study, beef patties incorporated with extracts of ulam raja (UREX) and commercial green tea extract (GTE) added individually at 200 and 500 mg/kg were stored at -18°C for up to 10 weeks. Lipid oxidation, cooking yield, physicochemical properties, textural properties, proximate composition and sensory characteristics of the beef patties were compared between those incorporated with UREX, GTE and the control (pure beef patty). Incorporation of UREX or GTE at 500 mg/kg into beef patties reduced the extent of lipid oxidation significantly (P0.05) on the colour, pH, proximate composition and overall sensory acceptability of the patties.

  20. Nutrient analysis of the Beef Alternative Merchandising cuts.

    Science.gov (United States)

    Desimone, T L; Acheson, R A; Woerner, D R; Engle, T E; Douglass, L W; Belk, K E

    2013-03-01

    The objective of this study was to generate raw and cooked nutrient composition data to identify Quality Grade differences in proximate values for eight Beef Alternative Merchandising (BAM) cuts. The data generated will be used to update the nutrient data in the USDA National Nutrient Database for Standard Reference (SR). Beef Rib, Oven-Prepared, Beef Loin, Strip Loin, and Beef Loin, Top Sirloin Butt subprimals were collected from a total of 24 carcasses from four packing plants. The carcasses were a combination of USDA Yield Grades 2 (n=12) and 3 (n=12), USDA Quality Grades upper two-thirds Choice (n=8), low Choice (n=8), and Select (n=8), and two genders, steer (n=16) and heifer (n=8). After aging, subprimals were fabricated into the BAM cuts, dissected, and nutrient analysis was performed. Sample homogenates from each animal were homogenized and composited for analysis of the following: proximate analysis, long chain and trans-fatty acids, conjugated linoleic acid, total cholesterol, vitamin B-12, and selenium. This study identified seven BAM cuts from all three Quality Grades that qualify for USDA Lean; seven Select cuts that qualify for USDA Extra Lean; and three Select cuts that qualify for the American Heart Association's Heart Healthy Check.

  1. Food Safety and Raw Milk

    Science.gov (United States)

    ... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

  2. Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Sarrafzadeh Zargar

    2014-07-01

    Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.

  3. Beef Cattle: Selection and Evaluation.

    Science.gov (United States)

    Clemson Univ., SC. Vocational Education Media Center.

    Designed for secondary vocational agriculture students, this text provides an overview of selecting and evaluating beef cattle in Future Farmers of America livestock judging events. The first of four major sections addresses topics such as the ideal beef animal, selecting steers, selecting breeding animals, studying the animal systematically, and…

  4. Beef Cattle: Selection and Evaluation.

    Science.gov (United States)

    Clemson Univ., SC. Vocational Education Media Center.

    Designed for secondary vocational agriculture students, this text provides an overview of selecting and evaluating beef cattle in Future Farmers of America livestock judging events. The first of four major sections addresses topics such as the ideal beef animal, selecting steers, selecting breeding animals, studying the animal systematically, and…

  5. 7 CFR 65.110 - Beef.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Beef. 65.110 Section 65.110 Agriculture Regulations of... MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT (CONTINUED) COUNTRY OF ORIGIN LABELING OF BEEF..., AND GINSENG General Provisions Definitions § 65.110 Beef. Beef means meat produced from...

  6. 7 CFR 65.160 - Ground chicken.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground chicken. 65.160 Section 65.160 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.160 Ground chicken. Ground chicken...

  7. Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food

    DEFF Research Database (Denmark)

    Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask

    2005-01-01

    The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...

  8. Effect of citrus young fruit extract on lipid oxidation of raw ground pork during refrigerated storage%柑橘幼果提取物对猪肉冷藏过程中抗脂质氧化影响

    Institute of Scientific and Technical Information of China (English)

    张进杰; 顾伟钢; 姚燕佳; 吕兵兵; 陈健初; 叶兴乾

    2012-01-01

    The efficacy of different mass fraction of citrus young fruit extract (CE) in retarding oxidative rancidity was tested in raw ground pork during storage. Fresh ground pork meat was assigned to one of the following five processing: control (no antioxidants); AC-0.02 (0.02% ascorbic acid); CE-0.05, 0.1, and 0.2 (0.05%, 0.1% and 0.2% CE, respectively). The pH of the samples decreased and the TBARS values and free fatty acids increased considerably (p<0.05) during storage. Samples treated with CE-0.1 and CE-0.2 presented lower total bacterial count than the control samples through the whole storage. The L value and a value decreased (p<0.05) with the addition of CE. The internal b* value of CE treatments were higher (p<0.05) than that of the control one and increased incrementally with CE concentration. The TBARS value and free fatty acids of CE-0.2 treated samples were the lowest among the treatments. The peroxide value (POV) of the control increased for 6 days and reached the maximum value at a certain storage time and decreased thereafter. In other treatments, POV increased all along the storage time. All treatments had lower concentration of conjugated dienes (CD) (p<0.05) compared to the control sample after the first day. Citrus young fruits of ethanolic extract exhibitsa protective effect against lipid oxidation in raw ground pork and provides the reference for meat processing industry.%为了研究不同浓度的柑橘幼果乙醇提取物(CE)在新鲜猪肉中的抗脂质氧化和抑菌作用.在冷藏(4℃)条件下对鲜猪肉进行以下5种处理:对照组(不添加保鲜剂);AC-0.02(添加0.02%抗坏血酸);CE-0.05(添加0.05%柑橘幼果醇提物,下同),CE-0.1和CE-0.2.在12 d的冷藏(4℃)过程中,各样品的pH值均显著降低(p<0.05),而硫代巴比妥酸值(TBARS)和游离脂肪酸的含量显著增加(p<0.05).CE-0.1和CE-0.2处理组的菌落总数在贮藏过程中均低于对照组.CE的加入使猪肉样品的L*值和a*值都显著

  9. Ground roasted peanuts leads to a lower post-prandial glycemic response than raw peanuts Maní tostado y molido conduce a una menor respuesta glicémica postprandial comparado con maní crudo

    Directory of Open Access Journals (Sweden)

    C. E. G. Reis

    2011-08-01

    Full Text Available Introduction: Few studies have evaluated the effect of nuts processing on the glycemic response and satiety. Objective: To evaluate the effect of peanut processing on glycemic response, and energy and nutrients intake. Method: Thirteen healthy subjects (4 men and 9 women, with a mean age of 28.5 ± 10 years, BMI 22.7 ± 2.5 kg/m², and body fat 23.7 ± 5.7% participated in this randomized crossover clinical trial. After 10-12 h of fasting, one of the following types of test meals were consumed: raw peanuts with skin (RPS, roasted peanuts without skin, ground-roasted peanuts without skin (GRPWS or control meal. The test meals had the same nutrient composition, and were consumed with 200 ml of water in 15 minutes. Glycemic response was evaluated 2 hours after each meal. Energy and nutrients intake were assessed through diet records reflecting the habitual food intake and food consumption 24 hours after the ingestion of test meal. Result: The area under the glycemic response curve after GRPWS was lower (p = 0.02 the one obtained for RPS. There was no treatment effect on energy intake, macronutrients and fiber consumption after the test meal. Conclusion: The consumption of ground-roasted peanuts may favor the control and prevention of diabetes due to its reduction on postprandial glucose response. However, more prospective studies are needed to confirm this hypothesis.Introducción: Escasos estudios han evaluado el efecto del procesado industrial de los frutos secos sobre la respuesta glicérica y la saciedad. Objetivos: Evaluar el efecto del procesamiento de maní sobre la respuesta glicémica y la ingesta de energía y nutrientes. Métodos: Trece sujetos sanos (4 hombres y 9 mujeres, con una edad media de 28,5 ± 10 años, IMC 22,7 ± 2,5 kg/m², y un porcentaje de grasa corporal de 23,7 ± 5,7% participaron en este ensayo clínico aleatorizado y cruzado. Tras 10-12 h de ayuno uno de los siguientes tipos de comidas test fueron consumidas: man

  10. Effect of marination in gravy on the radio frequency and microwave processing properties of beef.

    Science.gov (United States)

    Basaran-Akgul, Nese; Rasco, Barbara A

    2015-02-01

    Dielectric properties (the dielectric constant (ε') and the dielectric loss factor (ε″)) and the penetration depth of raw eye of round beef Semitendinosus muscle, raw beef marinated in gravy, raw beef cooked in gravy, and gravy alone were determined as a function of the temperature (20-130 °C) and frequency (27-1,800 MHz). Both ε' and ε″ values increased as the temperature increased at low frequencies (27 and 40 MHz). At high frequencies (915 and 1,800 MHz), ε' showed a 50 % decrease while ε″ increased nearly three fold with increasing temperature in the range from 20 to 130 °C. ε' increased gradually while ε″ increased five fold when the temperature increased from 20 to 130 °C. Both ε' and ε″ of all samples decreased with increase in frequency. Marinating the beef in gravy dramatically increased the ε″ values, particularly at the lower frequencies. Power penetration depth of all samples decreased with increase temperature and frequency. These results are expected to provide useful data for modeling dielectric heating processes of marinated muscle food.

  11. Development of curry beef sausage%咖喱牛肉肠的研制

    Institute of Scientific and Technical Information of China (English)

    张国荣

    2015-01-01

    Beef was taken as the main raw material. The processing formula of curry beef sausage was studied. Through single factor experiments and orthogonal experiments, the optimum formula of curry beef sausage was defined. The result showed that the addition of starch, water, curry flavor and beef ex⁃tract was 10%, 35%, 0. 1% and 0. 3%, respectively. The curry beef sausage with smooth surface, high flexibility, compact texture, integrated slice, delicate taste, moderate salinity and full curry beef flavor was obtained.%以牛肉为主要原料,研究了咖喱牛肉肠的制作工艺配方。通过单因素试验和L9(34)正交试验,确定出咖喱牛肉肠的最佳工艺配方:淀粉添加量为10%,水添加量为35%,咖喱香精添加量为0.1%,牛肉膏添加量为0.3%。制出的肠体表面光滑,富有弹性,组织致密,切片光滑平整,切面呈棕黄色,口感细腻嫩滑,咸淡适中,具有饱满的咖喱牛肉香味。

  12. 9 CFR 319.142 - Fresh beef sausage.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Fresh beef sausage. 319.142 Section... Sausage § 319.142 Fresh beef sausage. “Fresh Beef Sausage” is sausage prepared with fresh beef or frozen beef, or both, but not including beef byproducts, and may contain Mechanically Separated (Species)...

  13. Beef Consumption, Supply and Trade in Korea

    OpenAIRE

    Choi, Jung-Sup; Zhou, Zhang-Yue; Cox, Rodney J.

    2002-01-01

    Until recently the Korean beef market was heavily protected. However, since the beginning of 2001 there have been significant changes to beef import arrangements and their distribution channels, and the protection in the beef market has fallen. In January 2001 beef import quotas were lifted and replaced by an import tariff. The dual retail system – where domestic and imported beef are sold separately – was abolished in September 2001, and now domestic and imported beef can be sold in the ...

  14. BIODIESEL DARI CAMPURAN LEMAK SAPI (Beef Tallow DAN MINYAK SAWIT

    Directory of Open Access Journals (Sweden)

    Wara Dyah Pita Rengga

    2013-05-01

    Full Text Available Cadangan minyak bumi semakin menipis, sehingga dicari bahan bakar alternatif, salah satunya adalah biodiesel. Minyak nabati terutama minyak sawit merupakan bahan baku edible sedangkan lemak sapi merupakan bahan baku non-edible dengan biaya rendah dan memiliki ketersediaan tinggi pada produksi sapi. Pemanfaatan lemak sapi yang belum maksimal dapat digunakan bersama minyak sawit untuk menghasilkan biodiesel. Lemak sapi dicairkan supaya menjadi minyak sapi. Bahan baku minyak sapi dan minyak sawit dicampur dengan perban-dingan 3:1. Campuran minyak ditransesterifikasi dengan metanol dengan perbandingan molar (1:6 dan katalis NaOH. Proses dilakukan selama 90 menit pada suhu ±65°C. Hasil proses transesterifikasi adalah metil ester dan gliserol. Metil ester pada lapisan atas dipisahkan dari gliserol kemudian dilakukan pencucian. Metil ester atau biodiesel selanjutnya diuji angka asam, viskositas, densitas, dan analisis menggunakan GC-MS. Yield biodiesel yang dihasilkan dari campuran minyak sapi dan minyak sawit adalah 76%, angka asam 0,67124 mg-KOH/g, densitas 857,76 kg/cm³, dan viskositas 3,0074 mm2/s. Kesemua parameter tersebut sesuai dengan standart mutu SNI biodiesel. Kandungan metil ester dari minyak sawit dan lemak sapi adalah metiloleat dan metil palmitat. The availability of the fossil fuel is decreasing; hence the finding of an alternative fuels is very important. One of those alternative fuels is biodiesel. Vegetable oil, especially palm oil is the edible raw material, while the beef tallow is the non-edible raw material with low cost production and the availability is huge in the cattle production. The beef tallow mixed with palm oil can be used as raw material for producing biodiesel. Firstly, the beef tallow was melted into beef oil. The raw materials of beef tallow and palm oil were mixed with the composition ratio of 3:1. The resulted mixed-oil was transesterificated by adding methanol with molar ratio of 1:6 and NaOH as

  15. Dry aging of beef; Review

    OpenAIRE

    Dashdorj, Dashmaa; Tripathi, Vinay Kumar; Cho, Soohyun; Kim, Younghoon; Hwang, Inho

    2016-01-01

    The present review has mainly focused on the specific parameters including aging (aging days, temperature, relative humidity, and air flow), eating quality (flavor, tenderness and juiciness), microbiological quality and economic (shrinkage, retail yields and cost) involved beef dry aging process. Dry aging is the process where beef carcasses or primal cuts are hanged and aged for 28 to 55 d under controlling environment conditions in a refrigerated room with 0° to 4 °C and with relative humid...

  16. Dry aging of beef; Review.

    Science.gov (United States)

    Dashdorj, Dashmaa; Tripathi, Vinay Kumar; Cho, Soohyun; Kim, Younghoon; Hwang, Inho

    2016-01-01

    The present review has mainly focused on the specific parameters including aging (aging days, temperature, relative humidity, and air flow), eating quality (flavor, tenderness and juiciness), microbiological quality and economic (shrinkage, retail yields and cost) involved beef dry aging process. Dry aging is the process where beef carcasses or primal cuts are hanged and aged for 28 to 55 d under controlling environment conditions in a refrigerated room with 0° to 4 °C and with relative humidity of 75 to 80 %. However there are various opinions on dry aging procedures and purveyors of such products are passionate about their programs. Recently, there has been an increased interest in dry aging process by a wider array of purveyors and retailers in the many countries. Dry aging process is very costly because of high aging shrinkage (6 to15 %), trims loss (3 to 24 %), risk of contamination and the requirement of highest grades meat with. The packaging in highly moisture-permeable bag may positively impact on safety, quality and shelf stability of dry aged beef. The key effect of dry aging is the concentration of the flavor that can only be described as "dry-aged beef". But the contribution of flavor compounds of proteolysis and lipolysis to the cooked dry aged beef flavor is not fully known. Also there are limited scientific studies of aging parameters on the quality and palatability of dry aged beef.

  17. 9 CFR 319.102 - Corned beef round and other corned beef cuts.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Corned beef round and other corned beef cuts. 319.102 Section 319.102 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE... Meats, Unsmoked and Smoked § 319.102 Corned beef round and other corned beef cuts. In preparing...

  18. Enumeration of Escherichia coli O157:H7 in Outbreak-Associated Beef Patties.

    Science.gov (United States)

    Gill, Alexander; Huszczynski, George

    2016-07-01

    An outbreak of five cases of Escherichia coli O157 infection that occurred in Canada in 2012 was linked to frozen beef patties seasoned with garlic and peppercorn. Unopened retail packs of beef patties from the implicated production lot were recovered and analyzed to enumerate E. coli O157, other E. coli strains, and total coliforms. E. coli O157 was not recovered by direct enumeration on selective agar media. E. coli O157 in the samples was estimated at 3.1 most probable number per 140 g of beef patty, other E. coli was 11 CFU/g, and coliforms were 120 CFU/g. These results indicate that the presence of E. coli O157 in ground beef at levels below 0.1 CFU/g may cause outbreaks. However, the roles of temperature abuse, undercooking, and crosscontamination in amplifying the risk are unknown.

  19. Beef labelling: The Emergence of Transparancy

    NARCIS (Netherlands)

    Dorp, van C.A.

    2003-01-01

    Prior to the Bovine Spongiform Encephalopathy (BSE) crisis, detailed information on beef products seemed no real necessity. However, following the outbreak of BSE, the Government felt obliged to protect consumer interest with legislation. Obligatory product information became required for beef

  20. Microwave-assisted enzymatic synthesis of beef tallow biodiesel.

    Science.gov (United States)

    Rós, Patrícia C M Da; Castro, Heizir F de; Carvalho, Ana K F; Soares, Cleide M F; Moraes, Flavio F de; Zanin, Gisella M

    2012-04-01

    Optimal conditions for the microwave-assisted enzymatic synthesis of biodiesel have been developed by a full 2² factorial design leading to a set of seven runs with different combinations of molar ratio and temperature. The main goal was to reduce the reaction time preliminarily established by a process of conventional heating. Reactions yielding biodiesel, in which beef tallow and ethanol used as raw materials were catalyzed by lipase from Burkholderia cepacia immobilized on silica-PVA and microwave irradiations within the range of 8-15 W were performed to reach the reaction temperature. Under optimized conditions (1:6 molar ratio of beef tallow to ethanol molar ratio at 50°C) almost total conversion of the fatty acid presented in the original beef tallow was converted into ethyl esters in a reaction that required 8 h, i.e., a productivity of about 92 mg ethyl esters g⁻¹ h⁻¹. This represents an increase of sixfold for the process carried out under conventional heating. In general, the process promises low energy demand and higher biodiesel productivity. The microwave assistance speeds up the enzyme catalyzed reactions, decreases the destructive effects on the enzyme of the operational conditions such as, higher temperature, stability, and specificity to its substrate, and allows the entire reaction medium to be heated uniformly.

  1. Nutrient Composition of Retail Samples of Australian Beef Sausages.

    Science.gov (United States)

    Cunningham, Judy; Nguyen, Van; Adorno, Paul; Droulez, Veronique

    2015-11-19

    Some nutrient data for beef sausages in Australia's food composition table, NUTTAB 2010, is over 25 years old and may no longer reflect the composition of this popular food. To update this, 41 retail samples of fresh beef sausages were purchased in Melbourne, Australia, in May 2015. Each purchase was analysed, uncooked, for moisture, protein and fat. Sausages were then grouped by fat content into one of three composites and analysed for a wide range of nutrients, before and after dry heat cooking, the most popular sausage cooking method. Fat content in raw sausages averaged 14.9 g/100 g, 30% lower than NUTTAB values, varying from 7.3 to 22.6 g/100 g. This indicates it is possible to formulate leaner sausages that meet consumer expectations and may qualify for certain nutrition labelling statements. Under current Australian labelling requirements, two low fat sausages contain sufficient protein, B12, niacin, phosphorus and zinc to qualify as a good source of these nutrients and sufficient iron, selenium and vitamin A to qualify as a source of these. Sodium levels are higher than fresh beef, ranging from 680 to 840 mg/100 g. These data will be used to update NUTTAB and support product labelling and consumer education.

  2. 9 CFR 319.100 - Corned beef.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Corned beef. 319.100 Section 319.100... Corned beef. “Corned Beef” shall be prepared from beef briskets, navels, clods, middle ribs, rounds... A or Subchapter B. Canned product labeled “Corned Beef” shall be prepared so that the weight of...

  3. Minerals Concentration and Textural Properties of Romanian Beef Row and Cooked Meat and Offal

    Directory of Open Access Journals (Sweden)

    Liliana Tudoreanu

    2013-11-01

    Full Text Available Introduction: Consumers preferences for solid food are, for the majority of foods groups, influenced by their textural properties. Romanian traditional cuisine is rich in meat foods and therefore this food group has an important contribution to the total mineral intake as well as the ingestion of potentially toxic metals such as Cd and Pb. Although beef liver is an important source of minerals for human consumption, its concentrations in Cd and Pb and heterogeneous textural properties may hinder its acceptability. Aims: The purpose of the work was to estimate raw and cooked beef meat and offal mineral quality including Cd and Pb concentrations and their contribution to a balanced human diet and health  as well as the influenced of thermal preparation on their mineral and textural properties. Materials and methods:  Beef liver, kidney and longissimus dorsi muscle were bought from local markets. Thermal preparation was conducted by microwave and boiling with no water contact. Texture profile analyses was conducted for quantifying textural properties such as  Hardness, Cohesiveness, Springiness, Springiness Index, Chewiness, Adhesiveness and Stiffness. The mineral concentrations of the raw and cooked samples were analyzed by ICP-MS. Conclusion: The offal textural parameters variability was very large within the same organ and compared to the muscle textural parameters variability too. Muscle and offal thermal preparation strongly influenced their minerals’ concentrations as well as their textural properties. Thermal preparation significantly decreased beef liver and kidney samples’ total K and Na concentrations. It is suggested that for improving beef liver acceptability, the consumer has to be advised on the influence of the thermal preparation on beef liver parts’ textural properties as well as minerals concentrations.

  4. SAR Raw Data Generation for Complex Airport Scenes

    Directory of Open Access Journals (Sweden)

    Jia Li

    2014-10-01

    Full Text Available The method of generating the SAR raw data of complex airport scenes is studied in this paper. A formulation of the SAR raw signal model of airport scenes is given. Via generating the echoes from the background, aircrafts and buildings, respectively, the SAR raw data of the unified SAR imaging geometry is obtained from their vector additions. The multipath scattering and the shadowing between the background and different ground covers of standing airplanes and buildings are analyzed. Based on the scattering characteristics, coupling scattering models and SAR raw data models of different targets are given, respectively. A procedure is given to generate the SAR raw data of airport scenes. The SAR images from the simulated raw data demonstrate the validity of the proposed method.

  5. European beef consumers' interest in a beef eating-quality guarantee

    DEFF Research Database (Denmark)

    Verbeke, Wim; Van Wezemael, Lyn; de Barcellos, Marcia Dutra

    2010-01-01

    . The development of a beef quality grading and guarantee system, backed up by objective knowledge that is obtained through muscle profiling research, can allow the beef industry to meet these consumer demands. A qualitative consumer study has been carried out with beef consumers in France, Spain, United Kingdom...... and Germany to assess their opinions about beef muscle profiling and their interest in a beef eating-quality guarantee. Findings indicate that both concepts are well accepted by European beef consumers, although not unconditional. Besides acknowledging the opportunity to purchase beef with guaranteed......Consumer demand in relation to food is increasingly shifting towards products that are safe, nutritious, and of good eating quality. Beef consumers are demanding for experience quality that matches their quality expectations formed prior to consumption, particularly with respect to beef tenderness...

  6. The Effect of Repeated Heating on Fatty Acid Profile of Beef and Spices of Rendang

    Directory of Open Access Journals (Sweden)

    Rina Yenrina

    2015-03-01

    Full Text Available Rendang is a traditional Minangkabau cuisine with the main ingredient of beef or buffalo meat which is cooked using coconut milk and some spices. Rendang is cooked more than 2 hours, and after that do the repeated heating. This study aimed to determine the effect of repeated heating on fatty acid profiles of beef and spices of rendang. The analysis carried out at Chemistry Lab. and Biochemistry Lab. In  Fateta Unand and Integrated Lab in IPB Bogor. This  study   designed  used a completely  randomized  design  with 5 treatments and 3 replications.  The treatments that used in this study were A (raw beef, B (freshly cooked rendang, C (first heating, D (second heating, E (third heating where the heating was done every 2 days. Data were collected for  fatty acids profile of beef and spices of rendang. Analysis of the Type of  Fatty Acid by HPLC method (AOAC, 1984. The results shown that repeated heating of beef and spice of rendang had significantly different effect on the type of fatty acids and an increased trans fatty Acid of rendang.

  7. Prevalence and Antibiotic Susceptibility of Campylobacter species Isolated From Chicken and Beef Meat

    Directory of Open Access Journals (Sweden)

    Hossein Dabiri

    2014-05-01

    Full Text Available Background: To study prevalence of Campylobacter spp. in chicken and beef meat, and determine the drug susceptibility of strains, 450 samples in Tehran, Iran were investigated. Objectives: This study aimed to determine the prevalence and the antimicrobial resistance of entropathogenic Campylobacter strains ,especially C. jejuni isolated from raw chicken and beef meat in Tehran- Iran. Materials and Methods: Out of 250 chickens and 200 beef meats, 121(26.8 % contaminated cases with Campylobacter strains were isolated. Campylobacter was isolated from a significantly larger number of chickens (44% than beef meats (5.5 % (P < 0.05. Results: From all isolated Campylobacter organisms, 93 (76.8% species were identified as C. jejuni and 28 cases (23.1% as C. coli. Susceptibilities of 121 strains (93 C. jejuni and 28 C. coli were determined against 12 antimicrobial drugs using the disk agar diffusion method. Resistance to nalidixic acid (75% and ciprofloxacin (50% was an alarming finding, moreover, 32.6% of isolates was resistant to tetracycline, 10.8% to ampicillin, 29.3% to colisitin and 26.1% to amoxicillin. The highest sensitivity was seen to erythromycin (95 % and gentamicin (96%. Conclusions: These results showed that a high proportion of chicken and beef meat in Iran is contaminated with Campylobacter, particularly with Campylobacter jejuni. The high rate of contamination, especially chicken is a significant public health concern. Most of the isolates were resistant; therefore, human infection with Campylobacter spp. via consumption of these products is possible.

  8. Dangerous Raw Oysters

    Centers for Disease Control (CDC) Podcasts

    2013-08-05

    Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters.  Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/7/2013.

  9. 9 CFR 319.103 - Cured beef tongue.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Cured beef tongue. 319.103 Section 319... Cured beef tongue. In preparing “Cured Beef Tongue,” the application of curing solution to the fresh beef tongue shall not result in an increase in the weight of the cured beef tongue of more than...

  10. Environmental impacts of beef production

    NARCIS (Netherlands)

    Gerber, P.J.; Mottet, Anne; Opio, C.I.; Falcucci, Alessandra; Teillard, Félix

    2015-01-01

    Beef makes a substantial contribution to food security, providing protein, energy and also essential micro-nutrients to human populations. Rumination allows cattle - and other ruminant species - to digest fibrous feeds that cannot be directly consumed by humans and thus to make a net positive con

  11. Environmental impacts of beef production

    NARCIS (Netherlands)

    Gerber, P.J.; Mottet, Anne; Opio, C.I.; Falcucci, Alessandra; Teillard, Félix

    2015-01-01

    Beef makes a substantial contribution to food security, providing protein, energy and also essential micro-nutrients to human populations. Rumination allows cattle - and other ruminant species - to digest fibrous feeds that cannot be directly consumed by humans and thus to make a net positive

  12. U.S. Food Safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: analysis of set results.

    Science.gov (United States)

    Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.

  13. Genetic and ageing effects on beef quality

    OpenAIRE

    Li, Xin

    2013-01-01

    The overall aim of this thesis was to investigate genetic and ageing effects on beef quality. To study the genetic effects, association analyses were carried out between single nucleotide polymorphisms (SNPs) at DGAT1, LEP, SCD1, CAPN1 and CAST genes with colour, marbling, water holding capacity (WHC) and tenderness in meat from young bulls of the beef cattle population in Sweden. In total 243 young bulls from five beef breeds were included in the analysis. The results confirmed previous...

  14. Low complexity efficient raw SAR data compression

    Science.gov (United States)

    Rane, Shantanu; Boufounos, Petros; Vetro, Anthony; Okada, Yu

    2011-06-01

    We present a low-complexity method for compression of raw Synthetic Aperture Radar (SAR) data. Raw SAR data is typically acquired using a satellite or airborne platform without sufficient computational capabilities to process the data and generate a SAR image on-board. Hence, the raw data needs to be compressed and transmitted to the ground station, where SAR image formation can be carried out. To perform low-complexity compression, our method uses 1-dimensional transforms, followed by quantization and entropy coding. In contrast to previous approaches, which send uncompressed or Huffman-coded bits, we achieve more efficient entropy coding using an arithmetic coder that responds to a continuously updated probability distribution. We present experimental results on compression of raw Ku-SAR data. In those we evaluate the effect of the length of the transform on compression performance and demonstrate the advantages of the proposed framework over a state-of-the-art low complexity scheme called Block Adaptive Quantization (BAQ).

  15. Pragmatics of Raw Art

    DEFF Research Database (Denmark)

    Wilson, Alexander

    2014-01-01

    . The concepts of raw art and outsider art were typical of a time when oppositional politics still infused artistic and academic discourses. But modernity seems to have ‘grown out’ of its adolescence, so to speak: out of politics of opposition and absolutes. Of course, it is neither desirable nor possible...... to return to the oppositional dynamics and binary divisions of yesterday, now that we have crossed this paradigmatic threshold. But the schizoanalytic stance may offer us another view of the emerging paradigm. It affords different tools of interpretation and suggests ways artists may grow out of modernity...

  16. Potential application of the electronic nose for shelf-life determination of raw milk and red meat

    Science.gov (United States)

    Amari, Aziz; El Barbri, Noureddine; El Bari, Nezha; Llobet, Eduard; Correig, Xavier; Bouchikhi, Benachir

    2009-05-01

    The present study describes the performance of an electronic nose in food odor analysis. This methodology was successfully applied to odor characterization of milk stored at 4° C during 4 days and of beef and sheep meat stored at 4° C for up to 15 days. The electronic nose sensor system coupled to PCA as a pattern recognition technique, is able to reveal characteristic changes in raw milk and red meat quality related to storage time. Additionally, a bacteriological method was selected as the reference method to consistently train the electronic nose system for both beef and sheep meat analysis.

  17. An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.

    Science.gov (United States)

    Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar

    2016-11-01

    Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.

  18. Noni puree (Morinda citrifolia) mixed in beef patties enhanced color stability.

    Science.gov (United States)

    Tapp, W Nathan; Yancey, Janeal W S; Apple, Jason K; Dikeman, Michael E; Godbee, Richard G

    2012-06-01

    Ground beef, mixed with 0, 2, 4, and 6% Noni puree, was formed into 150-g patties, aerobically packaged, and displayed in retail for 5d. After 2 and 3d, patties with higher concentrations of Noni were perceived as redder and less discolored (P<0.05) by visual panelists. Noni patties were found to have greater (P<0.05) a* values than controls, even though all patties became less red during display. After 3 and 5d of retail display, patties with higher concentrations of Noni puree also had lower TBARS (were less oxidized; P<0.05). In fresh taste panels, panelists perceived the patties to have less beef flavor and greater incidence of off-flavors (P<0.05) as Noni puree concentration increased. The potential of Noni puree to improve the color stability and shelf life of fresh ground beef is very promising, but the flavors produced by the addition of Noni in ground beef may be detrimental to its use.

  19. High Sierra Beef Progress Update

    OpenAIRE

    Ingram, Roger

    2004-01-01

    Research similar efforts in other regions Research was completed on similar efforts in other regions. There are over 300 grass-fed beef marketing operations across the United States. Here in California, there are approximately 10. Most are selling approximately 50-60 head per year. This appears to be a marketing limit for those who produce, process, market and distribute on their own. Additional labor and space requirements for marketing, storage for dry-aging, and distribution appea...

  20. Beef healthiness and nutritional enhancement in beef as perceived by European consumers

    DEFF Research Database (Denmark)

    de Barcellos, Marcia Dutra; Kügler, Jens Oliver; van Wezemael, Lynn

    enhancement in beef as perceived by European consumers. The research is under the scope of ProSafeBeef project - Pillar 5 Consumer Issues: Safety and New Products. Pillar 5 will focus on assessing consumer expectations with respect to beef safety, healthiness and on consumer acceptance of new technologies...... or certifications, and brands) attributes or cues. Most consumers considered lean and "natural" beef to be the healthiest type: the more processed beef is, the less healthy it is believed to be. In the eyes of European consumers, healthiness also depends on how animals were fed and kept, how the meat was processed...... of excess fat and connective tissues was rejected by the most of the focus group participants. For most respondents, the government (both national and European) should be responsible for beef healthiness. The role if industry is to improve beef healthiness, in particular through its research branches...

  1. Staphylococcus aureus is More Prevalent in Retail Beef Livers than in Pork and other Beef Cuts

    Directory of Open Access Journals (Sweden)

    Lubna S. Abdalrahman

    2015-04-01

    Full Text Available Staphylococcus aureus is one of the top five pathogens contributing to acquired foodborne illnesses causing an estimated quarter million cases every year in the US. The objectives of this study were to determine the prevalence of Methicillin Susceptible S. aureus (MSSA and Methicillin Resistant S. aureus (MRSA in retail beef livers, beef, and pork meats sold in Tulsa, Oklahoma and to characterize the recovered strains for their virulence and antimicrobial resistance. Ninety six chilled retail beef (50 beef livers and 46 beef other cuts, and 99 pork meat samples were collected. The prevalence in beef livers was 40/50 (80% followed by other beef cuts 23/46 (50% then pork 43/99 (43.3%. No isolates were positive for MRSA since none harbored the mecA or mecC gene. A total of 334 recovered S. aureus isolates (143 beef livers, 76 beef, and 115 pork isolates were screened for their antimicrobial susceptibility against 16 different antimicrobials and their possession of 18 different toxin genes. Multidrug resistance was more prevalent in the pork isolates followed by beef then beef livers. The prevalence of enterotoxin genes such as seg, seh, and sei and the toxic shock syndrome gene tst was higher in the pork isolates than in the beef ones. The hemolysin genes, particularly hlb, were more prevalent in isolates from beef livers. Molecular typing of a subset of the recovered isolates showed that they are highly diverse where spa typing was more discriminatory than PFGE. The alarmingly high incidence of S. aureus in retail beef livers in this study should raise awareness about the food safety of such meat products.

  2. Decarboxylase gene expression and cadaverine and putrescine production by Serratia proteamaculans in vitro and in beef.

    Science.gov (United States)

    De Filippis, Francesca; Pennacchia, Carmela; Di Pasqua, Rosangela; Fiore, Alberto; Fogliano, Vincenzo; Villani, Francesco; Ercolini, Danilo

    2013-08-01

    Studies of the molecular basis of microbial metabolic activities that are important for the changes in food quality are valuable in order to help in understanding the behavior of spoiling bacteria in food. The growth of a psychrotrophic Serratia proteamaculans strain was monitored in vitro and in artificially inoculated raw beef. Two growth temperatures (25°C and 4°C) were tested in vitro, while growth at 15°C and 4°C was monitored in beef. During growth, the expression of inducible lysine and ornithine-decarboxylase genes was evaluated by quantitative reverse transcription-PCR (qRT-PCR), while the presence of cadaverine and putrescine was quantified by LC-ESI-MS/MS. The expression of the decarboxylase genes, and the consequent production of cadaverine and putrescine were shown to be influenced by the temperature, as well as by the complexity of the growth medium. Generally, the maximum gene expression and amine production took place during the exponential and early stationary phase, respectively. In addition, lower temperatures caused slower growth and gene downregulation. Higher amounts of cadaverine compared to putrescine were found during growth in beef with the highest concentrations corresponding to microbial loads of ca. 9CFU/g. The differences found in gene expression evaluated in vitro and in beef suggested that such activities are more reliably investigated in situ in specific food matrices.

  3. Authentication of beef versus horse meat using 60 MHz 1H NMR spectroscopy.

    Science.gov (United States)

    Jakes, W; Gerdova, A; Defernez, M; Watson, A D; McCallum, C; Limer, E; Colquhoun, I J; Williamson, D C; Kemsley, E K

    2015-05-15

    This work reports a candidate screening protocol to distinguish beef from horse meat based upon comparison of triglyceride signatures obtained by 60 MHz (1)H NMR spectroscopy. Using a simple chloroform-based extraction, we obtained classic low-field triglyceride spectra from typically a 10 min acquisition time. Peak integration was sufficient to differentiate samples of fresh beef (76 extractions) and horse (62 extractions) using Naïve Bayes classification. Principal component analysis gave a two-dimensional "authentic" beef region (p=0.001) against which further spectra could be compared. This model was challenged using a subset of 23 freeze-thawed training samples. The outcomes indicated that storing samples by freezing does not adversely affect the analysis. Of a further collection of extractions from previously unseen samples, 90/91 beef spectra were classified as authentic, and 16/16 horse spectra as non-authentic. We conclude that 60 MHz (1)H NMR represents a feasible high-throughput approach for screening raw meat.

  4. People on the Farm: Raising Beef Cattle.

    Science.gov (United States)

    Crain, Robert L.

    This booklet provides information on raising beef cattle through profiles of two families, the Ritschards of Colorado and the Schuttes of Missouri. Through descriptions of daily life for these families, the booklet discusses the way of life on modern beef cattle farms and the problems and decisions faced by farmers. The booklet explains how…

  5. Antimicrobial resistance issues in beef production

    Science.gov (United States)

    Antimicrobial resistance threats to human health as identified have been recognized as a critical global public health concern. Linkage of some threats to beef production is discussed. The relevance to beef production of recent government actions will be examined. Prominent antimicrobial resistance ...

  6. Contaminación de carne molida con cepas de Escherichia coli shigatoxigénico (STEC provenientes de comercios minoristas de San Martín, Buenos Aires, categorizados según nivel socioeconómico Contamination of Shiga toxin-producing Escherichia coli (STEC in fresh ground beef from butcher shops in San Martin, Buenos Aires Province, among different socioeconomic strata

    Directory of Open Access Journals (Sweden)

    L Miccio

    2011-06-01

    Full Text Available Escherichia coli shigatoxigénico (STEC produce enfermedades de transmisión alimentaria, desde diarreas leves a Síndrome Urémico Hemolítico, enfermedad de impacto en Argentina. Dentro de los alimentos implicados se destaca la carne bovina insuficientemente cocida. La contaminación de la carne molida y su relación con los estratos socioeconómicos no ha sido estudiada. El objetivo de este trabajo fue identificar en muestras de carne cepas STEC y establecer su perfil de virulencia, considerando la zona socioeconómica de procedencia y la persistencia de la contaminación en el local de venta. Se seleccionó el 30% de las bocas de expendio habilitadas en cada nivel socioeconómico. Se analizaron 72 muestras provenientes de 36 carnicerías de San Martín, Buenos Aires, en dos muestreos independientes utilizando PCR múltiple para stx1/stx2 e inmunocaptura para O157 al tamizaje. Se obtuvieron 11 cepas de 26 muestras sospechosas, 7% de los aislamientos fueron STEC O157. La proporción en la contaminación ponderada fue mayor en las zonas media y baja. No se comprobó persistencia. El grado de contaminación por STEC en carne para el área estudiada fue elevado y las cepas aisladas fueron altamente virulentas. En consideración a ello es necesario implementar programas de capacitación y control para reducir los riesgos para la salud pública.Shiga toxin-producing Escherichia coli (STEC causes foodborne diseases, from mild diarrhea to hemolytic uremic syndrome which impact in Argentina. Many human infections were acquired from eating undercooked contaminated beef. The contamination of ground beef and their relation to socio-economic strata has not been studied. The aim of this study was to identify STEC in meat samples and establish virulence profile, considering the socio-economic area of origin and persistence of contamination in local sales. It was selected 30% of the butcher shop of each socioeconomic level. It was analyzed 72 samples from 36

  7. 76 FR 18422 - Beef Promotion and Research; Reapportionment

    Science.gov (United States)

    2011-04-04

    ... Agricultural Marketing Service 7 CFR Part 1260 Beef Promotion and Research; Reapportionment AGENCY... representation on the Cattlemen's Beef Promotion and Research Board (Board), established under the Beef Promotion and Research Act of 1985 (Act), to reflect changes in cattle inventories and cattle and beef...

  8. 9 CFR 319.303 - Corned beef hash.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Corned beef hash. 319.303 Section 319... Products § 319.303 Corned beef hash. (a) “Corned Beef Hash” is the semi-solid food product in the form of a compact mass which is prepared with beef, potatoes, curing agents, seasonings, and any of the...

  9. 7 CFR 1260.115 - Qualified State beef council.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Qualified State beef council. 1260.115 Section 1260... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Definitions § 1260.115 Qualified State beef...

  10. The North Dakota Beef Industry Survey: Implications for Extension

    Science.gov (United States)

    Dahlen, Carl R.; Hadrich, Joleen C.; Lardy, Gregory P.

    2014-01-01

    A portion of the North Dakota Beef Industry Survey was developed to determine how educational programs can evolve to meet future needs of North Dakota beef producers. Of the 2,500 surveys mailed out to beef producers, 527 responses were completed and returned. Results highlight the level of education of North Dakota beef producers, anticipated use…

  11. Introduction to Beef Production. Instructor Guide [and] Student Reference.

    Science.gov (United States)

    Duncan, Kevin

    This packet contains an instructor guide and student reference for a course in introduction to beef production. The curriculum contains the following seven lessons: (1) introduction to the beef industry; (2) breeds of beef cattle; (3) principles of beef cattle selection; (4) production systems; (5) herd health; (6) herd management; and (7)…

  12. 9 CFR 319.101 - Corned beef brisket.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Corned beef brisket. 319.101 Section... Smoked § 319.101 Corned beef brisket. In preparing “Corned Beef Brisket,” the application of curing solution to the beef brisket shall not result in an increase in the weight of the finished cured product...

  13. 76 FR 42012 - Beef Promotion and Research; Reapportionment

    Science.gov (United States)

    2011-07-18

    ... Agricultural Marketing Service 7 CFR Part 1260 Beef Promotion and Research; Reapportionment AGENCY... the Cattlemen's Beef Promotion and Research Board (Board), established under the Beef Promotion and Research Act of 1985 (Act), to reflect changes in cattle inventories and cattle and beef imports that...

  14. European consumers' acceptance of beef processing technologies

    DEFF Research Database (Denmark)

    de Barcellos, Marcia Dutra; Kügler, Jens Oliver; Grunert, Klaus G.

    2010-01-01

    The use of new technologies in beef production chains may affect consumers' opinion of meat products. A qualitative study was performed to investigate consumers' acceptance of seven beef processing technologies: marinating by injection aiming for increased 1) healthiness; 2) safety; and 3) eating...... adults (19-60 years old) participated in eight focus groups in Spain, France, Germany and the UK. Results suggested a relationship between acceptance of new beef products, technology familiarity and perceived risks related to its application. Excessive manipulation and fear of moving away from 'natural......' beef were considered negative outcomes of technological innovations. Beef processing technologies were predominantly perceived as valuable options for convenience shoppers and less demanding consumers. Overall, respondents supported the development of 'non-invasive' technologies that were able...

  15. MOET Utility in Beef Production Strategies

    Directory of Open Access Journals (Sweden)

    Marcel Theodor Paraschivescu

    2012-10-01

    Full Text Available The paper presents the reason of beef production for human food security and the necessity of special dairy and beefbreeds in order to balance the milk and the meat production in cattle farming. That is a difficult target for manycountries since they don’t dispose of large natural pastures to extensively feed the beef cattle herds. At the same timemany European countries breed only dual purpose cattle breeds. So the idea of intensive farming with beef breeds orcrosses is developed. To speed up this kind of programs Open MOET (Multiple Ovulation Embryo Transfer Farmtechnology is proposed and it is completed with the needed facilities for production and preservation of embryos.Concerning the MOET Farm which confers directly pure bred beef calves, emphases is put on veterinary quarantineand heifer receptors conditioning. Concerning embryo conservation the direct transfer (DT technique isrecommended. Modalities of integrating dairy farms and beef cattle farms are finally discussed as recommendedstrategy for Romanian Agriculture.

  16. QUALITY MANAGEMENT IN ECOLOGICAL BEEF PRODUCTION

    Directory of Open Access Journals (Sweden)

    Cornelia Petroman

    2012-09-01

    Full Text Available Producing high quality beef asks for the implementation of a performing management of raising cattle ecologically. The main ways of improving beef quality management have a technical nature: sustaina ble grazing management to conserve floral diversity and to obtain ecological beef and rational distribution of the cattle over the grassland to facilitate vegetation recovery and to avoid the setting of invasive species. Implementing a sustainable manageme nt of the resources in the neighborhood of animal farms has beneficial effects on beef quality, brings good economic income through the practice of best beef quality management, protects the environment long - term, and reduces infrastructure expenses thus a voiding the risks of meat contamination.

  17. Development of chitosan-nanoparticle film based materials for controlled quality of minced beef during refrigerated storage

    Science.gov (United States)

    Erdawati

    2010-10-01

    Chitosan nanoparticles were prepared based on the ionic gelation of chitosan with tripolyphosphate anions. The physicochemical properties of the chitosan nanoparticles were determined by FTIR analysis, XRD pattern and TEM. The effects of chitosan nanoparticles treatment on the shelf-life extension of minced beef stored at 20±1° C were studied, including chemical and microbiological,. Results indicated that chitosan nanoparticle treatment reduced the total microbial load of fresh minced beef about 10-fold (from 3.2×104 CFU/g to 5.4×102 CFU/g) before storage and the microbial flora was different with that of raw samples. The wide-spectrum antibacterial property of chitosan against bacteria isolated from minced beef was confirmed, and chitosan concentration of 400 ppm was eventually determined for application in minced beef. Based on microbiological analysis, biochemical indices determination and sensory evaluation, shelf-lives of 2-3 days for control, 4-5 days for nanoparticle chitosan treatment samples, were observed, indicating that chitosan nanoparticle have a great potential for minced beef preservation.

  18. Anti-Toxoplasma gondii antibodies in beef cattle slaughtered in the metropolitan region of Belém, Brazilian Amazon

    Directory of Open Access Journals (Sweden)

    Ediclei Lima do Carmo

    Full Text Available Abstract The relevance of consuming raw or undercooked beef in the transmission of toxoplasmosis is unclear due to the high resistance of cattle to infection. However, this possibility needs to be considered in endemic areas, such as the Amazon, where the consumption of beef is frequent. The objective of this study was to determine the frequency of anti-Toxoplasma gondii IgG antibodies in beef cattle slaughtered in the metropolitan region of Belem, Pará state, Brazil. Blood samples were collected from 500 animals of both genders in a licensed slaughterhouse in Belém. Anti-T. gondii IgG antibodies were detected by an indirect immunofluorescence assay (IFA with a cut-off titer of 1:64. Anti-T. gondii antibodies were found in 203 animals (40.6%, with a titer of 64 in 112 animals (55.2%, 128 in 68 animals (33.5%, 256 in 15 animals (7.4%, 512 in 5 animals (2.5%, and 1,024 in 3 animals (1.4%. No significant difference was observed between males and females (p > 0.05. The high frequency of anti-T. gondii antibodies observed in beef cattle slaughtered in Belém indicates that the meat of these animals may be an important source of infection for humans and carnivorous domestic animals when inadequately cooked beef is consumed.

  19. Brand Premiums in the U.S. Beef Industry

    OpenAIRE

    Martinez, Stephen W.

    2011-01-01

    The U.S. beef industry has experienced considerable reductions in beef demand over the past 30 years. One possible factor in declining beef demand is lack of progress in the development of consistent, high-quality branded beef products. This article uses Nielsen Homescan data and hedonic models to estimate the value that U.S. consumers place on various beef attributes, including brand.

  20. Evaluation of carbon monoxide treatment in modified atmosphere packaging or vacuum packaging to increase color stability of fresh beef.

    Science.gov (United States)

    Jayasingh, P; Cornforth, D P; Carpenter, C E; Whittier, D

    2001-11-01

    Our goal was to obtain > 21 days red color stability for carbon monoxide (CO)-treated beef steaks in vacuum packaging (VP). In preliminary tests, pretreatment for 24 h in a 5% CO modified atmosphere package (MAP) was needed to maintain redness after re-packaging in VP. Pressure pretreatment with 5% CO for 2 h developed redness, but was impractical for large-scale application. Color stability and microbial load were then compared after treatment of steaks in 5% CO-MAP for 24 h, then VP; 100% CO-MAP for 1 h, then VP; steaks and ground beef in 0.5% CO-MAP; and steaks and ground beef in polyvinyl chloride (PVC) wrap. Steaks remained red for 5, 6, 8 and 10(6)cfu/cm(2)) at 5, 6, 7 and <2-weeks, respectively. Thus, extended color stability in VP was achieved by pretreatment with 5% CO for 24 h or 100% CO for 1 h.

  1. Characterization of beef tallow biodiesel and their mixtures with soybean biodiesel and mineral diesel fuel

    Energy Technology Data Exchange (ETDEWEB)

    Teixeira, Leonardo S.G. [Instituto de Quimica, Universidade Federal da Bahia, Campus Universitario de Ondina, 40.170-280, Salvador, Bahia (Brazil); INCT de Energia e Ambiente, Universidade Federal da Bahia, 40.170-280, Salvador, Bahia (Brazil); Couto, Marcelo B.; Filho, Miguel Andrade; Assis, Julio C.R.; Guimaraes, Paulo R.B.; Pontes, Luiz A.M.; Almeida, Selmo Q. [Departamento de Engenharia e Arquitetura, Universidade Salvador - UNIFACS, Av. Cardeal da Silva 132, 40.220-141, Salvador, Bahia (Brazil); Souza, Giancarlos S. [Instituto de Quimica, Universidade Federal da Bahia, Campus Universitario de Ondina, 40.170-280, Salvador, Bahia (Brazil); Teixeira, Josanaide S.R. [Instituto Federal de Educacao Ciencia e Tecnologica da Bahia - IFBAHIA, Rua Emidio de Morais S/N, 40.625-650, Salvador, Bahia (Brazil)

    2010-04-15

    Tallow is a raw material for biodiesel production that, due to their highly centralized generation in slaughter/processing facilities and historically low prices, may have energy, environmental, and economic advantages that could be exploited. However beef tallow biodiesel have unfavorable properties due the presence of high concentration of saturated fatty esters. One way to overcome these inconveniences is using blending procedures. In this way, blends of beef tallow biodiesel with soybean biodiesel and with conventional mineral diesel fuel were prepared and the quality of the mixtures was monitored with the purpose to study ideal proportions of the fuels. By measurement of the viscosity, density, cold filter plugging point, and flash point, it was demonstrated that tallow biodiesel can be blended with both mineral diesel and soybean biodiesel to improve the characteristics of the blend fuels, over that of the tallow. (author)

  2. Effect of Replacing Beef Fat with Chicken Skin on Some Properties of Model System Chicken Emulsions

    Directory of Open Access Journals (Sweden)

    Aslı Zungur

    2015-12-01

    Full Text Available Model system chicken emulsions were prepared by replacing 5, 10, 15 and 20 % beef fat with chicken skin. Moisture, protein, fat, ash and pH were determined in raw and heat processed emulsions. Emulsion samples were evaluated for cooking characteristics, TBA values and colour parameters (L*, a*, b*. Addition of chicken skin decreased fat content and increased moisture and protein content of emulsion samples. Chicken skin replacement significantly increased water holding capacity and cooking yield and decreased fluid release. Increasing chicken skin in formulation increased a* and b* values of emulsion samples. Therefore, adding of chicken skin instead of beef fat is useful in improving technological quality and producing low fat formulation.

  3. How thick do consumers' want their meat and how thick do they get it? The case of deep-fried breaded beef.

    Science.gov (United States)

    Ferraris, Daniela C; Libertino, Luciano M; Rodríguez, Graciela L; Hough, Guillermo E

    2013-08-01

    The main objective was to estimate the optimum thickness of meat from a consumers' perspective. Breaded beef (known as "milanesa" in Spanish speaking countries and as "schnitzels" in Austria) is a food product prepared with a slice of meat that is dipped in beaten egg to then be covered in bread crumbs; thus prepared it is fried. This product was used as a case study. Breaded beef was evaluated in three different stages: raw slice of meat, appearance of meat after frying, and during mastication. Breaded beef prepared with meat of varying thicknesses were presented to consumers who evaluated if the thicknesses were too thin, ok or too thick. Survival analysis statistics were used to estimate the optimum thicknesses. Results for each stage were: raw slice of meat = 6.7 ± 0.2 mm, appearance of the cut fried breaded beef = 8.4 ± 0.3 mm and during mastication = 7.6 ± 0.3 mm. The average thickness of the meat cut by butchers for breaded beef was 5.9 mm, not too far from the optimum. However, the average thickness of the meat in the breaded beef ready for frying sold by the same butchers 3.7 mm, clearly thinner than the optimum.

  4. OPPORTUNITIES TO PRODUCE HEALTHIER BEEF

    Directory of Open Access Journals (Sweden)

    G. HOLLÓ

    2013-12-01

    Full Text Available In this study the opportunities for enhancing the beneficial fatty acid in beef was examined. The effect of diet (extensive vs. intensive diet, forage to concentrate ratio, feeding concentrates rich in n-3 fatty acids and the breed (old: Hungarian Grey, dual purpose: Hungarian Simmental, dairy: Hungarian Holstein-Friesian was investigated on the fatty acid composition of beef. Findings reveal that the extensive diet with linseed supplemented concentrate influenced the n-6/n-3 ratio and the CLA content of longissimus muscle more advantageous concerning human nutrition. The meat from Hungarian Grey (HG contained more CLA and less n-6 fatty acids than that of Holstein-Friesian bulls. The different forage to concentrate ratio with/without linseed supplementation did not significantly affect the performance and slaughter traits in Hungarian Simmental (HS young bulls. The wider forage to linseed concentrate ratio caused slightly higher dressing percentage, meat and fat proportion and lower bone in carcass. The effect of muscle type on chemical composition of muscles is more significant than that of the diet. SFA and MUFA were affected by muscle type, n-3 fatty acids and n-6/n-3 fatty acid ratio of the diet. The level of cis-9 trans-11 CLA (mg/100 g was influenced by muscle type, but not by diet.

  5. Quality of beef burger with addition of wet okara along the storage

    Directory of Open Access Journals (Sweden)

    Rafaela Bergmann Strada de Oliveira

    Full Text Available ABSTRACT Combining the consuming of agricultural residues with satisfying consumers is a challenge that may result in financial income for the frozen meat industries, besides generating products with different nutritional value and satisfactory technological quality. Thus, we aimed at elaborating and assessing the physical, chemical and microbiological characteristics of frozen raw and fried beef hamburgers with addition of okara in its wet form throughout their storage over a period of 120 days. The inclusion of okara was proportional to the reduction in the content of protein, and to the increase of the lipid and moisture amount in the fried and raw formulations. Okara increased the luminosity and dimmed along the storage period. In the raw formulations at zero time lower values for b*, a* were observed when compared to the zero time of the fried hamburgers. This leaded to a light brown color and highlighting the clearing of the color due to the inclusion of okara. The fried hamburgers also featured this clearing, but they were darker brown. Chromaticity was greater with the inclusion of okara and with the passage of time. It can be concluded after 120 days storage the levels of protein, lipid and moisture of the formulations were according to the recommended by the Technical Regulation for Identity and Quality of Hamburgers and comply with the requirements of the Brazilian Law for microbiological standards. The brown colour changed with the inclusion of okara but without alterations in the characteristic colour for beef burguers.

  6. Growth potential of Clostridium perfringens from spores in acidified beef, pork, and poultry products during chilling.

    Science.gov (United States)

    Juneja, Vijay K; Baker, David A; Thippareddi, H; Snyder, O Peter; Mohr, Tim B

    2013-01-01

    The ability of Clostridium perfringens to germinate and grow in acidified ground beef as well as in 10 commercially prepared acidified beef, pork, and poultry products was assessed. The pH of ground beef was adjusted with organic vinegar to achieve various pH values between 5.0 and 5.6; the pH of the commercial products ranged from 4.74 to 6.35. Products were inoculated with a three-strain cocktail of C. perfringens spores to achieve ca. 2-log (low) or 4-log (high) inoculum levels, vacuum packaged, and cooled exponentially from 54.4 to 7.2°C for 6, 9, 12, 15, 18, or 21 h to simulate abusive cooling; the U.S. Department of Agriculture, Food Safety and Inspection Service (USDA-FSIS) recommends a cooling time of 6.5 h. Total germinated C. perfringens populations were determined after plating on tryptose-sulfite-cycloserine agar and incubating the plates anaerobically at 37°C for 48 h. In addition, C. perfringens growth from spores was assessed at an isothermal temperature of 44°C. Growth from spores was inhibited in ground beef with a pH of 5.5 or below, even during extended cooling from 54.4 to 7.2°C in 21 h. In ground beef with a pH of 5.6, the growth was >1 log after 18 h of cooling from 54.4 to 7.2°C. However, 15 h of cooling controlled the growth to product with a pH ranging from 4.74 to 5.17, both during exponential abusive cooling periods of up to 21 h and during storage for 21 h at 44°C. While product cooled exponentially from 54.4 to 7.2°C in 15 h or less, the pH 6.35 product supported growth, even after 6 h of cooling from 54.4 to 7.2°C. These challenge tests demonstrate that adjustment of ground beef to pH of 5.5 or less and of barbeque products to pH of 5.63 or less inhibits C. perfringens spore germination and outgrowth during extended cooling periods from 54.4 to 7.2°C up to 15 h. Therefore, safe cooling periods for products with homogeneous, lower pHs can be substantially longer.

  7. Comparison of AERMOD and WindTrax dispersion models in determining PM10 emission rates from beef cattle feedlots

    Science.gov (United States)

    Reverse dispersion modeling has been used to determine air emission fluxes from ground-level area sources, including open-lot beef cattle feedlots. This research compared AERMOD, a Gaussian-based and currently the U.S. Environmental Protection Agency (EPA) preferred regulatory dispersion model, and ...

  8. Evaluation of a cross contamination model describing transfer of salmonella spp. and listeria monocytogenes during grinding of pork and beef

    DEFF Research Database (Denmark)

    Møller, Cleide Oliveira de Almeida; Hansen, Tina Beck; Aabo, Søren

    2015-01-01

    Introduction: The cross contamination model (Møller et al. 2012) was evaluated to investigate its capability of describing transfer of Salmonella spp. and Listeria monocytogenes during grinding of pork and beef of varying sizes (50 – 324 g) and numbers of pieces to be ground (10 – 100), in two...

  9. Intramuscular variation in mitochondrial functionality of beef ...

    African Journals Online (AJOL)

    Suman, Surendranath P

    2017-08-16

    Aug 16, 2017 ... revenue loss to the United States beef industry due to discoloration is estimated to be more than 1 billion USD ... to estimate the surface color stability of steaks; greater ratio indicates ..... Elsevier, Oxford, United Kingdom.

  10. The beef market in the European Union

    DEFF Research Database (Denmark)

    Nielsen, Niels Asger

    are suckler cows which goes to show that milk production is in the main focus for most European cattle farmers who get only a small part of their income from beef production. 8. The beef slaughtering industry has become quite concentrated at the national level but at the European level concentration is still...... characteristics determining the consumers' value perception of a piece of meat appear to be fat, tenderness, taste and freshness. 7. The primary production of beef is fragmented in most European countries and the average number of cattle at a European cattle farm is only slowly rising. Two thirds of the cows...... small with the largest slaughtering company slaughtering only 3% of the total. 9. Relations between industry (slaughterhouses) and farmers tend to be much looser in the beef market than it is in other agricultural markets, eg the milk market. Cattle markets are still quite important although the share...

  11. The beef market in the European Union

    DEFF Research Database (Denmark)

    Nielsen, Niels Asger; Jeppesen, Lisbeth Fruensgaard

    are suckler cows which goes to show that milk production is in the main focus for most European cattle farmers who get only a small part of their income from beef production. 8. The beef slaughtering industry has become quite concentrated at the national level but at the European level concentration is still...... characteristics determining the consumers' value perception of a piece of meat appear to be fat, tenderness, taste and freshness. 7. The primary production of beef is fragmented in most European countries and the average number of cattle at a European cattle farm is only slowly rising. Two thirds of the cows...... small with the largest slaughtering company slaughtering only 4% of the total. 9. Relations between industry (slaughterhouses) and farmers tend to be much looser in the beef market than it is in other agricultural markets, eg the milk market. Cattle markets are still quite important although the share...

  12. ROMANIAN BEEF AND VEAL MEAT MARKET ANALYSIS

    Directory of Open Access Journals (Sweden)

    ilvius T. STANCIU

    2014-06-01

    Full Text Available Current nutritional trends, oriented towards a healthy nutrition, lead to the re-evaluation of the share held by beef in the diet of the population. The demand for beef and veal at European and global market level can represent a significant opportunity to increase domestic producers’ business. Though cattle breeding is a traditional activity for the indigenous population from rural areas, livestock for slaughter have decreased steadily in the last years, thus the domestic market being dependent on imports. Romanian natural potential allows the achievement of sufficient production to meet domestic and export demand for beef, which brings high income for producers. The article proposes a review of the domestic production of beef and veal, their consumption and the origin of products on the domestic market in the European and international context.

  13. ROMANIAN BEEF AND VEAL MEAT MARKET ANALYSIS

    Directory of Open Access Journals (Sweden)

    ilvius T. STANCIU

    2014-06-01

    Full Text Available Current nutritional trends, oriented towards a healthy nutrition, lead to the re-evaluation of the share held by beef in the diet of the population. The demand for beef and veal at European and global market level can represent a significant opportunity to increase domestic producers’ business. Though cattle breeding is a traditional activity for the indigenous population from rural areas, livestock for slaughter have decreased steadily in the last years, thus the domestic market being dependent on imports. Romanian natural potential allows the achievement of sufficient production to meet domestic and export demand for beef, which brings high income for producers. The article proposes a review of the domestic production of beef and veal, their consumption and the origin of products on the domestic market in the European and international context.

  14. OZONE ABSORPTION IN RAW WATERS

    Directory of Open Access Journals (Sweden)

    LJILJANA TAKIĆ

    2008-03-01

    Full Text Available The ozone absorption in raw water entering the main ozonization step at the Belgrade drinking water supply plant was investigated in a continuous stirred tank reactor (CSTR. A slow chemical reaction rate of dissolved ozone and pollutants present in raw water have been experimentally determined. The modified Hatta number was defined and calculated as a criterion which determines whether and to which extent the reactions of ozone and pollutants influence the rate of the pure physical ozone absorption.

  15. The Effect of Social Desirability Bias on Willingness-To-Pay for Organic Beef.

    OpenAIRE

    Cheek, Lindsey

    2007-01-01

    Researchers regularly conduct willingness-to-pay or valuation studies for product marketing or public policy purposes. However, a large volume of research suggests valuation tools such as conjoint analysis may be subject to social desirability bias, where subjects misrepresent their true preferences to create a favorable impression. The objective of this study is to measure the effects of social desirability bias on conjoint survey responses. Consumers were asked to rank organic ground beef r...

  16. Salmonella in beef and produce from honduras.

    Science.gov (United States)

    Maradiaga, Martha; Miller, Mark F; Thompson, Leslie; Pond, Ansen; Gragg, Sara E; Echeverry, Alejandro; Garcia, Lyda G; Loneragan, Guy H; Brashears, Mindy M

    2015-03-01

    Salmonella continues to cause a considerable number of foodborne illnesses worldwide. The sources of outbreaks include contaminated meat and produce. The purpose of this study was to establish an initial investigation of the burden of Salmonella in produce and beef from Honduras by sampling retail markets and abattoirs. Retail produce samples (cantaloupes, cilantro, cucumbers, leafy greens, peppers, and tomatoes; n = 573) were purchased in three major cities of Honduras, and retail whole-muscle beef (n = 555) samples were also purchased in four major cities. Additionally, both hide and beef carcass (n = 141) samples were collected from two Honduran abattoirs. Whole-muscle beef samples were obtained using a sponge hydrated with buffered peptone water, and 10 ml of the buffered peptone water rinsate of each produce sample was collected with a dry sponge and placed in a bag to be transported back to the United States. Salmonella was detected using a commercially available, closeplatform PCR system, and positive samples were subjected to culture on selective media to obtain isolates. Overall, the prevalence of Salmonella-positive samples, based on PCR detection in Honduras (n = 555) retail beef was 10.1% (95% confidence interval = 7.8, 12.9), whereas 7.8% (n = 141) of beef carcass and hides samples were positive in both beef plants. The overall Salmonella prevalence for all produce samples (n = 573) collected was 2.1% (95% confidence interval = 1.2, 3.6). The most common serotypes identified in Honduras were Salmonella Typhimurium followed by Derby. These results provide an indication of Salmonella contamination of beef and produce in Honduras. Developing a Salmonella baseline for Latin America through an initial investigation like the one presented here contributes to a broader global understanding of the potential exposure through food, thus providing insight into the needs for control strategies.

  17. Factors influencing resuscitation and growth of heat injured Listeria monocytogenes 13-249 in sous vide cooked beef.

    Science.gov (United States)

    Hansen, T B; Knøchel, S

    2001-01-22

    The growth of Listeria monocytogenes 13-249 in vacuum-packed, minced beef was investigated as a function of degree of heat injury (including no injury i.e. uncooked beef), growth phase (logarithmic and late stationary phase), pH (5.6 and 6.2), and storage temperature (3, 10 and 20 degrees C) during a storage period of 30 days. Late logarithmic and late stationary phase cultures of L. monocytogenes 13-249 showed similar growth in refrigerated, vacuum-packed, raw minced beef with a high pH (6.2). In normal pH (5.6) beef there was no growth at 3 degrees C while growth at 10 and 20 degrees C was only observed for logarithmic phase cultures. Heat injured late stationary phase cultures with 95-99.9% injured cells in the surviving population (as measured by differential plating on enriched vs. selective media after sous vide cooking) did not grow or repair sublethal injuries in sous vide cooked beef at 3 degrees C while repair and growth took place at 10 as well as at 20 degrees C. In logarithmic phase cultures heat injury occurred very rapidly and > or = 99.9% heat injury was observed in all trials in spite of much lower pasteurization values and fewer log10 reductions compared with late stationary phase cultures. Regardless of growth phase, all cultures where a high degree of heat injury (> or = 99.9%) was observed, did not subsequently grow in the beef product at 3 or 10 degrees C within 30 days. Growth of heat injured cultures preexposed to heat shock (46 degrees C, 30 min) or slowly rising temperatures (0.3 degrees C min(-1)) before heat injury was also investigated. Heat shocked or heat adapted cultures generally responded in the same manner as non-stressed cultures (no growth at 3 degrees C) except that a longer lag phase was observed in beef processed at slowly rising temperatures and in normal pH beef at 10 degrees C. Although processing at slowly rising temperatures may slightly increase the survival of L. monocytogenes 13-249 in cooked beef, there seem to be no

  18. Export Marketing of Croatian Baby Beef

    Directory of Open Access Journals (Sweden)

    Ante Kolega

    2003-09-01

    Full Text Available Croatia has traditionally been the exporter of livestock and beef. In 1988 Croatia exported a record of 35,7 thousand tons of livestock, worth almost 60 million US $. During the period between 1981 and 1991, the export of beef and processed meat was somewhat smaller, about 12,8 thousand tons, 40 million US $ worth. The most important export destinations were Italy, with almost 90% of all volume and monetary value of export, and Greece. In March 1993 EU has banned the import of livestock and beef from Croatia, due to a scandal with infected cattle. In spite of the subsequent abolition of this ban, Croatian export never really recovered, so today the export of beef amounts to less than a thousand tons. Even though the conditions on the export markets and in the domestic cattle breeding industry have changed, we think that it is possible to achieve the export expansion of Croatian baby beef in the foreign market. This article describes the results of the research conducted on the Italian and Greek market. According to expert opinions and the results of our survey it is evident that, with a certain quality of the product, it would be possible to renew the export of Croatian baby beef to the target markets.

  19. Efficient sliding spotlight SAR raw signal simulation of extended scenes

    Directory of Open Access Journals (Sweden)

    Huang Pingping

    2011-01-01

    Full Text Available Abstract Sliding spotlight mode is a novel synthetic aperture radar (SAR imaging scheme with an achieved azimuth resolution better than stripmap mode and ground coverage larger than spotlight configuration. However, its raw signal simulation of extended scenes may not be efficiently implemented in the two-dimensional (2D Fourier transformed domain. This article presents a novel sliding spotlight raw signal simulation approach from the wide-beam SAR imaging modes. This approach can generate sliding spotlight raw signal not only from raw data evaluated by the simulators, but also from real data in the stripmap/spotlight mode. In order to obtain the desired raw data from conventional stripmap/spotlight mode, the azimuth time-varying filtering, which is implemented by de-rotation and low-pass filtering, is adopted. As raw signal of extended scenes in the stripmap/spotlight mode can efficiently be evaluated in the 2D Fourier domain, the proposed approach provides an efficient sliding spotlight SAR simulator of extended scenes. Simulation results validate this efficient simulator.

  20. DEMAND FOR BEEF IN THE PROVINCE OF YOGYAKARTA

    Directory of Open Access Journals (Sweden)

    Sulistiya

    2014-07-01

    Full Text Available RACT Protein consumption level of society in Yogyakarta Province has yet to meet the target, but the beef is a source of animal protein that is easily obtainable. Therefore, research on the analysis of demand for beef in this province needs to be done. Objective: (1 Determine the factors that affect the demand for beef in Yogyakarta. (2 Determine the own price elasticity and income elasticity of demand for beef in this province, and to know the cross-price elasticity of demand for beef to changes in the price of mutton, chicken, rice, and cooking oil. Metode: descriptive statistics, followed by inductive statistics , and hypothesis testing. The data used are primary and secondary data. Data were analyzed by multiple linear regression with the value of t and F tests, and analysis of the coefficient of determination. Results: Taken together, the factors that affect the demand for beef in the province is the price of beef, mutton, chicken, rice, cooking oil, income, number of inhabitants. Individually, beef demand is influenced by the price of beef and income residents. Beef inelastic demand means that beef is the daily necessities that are affordable and easy to obtain population of Yogyakarta Province. The increase in income population does not add to demand for beef. Substitutes of beef in the province is goat and chicken, while the complementary goods are rice and cooking oil.

  1. European beef consumers' interest in a beef eating-quality guarantee

    DEFF Research Database (Denmark)

    Verbeke, Wim; Van Wezemael, Lyn; de Barcellos, Marcia Dutra

    2010-01-01

    from this study indicate good opportunities for the development of a beef eating-quality guarantee system in Europe. As an increase in consumers' satisfaction with beef products could lead to higher consumption rates and industry profitability, the introduction of an eating-quality guarantee system can...

  2. Carbon Footprint of Beef Cattle

    Directory of Open Access Journals (Sweden)

    Jim Dyer

    2012-12-01

    Full Text Available The carbon footprint of beef cattle is presented for Canada, The United States, The European Union, Australia and Brazil. The values ranged between 8 and 22 kg CO2e per kg of live weight (LW depending on the type of farming system, the location, the year, the type of management practices, the allocation, as well as the boundaries of the study. Substantial reductions have been observed for most of these countries in the last thirty years. For instance, in Canada the mean carbon footprint of beef cattle at the exit gate of the farm decreased from 18.2 kg CO2e per kg LW in 1981 to 9.5 kg CO2e per kg LW in 2006 mainly because of improved genetics, better diets, and more sustainable land management practices. Cattle production results in products other than meat, such as hides, offal and products for rendering plants; hence the environmental burden must be distributed between these useful products. In order to do this, the cattle carbon footprint needs to be reported in kg of CO2e per kg of product. For example, in Canada in 2006, on a mass basis, the carbon footprint of cattle by-products at the exit gate of the slaughterhouse was 12.9 kg CO2e per kg of product. Based on an economic allocation, the carbon footprints of meat (primal cuts, hide, offal and fat, bones and other products for rendering were 19.6, 12.3, 7 and 2 kg CO2e per kg of product, respectively.

  3. Prediction Model of Pan-Fried Beef Based on Consumer Sensory Evaluation%基于消费者感官评价的煎制牛肉预测模型

    Institute of Scientific and Technical Information of China (English)

    郎玉苗; 李敬; 卢凌; 谢鹏; 柴晓峰; 张丽; 李海鹏; 刘璇; 孙宝忠

    2015-01-01

    为建立适合我国消费者选择生鲜牛肉和煎制牛排的预测模型,对54块差异性牛肉的生鲜牛肉(肉色、脂肪沉积、汁液渗出、新鲜度和总体可受性)和煎制牛排(切面肉色、肉香气、嫩度、多汁性、肉滋味、残渣量和总体可受性)的感官喜好性进行评价。结果表明:脂肪沉积是影响消费者对生鲜牛肉购买欲的关键指标,其次为新鲜度、肉色和汁液浸出;多汁性是影响消费者对煎制牛排总体可受性的关键指标,其次为肉滋味和残渣量。建立的回归预测模型:生鲜牛肉外观可受性=0.534+0.448×脂肪沉积+0.435×新鲜度+0.174×肉色―0.124×汁液浸出(R2=0.932);煎制牛排总体可受性=―0.204+0.332×多汁性+0.489×肉滋味+0.237×残渣量(R2=0.936)。%The aim of this study was to investigate the eating quality and the key quality traits of pan-fried beef. Six muscles (M. longissimus, Tri-tip, Gluteobiceps, Eye of Kunckle, Knuckle Cover, and Knuckle Undercut) of nine cattle were used for consumer sensory evaluation on raw beef and pan-fried beef. The sensory quality traits evaluated for raw beef were beef color, marbling, the amount of exudation, freshness, and appearance acceptability. Color, beef aroma, tenderness, juiciness, beef flavor, the amount of residue, and overall acceptability were used for the sensory traits of pan-fried beef. The results showed that marbling was the key factor of raw beef quality, followed by freshness, beef color and the amount of exudation. Juiciness was the key sensory trait of pan-fried beef, followed by beef flavor and the amount of residue. The prediction model for raw beef was appearance acceptability=0.534+0.448 × marbling+0.435 × freshness+0.174 × beef color-0.124 the amount of exudation (R2=0.932). The prediction model for pan-fried beef was overall acceptability=-0.204+0.332 × juiciness+0.489 × beef flavor+0.237 × the amount of residue.

  4. Dietary PUFA Intervention Affects Fatty Acid- and Micronutrient Profiles of Beef and Related Beef Products

    Directory of Open Access Journals (Sweden)

    Dirk Dannenberger

    2013-07-01

    Full Text Available The study investigated the dietary impact of 18:3n-3 vs. 18:2n-6 on fatty acid- and micronutrient concentration of beef muscle and the extent of diet- and processing-induced changes of lipid- and micronutrient concentrations of beef products made thereof (German Corned beef (GCB, tea sausage spread (TSS, scalded sausage (SS. Beef and beef products were obtained from German Holstein bulls which either received a control diet consisting of maize silage and concentrate with soybean meal (41%, or an experimental diet of grass silage and concentrate plus rapeseed cake (12% and linseed oil (3%. The study revealed that upon an 18:3n-3 vs. 18:2n-6 intervention the amounts of 18:3n-3, EPA and Σn-3 LC-PUFA were significantly increased by 2.6, 2.3 and 1.7 fold, respectively. Experimental diet significantly increased β-carotene contents, and the γ-tocopherol contents were decreased. During beef processing, n-3 PUFA from beef were found to be product-specifically transferred into the corresponding beef products. 18:3n-3 and Σn-3 LC-PUFA contents were found to be 1.4 and 1.5 times higher in GCB from grass silage- than maize silage-fed bulls. The trace element contents in GCB (iron, copper, zinc, selenium were not affected by the diet; however γ-tocopherol contents were decreased by experimental diet. In conclusion, dietary n-3 PUFA were completely transferred into beef products unaffected by beef processing conditions.

  5. The profitability and production of a beef herd on transitional ...

    African Journals Online (AJOL)

    The profitability and production of a beef herd on transitional Cymbopogon- Themeda ... emphasizes the need to optimize, rather than maximize, the rate of reproduction. ... Keywords: Beef cattle, cow herd production, extensive farming, lick ...

  6. Livestock Update : Beef-Horse-Poultry-Sheep-Swine

    OpenAIRE

    Greiner, Scott Patrick; McCann, Mark A.; Neil, Scott J.; Harmon, Deidre D.; Whittier, W. Dee

    2013-01-01

    Includes articles on August herd management, phosphorus supplementation of beef cattle, 2013 across-breed EPD table, Applied Reproduction in Beef Cattle event, sheep breeding season tips, and a sheep update.

  7. Effect of texturized soy protein on quality characteristics of beef samosas

    Directory of Open Access Journals (Sweden)

    Mary Omwamba

    2014-04-01

    Full Text Available Texturized soy protein (TSP granules obtained from defatted soy flour were used to replace beef at 25, 50, 75 and 100% levels in samosa stuffing. The moisture, protein and ash content of the stuffing increased with an increase in the amount of texturized soy protein while the fat content decreased significantly (p<0.05 with an increase in the amount of texturized soy protein. Sensory evaluation of baked samosas showed no significant (p>0.05 difference in appearance, taste and overall acceptability with inclusion of texturized soy protein. However there were significant (p<0.05 differences in flavour, texture and willingness to purchase between 100% beef and 100% TSP samosas. There was a reduction in the moisture content while the protein, fat, ash and carbohydrate content increased in baked as compared to raw samples, both in the control and TSP50 samosas. The caloric value of the baked samosas was 24.07% lower in TSP added samples compared to 100% beef samples (control. Lipid oxidation increased with storage time from 0.25 to 0.68 mg malonaldehyde/kg in the control and from 0.21 to 0.39 mg malonaldehyde/kg in TSP50 samosas. The oxidation in the control was significantly (p<0.05 higher than in TSP50. The results suggest that TSP granules can be use with up to 50% addition in samosa products without significant differences in sensory attributes.

  8. Competitive advantages of the Brazilian Beef Processing Plants in their Internationalization Process

    Directory of Open Access Journals (Sweden)

    Francisco Américo Cassano

    2012-06-01

    Full Text Available The following study has the primary objective of identifying the major competitive advantages owned by Brazilian beef processing plants in their internationalization process. In order to reach it, it was carried out an exploratory research, based on the survey of official data and publications concerning world’s beef cattle production, followed by a literature review and finally, by a single case study. This case study was conducted through an interview with former employee of Redenção Frigorífico do Pará Ltda. The obtained results allowed the identification of the major competitive advantages of the studied company in its internationalization process, such as the raw material quality and availability, production scale, Brazilian cattle’s extensive production system, and control and prevention of main cattle diseases. It was concluded that Brazilian beef production plants really have competitive advantages within the internationalization process context, some of them practically observed in the studied company, and others that can be effectively corroborated by future studies.

  9. Antioxidant and antimicrobial activity of commercial propolis extract in beef patties.

    Science.gov (United States)

    Vargas-Sánchez, Rey D; Torrescano-Urrutia, Gastón R; Acedo-Félix, Evelia; Carvajal-Millán, Elizabeth; González-Córdova, Aarón F; Vallejo-Galland, Belinda; Torres-Llanez, María J; Sánchez-Escalante, Armida

    2014-08-01

    The objective of this study was to evaluate the efficacy of propolis extract (PE) to reduce lipid oxidation and microbial growth on beef patties during refrigerated storage. Beef patties were manufactured by incorporating PE in 4 different treatments: (1) Control (no PE addition); (2) commercial propolis 1 (2% w/w; CP1); (3) commercial propolis 2 (2% w/w; CP2); and (4) noncommercial propolis (2% w/w; NCP). Raw patties were wrapped with polyvinyl chloride and stored at 2 °C for 8 d. Total phenolic content (TPC), free-radical scavenging activity (FRS), and polyphenolic content of the PE were evaluated using high-performance liquid chromatography (HPLC). Lipid oxidation (thiobarbituric acid-reactive substances (TBARS), conjugated dienes (CnDs), metmyoglobin (MetMb%), pH variation, and color (L*, a*, b*, C*, and h*), and microbial growth (mesophilic and psychrotrophic bacteria) of patty samples were measured. NCP treatment demonstrated the highest FRS (64.8% at 100 μg/mL), which correlated with TPC and the presence of polyphenolic compounds. Lipid oxidation (78.54%, TBARS; 45.53%, CnD; 58.57%, MetMb) and microbial mesophilic and psychrotrophic growth (19.75 and 27.03%, respectively) values were reduced by NCP treatment in refrigerated samples after 8 d. These results indicate that PE has great potential as a natural antioxidant and antimicrobial additive to extend the shelf life of beef patties. © 2014 Institute of Food Technologists®

  10. An overview of microbial food safety programs in beef, pork, and poultry from farm to processing in Canada.

    Science.gov (United States)

    Rajić, Andrijana; Waddell, Lisa A; Sargeant, Jan M; Read, Susan; Farber, Jeff; Firth, Martin J; Chambers, Albert

    2007-05-01

    Canada's vision for the agri-food industry in the 21st century is the establishment of a national food safety system employing hazard analysis and critical control point (HACCP) principles and microbiological verification tools, with traceability throughout the gate-to-plate continuum. Voluntary on-farm food safety (OFFS) programs, based in part on HACCP principles, provide producers with guidelines for good production practices focused on general hygiene and biosecurity. OFFS programs in beef cattle, swine, and poultry are currently being evaluated through a national recognition program of the Canadian Food Inspection Agency. Mandatory HACCP programs in federal meat facilities include microbial testing for generic Escherichia coli to verify effectiveness of the processor's dressing procedure, specific testing of ground meat for E. coli O157:H7, with zero tolerance for this organism in the tested lot, and Salmonella testing of raw products. Health Canada's policy on Listeria monocytogenes divides ready-to-eat products into three risk categories, with products previously implicated as the source of an outbreak receiving the highest priority for inspection and compliance. A national mandatory identification program to track livestock from the herd of origin to carcass inspection has been established. Can-Trace, a data standard for all food commodities, has been designed to facilitate tracking foods from the point of origin to the consumer. Although much work has already been done, a coherent national food safety strategy and concerted efforts by all stakeholders are needed to realize this vision. Cooperation of many government agencies with shared responsibility for food safety and public health will be essential.

  11. Sustainability performance of soybean and beef chains in Latin America

    NARCIS (Netherlands)

    Pashaei Kamali, F.

    2015-01-01

    Sustainability Performance of Soybean and Beef Chains in Latin America The objective of this thesis, was to analyze the sustainability performance of soybean and beef production chains in Latin America (LA). First identifying a set of sustainability issues of soybean and beef

  12. BEEF TALLOW AND EMULSIFIER IN GROWING-FINISHING PIG DIETS

    Directory of Open Access Journals (Sweden)

    KASSIA M. SANTOS

    Full Text Available ABSTRACT Two trials were aimed to evaluate beef tallow in diets with and without emulsifier on performance of pigs at growing-finishing phases. In the first trial, 15 barrows (22.03±0.62 kg were distributed among three treatments: reference diet; test diet 1 (5% beef tallow and test diet 2 (10% beef tallow. Beef tallow presented average value of 7130.97 kcal ME/kg. For the performance trail, 30 barrows (24.85±1.18 kg were distributed among five treatments: T1 - diet with soybean oil and 3230 kcal ME /kg; T2 - diet with beef tallow and 3230 kcal ME/kg; T3 - diet with beef tallow and 3080 kcal ME/kg; T4 - diet with beef tallow, 3080 kcal/kg and 0.1% emulsifier; T5 - diet with beef tallow, 2930 kcal ME/kg and 0.1% emulsifier. Feed conversion was worse in animals fed diet with 3080 kcal ME/kg containing beef tallow and with 2930 kcal ME/kg with beef tallow and emulsifier. For economic availability, animals fed diet with beef tallow and 3230 kcal ME/kg and those fed diet with 3080 kcal ME/kg containing beef tallow and emulsifier, did not differ from animals fed diet with soybean oil, which enables the reduction up to 150 kcal ME/kg be compensated by emulsifier addition.

  13. Impact of product familiarity on beef quality perception

    DEFF Research Database (Denmark)

    Banovic, Marija; Fontes, Magda Aguiar; Barreira, Maria Madalena;

    2012-01-01

    This study examines the use of intrinsic and extrinsic cues in beef quality perception at the point of purchase and upon consumption by consumers with varying levels of familiarity with a particular beef product. High-familiarity consumers tend to use the color of the meat to assess beef quality,...

  14. 7 CFR 1260.315 - Qualified State Beef Councils.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Qualified State Beef Councils. 1260.315 Section 1260... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Rules and Regulations § 1260.315 Qualified State Beef Councils. The following...

  15. 7 CFR 1260.181 - Qualified State beef councils.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Qualified State beef councils. 1260.181 Section 1260... SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Assessments § 1260.181 Qualified State...

  16. Sustainability performance of soybean and beef chains in Latin America

    NARCIS (Netherlands)

    Pashaei Kamali, F.

    2015-01-01

    Sustainability Performance of Soybean and Beef Chains in Latin America The objective of this thesis, was to analyze the sustainability performance of soybean and beef production chains in Latin America (LA). First identifying a set of sustainability issues of soybean and beef produc

  17. BeefTracker: Spatial Tracking and Geodatabase for Beef Herd Sustainability and Lifecycle Analysis

    Science.gov (United States)

    Oltjen, J. W.; Stackhouse, J.; Forero, L.; Stackhouse-Lawson, K.

    2015-12-01

    We have developed a web-based mapping platform named "BeefTracker" to provide beef cattle ranchers a tool to determine how cattle production fits within sustainable ecosystems and to provide regional data to update beef sustainability lifecycle analysis. After initial identification and mapping of pastures, herd data (class and number of animals) are input on a mobile device in the field with a graphical pasture interface, stored in the cloud, and linked via the web to a personal computer for inventory tracking and analysis. Pasture use calculated on an animal basis provides quantifiable data regarding carrying capacity and subsequent beef production to provide more accurate data inputs for beef sustainability lifecycle analysis. After initial testing by university range scientists and ranchers we have enhanced the BeefTracker application to work when cell service is unavailable and to improve automation for increased ease of use. Thus far experiences with BeefTracker have been largely positive, due to livestock producers' perception of the need for this type of software application and its intuitive interface. We are now in the process of education to increase its use throughout the U.S.

  18. 77 FR 31975 - Shiga Toxin-Producing Escherichia coli in Certain Raw Beef Products

    Science.gov (United States)

    2012-05-31

    ... products subject to Agency E. coli O157:H7 sampling and testing, from both domestic and international...-reviewed journal with ARS and FSIS authors.\\2\\ The MLG method was validated and then verified for internal... by a regulatory body, or that is validated and certified by an independent body (e.g., AOAC...

  19. Quality evaluation of beef patties formulated with bambara groundnut (Vigna subterranean L.) seed flour.

    Science.gov (United States)

    Alakali, J S; Irtwange, S V; Mzer, M T

    2010-06-01

    This study evaluated composite beef-bambara groundnut (Vigna subterranean L.) seed flour patties to determine the effect of bambara groundnut flour (BGF) inclusion on the quality and acceptability of the products. The effect of different levels of BGF (0%, 2.5%, 5.0% and 7.5%) on the proximate composition and pH indicate that BGF had no significant (p0.05) effect on moisture, protein and carbohydrate of raw patties except ash and pH whereas there was significant (p0.05) effect on all the parameters for the cooked patties. BGF significantly (p0.05) reduced the shrinkage of the cooked patties from 9.13% to 6.76%, while percentage cooking yield, moisture retention, and fat retention increased significantly (p0.05) with increasing BGF levels from 79.1% to 87.2%, 67.51% to 78.05% and 73.51% to 88.34%, respectively. The use of BGF significantly (p0.05) increased the pH of cooked patties from 6.16 to 6.23. Beef patties extended with BGF up to 5% addition exhibited good quality attributes most acceptable to the consumers. The pH of the 0% BGF-beef patties decreased significantly during storage, up to day 14, and increased thereafter. However, the pH of the patties with BGF consistently decreased significantly up to day 21. The TBA values of both (0% and 5% BGF-beef patties) increased significantly (p0.05) from 0.054 to 0.25 and from 0.05 to 0.24mg malonaldehyde/kg, respectively. All sensory attributes decreased significantly (p0.05) as storage time progressed. The physico-chemical, microbiological and sensory characteristics of the patties were found to be acceptable after 21days refrigerated storage. Copyright 2010 Elsevier Ltd. All rights reserved.

  20. Golden flaxseed and its byproducts in beef patties: physico-chemical evaluation and fatty acid profile

    Directory of Open Access Journals (Sweden)

    Daiana Novello

    2013-09-01

    Full Text Available Flaxseed application in meat and meat products by adding not flesh ingredients has not yet been properly assessed. This technology strategy, if well optimized, could substantially improve the nutritional value of meat products and promote healthy appeals consistent. Knowing that, this study aimed to evaluate the effect of adding golden flaxseed oil, or flour, or seed in the physico-chemical properties and fatty acid profile of beef patties. Beef patties were prepared with 5.0% of oil (FO, or flour (FF, or seed (FS, plus a control formulation (FC. For raw products containing flaxseed, the moisture content (74.22 to 68.61% was decreased and the ash (1.61 to 2.00g 100g-1, protein (15.62 to 16.46g 100g-1, fat (6.20 to 9.74g 100g-1, carbohydrate (2.02 to 3.97 g 100g-1, and calorie (127.71 to 161.62kcal 100g-1 contents were increased. The raw and grilled samples containing golden flaxseed had increased beneficial omega-3 (n-3 fatty acids (0.85 a 2.98g 100g-1, a decreased n-6/n-3 ratio (0.50, thus improving the nutritional profile.

  1. Raw materials prices under pressure

    OpenAIRE

    Kolbe, Heinz

    1984-01-01

    Since April 1984 there has been a general fall in world market prices for industrial raw materials following upon increases which, in some cases, had been quite considerable. What are the reasons for this development? What are the prospects for 1985?

  2. Raw milk consumption and health.

    Science.gov (United States)

    Vranješ, Anka Popović; Popović, Milka; Jevtić, Marija

    2015-01-01

    Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39%) outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%), bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79%) outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market.

  3. Performance of raw bovine meat preservation by hyperbaric storage (quasi energetically costless) compared to refrigeration.

    Science.gov (United States)

    Freitas, Paulo; Pereira, Sofia A; Santos, Mauro D; Alves, Susana P; Bessa, Rui J B; Delgadillo, Ivonne; Saraiva, Jorge A

    2016-11-01

    Hyperbaric storage at room temperature (without temperature control) of raw bovine meat was studied and compared to refrigeration. Samples were first stored for 12h at 50, 100 and 150MPa, and in a second set of experiments, for a longer period of 10days at 50MPa. For the 12h storage, refrigeration and 50MPa had a similar microbial growth inhibition effect and, at 100 and 150MPa an additional microbial inactivation effect was found. For the longer experiment (10days at 50MPa) results pointed for a shelf-life increase of raw beef compared to samples stored under refrigeration. For both tests (12h and 10days) samples preserved under pressure showed no detrimental effect on physicochemical parameters comparatively to the initial and refrigerated samples. These results indicate that hyperbaric storage at room temperature not only allows high energy savings, but additionally has potential to extend the shelf-life of a perishable food product compared to refrigeration.

  4. Fornecimento de grão de milheto, inteiro ou triturado, em duas frequências de suplementação para bovinos de corte Supply of whole or ground millet grain at two frequencies of supplementation for beef cattle

    Directory of Open Access Journals (Sweden)

    João Marcos Beltrame Benatti

    2012-04-01

    the grain of millet in supplements given daily or three times a week to grazing beef cattle on productive performance, economic and diurnal intake behavior during the drought period. Twenty-five non-castrated Nelore cattle with initial body weight of 350.92±31.7 kg were kept in five paddocks with unit area of 1.45 ha formed by B. brizantha cv. Marandu. The animals were distributed in a completely radomized design in a 2 × 2 + 1 factorial arrangement, as follows: two physical forms of the grain of millet (whole or ground, two frequencies of supplementation (daily or three times a week and the control treatment (mineral mix. It was found that the concentrate supplementation promoted weight gains, while sole mineral supplementation resulted in weight loss of 0.16 kg/animal/day. Grinding the millet grain promoted higher gains (0.36 and 0.38 kg/animal/day for 3 and 7 times a week, respectively when compared with the whole grain (0.22 and 0.24 kg/animal/day for 3 and 7 times a week, respectively, with no differences between the frequencies of supplementation. Significant effect of the day × treatment interaction was found for time in the trough, grazing and drinking water. For the resting time difference was found between the control treatment and the others. Greater economic return was achieved when ground millet was supplied at lower supplementation frequency (R$ 22,70/animal. The use of multiple supplements, as well as the processing of millet grain, enabled greater weight gain, regardless of the supplementation frequency studied. Providing supplement 3 times a week reduces the costs with supplementation.

  5. Attachment and biofilm formation by Escherichia coli O157:H7 at different temperatures, on various food-contact surfaces encountered in beef processing.

    Science.gov (United States)

    Dourou, Dimitra; Beauchamp, Catherine Simpson; Yoon, Yohan; Geornaras, Ifigenia; Belk, Keith E; Smith, Gary C; Nychas, George-John E; Sofos, John N

    2011-10-03

    Escherichia coli O157:H7 attached to beef-contact surfaces found in beef fabrication facilities may serve as a source of cross-contamination. This study evaluated E. coli O157:H7 attachment, survival and growth on food-contact surfaces under simulated beef processing conditions. Stainless steel and high-density polyethylene surfaces (2×5cm) were individually suspended into each of three substrates inoculated (6log CFU/ml or g) with E. coli O157:H7 (rifampicin-resistant, six-strain composite) and then incubated (168h) statically at 4 or 15°C. The three tested soiling substrates included sterile tryptic soy broth (TSB), unsterilized beef fat-lean tissue (1:1 [wt/wt]) homogenate (10% [wt/wt] with sterile distilled water) and unsterilized ground beef. Initial adherence/attachment of E. coli O157:H7 (0.9 to 2.9log CFU/cm(2)) on stainless steel and high-density polyethylene was not affected by the type of food-contact surface but was greater (ptemperature. Notably, attachment occurred not only at a temperature representative of beef fabrication areas during non-production hours (15°C), but also during cold storage (4°C) temperatures, thus, rendering the design of more effective sanitation programs necessary.

  6. Industrial lubricants based on renewable raw materials. Report 1. Properties of the natural acylglycerols

    Directory of Open Access Journals (Sweden)

    Igor A. Mandziuk

    2016-03-01

    Full Text Available The paper analyzes and generalizes the information available on animal fats that can be used as secondary raw materials in production of lubricants compatible with the new recycling technologies. The paper reviews the current market of lubricants, analyses the environmental problems in manufacturing of petroleum-based lubricants and suggests a new class of alternative raw materials for the lubricant production. The experimental studies showed that sunflower oil contains the highest number of unsaturated bonds as compared to other fats. The iodine number measurements of the beef and chicken fats indicated that the latter contains more unsaturated carboxylic acids. Dynamic viscosity of the beef fat is much higher than that of other studied fats. The synthetic acylglycerols have higher temperature-dependent and shear viscosity as compared to the original fats. The paper presents the results of experimental physicochemical and rheometric studies of animal fats. It is shown that animal fat-based materials may serve as an alternative source of environmentally-friendly lubricants.

  7. Alternative BSE risk assessment methodology for beef and beef offal imported into Japan.

    Science.gov (United States)

    Yoshikawa, Yasuhiro; Horiuchi, Motohiro; Ishiguro, Naotaka; Kadohira, Mutsuyo; Kai, Satoshi; Mizusawa, Hidehiro; Nagata, Chisato; Onodera, Takashi; Sata, Tetsutaro; Tsutsui, Toshiyuki; Yamada, Masahito; Yamamoto, Shigeki

    2012-08-01

    The Food Safety Commission (FSC) of Japan, established in July 2003, has its own initiative to conduct risk assessments on food stuffs known as "self-tasking assessment". Within this framework, the FSC decided to conduct a risk assessment of beef and beef offal imported into Japan from countries with no previous BSE reports; thus, a methodology was formed to suit to this purpose. This methodology was partly based on the previous assessments of Japanese domestic beef and beef imported from U.S.A./Canada, but some modifications were made. Other organizations' assessment methods, such as those used for BSE status assessment in live cattle by the OIE and EFSA's GBR, were also consulted. In this review, the authors introduce this alternative methodology, which reflects (1) the risk of live cattle in the assessed country including temporal risks of BSE invasion and domestic propagation, with the assessment results verified by surveillance data, and (2) the risk of beef and beef offal consisting of cumulative BSE risk by types of slaughtering and meat production processes implemented and the status of mechanically recovered meat production. Other possible influencing factors such as atypical BSE cases were also reviewed. The key characteristic of the current assessment is a combination of the time-sequential risk level of live cattle and qualitative risk level of meat production at present in an assessed country.

  8. Raw milk consumption and health

    Directory of Open Access Journals (Sweden)

    Popović-Vranješ Anka

    2015-01-01

    Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095

  9. Illinois Occupational Skill Standards. Beef Production Cluster.

    Science.gov (United States)

    Illinois Occupational Skill Standards and Credentialing Council, Carbondale.

    This document, which is intended as a guide for workforce preparation program providers, details the Illinois occupational skill standards for programs preparing students for employment in occupations in the beef production cluster. The document begins with a brief overview of the Illinois perspective on occupational skill standards and…

  10. Reactive N emissions from beef cattle feedlots

    Science.gov (United States)

    Large amounts of nitrogen (N) are fed to meet the nutritional needs of beef cattle in feedlots. However, only from 10 to 15% of fed N is retained in animals. Most N is excreted. Chemical and biological processes transform manure N into ammonia, nitrous oxide and nitrate. These reactive forms of ...

  11. Enhance beef cattle improvement by embryo biotechnologies.

    Science.gov (United States)

    Wu, B; Zan, L

    2012-10-01

    Embryo biotechnology has become one of the prominent high businesses worldwide. This technology has evolved through three major changes, that is, traditional embryo transfer (in vivo embryo production by donor superovulation), in vitro embryo production by ovum pick up with in vitro fertilization and notably current cloning technique by somatic cell nuclear transfer and transgenic animal production. Embryo biotechnology has widely been used in dairy and beef cattle industry and commercial bovine embryo transfer has become a large international business. Currently, many developed biotechnologies during the period from early oocyte stage to pre-implantation embryos can be used to create new animal breeds and accelerate genetic progression. Based on recent advances in embryo biotechnologies and authors current studies, this review will focus on a description of the application of this technology to beef cattle improvement and discuss how to use this technology to accelerate beef cattle breeding and production. The main topics of this presentation include the following: (i) how to increase calf production numbers from gametes including sperm and oocyte; (ii) multiple ovulation and embryo transfer breeding schemes; (iii) in vitro fertilization and intracytoplasm sperm injection in bovine; (iv) pronuclear development and transgenic animals; (v) sex selection from sperm and embryos; (vi) cloning and androgenesis; (vii) blastocyst development and embryonic stem cells; (viii) preservation of beef cattle genetic resources; and (ix) conclusions. © 2011 Blackwell Verlag GmbH.

  12. Distinct physicochemical characteristics of different beef from ...

    African Journals Online (AJOL)

    Jane

    2011-04-11

    Apr 11, 2011 ... The essential amino acid (EAA) content were ranked in the descending order of ST >. SV ≥ LD ... corn grit, 1.97% cotton cake, 2.3% vitamin and mineral supplement ..... effects of lactic acid on Qin-chuan beef at different ages.

  13. European consumers' acceptance of beef processing technologies

    DEFF Research Database (Denmark)

    de Barcellos, Marcia Dutra; Kügler, Jens Oliver; Grunert, Klaus G.

    2010-01-01

    adults (19-60 years old) participated in eight focus groups in Spain, France, Germany and the UK. Results suggested a relationship between acceptance of new beef products, technology familiarity and perceived risks related to its application. Excessive manipulation and fear of moving away from 'natural...

  14. Characterization and virulence potential of serogroup O113 Shiga toxin-producing Escherichia coli strains isolated from beef and cattle in the United States

    Science.gov (United States)

    Shiga toxin-producing Escherichia coli (STEC) of serotype O113:H21 have caused severe diseases but are unusual in that they do not produce the intimin protein required for adherence to intestinal epithelial cells. Strains of serogroup O113 are one of the most common STEC found in ground beef and be...

  15. Comparison of external morphological traits of newborns to inner morpholical traits of the dam in the double-muscled Belgian Blue Beef breed.

    NARCIS (Netherlands)

    Coopman, F.; Gengler, N.; Groen, A.F.; Smet, de S.; Zeveren, van A.

    2004-01-01

    In the double-muscled (DM) Belgian Blue Beef (BBB) breed, caesarean section (CS) is used as a routine management tool to prevent dystocia. This practice is criticized on animal welfare grounds. With unassisted (natural) births, difficulties arise because of disproportion between the sizes of the new

  16. A portable detection instrument based on DSP for beef marbling

    Science.gov (United States)

    Zhou, Tong; Peng, Yankun

    2014-05-01

    Beef marbling is one of the most important indices to assess beef quality. Beef marbling is graded by the measurement of the fat distribution density in the rib-eye region. However quality grades of beef in most of the beef slaughtering houses and businesses depend on trainees using their visual senses or comparing the beef slice to the Chinese standard sample cards. Manual grading demands not only great labor but it also lacks objectivity and accuracy. Aiming at the necessity of beef slaughtering houses and businesses, a beef marbling detection instrument was designed. The instrument employs Charge-coupled Device (CCD) imaging techniques, digital image processing, Digital Signal Processor (DSP) control and processing techniques and Liquid Crystal Display (LCD) screen display techniques. The TMS320DM642 digital signal processor of Texas Instruments (TI) is the core that combines high-speed data processing capabilities and real-time processing features. All processes such as image acquisition, data transmission, image processing algorithms and display were implemented on this instrument for a quick, efficient, and non-invasive detection of beef marbling. Structure of the system, working principle, hardware and software are introduced in detail. The device is compact and easy to transport. The instrument can determine the grade of beef marbling reliably and correctly.

  17. Use of a novel medium, the Polymyxin Ceftazidime Oxford Medium, for isolation of Listeria monocytogenes from raw or non-pasteurized foods.

    Science.gov (United States)

    Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A

    2016-05-01

    Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries.

  18. Beef Species Symposium: an assessment of the 1996 Beef NRC: metabolizable protein supply and demand and effectiveness of model performance prediction of beef females within extensive grazing systems.

    Science.gov (United States)

    Waterman, R C; Caton, J S; Löest, C A; Petersen, M K; Roberts, A J

    2014-07-01

    Interannual variation of forage quantity and quality driven by precipitation events influence beef livestock production systems within the Southern and Northern Plains and Pacific West, which combined represent 60% (approximately 17.5 million) of the total beef cows in the United States. The beef cattle requirements published by the NRC are an important tool and excellent resource for both professionals and producers to use when implementing feeding practices and nutritional programs within the various production systems. The objectives of this paper include evaluation of the 1996 Beef NRC model in terms of effectiveness in predicting extensive range beef cow performance within arid and semiarid environments using available data sets, identifying model inefficiencies that could be refined to improve the precision of predicting protein supply and demand for range beef cows, and last, providing recommendations for future areas of research. An important addition to the current Beef NRC model would be to allow users to provide region-specific forage characteristics and the ability to describe supplement composition, amount, and delivery frequency. Beef NRC models would then need to be modified to account for the N recycling that occurs throughout a supplementation interval and the impact that this would have on microbial efficiency and microbial protein supply. The Beef NRC should also consider the role of ruminal and postruminal supply and demand of specific limiting AA. Additional considerations should include the partitioning effects of nitrogenous compounds under different physiological production stages (e.g., lactation, pregnancy, and periods of BW loss). The intent of information provided is to aid revision of the Beef NRC by providing supporting material for changes and identifying gaps in existing scientific literature where future research is needed to enhance the predictive precision and application of the Beef NRC models.

  19. A DECISION SUPPORT AID FOR BEEF CATTLE INVESTMENT USING EXPERT SYSTEMS

    OpenAIRE

    Lawrence L. Falconer; Long, Charles R.; McGrann, James M.

    1996-01-01

    The beef cattle investment decision provides an excellent opportunity to increase the economic efficiency of beef cattle production. The investment questions that face beef cattle producers are of interest to beef cattle producers, educators, and financial institutions involved in lending to beef cattle producing firms. This study develops a decision support aid utilizing expert system technology to assist beef cattle producers in making well-founded investment decisions with respect to the f...

  20. A Higher Prevalence Rate of Campylobacter in Retail Beef Livers Compared to Other Beef and Pork Meat Cuts

    Science.gov (United States)

    Noormohamed, Aneesa; Fakhr, Mohamed K.

    2013-01-01

    The objectives of this study were to determine the prevalence of Campylobacter jejuni and Campylobacter coli in retail beef, beef livers, and pork meats purchased from the Tulsa (OK, USA) area and to further characterize the isolates obtained through antimicrobial susceptibility testing. A total of 97 chilled retail beef (50 beef livers and 47 other cuts), and 100 pork samples were collected. The prevalence of Campylobacter in beef livers was 39/50 (78%), while no Campylobacter was isolated from the other beef cuts. The prevalence in pork samples was 2/100 (2%). A total of 108 Campylobacter isolates (102 beef livers isolates and six pork isolates) were subjected to antimicrobial resistance profiling against sixteen different antimicrobials that belong to eight different antibiotic classes. Of the six pork Campylobacter coli isolates, four showed resistance to all antimicrobials tested. Among the beef liver isolates, the highest antibiotic resistances were to tetracyclines and β-lactams, while the lowest resistances were to macrolides, aminoglycosides, lincosamides, and phenicols. Resistances to the fluoroquinolone, macrolide, aminoglycoside, tetracycline, β-lactam, lincosamide, and phenicol antibiotic classes were significantly higher in Campylobacter coli than Campylobacter jejuni isolates. Multidrug Resistance (MDR) among the 102 Campylobacter (33 Campylobacter jejuni and 69 Campylobacter coli) beef liver isolates was significantly higher in Campylobacter coli (62%) than Campylobacter jejuni (39%). The high prevalence of Campylobacter in retail beef livers and their antimicrobial resistance raise concern about the safety of these retail products. PMID:23698698

  1. Use of ensiled straw and beef cattle manure for feeding fattening young bulls. 2. Toxicological and microbiological aspects

    Energy Technology Data Exchange (ETDEWEB)

    Pace, V.; De Michelis, F.; Fontanelli, G.; Molossini, F.

    1980-06-01

    A mixture of straw 38%, beef cattle manure 52% and ground corn 10% was ensiled in about 15 cubic meters plastic bag silos. Biogenic amines (histamine, tyramine, putrescine and cadaverine) were determined in fresh faces and in the silage: the total content was respectively 37.0 and 33.3 mg/100 g D.M. Microbial population decreased after ensiling; pathogenic staphylococci, Cl. perfringens and salmonellae were not detected before nor after ensiling.

  2. European consumer response to packaging technologies for improved beef safety.

    Science.gov (United States)

    Van Wezemael, Lynn; Ueland, Øydis; Verbeke, Wim

    2011-09-01

    Beef packaging can influence consumer perceptions of beef. Although consumer perceptions and acceptance are considered to be among the most limiting factors in the application of new technologies, there is a lack of knowledge about the acceptability to consumers of beef packaging systems aimed at improved safety. This paper explores European consumers' acceptance levels of different beef packaging technologies. An online consumer survey was conducted in five European countries (n=2520). Acceptance levels among the sample ranged between 23% for packaging releasing preservative additives up to 73% for vacuum packaging. Factor analysis revealed that familiar packaging technologies were clearly preferred over non-familiar technologies. Four consumer segments were identified: the negative (31% of the sample), cautious (30%), conservative (17%) and enthusiast (22%) consumers, which were profiled based on their attitudes and beef consumption behaviour. Differences between consumer acceptance levels should be taken into account while optimising beef packaging and communicating its benefits.

  3. MICROBIOLOGICAL AND PHYSICAL PROPERTIES OF BEEF MARINATED WITH GARLIC JUICE

    Directory of Open Access Journals (Sweden)

    Nurwantoro

    2011-09-01

    Full Text Available The study was carried out to investigate the effect of marination, performed by soaking of beef in garlic juice, on microbiological and physical properties. The study was committed to a completely randomized design, with 5 treatments, i.e.: T0 (unmarinated beef, as a control, T1, T2, T3, and T4 that beef were marinated in garlic juice for 5, 10, 15, and 20 minutes, respectively, at room temperature (25⁰C. Each treatment consisted of 4 replications. Examination upon experimental parameters was conducted after marinated (and control beef was stored for 8 hours at room temperature. Total bacteria, total coliform and water holding capacity of beef were significantly (P0.05 by the treatments. As a conclusion, marination of beef with garlic juice could reduce total bacteria, total coliform, and water holding capacity, but could not reduce cooking loss.

  4. Prediction of the fatty acid composition of beef by near infrared transmittance spectroscopy.

    Science.gov (United States)

    Sierra, V; Aldai, N; Castro, P; Osoro, K; Coto-Montes, A; Oliván, M

    2008-03-01

    The intramuscular fat content and composition influence consumer selection of meat products. A study predicting the fatty acid (FA) profile of ground beef from the Longissimus thoracis of yearling bulls (n=100) using near infrared transmittance spectroscopy (NIT) was conducted. The samples were scanned using an Infratec 1265 Meat Analyzer which operates in transmittance mode from 850 to 1050nm. NIT technology was able to accurately predict (R(CV)(2) over 0.76) some prominent FAs such as C14:0, C16:0, C16:1cis9, C17:0, C18:1cis9 and C18:1cis11, and minor FAs like C13:0, C15:0, C17:1cis9 and C18:1cis13. When studying FA groups, NIT spectra were able to accurately predict saturated (R(CV)(2)=0.837), branched (R(CV)(2)=0.701) and monounsaturated (R(CV)(2)=0.852) FAs. In addition, NIT spectra provided useful information on the contents of conjugated linoleic acids (CLA) in beef. These results show the potential of NIT technique as a rapid and easy tool to predict the major FAs in beef, especially those located in triglycerides.

  5. Detection of Escherichia coli O157 in raw and cooked meat: comparison of conventional direct culture method and Enzyme Linked Fluorescent Assay (ELFA

    Directory of Open Access Journals (Sweden)

    Maria De Giusti

    2011-03-01

    Full Text Available

    Abstract
    Background: Verocytotoxin Escherichia coli is a frequent and important cause of diarrhea and haemolytic uremic syndrome all over the world. Consumption of ground beef, lettuce, and other kinds of food have been associated with outbreaks.
    The aim of this study was to detect the presence of E. coli O157 in meat products collected from hospital food catering services in Rome, using a rapid detection method in comparison with a standard culture method to verify the effectiveness of HACCP system.
    Methods: Three hundred and ten food samples (80 of cooked and 230 of raw meat were screened for E.coli O157 by ISO culture method and by enzyme-linked-fluorescent-assay (ELFA-based methods
    (VIDAS®system, bioMérieux. All isolates obtained were tested for VT1 and VT2 genes by PCR. The statistical analysis considered absolute frequencies and percentages. The K statistic was applied to assess agreement between direct culture method and the VIDAS system.
    Results: A total of 6 (1,9% E.coli O157 isolates were recovered from raw meat samples by the culture method; of these only four were identified by PCR as VTEC producers. A total of 9 (2,9% E.coli O157 isolates were recovered from raw meat samples by the VIDAS® system. No E.coli O157 was detected in cooked products. All comparisons between the direct culture method and the VIDAS system were
    statistically significant (K= 0,795; p<0.001.
    Conclusions: The present study showed how ELFA-based methods are highly specific and rapid for the detection of E.coli O157 in food samples compared with the direct culture method. ELFA method is useful to verify the effectiveness of the HACCP system in the risk management of potential contaminating hazards during the preparation of foods for susceptible persons.

  6. Beef production in Romania (2010-2012

    Directory of Open Access Journals (Sweden)

    eleonora nistor

    2013-10-01

    Full Text Available The purpose of the statistics is to show changes in the size and value of total production of animals for slaughtering and meat analyzed by use. Due to the interest of breeders and specialists from our country in specialized breeds of cattle meat production is increasing, the purpose of this paper is to present the evolution of beef production over the last three years. The number of animals slaughtered decreased steadily from 2010 to 2012. Most slaughter, were done in the second half of the years in which research was made. The largest number of cattle were slaughtered in December 2010, and the fewest (with 62.32% less in January 2012. Total slaughter is declining, but a higher number of animals are slaughtered in official slaughterhouses, at a higher weight. As a consequence, beef production is forecast to remain relatively stagnant.

  7. Isolation and characterization of non-O157 Shiga toxin-producing Escherichia coli from beef carcasses, cuts and trimmings of abattoirs in Argentina

    Science.gov (United States)

    Brusa, Victoria; Restovich, Viviana; Galli, Lucía; Teitelbaum, David; Signorini, Marcelo; Brasesco, Hebe; Londero, Alejandra; García, Diego; Padola, Nora Lía; Superno, Valeria; Sanz, Marcelo; Petroli, Sandra; Costa, Magdalena; Bruzzone, Mariana; Sucari, Adriana; Ferreghini, Marcela; Linares, Luciano; Suberbie, Germán; Rodríguez, Ricardo

    2017-01-01

    Several foods contaminated with Shiga toxin-producing Escherichia coli (STEC) are associated with human diseases. Some countries have established microbiological criteria for non-O157 STEC, thus, the absence of serogroups O26, O45, O103, O104, O111, O121, and O145 in sprouts from the European Union or ground beef and beef trimmings from the United States is mandatory. While in Argentina screening for O26, O103, O111, O145 and O121 in ground beef, ready-to-eat food, sausages and vegetables is mandatory, other countries have zero-tolerance for all STEC in chilled beef. The aim of this study was to provide data on the prevalence of non-O157 STEC isolated from beef processed in eight Argentinean cattle slaughterhouses producing beef for export and local markets, and to know the non-O157 STEC profiles through strain characterization and genotypic analysis. Samples (n = 15,965) from 3,205 beef carcasses, 9,570 cuts and 3,190 trimmings collected between March and September 2014 were processed in pools of five samples each. Pools of samples (n = 3,193) from 641 carcasses, 1,914 cuts and 638 trimming were analyzed for non-O157 STEC isolation according to ISO/CEN 13136:2012. Of these, 37 pools of carcasses (5.8%), 111 pools of cuts (5.8%) and 45 pools of trimmings (7.0%) were positive for non-O157 STEC. STEC strains (n = 200) were isolated from 193 pools of samples. The most prevalent serotypes were O174:H21, O185:H7, O8:H19, O178:H19 and O130:H11, and the most prevalent genotypes were stx2c(vh-b) and stx2a/saa/ehxA. O103:H21 strain was eae-positive and one O178:H19 strain was aggR/aaiC-positive. The prevalence of non-O157 STEC in beef carcasses reported here was low. None of the non-O157 STEC strains isolated corresponded to the non-O157 STEC serotypes and virulence profiles isolated from human cases in Argentina in the same study period. The application of microbiological criteria for each foodstuff should be determined by risk analysis in order to have a stringent

  8. Campylobacter in poultry, pork and beef

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Carroll, C.; Rudi, K.

    2011-01-01

    Campylobacter infection has become one of the most important zoonoses worldwide. A low prevalence of Campylobacter is generally found in beef and pork at retail, although they may still be sources of infection. Based on the high prevalence of poultry-associated infections, this chapter mainly foc...... positive samples to produce isolates for further characterization. The choice of a rapid method will always depend on the requested information and be influenced by the relevant matrix and the expected level of contamination....

  9. Beef cattle growing and backgrounding programs.

    Science.gov (United States)

    Peel, Derrell S

    2003-07-01

    The stocker industry is one of many diverse production and marketing activities that make up the United States beef industry. The stocker industry is probably the least understood industry sector and yet it plays a vital role in helping the industry exploit its competitive advantage of using forage resources and providing an economical means of adjusting the timing and volume of cattle and meat in a complex market environment.

  10. Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

    Energy Technology Data Exchange (ETDEWEB)

    Castejón, David [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); García-Segura, Juan Manuel [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Escudero, Rosa [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain); Herrera, Antonio [Departamento de Química Orgánica, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Cambero, María Isabel, E-mail: icambero@vet.ucm.es [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain)

    2015-12-11

    In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by {sup 1}H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

  11. Environmental Awareness on Beef Cattle Technology

    Directory of Open Access Journals (Sweden)

    Abdullah M Bamualim

    2008-09-01

    Full Text Available The acceleration program to meet beef self sufficient in 2010 is expected to increase animal protein consumption of Indonesian people in order to be equal with other countries as well as to improve the livestock farmer’s income. The main objective of the program is to increase cattle population. Since the availability of forage and grassland is limited, beef cattle development is driven to the crop and plantation integration approach by using their by-product as cattle feed. Crop and plantation by-products, generally are considered to be fiber source with high lignocellulose’s and low nutritive value. Feeding high fiber would increase methane gas production, and faeces and grass cultivation also contributed on greenhouse emission. Methane is one of the main greenhouse gases contributed by agriculture sector; increasing beef cattle population using high fiber feed is predicted to increase methane production. Good management is expected to improve productivity and to reduce methane production on livestock. Some efforts could be done such as good feeding management and nutrition manipulation, environment friendly cattle waste management, improving management on roughage cultivation, and improving management on cattle production.

  12. Preprocessing of raw metabonomic data.

    Science.gov (United States)

    Vettukattil, Riyas

    2015-01-01

    Recent advances in metabolic profiling techniques allow global profiling of metabolites in cells, tissues, or organisms, using a wide range of analytical techniques such as nuclear magnetic resonance (NMR) spectroscopy and mass spectrometry (MS). The raw data acquired from these instruments are abundant with technical and structural complexity, which makes it statistically difficult to extract meaningful information. Preprocessing involves various computational procedures where data from the instruments (gas chromatography (GC)/liquid chromatography (LC)-MS, NMR spectra) are converted into a usable form for further analysis and biological interpretation. This chapter covers the common data preprocessing techniques used in metabonomics and is primarily focused on baseline correction, normalization, scaling, peak alignment, detection, and quantification. Recent years have witnessed development of several software tools for data preprocessing, and an overview of the frequently used tools in data preprocessing pipeline is covered.

  13. Culture medium for selective isolation and enumeration of Gram-negative bacteria from ground meats.

    OpenAIRE

    Cyzeska, F J; Seiter, J A; Marks, S N; Jay, J M

    1981-01-01

    We developed a new medium, designated peptone bile amphotericin cycloheximide (PBAC) agar, which contains (per liter) 10 g of peptone, 300 mg of bile salts, 1 mg of amphotericin B, 1 g of cycloheximide, and 15 g of agar. When 21 samples of fresh ground beef were studied and plate count agar counts were used as references, we obtained a mean recovery of 28% of total counts with violet red bile agar overlay, whereas we obtained 48% recovery with PBAC agar. With 12 samples of frozen ground beef,...

  14. The effect of meat cuts and thermal processing on selected mineral concentration in beef from Holstein-Friesian bulls.

    Science.gov (United States)

    Czerwonka, Małgorzata; Szterk, Arkadiusz

    2015-07-01

    The impact of meat cuts (nine muscles and liver) and thermal processing on selected mineral (potassium, sodium, phosphorus, magnesium, zinc, iron, including heme form) concentration in beef from Holstein-Friesian bulls was evaluated in the present study. The mineral's content widely varied depending on the tissue type (skeletal muscles/liver, except zinc) and between the different bovine muscles. The greatest diversity between the muscles demonstrated was zinc (3.5-6.9 mg 100 g(-1)f/w) and iron (1.7-2.3 mg 100 g(-1)f/w), however, there were no significant differences in heme iron to total iron ratio (average 74%). Thermal processes conducted on longissimus dorsi muscles also significantly affected mineral concentration. Grilled, roasted and fried bovine meat was characterised by a higher content (by 6-26%) of most studied minerals (except sodium) as compared to raw meat. Sodium levels in processed meat were 16-33% lower than in raw samples.

  15. Method Modification of the Thermo Scientific SureTect Listeria monocytogenes Assay for Raw Meat, Dairy, Produce, and Seafood.

    Science.gov (United States)

    Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko

    2015-01-01

    The Thermo Scientific™ SureTect™ Listeria monocytogenes assay is a real-time PCR assay for the detection of Listeria monocytogenes in food and environmental samples, which was certified during 2013 by the AOAC Research Institute (RI) as Performance Tested Method(SM) (PTM) 061302 for a representative range of key food matrixes and production surfaces. This report details the method modification study, which was conducted during 2014, using the AOAC-RI PTM program to extend the validated matrix claims of the assay in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996, including Amendment 1:2004, to gain certification for raw ground turkey, raw ground pork, pasteurized 2% milk, raw pork sausages, raw cod, pasteurized brie cheese, cooked sliced ham, and bagged lettuce. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, brie cheese, bagged lettuce, and raw cod were analyzed independently by the University of Guelph, Canada, during the AOAC-RI controlled independent laboratory study. Using probability of detection (POD) statistical analysis, a significant difference was demonstrated between the candidate and reference methods for the high spiking level with raw ground pork and brie cheese. For all other matrixes and the low spiked levels for raw ground pork and brie cheese, no significant difference by POD was seen between the two methods during the study.

  16. Toxinotyping and antimicrobial susceptibility of enterotoxigenic Clostridium perfringens isolates from mutton, beef and chicken meat.

    Science.gov (United States)

    Khan, Madiha; Nazir, Jawad; Anjum, Aftab Ahmad; Ahmad, Mansur-Ud-Din; Nawaz, Muhammad; Shabbir, Muhammad Zubair

    2015-08-01

    A total of 300 meat samples comprising mutton, beef, and chicken meat (n = 100) collected from either local butcher shops or large meat outlets situated at various areas of Lahore City located in Punjab province of Pakistan were tested for the isolation of Clostridium perfringens. Prevalence of the organism was highest in the chicken (6 %) followed by mutton (5 %) and beef (1 %). Contamination level was high (10/150) in the samples collected from local butcher shops in comparison to the samples collected from large meat outlets (2/150). All of the raw meat samples were negative for the presence of alpha, beta and epsilon toxins of C. perfringens as detected through ELISA. Out of a total number of 12 isolates only half were capable of producing enterotoxins when cultured in trypticase glucose yeast (TGY) broth. Toxinotyping of the isolates showed that 3 were of type A while one each of the remaining three belonged to type B, C, and D. Antibiotic susceptibility testing of the toxin producing isolates revealed that C. perfringens were susceptible to chloramphenicol, ciprofloxacin, metronidazole, and ceftriaxone. All of the other drugs were relatively less effective with a least activity of amoxicillin against the isolates.

  17. Physicochemical, microbiological and sensory evaluation of beef patties incorporated with destoned olive cake powder.

    Science.gov (United States)

    Hawashin, Majed D; Al-Juhaimi, Fahad; Ahmed, Isam A Mohamed; Ghafoor, Kashif; Babiker, Elfadil E

    2016-12-01

    The biological efficacy of different concentrations (2%, 4%, and 6%) of destoned olive cake (DOC) as improvers of the quality, storability, and safety of beef patties was investigated. Increasing the percentage of DOC in the patties improved (P≤0.05) the protein and fat contents, cooking yield, moisture and fat retention, total phenolic, and DPPH radical scavenging activity, while the dimensional shrinkage and TBARS showed a progressive reduction. The pH of the patties decreased gradually with the storage time. DOC-incorporated patties showed significantly (P≤0.05) lower total plate count than untreated. Surface color values of raw beef patties were decreased gradually with the storage time. Throughout the storage period, all the sensory traits of non-formulated patties were significantly (P≤0.05) reduced, whereas the formulated patties revealed considerable stability of all characters. Overall, this study identified antioxidant and antimicrobial potentiality of DOC, which could pave the way for its use as an extender of the shelf life of the patties.

  18. Inhibitory Effect of Lactococcin BZ Against Listeria innocua and Indigenous Microbiota of Fresh Beef.

    Science.gov (United States)

    Yıldırım, Zeliha; Yerlikaya, Sabire; Öncül, Nilgün; Sakin, Tuba

    2016-09-01

    In this study, the effect of lactococcin BZ on microbiological quality of fresh beef is investigated. For this purpose, the meat samples were treated with various amounts of lactococcin BZ (200-2500 AU/mL), a bacteriocin produced by Lactococcus lactis spp. lactis BZ, and kept at 4-5 °C for 12 days. During storage, the microbiological properties of the meat samples with or without lactococcin BZ were determined. Inhibitory effect of lactococcin BZ depended on its amount. The higher the amount of lactococcin BZ, the higher the inhibitory activity. Treatment with lactococcin BZ at the level of 2500 AU/mL resulted in 4.87, 3.50 and 3.94 log cycle decrease in the counts of mesophilic, psychrotrophic and lactic acid bacteria, respectively, and 1.90·10(4) and 1.04·10(2) CFU/g reduction in coliform and faecal coliform bacteria, respectively, at the end of storage as compared to their initial numbers in the control sample. However, the counts of these bacteria in control samples increased during storage. Also, lactococcin BZ at 1600 AU/mL showed very strong antilisterial effect against Listeria innocua in fresh meat and reduced the cell numbers from 6.04 log CFU/g to undetectable level on the 6th day of storage. In conclusion, lactococcin BZ has a potential use as a biopreservation agent to improve safety and shelf life of raw beef.

  19. Inhibitory Effect of Lactococcin BZ Against Listeria innocua and Indigenous Microbiota of Fresh Beef

    Science.gov (United States)

    Yerlikaya, Sabire; Öncül, Nilgün; Sakin, Tuba

    2016-01-01

    Summary In this study, the effect of lactococcin BZ on microbiological quality of fresh beef is investigated. For this purpose, the meat samples were treated with various amounts of lactococcin BZ (200–2500 AU/mL), a bacteriocin produced by Lactococcus lactis spp. lactis BZ, and kept at 4–5 °C for 12 days. During storage, the microbiological properties of the meat samples with or without lactococcin BZ were determined. Inhibitory effect of lactococcin BZ depended on its amount. The higher the amount of lactococcin BZ, the higher the inhibitory activity. Treatment with lactococcin BZ at the level of 2500 AU/mL resulted in 4.87, 3.50 and 3.94 log cycle decrease in the counts of mesophilic, psychrotrophic and lactic acid bacteria, respectively, and 1.90·104 and 1.04·102 CFU/g reduction in coliform and faecal coliform bacteria, respectively, at the end of storage as compared to their initial numbers in the control sample. However, the counts of these bacteria in control samples increased during storage. Also, lactococcin BZ at 1600 AU/mL showed very strong antilisterial effect against Listeria innocua in fresh meat and reduced the cell numbers from 6.04 log CFU/g to undetectable level on the 6th day of storage. In conclusion, lactococcin BZ has a potential use as a biopreservation agent to improve safety and shelf life of raw beef. PMID:27956863

  20. CO2 Capture by Cement Raw Meal

    DEFF Research Database (Denmark)

    Pathi, Sharat Kumar; Lin, Weigang; Illerup, Jytte Boll

    2013-01-01

    The cement industry is one of the major sources of CO2 emissions and is likely to contribute to further increases in the near future. The carbonate looping process has the potential to capture CO2 emissions from the cement industry, in which raw meal for cement production could be used...... as the sorbent. Cyclic experiments were carried out in a TGA apparatus using industrial cement raw meal and synthetic raw meal as sorbents, with limestone as the reference. The results show that the CO2 capture capacities of the cement raw meal and the synthetic raw meal are comparable to those of pure limestone...... that raw meal could be used as a sorbent for the easy integration of the carbonate looping process into the cement pyro process for reducing CO2 emissions from the cement production process....

  1. CO2 Capture by Cement Raw Meal

    DEFF Research Database (Denmark)

    Pathi, Sharat Kumar; Lin, Weigang; Illerup, Jytte Boll

    2013-01-01

    The cement industry is one of the major sources of CO2 emissions and is likely to contribute to further increases in the near future. The carbonate looping process has the potential to capture CO2 emissions from the cement industry, in which raw meal for cement production could be used...... as the sorbent. Cyclic experiments were carried out in a TGA apparatus using industrial cement raw meal and synthetic raw meal as sorbents, with limestone as the reference. The results show that the CO2 capture capacities of the cement raw meal and the synthetic raw meal are comparable to those of pure limestone....... The CO2 capture capacity of limestone in the raw meal is lower than for pure limestone. The difference in the CO2 capture capacity decreases with an increase in cycle number. The calcination conditions and composition are major factors that influence the CO2 capture capacity of limestone. At 850 °C in N2...

  2. Evaluation of nutrient digestibility and fecal characteristics of exotic felids fed horse- or beef-based diets: use of the domestic cat as a model for exotic felids.

    Science.gov (United States)

    Vester, Brittany M; Beloshapka, Alison N; Middelbos, Ingmar S; Burke, Sarah L; Dikeman, Cheryl L; Simmons, Lee G; Swanson, Kelly S

    2010-01-01

    The objective of this study was to determine the effects of feeding commercially available beef- and horse-based diets on nutrient digestibility and fecal characteristics of large captive exotic felids and domestic cats. Four species of large exotic felids including cheetahs, Malayan tigers, jaguars, and Amur tigers, and domestic cats were utilized in a crossover design. Raw meat diets included a beef-based diet (57% protein; 28% fat) and a horse-based diet (51% protein; 30% fat). All cats were acclimated to the diet for 16 days followed by a 4 day collection period, where total feces, including one fresh sample, were collected. All feces were scored on collection. Intake did not differ due to diet, but fecal output was greater when cats consumed the horse-based diet. Total tract apparent dry matter (DM) digestibility was higher (Phorse-based diet. CP digestibility was similar in domestic cats and cheetahs, and greater (Phorse-based diet compared with the beef-based diet. Domestic cats had lower (Phorse-based diet. Fecal total short-chain fatty acid (SCFA), branched-chain fatty acid (BCFA), and butyrate concentrations were higher (P<0.05) when cats consumed the beef-based diet. Our results suggest that the domestic cat serves as an appropriate model for large exotic felid species, but differences among the species exist. Decreased nutrient digestibility by tigers and jaguars should be considered when developing feeding recommendations for these species based on domestic cat data.

  3. Effects of microbial transglutaminase, fibrimex and alginate on physicochemical properties of cooked ground meat with reduced salt level.

    Science.gov (United States)

    Atilgan, Esra; Kilic, Birol

    2017-02-01

    Effects of microbial transglutaminase (MTGase), fibrin/thrombin combination (fibrimex), alginate or combination of these binding agents on physicochemical parameters of cooked ground beef with reduced salt level were investigated. Seventeen treatments included three control (no binding agent) groups incorporated with varying concentrations of salt (0.5, 1, 2%, w/w) and fourteen treatment groups produced with MTGase or fibrimex or alginate or their combinations at 0.5 or 1% salt levels. The samples were analyzed for cooking loss (CL), pH, color, moisture, fat, protein, ash, salt, texture and TBARS. The results indicated that the use of MTGase or fibrimex or MTGase/fibrimex combination had significant effect on preventing textural deterioration caused by salt reduction. Even though the use of MTGase resulted in higher CL values, formulation of ground beef with fibrimex or alginate or MTGase/fibrimex/alginate combinations reduced CL when compared with the control groups. The use of fibrimex in ground beef resulted in a decrease in TBARS, lightness, redness and pH values. However, the use of alginate caused an increase in pH, lightness and redness values of ground beef. Based on the present study, the use of fibrimex or a combination of fibrimex with MTGase in the product formulation can be an effective strategy to reduce cooking loss, to improve or maintain the textural properties and to extend shelf life of cooked ground beef with reduced salt level.

  4. Photoshop CS3 RAW Transforming your RAW data into works of art

    CERN Document Server

    Aaland, Mikkel

    2008-01-01

    Because RAW files remain virtually untouched by in-camera processing, working with them has given digital photographers greater flexibility and control during the editing process -- for those who are familiar enough with the format. Camera RAW, the plug in for Adobe Photoshop CS3, has emerged as one of the best and most familiar tools for editing RAW images, and the best way to master this workflow is with Photoshop CS3 RAW. Award-winning author Mikkel Aaland explores the entire RAW process, from the practical reasons to shoot RAW, to managing the images with the new features of Bridge 2.0 n

  5. Economic viability of beef cattle grazing systems under prolonged drought

    Science.gov (United States)

    Prolonged drought in the Southern Great Plains of the USA in recent years has raised concerns about vulnerability of beef cattle grazing systems under adverse climate change. To help address the economic viability of beef grazing operations in the Southern Great Plains, this paper provides an econom...

  6. Development of breeding objectives for beef cattle breeding ...

    African Journals Online (AJOL)

    Mnr J F Kluyts

    The purpose of this article is to review the development of breeding objectives in beef cattle ... selection criteria, and estimation of phenotypic and genetic parameters. ... Unfortunately, the evolution from a performance .... The beef cattle industry has a history of chasing and promoting maximum values (e.g. maximum weight).

  7. 9 CFR 319.81 - Roast beef parboiled and steam roasted.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Roast beef parboiled and steam roasted... beef parboiled and steam roasted. “Roast Beef Parboiled and Steam Roasted” shall be prepared so that... of the fresh beef weight. Transglutaminase enzyme at levels of up to 65 ppm may be used as a...

  8. Beef-cattle producers benefit from Extension-managed process verification programs

    OpenAIRE

    Sutphin, Michael D.

    2009-01-01

    The most recent data from the U.S. Census of Agriculture shows that Virginia's beef producers face a myriad of challenges. Virginia Cooperative Extension is working with the beef-cattle industry to boost profits and add value to Virginia's beef products by training and educating producers about process verification programs that certify the age and source of beef cattle.

  9. PREFERENCES AND BUYING BEHAVIOUR OF BEEF CONSUMERS IN TUSCANY

    Directory of Open Access Journals (Sweden)

    Marija RADMAN

    2005-07-01

    Full Text Available Tuscany, probably the most famous Italian region, is known because of many typical food specialities. One of them is the “fi orentina” - a thick, fi rst quality beef, called after the name of the city of Florence. However, recent trends in consumers’ behaviour and the BSE crisis have affected the attitude of consumers toward such products. In this study are presented the results of a mail survey about beef consumption and preferences that was conducted in Tuscany in May 2002. The survey showed that, despite recent food scares and new consumption behaviour, Tuscany consumers still like and prefer beef that has guarantees of quality. Therefore, there are good market opportunities for the Italian and foreign beef producers in Tuscany if they will provide consumers with not only good quality beef, but also more information about the meat.

  10. MICROBIOLOGICAL AND PHYSICAL PROPERTIES OF BEEF MARINATED WITH GARLIC JUICE

    Directory of Open Access Journals (Sweden)

    N. Nurwantoro

    2014-10-01

    Full Text Available The study was carried out to investigate the effect of marination, performed by soaking of beef ingarlic juice, on microbiological and physical properties. The study was committed to a completelyrandomized design, with 5 treatments, i.e.: T0 (unmarinated beef, as a control, T1, T2, T3, and T4 thatbeef were marinated in garlic juice for 5, 10, 15, and 20 minutes, respectively, at room temperature(25⁰C. Each treatment consisted of 4 replications. Examination upon experimental parameters wasconducted after marinated (and control beef was stored for 8 hours at room temperature. Total bacteria,total coliform and water holding capacity of beef were significantly (P<0.05 affected by marinationwith garlic juice. Conversely, cooking loss was not significantly affected (P>0.05 by the treatments. Asa conclusion, marination of beef with garlic juice could reduce total bacteria, total coliform, and waterholding capacity, but could not reduce cooking loss.

  11. Consumers' quality perception of national branded, national store branded, and imported store branded beef

    DEFF Research Database (Denmark)

    Banovic, Marija; Grunert, Klaus G.; Barreira, Maria Madalena

    2010-01-01

    This study investigated the differences in the consumers' quality perception of national branded, national store branded, and imported store branded beef. Partial Least Squares analysis is used for modelling the quality perception process. Results show that consumers perceived national branded...... Carnalentejana beef, as better on all quality cues and quality aspects than the other two store branded beefs. Preference for Carnalentejana beef stayed highly consistent even after the blind test, where consumers differentiated this beef from the other two beef brands on all sensory dimensions: taste......, tenderness, and juiciness, and chose it as the preferred one. Consumers utilized more perceived intrinsic cues to infer expected eating quality of store branded beefs....

  12. Determination of protein markers for beef tenderness in U. S. select beef

    Science.gov (United States)

    Objectives: Beef tenderness is a primary quality feature that defines the consumer’s perception of the product quality. Therefore definition of chemical characteristics that contribute to variation in tenderness within a specific USDA grade can help refine our understanding of meat tenderness. The o...

  13. Characteristics, socioeconomic benefits and household livelihoods of beef buffalo and beef cattle farming in Northeast Thailand

    Directory of Open Access Journals (Sweden)

    Eva Schlecht

    2012-01-01

    Full Text Available Since the Thai economy experiences rapid growth, agricultural systems, i.e. crop-livestock systems, are changing rapidly. On account of these changes, buffalo and cattle production has to be re-examined in terms of performance characteristics and roles of livestock for farm households in order to initiate suitable development programmes. Therefore, this study aimed to investigate the present characteristics of beef buffalo and beef cattle farms in Northeast Thailand. Using a semi-structured questionnaire, 121 randomly selected beef buffalo and beef cattle farms were interviewed in Nakhon Ratchasima province between October 2007 and May 2008. Both buffaloes and cattle were mostly integrated in mixed crop-livestock systems with medium to large farm sizes (7.9 ha, whereof less than half of the area was used for livestock. Family members were mainly responsible for the different activities of livestock farming and salaried labourers were only found on large-scale farms. The dominant roles of livestock were income generation to build up wealth or savings, the coverage of expected and unexpected expenses and earning of regular and additional income. Another important issue was the improvement of the social status, which increased with herd size. In order to improve farmers’ livelihoods and develop sustainable farming systems in Northeast Thailand the changing economic circumstances of cattle and especially buffalo production should receive more attention of researchers, governmental institutions and stakeholders.

  14. Fecal microbial communities of healthy adult dogs fed raw meat-based diets with or without inulin or yeast cell wall extracts as assessed by 454 pyrosequencing.

    Science.gov (United States)

    Beloshapka, Alison N; Dowd, Scot E; Suchodolski, Jan S; Steiner, Jörg M; Duclos, Laura; Swanson, Kelly S

    2013-06-01

    Our objective was to determine the effects of feeding raw meat-based diets with or without inulin or yeast cell wall extract (YCW) on fecal microbial communities of dogs using 454 pyrosequencing. Six healthy female adult beagles (5.5 ± 0.5 years; 8.5 ± 0.5 kg) were randomly assigned to six test diets using a Latin square design: (1) beef control; (2) beef + 1.4% inulin; (3) beef + 1.4% YCW; (4) chicken control; (5) chicken + 1.4% inulin; and (6) chicken + 1.4% YCW. Following 14 days of adaptation, fresh fecal samples were collected on day 15 or day 16 of each period. Fecal genomic DNA was extracted and used to create 16S rRNA gene amplicons, which were subjected to 454 pyrosequencing and qPCR. Predominant fecal bacterial phyla included Fusobacteria, Firmicutes, Bacteroidetes, and Proteobacteria. Beef-based diets increased (P Inulin decreased (P Inulin increased (P Inulin also decreased (P inulin and control and inulin increased (P inulin or YCW consumption, a strong prebiotic effect was not observed.

  15. Grounded theory.

    Science.gov (United States)

    Harris, Tina

    2015-04-29

    Grounded theory is a popular research approach in health care and the social sciences. This article provides a description of grounded theory methodology and its key components, using examples from published studies to demonstrate practical application. It aims to demystify grounded theory for novice nurse researchers, by explaining what it is, when to use it, why they would want to use it and how to use it. It should enable nurse researchers to decide if grounded theory is an appropriate approach for their research, and to determine the quality of any grounded theory research they read.

  16. 7 CFR 29.6033 - Raw.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Raw. 29.6033 Section 29.6033 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Definitions § 29.6033 Raw. Tobacco as it appears between the time of harvesting and...

  17. The Implementation of Indonesia’s Beef Self-Sufficiency Programme (BSSP) as Seen from a Farmer-Family Perspective

    DEFF Research Database (Denmark)

    Gayatri, Siwi; Vaarst, Mette

    2015-01-01

    focus on the way in which the programme was implemented. The present study is based on the findings from 14 semi-structured qualitative interviews carried out with smallholder beef-cattle farmers from the Central Java Province in Indonesia. A modified grounded theory approach was used to analyze...... the data, using the software program Transana. The study showed that the farmers were mostly unaware of the existing government policies on beef-cattle farming, i.e., regarding the BSSP, including the overall aim of these policies. Furthermore, the activities they did know about they viewed as individual...... activities run in isolation, rather than parts of a grander plan or overall larger targeted programme—note, in this paper, we refer to these individual activities as ‘fragments’. The farmers who took part in the interviews outlined the challenges they faced in increasing the quantity and quality...

  18. Assessment of hardened characteristics of raw fly ash blended self-compacting concrete

    Directory of Open Access Journals (Sweden)

    B. Mahalingam

    2016-09-01

    Full Text Available Fly ash is widely used as a supplementary cementitious material in concrete. Due to the implementation of new thermal power plants as a consequence of electricity demand, generation of fly ash is noticeably increased. In addition to pozzolana blended cement production, it is very imperative to use raw fly ash in concrete. Earlier research studies investigated the performance of processed fly ash in blended cement production as well as in concrete. In general, ground fly ash is used in blended cement production. A comprehensive study on the performance evaluation of raw fly ash in self-compacting concrete is not available in the existing literature. Moreover, utilization of raw fly ash in special concrete such as self-compacting concrete is essential to comprehend the performance of raw fly ash blended concrete compared to ordinary Portland concrete. Additionally, it will help to achieve maximum utilization of raw fly ash as a supplementary cementitious material rather than disposal as a waste, which eventually leads to several environmental issues. In the study, raw fly ash was collected and is directly used in development of self-compacting concrete. Two mixes were cast and hardened characteristics of blended concrete were investigated. Results from the study showed comparable performance with control concrete. Furthermore, significant reduction in chloride permeability was observed for raw fly ash blended concrete.

  19. Managing the reproductive performance of beef cows.

    Science.gov (United States)

    Diskin, M G; Kenny, D A

    2016-07-01

    A reproductively efficient beef cow herd will be fundamental to meeting the protein and specifically, red meat demand of an ever increasing global population. However, attaining a high level of reproductive efficiency is underpinned by producers being cognizant of and achieving many key targets throughout the production cycle and requires considerable technical competency. The lifetime productivity of the beef-bred female commences from the onset of puberty and will be dictated by subsequent critical events including age at first calving, duration of the postpartum interval after successive calvings, conception and pregnancy rate, and ultimately manifested as length of intercalving intervals. In calved heifers and mature cows, the onset of ovarian activity, postpartum is a key event dictating the calving interval. Again, this will be the product mainly of prepartum nutrition, manifested through body condition score and the strength of the maternal bond between cow and calf, though there is increasing evidence of a modest genetic influence on this trait. After the initiation of postpartum ovarian cyclicity, conception and subsequent pregnancy rate is generally a function of bull fertility in natural service herds and heat detection and timing of insemination in herds bred through AI. Cows and heifers should be maintained on a steady plane of nutrition during the breeding season, but the contribution of significant excesses or deficiencies of nutrients including protein and trace elements is likely to be minor where adequate pasture is available. Although increased efforts are being made internationally to genetically identify and select for more reproductively efficient beef cows, this is a more long-term strategy and will not replace the need for a high level of technical efficiency and management practice at farm level.

  20. Consumer perceptions of beef healthiness: results from a qualitative study in four European countries

    Directory of Open Access Journals (Sweden)

    de Barcellos Marcia D

    2010-06-01

    Full Text Available Abstract Background Consumer perception of the healthiness of beef is an important determinant of beef consumption. However, little is known about how consumers perceive the healthiness of beef. The aim of this study is to shed light on the associations between beef and health. Methods Eight focus group discussions were conducted in four European countries (France, UK, Germany, Spain, each consisting of seven to nine participants. A content analysis was performed on the transcripts of these discussions. Results Although beef was generally perceived as healthful, focus group participants expected positive as well as negative effects of beef consumption on their health. Labelled, branded, fresh and lean beef were perceived as signalling healthful beef, in contrast with further processed and packaged beef. Consumers felt that their individual choices could make a difference with respect to the healthiness of beef consumed. Focus group participants were not in favour of improving beef healthiness during processing, but rather focussed on appropriate consumption behaviour and preparation methods. Conclusions The individual responsibility for health implies that consumers should be able to make correct judgements about how healthful their food is. However, the results of this study indicate that an accurate assessment of beef healthiness is not always straightforward. The presented results on consumer perceptions of beef healthiness provide insights into consumer decision making processes, which are important for the innovation and product differentiation in the European beef sector, as well as for public health policy decisions related to meat consumption in general and beef consumption in particular.

  1. Maxillary osteosarcoma in a beef suckler cow

    Directory of Open Access Journals (Sweden)

    Prins Diether G J

    2012-07-01

    Full Text Available Abstract A ten-year-old beef suckler cow was referred to the Scottish Centre for Production Animal Health & Food Safety of the University of Glasgow, because of facial swelling in the region of the right maxilla. The facial swelling was first noticed three months earlier and was caused by a slow growing oral mass which contained displaced, loosely embedded teeth. The radiographic, laboratory and clinicopathological findings are described. Necropsy, gross pathology and histological findings confirmed the mass as a maxillary osteosarcoma.

  2. Mycoflora And Mycotoxins Of Corned Beef

    OpenAIRE

    El Maraghy, S. S. Mohamed [سعد شحاتة محمد المراغي; Zohri, A. A.

    1995-01-01

    Sixty species and 5 varieties belonging to 21 genera of fungi were collected from 20 corned beef samples . The average total counts of fungi ranged from 56 -236,47-275 and 39-202 colonies /g on glucose - 10% NAC1 - glucose - and 15% NAC1 - glucose - Czapek's agar media , respectively . Aspergillus niger, A. flavus , and Pencillium chrysogenum were the most common species on the three tested media . A. fumigatus and A. sydowii were common on glucose -Czapek's medium only while A. speluneus and...

  3. Meeting European consumers’ demand for imported beef

    DEFF Research Database (Denmark)

    Peschel, Anne Odile; Grebitus, Carola; Colson, Gregory

    . This study provides deeper insights into consumers' use of attribute cut-off values when making choices. More specifically, we focus on "involvement", one of the potential drivers of both attribute cut-off use and cut-off violation. Involvement is considered a key component in consumer choice theory. We...... combine data from an online choice experiment for beef using shelf simulations with questions to define respondents' attribute cut-off values, and the validated Personal Involvement Inventory (PII). Evidence from the analysis indicates that consumers who are highly involved are more likely to exhibit...

  4. Scientific and technical factors affecting the setting of Salmonella criteria for raw poultry: a global perspective

    NARCIS (Netherlands)

    Mead, G.; Lammerding, A.M.; Cox, N.; Doyle, M.P.; Humbert, F.; Kulikovskiy, A.; Panin, A.; Pinheiro do Nascimento, V.; Wierup, M.; Zwietering, M.H.

    2010-01-01

    Concerns about foodborne salmonellosis have led many countries to introduce microbiological criteria for certain food products. If such criteria are not well-grounded in science, they could be an unjustified obstacle to trade. Raw poultry products are an important part of the global food market. Imp

  5. Factors influencing intention to purchase beef in the Irish market.

    Science.gov (United States)

    McCarthy, M; de Boer, M; O'Reilly, S; Cotter, L

    2003-11-01

    This paper reports on the findings of a study into consumer perceptions towards beef and the influence of these perceptions on consumption. Fishbein and Ajzen's [Belief, attitude, intention and behaviour. An introduction to theory and research (1995) Reading, MA: Addison-Wesley] Theory of Reasoned Action (TRA) provided a useful framework for this analysis. The influence of attitudes and important others (subjective norm) on intention to consume beef were explored. The findings support the usefulness of this model in understanding behaviour towards beef. In this study both attitude and the subjective norm influenced intention to consume beef, but it was attitude that was of greater importance. Health, eating enjoyment and safety were most important determinants of attitude with price, environment and animal welfare less so. An evaluation of the impact of the introduction of new information which related to one belief (health) was also conducted. Those indicating that they would consider increasing their consumption of beef had a more positive attitude towards beef and had more positive health and eating enjoyment beliefs about beef than the 'no' group who had significantly higher safety concerns.

  6. Evaluation of four raw meat diets using domestic cats, captive exotic felids, and cecectomized roosters.

    Science.gov (United States)

    Kerr, K R; Beloshapka, A N; Morris, C L; Parsons, C M; Burke, S L; Utterback, P L; Swanson, K S

    2013-01-01

    Our objective was to evaluate raw meat diets for captive exotic and domestic carnivores containing traditional and alternative raw meat sources, specifically, beef trimmings, bison trimmings, elk muscle meat, and horse trimmings. We aimed to examine diet composition and protein quality; apparent total tract energy and macronutrient digestibility in domestic cats, African wildcats, jaguars, and Malayan tigers; and ME and fecal fermentative end-products in domestic cats. Because of variation in the meat sources, dietary proximate, AA, and long-chain fatty acid composition were variable. Our analyses indicated that all diets had essential fatty acid deficiencies, and the elk diet (i.e., trimmed muscle meat) was deficient in total fat. Standardized AA digestibilities measured using the cecectomized rooster assay were high (>87%). Using the NRC minimum requirements for the growth of kittens, the first limiting AA of all diets was the combined requirement of Met and Cys (AA score: 81 to 95; protein digestibility corrected AA score: 75 to 90). All diets were highly digestible (88 to 89% OM digestibility). There was no effect of diet or felid species on DM (85 to 87%), OM, and GE (90 to 91%) digestibilities. Apparent CP digestibility was greater (P≤0.05) in cats fed elk (97%) compared with those fed bison (96%), and greater (P≤0.05) in wildcats (97%) and domestic cats (97%) compared with tigers (95%). The diet and species interaction (P≤0.05) was observed for apparent fat digestibility. In domestic cats, the fresh fecal pH and proportions of acetate and butyrate were altered (P≤0.05) due to diet. Diet also affected (P≤0.05) fresh fecal concentrations of total branched-chain fatty acids, valerate, and Lactobacillus genus. In conclusion, although the raw meat diets were highly digestible, because of variation in raw meat sources the nutrient composition of the diets was variable. Thus, compositional analysis of raw meat sources is necessary for proper diet

  7. Grounded cognition.

    Science.gov (United States)

    Barsalou, Lawrence W

    2008-01-01

    Grounded cognition rejects traditional views that cognition is computation on amodal symbols in a modular system, independent of the brain's modal systems for perception, action, and introspection. Instead, grounded cognition proposes that modal simulations, bodily states, and situated action underlie cognition. Accumulating behavioral and neural evidence supporting this view is reviewed from research on perception, memory, knowledge, language, thought, social cognition, and development. Theories of grounded cognition are also reviewed, as are origins of the area and common misperceptions of it. Theoretical, empirical, and methodological issues are raised whose future treatment is likely to affect the growth and impact of grounded cognition.

  8. REPRODUCTIVE TRAITS SELECTION IN NELORE BEEF CATTLE

    Directory of Open Access Journals (Sweden)

    Heverton Luis Moreira

    2015-08-01

    Full Text Available Genetic breeding programs of beef cattle in Brazil are including new features, mainly related to reproductive efficiency.Thus, it is necessary to study the effectiveness of selection and quantify genetic gain for these traits in herds. This study estimated genetic and phenotypic parameters and genetic trends for reproductive traits used in breeding programs for Nelore beef cattle. The traits studied were the scrotal circumference (SC at 365 and 450 days of age (SC365 and SC450, age at first calving (AFC and gestation length, as a cow trait (GLcow and a calf trait (GLcalf. The (covariance components were obtained with the Restricted Maximum Likelihood Methodology in a single and double-trait analysis of the animal model. For scrotal circumference (SC365 and SC450, positive and favorable genetic gains were observed. For AFC, GLcow and GLcalf, the trends were favorable for selection, but without significant genetic gain. Selection for large SC may reduce AFC and improve female reproductive efficiency. The selection for reproductive traits (SC365, SC450, AFC and GL may improve reproductive and productive efficiency of Nelore cattle, if used as a selection criterion.

  9. Impact of Government Reform on Beef Market

    Directory of Open Access Journals (Sweden)

    Z. Malá, M. Malý

    2012-12-01

    Full Text Available The present paper deals with the simulation of the impact of selected measures of government reforms in the beef market in the Czech Republic. The selected measures of government reforms are defined and specified on the base of available resources in the introduction. Subsequently, these measures are simulated by the model of partial equilibrium of defined market in the practical part. The impacts of the measures on both supply and demand of selected market are then commented, based on formal econometric quantification and verification of model outputs. The analyzed government measures are included in the form of an expected increase in VAT, the movement of the Czech crown, the development of consumer income and the price expectancy in vertical of beef. The results predict negative consequences on domestic market, in particular on the supply side, in the form of a relatively significant reduction in the number of pieces of cattle. These can result in reducing the number of enterprises with intensive fattening or in shifting their focus to other commodities of vegetable nature. On the demand side, the analyzed measures are likely to bring short-term price reductions. However, the steep growth accompanied by a reduction in quality of meat products can be reasonable expected in the long run. Pieces of knowledge introduced in this paper resulted from solution of an institutional research intention MSMT 6046070906 „Economics of resources of Czech agriculture and their efficient use in frame of multifunctional agri-food systems“.

  10. Polymers based on renewable raw materials

    Directory of Open Access Journals (Sweden)

    Jovanović Slobodan M.

    2002-01-01

    Full Text Available The basic raw materials for the chemical industry, which also means for polymer production, are mineral oil and natural gas. Mineral oil and natural gas resources are limited so that sooner or later they will be consumed. For this reason alternative, renewable raw materials for the chemical industry have become the object of intensive investigation all over the world. Some of the results of these investigations concerning renewable raw materials for the production of polymer materials are presented in this paper.

  11. Phase I of The National Beef Quality Audit-2011: quantifying willingness-to-pay, best-worst scaling, and current status of quality characteristics in different beef industry marketing sectors.

    Science.gov (United States)

    Igo, J L; VanOverbeke, D L; Woerner, D R; Tatum, J D; Pendell, D L; Vedral, L L; Mafi, G G; Moore, M C; McKeith, R O; Gray, G D; Griffin, D B; Hale, D S; Savell, J W; Belk, K E

    2013-04-01

    The National Beef Quality Audit (NBQA)-2011 benchmarked the current status of and assessed progress being made toward quality and consistency of U.S. cattle, carcasses, and beef products after the completion of the first NBQA in 1991. Unlike previous NBQA, objectives of the 2011 Phase I study were to determine how each beef market sector defined 7 quality categories, estimate willingness-to-pay (WTP) for the same quality categories by market sector, and establish a best-worst (B/W) scaling for the quality categories. Structured face-to-face interviews were conducted and responses were recorded using dynamic routing software over an 11-mo period (February to December 2011) with decision makers in each of the following beef market sectors: Feeders (n = 59), Packers (n = 26), Food Service, Distribution, and Further Processors (n = 48), Retailers (n = 30), and Government and Allied Industries (n = 47). All respondents participated in a structured interview consisting of WTP and B/W questions that were tied to 7 quality categories and then were asked to "define" each of the 7 categories in terms of what the category meant to them, resulting in completely unbiased results. The 7 quality categories were a) how and where the cattle were raised, b) lean, fat, and bone, c) weight and size, d) cattle genetics, e) visual characteristics, f) food safety, and g) eating satisfaction. Overall, "food safety" and "eating satisfaction" were the categories of greatest and second most importance, respectively, to all beef market sectors except for Feeders. Feeders ranked "how and where the cattle were raised" and "weight and size" as the most important and second most important, respectively. Overall, "how and where the cattle were raised" had the greatest odds of being considered a nonnegotiable requirement before the raw material for each sector would be considered for purchase and was statistically more important (P market sectors were considered, "eating satisfaction" was shown to

  12. Alpharma Beef Cattle Nutrition Symposium: implications of nutritional management for beef cow-calf systems.

    Science.gov (United States)

    Funston, R N; Summers, A F; Roberts, A J

    2012-07-01

    The beef cattle industry relies on the use of high-forage diets to develop replacement females, maintain the cow herd, and sustain stocker operations Forage quantity and quality fluctuate with season and environmental conditions Depending on class and physiological state of the animal, a forage diet may not always meet nutritional requirements, resulting in reduced ADG or BW loss if supplemental nutrients are not provided It is important to understand the consequences of such BW loss and the economics of providing supplementation to the beef production system Periods of limited or insufficient nutrient availability can be followed by periods of compensatory BW gain once dietary conditions improve This may have less impact on breeding animals, provided reproductive efficiency is not compromised, where actual BW is not as important as it is in animals destined for the feedlot A rapidly evolving body of literature is also demonstrating that nutritional status of cows during pregnancy can affect subsequent offspring development and production characteristics later in life The concept of fetal programming is that maternal stimuli during critical periods of fetal development have long-term implications for offspring Depending on timing, magnitude, and duration of nutrient limitation or supplementation, it is possible that early measures in life, such as calf birth BW, may be unaffected, whereas measures later in life, such as weaning BW, carcass characteristics, and reproductive traits, may be influenced This body of research provides compelling evidence of a fetal programming response to maternal nutrition in beef cattle Future competitiveness of the US beef industry will continue to be dependent on the use of high-forage diets to meet the majority of nutrient requirements Consequences of nutrient restriction or supplementation must be considered not only on individual animal performance but also the developing fetus and its subsequent performance throughout life.

  13. Data extraction from proteomics raw data

    DEFF Research Database (Denmark)

    Mancuso, Francesco; Bunkenborg, Jakob; Wierer, Michael

    2012-01-01

    In shot-gun proteomics raw tandem MS data are processed with extraction tools to produce condensed peak lists that can be uploaded to database search engines. Many extraction tools are available but to our knowledge, a systematic comparison of such tools has not yet been carried out. Using raw data...... and agreement in-between tools. Processing a primary data set with 9 different tandem MS extraction tools resulted in a low overlap of identified peptides. The tools differ by assigned charge states of precursors, precursor and fragment ion masses, and we show that peptides identified very confidently using one...... extraction tool might not be matched when using another tool. We also found a bias towards peptides of lower charge state when extracting fragment ion data from higher resolution raw data without deconvolution. Collecting and comparing the extracted data from the same raw data allow adjusting parameters...

  14. Quality quantification model of basic raw materials

    Directory of Open Access Journals (Sweden)

    Š. Vilamová

    2016-07-01

    Full Text Available Basic raw materials belong to the key input sources in the production of pig iron. The properties of basic raw materials can be evaluated using a variety of criteria. The essential ones include the physical and chemical properties. Current competitive pressures, however, force the producers of iron more and more often to include cost and logistic criteria into the decision-making process. In this area, however, they are facing a problem of how to convert a variety of vastly different parameters into one evaluation indicator in order to compare the available raw materials. This article deals with the analysis of a model created to evaluate the basic raw materials, which was designed as part of the research.

  15. High belite cement from alternative raw materials

    OpenAIRE

    Ghorab, H. Y.; Rizk, M.; Ibrahim, B.; Allam, M. M.

    2014-01-01

    Three high belite laboratory clinkers were prepared from traditional and alternative raw materials. Reference clinker was obtained from 77% limestone, 11% sandy clays, 11% fatty clays and 1% iron scales. The fatty clays were replaced by red brick powder in the raw meal of the second clinker and were lowered to 2% with the replacement of 10% of the limestone by egg shells in the third clinker. The SEM examination revealed clear presence of crossed striae and twinning in the rounded belite grai...

  16. Plastic raw materials in Neolithic pottery production

    Directory of Open Access Journals (Sweden)

    Alexander A. Bobrinsky

    2012-12-01

    Full Text Available The paper is dedicated to the investigation of various natural silts as the most ancient type of raw material used in pottery production. The authors describe the specific features of the composition of plain and mountain silts, and discover the same features in ancient ceramics from different regions in Russia. It can be concluded that silts were the earliest raw material used, a tradition that faded away during the evolution of pottery production.

  17. Quality quantification model of basic raw materials

    OpenAIRE

    Š. Vilamová; P. Besta; R. Kozel; K. Janovská; M. Piecha; Levit, A; Straka, M.; Šanda, M.

    2016-01-01

    Basic raw materials belong to the key input sources in the production of pig iron. The properties of basic raw materials can be evaluated using a variety of criteria. The essential ones include the physical and chemical properties. Current competitive pressures, however, force the producers of iron more and more often to include cost and logistic criteria into the decision-making process. In this area, however, they are facing a problem of how to convert a variety of vastly differ...

  18. The complete raw workflow guide how to get the most from your raw images in Adobe Camera Raw, Lightroom, Photoshop, and Elements

    CERN Document Server

    Andrews, Philip

    2007-01-01

    One of the most important technologies a photographer can master is shooting and working with raw images. However, figuring out the best way to work with raw files can be confusing and overwhelming. What's the advantage to working in raw? How do you manage, organize, and store raw files? What's the best way to process your files to meet your photographic needs? How do Photoshop, Lightroom and Adobe Camera Raw work together? Is it possible to keep your photos in the raw format and still enhance them extensively? Philip Andrews answers these questions and more in his all-new essential raw workfl

  19. THE FUTURE ROLE OF IMPROVED PASTURES FOR BEEF CATTLE

    African Journals Online (AJOL)

    tinue to provide the bulk of the forage demands for beef cattle. various ... While the summer day temperatures are rnoderate (max ... one another to achieve the desired effect. The most sig- ... Wherever possible legumes should be established.

  20. High School Beef Farm is Career Education Center

    Science.gov (United States)

    Herren, Ray

    1976-01-01

    The beef farm at Gaylesville High School, Gaylesville, Alabama, has provided an opportunity for students to gain work experience in a variety of areas including construction, animal care, and packing plant procedures. (LH)

  1. Antagonism in the carbon footprint between beef and dairy ...

    African Journals Online (AJOL)

    Antagonism in the carbon footprint between beef and dairy production ... decomposition of manure is aerobic, which produces carbon dioxide (CO2), part ... Keywords: Cow-calf production, methane, pasture production, production levels, total ...

  2. Genetic parameters for reproductive traits in a beef cattle herd ...

    African Journals Online (AJOL)

    Unknown

    a composite multibreed beef cattle herd using multitrait analysis. A REML procedure ... complex, CD and AFC (because of its high heritability) may be considered as selection criteria for ..... Marshall, D.M., Minqiang, W. & Freking, B.A., 1990.

  3. MORPHOLOGICAL AND BIOCHEMICAL CHARACTERISTICS OF THE BEEF OF YOUNG SPECIAL MEAT AND HOLSTAIN SPECIES GROWN IN THE SOUTH OF RUSSIA

    Directory of Open Access Journals (Sweden)

    Shchukina I. V.

    2016-09-01

    Full Text Available The author has examined peculiarities of meat productivity of animals of the most common breeds: Charolais, Simmental, Aberdeen Angus, Hereford, Kuban type of Red Steppe. As a result of the slaughter carried out for younger group achieved 15 months age, the Charolais breed bulls exceeded peers of Kuban type on slaughter weight to 60.9 kg (20.9 %, Aberdeen Angus – 53.8 kg (18.5 %, Hereford and Simmental respectively – to 35.1 and 24.8 kg (8,5-12,0 %. By the age of 18 months their superiority increased respectively by 56.9; 57.5; 55.8 and 29.9 kg (16.8; 16.9; 16.5 and 8.82%. Halves of bodies of the Kuban breed (considering the specific type of boneless beef output aged 15 months gave way to all the groups: Charolais and Angus – by 1.1- 1.5%, Simmental and Hereford – by 0.4-0.6%. The yield of premium beef exceeds the standards in all genotypes: Kuban – by 9.5%, beef breeds – by 11.2% (Charolais and 19% (Simmental. The balance beetween dry matter and moisture is in the optimal range (0.43: 1-0,73: 1. At 15 months of age, in the number of dry matter, Charolais bulls outnumbered Aberdeen-Angus and Red steppe at 5.1-5.2%, Simmental and Hereford - on 3,0-4,9%. With age, in the meat of calves of beef breeds the level of fat increased, for example, in Hereford and Simmental 0.3-0.5%, Aberdeen Angus and Simmental – 0.7-0.8%. In the middle of a sample of ground beef of carcasses of the calves of Charolais breed at the age of 18 months it contained more protein than in the meat of the calves of Red steppe (1.2%, Hereford (1.1%, Angus (1.4%, Simmental (1,3%. All the meat of the carcasses of the calves of specialized beef breeds was of high quality and diet: one part of the protein had 0.59 parts of fat (Aberdeen Angus and 0.45 parts (Hereford

  4. Beef quality parameters estimation using ultrasound and color images

    OpenAIRE

    Nunes, Jose Luis; Piquerez, Martín; Pujadas, Leonardo; Armstrong,Eileen; Alicia FERNÁNDEZ; Lecumberry, Federico

    2015-01-01

    Background Beef quality measurement is a complex task with high economic impact. There is high interest in obtaining an automatic quality parameters estimation in live cattle or post mortem. In this paper we set out to obtain beef quality estimates from the analysis of ultrasound (in vivo) and color images (post mortem), with the measurement of various parameters related to tenderness and amount of meat: rib eye area, percentage of intramuscular fat and backfat thickness or subcutaneous fat. ...

  5. Value-added beef products (Productos Carnicos con Valor Agregado)

    Science.gov (United States)

    Mac Donaldson; Will Holder; Jan Holder

    2006-01-01

    I'm speaking for Will and Jan Holder, who couldn't be here. I happen to be familiar with Will and Jan's company, Ervin's Natural Beef, and its program because I've sold them cattle. Will and Jan's value-added beef program is based on their family ranch in the area known as The Blue, in the mountains of eastern Arizona.

  6. Beef quality parameters estimation using ultrasound and color images

    OpenAIRE

    Nunes, Jose Luis; Piquerez, Mart?n; Pujadas, Leonardo; Armstrong,Eileen; Fern?ndez, Alicia; Lecumberry, Federico

    2015-01-01

    Background Beef quality measurement is a complex task with high economic impact. There is high interest in obtaining an automatic quality parameters estimation in live cattle or post mortem. In this paper we set out to obtain beef quality estimates from the analysis of ultrasound (in vivo) and color images (post mortem), with the measurement of various parameters related to tenderness and amount of meat: rib eye area, percentage of intramuscular fat and backfat thickness or subcutaneous fat. ...

  7. Evaluation of observed parameters of a beef herd.

    OpenAIRE

    CIMBURKOVÁ, Pavla

    2008-01-01

    It has been observed beef breed herd of Aberdeen Angus cattle in the foothills area of Novohradské mountains in 1992 - 2007. The base of herd was consisted of 117 dams and 814 pieces of calves in total. The parameters of beef production of calves and the reproduction of dams were monitored. For the parameters of growth of calves were found significant effects of the year, the month of birth, sex, the order of calving, the method of reproduction and the sire.

  8. Environmental consequences of different beef production systems in the EU

    DEFF Research Database (Denmark)

    Nguyen, T Lan T; Hermansen, John Erik; Mogensen, Lisbeth

    2010-01-01

    The aim of this paper is to examine the environmental consequences of beef meat production in the EU, using a life cycle approach. Four beef production systems were studied - three from intensively reared dairy calves and one from suckler herds. According to the results of the analysis, the contr...... on a depreciation period of 20 years. This highlights the importance of taking into account the impacts of land use in assessing the environmental impacts of livestock production....

  9. Three-dimensional characterization of the ammonia plume from a beef cattle feedlot

    Science.gov (United States)

    Staebler, Ralf M.; McGinn, Sean M.; Crenna, Brian P.; Flesch, Thomas K.; Hayden, Katherine L.; Li, Shao-Meng

    2009-12-01

    In Canada approximately 45% of ammonia (NH 3) emissions are attributed to dairy and beef cattle industries. The present study focused on NH 3 emissions from a beef feedlot with a one-time capacity of 17,220 head. The aim was to improve the Canadian NH 3 emission inventories and air quality forecasting capabilities. A Cessna 207, equipped with a fast-response NH 3/NO y detector and a quadrupole aerosol mass spectrometer, was flown in a grid pattern covering an area of 8 × 8 km centered on a feedlot (800 × 800 m) at altitudes ranging from 30 to 300 m above ground. Stationary ground measurements of NH 3 concentration and turbulence parameters were made downwind of the feedlot. Three flights were conducted under varying meteorological conditions, ranging from very calm to windy with near-neutral stratification. NH 3 mixing ratios up to 100 ppbv were recorded on the calm day, up to 300 m above ground. An average feedlot NH 3 emission rate of 76 ± 4 μg m -2 s -1 (equivalent to 10.2 g head -1 h -1) was estimated. Characteristics of the measured NH 3 plume were compared to those predicted by a Lagrangian dispersion model. The spatially integrated pattern of NH 3 concentrations predicted and measured agreed but the measured was often more complex than the predicted spatial distribution. The study suggests that the export of NH 3 through advection accounted for about 90% of the emissions from the feedlot, chemical transformation was insignificant, and dry deposition accounted for the remaining 10%.

  10. Evaluation of beef eating quality by Irish consumers.

    Science.gov (United States)

    McCarthy, S N; Henchion, M; White, A; Brandon, K; Allen, P

    2017-10-01

    A consumer's decision to purchase beef is strongly linked to its sensory properties and consistent eating quality is one of the most important attributes. Consumer taste panels were held according to the Meat Standards Australia guidelines and consumers scored beef according to its palatability attributes and completed a socio-demographic questionnaire. Consumers were able to distinguish between beef quality on a scale from unsatisfactory to premium with high accuracy. Premium cuts of beef scored significantly higher on all of the scales compared to poorer quality cuts. Men rated grilled beef higher on juiciness and flavour scales compared to women. Being the main purchaser of beef had no impact on rating scores. Overall the results show that consumers can judge eating quality with high accuracy. Further research is needed to determine how best to communicate inherent benefits that are not visible into extrinsic eating quality indicators, to provide the consumer with consistent indications of quality at the point of purchase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Meeting European consumers’ demand for imported beef

    DEFF Research Database (Denmark)

    Peschel, Anne Odile; Grebitus, Carola; Colson, Gregory

    . This study provides deeper insights into consumers' use of attribute cut-off values when making choices. More specifically, we focus on "involvement", one of the potential drivers of both attribute cut-off use and cut-off violation. Involvement is considered a key component in consumer choice theory. We...... combine data from an online choice experiment for beef using shelf simulations with questions to define respondents' attribute cut-off values, and the validated Personal Involvement Inventory (PII). Evidence from the analysis indicates that consumers who are highly involved are more likely to exhibit...... attribute cut-off values. Also, highly involved consumers are less likely of violating their cut-off values. At the same, the lower the involvement the lower the probability to have cut-off values developed....

  12. Campylobacter in poultry, pork and beef

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Carroll, C.; Rudi, K.

    2011-01-01

    Campylobacter infection has become one of the most important zoonoses worldwide. A low prevalence of Campylobacter is generally found in beef and pork at retail, although they may still be sources of infection. Based on the high prevalence of poultry-associated infections, this chapter mainly...... focuses on rapid methods for detection of Campylobacter in this particular production chain, and describes the routes of transmission and sampling in the different levels as well as intervention strategies. The chapter focuses on the introduction, infection dynamics, and sampling of Campylobacter...... throughout the poultry production chain, from farm to consumer level. It also describes culture-based, immunological, and molecular methods for rapid detection, characterization, and enumeration for Campylobacter. Rapid methods can generally be also more sensitive and specific than culture-based methods...

  13. Low-temperature cooking of beef

    DEFF Research Database (Denmark)

    Mortensen, Louise Mørch

    Molecular gastronomy is a new scientific field concerned with domestic and restaurant cooking, perception of food, and other factors relevant for cooking and meals. Most available gastronomic knowledge is based on experience and handed-down procedures from cookbooks and recipes. This inductive way......-temperature long-time heat treatment of meat from a gastronomic viewpoint. The effect of cooking time and cooking temperature on the sensory properties of beef eye of round (semitendinosus) was investigated by a sensory descriptive study. The results showed that both cooking time (3, 6, 9, and 12 hours....... The third group showed a different behaviour; in this group time and temperature worked in different directions. Thus, the results showed three dominant behaviours in sensory properties. Two sensory properties, tenderness and juiciness, are very important in cooked meat according to both consumers and chefs...

  14. Factors influencing the purchase and consumers’ willingness to pay for ground bison

    OpenAIRE

    Qasmi, Bashir; Fausti, Scott; Underwood, Keith

    2015-01-01

    A consumer preference study that included willingness to pay and consumer sensory experiments was conducted for ground bison versus ground beef. A total of 82 subjects completed the study. The initial statistical analysis suggest that there is consistent consumer behavior with respect to consumer preference and frequency of consumption within species consumption options, but consistent consumer behavior appears to weaken when across species consumption preferences is compared to across specie...

  15. Antibiotic resistance in bacterial pathogens from retail raw meats and food-producing animals in Japan.

    Science.gov (United States)

    Hiroi, Midori; Kawamori, Fumihiko; Harada, Tetsuya; Sano, Yono; Miwa, Norinaga; Sugiyama, Kanji; Hara-Kudo, Yukiko; Masuda, Takashi

    2012-10-01

    To determine the prevalence and antimicrobial susceptibility profiles of Campylobacter, Salmonella, Staphylococcus aureus, methicillin-resistant S. aureus (MRSA), and vancomycin-resistant enterococci (VRE) in food-producing animals and retail raw meats in Japan, raw meat samples as well as food-producing animal feces, cutaneous swabs, and nasal swabs collected from 2004 to 2006 were analyzed. Isolation rates of Campylobacter jejuni and Campylobacter coli, Salmonella, and S. aureus were 34.6% (363 of 1,050), 2.7% (28 of 1,050), and 32.8% (238 of 725), respectively. MRSA was isolated from 3% (9 of 300) of meat samples. No VRE were isolated in this study. Antibiotic resistance in C. coli was higher than that in C. jejuni. Three C. jejuni isolates from a patient with diarrhea in a hospital of Shizuoka Prefecture and two chicken samples that exhibited resistance to ciprofloxacin had identical pulsed-field gel electrophoresis patterns, suggesting that ciprofloxacin-resistant C. jejuni could have been distributed in meat. S. aureus isolates showed the highest level of resistance to ampicillin and tetracycline. Resistance to tetracycline in S. aureus isolates from beef was lower than that seen in isolates from chicken and pork (P food-producing animals and retail domestic meats in Japan, although Campylobacter isolates resistant to fluoroquinolone and erythromycin were detected. The occurrence of antimicrobial-resistant pathogens should be monitored continuously to improve the management of the risks associated with antimicrobial drug resistance transferred from food-producing animals to humans.

  16. Production Flexibility in Extensive Beef Farming Systems

    Directory of Open Access Journals (Sweden)

    Laura Astigarraga

    2011-03-01

    Full Text Available The aim of this work is to assess the flexibility of production allowed by extensive production conditions faced with variations in the environment, i.e., market variations and climatic fluctuations, of Limousin beef systems. The study used a case-based methodology in which seven beef farms with less than 1 LU/ha were chosen. Data collection was based on three interviews using a semistructured questionnaire and on the analysis of productive and economic results over a 15-year period (1991-2005. The main evolution of these farms is related to a rise in work productivity associated with an increase in herd size. Herd increase was made possible by enlarging the area, the margin of intensification being limited in these regions. To take advantage of the enlarged land area, females were reared for fattening or for reproduction instead of selling them at weaning. The Limousin female provides a wide product mix because of its plasticity, as has been studied by several researchers. This mix flexibility is achieved by delaying product differentiation, a form of production flexibility that can reduce the risk of under-producing or over-producing varied product configurations. On the other hand, calves sold to the Italian market after weaning are generic products, associated with a flexible production process to overcome fluctuations in forage availability due to climatic variations. The introduction of maize silage for feeding acts as an alternative route, actual and potential, through the system to overcome unexpected forage shortage from natural grasslands as a result of droughts. The study shows that extensive farming systems have developed types of flexibility to match different factors of uncertainty from the environment. Finally, the issue of farm system performance is thus not so much a question of whether a farm is fit at a specific moment in time, but whether it transforms into a less or more sustainable orientation.

  17. Milestones in beef cattle genetic evaluation.

    Science.gov (United States)

    Golden, B L; Garrick, D J; Benyshek, L L

    2009-04-01

    National beef cattle genetic evaluation programs have evolved in the United States over the last 35 yr to create important tools that are part of sustainable breeding programs. The history of national beef cattle genetic evaluation programs has lessons to offer the next generation of researchers as new approaches in molecular genetics and decision support are developed. Through a series of complex and intricate pressures from technology and organizational challenges, national cattle evaluation programs continue to grow in importance and impact. Development of enabling technologies and the interface of the disciplines of computer science, numerical methods, statistics, and quantitative genetics have created an example of how academics, government, and industry can work together to create more effective solutions to technical problems. The advent of mixed model procedures was complemented by a series of breakthrough discoveries that made what was previously considered intractable a reality. The creation of modern genetic evaluation procedures has followed a path characterized by a steady and constant approach to identification and solution for each technical problem encountered. At its core, the driving force for the evolution has been the need to constantly improve the accuracy of the predictions of genetic merit for breeding stock, especially young animals. Sensible approaches, such as the principle of economically relevant traits, were developed that created the rules to be followed as the programs grew. However, the current systems are far from complete or perfect. Modern genetic evaluation programs have a long way to go, and a great deal of improvement in the accuracy of prediction is still possible. But the greatest challenge remains: the need to understand that genetic predictions are only parameters for decision support procedures and not an end in themselves.

  18. Caesalpinia decapetala Extracts as Inhibitors of Lipid Oxidation in Beef Patties

    Directory of Open Access Journals (Sweden)

    Maria G. Gallego

    2015-07-01

    Full Text Available In this study we investigated the effects of Caesalpinia decapetala (CD extracts on lipid oxidation in ground beef patties. Plant extracts and butylated hydroxytoluene (BHT were individually added to patties at both 0.1% and 0.5% (w/w concentrations. We assessed the antioxidant efficacy of CD by the ferric reducing antioxidant power (FRAP assay and evaluated their potential as natural antioxidants for meat preservation by thiobarbituric acid reactive substance (TBARS values, hexanal content, fatty acid composition and color parameters. These were tested periodically during 11 days of refrigerated storage. TBARS levels were significantly lower (p ≤ 0.05 in the samples containing plant extracts or BHT than in the non-treated control. In addition, the beef patties formulated with the selected plant extracts showed significantly (p ≤ 0.05 better color stability than those without antioxidants. These results indicate that edible plant extracts are promising sources of natural antioxidants and can potentially be used as functional preservatives in meat products.

  19. Ground Wars

    DEFF Research Database (Denmark)

    Nielsen, Rasmus Kleis

    Political campaigns today are won or lost in the so-called ground war--the strategic deployment of teams of staffers, volunteers, and paid part-timers who work the phones and canvass block by block, house by house, voter by voter. Ground Wars provides an in-depth ethnographic portrait of two...... infrastructures that utilize large databases with detailed individual-level information for targeting voters, and armies of dedicated volunteers and paid part-timers. Nielsen challenges the notion that political communication in America must be tightly scripted, controlled, and conducted by a select coterie...... of professionals. Yet he also quashes the romantic idea that canvassing is a purer form of grassroots politics. In today's political ground wars, Nielsen demonstrates, even the most ordinary-seeming volunteer knocking at your door is backed up by high-tech targeting technologies and party expertise. Ground Wars...

  20. Consumer-reported handling of raw poultry products at home: results from a national survey.

    Science.gov (United States)

    Kosa, Katherine M; Cates, Sheryl C; Bradley, Samantha; Chambers, Edgar; Godwin, Sandria

    2015-01-01

    Salmonella and Campylobacter cause an estimated combined total of 1.8 million foodborne infections each year in the United States. Most cases of salmonellosis and campylobacteriosis are associated with eating raw or undercooked poultry or with cross-contamination. Between 1998 and 2008, 20% of Salmonella and 16% of Campylobacter foodborne disease outbreaks were associated with food prepared inside the home. A nationally representative Web survey of U.S. adult grocery shoppers (n = 1,504) was conducted to estimate the percentage of consumers who follow recommended food safety practices when handling raw poultry at home. The survey results identified areas of low adherence to current recommended food safety practices: not washing raw poultry before cooking, proper refrigerator storage of raw poultry, use of a food thermometer to determine doneness, and proper thawing of raw poultry in cold water. Nearly 70% of consumers reported washing or rinsing raw poultry before cooking it, a potentially unsafe practice because "splashing" of contaminated water may lead to the transfer of pathogens to other foods and other kitchen surfaces. Only 17.5% of consumers reported correctly storing raw poultry in the refrigerator. Sixty-two percent of consumers own a food thermometer, and of these, 26% or fewer reported using one to check the internal temperature of smaller cuts of poultry and ground poultry. Only 11% of consumers who thaw raw poultry in cold water reported doing so correctly. The study results, coupled with other research findings, will inform the development of science-based consumer education materials that can help reduce foodborne illness from Salmonella and Campylobacter.

  1. Factors affecting lactose quantity in raw milk

    Directory of Open Access Journals (Sweden)

    Rubporn Kittivachra

    2007-07-01

    Full Text Available The purpose of this study was to characterize factors affecting lactose quantities in raw cow's milk. This study combined the survey design with laboratory analysis. Selected farm members of Nong Poh Dairy Cooperatives, from Ban Pong and Photharam Districts, Ratchaburi Province, were sampled. From the selected farms, data collected included lactose quantities in the raw milk and dairy farming information. The raw milk of selected farms was sampled at the delivery site of Nong Poh dairy cooperatives in the morning during December 2003 till February 2004. Lactose in the raw milk was then quantified by the Fourier Transform Infrared Analysis (FTIR using the MilkoScan FT6000 at the Department of Livestock Development. The farm owners or managers of selected farms were in-depth interviewed on dairy farming information including cowsí health and cows' diet. The data revealed that all cows from the selected farms were fed with concentrate diet purchased from Nong Poh Dairy Cooperatives and grass as high fiber diets. Sample of eighteen farms also fed their cows with one of supplements: corn stem, soybean meal, or rice straw. All cows from these farms were Holstein-Friesian Hybrid. As supplemented high fiber diets, corn stem significantly increased the lactose quantities over soybean meal and rice straw (planned comparison, pvalue = 0.044. The study concluded that some high fiber diets, specifically corn stem, significantly contributed to the lactose quantities in raw milk.

  2. Improving the raw management in Ukraine

    Energy Technology Data Exchange (ETDEWEB)

    Jung, H.G.; Koever, M. [NUKEM Technologies GmbH, Alzenau (Germany)

    2013-07-01

    In Ukraine 13 VVER-1000 and 2 VVER-440 reactor units generate about 50 % of the country's energy production. By contrast, when looking at the large volume of radioactive waste of all categories, which is produced by these nuclear power plants (NPP), the radioactive waste (RAW) management - onsite of NPP, towards interim storage as well as towards final disposal - is still not adequately developed. Currently all operational waste of Ukrainian NPP is incompletely treated/conditioned and stored onsite, though insufficient storage capacity is available at the NPP. As no effective Ukraine-wide strategy is yet established to manage RAW beyond NPP a serious situation could arise, which even leads to constrained temporary shut-down of reactor units, threatening the energy supply of whole the country. In addition large quantities of RAW, partly badly sorted, derive from decommissioning of the shut-down Chernobyl NPP. Also other sources of RAW contribute to the whole volume, which has to be managed in Ukraine, as research reactors, reprocessing of spent nuclear fuel and other nuclear facilities and applications. Nevertheless, operational and shut-down NPP in Ukraine are by far the largest producers. To support Ukraine in managing their radioactive waste NUKEM Technologies GmbH was appointed to provide technical support for the improvement of the current situation in cooperation with responsible Ukrainian experts towards a targeted, comprehensive and effective RAW management. (orig.)

  3. Beef consumer segment profiles based on information source usage in Poland.

    Science.gov (United States)

    Żakowska-Biemans, Sylwia; Pieniak, Zuzanna; Gutkowska, Krystyna; Wierzbicki, Jerzy; Cieszyńska, Katarzyna; Sajdakowska, Marta; Kosicka-Gębska, Małgorzata

    2017-02-01

    The main aim of this study was to identify market segments based on consumers' usage of information sources about beef and to investigate whether the use of information sources was associated with the type of information consumers were searching for, factors guiding their decision processes to buy beef and motives related to beef consumption. Data were collected in 2014 through a self-administered survey of 501 regular beef consumers. Three distinct clusters were identified: Enthusiast (38.5%), Conservative (43.1%) and Ultra Conservative (18.4%). This study revealed that culinary and personal sources of information on beef were the most frequently used. Taste, perceived healthiness and suitability to prepare many dishes were reported as primary motives to eat beef. These results show that communication channels such as culinary programs and opportunities provided by the development of labelling systems to guarantee beef quality should be considered when developing policies and strategies to increase beef consumption in Poland.

  4. The Role of Consumer risk Perceptions and Attitudes in Cross Cultural Beef Consumptions Changes

    NARCIS (Netherlands)

    Schroeder, T.C.; Tonsor, G.T.; Pennings, J.M.E.; Mintert, J.

    2007-01-01

    Abstract Beef food safety events have contributed to considerable market volatility, produced varied consumer reactions, created policy debates, sparked heated trade disputes, and generally contributed to beef industry frustrations. Better understanding of the forces causing observed consumer reacti

  5. Semen quality of fertile US males in relation to their mothers' beef consumption during pregnancy

    National Research Council Canada - National Science Library

    Swan, S.H; Liu, F; Overstreet, J.W; Brazil, C; Skakkebaek, N.E

    2007-01-01

    BACKGROUND To look at possible long-term risks from anabolic steroids and other xenobiotics in beef, we examined mens' semen quality in relation to their mother's self-reported beef consumption during pregnancy. METHODS...

  6. Genome-wide association studies of female reproduction in tropically adapted beef cattle

    National Research Council Canada - National Science Library

    Hawken, R J; Zhang, Y D; Fortes, M R S; Collis, E; Barris, W C; Corbet, N J; Williams, P J; Fordyce, G; Holroyd, R G; Walkley, J R W; Barendse, W; Johnston, D J; Prayaga, K C; Tier, B; Reverter, A; Lehnert, S A

    2012-01-01

    .... To elucidate the genetics underlying reproduction in beef cattle, we performed a genome-wide association study using the bovine SNP50 chip in 2 tropically adapted beef cattle breeds, Brahman and Tropical Composite...

  7. The Role of Consumer risk Perceptions and Attitudes in Cross Cultural Beef Consumptions Changes

    NARCIS (Netherlands)

    Schroeder, T.C.; Tonsor, G.T.; Pennings, J.M.E.; Mintert, J.

    2007-01-01

    Abstract Beef food safety events have contributed to considerable market volatility, produced varied consumer reactions, created policy debates, sparked heated trade disputes, and generally contributed to beef industry frustrations. Better understanding of the forces causing observed consumer

  8. EFFECT OF NITRITE AND CITRIC ACID ON THE CHEMICAL COMPOSITION AND pH OF THE CANNED BEEF SAUSAGES

    Directory of Open Access Journals (Sweden)

    M.M.A. MAHA

    2015-01-01

    Full Text Available The effects of nitrite and citric acid as preservatives on the chemical composition and pH of the canned beef sausage were investigated after three months storage at room temperature (35±5ºc. Two experiments were conducted in this study, the first, was undertaken to determine the effect of nitrite as a preservative on the chemical composition and pH of the canned beef sausages retorted at 107.2°C (225ºF for 80 minutes, and at 115.5°C (240ºF for 40 minutes. The second experiment, which was based on the results of the first one, was conducted to determine the effects of the absence of nitrite on the canned beef sausage processed with meat treated by immersion in 1% citric acid before processing at (80 and 30ºc for one minute and drained, then the product retorted at 107.2°C for 80 minutes. The evaluation of percentages of the dry matter, ash, crude protein, fat and also pH were done monthly. The results in experiment 1 indicated that, percentages of the dry matter, ash and crude protein before and after canning of sausages were not significantly different (P>0.05. The fat (% was significantly different among treatments (P0.05 for the raw, cooked and canned sausages. Generally it was observed a decrease in moisture content (increases in dry matter content, ash%, crude protein fat (% and pH value with increasing of storage period. Citric acid had no clear effect on chemical properties and pH value.

  9. ISMRM Raw data format: A proposed standard for MRI raw datasets

    DEFF Research Database (Denmark)

    Inati, Souheil; Naegle, Joseph; R. Zwart, Nicholas

    2016-01-01

    Purpose This work proposes the ISMRM Raw Data format as a common MR raw data format, which promotes algorithm and data sharing. Methods A file format consisting of a flexible header and tagged frames of k-space data was designed. Application Programming Interfaces were implemented in C/C++, MATLAB...

  10. Does it pay to integrate irrigated forages in a beef cattle breeding operation in north Queensland?

    OpenAIRE

    2014-01-01

    The northern Australian beef industry accounts for approximately half of the national beef herd. It is currently challenged by a range of factors including decline in beef prices, limited live export trade, large farm debt levels, and low return on assets managed. Access to irrigation has been identified as one factor with potential to contribute to growth of the northern Australian beef industry. The development of irrigation for growing pasture and forage crops could extend the ability to s...

  11. Determination of Total Volatile Basic Nitrogen (TVB-N) Content in Beef by Hyperspectral Imaging Technique

    OpenAIRE

    Liu Shanmei; Gan Lu

    2016-01-01

    Non-destructive determination of TVB-N content in beef using hyperspectral imaging (HSI) technique was evaluated. In order to create a robust model to predict the TVB-N content in beef, partition of sample set, spectral pretreatment, and the optimum wavelength selection were discussed. After the beef sample set was parted by concentration gradient (CG) algortithm, and the spectra of beef samples were preprocessed by standard normalized variate (SNV) combined with auto scale(AS), the partial l...

  12. Ethanol is a strategic raw material

    Directory of Open Access Journals (Sweden)

    Baras Josip K.

    2002-01-01

    Full Text Available The first part of this review article considers general data about ethanol as an industrial product, its qualities and uses. It is emphasized that, if produced from biomass as a renewable raw material, its perspectives as a chemical raw material and energent are brilliant. Starchy grains, such as corn, must be used as the main raw materials for ethanol production. The production of bioethanol by the enzyme-catalyzed conversion of starch followed by (yeast fermentation, distillation is the process of choice. If used as a motor fuel, anhydrous ethanol can be directly blended with gasoline or converted into an oxygenator such as ETBE. Finally, bioethanol production in Yugoslavia and the possibilities for its further development are discussed.

  13. PERSPECTIVE NONMETALLIC RAW MATERIALS AND THEIR UTILIZATION

    Directory of Open Access Journals (Sweden)

    Havelka Jaroslav

    1997-10-01

    Full Text Available It is the existence of the domestic base of raw materials and stable or growing markets that are a precondition for the prospectiveness industrial minerals. Traditional and non-traditional prospective nonmetal-liferous raw materials can be distinguished. The main trends in new industrial applications of industrial minerals are being stated. In the Czech Republic, the following may be ranked among the traditional prospective nonme-talliferous raw materials: kaoline, refractory clays, ceramic and expandable clays, glass and foundry sands, li-mestones, building stones, gypsum, cast basalt, bentonite, diatomite, feldspars, graphite. Alkali rocks, industrial garnets, flaky mica, wollastonite and yet unmined staurolite, minerals of the sillimanite group and others belong to the non-traditional prospective industrial minerals.

  14. Preoperational test report, raw water system

    Energy Technology Data Exchange (ETDEWEB)

    Clifton, F.T.

    1997-10-29

    This represents the preoperational test report for the Raw Water System, Project W-030. Project W-030 provides a ventilation upgrade for the four Aging Waste Facility tanks. The system supplies makeup water to the W-030 recirculation evaporative cooling towers for tanks AY1O1, AY102, AZ1O1, AZ102. The Raw Water pipe riser and associated strainer and valving is located in the W-030 diesel generator building. The tests verify correct system operation and correct indications displayed by the central Monitor and Control System.

  15. Effect of composting on the fate of steroids in beef cattle manure

    Science.gov (United States)

    In this study, the fate of steroid hormones in beef cattle manure composting is evaluated. The fate of 16 steroids and metabolites was evaluated in composted manure from beef cattle administered growth promotants and from beef cattle with no steroid hormone implants. The fate of estrogens (primary...

  16. 7 CFR 59.104 - Mandatory reporting of boxed beef sales.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Mandatory reporting of boxed beef sales. 59.104... (CONTINUED) LIVESTOCK MANDATORY REPORTING Cattle Reporting § 59.104 Mandatory reporting of boxed beef sales... time, and once by 2 p.m. central time) the following information on total boxed beef domestic...

  17. 7 CFR 1260.312 - Remittance to the Cattlemen's Board or Qualified State Beef Council.

    Science.gov (United States)

    2010-01-01

    ... State Beef Council. 1260.312 Section 1260.312 Agriculture Regulations of the Department of Agriculture...), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Rules and Regulations § 1260.312 Remittance to the Cattlemen's Board or Qualified State Beef Council. Each person responsible for the collection and...

  18. 78 FR 72597 - Descriptive Designation for Needle- or Blade-Tenderized (Mechanically Tenderized) Beef Products

    Science.gov (United States)

    2013-12-03

    ... Needle- or Blade-Tenderized (Mechanically Tenderized) Beef Products AGENCY: Food Safety and Inspection... needle- or blade-tenderized (mechanically tenderized) beef products that appeared in the Federal Register...-tenderized (Mechanically Tenderized) Beef Products'' (78 FR 34589). The Agency proposed to require the use...

  19. Beef Cattle Production. An Instructional Unit for Teachers of Adult Vocational Education in Agriculture.

    Science.gov (United States)

    Metzger, Bruce; Iverson, Maynard J.

    The unit on beef cattle production is designed primarily for the adult farmer program in Kentucky as an aid to making the beef enterprise more profitable. It is aimed primarily at the commercial producer. The lessons center on some of the more important economic points in beef cattle production. Ten lessons comprise the unit, which can be adapted…

  20. 9 CFR 94.27 - Importation of whole cuts of boneless beef from Japan.

    Science.gov (United States)

    2010-01-01

    ... beef from Japan. 94.27 Section 94.27 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION... IMPORTATIONS § 94.27 Importation of whole cuts of boneless beef from Japan. Notwithstanding any other provisions of this part, whole cuts of boneless beef derived from cattle that were born, raised,...

  1. 9 CFR 319.312 - Pork with barbecue sauce and beef with barbecue sauce.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Pork with barbecue sauce and beef with..., Frozen, or Dehydrated Meat Food Products § 319.312 Pork with barbecue sauce and beef with barbecue sauce. “Pork with Barbecue Sauce” and “Beef with Barbecue Sauce” shall consist of not less than 50...

  2. Advanced Beef Unit for Advanced Livestock Production Curriculum. Selected Readings. AGDEX 420/00.

    Science.gov (United States)

    Sparks, Jim; Stewart, Bob R.

    These selected readings are designed to supplement James Gillespie's "Modern Livestock and Poultry Production" (2nd edition) as the student reference for the advanced beef unit. The 15 lessons build on Agricultural Science I and II competencies. Topics of the 15 lessons are: importance of the beef enterprise; cost of beef production;…

  3. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  4. 78 FR 53017 - Changes to the Salmonella Verification Sampling Program: Analysis of Raw Beef for Shiga Toxin...

    Science.gov (United States)

    2013-08-28

    ... regulatory program under the Federal Meat Inspection Act (FMIA) (21 U.S.C. 601 et seq.) that is intended to ensure that meat and meat food products distributed in commerce are wholesome; not adulterated; and... ``Pathogen Reduction; Hazard Analysis and Critical Control Point (PR/HACCP) Systems,'' which FSIS...

  5. 77 FR 26725 - Changes to FSIS Traceback, Recall Procedures for Escherichia coli O157:H7 Positive Raw Beef...

    Science.gov (United States)

    2012-05-07

    .... coli O157:H7. FSAs are complete investigations concerning the establishment's entire HACCP system. FSIS... containers or purge material (that is, remaining liquid, fat, and meat particles in containers or combo bins... effectiveness of HACCP measures in addressing the pathogen. Therefore, in order for a sampled and tested...

  6. Calm temperament improves reproductive performance of beef cows.

    Science.gov (United States)

    Kasimanickam, R; Asay, M; Schroeder, S; Kasimanickam, V; Gay, J M; Kastelic, J P; Hall, J B; Whittier, W D

    2014-12-01

    Profitability of a beef operation is determined by the proportion of cows attaining pregnancy early in the breeding season and those that are pregnant at the end of breeding season. Many factors, including temperament, contribute to those reproductive parameters. The objective of this study was to evaluate effects of temperament on reproductive performance of beef cows. In Experiment 1, Angus and Angus-cross beef cows (n = 1546) from eight locations were assigned a body condition score (BCS; 1 = emaciated; 9 = obese) and chute exit and gait score (1 = slow exit, walk; calm temperament; 2 = jump, trot or run; excitable temperament). Cows were grouped with bulls (1 : 25 to 1 : 30; with satisfactory breeding potential and free of venereal disease) for an 85-day breeding season. Pregnancy status and stage of gestation were determined (transrectal palpation) 35 days after the end of the breeding season. Controlling for BCS (p beef cows (n = 1407) from 8 locations were assigned scores for body condition and chute exit and gait (as described in Experiment 1) and assigned to bulls (breeding sound and free of venereal disease; 1 : 25 to 1 : 30) for 85 days. Pregnancy status was determined by transrectal palpation at 2 and 6 months after the onset of the breeding season. Controlling for BCS (p beef cows with an excitable temperament had significantly lower reproductive performance than calmer cows. The modified two-point chute exit-gait scoring method was repeatable and identified cattle with an excitable temperament. © 2014 Blackwell Verlag GmbH.

  7. Industrial development of beef and pork cecina with different flavors

    Directory of Open Access Journals (Sweden)

    Francisco A. Nuñez-Gonzalez

    2013-12-01

    Full Text Available Cecina used traditional technique for salting and preserving meat as well as to impart flavor; however, addition of spices is a viable alternative to diversify the flavors of the product. The objective of this research was to develop beef and pork cecina of flavors and evaluate lipid oxidation after 30 days of storage. Beef and pork cecina were distributed independently in four treatments: Formulation 1 or base (10.7% salt, 1.3% sugar, 0.5% nitrite and seasoning 0.1%; formulation 2, base plus 10 g of mixture of coriander, celery, parsley dehydrated/kg meat; formulation 3, base plus 10 g dry mirasol chilli/kg of meat and liquid smoke (2 mL/L and formulation 4, base plus 0.80 mL of essential oregano oil/L. Beef cecina was dried at 80 °C for 150 minutes and pork cecina for 180 minutes until these achieved a water activity (aw of 0.75. Beef cecina was packaged in cellophane bag, while for pork cecina in vacuum bags. Lipid oxidation was determined using thiobarbituric acid test (TBA. The results revealed that only beef cecina presented fat rancidity.

  8. Enzyme immunoassay and proteomic characterization of troponin I as a marker of mammalian muscle compounds in raw meat and some meat products.

    Science.gov (United States)

    Zvereva, Elena A; Kovalev, Leonid I; Ivanov, Alexei V; Kovaleva, Marina A; Zherdev, Anatoly V; Shishkin, Sergey S; Lisitsyn, Andrey B; Chernukha, Irina M; Dzantiev, Boris B

    2015-07-01

    The skeletal muscle protein troponin I (TnI) has been characterized as a potential thermally stable and species-specific biomarker of mammalian muscle tissues in raw meat and meat products. This study proposed a technique for the quantification of TnI comprising protein extraction and sandwich enzyme-linked immunosorbent assay (ELISA). The technique is characterized by a TnI detection limit of 4.8 ng/ml with quantifiable concentrations ranging from 8.7 to 52 ng/ml. The method was shown to be suitable for detection of TnI in mammalian (beef, pork, lamb, and horse) meat but not in poultry (chicken, turkey, and duck) meat. In particular, the TnI content in beef was 0.40 3 ± 0.058 mg/g of wet tissue. The TnI estimations obtained for the pork and beef samples using ELISA were comparable to the proteomic analysis results. Thus, the quantitative study of TnI can be a convenient way to assess the mammalian muscle tissue content of various meat products. Copyright © 2015. Published by Elsevier Ltd.

  9. Inactivation by lemon juice of Escherichia coli O157:H7, Salmonella Enteritidis, and Listeria monocytogenes in beef marinating for the ethnic food kelaguen.

    Science.gov (United States)

    Yang, Jian; Lee, Delores; Afaisen, Shayna; Gadi, Rama

    2013-01-01

    Lemon juice, a major source of acidulant citric acid, is frequently used in the preparation of ethnic foods. Raw or partially cooked meats are marinated with lemon juice in the preparation of a popular Chamorro dish called kelaguen, which is, unfortunately, strongly associated with foodborne illness outbreaks in Guam. We investigated the efficacy of lemon juice in reducing numbers of Escherichia coli O157:H7, Salmonella Enteritidis, and Listeria monocytogenes at stationary phase during marination. Beef inoculated with a three-strain mixture of E. coli O157:H7, S. Enteritidis, or L. monocytogenes at 10(6)CFU/mL was marinated with lemon juice from 0.2 to 10mL/g for 48h at 28°C. The decline of the pathogens during marination exhibited various degrees of deviation from first-order kinetics. Based on calculations with both linear regression and Weibull models, the decimal reduction time (4-D values) over the range of lemon concentrations was 366-5.1h for E. coli O157:H7, 282-2.4h for S. Enteritidis, and 104-2.4h for L. monocytogenes, indicating that E. coli O157:H7 was the most lemon-juice-resistant of the three. The pathogen reduction time (log 4-D values) plotted against undissociated titratable citric acid exhibited a biphasic pattern. The pathogen reduction time (log 4-D or δ values) was linearly correlated with the pH of the marinating beef (R(2)=0.92 to 0.98). The Z(pH) values (pH dependence of death rate) with beef marination were 1.03 for E. coli O157:H7, 0.92 for S. Enteritidis, and 1.29 for L. monocytogenes, indicating that L. monocytogenes was the most pH resistant of the three. L. monocytogenes exhibited less resistance to lemon juice than S. Enteritidis at pH of 3.5-4.4 but more resistance at pH of 2.6-2.8. In addition, at 4°C, all three pathogens exhibited 4-D values 1.7-4.1 times greater than those at 24°C at 5mL lemon juice/g beef. In conclusion, the usual beef marinating practice for kelaguen preparation (lemon juice/g beef for 1-12h) did not

  10. Synthetic Raw Materials for Refractories in China

    Institute of Scientific and Technical Information of China (English)

    SHIGan; YUEWeidong

    2001-01-01

    The development and status of synthetic raw materials for refractories in China are reviewed,including magne-site-based materials,alumina ,ullite,calcium alumi-nate cement ,ultrafine powder,spinel,silicon carbide and cordierite.The research work on calcium zirconate and sialon materials are also introduced.

  11. Quality aspects of raw milk cheeses

    Science.gov (United States)

    Cheese has been a part of the human diet for thousands of years and over the centuries cheesemakers have relied on the indigenous microflora and enzymes in raw milk to create the signature quality traits for the many different varieties of cheese found around the world. Although most of the cheese i...

  12. Residual feed intake in beef cattle

    Directory of Open Access Journals (Sweden)

    J P.F. Arthur

    2008-07-01

    Full Text Available Providing feed is a major input cost in beef production, hence improvements in the efficiency of feed utilisation will reduce the cost of production. Residual feed intake (RFI is a measure of feed efficiency, and is defined as the difference between an animal's actual feed intake and its expected feed intake based on its size and growth. It is independent of the level of production, and the lower the value the more efficient the animal is. This paper examines the current state of knowledge on RFI. Available information indicates that postweaning RFI is moderately heritable, and that selection for low RFI will result in progeny that consume less feed for the same level of production as progeny of high RFI cattle. Under ad libitum feeding, RFI is phenotypically independent of growth traits. There is a weak genetic relationship between RFI and fatness but additional studies are needed to assess the magnitude of this relationship in different breeds, sexes, ages and feeding regimes. Residual feed intake is believed to represent inherent variation in basic metabolic processes which determine efficiency. Economic analyses of genetic improvement schemes that incorporate testing of individuals for RFI have yielded substantial economic benefits over and above existing schemes that do not include RFI testing. Selection for low RFI has an additional benefit of reducing greenhouse gas emissions by cattle.

  13. Fine detrending of raw Kepler and MOST photometric data of KIC 6950556 and HD 37633

    Science.gov (United States)

    Mikulášek, Zdeněk; Paunzen, Ernst; Zejda, Miloslav; Semenko, Evgenij; Bernhard, Klaus; Hümmerich, Stefan; Zhang, Jia; Hubrig, Swetlana; Kuschnig, Rainer; Janík, Jan; Jagelka, Miroslav

    2016-07-01

    We present a simple phenomenological method for detrending of raw Kepler and MOST photometry, which is illustrated by means of photometric data processing of two periodically variable chemically peculiar stars, KIC 6950556 and HD 37633. In principle, this method may be applied to any type of periodically variable objects and satellite or ground based photometries. As a by product, we have identified KIC 6950556 as a magnetic chemically peculiar star with an ACV type variability.

  14. Fine detrending of raw Kepler and MOST photometric data of KIC 6950556 and HD 37633

    CERN Document Server

    Mikulasek, Zdenek; Zejda, Miloslav; Semenko, Evgenij; Bernhard, Klaus; Hummerich, Stefan; Zhang, Jia; Hubrig, Swetlana; Kuschnig, Rainer; Janik, Jan; Jagelka, Miroslav

    2016-01-01

    We present a simple phenomenological method for detrending of raw Kepler and MOST photometry, which is illustrated by means of photometric data processing of two periodically variable chemically peculiar stars, KIC 6950556 and HD 37633. In principle, this method may be applied to any type of periodically variable objects and satellite or ground based photometries. As a by product, we have identified KIC 6950556 as a magnetic chemically peculiar star with an ACV type variability.

  15. Improvements in Iron Status and Cognitive Function in Young Women Consuming Beef or Non-Beef Lunches

    Directory of Open Access Journals (Sweden)

    Cynthia Blanton

    2013-12-01

    Full Text Available Iron status is associated with cognitive performance and intervention trials show that iron supplementation improves mental function in iron-deficient adults. However, no studies have tested the efficacy of naturally iron-rich food in this context. This investigation measured the hematologic and cognitive responses to moderate beef consumption in young women. Participants (n = 43; age 21.1 ± 0.4 years were randomly assigned to a beef or non-beef protein lunch group [3-oz (85 g, 3 times weekly] for 16 weeks. Blood was sampled at baseline, and weeks 8 and 16, and cognitive performance was measured at baseline and week 16. Body iron increased in both lunch groups (p < 0.0001, with greater improvement demonstrated in women with lower baseline body iron (p < 0.0001. Body iron had significant beneficial effects on spatial working memory and planning speed (p < 0.05, and ferritin responders (n = 17 vs. non-responders (n = 26 showed significantly greater improvements in planning speed, spatial working memory strategy, and attention (p < 0.05. Lunch group had neither significant interactions with iron status nor consistent main effects on test performance. These findings support a relationship between iron status and cognition, but do not show a particular benefit of beef over non-beef protein consumption on either measure in young women.

  16. Bill E. Kunkle Interdisciplinary Beef Symposium: Practical developments in managing animal welfare in beef cattle: what does the future hold?

    Science.gov (United States)

    Lyles, J L; Calvo-Lorenzo, M S

    2014-12-01

    Interest in the welfare of cattle in the beef industry has intensified over time because of ethical concerns and varying societal perceptions that exist about the treatment and living conditions of farm animals. The definition of welfare will vary according to an individual's philosophies (how one defines and prioritizes what is "good"), experiences (societal and cultural influences of animal roles and relationships), and involvement in the livestock industry (knowledge of how livestock operations work and why). Many welfare concerns in the beef industry could be mitigated by enhancing traditional husbandry practices that utilize practical improvements to alleviate or eliminate heat stress, pain from routine husbandry procedures, negative cattle handling, and the transitional effects of weaning, dry feeding, transportation, and comingling of calves. Recent concerns about the potential welfare effects of feeding technologies such as β-adrenergic agonists (BAA) have emerged and led to industry-wide effects, including the removal of a single BAA product from the market and the development of BAA-specific welfare audits. Altogether, the beef industry continues to be challenged by welfare issues that question a large range of practices, from traditional husbandry to newer technological advancements. As welfare awareness increases, efforts to improve livestock care and management must focus on scientific investigations, practical solutions, consumer perceptions, and educational tools that advance knowledge and training in livestock welfare. Furthermore, the future of beef cattle welfare must align welfare concerns with other aspects of sustainable beef production such as environmental quality, profitability, food safety, and nutritional quality.

  17. Relationship between colorimetric (instrumental) evaluation and consumer-defined beef colour acceptability.

    Science.gov (United States)

    Holman, Benjamin W B; Mao, Yanwei; Coombs, Cassius E O; van de Ven, Remy J; Hopkins, David L

    2016-11-01

    The relationship between instrumental colorimetric values (L*, a*, b*, the ratio of reflectance at 630nm and 580nm) and consumer perception of acceptable beef colour was evaluated using a web-based survey and standardised photographs of beef m. longissimus lumborum with known colorimetrics. Only L* and b* were found to relate to average consumer opinions of beef colour acceptability. Respondent nationality was also identified as a source of variation in beef colour acceptability score. Although this is a preliminary study with the findings necessitating additional investigation, these results suggest L* and b* as candidates for developing instrumental thresholds for consumer beef colour expectations.

  18. Competitiveness of the EU Beef Sector – a Case Study

    Directory of Open Access Journals (Sweden)

    Z. Smeets Kristková

    2015-06-01

    Full Text Available In this study, the elements of competitiveness of the EU beef sector are assessed using the value chain approach. Consequently, the impact of the external factors represented by domestic policy and foreign trade policy is discussed, with the aim of deriving recommendations for policy makers. It is shown that investing in collaborative supply chains can improve the disadvantaged position of beef producers, which have the least power in the supply chain. Furthermore, the domains of science and innovation provide several opportunities that could be further explored, namely improving the logistics of the supply chain and developing more tailored quality systems. The main threats stem from potential free trade agreements, climate change and the internal competition between other agricultural crops. Better targeting of the CAP and environmental aspects are suggested to maintain the competitiveness of European beef producers.

  19. Beef HACCP: intervention and non-intervention systems.

    Science.gov (United States)

    Bolton, D J; Doherty, A M; Sheridan, J J

    2001-05-21

    While there are several generic beef HACCP documents available to the beef industry, these lack sufficient detail to be of any use other than as a general guide to HACCP. A document which clearly identifies and provides a sound scientific basis for potential critical control points (CCPs') and details critical limits, monitoring and corrective actions is clearly required. The objective of this paper is to provide such information. A detailed description of CCPs' for two different HACCP systems (an intervention and a non-intervention system) are presented and the advantages and disadvantages of each are discussed. Individual beef plants may then make an informed choice as to which HACCP system is most suitable for them and have all the specific information required for effective implementation.

  20. European consumers' acceptance and rejection of novel beef technologies

    DEFF Research Database (Denmark)

    de Barcellos, Marcia Dutra; Kügler, Jens Oliver; Grunert, Klaus G.

    As part of ProSafeBeef, an integrated research project funded by the European Commission, the present qualitative study was carried out with European consumers to obtain insights into their acceptance or rejection of eight selected novel beef production and processing technologies, identified here...... as concepts: 1) marinating by injection for increased healthiness; 2) marinating by injection for increased safety; 3) marinating by injection for increased eating quality; 4) marinating by submerging for increased eating quality; 5) nutritional enhancement; 6) shock wave treatment; 7) muscle profiling and 8...... of each one of them. The obtained data was consecutively transcribed, coded and analysed by using the software package NVivo 7. The results reveal a dependency between the acceptance of novel beef products and how consumers perceive the characteristics of the innovation itself. Excess manipulation...

  1. Factors affecting beef consumption in the valley of Mexico

    Directory of Open Access Journals (Sweden)

    Ricardo Tellez Delgado

    2015-10-01

    Full Text Available ABSTRACTThe objective of this study was to know the factors that determine the consumption of beef in the Metropolitan Area of the Valley of Mexico, using logit and probit modeling (nominal variable with 400 surveys. The results showed that significant variables that determine the probability of purchasing beef are schooling, number of members per family, meat preference, family income, and presence of disease in the individual. The largest marginal effects on the purchase decision were provided by the income and the meat preference variables, while the price was not significant. The main factors that determine the consumption of beef are schooling and the number of members in the family, while the meat preference and income are dismissed.

  2. Antibacterial Resistance in the Muscles of Chicken, Pig and Beef

    Directory of Open Access Journals (Sweden)

    Pravin Raj Solomon

    2016-04-01

    Full Text Available Though antibiotic drugs are known to improve the health and welfare of food animals , there is parallel risk due to the development of resistant microorganisms in the body of target animals. Seven meat samples were procured from wet market in Old Town,Petaling Jaya, Malaysia and assessed for the presence of antibiotic residues. The samples chosen were chicken parts (skin, muscle and liver , pig parts (liver, muscle and intestine and beef muscle. The results indicated that chicken skin had high level of antibioticresidues which positively resisted the presence of gram positive, Staphylococcus aureus, S. epidermidisand B. cereus as known by the zone of inhibition.The beef muscle also held residue which resisted S. aureusChosenbacteriaalong with the extracts of chicken skin, pig intestine and beef muscle were observed to be resistant totetracycline hydrochloride, ciprofloxacin hydrochloride monohydrate and their combinations when tested at a concentration of 1 percent

  3. Beef identification in industrial slaughterhouses using machine vision techniques

    Directory of Open Access Journals (Sweden)

    J. F. Velez

    2013-10-01

    Full Text Available Accurate individual animal identification provides the producers with useful information to take management decisions about an individual animal or about the complete herd. This identification task is also important to ensure the integrity of the food chain. Consequently, many consumers are turning their attention to issues of quality in animal food production methods. This work describes an implemented solution for individual beef identification, taking in the time from cattle shipment arrival at the slaughterhouse until the animals are slaughtered and cut up. Our beef identification approach is image-based and the pursued goals are the correct automatic extraction and matching between some numeric information extracted from the beef ear-tag and the corresponding one from the Bovine Identification Document (BID. The achieved correct identification results by our method are near 90%, by considering the practical working conditions of slaughterhouses (i.e. problems with dirt and bad illumination conditions. Moreover, the presence of multiple machinery in industrial slaughterhouses make it difficult the use of Radio Frequency Identification (RFID beef tags due to the high risks of interferences between RFID and the other technologies in the workplace. The solution presented is hardware/software since it includes a specialized hardware system that was also developed. Our approach considers the current EU legislation for beef traceability and it reduces the economic cost of individual beef identification with respect to RFID transponders. The system implemented has been in use satisfactorily for more than three years in one of the largest industrial slaughterhouses in Spain.

  4. Intensive (pasture) beef cattle operations: the perspective of New Zealand.

    Science.gov (United States)

    Hathaway, S C

    1997-08-01

    Beef production in New Zealand has characteristics typical of a temperate climate and pasture-based animal husbandry. The specific pathogens which may contaminate fresh beef and which are empirically considered to be of public health importance are similar to those in other countries with temperate climates, i.e. Salmonella, Campylobacter, Escherichia coli O157:H7, Listeria monocytogenes and Toxoplasma gondii. With the exception of T. gondii, it is likely that almost all transmission of these hazards through consumption of beef results from unseen microbial cross-contamination from gastrointestinal sources during slaughter, dressing and further processing. Gaining comprehensive information on carcass contamination levels is an essential first step in establishing food safety objectives for a particular beef production system, and in designing risk-based hazard analysis and critical control point (HACCP) plans. It is likely that the lower mean and maximum numbers of indicator micro-organisms on New Zealand carcasses (when compared with other countries) are in part due to the pre-slaughter cleanliness status of cattle reared under temperate, pasture conditions. Similarly, the failure to detect specific pathogens of gastrointestinal origin in a comprehensive baseline survey most probably reflects the limited pathway for faecal contamination during slaughter and dressing under processing conditions in New Zealand. The New Zealand example provides strong evidence for the need to design HACCP plans according to the specific national (or regional) situation. Reducing all pathways for faecal contamination of products to the maximum extent practicable will be the most important factor in achieving desired food safety objectives for fresh beef. Variable densities of microbial pathogens in gastrointestinal contents are also likely to have a significant effect on subsequent contamination levels of beef carcasses: however, effective controls for limiting the presence of most

  5. Using instrumental (CIE and reflectance) measures to predict consumers' acceptance of beef colour.

    Science.gov (United States)

    Holman, Benjamin W B; van de Ven, Remy J; Mao, Yanwei; Coombs, Cassius E O; Hopkins, David L

    2017-05-01

    We aimed to establish colorimetric thresholds based upon the capacity for instrumental measures to predict consumer satisfaction with beef colour. A web-based survey was used to distribute standardised photographs of beef M. longissimus lumborum with known colorimetrics (L*, a*, b*, hue, chroma, ratio of reflectance at 630nm and 580nm, and estimated deoxymyoglobin, oxymyoglobin and metmyoglobin concentrations) for scrutiny. Consumer demographics and perceived importance of colour to beef value were also evaluated. It was found that a* provided the most simple and robust prediction of beef colour acceptability. Beef colour was considered acceptable (with 95% acceptance) when a* values were equal to or above 14.5. Demographic effects on this threshold were negligible, but consumer nationality and gender did contribute to variation in the relative importance of colour to beef value. These results provide future beef colour studies with context to interpret objective colour measures in terms of consumer acceptance and market appeal.

  6. Relationships between sensory evaluations of beef tenderness, shear force measurements and consumer characteristics.

    Science.gov (United States)

    Van Wezemael, Lynn; De Smet, Stefaan; Ueland, Øydis; Verbeke, Wim

    2014-07-01

    The supply of tender beef is an important challenge for the beef industry. Knowledge about the profile of consumers who are more optimistic or more accurate in their tenderness evaluations is important for product development and beef marketing purposes. Central location tests of beef steaks were performed in Norway and Belgium (n=218). Instrumental and sensorial tenderness of three muscles from Belgian Blue and Norwegian Red cattle was reported. Consumers who are optimistically evaluating tenderness were found to be more often male, less food neophobic, more positive towards beef healthiness, and showed fewer concerns about beef safety. No clear profile emerged for consumers who assessed tenderness similar to shear force measurements, which suggests that tenderness is mainly evaluated subjectively. The results imply a window of opportunities in tenderness improvements, and allow targeting a market segment which is less critical towards beef tenderness.

  7. The effect of technology information on consumer expectations and liking of beef

    DEFF Research Database (Denmark)

    van Wezemael, Lynn; Ueland, Øydis; Rødbotten, Rune

    2012-01-01

    European consumers increasingly attach value to process characteristics of food. Although beef technologies are hardly communicated to consumers, providing consumer-oriented information about technology application might increase perceived transparency and consumer acceptance. This study...... technologies: unprocessed tenderloin M. Psoas major, muscle profiled M. Infraspinatus, and marinated (by injection) M. Semitendinosus. The findings indicate that detailed information about beef technologies can enhance consumers' expectations and liking of beef. However, this effect differs between countries...... investigates how information about beef technologies influences consumer expectations and liking of beef. Beef consumers in Belgium (n=108) and Norway (n=110) participated in an information experiment combined with sensory testing in which each consumer tasted three beef muscles treated with different...

  8. Carbon footprint and ammonia emissions of California beef production systems.

    Science.gov (United States)

    Stackhouse-Lawson, K R; Rotz, C A; Oltjen, J W; Mitloehner, F M

    2012-12-01

    Beef production is a recognized source of greenhouse gas (GHG) and ammonia (NH(3)) emissions; however, little information exists on the net emissions from beef production systems. A partial life cycle assessment (LCA) was conducted using the Integrated Farm System Model (IFSM) to estimate GHG and NH(3) emissions from representative beef production systems in California. The IFSM is a process-level farm model that simulates crop growth, feed production and use, animal growth, and the return of manure nutrients back to the land to predict the environmental impacts and economics of production systems. Ammonia emissions are determined by summing the emissions from animal housing facilities, manure storage, field applied manure, and direct deposits of manure on pasture and rangeland. All important sources and sinks of methane, nitrous oxide, and carbon dioxide are predicted from primary and secondary emission sources. Primary sources include enteric fermentation, manure, cropland used in feed production, and fuel combustion. Secondary emissions occur during the production of resources used on the farm, which include fuel, electricity, machinery, fertilizer, and purchased animals. The carbon footprint is the net exchange of all GHG in carbon dioxide equivalent (CO(2)e) units per kg of HCW produced. Simulated beef production systems included cow-calf, stocker, and feedlot phases for the traditional British beef breeds and calf ranch and feedlot phases for Holstein steers. An evaluation of differing production management strategies resulted in ammonia emissions ranging from 98 ± 13 to 141 ± 27 g/kg HCW and carbon footprints of 10.7 ± 1.4 to 22.6 ± 2.0 kg CO(2)e/kg HCW. Within the British beef production cycle, the cow-calf phase was responsible for 69 to 72% of total GHG emissions with 17 to 27% from feedlot sources. Holstein steers that entered the beef production system as a by-product of dairy production had the lowest carbon footprint because the emissions

  9. Nutrient Composition of Retail Samples of Australian Beef Sausages

    OpenAIRE

    Judy Cunningham; Nguyen, Van; Paul Adorno; Veronique Droulez

    2015-01-01

    Some nutrient data for beef sausages in Australia’s food composition table, NUTTAB 2010, is over 25 years old and may no longer reflect the composition of this popular food. To update this, 41 retail samples of fresh beef sausages were purchased in Melbourne, Australia, in May 2015. Each purchase was analysed, uncooked, for moisture, protein and fat. Sausages were then grouped by fat content into one of three composites and analysed for a wide range of nutrients, before and after dry heat coo...

  10. Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health.

    Science.gov (United States)

    Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O

    2016-09-24

    The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p < 0.05) suggesting a consequence of the dissemination of resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.

  11. Color, sensory and textural attributes of beef frankfurter, beef ham and meat-free sausage containing tomato pomace.

    Science.gov (United States)

    Savadkoohi, Sobhan; Hoogenkamp, Henk; Shamsi, Kambiz; Farahnaky, Asgar

    2014-08-01

    The present investigation focuses on the textural properties, sensory attributes and color changes of beef frankfurter, beef ham and meat-free sausage produced by different levels of bleached tomato pomace. The texture and color profile were performed using an instrumental texture analyzer and colorimeter. The findings indicated that tomato pomace-added sausages had higher water holding capacity (WHC) compared to that of commercial samples. The frankfurters containing 5 and 7% (w/w) tomato pomace had the highest redness (a*), chroma (C*) and color differences (ΔE) values, while the meat-free sausages containing 7% (w/w) tomato pomace had significant (p0.05) color differences between beef ham samples (with and without tomato pomace). A significant progression in the textural hardness and chewiness of systems containing tomato pomace was observed as well as higher sensory scores by panelists. According to sensorial evaluations, bleached tomato pomace improved the consumer acceptability and preference.

  12. Spatial and Temporal Distribution of Escherichia coli on Beef Trimmings Obtained from a Beef Packing Plant.

    Science.gov (United States)

    Visvalingam, Jeyachchandran; Wang, Hui; Youssef, Mohamed K; Devos, Julia; Gill, Colin O; Yang, Xianqin

    2016-08-01

    The objective of this study was to determine the immediate source of Escherichia coli on beef trimmings produced at a large packing plant by analyzing the E. coli on trimmings at various locations of a combo bin filled on the same day and of bins filled on different days. Ten 2,000-lb (907-kg) combo bins (B1 through B10) of trimmings were obtained from a large plant on 6 days over a period of 5 weeks. Thin slices of beef with a total area of approximately 100 cm(2) were excised from five locations (four corners and the center) at each of four levels of the bins: the top surface and 30, 60, and 90 cm below the top. The samples were enriched for E. coli in modified tryptone soya broth supplemented with 20 mg/liter novobiocin. The positive enrichment cultures, as determined by PCR, were plated on E. coli/coliform count plates for recovery of E. coli. Selected E. coli isolates were genotyped using multiple-locus variable-number tandem repeat analysis (MLVA). Of the 200 enrichment cultures, 43 were positive by PCR for E. coli, and 32 of these cultures yielded E. coli isolates. Two bins did not yield any positive enrichment cultures, and three PCR-positive bins did not yield any E. coli isolates. MLVA of 165 E. coli isolates (30, 62, 56, 5, and 12 from B6 through B10, respectively) revealed nine distinct genotypes. MLVA types 263 and 89 were most prevalent overall and on individual days, accounting for 49.1 and 37.6% of the total isolates, respectively. These two genotypes were also found at multiple locations within a bin. All nine genotypes belonged to the phylogenetic group A0 of E. coli, suggesting an animal origin. The finding that the trimmings carried very few E. coli indicates an overall effective control over contamination of beef with E. coli at this processing plant. The lack of strain diversity of the E. coli on trimmings suggests that most E. coli isolates may have come from common sources, most likely equipment used in the fabrication process.

  13. High temperature cement raw meal flowability

    DEFF Research Database (Denmark)

    Maarup, Claus; Hjuler, Klaus; Dam-Johansen, Kim

    2014-01-01

    The flowability of cement raw meal is investigated at temperatures up to 850°C in a specially designed monoaxial shear tester. Consolidation stresses of 0.94, 1.87 and 2.79kPa are applied. The results show that the flowability is reduced as temperature is increased above 550°C, indicated by incre......The flowability of cement raw meal is investigated at temperatures up to 850°C in a specially designed monoaxial shear tester. Consolidation stresses of 0.94, 1.87 and 2.79kPa are applied. The results show that the flowability is reduced as temperature is increased above 550°C, indicated...

  14. Minimization of Salmonella contamination on raw poultry.

    Science.gov (United States)

    Cox, N A; Cason, J A; Richardson, L J

    2011-01-01

    Many reviews have discussed Salmonella in poultry and suggested best practices to minimize this organism on raw poultry meat. Despite years of research and conscientious control efforts by industry and regulatory agencies, human salmonellosis rates have declined only modestly and Salmonella is still found on raw poultry. Expert committees have repeatedly emphasized the importance of controlling risk, but information about Salmonella in poultry is often limited to prevalence, with inadequate information about testing methods or strains of Salmonella that are detected by these methods and no information about any impact on the degree of risk. This review examines some assumptions behind the discussion of Salmonella in poultry: the relationships between sampling and cultural methodology, prevalence and numbers of cells, and the implications of serotype and subtype issues. Minimizing Salmonella contamination of poultry is not likely to reduce human salmonellosis acquired from exposure to contaminated chicken until these issues are confronted more systematically.

  15. Raw material studies of West Central Serbia

    Directory of Open Access Journals (Sweden)

    Vera Bogosavljević Petrović

    2014-03-01

    Full Text Available This paper deals with raw material problems in the territory of West Central Serbia geologically determined as the Čačak-Kraljevo (or West Morava basin. Our research is presented through the most striking case studies, Lojanik, Vlaška Glava and Lazac.  The Lojanik hill is a silicified forest by origin. It has occasionally been in use from the earliest periods of prehistory until today as a source of black and ochre-coloured flint, opal and silicified wood. A detailed prospection, including the mapping of surface finds using square nets, was conducted during two research campaigns.The Vlaška Glava is an open-air Palaeolithic site at which artefacts made of white, ochre, red, brown and black chert, silicified magnesite, volcanic and metamorphic rocks were found. Our research of primary and secondary geological deposits in the vicinity of the site showed equivalent raw material. We also found an interesting primary deposit of high quality bluish grey flint with outcrop activities (Workshop 1.The Lazac shaft is a contemporary magnesite mine, recently abandoned because of the high percentage of silicon-dioxide. We determined the same raw material in collections found at nearby Neolithic sites. Certain similarities between the wooden support systems of ore exploration in the Middle Ages and modern times were established at the entrance of the shaft.Our research in the territory of the West Morava basin resulted in reconstruction of some links between geological deposits and settlements and also creation of a relevant base for future raw material studies.

  16. Determination of essential nutrients in raw milk

    Directory of Open Access Journals (Sweden)

    Penphimon Phongphanphanee

    2006-03-01

    Full Text Available Milk production in Thailand has gradually increased since 1961. Occasional oversupply of raw milk has become one of dairy farmers' major problems. Increasing the consumption of milk by making use of its separated nutrients may offer a solution. This study was to assess the composition of raw milk produced in Thailand, which included fat, protein, lactose, solid-not-fat (SNF and total solid (TS. A large dairy cooperatives in Saraburi Province was selected for the study. About 9% of its total members, constituting 108 farms, were randomly chosen. They consisted of small size (less than 20 cows/farm, medium size (21-100 cows/farm and large size (>100 cows/farm. The majority was medium-size. Raw milk from each farm was sampled at the delivery site of the cooperatives in the morning. Milk data of the 108 farms were compiled at 3 different periods between February and July 2003. The raw milk was analyzed by the Fourier Transform Infrared Analysis (FTIR using MilkoScan FT6000. The results showed the average fat content of 3.50±0.47%, protein of 3.13±0.16%, lactose of 4.59±0.12%, SNF of 8.42±0.20%, and TS of 11.92±0.54%. The samples were superior in all of the nutrients as compared to the standard levels set by the Department of Livestock Development, except for TS. This indicates the possibility of a local production of milk nutrients such as lactose and protein as ingredients for the pharmaceutical and health food industries.

  17. Untrained consumer assessment of the eating quality of beef: 1. A single composite score can predict beef quality grades.

    Science.gov (United States)

    Bonny, S P F; Hocquette, J-F; Pethick, D W; Legrand, I; Wierzbicki, J; Allen, P; Farmer, L J; Polkinghorne, R J; Gardner, G E

    2016-11-10

    Quantifying consumer responses to beef across a broad range of demographics, nationalities and cooking methods is vitally important for any system evaluating beef eating quality. On the basis of previous work, it was expected that consumer scores would be highly accurate in determining quality grades for beef, thereby providing evidence that such a technique could be used to form the basis of and eating quality grading system for beef. Following the Australian MSA (Meat Standards Australia) testing protocols, over 19 000 consumers from Northern Ireland, Poland, Ireland, France and Australia tasted cooked beef samples, then allocated them to a quality grade; unsatisfactory, good-every-day, better-than-every-day and premium. The consumers also scored beef samples for tenderness, juiciness, flavour-liking and overall-liking. The beef was sourced from all countries involved in the study and cooked by four different cooking methods and to three different degrees of doneness, with each experimental group in the study consisting of a single cooking doneness within a cooking method for each country. For each experimental group, and for the data set as a whole, a linear discriminant function was calculated, using the four sensory scores which were used to predict the quality grade. This process was repeated using two conglomerate scores which are derived from weighting and combining the consumer sensory scores for tenderness, juiciness, flavour-liking and overall-liking, the original meat quality 4 score (oMQ4) (0.4, 0.1, 0.2, 0.3) and current meat quality 4 score (cMQ4) (0.3, 0.1, 0.3, 0.3). From the results of these analyses, the optimal weightings of the sensory scores to generate an 'ideal meat quality 4 score (MQ4)' for each country were calculated, and the MQ4 values that reflected the boundaries between the four quality grades were determined. The oMQ4 weightings were far more accurate in categorising European meat samples than the cMQ4 weightings, highlighting that

  18. Food safety hazards associated with consumption of raw milk.

    Science.gov (United States)

    Oliver, Stephen P; Boor, Kathryn J; Murphy, Steven C; Murinda, Shelton E

    2009-09-01

    An increasing number of people are consuming raw unpasteurized milk. Enhanced nutritional qualities, taste, and health benefits have all been advocated as reasons for increased interest in raw milk consumption. However, science-based data to substantiate these claims are limited. People continue to consume raw milk even though numerous epidemiological studies have shown clearly that raw milk can be contaminated by a variety of pathogens, some of which are associated with human illness and disease. Several documented milkborne disease outbreaks occurred from 2000-2008 and were traced back to consumption of raw unpasteurized milk. Numerous people were found to have infections, some were hospitalized, and a few died. In the majority of these outbreaks, the organism associated with the milkborne outbreak was isolated from the implicated product(s) or from subsequent products made at the suspected dairy or source. In contrast, fewer milkborne disease outbreaks were associated with consumption of pasteurized milk during this same time period. Twenty nine states allow the sale of raw milk by some means. Direct purchase, cow-share or leasing programs, and the sale of raw milk as pet food have been used as means for consumers to obtain raw milk. Where raw milk is offered for sale, strategies to reduce risks associated with raw milk and products made from raw milk are needed. Developing uniform regulations including microbial standards for raw milk to be sold for human consumption, labeling of raw milk, improving sanitation during milking, and enhancing and targeting educational efforts are potential approaches to this issue. Development of pre- and postharvest control measures to effectively reduce contamination is critical to the control of pathogens in raw milk. One sure way to prevent raw milk-associated foodborne illness is for consumers to refrain from drinking raw milk and from consuming dairy products manufactured using raw milk.

  19. Effect of raw soya bean particle size on productive performance and digestion of dairy cows.

    Science.gov (United States)

    Naves, A B; Freitas Júnior, J E; Barletta, R V; Gandra, J R; Calomeni, G D; Gardinal, R; Takiya, C S; Vendramini, T H A; Mingoti, R D; Rennó, F P

    2016-08-01

    Differing soya bean particle sizes may affect productive performance and ruminal fermentation due to the level of fatty acid (FA) exposure of the cotyledon in soya bean grain and because the protein in small particles is more rapidly degraded than the protein in large particles, which influence ruminal fibre digestion and the amounts of ruminally undegradable nutrients. The objective of this experiment was to investigate the effects of raw soya bean particle size on productive performance, digestion and milk FA profile of dairy cows. Twelve Holstein cows were assigned to three 4 × 4 Latin squares with 21-day periods. At the start of the experiment, cows were 121 days in milk (DIM) and yielded 30.2 kg/day of milk. Cows were fed 4 diets: (i) control diet (CO), without raw soya bean; (ii) whole raw soya bean (WRS); (iii) cracked raw soya bean in Wiley mill 4-mm screen (CS4); and (iv) cracked raw soya bean in Wiley mill 2-mm screen (CS2). The inclusion of soya beans (whole or cracked) was 200 g/kg on dry matter (DM) basis and partially replaced ground corn and soya bean meal. Uncorrected milk yield and composition were not influenced by experimental diets; however, fat-corrected milk (FCM) decreased when cows were fed soya bean treatments. Soya bean diets increased the intake of ether extract (EE) and net energy of lactation (NEL ), and decreased the intake of DM and non-fibre carbohydrate (NFC). Ruminal propionate concentration was lower in cows fed WRS than cows fed CS2 or CS4. Cows fed cracked raw soya bean presented lower nitrogen in faeces than cows fed WRS. The milk of cows fed WRS, CS2 and CS4 presented higher unsaturated FA than cows fed CO. The addition of raw soya bean in cow diets, regardless of the particle size, did not impair uncorrected milk yield and nutrient digestion, and increased the concentration of unsaturated FA in milk. Cows fed cracked raw soya bean presented similar productive performance to cows fed whole raw soya bean. Journal of

  20. 'Grounded' Politics

    DEFF Research Database (Denmark)

    Schmidt, Garbi

    2012-01-01

    play within one particular neighbourhood: Nørrebro in the Danish capital, Copenhagen. The article introduces the concept of grounded politics to analyse how groups of Muslim immigrants in Nørrebro use the space, relationships and history of the neighbourhood for identity political statements....... The article further describes how national political debates over the Muslim presence in Denmark affect identity political manifestations within Nørrebro. By using Duncan Bell’s concept of mythscape (Bell, 2003), the article shows how some political actors idealize Nørrebro’s past to contest the present...

  1. United States Climate Reference Network (USCRN) Raw Observations from Datalogger

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Datalogger files are raw USCRN data. However, instead of being collected via satellite, the raw data are collected from station dataloggers (also referred to as...

  2. Waste to wealth: Industrial raw materials potential of peels of ...

    African Journals Online (AJOL)

    Waste to wealth: Industrial raw materials potential of peels of Nigerian sweet orange ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING ... of orange peels with a view to establishing their raw material potentials.

  3. Indigenous processing methods and raw materials of borde , an ...

    African Journals Online (AJOL)

    Indigenous processing methods and raw materials of borde , an Ethiopian traditional ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search ... A study of village-level processing techniques and raw materials used for the ...

  4. Use of alternative raw materials for yoghurt production | Farinde ...

    African Journals Online (AJOL)

    Use of alternative raw materials for yoghurt production. ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING AJOL · RESOURCES ... Soymilk and maize steep water were used as alternative raw materials to cow milk ...

  5. Beef, Real Food for Real People: An Industrial Analysis of the Beef Industry

    Science.gov (United States)

    1992-04-01

    Labeling for raw products would be voluntary. The label will show totadl calories, fates, cholesterol, carbohydrates, protein, sugar, fiber , sodium... pineapple plantations; 8) banks; 9) publishing companies; 10) sporting-goods manufacturers; and 11) a plumbing shop. They also owned substantial

  6. Management Can Reduce Contamination Potential of Beef Backgrounding

    Science.gov (United States)

    Producers who want to “background” beef cattle on karst landscapes face great challenges. This is because without proper management, manure-borne contaminants from backgrounding sites can quickly degrade water quality in karst regions. Western Kentucky University and USDA-ARS reported on three-year ...

  7. Physiology and Endocrinology Symposium. Factors controlling puberty in beef heifers

    Science.gov (United States)

    The Physiology and Endocrinology Symposium on “Factors controlling puberty in beef heifers” was held at the joint annual meeting of the American Dairy Science Association and the American Society of Animal Science in New Orleans, Louisiana, USA, July 10 to 14, 2011. The objective of the symposium w...

  8. Mate extract as feed additive for improvement of beef quality

    DEFF Research Database (Denmark)

    de Zawadzki, Andressa; Arrivetti, Leandro de O.R.; Vidal, Marília P.

    2017-01-01

    Mate (Ilex paraguariensis A.St.-Hil.) is generally recognized as safe (GRAS status) and has a high content of alkaloids, saponins, and phenolic acids. Addition of mate extract to broilers feed has been shown to increase the oxidative stability of chicken meat, however, its effect on beef quality ...

  9. Botswana's Beef Global Commodity Chain: Explaining the Resistance to Change

    Science.gov (United States)

    Ransom, Elizabeth

    2011-01-01

    In an era of increasing global agricultural trade, many firms and farms seek to upgrade their agricultural commodity chains to become better integrated into global markets. Utilizing a global commodity chain (GCC) approach, this analysis unravels the challenges to and the potential consequences of upgrading Botswana's beef commodity chain.…

  10. Where's the Beef? Adding Rigor to Student Digital Products

    Science.gov (United States)

    Porter, Bernajean

    2010-01-01

    Effective communication skills start with content that is worthy of sharing. Students exploring and using various technologies, unfortunately, easily become enamoured by media novelties, such as flying words or spinning images, and produce digital products with no beef. Using digital tools does not make their cutting and pasting of summary…

  11. Selection for beef traits and calving performance in Piemontese cattle

    NARCIS (Netherlands)

    Albera, A.

    2006-01-01

    Beef cattle selection programmes are usually focused on the improvement of production traits. However, also functional traits play an important role for the efficiency of animal production. Among these traits calving performance, affecting stillbirth of calves, fertility of cows, animal welfare and

  12. Microbial pathogen control in the beef chain: recent research advances.

    Science.gov (United States)

    Buncic, Sava; Nychas, George-John; Lee, Michael R F; Koutsoumanis, Kostas; Hébraud, Michel; Desvaux, Mickaël; Chorianopoulos, Nikos; Bolton, Declan; Blagojevic, Bojan; Antic, Dragan

    2014-07-01

    Within a recent EU research project ("ProSafeBeef"), research on foodborne pathogens in the beef chain was conducted by using a longitudinally integrated (fork-to-farm) approach. There is not any "single intervention-single chain point" combination by which the pathogens would be reliably and entirely eliminated from the chain resulting in total prevention of pathogens in beef and products thereof at the consumption time. Rather, a range of control interventions have to be applied at multiple points of the chain, so to achieve an acceptable, ultimate risk reduction. Various novel interventions were developed and evaluated during the project, and are briefly summarized in this paper. They include on-farm measures, risk categorisation of cattle presented for slaughter, hygiene-based measures and antimicrobial treatments applied on hides and/or carcasses during cattle slaughter, those applied during beef processing-storage-distribution, use of Time Temperature Integrator-based indicators of safety, and effective sanitation of surfaces. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Evaluation of hair cortisol in beef cattle of divergent temperaments

    Science.gov (United States)

    The objective of this research project was to evaluate the relationships among hair and serum cortisol concentrations and cattle disposition. Spring born (n = 101) crossbred beef heifers (7 to 8 mo. of age) were evaluated for temperament preweaning and at weaning by pen score (PS; 1 = calm and 5 = e...

  14. In Vitro Iron Availability from Insects and Sirloin Beef.

    Science.gov (United States)

    Latunde-Dada, Gladys O; Yang, Wenge; Vera Aviles, Mayra

    2016-11-09

    Interest in the consumption of insects (entomophagy) as an alternative environmentally sustainable source of protein in the diet of humans has recently witnessed a surge. Knowledge of the nutrient composition and, in particular, the bioavailability of minerals from insects is currently sparse. This study evaluated the availability of Fe, Ca, Cu, Mg, Mn, and Zn from four commonly eaten insects and compared these to sirloin beef. Soluble iron from the samples was measured by inductively coupled plasma optical emission spectrometry (ICP-OES). Iron bioavailability was determined using an in vitro simulated peptic-pancreatic digestion, followed by measurement of ferritin (a surrogate marker for iron absorption) in Caco-2 cells. Cricket and sirloin beef had comparably higher levels of Fe, Ca, and Mn than grasshopper, meal, and buffalo worms. However, iron solubility was significantly higher from the insect samples than from beef. The complementation of whole-wheat flour with insect or beef protein resulted in overall decreases in mineral content and iron solubility in the composite mixtures. Collectively, the data show that grasshopper, cricket, and mealworms contain significantly higher chemically available Ca, Cu, Mg, Mn, and Zn than sirloin. However, buffalo worms and sirloin exhibited higher iron bioavailability comparable to that of FeSO4. Commonly consumed insect species could be excellent sources of bioavailable iron and could provide the platform for an alternative strategy for increased mineral intake in the diets of humans.

  15. THE DESCRIPTION OF GROWTH IN BEEF BULLS AND ...

    African Journals Online (AJOL)

    Animal orul Dairy Science Research Institute, Private Bag X2, Irene, 1675. (Key words: ...... animals with high fattening capacity (small frame. Hereford) in ... Rate of protein deposition in beef cattle as a function of mature size and weight and ...

  16. Polymorphisms in the leptin gene promoter in Brazilian beef herds.

    Science.gov (United States)

    Guimarães, R C; Azevedo, J S N; Corrêa, S C; Campelo, J E G; Barbosa, E M; Gonçalves, E C; Silva Filho, E

    2016-12-02

    Brazil is the world's largest producer of beef cattle; however, the quality of its herds needs to be improved. The use of molecular markers as auxiliary tools in selecting animals for reproduction with high pattern for beef production would significantly improve the quality of the final beef product in Brazil. The leptin gene has been demonstrated to be an excellent candidate gene for bovine breeding. The objective of this study was to sequence and compare the leptin gene promoter of Brazil's important cattle breeds in order to identify polymorphisms in it. Blood samples of the Nellore, Guzerat, Tabapuã, and Senepol breeds were collected for genomic DNA extraction. The genomic DNA was used as a template for polymerase chain reaction (PCR) to amplify a 1575-bp fragment, which in turn was sequenced, aligned, and compared between animals of different breeds. Twenty-three single nucleotide polymorphic sites, including transitions and transversions, were detected at positions -1457, -1452, -1446, -1397, -1392, -1361, -1238, -963,-901, -578, -516, -483, -478, -470, -432, -430, -292, -282, -272, -211, -202, -170, and -147. Additionally, two insertion sites at positions -680 and -416 and two deletion sites at positions -1255 and -1059 were detected. As the promoter region of the leptin gene has been demonstrated to vary among breeds, these variations must be tested for their use as potential molecular markers for artificial selection of animals for enhanced beef production in different systems of bovine production in Brazil.

  17. Manure total nitrogen flux from condensed tannin fed beef cattle

    Science.gov (United States)

    A study was conducted to determine the effects of three levels of condensed tannins fed to 27 beef feedyard steers on total nitrogen (N) flux from manure. Condensed tannins were fed at rates of 0, 0.5, and 1 percent of the daily ration on a dry matter basis. Manure and urine were collected over two ...

  18. Selection for beef traits and calving performance in Piemontese cattle

    NARCIS (Netherlands)

    Albera, A.

    2006-01-01

    Beef cattle selection programmes are usually focused on the improvement of production traits. However, also functional traits play an important role for the efficiency of animal production. Among these traits calving performance, affecting stillbirth of calves, fertility of cows, animal welfare and

  19. Safety of street vended meat products - chicken and beef suya

    African Journals Online (AJOL)

    USER

    2010-06-28

    Jun 28, 2010 ... second day after heating produced in beef suya 3.3 x 103/g. Shigella ... However, consumers of street vended meat are little aware of ... Growth in peptone water was used for .... vendor to re-heat the suya before purchasing.

  20. Estimates of crossbreeding parameters in a multibreed beef cattle ...

    African Journals Online (AJOL)

    Unknown

    breeds managed in a relatively intensive but high stocking rate environment, were .... crossbreeding effects, using the CBE3 package of Wolf (1996) and fitting Kinghorn's Model 7 (Kinghorn 1987; ... predicted value of the genetic group G under consideration m. = ...... preweaning growth rate and type score of beef calves.

  1. The profitability of beef production under semi-extensive conditions

    African Journals Online (AJOL)

    capital investment and gross margin per animal unit. The need for more ... Figure 1 Relationship between average weighted beef price at urban markets and cost of all ... updated every year using market-related information. Al- though the size ..... be profitable to improve calving rates by additional short-term feeding during ...

  2. Genetic selection strategies to improve longevity in Chianina beef cattle

    NARCIS (Netherlands)

    Forabosco, F.; Boettcher, P.; Bozzi, R.; Filippini, F.; Bijma, P.

    2006-01-01

    Longevity in beef cattle is an important economic trait. Including this trait in a breeding scheme increases profit and has a positive impact on the well-being and welfare of the animals. The aim of the present study was to evaluate the consequences of alternative selection strategies to include lon

  3. Botswana's Beef Global Commodity Chain: Explaining the Resistance to Change

    Science.gov (United States)

    Ransom, Elizabeth

    2011-01-01

    In an era of increasing global agricultural trade, many firms and farms seek to upgrade their agricultural commodity chains to become better integrated into global markets. Utilizing a global commodity chain (GCC) approach, this analysis unravels the challenges to and the potential consequences of upgrading Botswana's beef commodity chain.…

  4. Classification and characterization of Japanese consumers' beef preferences by external preference mapping.

    Science.gov (United States)

    Sasaki, Keisuke; Ooi, Motoki; Nagura, Naoto; Motoyama, Michiyo; Narita, Takumi; Oe, Mika; Nakajima, Ikuyo; Hagi, Tatsuro; Ojima, Koichi; Kobayashi, Miho; Nomura, Masaru; Muroya, Susumu; Hayashi, Takeshi; Akama, Kyoko; Fujikawa, Akira; Hokiyama, Hironao; Kobayashi, Kuniyuki; Nishimura, Takanori

    2017-08-01

    Over the past few decades, beef producers in Japan have improved marbling in their beef products. It was recently reported that marbling is not well correlated with palatability as rated by Japanese consumers. This study sought to identify the consumer segments in Japan that prefer sensory characteristics of beef other than high marbling. Three Wagyu beef, one Holstein beef and two lean imported beef longissimus samples were subjected to a descriptive sensory test, physicochemical analysis and a consumer (n = 307) preference test. According to consumer classification and external preference mapping, four consumer segments were identified as 'gradual high-fat likers', 'moderate-fat and distinctive taste likers', 'Wagyu likers' and 'distinctive texture likers'. Although the major trend of Japanese consumers' beef preference was 'marbling liking', 16.9% of the consumers preferred beef samples that had moderate marbling and distinctive taste. The consumers' attitudes expressed in a questionnaire survey were in good agreement with the preference for marbling among the 'moderate-fat and distinctive taste likers'. These results indicate that moderately marbled beef is a potent category in the Japanese beef market. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  5. 21 CFR 161.175 - Frozen raw breaded shrimp.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen raw breaded shrimp. 161.175 Section 161.175... § 161.175 Frozen raw breaded shrimp. (a) Frozen raw breaded shrimp is the food prepared by coating one of the optional forms of shrimp specified in paragraph (c) of this section with safe and suitable...

  6. 19 CFR 151.22 - Estimated duties on raw sugar.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Estimated duties on raw sugar. 151.22 Section 151... THE TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Sugars, Sirups, and Molasses § 151.22 Estimated duties on raw sugar. Estimated duties shall be taken on raw sugar, as defined...

  7. Molecular typing among beef isolates of Escherichia coli using consensus repetitive intergenic enterobacteria-polymerase chain reaction (ERIC-PCR)

    Science.gov (United States)

    Zoolkifli, Nurliyana Wan; Mutalib, Sahilah Abd

    2013-11-01

    Genomic DNA of Escherichia coli were characterized by enterobacterial repetitive intergenic consensus-Polymerase chain reaction (ERIC-PCR) and the presence of Shiga toxin gene-I (Stx1) and Shiga toxin gene-2 (Stx2). These isolates were originated from imported raw beef which are come from two countries namely Australia and India. The isolation of E. coli was conducted by using Eosin Methylene Blue Agar (EMBA). A total of 94 strains had been isolated from 30 samples of imported raw beefand 42 strains had been detected positively E. coli by doing biochemical tests. All strains had been tested and the results of biochemical tests showed that 3 strains were from Australia samples while the other 39 strains were from India samples. The biochemical tests used are Indole test, Methyl Red test, Voges-Proskauer test and Citrate test. All the 42 strains were examined for Shiga toxin (stx1 and stx2) gene detection by two pair primers which are stx2F (5'-TTCTTCGGTATCCTATTCCC-3'), stx2R (5'-ATGCATCTCTGGTCATTGTA-3'), stx1F (5'-CAGTTAATGTGGTGGCGAAG-3'), and stx1R (5'-CTGTCACAGTAACAACCGT-3'). The results showed that none of the strains are positive for Shiga toxin gene. Application of ERIC-PCR method towards E. coli had successfully shown the high diversity polymorphism in 21 different genome types of DNA with primers ERIC1R (5'- CACTTAGGGGTCCTCGAATGTA- 3') and ERIC2R (5'- AAGTAAGTGACTGGGGTGACGC- 3').

  8. Shiga toxin-producing Escherichia coli in beef retail markets from Argentina

    Directory of Open Access Journals (Sweden)

    Victoria eBrusa

    2013-01-01

    Full Text Available Shiga toxing-producing Escherichia coli (STEC are foodborne pathogens that cause mild or serious diseases and can lead to people death. This study reports the prevalence and characteristics of STEC O157 and non-O157 in commercial ground beef and environmental samples, including meat table, knife, meat mincing machine and manipulator hands (n= 450 obtained from 90 retail markets over a nine-month period. The STEC isolates were serotyped and virulence genes as stx (Shiga toxin, rfbO157 (O157 lipopolysaccharide, fliCH7 (H7 flagellin, eae (intimin, ehxA (enterohemolysin and saa (STEC autoagglutinating adhesin, were determined. STEC O157 were identified in 23 (25.5% beef samples and 16 (4.4% environmental samples, while STEC non-O157 were present in 47 (52.2% and 182 (50.5%, respectively. Among 54 strains isolated, 17 were STEC O157:H7 and 37 were STEC non-O157. The prevalent genotype for O157 was stx2/eae/ehxA/fliCH7 (83.4%, and for STEC non-O157 the most frequent ones were stx1/stx2/saa/ehxA (29.7%; stx2 (29.7%; and stx2/saa/ehxA (27%. None of the STEC non-O157 strains were eae-positive. Besides O157:H7, other 20 different serotypes were identified, being O8:H19, O178:H19 and O174:H28 the prevalent. Strains belonging to the same serotype could be isolated from different sources of the same retail market. Also, the same serotype could be detected in different stores. In conclusion, screening techniques are increasingly sensitive, but the isolation of STEC non-O157 is still a challenge. Moreover, with the results obtained from the present work, although more studies are needed, cross-contamination between meat and the environment could be suspected.

  9. Nicotinamide riboside phosphorylase from beef liver: purification and characterization.

    Science.gov (United States)

    Imai, T; Anderson, B M

    1987-04-01

    Nicotinamide riboside phosphorylase (NR phosphorylase) from beef liver has been purified to apparent homogeneity at 300-fold purification with a 35% yield. Kinetic constants for the enzyme-catalyzed phosphorolysis were as follows Knicotinamide riboside, 2.5 +/- 0.4 mM; Kinorganic phosphate, 0.50 +/- 0.12 mM; Vmax, 410 +/- 30 X 10(-6) mol min-1 mg protein-1, respectively. The molecular weights of the native enzyme and subunit structure were determined to be 131,000 and 32,000, respectively, suggesting the beef liver NR phosphorylase to be tetrameric in structure and consistent with the presence of identical subunits. The amino acid composition was shown to be very similar to that reported for human erythrocyte purine-nucleoside phosphorylase but differing considerably from that found for rat liver purine-nucleoside phosphorylase. In addition to catalytic activity with nicotinamide riboside, the beef liver enzyme catalyzed a phosphorolytic reaction with inosine and guanosine exhibiting activity ratios, nicotinamide riboside:inosine: guanosine of 1.00:0.35:0.29, respectively. These ratios of activity remained constant throughout purification of the beef liver enzyme and no separation of these activities was detected. Phosphorolysis of nicotinamide riboside was inhibited competitively by inosine (Ki = 75 microM) and guanosine (Ki = 75 microM). Identical rates of thermal denaturation of the beef liver enzyme were observed when determined for the phosphorolysis of either nicotinamide riboside or inosine. These observations coupled with studies of pH and specific buffer effects indicate the phosphorolysis of nicotinamide riboside, inosine, and guanosine to be catalyzed by the same enzyme.

  10. A traditional intermediate moisture meat: Beef cecina.

    Science.gov (United States)

    Reyes-Cano, R; Dorantes-Alvarez, L; Hernandez-Sanchez, H; Gutierrez-Lopez, G F

    1994-01-01

    Cecina is an intermediate moisture meat produced and consumed to a large extent in Mexico. Four samples of cecina coming from different States of this country, were tested for water activity, colour, texture, fat, protein, moisture and chloride content. Sensory and microbiological analyses were also performed. Different fabrication methods for producing cecina were identified, involving large variations in the formulation of the product. There was a significant difference (P < 0·05) among samples regarding fat and chloride content, colour and texture. Differences in colour and saltiness were recorded through sensory analysis. Microbiological analysis showed higher counts than those recommended in the Mexican Official Standard for chopped and raw meat, due to poor sanitary conditions during production and marketing.

  11. Transfer of Salmonella enterica Serovar Typhimurium from Beef to Tomato through Kitchen Equipment and the Efficacy of Intermediate Decontamination Procedures.

    Science.gov (United States)

    Gkana, E; Lianou, A; Nychas, G-J E

    2016-07-01

    It is well established that a high percentage of foodborne illness is caused by failure of consumers to prepare food in a hygienic manner. Indeed, a common practice in households is to use the same kitchen equipment for both raw meat and fresh produce. Such a practice may lead to cross-contamination of fruits and vegetables, which are mainly consumed without further processing, with pathogenic microorganisms originating from raw meat. The present study was performed to examine the transfer of the pathogenic bacterium Salmonella enterica serovar Typhimurium from inoculated beef fillets to tomatoes via contact with high-density polyethylene (PE), stainless steel (SS), and wooden (WD) surfaces and through cutting with SS knives. Furthermore, the following decontamination procedures were applied: (i) rinsing with tap water, (ii) scrubbing with tap water and liquid dish detergent, and (iii) using a commercial antibacterial spray. When surfaces and knives that came into contact with contaminated beef fillets were not cleaned prior to handling tomatoes, the lowest level of pathogen transfer to tomatoes was observed through PE surfaces. All of the decontamination procedures applied were more effective on knives than on surfaces, while among the surface materials tested, WD surfaces were the most difficult to decontaminate, followed by PE and SS surfaces. Mechanical cleaning with tap water and detergent was more efficient in decontaminating WD surfaces than using commercial disinfectant spray, followed by rinsing only with water. Specifically, reductions of 2.07 and 1.09 log CFU/cm(2) were achieved by washing the WD surfaces with water and detergent and spraying the surfaces with an antibacterial product, respectively. Although the pathogen's populations on SS and PE surfaces, as well as on tomatoes, after both aforementioned treatments were under the detection limit, the surfaces were all positive after enrichment, and thus, the potential risk of cross-contamination cannot

  12. A Pilot Study to Compare a Mushroom-Soy-Beef Burger to an All-Beef Burger in School Meals

    Science.gov (United States)

    Summers, Amber C.; Smith, Paul; Ezike, Adaora; Frutchey, Robin; Fahle, Jenna; DeVries, Eva; Taylor, Jarrett; Cheskin, Lawrence J.

    2015-01-01

    Purpose/Objectives: The purpose of this study was to determine if mushroom blended recipes are an acceptable option for use in the school food program. The palatability and acceptance of mushroom-soy-beef blend burgers among school-aged children was tested. Methods: Students in grades 2 through 8 were invited to participate in a taste test.…

  13. Relationship of feed efficiency of replacement beef heifers to subsequent feed efficiency as 3-year old suckled beef cows

    Science.gov (United States)

    We determined the correlaton between Residual Feed Intake (RFI) measured as post-weaned growing heifers (phase 1) and RFI measured as lactating beef cows (phase 2) in the same cohort. Individual performance and daily DMI were evaluated in 74 yearling heifers, and were subsequently reevaluated upon t...

  14. Quality evaluation of commercially available roast beef based on fuzzy comprehensive evaluation%基于模糊综合评价法的市售烧烤牛肉质量评价

    Institute of Scientific and Technical Information of China (English)

    龚艳; 汤晓艳; 王敏; 陶瑞; 颜成英

    2015-01-01

    本研究为建立烧烤牛肉感官指标评价体系,为烧烤牛肉原料肉指标评价体系的建立提供依据,以具有烧烤牛肉消费经验的人群为调查对象,统计消费者对烧烤牛肉感官评定指标(嫩度、风味、多汁性、颜色、弹性与润滑性)的评价结果,运用模糊综合评价方法对烧烤牛肉的满意度进行分析.结果表明,消费者对现有市售烧烤牛肉的总体满意度是较高,并且各感官指标重要性顺序从大到小依次为嫩度、风味、多汁性、颜色、弹性和润滑性.本研究说明运用模糊综合评价方法对市售烧烤牛肉进行质量评价是可行的.%This study was aimed to establish a roast beef sensory property evaluation system and to provide the basis for the establishment of roast raw beef' s sensory property evaluation system.The method of fuzzy mathematics comprehensive evaluation was applied to analyze roast beef satisfaction,and the consumer evaluation to roast beef sensory evaluation properties (flavor,tenderness,juiciness,color,elastic and lubricity,respectively) was conducted in the study by investigating the consumers who had consumed roast beef.Results showed that consumers were more satisfied with the roast beef on the present market,and they thought that the importance ranking of sensory properties was tenderness,flavor,juiciness,color,elastic and lubricity from most important to least.This study showed that fuzzy comprehensive evaluation to evaluate quality of commercially available roast beef was feasible.

  15. Spanish, French and British consumers' acceptability of Uruguayan beef, and consumers' beef choice associated with country of origin, finishing diet and meat price.

    Science.gov (United States)

    Realini, C E; Font i Furnols, M; Sañudo, C; Montossi, F; Oliver, M A; Guerrero, L

    2013-09-01

    The effect of country of origin (local, Switzerland, Argentina, Uruguay), finishing diet (grass, grass plus concentrate, concentrate), and price (low, medium, high) on consumer's beef choice and segmentation was evaluated in Spain, France and United Kingdom. Sensory acceptability of Uruguayan beef from different production systems was also evaluated and contrasted with consumers' beef choices. Origin was the most important characteristic for the choice of beef with preference for meat produced locally. The second most important factor was animal feed followed by price with preference for beef from grass-fed animals and lowest price. The least preferred product was beef from Uruguay, concentrate-fed animals and highest price. Sensory data showed higher acceptability scores for Uruguayan beef from grass-fed animals with or without concentrate supplementation than animals fed concentrate only. Consumer segments with distinct preferences were identified. Foreign country promotion seems to be fundamental for marketing beef in Europe, as well as the development of different marketing strategies to satisfy each consumer segment.

  16. 卤牛肉与牛肉高汤联合生产技术%Joint production technology of stewed beef and beef broth

    Institute of Scientific and Technical Information of China (English)

    马晓钟; 张蕾

    2015-01-01

    The joint production processing of stewed beef and beef broth was discussed. The pro⁃duction economic benefits were analyzed.%主要阐述卤牛肉与牛肉高汤联合生产工艺,分析了产生的经济效益。

  17. Relationships among performance, residual feed intake, and temperament assessed in growing beef heifers and subsequently as 3-year-old, lactating beef cows

    Science.gov (United States)

    Seventy-four beef heifers were used to evaluate the relationships among performance, residual feed intake (RFI), and temperament measured as growing heifers (Phase 1) and subsequently as 3-year-old lactating beef cows (Phase 2) in the same cohort. In both phases, females were housed in a covered fac...

  18. Effects of crossing of domestic breed with beef breeds on the quality of meat in PR China and Republic of Serbia

    OpenAIRE

    Aleksić S.; Fang Sun; Di Liu; Petrović M.M.; Pantelić V.; Stanišić N.; Ostojić-Andrić D.; Petričević M.; Nikšić D.; Delić N.

    2013-01-01

    This paper presents the results of crossing Domestic Spotted breed with beef cattle breeds in the People's Republic of China and the Republic of Serbia. China is a big country of beef production and consumption. In 2012, beef production in China was 5,540,000 tons, which accounted for 9.7% of the global beef production, ranking the third in the world. The main sources of China’s beef are from crossbreeding cattle (native breed crossbred with foreign beef ca...

  19. Scientific and technical factors affecting the setting of Salmonella criteria for raw poultry: a global perspective.

    Science.gov (United States)

    Mead, Geoffrey; Lammerding, Anna M; Cox, Nelson; Doyle, Michael P; Humbert, Florence; Kulikovskiy, Alexander; Panin, Alexander; do Nascimento, Vladimir Pinheiro; Wierup, Martin

    2010-08-01

    Concerns about foodborne salmonellosis have led many countries to introduce microbiological criteria for certain food products. If such criteria are not well-grounded in science, they could be an unjustified obstacle to trade. Raw poultry products are an important part of the global food market. Import and export ambiguities and regulatory confusion resulting from different Salmonella requirements were the impetus for convening an international group of scientific experts from 16 countries to discuss the scientific and technical issues that affect the setting of a microbiological criterion for Salmonella contamination of raw chicken. A particular concern for the group was the use of criteria implying a zero tolerance for Salmonella and suggesting complete absence of the pathogen. The notion can be interpreted differently by various stakeholders and was considered inappropriate because there is neither an effective means of eliminating Salmonella from raw poultry nor any practical method for verifying its absence. Therefore, it may be more useful at present to set food safety metrics that involve reductions in hazard levels. Such terms as "zero tolerance" or "absence of a microbe" in relation to raw poultry should be avoided unless defined and explained by international agreement. Risk assessment provides a more meaningful approach than a zero tolerance philosophy, and new metrics, such as performance objectives that are linked to human health outcomes, should be utilized throughout the food chain to help define risk and identify ways to reduce adverse effects on public health.

  20. Globalization determinants of raw materials markets development

    Directory of Open Access Journals (Sweden)

    Olga Yatsenko

    2013-02-01

    Full Text Available The determinants of development of raw materials markets and the peculiarities of their formation in the terms of world economy globalization have been researched. The empirical base of research is the agricultural food market as one of the most important bases in the sphere of material production and provision of food security of the country. The important social and economic mission of the agricultural sector has been highlighted, along with the export competitiveness and import dependence of agricultural food products in the international trade. The imperative norms have been substantiated and conclusions have been drawn regarding the establishment of respective conditions for the operation of globally integrated markets in Ukraine.

  1. Clay ground in paintings: from Northern to Southern Europe

    DEFF Research Database (Denmark)

    Buti, David; Vila, Anna; Haack Christensen, Anne

    it give more flexibility to the painting support? Was it connected to the tile industry? Was it a waste/reuse from the ceramic production? To better understand the role of clay ground as a material and its influence on painting techniques, a number of Danish and Italian 17th century paintings from...... of the period, the transmission of technology and knowledge of employing this type of clay grounds and, possibly, tracing the origin of the raw materials employed in the grounds. [1] K. M. Groen, ArtMatters - Netherlands Technical Studies in Art, 3, 2005, 138-154. Waanders, Zwolle. [2] K. M. Groen, "Grounds...

  2. The usage of plastic waste as a secondary raw material for the modification of sandcrete properties

    Science.gov (United States)

    Klovas, A.; Daukšys, M.; Venčkauskas, L.

    2015-03-01

    Recently the usage of various industry wastes as a secondary raw material tends to increase its relevancy. One of possible options to decrease the amount of waste is to use them to produce new products or materials. The operation of various secondary raw materials (tire rubber, tire cord, ground glass shards, ground ceramic waste products) during the concrete mixture preparation allows to change its as well as cured concrete properties. Recently polymer and steel fibers are used for concrete reinforcement. This study analyses the usage possibility of plastic shavings for the reinforcement of concrete. The technological properties of cement slurry (sand, fraction of 0/4 and 10 kg/m3, 15 kg/m3 and 20 kg/m3 of plastic shavings) as well as mechanical, physical and porosity properties of cured sandcrete were established during the experimental research. The geometric characteristics of mill-shredded plastic shavings were established. Experimental results revealed that the usage of plastic shavings decreased slurry slump and density. The minor decrease of cured sandcrete density (~2200 kg/m3) was noticed with the addition of plastic shavings within the limits of 10 - 20 kg/m3. The flexural strength of cured sandcrete increased from 36 % to 57 % compared with reference specimen (without plastic shavings). The dependence of flexural force and deflection was obtained. Study revealed that the residual strength after crack opening is bigger with the usage of plastic shavings as a secondary raw material compared with reference specimen.

  3. European consumer acceptance of safety-improving interventions in the beef chain

    DEFF Research Database (Denmark)

    Van Wezemael, Lynn; Verbeke, Wim; Kügler, Jens O.

    2011-01-01

    While safety interventions are applied on different stages of the beef chain, consumer acceptance remains largely uninvestigated and undiscussed though often taken for granted. In this study, European consumer acceptance of beef safety-enhancing interventions was investigated at three key stages...... of the beef chain: primary production (adjusting cattle feed), slaughtering (decontaminating cattle hides) and processing (applying treatments). This paper presents original findings from a quantitative study with beef consumers (n ¼ 2520) from five European countries (France, Germany, Poland, Spain...... and the United Kingdom). Acceptance levels differ between countries and consumer segments, and between stages of application, processes, and level of information detail provided. Higher a priori confidence in beef and beef products, as well as higher risk perception were associated with increased acceptance...

  4. Effects of dry-aging on meat quality attributes and metabolite profiles of beef loins.

    Science.gov (United States)

    Kim, Yuan H Brad; Kemp, Robert; Samuelsson, Linda M

    2016-01-01

    The objectives of this study were to evaluate different dry-aging regimes and their impacts on quality attributes and metabolite profiles of beef loins. Thirty loins (M. longissimus lumborum) from 15 beef carcasses at 2 days post-mortem were obtained. Each loin was cut in half yielding 60 sections, which were randomly assigned to six treatments including 4 dry-aging (2 temperatures (1 or 3°C) × 2 air-velocities (0.2 or 0.5 m/s)) and 2 wet-aging regimes for 3 weeks; n=10/treatment. The sensory panel found that dry-aged loins had better flavour and overall liking (Pdry-aged beef compared to the wet-aged beef, which may contribute to the enhanced flavours of the dry-aged beef. Overall, dry-aging loins at 3°C with 0.2m/s resulted in the greatest improvement in beef palatability.

  5. European consumer acceptance of safety-improving interventions in the beef chain

    DEFF Research Database (Denmark)

    Van Wezemael, Lynn; Verbeke, Wim; Kügler, Jens O.

    2011-01-01

    of the beef chain: primary production (adjusting cattle feed), slaughtering (decontaminating cattle hides) and processing (applying treatments). This paper presents original findings from a quantitative study with beef consumers (n ¼ 2520) from five European countries (France, Germany, Poland, Spain......While safety interventions are applied on different stages of the beef chain, consumer acceptance remains largely uninvestigated and undiscussed though often taken for granted. In this study, European consumer acceptance of beef safety-enhancing interventions was investigated at three key stages...... and the United Kingdom). Acceptance levels differ between countries and consumer segments, and between stages of application, processes, and level of information detail provided. Higher a priori confidence in beef and beef products, as well as higher risk perception were associated with increased acceptance...

  6. Growth of Brazilian beef production: effect of shocks of supply and demand

    Directory of Open Access Journals (Sweden)

    Waldemiro Alcântara da Silva Neto

    2014-06-01

    Full Text Available With the considerable growth of beef production in Brazil and the growth in beef exports as a backdrop, the main objective of this study is to identify the factors responsible for the excellent performance of this agribusiness sector. Conducting this study required the construction of a theoretical model that was capable of supporting the specification of the adjusted econometric model using vector autoregression with identification by the Bernanke process. The findings show that the main determinant of beef cattle growth and Brazilian beef exports is increased animal stock. Furthermore, productivity has a positive, albeit more modest, effect on beef production and exports. The results show that the increase of the number of cattle reduces costs to the farmer and retail beef prices.

  7. A Meta-Analysis of the Global Prevalence Rates of Staphylococcus aureus and Methicillin-Resistant S. aureus Contamination of Different Raw Meat Products.

    Science.gov (United States)

    Ou, Qianting; Peng, Yang; Lin, Dongxin; Bai, Chan; Zhang, Ting; Lin, Jialing; Ye, Xiaohua; Yao, Zhenjiang

    2017-03-30

    Previous research has indicated that raw meats are frequently contaminated with Staphylococcus aureus , but data regarding the pooled prevalence rates of S. aureus and methicillin-resistant S. aureus (MRSA) contamination in different types of raw meat products (beef, chicken, and pork) and across different periods, regions, and purchase locations remain inconsistent. We systematically searched the PubMed, EMBASE, Ovid, Web of Science, and HighWire databases to identify studies published up to June 2016. The STROBE guidelines were used to assess the quality of the 39 studies included in this meta-analysis. We observed no significant differences in the pooled prevalence rates of S. aureus and MRSA contamination identified in various raw meat products, with overall pooled prevalence rates of 29.2% (95% confidence interval [CI], 22.8 to 35.9%) and 3.2% (95% CI, 1.8 to 4.9%) identified for the two contaminants, respectively. In the subgroup analyses, the prevalence of S. aureus contamination in chicken products was highest in Asian studies and significantly decreased over time worldwide. In European studies, the prevalence rates of S. aureus contamination in chicken and pork products were lower than those reported on other continents. The pooled prevalence rates of S. aureus contamination in chicken and pork products and MRSA contamination in beef and pork products were significantly higher in samples collected from retail sources than in samples collected from slaughterhouses and processing plants. These results highlight the need for good hygiene during transportation to and manipulation at retail outlets to reduce the risk of transmission of S. aureus and MRSA from meat products to humans.

  8. Biogenic amines in raw and processed seafood

    Directory of Open Access Journals (Sweden)

    Pierina eVisciano

    2012-06-01

    Full Text Available The presence of biogenic amines in raw and processed seafood, associated with either time/temperature conditions or food technologies is discussed in the present paper from a safety and prevention point of view. In particular, storage temperature, handling practices, presence of microbial populations with decarboxylase activity and availability of free amino acids are considered the most important factors affecting the production of biogenic amines in raw seafood. On the other hand, some food technological treatments such as salting, ripening, fermentation or marination can increase the levels of biogenic amines in processed seafood. The consumption of high amount of biogenic amines, above all histamine, can result in food borne poisoning which is a worldwide problem. The European Regulation established as maximum limits for histamine, in fishery products from fish species associated with high histidine amounts, values ranging from 100 to 200 mg/kg, while for products which have undergone enzyme maturation treatment in brine, the aforementioned limits rise to 200 and 400 mg/kg. Preventive measures and emerging methods aiming at controlling the production of biogenic amines are also reported for potential application in seafood industries.

  9. Prevalence and antibiotic resistance of Enterococcus spp. isolated from retail cheese, ready-to-eat salads, ham, and raw meat.

    Science.gov (United States)

    Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A

    2014-08-01

    Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections.

  10. An analysis of the South African beef supply chain: from farm to fork.

    OpenAIRE

    2008-01-01

    The primary objective of this dissertation is to perform an analysis of the South African beef supply chain ‘from farm to fork’. This will contribute towards a better understanding of the beef supply chain, aiding collaboration, transparency and supply chain strategies to enhance national industry competitiveness. Currently, the industry, and the supply chain is facing pertinent challenges such as globalisation, the declining consumption of beef, the disconnection of the farmer from the suppl...

  11. The Economic Effects of New-Product Beef Promotion in Guatemala

    OpenAIRE

    Leister, Amanda M.; Capps, Oral, Jr.; Rosson, C. Parr, III

    2010-01-01

    The implementation of the Central America-Dominican Republic Free Trade Agreement (CAFTA-DR) has expanded trade opportunities for U.S. agricultural producers. U.S. beef is an important product affected by the agreement, and the United States Meat Export Federation (USMEF) invested in a new product promotion program to increase exports of U.S. beef to Guatemala. Consumer responsiveness and the effectiveness of the U.S. branded beef promotion program are analyzed in this study. Demand responses...

  12. Channels, Margin and Proft Beef Cattle Marketing Agencies from Bone District To Makassar City

    OpenAIRE

    Hastang; Asnawi, A.

    2015-01-01

    This study aimed to determine the channel marketing types, margin and proft of beef cattle marketing agency from Bone Regency to Makassar. The population of the study covered all beef cattle marketing agencies of Bone Regency to Makassar. Determination of the samples was done by snowball sampling method. Data were collected through direct observation and interviews. Data were then analyzed descriptively. The results showed that there were two forms of beef cattle marketing cha...

  13. Meat Science and Muscle Biology Symposium: Development of bacteriophage treatments to reduce Escherichia coli O157:H7 contamination of beef products and produce.

    Science.gov (United States)

    Hong, Y; Pan, Y; Ebner, P D

    2014-04-01

    Escherichia coli O157:H7 remains a foodborne pathogen of concern with infections associated with products ranging from ground beef to produce to processed foods. We previously demonstrated that phage-based technologies could reduce foodborne pathogen colonization in live animals. Here, we examined if a 3-phage cocktail could reduce E. coli O157:H7 in experimentally contaminated ground beef, spinach, and cheese. The 3 phages were chosen from our E. coli O157:H7 phage library based on their distinct origins of isolation, lytic ranges, and rapid growth (40- to 50-min life cycle). Two phages belonged to the Myoviridae family and the other phage belonged to the Siphoviridae family. The phage cocktail was added to ground beef, spinach leaves, and cheese slices contaminated with E. coli O157:H7 (10(7) cfu) at a multiplicity of infection of 1. Phage treatment reduced (P refrigeration (4 °C), and 0.56 log10 cfu/mL in undercooked condition (internal temperature of 46 °C). Likewise, phage treatment reduced (P adsorption assays indicated that phage resistance in strains 309-PR4 and 502-PR5 was mediated, at least in part, by prevention of phage adsorption. Phage resistance in strain 309-PR1 was the result of limited phage proliferation. Phage resistance was stably maintained in vitro throughout a 4-d subculture period in the absence of phage. No significant reductions in bacterial growth or cell adhesion were observed in resistant strains. Taken together, our results provide additional support for the use of phage to control E. coli O157:H7 in food products; however, the emergence of phage-resistant bacteria could limit the efficacy of phage products. Therefore, further studies are needed to develop resistance mitigation strategies to optimize phage-based technologies.

  14. Contamination of beef products with staphylococcal classical enterotoxins in Egypt and Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Shawish, Reyad R.

    2016-04-01

    Full Text Available Food-borne pathogens are of high concern for public health and food safety. food poisoning is one of the most economically devastating types of food poisoning globally. The purpose of this study was to detect staphylococcal classical enterotoxins (SEs in processed beef from Kingdom of Saudi Arabia (KSA and Egypt. In the present investigation a total of 250 random processed meat samples (50 each of minced meat, beef burger, beef sausage, beef kofta and beef luncheon were collected from different super markets in the study area. Using conventional cultural methods, samples were cultured for isolation and identification of . Multiplex PCR was used to detect SEs of the classical type SEA, SEB, SEC and SED from isolates.The percentage presence of in minced meat, beef burger, beef sausage, beef kofta and beef luncheon was 38%, 22%, 30%, 32% and 12%, respectively. Multiplex PCR indicated that all examined samples contain different types of classical staphylococcal enterotoxins and only minced meat samples contained all four types of toxins. Multiplex PCR is efficient in detection of SEs from food and may be used in tracing of toxins to promote food hygiene. Implications of contamination of processed meat to food hygiene in the study area are highlighted.

  15. From the Plains to the plate : can the beef industry regain market share?

    OpenAIRE

    Lamb, Russell L.; Michelle Beshear

    1998-01-01

    Over the past several decades, the beef industry has seen a sharp drop in its share of the retail meat market. While per capita meat consumption has grown, per capita beef consumption has plunged. Explaining the drop in beef's market share has become a favorite pastime of industry analysts. In fact, a family feud of sorts has broken out in the industry between those who think the decline largely reflects increases in beef's price relative to competing meats and those who stress nonprice facto...

  16. Lime kiln dust as a potential raw material in portland cement manufacturing

    Science.gov (United States)

    Miller, M. Michael; Callaghan, Robert M.

    2004-01-01

    In the United States, the manufacture of portland cement involves burning in a rotary kiln a finely ground proportional mix of raw materials. The raw material mix provides the required chemical combination of calcium, silicon, aluminum, iron, and small amounts of other ingredients. The majority of calcium is supplied in the form of calcium carbonate usually from limestone. Other sources including waste materials or byproducts from other industries can be used to supply calcium (or lime, CaO), provided they have sufficiently high CaO content, have low magnesia content (less than 5 percent), and are competitive with limestone in terms of cost and adequacy of supply. In the United States, the lime industry produces large amounts of lime kiln dust (LKD), which is collected by dust control systems. This LKD may be a supplemental source of calcium for cement plants, if the lime and cement plants are located near enough to each other to make the arrangement economical.

  17. Bacteriological quality of raw milk used for production of a Brazilian farmstead raw milk cheese.

    Science.gov (United States)

    Costa Sobrinho, Paulo de Souza; Marçal de Faria, Camila Andreata; Silva Pinheiro, Julia; Gonçalves de Almeida, Héllen; Vieira Pires, Christiano; Silva Santos, Aline

    2012-02-01

    The objective of this study was to evaluate the bacteriological quality of raw cow's milk utilized for the production of Traditional Minas Serro cheese, a Brazilian farmstead raw milk cheese. Raw milk samples were collected from six farmstead cheese operations manufacturing raw milk cheese from cow's milk. Coliform count (CC) and Escherichia coli counts were determined using Petrifilm™ EC plates, and Staphylococcus aureus counts were determined using Petrifilm™ Staph Express count plates. The standard plate count (SPC) was determined using plate count agar. The somatic cell count (SCC) was determined with a DeLaval cell counter. The detection of Listeria monocytogenes was based in the ISO 11290-1 protocol. A total of 165 samples were analyzed, and the SPC was 1.85-7.88 log CFU/mL. Coliform were detected in 140 (84.8%) of the 165 samples, with counts of 1-6.39 log CFU/mL. E. coli was detected in 17 (10.3%) samples, with counts of 1-2.18 log CFU/mL. The SCC in raw milk was 10,000-1,390,000 cells per mL, with mean and geometric mean values of 247,000 and 162,181, respectively. The SCC did not differ significantly between the seasons (p>0.05), but differed between different farms (pcount was 1.47-5.03 log CFU/mL. The median of SPC, CC, and S. aureus counts differed significantly between seasons and between farms (pbacterial (including pathogenic) presence.

  18. Identification of beef using restriction fragment length polymorphism–

    Directory of Open Access Journals (Sweden)

    R. A. Al-Sanjary

    2009-01-01

    Full Text Available To differentiate the beef from other types of meat consumed by human, DNA markers based on polymerase chain reaction restriction fragment length polymorphism technique is performed by using universal primers designed on mitochondrial cytochrome b gene to obtain amplified band 359 bp, then digested with some of restriction enzymes like Tru91, RsaI, Hinf I, Hae III, Alu I, Taq I, Mob I. The result revealed that, the Hinf I enzyme produce three bands 198, 117, 44 bp and the Hae III enzyme revealed two band 285, 74 bp, the Alu I enzyme also produced two band but the molecular weight are 190, 169 bp. The other enzymes did not reveal any digestion of the amplified bands and this result is a characteristic unique to beef compared with other types of meat when using same enzymes.

  19. Beef quality attributes: A systematic review of consumer perspectives.

    Science.gov (United States)

    Henchion, Maeve M; McCarthy, Mary; Resconi, Virginia C

    2017-06-01

    Informed by quality theory, this systematic literature review seeks to determine the relative importance of beef quality attributes from a consumer perspective, considering search, experience and credence quality attributes. While little change is anticipated in consumer ranking of search and experience attributes in the future, movement is expected in terms of ranking within the credence category and also in terms of the ranking of credence attributes overall. This highlights an opportunity for quality assurance schemes (QAS) to become more consumer focused through including a wider range of credence attributes. To capitalise on this opportunity, the meat industry should actively anticipate new relevant credence attributes and researchers need to develop new or better methods to measure them. This review attempts to identify the most relevant quality attributes in beef that may be considered in future iterations of QAS, to increase consumer satisfaction and, potentially, to increase returns to industry.

  20. Qualitative improvement of low meat beef burger using Aloe vera.

    Science.gov (United States)

    Soltanizadeh, Nafiseh; Ghiasi-Esfahani, Hossein

    2015-01-01

    Low meat beef burgers have found their niche in the food markets in developing countries because of their lower price. However, these burgers still lack an acceptable quality. This study investigates the effects of different concentrations of Aloe vera on the quality of this food product. For this purpose, beef burgers were produced with 0%, 1%, 3%, and 5% Aloe vera and the changes in their cooking parameters, lipid oxidation, texture, and appeal to consumers over 7days of refrigerated storage were evaluated. Results indicate that Aloe vera contributed to some extent to decreased cooking loss and diameter reduction in the burgers. Increased concentrations of Aloe vera led to improvements in the water absorption and texture of the burgers as well as their lipid stability. However, a concentration level of 3% led to the most acceptability of the product to the panelists. Finally, it was found that Aloe vera acts as a hydrocolloid and improves the quality of burgers.

  1. MODEL SYSTEM EVALUATIONS OF MEAT EMULSIONS PREPARED WITH DIFFERENT EDIBLE BEEF BY PRODUCTS AND FATS AND OIL

    Directory of Open Access Journals (Sweden)

    Mustafa KARAKAYA

    1997-02-01

    Full Text Available Emulsion parameters of different meat by-products (beef head-meat, beef heart and liver and animal fats and oil (beef fat, mutton fat, sheep tail-fat and corn oil were studied in a model system. The results of the study showed that the highest emulsion capacity (EC was with the heart meat and beef fat emulsion while the lowest EC was measured in the beef head-meat and sheep tail-fat combination. Corn oil gave the best emulsification with beef head-meat and liver, and beef fat resulted the second best results. Beef head-meat gave the most stable emulsion with all fats, but the emulsions prepared with heart and liver were generally unstable.

  2. Control of Clostridium perfringens spores by plant-derived antimicrobials during cooling of cooked ground beef

    Science.gov (United States)

    Inhibition of Clostridium perfringens spore germination and outgrowth by carvacrol, cinnamaldehyde, thymol, oregano oil and two green tea extracts with low (green tea leaf powder (GTL); 141 mg of total catechins/g of green tea extract) and high (green tea leaf extract (GTE); 697 mg of total catechin...

  3. Electrochemiluminescence immunosorbent assay of ricin in ground beef: Biotinylated capture antibodies and matrix effects

    Science.gov (United States)

    Ricin is a highly toxic protein present in the seeds of castor (Ricinus communis), grown principally as a source of high quality industrial lubricant and as an ornamental. Because of the past use of ricin for intentional poisoning, there is a need for analytical methodology to detect ricin in food m...

  4. Detection of ricin contamination in ground beef by electrochemiluminescence immunosorbent assay

    Science.gov (United States)

    Ricin is a highly toxic protein present in the seeds of Ricinus communis (castor), grown principally as a source of high quality industrial lubricant and as an ornamental. Because ricin has been used for intentional poisoning in the past and could be used to contaminate food, there is a need for ana...

  5. Mild desalination of various raw water streams.

    Science.gov (United States)

    Groot, C K; van den Broek, W B P; Loewenberg, J; Koeman-Stein, N; Heidekamp, M; de Schepper, W

    2015-01-01

    For chemical industries, fresh water availability is a pre-requisite for sustainable operation. However, in many delta areas around the world, fresh water is scarce. Therefore, the E4 Water project (www.e4water.eu) comprises a case study at the Dow site in Terneuzen, The Netherlands, which is designed to develop commercial applications for mild desalination of brackish raw water streams from various origins to enable reuse in industry or agriculture. This study describes an effective two-stage work process, which was used to narrow down a broad spectrum of desalination technologies to a selection of the most promising techniques for a demonstration pilot at 2-4 m³/hour. Through literature study, laboratory experiments and multi-criteria analysis, nanofiltration and electrodialysis reversal were selected, both having the potential to attain the objectives of E4Water at full scale.

  6. Noise in raw data from magnetic observatories

    Directory of Open Access Journals (Sweden)

    S. Y. Khomutov

    2017-09-01

    Full Text Available In spite of significant progress in the development of new devices for magnetic measurements, mathematical and computational technologies for data processing and means of communication, the quality of magnetic data accessible through the data centres (for example, World Data Centres or INTERMAGNET still largely depends on the actual conditions in which observation of the Earth's magnetic field is performed at observatories. Processing of raw data of magnetic measurements by observatory staff plays an important role. It includes effective identification of noise and elimination of its influence on final data. In this paper, on the basis of the experience gained during long-term magnetic monitoring carried out at the observatories of IKIR FEB RAS (Russia and CSIR-NGRI (India, we present a review of methods commonly encountered in actual practice for noise identification and the possibility of reducing noise influence.

  7. Noise in raw data from magnetic observatories

    Science.gov (United States)

    Khomutov, Sergey Y.; Mandrikova, Oksana V.; Budilova, Ekaterina A.; Arora, Kusumita; Manjula, Lingala

    2017-09-01

    In spite of significant progress in the development of new devices for magnetic measurements, mathematical and computational technologies for data processing and means of communication, the quality of magnetic data accessible through the data centres (for example, World Data Centres or INTERMAGNET) still largely depends on the actual conditions in which observation of the Earth's magnetic field is performed at observatories. Processing of raw data of magnetic measurements by observatory staff plays an important role. It includes effective identification of noise and elimination of its influence on final data. In this paper, on the basis of the experience gained during long-term magnetic monitoring carried out at the observatories of IKIR FEB RAS (Russia) and CSIR-NGRI (India), we present a review of methods commonly encountered in actual practice for noise identification and the possibility of reducing noise influence.

  8. The complex microbiota of raw milk.

    Science.gov (United States)

    Quigley, Lisa; O'Sullivan, Orla; Stanton, Catherine; Beresford, Tom P; Ross, R Paul; Fitzgerald, Gerald F; Cotter, Paul D

    2013-09-01

    Here, we review what is known about the microorganisms present in raw milk, including milk from cows, sheep, goats and humans. Milk, due to its high nutritional content, can support a rich microbiota. These microorganisms enter milk from a variety of sources and, once in milk, can play a number of roles, such as facilitating dairy fermentations (e.g. Lactococcus, Lactobacillus, Streptococcus, Propionibacterium and fungal populations), causing spoilage (e.g. Pseudomonas, Clostridium, Bacillus and other spore-forming or thermoduric microorganisms), promoting health (e.g. lactobacilli and bifidobacteria) or causing disease (e.g. Listeria, Salmonella, Escherichia coli, Campylobacter and mycotoxin-producing fungi). There is also concern that the presence of antibiotic residues in milk leads to the development of resistance, particularly among pathogenic bacteria. Here, we comprehensively review these topics, while comparing the approaches, both culture-dependent and culture-independent, which can be taken to investigate the microbial composition of milk.

  9. From Raw Data to Physics Results

    CERN Document Server

    CERN. Geneva

    2005-01-01

    These series of lectures describes the work that lies between the raw data taken by the detector elements and the physics variables used to study particular reactions. We start by defining some simple physics variables of interest, then describe the fitting process used to extract values from the observed patterns in typical detectors. This is followed by a discussion of the various problems of pattern recognition in tracking, calorimetry and particle identification detectors. The process of calibration and alignment is surveyed, with emphasis on getting "reasonable" results in the absence of formally complete information. Finally, the role of Monte Carlo simulation in understanding the quality of the obtained information is examined. Throughout, we emphasize how the use of "composite" observables is required due to what our instrumentation and reconstruction can achieve.

  10. From raw data to physics results

    CERN Document Server

    CERN. Geneva

    1999-01-01

    This series of lectures describes the work that lies between the raw data taken by the detector elements and the physics variables used to study particular reactions. We start by defining some simple physics variables of interest, then describe the fitting process used to extract values from the observed patterns in typical detectors. This is followed by a discussion of the various problems of pattern recognition in racking, calorimetry and particle identification detectors. The process of calibration and alignment is surveyed, with emphasis on getting "reasonable" results in the absence of formally complete information. Finally, the role of Monte Carlo simulation in understanding the quality of the obtained information is examined. Throughout, we emphasize how the use of "composite" observables is required due to what our instrumentation and reconstruction can achieve.

  11. From Raw Data to Physics Results course

    CERN Document Server

    CERN. Geneva HR-RFA

    2006-01-01

    It would be helpful for students to know: a) How measurements are made in physical detectors, for example how a tracking chamber "sees" a charged particle or how a calorimeter measures energy. b) That physics processes result in photons, leptons, etc., which we then want to detect and analyze. These series of lectures describes the work that lies between the raw data taken by the detector elements and the physics variables used to study particular reactions. We start with an example analysis to show the kinds of information needed. We then describe the fitting process used to extract values from the observed patterns in typical detectors. This is followed by a discussion of the various problems of pattern recognition in tracking, calorimetry and particle identification detectors. The role of Monte Carlo simulation in understanding the quality of the obtained information is examined. We discuss how the use of "composite" observables is required due to what our instrumentation and reconstruction can achieve. Th...

  12. Package systems and storage times serve as postlethality controls for Listeria monocytogenes on whole-muscle beef jerky and pork and beef smoked sausage sticks.

    Science.gov (United States)

    Lobaton-Sulabo, April Shayne S; Axman, Tyler J; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Uppal, Kamaldeep K; Barry, Bruce; Higgins, James J

    2011-02-01

    To validate how packaging and storage reduces Listeria monocytogenes on whole-muscle beef jerky and smoked pork and beef sausage sticks, four packaging systems (heat sealed [HS] without vacuum, heat sealed with oxygen scavenger, nitrogen flushed with oxygen scavenger [NFOS], and vacuum) and four ambient temperature storage times were evaluated. Commercially available whole-muscle beef jerky and smoked pork and beef sausage sticks were inoculated with a five-strain L. monocytogenes cocktail, packaged, and then stored at 25.5 °C until enumerated for L. monocytogenes at 0, 24, 48, and 72 h and 30 days after packaging. The interaction of packaging and storage time affected L. monocytogenes reduction on jerky, but not on sausage sticks. A >2-log CFU/cm(2) reduction was achieved on sausage sticks after 24 h of storage, regardless of package type, while jerky had 2 log CFU/cm(2), except for NFOS (1.22-log CFU/cm(2) reduction). Processors could package beef jerky in HS packages with oxygen scavenger or vacuum in conjunction with a 24-h holding time as an antimicrobial process to ensure a >1-log CFU/cm(2) L. monocytogenes reduction or use a 48-h holding time for HS- or NFOS-packaged beef jerky. A >3-log CFU/cm(2) mean reduction was observed for all beef jerky and sausage stick packaging systems after 30 days of 25.5 °C storage.

  13. Cue utilisation and quality perception with regard to branded beef

    DEFF Research Database (Denmark)

    Bredahl, Lone

    2004-01-01

    Consumers' quality perception is based on individual evaluative judgments. Meat is a food category where consumers' quality perception is particularly difficult, among other things because meat is mostly sold unbranded. Through interviews with buyers of branded beef steaks, the study investigates...... the presence of a brand, the correspondence between expected and experienced quality remains moderate. Product familiarity seems to influence the quality perception process as well, with low familiarity consumers relying significantly more on the brand as a quality cue....

  14. Beef Supply Response Under Uncertainty: An Autoregressive Distributed Lag Model

    OpenAIRE

    Mbaga, Msafiri Daudi; Coyle, Barry T.

    2003-01-01

    This is the first econometric study of dynamic beef supply response to incorporate risk aversion or, more specifically, price variance. Autoregressive distributed lag (ADL) models are estimated for cow-calf and feedlot operations using aggregate data for Alberta. In all cases, output price variance has a negative impact on output supply and investment. Moreover, the impacts of expected price on supply response are greater in magnitude and significance than in risk-neutral models.

  15. Study on Five Microsatellite Markers in Beef Cattle Population

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Five microsatellites, IDVGA-2, IDVGA-27, IDVGA-46, IDVGA-55 and TGLA-44,were analyzed for polymorphisms in beef cattle. The number of alleles and polymorphism information content (PIC) values were 12/0. 82, 5/0. 58, 8/0. 70, 6/0. 57 and 11/0. 86 respectively. Each microstellite was typed on a half-sib family in order to verify the segregation of the alleles.

  16. Cue utilisation and quality perception with regard to branded beef

    DEFF Research Database (Denmark)

    Bredahl, Lone

    2004-01-01

    Consumers' quality perception is based on individual evaluative judgments. Meat is a food category where consumers' quality perception is particularly difficult, among other things because meat is mostly sold unbranded. Through interviews with buyers of branded beef steaks, the study investigates...... the presence of a brand, the correspondence between expected and experienced quality remains moderate. Product familiarity seems to influence the quality perception process as well, with low familiarity consumers relying significantly more on the brand as a quality cue....

  17. A survey of beef muscle color and pH.

    Science.gov (United States)

    Page, J K; Wulf, D M; Schwotzer, T R

    2001-03-01

    The objectives of this study were to define a beef carcass population in terms of muscle color, ultimate pH, and electrical impedance; to determine the relationships among color, pH, and impedance and with other carcasses characteristics; and to determine the effect of packing plant, breed type, and sex class on these variables. One thousand beef carcasses were selected at three packing plants to match the breed type, sex class, marbling score, dark-cutting discount, overall maturity, carcass weight, and yield grade distributions reported for the U.S. beef carcass population by the 1995 National Beef Quality Audit. Data collected on these carcasses included USDA quality and yield grade data and measurements of muscle color (L*, a*, b*), muscle pH, and electrical impedance of the longissimus muscle. About one-half (53.1%) of the carcasses fell within a muscle pH range of 5.40 to 5.49, and 81.3% of the carcasses fell within a longissimus muscle pH range of 5.40 to 5.59. A longissimus muscle pH of 5.87 was the approximate cut-off between normal and dark-cutting carcasses. Frequency distributions indicated that L* values were normally distributed, whereas a* and b* values were abnormally distributed (skewed because of a longer tail for lower values, a tail corresponding with dark-cutting carcasses). Electrical impedance was highly variable among carcasses but was not highly related to any other variable measured. Color measurements (L*, a*, b*) were correlated (P Brahman-type (pH = 5.46, L* = 39.75, a* = 25.17, and b* = 11.05) carcasses (P < 0.05).

  18. Preliminary results on mineral content of some beef muscles

    Directory of Open Access Journals (Sweden)

    A. Cignetti

    2010-01-01

    Full Text Available Regarding the growing interest of consumers for nutritional aspect of food, little data are available on meat mineral content. Among the factors influencing minerals, muscle appears interesting: Doornenbal and Murray (1981 found that the concentrations of several minerals were influenced by muscle and sometimes by age, whereas sex and breed differences were less important. This research aimed to evaluate the mineral content in beef muscles.

  19. Beef quality perception at the point of purchase

    DEFF Research Database (Denmark)

    Banovic, Marija; Grunert, Klaus G.; Barreira, Maria Madalena

    2009-01-01

    the perception of intrinsic quality cues. Furthermore, the study attempts to investigate how quality expectations are related to quality experience and future purchase intention after blind-tasting of beef steaks. Results show that extrinsic quality cues influence perception of intrinsic quality cues. Brand...... was found to be the predominant extrinsic quality cue. Consumers used brand both for perception of intrinsic quality cues and for inference of quality expectations. Future purchase intention is mainly influenced by experienced eating quality....

  20. CREATION OF COLLAGEN PRODUCTS FISH RAW MATERIAL

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2015-01-01

    Full Text Available Purposeful use of proteins of connecting fabrics is based first of all on structural and mechanical and physical and chemical properties of collagen, his physiology to a human body. Traditional source of collagen is the split of skins of the cattle, but in view of the objective reasons (spongy encephalopathy, reduction of a livestock of cattle, there was a need for search of alternative sources. The particular interest and popularity represent collagenic proteins in biomedical technologies, when receiving surgical sutural materials, wound healing means, prolongator of medicines, artificial organs and fabrics, implatant. New data on use the collagen containing of sources are directly connected with expansion of a source of raw materials of processing industries of agrarian and industrial complex on the basis of deep processing of biological resources and their maximum involvement in the main and special production with significant growth in an exit of useful products from raw materials unit. In this regard, researches of a microstructure of skins and fractional composition of proteins of objects of research are conducted; data on the general chemical composition and the content of collagen in them are received. Experimental data showed that the most perspective source of collagen from the studied fishes of internal reservoirs is the skin of a silver carp that is caused by the high content of target substance collagen, the low content of fat. The technology of receiving collagenic substances with the high technical characteristics allowing to apply them in production of medical materials is proved and realized in vitro. The comparative analysis showed that substances from a split of skins of cattle and a silver carp have an identical set of amino acids, but are characterized by the different content of separate amino acid s.