The antimicrobial effects of chopped garlic in ground beef and raw meatball (ciğ köfte).
Aydin, Ali; Bostan, Kamil; Erkan, Mehmet Emin; Bingöl, Bariş
2007-03-01
This study was carried out to investigate the antimicrobial effects of chopped garlic in ground beef and raw meatball (çig köfte), which is a traditional food product eaten raw. Fresh minced ground beef and raw meatball batter prepared with traditional methods were separated into groups. Chopped and crushed garlic was added to each batch in order to reach various concentrations from 0% to 10%. The ground beef samples were stored at refrigerator and ambient temperatures. The raw meatball samples were only stored at room temperature. All samples were analyzed in order to determine the microbial counts at the 2(nd), 6(th), 12(th), and 24(th) hours of storage. Garlic addition decreased the microbial growth in some ground beef samples kept either at room temperature or in the refrigerator. However, microbial growth increased in some ground beef samples kept in similar conditions. The difference was found in samples kept in the refrigerator for 24 hours in terms of total aerobic mesophilic bacteria and coliform bacteria when garlic used at 10%. The effects of garlic on the microbial growth of both coliforms and Staphylococcus/Micrococcus in the samples kept at room temperature were increased. The yeast and mold counts in ground beef samples kept in any condition were not affected by garlic addition. However, the addition of garlic to the raw meatball mix decreased the microbial count, in terms of total aerobic mesophilic bacteria and yeast and mold counts, when the garlic was added at 5% or 10% (P meatball caused a permanent decrease in yeast and mold count, unlike in ground beef. The results of this study indicate that the chopped garlic has a slowing-down effect on microbiological growth in ground meat depending on the garlic concentration, but this effect was not at an expected level even at the highest concentration, because potential antimicrobial agents in chopped garlic were probably insufficiently extracted.
The objective of this study was to develop primary and secondary models to describe the growth of Salmonella in raw ground beef. Primary and secondary models can be integrated into a dynamic model that can predict the microbial growth under varying environmental conditions. Growth data of Salmonel...
The objective of this study was to investigate the growth of Shiga toxin-producing Escherichia coli (STEC, including serogroups O45, O103, O111, O121, and O145) in raw ground beef and to develop mathematical models to describe the bacterial growth under different temperature conditions. Three prima...
Directory of Open Access Journals (Sweden)
XINZHUANG ZHANG
2016-03-01
Full Text Available The study aims to investigate the effects of garlic extracts on color, lipid oxidation, and oxidative breakdown products in raw ground beef during refrigerated storage. The two treatments were:control group (C, with no addition and experiment group (D, 50 mg garlic extracts added to 100 g beef. Adding garlic extracts significant increased a* value (PA ≤ 0.05, and significant decreased TBARS and PV values (PA ≤ 0.05. The pH and –SH value of D group had a decreasing tendency (PA=0.0522 and an increasing tendency (PA=0.0636 respectively compared to C group. Garlic extracts protected phospholipids, fatty acids and polypeptides from oxidation. The results indicatethat garlic extracts have the antioxidant activity, helping maintain the meat color, inhibiting lipid oxidation and protein degradation of raw ground beef during refrigerated storage.
International Nuclear Information System (INIS)
Clavero, M.R.S.; Monk, J.D.; Beuchat, L.R.; Doyle, M.P.; Brackett, R.E.
1994-01-01
Raw ground beef patties inoculated with stationary-phase cells of Escherichia coli O157:H7, salmonellae, or Campylobacter jejuni were subjected to gamma irradiation (60Co) treatment, with doses ranging from 0 to 2.52 kGy. The influence of two levels of fat (8 to 14% [low fat] and 27 to 28% [high fat]) and temperature (frozen [-17 to -15 degrees C] and refrigerated [3 to 5 degrees C]) on the inactivation of each pathogen by irradiation was investigated. In ascending order of irradiation resistance, the D10 values ranged from 0.175 to 0.235 kGy (C. jejuni), from 0.241 to 0.307 kGy (E. coli O157:H7), and from 0.618 to 0.800 kGy (salmonellae). Statistical analysis revealed that E. coli O157:H7 had a significantly (P 0.05) higher D10 value when irradiated at -17 to -15 degrees C than when irradiated at 3 to 5 degrees C. Regardless of the temperature during irradiation, the level of fat did not have a significant effect on the D10 value. Salmonellae behaved like E. coli O157:H7 in low-fat beef, but temperature did not have a significant effect when the pathogen was irradiated in high-fat ground beef. Significantly higher D10 values were calculated for C. jejuni irradiated in frozen than in refrigerated low-fat beef. C. jejuni was more resistant to irradiation in low-fat beef than in high-fat beef when treatment was at -17 to -15 degrees C. Regardless of the fat level and temperature during inactivation, these pathogens were highly sensitive to gamma irradiation. An applied dose of 2.5 kGy would be sufficient to kill 10(8.1) E. coli O157:H7, 10(3.1) salmonellae, and 10(10.6) C. jejuni, resulting in a high probability of complete inactivation of populations much higher than those occasionally present in ground beef patties
Ahmed, Imtiaz; Hughes, Denise; Jenson, Ian; Karalis, Tass
2009-03-01
Testing of beef destined for use in ground beef products for the presence of Escherichia coli O157:H7 has become an important cornerstone of control and verification activities within many meat supply chains. Validation of the ability of methods to detect low levels of E. coli O157:H7 is critical to confidence in test systems. Many rapid methods have been validated against standard cultural methods for 25-g samples. In this study, a number of previously validated enrichment broths and commercially available test kits were validated for the detection of low numbers of E. coli O157:H7 in 375-g samples of raw ground beef component matrices using 1 liter of enrichment broth (large-sample:low-volume enrichment protocol). Standard AOAC International methods for 25-g samples in 225 ml of enrichment broth, using the same media, incubation conditions, and test kits, were used as reference methods. No significant differences were detected in the ability of any of the tests to detect low levels of E. coli O157:H7 in samples of raw ground beef components when enriched according to standard or large-sample:low-volume enrichment protocols. The use of large-sample:low-volume enrichment protocols provides cost savings for media and logistical benefits when handling and incubating large numbers of samples.
Roels, T H; Frazak, P A; Kazmierczak, J J; Mackenzie, W R; Proctor, M E; Kurzynski, T A; Davis, J P
1997-10-01
Consumers in the United States continue to eat raw or undercooked foods of animal origin despite public health warnings following several well-publicized outbreaks. We investigated an outbreak of Salmonella serotype Typhimurium infection in 158 patients in Wisconsin during the 1994 Christmas holiday period. To determine the vehicle and source of the outbreak, we conducted cohort and case-control studies, and environmental investigations in butcher shop A. Eating raw ground beef purchased from butcher shop A was the only item significantly associated with illness [cohort study: relative risk = 5.8, 95% confidence interval (CI) = 1.5-21.8; case control study: odds ratio = 46.2, 95% CI = 3.8-2751]. Inadequate cleaning and sanitization of the meat grinder in butcher shop A likely resulted in sustained contamination of ground beef during an 8-day interval. Consumer education, coupled with hazard reduction efforts at multiple stages in the food processing chain, will continue to play an important role in the control of foodborne illness.
Antioxidative activity of carnosine in gamma irradiated ground beef and beef patties
International Nuclear Information System (INIS)
Badr, H.M.
2005-01-01
The activity of carnosine as a natural antioxidant in gamma irradiated ground beef and beef patties was studied. Samples of ground beef, in absence and presence of 0.5% or 1.0% carnosine, as well as raw and cooked beef patties prepared with 1.5% salt (NaCl), in absence and presence of 0.5% or 1.0% carnosine, were gamma irradiated at doses of 2 and 4 KGy. Then, the extent of oxidation in irradiated and non-irradiated samples of ground beef and raw beef patties was determined during refrigerated (4± 1 degree C) and frozen (-18 degree C) storage, while was determined for cooked beef patties during refrigerated storage only. Moreover, the determination of metmyoglobin (MetMb) accumulation and sensory evaluation for the visual colour were carried out for samples of ground beef and raw patties. The results indicated that salt or salt and cooking can accelerate the oxidative processes and significantly increased the peroxide value (PV) and thiobarbituric acid reactive substances (TBARS) in the prepared non-irradiated samples. However, salt slowed down the accumulation of MetMb in raw patties. Irradiation treatments and storage in absence of carnosine significantly increased with higher rates the PV and TBARS in salted or salted and cooked beef samples. Moreover, irradiation and storage significantly increased the formation of MetMb in ground beef and raw patties in absence of carnosine. Addition of carnosine significantly reduced the oxidative processes and MetMb formation (proportionally to the used concentration) in samples post irradiation and during storage. Furthermore, carnosine exerted significant efficacy in maintaining an acceptable visual red colour post irradiation and during storage of ground beef and raw patties. These results demonstrate that carnosine can be successfully used as a natural antioxidant to increase the oxidative stability in gamma irradiated raw and cooked meat products
... 4 days. If frozen, it should keep its quality for about 4 months. When reheating fully cooked patties or casseroles containing ground beef, be sure the internal temperature reaches 165 °F (73.9 °C). Why ...
Galia, Wessam; Leriche, Francoise; Cruveiller, Stéphane; Garnier, Cindy; Navratil, Vincent; Dubost, Audrey; Blanquet-Diot, Stéphanie; Thevenot-Sergentet, Delphine
2017-08-03
Enterohemorrhagic Escherichia coli (EHEC) are zoonotic agents associated with outbreaks worldwide. Growth of EHEC strains in ground beef could be inhibited by background microbiota that is present initially at levels greater than that of the pathogen E. coli. However, how the microbiota outcompetes the pathogenic bacteria is unknown. Our objective was to identify metabolic pathways of EHEC that were altered by natural microbiota in order to improve our understanding of the mechanisms controlling the growth and survival of EHECs in ground beef. Based on 16S metagenomics analysis, we identified the microbial community structure in our beef samples which was an essential preliminary for subtractively analyzing the gene expression of the EHEC strains. Then, we applied strand-specific RNA-seq to investigate the effects of this microbiota on the global gene expression of EHEC O26 21765 and O157 EDL933 strains by comparison with their behavior in beef meat without microbiota. In strain O26 21765 , the expression of genes connected with nitrate metabolism and nitrite detoxification, DNA repair, iron and nickel acquisition and carbohydrate metabolism, and numerous genes involved in amino acid metabolism were down-regulated. Further, the observed repression of ftsL and murF, involved respectively in building the cytokinetic ring apparatus and in synthesizing the cytoplasmic precursor of cell wall peptidoglycan, might help to explain the microbiota's inhibitory effect on EHECs. For strain O157 EDL933 , the induced expression of the genes implicated in detoxification and the general stress response and the repressed expression of the peR gene, a gene negatively associated with the virulence phenotype, might be linked to the survival and virulence of O157:H7 in ground beef with microbiota. In the present study, we show how RNA-Seq coupled with a 16S metagenomics analysis can be used to identify the effects of a complex microbial community on relevant functions of an individual
Cadirci, Ozgür; Siriken, Belgin; Inat, Gökhan; Kevenk, Tahsin Onur
2010-03-01
The present study was conducted to investigate the presence of Escherichia coli O157 and O157:H7 strains and to detect the presence of the stx1, stx2, and eaeA genes in isolates derived from 200 samples (100 samples from fresh ground beef and 100 samples from raw meatball). The samples were purchased from the Samsun Province in Turkey, over a period of 1 year. Enrichment-based immunomagnetic separation and multiplex polymerase chain reaction were applied for these analyses. E. coli O157 was detected in five of the 200 (2.5%) samples tested (one isolated from ground beef and four from meatball samples), whereas E. coli O157: H7 was not detected in any sample. During the analysis, eight strains of E. coli O157 were obtained. The genes stx1, stx2, and eaeA were detected in two E. coli O157 isolates obtained from two meatball samples, whereas only the eaeA and the stx2 genes were detected in four E. coli O157 strains that were isolated from one meatball sample. None of the stx1, stx2, and eaeA was detected in the E. coli O157 isolates obtained from the ground beef and the one meatball samples. Copyright 2009 Elsevier Ltd. All rights reserved.
Effect of comminution method and raw binder system in restructured beef.
Boles, J A; Shand, P J
1998-07-01
The effect of particle size, method of particle size reduction (grinding, flaking, slicing) and alginate or Fibrimex(™) binding systems on processing properties of restructured beef were investigated. The size of semimembranosus muscles was reduced with a meat slicer, grinder or flaker (Comitrol) through machine openings that were 2, 4 and 8 mm in size. Bind of meat pieces in raw and cooked beef steakettes were measured. Sensory evaluation to determine the effect of method of size reduction on texture of beef steakettes was done only on steakettes manufactured with alginate. Beef steakettes manufactured with the alginate binding system had significantly (p meat for the manufacture of restructured beef steakettes resulted in a higher raw bind than did either grinding or flaking the meat. Significant (p meat was sliced than when it was ground or flaked. However, when Fibrimex was used, bind was stronger when sliced meat was used. The alginate system resulted in higher binds for cooked product when particle size was smaller but with the Fibrimex system bind was higher when particle sizes were larger. A consumer panel on alginate restructured steakettes showed no preference for the texture produced by the different methods of particle size reduction.
Kılıç, B; Simşek, A; Claus, J R; Atılgan, E
2014-05-01
Effects of encapsulated sodium tripolyphosphate (STP), sodium hexametaphosphate (HMP) and sodium pyrophosphate (SPP) on lipid oxidation in uncooked (0, 2, 24h) and cooked (0, 1, 7 d) ground chicken and beef during storage were determined. Ten phosphate treatments included a control (no phosphate), three unencapsulated (u) at 0.5% and three encapsulated (e) phosphates (0.5%) each at a low (e-low) and high (e-high) coating level. Two heating rates (slow, fast) were investigated. Cooking loss (CL), pH, color, orthophosphate (OP), TBARS and lipid hydroperoxides (LPO) were determined. A fast heating and uSTP resulted in lower CL (pcooked samples. Not increased coating level but encapsulated phosphates decreased lipid oxidation in cooked samples (p<0.05). Copyright © 2014 Elsevier Ltd. All rights reserved.
Influence of Skin Packaging on Raw Beef Quality: A Review
Directory of Open Access Journals (Sweden)
S. Stella
2018-01-01
Full Text Available A detailed revision of several aspects related to the application of skin packaging to raw beef was considered. Skin packaging, a relatively new technique derived from vacuum packaging, was developed with the aim of retailing small portions of fresh meat, minced meat, or meat preparations. Above all, the influence of this typology of packaging on the microbial population of raw meat was studied, with particular attention to total viable count, aerobic spoilage bacteria, anaerobic bacteria, Enterobacteriaceae, Brochothrix thermosphacta, and lactic acid bacteria. Moreover, the effect on acidification by LAB was also deepened. As colour is the main characteristic influencing purchase decisions at the point of sale, the effect of skin packaging on this parameter was evaluated for raw meat but also for cooked meat. Tenderness, juiciness, and the ability to hold liquid of raw meat when packed in skin conditions were also considered. Furthermore, odour and flavour were considered as sensorial parameters possibly affected by skin packaging. Finally, acceptability by consumer was also investigated. In the studies considered, results showed that skin packaging is advantageous in terms of maintenance of meat quality and for prolonging shelf-life, improving the stability of the products.
Wasilenko, Jamie L; Fratamico, Pina M; Sommers, Christopher; DeMarco, Daniel R; Varkey, Stephen; Rhoden, Kyle; Tice, George
2014-01-01
Shiga toxin-producing Escherichia coli (STEC) and Salmonella are food-borne pathogens commonly associated with beef, and reliable methods are needed to determine their prevalence in beef and to ensure food safety. Retail ground beef was tested for the presence of E. coli O157:H7, STEC serogroups O26, O45, O103, O111, O121, and O145, and Salmonella using the DuPont™ BAX® system method. Ground beef (325 g) samples were enriched in 1.5 L of TSB with 2 mg/L novobiocin at 42°C for 18 h, and then evaluated using the BAX® System real-time PCR assays for E. coli O157:H7 and STEC suite, and the BAX® System standard PCR assays for E. coli O157:H7 MP and Salmonella. Samples positive for STEC target genes by the BAX® System assays were subjected to immunomagnetic separation (IMS) and plating onto modified Rainbow Agar O157. Enrichments that were PCR positive for Salmonella were inoculated into RV broth, incubated for 18 h at 42°C, and then plated onto XLT-4 agar. Presumptive positive STEC and Salmonella colonies were confirmed using the BAX® System assays. Results of the BAX® System STEC assays showed 20/308 (6.5%) of samples positive for both the Shiga toxin (stx) and intimin (eae) genes; 4 (1.3%) for stx, eae, and O26; 1 (0.3%) for stx, eae, and O45; 3 (1%) for stx, eae, and O103; and 1 (0.3%) for stx, eae, and O145. There were also 3 samples positive for stx, eae, and more than one STEC serogroup. Three (1.0%) of the samples were positive using the BAX® System real-time E. coli O157:H7 assay, and 28 (9.1%) were positive using the BAX® System Salmonella assay. STEC O103 and E. coli O157:H7 were isolated from 2/6 and 2/3 PCR positive samples, respectively. Salmonella isolates were recovered and confirmed from 27 of the 28 Salmonella PCR positive samples, and a portion of the isolates were serotyped and antibiotic resistance profiles determined. Results demonstrate that the BAX® System assays are effective for detecting STEC and Salmonella in beef.
Cow biological type affects ground beef colour stability.
Raines, Christopher R; Hunt, Melvin C; Unruh, John A
2009-12-01
To determine the effects of cow biological type on colour stability of ground beef, M. semimembranosus from beef-type (BSM) and dairy-type (DSM) cows was obtained 5d postmortem. Three blends (100% BSM, 50% BSM+50% DSM, 100% DSM) were adjusted to 90% and 80% lean points using either young beef trim (YBT) or beef cow trim (BCT), then packaged in high oxygen (High-O(2); 80% O(2)) modified atmosphere (MAP). The BSM+YBT patties had the brightest colour initially, but discoloured rapidly. Although DSM+BCT patties had the darkest colour initially, they discoloured least during display. Metmyoglobin reducing ability of ground DSM was up to fivefold greater than ground BSM, and TBARS values of BSM was twofold greater than DSM by the end of display (4d). Though initially darker than beef cow lean, dairy cow lean has a longer display colour life and may be advantageous to retailers using High-O(2) MAP.
Prevalence and distribution of Arcobacter spp. in raw milk and retail raw beef.
Shah, A H; Saleha, A A; Murugaiyah, M; Zunita, Z; Memon, A A
2012-08-01
A total of 106 beef samples which consisted of local (n = 59) and imported (n = 47) beef and 180 milk samples from cows (n = 86) and goats (n = 94) were collected from Selangor, Malaysia. Overall, 30.2% (32 of 106) of beef samples were found positive for Arcobacter species. Imported beef was significantly more contaminated (46.80%) than local beef (16.9%). Arcobacter butzleri was the species isolated most frequently from imported (81.8%) and local (60%) beef, followed by Arcobacter cryaerophilus in local (33.3%) and imported (18.2%) beef samples. Only one local beef sample (10%) yielded Arcobacter skirrowii. Arcobacter species were detected from cow's milk (5.8%), with A. butzleri as the dominant species (60%), followed by A. cryaerophilus (40%), whereas none of the goat's milk samples were found positive for Arcobacter. This is the first report of the detection of Arcobacter in milk and beef in Malaysia.
Shelf life of ground beef patties treated by gamma radiation.
Roberts, W T; Weese, J O
1998-10-01
The effects of irradiation on microbial populations in ground beef patties vacuum package and irradiated frozen at target doses of 0.0, 1.0, 3.0, 5.0, and 7.0 kGy were determined. Irradiated samples were stored at 4 or -18 degrees C for 42 days, and mesophilic aerobic plate counts (APCs) were periodically determined. Fresh ground beef (initial APC of 10(2) CFU/g) treated with 3.0, 5.0, and 7.0 kGy was acceptable ( 10(7) CFU/g) by day 14 and 21, respectively, whereas patties treated at 5.0 kGy did not spoil until 42 days. The nonirradiated control samples for both batches of ground beef spoiled within 7 days. Microbial counts in ground beef patties stored at -18 degrees C did not change over the 42-day period. Shelf life of ground beef patties stored at 4 degrees C may be extended with gamma radiation, especially at 5.0 and 7.0 kGy. Initial microbial load in ground beef samples was an important shelf life factor.
Preservation by ionization of refrigerated vacuum-packed ground beef
International Nuclear Information System (INIS)
Soualhia, Z.
1998-01-01
The application of doses of 1, 2, 3, 4, 5 KGy is interesting to lower significantly the contamination microbial flora in ground beef without changing significantly for all that original qualities. Treatment combining ionization (5 KGy) and / or salting (2 %) increases of almost 2 months the duration of refrigerated conservation of Vacuum-packed ground beef with no major change in initial quality. In ionized beef (5 KGy) and / or salted (2 %), the rate of psychotropic germs stays inferior to the threshold superficial putrefaction at all conservation stages. Moreover, faecal contamination pilots, mouldiness, yeast and pathogenic micro-organisms are totally absent in treated samples. Reduction effect of salt is observed at all stages of refrigerated storage. Finally, after cooking, ionizing dose does not change significantly loss of weight and pH of ground beef heated at 100 degrees C in bain-marie or 150 degrees C in drying over during one hour (author)
Shelf life extension of ground beef by radurization
International Nuclear Information System (INIS)
Holzapfel, W.H.; Niemand, J.G.
1982-01-01
Radurization was investigated as a technique in the shelf life extension of ground beef. Although radurization does not necessarily kill off all meat spoilage bacteria, this process may be used for extending the bacteriological keeping quality of fresh meat. The materials and methods used in the investigation are also discussed
Baccus-Taylor, G S H; Falloon, O C; Henry, N
2015-06-01
(i) To study the effects of cold shock on Escherichia coli O157:H7 cells. (ii) To determine if cold-shocked E. coli O157:H7 cells at stationary and exponential phases are more pressure-resistant than their non-cold-shocked counterparts. (iii) To investigate the baro-protective role of growth media (0·1% peptone water, beef gravy and ground beef). Quantitative estimates of lethality and sublethal injury were made using the differential plating method. There were no significant differences (P > 0·05) in the number of cells killed; cold-shocked or non-cold-shocked. Cells grown in ground beef (stationary and exponential phases) experienced lowest death compared with peptone water and beef gravy. Cold-shock treatment increased the sublethal injury to cells cultured in peptone water (stationary and exponential phases) and ground beef (exponential phase), but decreased the sublethal injury to cells in beef gravy (stationary phase). Cold shock did not confer greater resistance to stationary or exponential phase cells pressurized in peptone water, beef gravy or ground beef. Ground beef had the greatest baro-protective effect. Real food systems should be used in establishing food safety parameters for high-pressure treatments; micro-organisms are less resistant in model food systems, the use of which may underestimate the organisms' resistance. © 2015 The Society for Applied Microbiology.
Consumers' willingness to pay for irradiated prepared ground beef
International Nuclear Information System (INIS)
Nayga, R.M. Jr.; Woodward, R.; Aiew, W.
2009-01-01
This paper focuses on estimating willingness to pay for reducing the risk of contracting foodborne illness using a non-hypothetical experiment utilizing real food products (i.e. prepared ground beef), real cash and actual exchange in a market setting. Respondents were given positive information about the nature of food irradiation. Single bounded and one and one-half bounded models are developed using dichotomous choice experiments. The results indicate that individuals are willing to pay for a reduction in the risk of foodborne illness once informed about the nature of food irradiation. Respondents are willing to pay a premium of about US $0.77 for 450 g (1 pound) of irradiated ground beef, which is higher than the cost of irradiating the product. (author)
Irradiation of ground beef with the purpose of refrigerated storage
International Nuclear Information System (INIS)
Keskin, S.
1977-01-01
Ground beef packaged in polyethylene film was irradiated at different dose levels ranging from 0.25 to 1.0 Mrad and stored at 3+-1 0 C. Bacteriological and organoleptic evaluations were carried out immediately after irradiation and at weekly intervals thereafter. The red color of the meat was darker after irradiation and this darkening increased with radiation dose. This color change was limited to the surface of the samples. The results of the bacteriological and organoleptic examination indicate that irradiation at 0.25 Mrad permits refrigerated storage of ground beef for 3 weeks, 0,5 Mrad for 6 weeks. Coliforms were found only in non-irradiated samples [fr
Cloke, Jonathan; Crowley, Erin; Bird, Patrick; Bastin, Ben; Flannery, Jonathan; Agin, James; Goins, David; Clark, Dorn; Radcliff, Roy; Wickstrand, Nina; Kauppinen, Mikko
2015-01-01
The Thermo Scientific™ SureTect™ Escherichia coli O157:H7 Assay is a new real-time PCR assay which has been validated through the AOAC Research Institute (RI) Performance Tested Methods(SM) program for raw beef and produce matrixes. This validation study specifically validated the assay with 375 g 1:4 and 1:5 ratios of raw ground beef and raw beef trim in comparison to the U.S. Department of Agriculture, Food Safety Inspection Service, Microbiology Laboratory Guidebook (USDS-FSIS/MLG) reference method and 25 g bagged spinach and fresh apple juice at a ratio of 1:10, in comparison to the reference method detailed in the International Organization for Standardization 16654:2001 reference method. For raw beef matrixes, the validation of both 1:4 and 1:5 allows user flexibility with the enrichment protocol, although which of these two ratios chosen by the laboratory should be based on specific test requirements. All matrixes were analyzed by Thermo Fisher Scientific, Microbiology Division, Vantaa, Finland, and Q Laboratories Inc, Cincinnati, Ohio, in the method developer study. Two of the matrixes (raw ground beef at both 1:4 and 1:5 ratios) and bagged spinach were additionally analyzed in the AOAC-RI controlled independent laboratory study, which was conducted by Marshfield Food Safety, Marshfield, Wisconsin. Using probability of detection statistical analysis, no significant difference was demonstrated by the SureTect kit in comparison to the USDA FSIS reference method for raw beef matrixes, or with the ISO reference method for matrixes of bagged spinach and apple juice. Inclusivity and exclusivity testing was conducted with 58 E. coli O157:H7 and 54 non-E. coli O157:H7 isolates, respectively, which demonstrated that the SureTect assay was able to detect all isolates of E. coli O157:H7 analyzed. In addition, all but one of the nontarget isolates were correctly interpreted as negative by the SureTect Software. The single isolate giving a positive result was an E
Brazilian ground beef authentication by multiplex polymerase chain reaction
Directory of Open Access Journals (Sweden)
Andrey Carlos do Sacramento de Oliveira
2018-02-01
Full Text Available ABSTRACT: The aim of the present study was to assess the efficacy ofmultiplex PCR in detecting the adulterationof commercially available ground beefvia addition and/orsubstitution ofground buffalo meat. Experimentally adulterated ground beefsamples were prepared in triplicate, and dilutions of DNA from Bos taurus and Bubalusbubalis were prepared to determine the detection limit of the method. Concurrently, 91 ground meatsamples sold as “ground beef” were collected from differentstores in northern Brazil andanalyzed bymultiplex PCR. Buffalo DNA was detected in 17.5% of the collected ground meat samples.Our results showed that multiplex PCR is an efficient method for detectingthe incorporation of groundbuffalo meatatpercentages ranging from 10 to 100% and the incorporation of beef at percentages ranging from0.1 to 100% intoground meat samples.
Juneja, V K; Klein, P G; Marmer, B S
1998-04-01
Duplicate beef gravy or ground beef samples inoculated with a suspension of a four-strain cocktail of Escherichia coli O157:H7 were subjected to sublethal heating at 46 degrees C for 15-30 min, and then heated to a final internal temperature of 60 degrees C. Survivor curves were fitted using a linear model that incorporated a lag period (TL), and D-values and 'time to a 4D inactivation' (T4D) were calculated. Heat-shocking allowed the organism to survive longer than non-heat-shocked cells; the T4D values at 60 degrees C increased 1.56- and 1.50-fold in beef gravy and ground beef, respectively. In ground beef stored at 4 degrees C, thermotolerance was lost after storage for 14 h. However, heat-shocked cells appeared to maintain their thermotolerance for at least 24 h in ground beef held to 15 or 28 degrees C. A 25 min heat shock at 46 degrees C in beef gravy resulted in an increase in the levels of two proteins with apparent molecular masses of 60 and 69 kDa. These two proteins were shown to be immunologically related to GroEL and DnaK, respectively. Increased heat resistance due to heat shock must be considered while designing thermal processes to assure the microbiological safety of thermally processed foods.
Brilliana, I. N.; Manuhara, G. J.; Utami, R.; Khasanah, L. U.
2017-04-01
Ground beef has a short shelf life because it is susceptible to damage due to microbial contamination and lipid oxidation. So some sort of preservation method such as refrigerated storage, vacuum packaging or natural preservative addition is needed to extend the shelf life of ground beef. A natural preservative that can be used as a food preservative is the cinnamon bark (Cinnamomum burmanii) essential oil microcapsules. The aim of the research was to determine the influence of a cinnamon bark essential oil microcapsules (0%;0.5% and 1% w/w of the ground beef) on the Total Plate Count (TPC), Thiobarbituric Acid (TBA), pH and color of ground beef during refrigerated storage (4±1°C). The result showed that cinnamon bark essential oil microcapsules affected the TPC, TBA, pH and color of ground beef. The addition of the cinnamon bark essential oil microcapsules on ground beef can inhibit microbial growth, inhibit lipid oxidation, inhibit discoloration and lowering pH of fresh ground beef during refrigerated storage compared to the control sample. The higher of the microcapsules were added, the higher the inhibition of microbial growth, lipid oxidation and discoloration of ground beef, indicating better preservation effects.
Measurement of soy contents in ground beef using near-infrared spectroscopy
Models for determining contents of soy products in ground beef were developed using near-infrared (NIR) spectroscopy. Samples were prepared by mixing four kinds of soybean protein products (Arconet, toasted soy grits, Profam and textured vegetable protein (TVP)) with ground beef (content from 0%–100...
Ground beef handling and cooking practices in restaurants in eight States.
Bogard, April K; Fuller, Candace C; Radke, Vincent; Selman, Carol A; Smith, Kirk E
2013-12-01
Eating in table-service restaurants has been implicated as a risk factor for Escherichia coli O157:H7 infection. To explore this association and learn about the prevalence of risky ground beef preparation practices in restaurants, the Environmental Health Specialists Network (EHS-Net) assessed ground beef handling policies and practices in restaurants in California, Colorado, Connecticut, Georgia, Minnesota, New York, Oregon, and Tennessee. Eligible restaurants prepared and served hamburgers. EHS-Net specialists interviewed a restaurant employee with authority over the kitchen (defined as the manager) using a standard questionnaire about food safety policies, hamburger preparation policies, and use of irradiated ground beef. Interviews were followed by observations of ground beef preparation. Data from 385 restaurants were analyzed: 67% of the restaurants were independently owned and 33% were chain restaurants; 75% of the restaurants were sit down, 19% were quick service or fast food, and 6% were cafeteria or buffet restaurants. Eighty-one percent of restaurants reported determining doneness of hamburgers by one or more subjective measures, and 49% reported that they never measure the final cook temperatures of hamburgers. At least two risky ground beef handling practices were observed in 53% of restaurants. Only 1% of restaurants reported purchasing irradiated ground beef, and 29% were unfamiliar with irradiated ground beef. Differences in risky ground beef handling policies and practices were noted for type of restaurant ownership (independently owned versus chain) and type of food service style (sit down versus quick service or fast food). This study revealed the pervasiveness of risky ground beef handling policies and practices in restaurants and the need for educational campaigns targeting food workers and managers. These results highlight the importance of continued efforts to reduce the prevalence of E. coli O157:H7 in ground beef.
Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.
Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott
2014-02-05
Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.
75 FR 10460 - Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef Product
2010-03-08
... Tracing Procedures for E. coli O157:H7 Positive Raw Beef Product AGENCY: Food Safety and Inspection... has found positive for Escherichia coli (E. coli) O157:H7. FSIS will also discuss additional verification activities the Agency will conduct at suppliers in response to positive E. coli O157:H7 results...
Directory of Open Access Journals (Sweden)
S. N. Depamede
2011-08-01
Full Text Available A rapid immunodiagnostic test that provides visual evidence of the presence of pork components in raw beef and chicken meats was developed. Colloidal gold was prepared and conjugated with anti-Swine IgG polyclonal antibody. Immunochromatographic test strips were produced, and then were used to test laboratory adulterated raw meat samples. The samples consisted adulteration meat, immunodiagnostic, pork, rapid test of pork-in-beef, or pork-in-chicken at 1/0; 1/100; 1/1,000; 1/5,000; 1/10,000 (w/w adulteration levels that were extracted in phosphate-buffered saline. Raw beef and chicken meats without pork were included as controls. Analysis was completed in 10 min. Detection limit was 1/5,000 (w/w, although 1/10,000 was also observed. This immunodiagnostic tests can be conveniently applied to detect low levels of pork components in raw beef and chicken meat products. For the commercial purposes, further studies need to be carried out.
Energy Technology Data Exchange (ETDEWEB)
Ahn, D.U. E-mail: duahn@iastate.edu; Nam, K.C
2004-10-01
Beef loins with 3 different aging times after slaughter were ground, added with none, 0.1% ascorbic acid, 0.01% sesamol+0.01% {alpha}-tocopherol, or 0.1% ascorbic acid+0.01% sesamol+0.01% tocopherol. The meats were packaged in oxygen-permeable bags, irradiated at 2.5 kGy, and color, oxidation-reduction potential (ORP), lipid oxidation and volatile profiles were determined. Irradiation decreased the redness of ground beef, and visible color of beef changed from a bright red to a green/brown depending on the age of meat. Addition of ascorbic acid prevented color changes in irradiated beef, and the effect of ascorbic acid became greater as the age of meat or storage time after irradiation increased. The ground beef added with ascorbic acid had lower ORP than control, and the low ORP of meat helped maintaining the heme pigments in reduced form. During aerobic storage, S-volatiles disappeared while volatile aldehydes significantly increased in irradiated beef. Addition of ascorbic acid at 0.1% or sesamol+{alpha}-tocopherol at each 0.01% level to ground beef prior to irradiation were effective in reducing lipid oxidation and S-volatiles. As storage time increased, however, the antioxidant effect of sesamol+tocopherol in irradiated ground beef was superior to that of ascorbic acid.
International Nuclear Information System (INIS)
Ahn, D.U.; Nam, K.C.
2004-01-01
Beef loins with 3 different aging times after slaughter were ground, added with none, 0.1% ascorbic acid, 0.01% sesamol+0.01% α-tocopherol, or 0.1% ascorbic acid+0.01% sesamol+0.01% tocopherol. The meats were packaged in oxygen-permeable bags, irradiated at 2.5 kGy, and color, oxidation-reduction potential (ORP), lipid oxidation and volatile profiles were determined. Irradiation decreased the redness of ground beef, and visible color of beef changed from a bright red to a green/brown depending on the age of meat. Addition of ascorbic acid prevented color changes in irradiated beef, and the effect of ascorbic acid became greater as the age of meat or storage time after irradiation increased. The ground beef added with ascorbic acid had lower ORP than control, and the low ORP of meat helped maintaining the heme pigments in reduced form. During aerobic storage, S-volatiles disappeared while volatile aldehydes significantly increased in irradiated beef. Addition of ascorbic acid at 0.1% or sesamol+α-tocopherol at each 0.01% level to ground beef prior to irradiation were effective in reducing lipid oxidation and S-volatiles. As storage time increased, however, the antioxidant effect of sesamol+tocopherol in irradiated ground beef was superior to that of ascorbic acid
Kashoma, Isaac P; Kassem, Issmat I; John, Julius; Kessy, Beda M; Gebreyes, Wondwossen; Kazwala, Rudovick R; Rajashekara, Gireesh
2016-01-01
Campylobacter species are commonly transmitted to humans through consumption of contaminated foods such as milk and meat. The aim of this study was to investigate the prevalence, antimicrobial resistance, and genetic determinants of resistance of Campylobacter isolated from raw milk and beef carcasses in Tanzania. The antimicrobial resistance genes tested included blaOXA-61 (ampicillin), aph-3-1 (aminoglycoside), tet(O) (tetracycline), and cmeB (multi-drug efflux pump). The prevalence of Campylobacter was 9.5% in beef carcasses and 13.4% in raw milk, respectively. Using multiplex-polymerase chain reaction (PCR), we identified 58.1% of the isolates as Campylobacter jejuni, 30.7% as Campylobacter coli, and 9.7% as other Campylobacter spp. One isolate (1.6%) was positive for both C. jejuni and C. coli specific PCR. Antimicrobial susceptibility testing using the disk diffusion assay and the broth microdilution method showed resistance to: ampicillin (63% and 94.1%), ciprofloxacin (9.3% and 11.8%), erythromycin (53.7% and 70.6%), gentamicin (0% and 15.7%), streptomycin (35.2% and 84.3%), and tetracycline (18.5% and 17.7%), respectively. Resistance to azithromycin (42.6%), nalidixic acid (64.8%), and chloramphenicol (13%) was determined using the disk diffusion assay only, while resistance to tylosin (90.2%) was quantified using the broth microdilution method. The blaOXA-61 (52.6% and 28.1%), cmeB (26.3% and 31.3%), tet(O) (26.3% and 31.3%), and aph-3-1 (5.3% and 3.0%) were detected in C. coli and C. jejuni. These findings highlight the extent of antimicrobial resistance in Campylobacter occurring in important foods in Tanzania. The potential risks to consumers emphasize the need for adequate control approaches, including the prudent use of antimicrobials to minimize the spread of antimicrobial-resistant Campylobacter.
International Nuclear Information System (INIS)
Gapud, V.G.; Schlimme, D.V.
1986-01-01
Commercially processed, 80% lean, chub packaged ground beef (both conventionally boned and hot boned) was frozen to O F (-18 0 C) at three rates: 72, 96, and 120 hours before storage at O F (-18 0 C). The meat was examined after 0, 1.5, 3, 6, 9, and 12 months storage for the following attributes: psychrophile and aerobic plate counts, free fatty acid (FFA) and thiobarbituric acid (TBA) values, niacin content, raw and cooked color, moisture, fat and protein contents, and cook shrink and texture of cooked patties. Freezing rates had no significant effect on microbial load, niacin content, color, or cook shrink and texture. Freezing rate had a significant effect upon TBA and FFA values. Niacin, cook shrink and moisture values declined and TBA and FFA values increased with storage. Raw meat Hunter L value increased and Hunter a/b value declined during storage. Substantial quality differences between meat types were found
Estimating animal abundance in ground beef batches assayed with molecular markers.
Directory of Open Access Journals (Sweden)
Xin-Sheng Hu
Full Text Available Estimating animal abundance in industrial scale batches of ground meat is important for mapping meat products through the manufacturing process and for effectively tracing the finished product during a food safety recall. The processing of ground beef involves a potentially large number of animals from diverse sources in a single product batch, which produces a high heterogeneity in capture probability. In order to estimate animal abundance through DNA profiling of ground beef constituents, two parameter-based statistical models were developed for incidence data. Simulations were applied to evaluate the maximum likelihood estimate (MLE of a joint likelihood function from multiple surveys, showing superiority in the presence of high capture heterogeneity with small sample sizes, or comparable estimation in the presence of low capture heterogeneity with a large sample size when compared to other existing models. Our model employs the full information on the pattern of the capture-recapture frequencies from multiple samples. We applied the proposed models to estimate animal abundance in six manufacturing beef batches, genotyped using 30 single nucleotide polymorphism (SNP markers, from a large scale beef grinding facility. Results show that between 411∼1367 animals were present in six manufacturing beef batches. These estimates are informative as a reference for improving recall processes and tracing finished meat products back to source.
RESEARCH OF MOISTURE MIGRATION DURING PARTIAL FREEZING OF GROUND BEEF
Directory of Open Access Journals (Sweden)
V. M. Stefanovskiy
2016-01-01
Full Text Available The concept of «ideal product» is proposed for the study of mass transfer during partial freezing of food products by freezing plate. The ideal product is a product, in which number of factors affecting the «real product» (meat are excluded. These factors include chemical composition of meat, quality grade of raw material (NOR, DFD, PSE, cryoscopic temperature that determines the degree of water transformation into ice, the phenomenon of osmosis, rate of freezing, etc. By using the concept of «ideal product» and its implementation in a physical experiment, it is proved that the “piston effect” causing the migration of moisture is due to frozen crust formation during partial freezing of the body. During partial freezing of the product by freezing plate, «ideal» and «real» food environment is transformed from closed system into open one with inflow of moisture to unfrozen part of the body. In the «ideal product», there is an expulsion of unfrozen moisture from freezing front, so the water appears on the body surface. Thus, the displacement of moisture increases by the same law, according to which the thickness (weight of frozen layer increases. During partial freezing of ground meat, moisture does not appear on the surface of the product, but hydrates the unfrozen part of meat. The reason of this phenomenon is the expulsion of water during formation of frozen crust and water-binding capacity of meat.
Knize, M G; Shen, N H; Felton, J S
1988-11-01
Ground chicken breast and ground beef with either endogenous or a 10-fold increase in the concentration of creatine were fried at 220 degrees C for 10 min per side. One patty (100 g) of chicken meat yielded 120,000 Salmonella (TA1538) revertants following metabolic activation. The pan residues had 39% of the total activity. Added creatine (10-fold the endogenous level) increased mutagen yields an average of 2-fold. Beef cooked under identical conditions yielded 150,000 revertants/100 g for the meat patties and pan residues combined. Added creatine to beef prior to cooking increased mutagen yields 3-fold. The mutagenic profiles following initial HPLC separation showed that chicken samples with endogenous or added creatine were remarkably similar. Chicken and beef HPLC mutagenicity profiles were also similar to each other, but not identical. This suggests that the general mutagen-forming reactions with the two different types of muscle are qualitatively similar with only minor quantitative differences. The pan residues from both meat types with and without added creatine showed some significant differences in the mutagen peak profile. This work suggests that the types of mutagens formed in chicken are similar to those formed in beef and that creatine appears to be involved in the formation of all the mutagenic compounds produced from fried muscle tissue.
Directory of Open Access Journals (Sweden)
Fred Pohlman
2014-10-01
Full Text Available The objective of this study was to evaluate the effectiveness of antimicrobial interventions using peroxyacetic acetic acid (PAA followed by novel organic acids on beef trimmings prior to grinding with conventional spray (CS or electrostatic spray (ES on ground beef microbial populations and color. Beef trimmings (80/20; 25kg were inoculated with E. coli O157:H7, non- O157:H7 shiga toxin producing (STEC E. coli (EC and Salmonella spp. (SA at 105 CFU/g. Inoculated trimmings (1.5 kg /treatment/replicate, 2 replicates were treated with CS application of 0.02% PAA alone or followed by CS or ES application of 3% octanoic acid (PO, 3% pyruvic acid (PP, 3% malic acid (PM, saturated solution of fumaric acid (PF or deionized water (W. Findings from this study suggest that PA as a single or multiple chemical hurdle approach with malic, pyruvic, octanoic and fumaric acid on beef trimmings may be effective in reducing E. coli O157:H7 as well as non-STEC serotypes and Salmonella in ground beef up to day 2 of simulated retail display. Results of this study showed that instrumental color properties of ground beef treated with peroxyacetic acid followed by organic acids had little or no difference (P > 0.05 compared to the untreated un-inoculated control ground beef samples. The results also indicate that ES application of some organic acids may have similar or greater efficiency in controlling ground beef microbial populations compared to the CS application of the same acid providing a more economical and waste manageable decontamination approach.
Antibacterial effect of lactoferricin B on Escherichia coli O157:H7 in ground beef.
Venkitanarayanan, K S; Zhao, T; Doyle, M P
1999-07-01
The antibacterial activity of lactoferricin B on enterohemorrhagic Escherichia coli O157:H7 in 1% peptone medium and ground beef was studied at 4 and 10 degrees C. In 1% peptone medium, 50 and 100 microg of lactoferricin B per ml reduced E. coli O157:H7 populations by approximately 0.7 and 2.0 log CFU/ml, respectively. Studies comparing the antibacterial effect of lactoferricin B on E. coli O157:H7 in 1% peptone at pH 5.5 and 7.2 did not reveal any significant difference (P > 0.5) at the two pH values. Lactoferricin B (100 microg/g) reduced E. coli O157:H7 population in ground beef by about 0.8 log CFU/g (P 0.5) was observed in the total plate count between treatment and control ground beef samples stored at 4 and 10 degrees C. The antibacterial effect of lactoferricin B on E. coli O157:H7 observed in this study is not of sufficient magnitude to merit its use in ground beef for controlling the pathogen.
Kim, Hyun-Wook; Choi, Yun-Sang; Choi, Ji-Hun; Kim, Hack-Youn; Hwang, Ko-Eun; Song, Dong-Heon; Lee, Soo-Yoen; Lee, Mi-Ai; Kim, Cheon-Jei
2013-11-01
This study was conducted to evaluate the antioxidant effects of soy sauce on lipid oxidation and color stability of raw beef patties. Raw beef patties were formulated with four solutions such as NaCl (sodium chloride solution), NaCl/SS (1:1 ratio of sodium chloride and soy sauce solution), SS (soy sauce solution), or SS/A (soy sauce solution combined with 0.05% ascorbic acid) in the same salt concentration. Addition of soy sauce resulted in the decreased pH, lightness, and increased yellowness. Treatment SS/A had the lowest percent of metmyoglobin during storage (Psauce addition were observed in treatments SS and SS/A at the end of the storage period. There were no differences (P>0.05) in free fatty acid concentration at the end of storage. The combined addition of soy sauce and ascorbic acid greatly improved (P<0.05) color stability and retarded lipid oxidation. Copyright © 2013 Elsevier Ltd. All rights reserved.
Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza
2010-04-01
Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.
On-line, proximate analysis of ground beef directly at a meat grinder outlet.
Isaksson, T; Nilsen, B N; Tøgersen, G; Hammond, R P; Hildrum, K I
1996-07-01
The fat, moisture and protein contents of ground beef were determined on-line by a diffuse reflectance near infrared (NIR) spectroscopy instrument at the outlet of a meat grinder. Beef samples in the range of 6.2-21.7% fat, 59.6-72.9% moisture and 18.1-20.7% protein were studied. Calibrations from samples ground with hole diameters of 4, 8, 13 or 19 mm in the grinder plate were validated. In addition, calibrations of combinations of these samples from the different hole diameters were validated. Prediction errors, expressed as root mean square error of cross validation of the beef samples, were 0.73-1.50% for fat, 0.75-1.33% for moisture and 0.23-0.32% for protein, depending on the hole diameter of the grinder plate. Calibrations from samples ground with the smallest hole diameters gave lowest prediction errors. The present prediction error results are only slightly higher compared to reported prediction error results using conventional at- and off-line NIR instruments. It is concluded that the on-line NIR prediction results were acceptable for samples ground with grinder plates of 4, 8 or 13 mm hole diameter.
International Nuclear Information System (INIS)
Lee, Kyung Haeng; Yun, Hyejeong; Lee, Ju Woon; Ahn, Dong Uk; Lee, Eun Joo; Jo, Cheorun
2012-01-01
Irradiation is the most efficient non-thermal technology for improving hygienic quality and extending the shelf-life of food products. One of the adverse effects of food irradiation, however, is off-flavor production, which significantly affects the sensory preferences for certain foods. In this study, garlic (5%, w/w) and red wine (1:1, w/w) were added to ground beef to increase the radiation sensitivity of pathogens and improve meat odor/flavor. Samples were irradiated at 0 or 5 kGy in the presence of charcoal pack. SPME-GC–MS analysis was performed to measure the changes in the volatile compounds and sensory characteristics of the samples. The amount of total volatile compounds produced from ground beef was greater when the sample was irradiated. When garlic and red wine were added to the ground beef, the amount of volatile compounds significantly increased, and the amount of volatile compounds increased even further after irradiation. However, when the samples were irradiated with charcoal pack, the amount of volatile compounds decreased significantly. Sensory evaluation indicated that charcoal pack significantly increased the odor preferences for both irradiated and non-irradiated ground beef added with garlic. These results indicated that addition of charcoal pack to ground beef could reduce off-odor problems induced by irradiation, and this effect was consistent even when certain additives such as garlic and red wine were added. - Highlights: ► Garlic and red wine were added to ground beef and irradiated at 5 kGy in the presence of charcoal pack. ► When the samples were irradiated with charcoal pack, the amount of volatile compounds decreased significantly and it affected sensory score. ► Thus, addition of charcoal pack to ground beef could reduce off-odor problems induced by irradiation. ► This effect was consistent when additives, such as garlic and red wine, were added into ground beef.
International Nuclear Information System (INIS)
Murano, P.S.; Murano, E.A.; Olson, D.G.
1998-01-01
Ground beef patties (irradiated with 2 kGy and nonirradiated) were packaged using oxygen permeable (polyolefin) or oxygen impermeable material (polyethylene). Samples were irradiated in air and stored in air; irradiated under vacuum and stored under vacuum; or irradiated under vacuum and stored in air. Changes in flavor, texture, juiciness or aftertaste were evaluated after either 1 or 7 days storage at -25 degrees C prior to cooking. Irradiated 'Vac/Air' samples were more tender, irradiated 'Vac' samples were more moist, and irradiated 'Air' samples had the least aftertaste. A 3 log10 reduction in total aerobic counts was detected immediately after irradiation. No difference in lipid oxidation was found within the first week of storage, regardless of packaging atmosphere. Shelf life of ground beef patties was extended 55 days at 4 degrees C
GPM GROUND VALIDATION NOAA UHF 449 PROFILER RAW DATA SPC FORMAT MC3E V1
National Aeronautics and Space Administration — The GPM Ground Validation NOAA UHF 449 Profiler Raw Data SPC Format MC3E dataset was collected during the NASA supported Midlatitude Continental Convective Clouds...
Microbial pathogens in raw pork, chicken, and beef: benefit estimates for control using irradiation
Energy Technology Data Exchange (ETDEWEB)
Roberts, T.
1985-12-01
Various control procedures have been suggested for reducing foodborne infectious diseases. Receiving considerable attention is irradiation. This report estimates the medical and wage (or productivity) benefits associated with prevention of five human diseases transmitted by beef, pork, and chicken. (These diseases can also be transmitted by other vectors, such as eggs, milk, and pets. But these sources are not included in the analysis.) All of these foodborne infectious diseases - salmonellosis, campylobacteriosis, trichinosis, tapeworm, and toxoplasmosis - could be significantly reduced by irradiating meat and poultry. The Food and Drug Administration (FDA) has just approved irradiation of pork to prevent trichinosis (50FR 29658-59) and is considering approval of irradiation of chicken to kill Salmonella. 22 references.
Microbial pathogens in raw pork, chicken, and beef: benefit estimates for control using irradiation
International Nuclear Information System (INIS)
Roberts, T.
1985-01-01
Various control procedures have been suggested for reducing foodborne infectious diseases. Receiving considerable attention is irradiation. This report estimates the medical and wage (or productivity) benefits associated with prevention of five human diseases transmitted by beef, pork, and chicken. (These diseases can also be transmitted by other vectors, such as eggs, milk, and pets. But these sources are not included in the analysis.) All of these foodborne infectious diseases - salmonellosis, campylobacteriosis, trichinosis, tapeworm, and toxoplasmosis - could be significantly reduced by irradiating meat and poultry. The Food and Drug Administration (FDA) has just approved irradiation of pork to prevent trichinosis (50FR 29658-59) and is considering approval of irradiation of chicken to kill Salmonella. 22 references
Lee, Kyung Haeng; Yun, Hyejeong; Lee, Ju Woon; Ahn, Dong Uk; Lee, Eun Joo; Jo, Cheorun
2012-08-01
Irradiation is the most efficient non-thermal technology for improving hygienic quality and extending the shelf-life of food products. One of the adverse effects of food irradiation, however, is off-flavor production, which significantly affects the sensory preferences for certain foods. In this study, garlic (5%, w/w) and red wine (1:1, w/w) were added to ground beef to increase the radiation sensitivity of pathogens and improve meat odor/flavor. Samples were irradiated at 0 or 5 kGy in the presence of charcoal pack. SPME-GC-MS analysis was performed to measure the changes in the volatile compounds and sensory characteristics of the samples. The amount of total volatile compounds produced from ground beef was greater when the sample was irradiated. When garlic and red wine were added to the ground beef, the amount of volatile compounds significantly increased, and the amount of volatile compounds increased even further after irradiation. However, when the samples were irradiated with charcoal pack, the amount of volatile compounds decreased significantly. Sensory evaluation indicated that charcoal pack significantly increased the odor preferences for both irradiated and non-irradiated ground beef added with garlic. These results indicated that addition of charcoal pack to ground beef could reduce off-odor problems induced by irradiation, and this effect was consistent even when certain additives such as garlic and red wine were added.
Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2013-12-01
Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.
Effects of irradiation on trans fatty acids formation in ground beef
International Nuclear Information System (INIS)
Brito, M.S.; Villavicencio, A.L.C.H.; Mancini-filho, Jorge
2002-01-01
In order to give the consumer the assurance that meat processed by irradiation is a safe product, a great deal of research has been developed in the world. The effect of irradiation on the hygienic quality of meat and meat products is considered as related to the control of meat-borne parasites of humans; elimination of pathogens from fresh meat and poultry; and elimination of pathogens from processed meat. Lipid oxidation and associated changes are the major causes of the quality deterioration of meat during storage. Irradiation of lipids induces the production of free radicals, which react with oxygen, leading to the formation of carbonyls, responsible for alterations in food nutritional and sensorial characteristics. Trans fatty acids are present in ground beef and can also be formed during its processing. Interestingly, the trans fatty acids, due to their chemical and physical characteristics, show more resistance to the oxidizing process. This property motivated us to investigate the level of the trans fatty acids, as well as the level of oxidation in irradiated ground beef. Irradiation of ground beef was performed by gamma rays from a 60 Co source. The applied radiation doses were 0; 1.0; 2.0; 3.0; 4.0; 5.0; 6.0; 7.0 and 8.0 kGy. Lipid peroxidation in terms of TBA number and carbonyl content was monitored during storage. The sample characteristics and trans fatty acids composition were measured, following irradiation and after 60 and 90 days of storage at -10 deg. C
Escherichia coli O157:H7 outbreak associated with consumption of ground beef, June-July 2002.
Vogt, Richard L; Dippold, Laura
2005-01-01
A case-control and environmental study tested the hypothesis that purchasing and eating ground beef from a specific source was the cause of a cluster of cases of hemolytic uremic syndrome (HUS) and Escherichia coli (E. coli) O157:H7 gastroenteritis. A case-control study comparing risk factors was conducted over the telephone on nine case-patients with 23 selected controls. An environmental investigation was conducted that consisted of reviewing beef handling practices at a specific local supermarket and obtaining ground beef samples from the store and two households with case-patients. The analysis of the case-control study showed that eight case-patients (89%) purchased ground beef at Grocery Chain A compared with four controls who did not develop illness (17%) (matched odds ratio=undefined; 95% confidence interval 2.8, infinity; p=0.006). The environmental investigation showed that Grocery Chain A received meat from Meatpacker A. Laboratory analysis of meat samples from Meatpacker A and Grocery Chain A and stool samples from some patients recovered an identical strain of E. coli O157:H7 according to pulse-field gel electrophoresis. Both the case-control and environmental studies showed that purchasing ground beef at Grocery Chain A, which received ground beef from Meatpacker A, was the major risk factor for illness in eight case-patients; the ninth case-patient was found to be unrelated to the outbreak. Furthermore, meat from Meatpacker A was associated with a nationwide outbreak of E. coli O157:H7 illness that resulted in the second largest recall of beef in U.S. history at the time.
Klein, Günter; Pack, Alexander; Reuter, Gerhard
1998-01-01
The food chain, especially raw minced meat, is thought to be responsible for an increase in the incidence of vancomycin-resistant enterococci (VRE) in human nosocomial infections. Therefore, 555 samples from 115 batches of minced beef and pork from a European Union-licensed meat-processing plant were screened for the occurrence of VRE. The processed meat came from 45 different slaughterhouses in Germany. Enterococci were isolated directly from Enterococcosel selective agar plates and also from Enterococcosel selective agar plates supplemented with 32 mg of vancomycin per liter. In addition, peptone broth was used in a preenrichment procedure, and samples were subsequently plated onto Enterococcosel agar containing vancomycin. To determine resistance, 209 isolates from 275 samples were tested with the glycopeptides vancomycin, teicoplanin, and avoparcin and 19 other antimicrobial substances by using a broth microdilution test. When the direct method was used, VRE were found in 3 of 555 samples (0.5%) at a concentration of 1.0 log CFU/g of minced meat. When the preenrichment procedure was used, 8% of the samples were VRE positive. Our findings indicate that there is a low incidence of VRE in minced meat in Germany. In addition, the resistance patterns of the VRE isolates obtained were different from the resistance patterns of clinical isolates. A connection between the occurrence of VRE in minced meat and nosocomial infections could not be demonstrated on the basis of our findings. PMID:9572958
Aouidi, Fathia; Okba, Aicha; Hamdi, Moktar
2017-08-01
Olive leaves (OL), available in huge amounts from pruning, are known to be a useful source of biologically active compounds. This study investigated the potential application of OL as a supplement to minced beef meat in order to develop a functional product. The effect of OL extract or powder (100 and 150 µg phenols g -1 meat) on the quality and stability of raw and cooked meat during refrigerated storage was examined. Microwave drying at 600 W gave OL with the highest antioxidant quality (evaluated by TEAC/[phenols] (mg mg -1 ) and DPPH/[phenols] (mg mg -1 )) compared with other methods. OL showed an ability to inhibit (P production was 43-65% in control samples and 14-35% in treated samples). OL also improved the technological quality of the meat, decreasing (P functional meat products of good technological quality that remain stable during storage. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
2015-02-01
This study evaluated the influence of the Programmed Nutrition Beef Program and exogenous growth promotants (ExGP) on water holding capacity characteristics of enhanced beef strip loins. Sixty, frozen strip loins, arranged in a 2 × 2 factorial treatment arrangement with dietary program serving as the first factor and use of ExGP as the second factor, were thawed, injected with an enhancement solution, and stored for 7 days. Loins from ExGP cattle possessed the ability to bind more (P water before pumping and bind less (P water after pumping and storage. Loin pH across treatments was similar (P > 0.10) before injection, but increased post-injection and after storage (P 0.10). The Programmed Nutrition Beef Program and use of ExGPs minimally impacted water holding capacity of enhanced frozen/thawed beef strip loins.
Raw beef bones as chewing items to reduce dental calculus in Beagle dogs.
Marx, F R; Machado, G S; Pezzali, J G; Marcolla, C S; Kessler, A M; Ahlstrøm, Ø; Trevizan, L
2016-01-01
Evaluate the effect of raw bovine cortical bone (CB) (medullary bone cross-sectioned) and marrow or epiphyseal 'spongy' bone (SB) as chew items to reduce dental calculus in adult dogs. Eight 3-year-old Beagle dogs were observed in two study periods. In the first study, the dogs each received a piece of bovine femur CB (122 ± 17 g) daily and in the second study, a piece of bovine femur SB (235 ± 27 g). The first study lasted 12 days and the second 20 days. Dental calculus was evaluated using image integration software. At the start of the studies, dental calculus covered 42.0% and 38.6% of the dental arcade areas, respectively. In study one, the chewing reduced the established dental calculus area to 27.1% (35.5% reduction) after 3 days and after 12 days the dental calculus covering was reduced to 12.3% (70.6% reduction). In study two, the dental calculus covered 16.8% (56.5% reduction) after 3 days, 7.1% (81.6% reduction) after 12 days and 4.7% (87.8% reduction) after 20 days. The CB remained largely intact after 24 h, but SB was reduced to smaller pieces and in some cases totally consumed after 24 h. No complications such as tooth fractures, pieces of bone stuck between teeth or intestinal obstructions were observed during the studies. Chewing raw bovine bones was an effective method of removing dental calculus in dogs. The SB bones removed dental calculus more efficiently in the short term. © 2016 Australian Veterinary Association.
Schecter, A; Dellarco, M; Päpke, O; Olson, J
1998-01-01
The primary source of dioxins (PCDDs), dibenzofurans (PCDFs) and coplanar PCBs for the general population is food, especially meat, fish, and dairy products. However, most data on the levels of these chemicals is from food in the raw or uncooked state. We report here the effect of one type of cooking (broiling) on the levels of PCDDs, PCDFs, and coplanar PCBs in ground beef (hamburger), bacon and catfish. Samples of hamburger, bacon, and catfish were broiled and compared to uncooked samples in order to measure changes in the amounts of dioxins in cooked food. The total amount of PCDD, PCDF, and coplanar PCB TEQ decreased by approximately 50% on average for each portion as a result of broiling the hamburger, bacon and catfish specimens. The mean concentration (pg TEQ/kg, wet weight) of PCDDs, PCDFs, and coplanar PCBs, however, remained the same in the hamburger, increased by 83% in the bacon, and decreased by 34% in the catfish. On average, the total measured concentration (pg/kg) of the congeners of PCDDs, PCDFs, and coplanar PCBs increased 14% in the hamburger, increased 29% in the bacon, and decreased 33% in the catfish.
Energy Technology Data Exchange (ETDEWEB)
Ouattara, B.; Giroux, M.; Yefsah, R.; Smoragiewicz, W.; Saucier, L.; Borsa, J.; Lacroix, M. E-mail: monique.lacroix@inrs-iaf.uquebec.ca
2002-03-01
The current interest in 'minimally processed foods' has attracted the attention for combination of mild treatments to improve food safety and shelf-life extension. The present study was conducted to evaluate the combined effect of gamma irradiation and incorporation of naturally occurring antimicrobial compounds on microbial and biochemistry characteristics of ground beef. Ground beef patties (23% fat ) were purchased from a local grocery store (IGA, Laval, Que., Canada) and divided into 3 separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid, and (iii) ground beef with 0.5% ascorbic acid and coated with a protein-based coating containing selected spices. Samples were irradiated at 0, 1, 2, and 3 kGy final dose at the CIC. Samples were stored at 4 deg. C and evaluated periodically for microbial growth, total thiobarbituric reactive substances (TBARS) and free sulfydryl content. At the end of the storage period, Enterobacteriaceae, Lactic acid bacteria, Pseudomonas and Brochothrix thermosphacta were enumerated. Regardless of the treatment group, irradiation significantly (p{<=}0.05) reduced the total aerobic plate counts (APC). Irradiation doses of 1, 2, and 3 kGy produced immediate reduction of 2, 3, and 4 log units of APCs, respectively. Also, shelf-life periods were higher for ground beef samples containing food additives. Lactic acid bacteria and Brochothrix thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. Concentration of TBARS and free sulfydryl concentrations were stabilized during post-irradiation storage for samples containing ascorbic acid and coated with the protein-based coating containing spices.
International Nuclear Information System (INIS)
Ouattara, B.; Giroux, M.; Yefsah, R.; Smoragiewicz, W.; Saucier, L.; Borsa, J.; Lacroix, M.
2002-01-01
The current interest in 'minimally processed foods' has attracted the attention for combination of mild treatments to improve food safety and shelf-life extension. The present study was conducted to evaluate the combined effect of gamma irradiation and incorporation of naturally occurring antimicrobial compounds on microbial and biochemistry characteristics of ground beef. Ground beef patties (23% fat ) were purchased from a local grocery store (IGA, Laval, Que., Canada) and divided into 3 separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid, and (iii) ground beef with 0.5% ascorbic acid and coated with a protein-based coating containing selected spices. Samples were irradiated at 0, 1, 2, and 3 kGy final dose at the CIC. Samples were stored at 4 deg. C and evaluated periodically for microbial growth, total thiobarbituric reactive substances (TBARS) and free sulfydryl content. At the end of the storage period, Enterobacteriaceae, Lactic acid bacteria, Pseudomonas and Brochothrix thermosphacta were enumerated. Regardless of the treatment group, irradiation significantly (p≤0.05) reduced the total aerobic plate counts (APC). Irradiation doses of 1, 2, and 3 kGy produced immediate reduction of 2, 3, and 4 log units of APCs, respectively. Also, shelf-life periods were higher for ground beef samples containing food additives. Lactic acid bacteria and Brochothrix thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. Concentration of TBARS and free sulfydryl concentrations were stabilized during post-irradiation storage for samples containing ascorbic acid and coated with the protein-based coating containing spices
Directory of Open Access Journals (Sweden)
Bahador Hajimohammadi
2014-11-01
Full Text Available Background: Sarcocystisspp. is zoonotic parasitic pathogen endangering safety of meat and derived meat products such as hamburgers which is among the most popular fast foods worldwide. Objectives: The current study aimed to design a protocol for molecular identification of Sarcocystis hominis in commercial hamburgers using PCR-RFLP with target of 18S rRNA. Materials and Methods: A total of 25 raw commercial hamburger samples were randomly collected from supermarkets of Yazd city, Iran. Five mm slices from different parts of each sample were selected, well mixed, and then preserved in ethanol 70% at -20°C for the next steps. The genomic DNA was extracted using salting out method. Detection and identification of Sarcocystis isolates were performed using PCR RFLP. The 18s rRNA gene sequence was mined from GenBank and the specific primer pair was designed using Primer3 software. Restriction fragment length polymorphims (RFLP analysis was performed using BfaI and RsaI restriction enzymes. The digestion was analyzed, using agarose gel electrophoresis alongside 100base pair DNA ladder. Results: Among 25 commercial hamburger samples, 17 samples showed a PCR product around 900 bp which could detect Sarcocyst Spp. After RFLP with BfaI, the restriction fragments of 376 bp and 397 bp detected S. hominis or S. hirsuta and fragments of 184 bp, 371 bp and 382 bp detected S. cruzi. After RFLP with RsaI, the restriction fragments of 376 bp and 557 bp detected S. hirsuta and fragment of 926 bp, without any digestion, detected S. hominis. For verification, each species detected in samples was randomly selected and sent for sequencing and the results were analyzed with BLAST. Conclusions: In conclusion, the current study developed a practical technique to detect the prevalence of S. hominis in meat products such as hamburgers.
International Nuclear Information System (INIS)
Fu, A.H.; Sebranek, J.G.; Murano, E.A.
1995-01-01
Beef steaks and ground beef were inoculated with Listeria monocytogenes, Yersinia enterocolitica, or Escherichia coli O157:H7. Samples were packaged in air or under vacuum and irradiated at low (0.60 to 0.80 kGy) or medium (1.5 to 2.0 kGy) doses, with each dose delivered at either a low (2.8 M/min conveyor speed) or high (6.9 M/min) dose rate. Medium-dose irradiation accompanied by 7 degrees C storage resulted in no Y. enterocolitica or E. coli O157:H7 survivors being detected. There was no effect on survival of the pathogens by dose rate or storage atmosphere. No difference (P0.05) was observed in meat pH or color, but TBA values increased after 7 days storage
Shiga Toxin-Producing Escherichia coli (STEC) are frequently implicated in foodborne illness outbreaks and recalls of ground beef. In this study we determined the High Pressure Processing (HPP) D-10 value (the processing conditions needed to reduce the microbial population by 1 log) of 39 individua...
Arelovich, H M; Lagrange, S; Torre, R; Martinez, M F; Laborde, H E
2018-02-01
Experiments (Exp) I and II were conducted to compare raw whole soya beans (WSB), roasted (rWSB) or other protein sources as supplements of low-quality forages fed ad libitum to beef cattle, upon DM intake (DMI), ruminal and blood parameters, and animal performance. Exp I: treatments for wheat straw fed to four ruminally cannulated steers were (i) Control-WS: no supplement; (ii) WSB-WS: whole soya beans; (iii) rWSB-WS: roasted WSB; and (iv) SBM-WS: soybean meal-wheat midds mixture; all fed at 1.4 kg DM/day. Exp II: 12 steers grazed deferred grain sorghum (DS) receiving these treatments: (i) Control-DS: no supplement; (ii) WSB-DS: 1.26 kg DM/day whole soya beans; and (iii) SFM-DS: 1.35 kg DM/day of sunflower meal. In Exp I, WS DMI resulted 47, 52 and 41% greater for WSB-WS, rWSB-WS and SBM-WS, respectively, than Control-WS (p < .05). In Exp II, the DMI of DS was unaffected by supplementation; a substitution of DS by supplement was found for WSB-DS (p < .05); however, total diet and digestible DMI increased with supplementation (p < .05). Rumen pH in Exp I remained unaffected by supplementation, but N-NH 3 as well as blood urea-N in Exp II increased (p < .05). In Exp II, average daily weight gains improved similarly with both supplements compared with Control-DS. Additionally, feed-to-gain ratio decreased (p < .05), being lower for WSB-DS (8.3) vs. SFM-DS (9.9). Roasting effects of WSB as a supplement for low-quality forages were not detected, and all protein sources increased total diet DMI and forage utilization. Only moderate cattle weight gains could be expected for unsupplemented DS. © 2017 Blackwell Verlag GmbH.
Directory of Open Access Journals (Sweden)
J. Uriyapongson
2010-02-01
Full Text Available A comparison of chemical and physical properties of beef and buffalo meat, and eight treatments of their ground meat patties was undertaken. Low-fat patties from both meat were prepared using two types of starches; corn and modified tapioca starch as binding ingredients in the ground meat, and methylcellulose (MC in the batter for patty coating. The patties were stored at -18ºC for 1, 15, 30 and 45 days, then deep fried and analyzed for color, % decrease in diameter and % gain in height, % oil absorption and texture. The results suggested that MC improved outside and inside color of patties (p≤0.05. There was no significant difference of cooking yield between beef and buffalo meat patties. Addition of modified starches and MC provided less % decrease in diameter after frying for frozen buffalo meat patties. Modified starch significantly improved % oil absorption in frozen beef and buffalo patties. Modified starch and MC gave both beef and buffalo meat patties more stable in hardness, chewiness and gumminess during the frozen storage. MC improved texture quality of frozen buffalo meat patties. Fried meat patties had high calories at 15 days of frozen storage.
Pollari, Frank; Christidis, Tanya; Pintar, Katarina D M; Nesbitt, Andrea; Farber, Jeff; Lavoie, Marie-Claude; Gill, Alex; Kirsch, Penelope; Johnson, Roger P
2017-04-20
Human infection with Escherichia coli O157:H7/NM has historically been associated with consumption of undercooked ground beef. The purpose of this paper is to investigate the correlation of the decline in E. coli O157:H7/NM infections in Canada with the introduction of control efforts in ground beef by industry. The human incidence of E. coli O157:H7/NM, prevalence in ground beef and interventions from 1996 to 2014 were analyzed. Pathogen prevalence data were obtained from federal government and industry surveillance and inspection/compliance programs. A survey of the largest ground beef producers in Canada was conducted to identify when interventions were implemented. The incidence of E. coli O157:H7/NM infections in Canada declined from ∼4 cases/100 000 to ∼1 case/100 000 from 2000 to 2010. Verotoxigenic Escherichia coli (VTEC) prevalence in ground beef sold at retail declined from about 30% around the year 2000 to <2% since 2012. Other measures of the prevalence of E. coli, VTEC, and E. coli O157:H7/NM in beef and ground beef also declined. The number and types of interventions implemented in the major beef processing establishments in Canada increased from 1996 to 2016. The observed decline in human illnesses and pathogen levels in relation to retail meats was associated with the introduction of control efforts by industry, federal and provincial/territorial governments, and the general population. Industry-led changes in beef processing along with the introduction of food safety policies, regulations, and public education have led to improved food safety in Canada.
Energy Technology Data Exchange (ETDEWEB)
Sohn, S.H. [Busan Regional Food and Drug Administration, Busan 608-829 (Korea, Republic of); Jang, A. [National Institute of Animal Science, RDA, Suwon 441-706 (Korea, Republic of); Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, J.K. [Cooperative Research, Extension, and Education Service, Northern Marianas College, Saipan, MP 96950 (Korea, Republic of); Song, H.P. [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, J.H. [Cooperative Research, Extension, and Education Service, Northern Marianas College, Saipan, MP 96950 (Korea, Republic of); Lee, M. [Department of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Jo, C. [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)], E-mail: cheorun@cnu.ac.kr
2009-02-15
A combination of a charcoal pack during irradiation and {alpha}-tocopherol addition into ground beef was applied to eliminate an irradiation characteristic off-odor and to retard the lipid oxidation caused by the irradiation process. Ground beef was mixed with 200 ppm {alpha}-tocopherol and gamma irradiated with 0, 5, and 10 kGy with or without a charcoal pack present during the irradiation treatment. The pH of the control group was lower than that of {alpha}-tocopherol and charcoal pack treatment initially but increased rapidly and showed higher pH at day 7. Addition of {alpha}-tocopherol with or without charcoal pack addition showed lower 2-thiobarbituric acid reactive substances values in irradiated ground beef at days 3 and 7 compared to those without addition. The color of ground beef was not significantly affected by the treatment. However, odor preference result showed that 10 kGy-irradiated ground beef with a combination of charcoal pack and {alpha}-tocopherol addition had higher scores than the control group regardless of irradiation. Solid-phase microextraction (SPME) gas chromatograph/mass spectrometry (GC/MS) analysis identified various volatile compounds that were created by irradiation of ground beef. These compounds were reduced or eliminated when a charcoal pack was used during the irradiation process. The results of the present study imply that combination of packaging with a charcoal pack during the irradiation process and addition of {alpha}-tocopherol into ground beef is a good method to effectively eliminate an irradiation off-odor and retard the lipid oxidation development in ground beef caused by irradiation.
International Nuclear Information System (INIS)
Sohn, S.H.; Jang, A.; Kim, J.K.; Song, H.P.; Kim, J.H.; Lee, M.; Jo, C.
2009-01-01
A combination of a charcoal pack during irradiation and α-tocopherol addition into ground beef was applied to eliminate an irradiation characteristic off-odor and to retard the lipid oxidation caused by the irradiation process. Ground beef was mixed with 200 ppm α-tocopherol and gamma irradiated with 0, 5, and 10 kGy with or without a charcoal pack present during the irradiation treatment. The pH of the control group was lower than that of α-tocopherol and charcoal pack treatment initially but increased rapidly and showed higher pH at day 7. Addition of α-tocopherol with or without charcoal pack addition showed lower 2-thiobarbituric acid reactive substances values in irradiated ground beef at days 3 and 7 compared to those without addition. The color of ground beef was not significantly affected by the treatment. However, odor preference result showed that 10 kGy-irradiated ground beef with a combination of charcoal pack and α-tocopherol addition had higher scores than the control group regardless of irradiation. Solid-phase microextraction (SPME) gas chromatograph/mass spectrometry (GC/MS) analysis identified various volatile compounds that were created by irradiation of ground beef. These compounds were reduced or eliminated when a charcoal pack was used during the irradiation process. The results of the present study imply that combination of packaging with a charcoal pack during the irradiation process and addition of α-tocopherol into ground beef is a good method to effectively eliminate an irradiation off-odor and retard the lipid oxidation development in ground beef caused by irradiation
Cho, Youngjae; Muhlisin; Choi, Ji Hye; Hahn, Tae-Wook; Lee, Sung Ki
2014-01-01
This study was designed to elucidate the effect of ozone exposure on the bacteria counts and oxidative properties of ground Hanwoo beef contaminated with Escherichia coli O157:H7 at refrigeration temperature. Ground beef was inoculated with 7 Log CFU/g of E. coli O157:H7 isolated from domestic pigs and was then subjected to ozone exposure (10×10(-6) kg O3 h(-1)) at 4℃ for 3 d. E. coli O157:H7, total aerobic and anaerobic bacterial growth and oxidative properties including instrumental color changes, TBARS, catalase (CAT) and glutathione peroxidase (GPx) activity were evaluated. Ozone exposure significantly prohibited (pgenerator inside a refrigerator. Further studies regarding the ozone concentrations and exposure times are needed.
2012-05-07
... employees, and is therefore likely to contaminate common conveyor belts and equipment. Also, such high rates.... Industry commenters noted that microbiological testing is not designed to test the safety of beef products... properly designing a sampling program.\\8\\ However, a national prevalence estimate is not sufficient...
Loukiadis, Estelle; Bièche-Terrier, Clémence; Malayrat, Catherine; Ferré, Franck; Cartier, Philippe; Augustin, Jean-Christophe
2017-06-05
Undercooked ground beef is regularly implicated in food-borne outbreaks involving pathogenic Shiga toxin-producing Escherichia coli. The dispersion of bacteria during mixing processes is of major concern for quantitative microbiological risk assessment since clustering will influence the number of bacteria the consumers might get exposed to as well as the performance of sampling plans used to detect contaminated ground beef batches. In this study, batches of 25kg of ground beef were manufactured according to a process mimicking an industrial-scale grinding with three successive steps: primary grinding, mixing and final grinding. The ground beef batches were made with 100% of chilled trims or with 2/3 of chilled trims and 1/3 of frozen trims. Prior grinding, one beef trim was contaminated with approximately 10 6 -10 7 CFU of E. coli O157:H7 on a surface of 0.5cm 2 to reach a concentration of 10-100cells/g in ground beef. The E. coli O157:H7 distribution in ground beef was characterized by enumerating 60 samples (20 samples of 5g, 20 samples of 25g and 20 samples of 100g) and fitting a Poisson-gamma model to describe the variability of bacterial counts. The shape parameter of the gamma distribution, also known as the dispersion parameter reflecting the amount of clustering, was estimated between 1.0 and 1.6. This k-value of approximately 1 expresses a moderate level of clustering of bacterial cells in the ground beef. The impact of this clustering on the performance of sampling strategies was relatively limited in comparison to the classical hypothesis of a random repartition of pathogenic cells in mixed materials (purely Poisson distribution instead of Poisson-gamma distribution). Copyright © 2017 Elsevier B.V. All rights reserved.
Chao, Che-Yi; Yin, Mei-Chin
2009-03-01
The antibacterial effects of roselle calyx aqueous and ethanol extracts and protocatechuic acid against food spoilage bacteria Salmonella typhimurium DT104, Escherichia coli O157:H7, Listeria monocytogenes, Staphylococcus aureus, and Bacillus cereus were examined. Minimal inhibitory concentrations of roselle calyx aqueous and ethanol extracts and protocatechuic acid against these bacteria were in the range of 112-144, 72-96, and 24-44 microg/mL, respectively. Protocatechuic acid content in roselle calyx aqueous and ethanol extracts was 2.8 +/- 0.7 and 11.9 +/- 1.2 mg/g, respectively. Antibacterial activity of roselle calyx ethanol extract and protocatechuic acid was not affected by heat treatments from 25 degrees to 75 degrees C and 25 degrees to 100 degrees C, respectively. After 3 days storage at 25 degrees C, the addition of roselle calyx extracts and protocatechuic acid exhibited dose-dependent inhibitory effects against test bacteria in ground beef and apple juice, in which the roselle calyx ethanol extract showed greater antibacterial effects than the aqueous extract. These data suggest that roselle calyx ethanol extract and protocatechuic acid might be potent agents as food additives to prevent contamination from these bacteria.
Irfiana, D.; Utami, R.; Khasanah, L. U.; Manuhara, G. J.
2017-04-01
The purpose of this study was to determine the effect of two stage cinnamon bark oleoresin microcapsules (0%, 0.5% and 1%) on the TPC (Total Plate Count), TBA (thiobarbituric acid), pH, and RGB color (Red, Green, and Blue) of vacuum-packed ground beef during refrigerated storage (at 0, 4, 8, 12, and 16 days). This study showed that the addition of two stage cinnamon bark oleoresin microcapsules affected the quality of vacuum-packed ground beef during 16 days of refrigerated storage. The results showed that the TPC value of the vacuum-packed ground beef sample with the addition 0.5% and 1% microcapsules was lower than the value of control sample. The TPC value of the control sample, sample with additional 0.5% and 1% microcapsules were 5.94; 5.46; and 5.16 log CFU/g respectively. The TBA value of vacuum-packed ground beef were 0.055; 0.041; and 0.044 mg malonaldehyde/kg, resepectively on the 16th day of storage. The addition of two-stage cinnamon bark oleoresin microcapsules could inhibit the growth of microbia and decrease the oxidation process of vacuum-packed ground beef. Moreover, the change of vacuum-packed ground beef pH and RGB color with the addition 0.5% and 1% microcapsules were less than those of the control sample. The addition of 1% microcapsules showed the best effect in preserving the vacuum-packed ground beef.
Directory of Open Access Journals (Sweden)
João Marcos Beltrame Benatti
2014-05-01
Full Text Available The objective of this study was to evaluate the processing of millet grain provided at two supplementation frequencies for grazing beef cattle during the dry season on nutritional parameters. Five rumen-cannulated crossbred steers, with 24 to 26 months of age and average body weight of 428.6±26.06 kg, were assigned to a Latin square design (5 × 5 in a 2 × 2 + 1 factorial arrangement, as follows: two forms of millet grain (whole grains - or ground; WG - GG, two strategies of concentrate supplementation (daily distribution - 7X; or three times a week - 3X and a control treatment (mineral mixture - MM. Animals were kept in five paddocks of 0.24 ha each with Marandu grass pastures. Concentrate supplements were supplied at 2.00 and 4.66 kg/animal/day for treatments 7X and 3X, respectively. The concentrate supplementation enhanced the intake of total dry matter (DM and organic matter (OM and nutrients compared with mineral supplementation. No differences were found between dry matter intake and forage organic matter intake. The values of digestibility coefficients of DM, OM, ether extract, total carbohydrates and non-fiber carbohydrates were increased by concentrate supplementation. Regarding concentrations of rumen ammonia nitrogen, the interactions among time × treatment × day and day × treatment had effects on the measurements of ruminal pH. Plasma urea nitrogen, urinary urea excretion and urinary urea N excretion differed only between MM treatment and the others, with no interference of grain physical form and supplementation frequency on those variables. The millet grain processing does not alter forage intake, but improves digestibility. Daily supplementation increases digestibility of dry matter and neutral detergent fiber.
Runge, Kristin K; Chung, Jennifer H; Su, Leona Yi-Fan; Brossard, Dominique; Scheufele, Dietram A
2018-09-01
In March 2012 ABC World News Report aired a series of reports on lean finely textured beef (LFTB) that resulted in a 10-year low for beef prices and the bankruptcy of a major firm that produced LFTB. Using a random sample survey, we tested the effects of the media frame "pink slime" and industry frame "lean finely textured beef," alongside media use, food-related knowledge, trust in food-related institutions and preference for local, fresh, organic and GMO-free foods on perceptions of risk related to ground beef containing pink slime/LFTB, processed foods and red meat. The "pink slime" frame was strongly and positively associated with risk related to ground beef, but not risk related to red meat or processed foods. Attention to news stories about pink slime/LFTB was strongly associated with risk related to ground beef and processed foods, but not red meat. We found varying effects of food values, knowledge and trust on all three dependent variables. Implications are discussed. Copyright © 2018 Elsevier Ltd. All rights reserved.
Survival of Escherichia coli O157:H7 in ground beef jerky assessed on two plating media.
Harrison, J A; Harrison, M A; Rose, R A
1998-01-01
Recent outbreaks of food-borne illness due to Salmonella spp. in beef jerky and Escherichia coli O157:H7 in venison jerky, coupled with the fact that a variety of preparation methods and dying procedures abound, raise concern over the safety of processed meat products made in the home. The potential of injured bacterial cells to regain the ability to cause illness is a particular threat with pathogens such as E. coli O157:H7, which is believed to have a low infectious dose. This study examined the efficacy of various methods of jerky preparation in reducing populations of E, coli O157:H7 in ground beef jerky and compared the recovery rate of E. coli O157:H7 on two selective plating media, modified sorbitol MacConkey agar (MSMA) and modified eosin methylene blue agar (MEMB). Populations of E. coli O157:H7 in both heated and unheated samples exhibited a greater decline during drying when a nitrite and salt cure mix was added during jerky preparation. When recovery of E. coli O157:H7 on MSMA and MEMB was compared, a trend toward slightly higher recovery rates with MEMB was observed. On the basis of these results, MEMB is a suitable alternative to MSMA for the recovery of E. coli O157:H7 from heated and dried meat samples similar to beef jerky.
Ground transport stress affects bacteria in the rumen of beef cattle: A real-time PCR analysis.
Deng, Lixin; He, Cong; Zhou, Yanwei; Xu, Lifan; Xiong, Huijun
2017-05-01
Transport stress syndrome often appears in beef cattle during ground transportation, leading to changes in their capacity to digest food due to changes in rumen microbiota. The present study aimed to analyze bacteria before and after cattle transport. Eight Xianan beef cattle were transported over 1000 km. Rumen fluid and blood were sampled before and after transport. Real-time PCR was used to quantify rumen bacteria. Cortisol and adrenocorticotrophic hormone (ACTH) were measured. Cortisol and ACTH were increased on day 1 after transportation and decreased by day 3. Cellulolytic bacteria (Fibrobacter succinogenes and Ruminococcus flavefaciens), Ruminococcus amylophilus and Prevotella albensis were increased at 6 h and declined by 15 days after transport. There was a significant reduction in Succinivibrio dextrinosolvens, Prevotella bryantii, Prevotella ruminicola and Anaerovibrio lipolytica after transport. Rumen concentration of acetic acid increased after transport, while rumen pH and concentrations of propionic and butyric acids were decreased. Body weight decreased by 3 days and increased by 15 days after transportation. Using real-time PCR analysis, we detected changes in bacteria in the rumen of beef cattle after transport, which might affect the growth of cattle after transport. © 2016 Japanese Society of Animal Science.
International Nuclear Information System (INIS)
Lacroix, M.; Ouattara, B.; Saucier, L.; Giroux, M.; Smoragiewicz, W.
2004-01-01
The present study was conducted to evaluate the combined effect of gamma irradiation in presence of ascorbic acid on the microbiological characteristics and thiobarbituric acid-reactive substances (TBARS) concentration of ground beef coated with an edible coating, crosslinked by gamma irradiation. The medium fat ground beef patties (23% fat ) were divided into two separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid. Meat samples were irradiated at doses of 0, 1, 2, and 3 kGy and stored at 4±2 deg. C. The content of TBARS was evaluated. After 7 days of storage, Enterobacteriaceae, presumptive Staphylococcus aureus, presumptive Pseudomonas spp., Brochothrix thermosphacta and lactic acid bacteria were enumerated. Results showed that lactic acid bacteria and Br. thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. The content in TBARS was stabilized during post-irradiation storage for samples containing ascorbic acid. Shelf life extension periods estimated on the basis of a limit level of 6 log CFU/g for APCs were 4, 7, and 10 days for samples irradiated at 1, 2, and 3 kGy, respectively. However, the incorporation of ascorbic acid in ground beef did not improve significantly (p>0.05) the inhibitory effect of gamma irradiation
Energy Technology Data Exchange (ETDEWEB)
Lacroix, M. E-mail: monique.lacroix@inrs-iaf.uquebec.ca; Ouattara, B.; Saucier, L.; Giroux, M.; Smoragiewicz, W
2004-10-01
The present study was conducted to evaluate the combined effect of gamma irradiation in presence of ascorbic acid on the microbiological characteristics and thiobarbituric acid-reactive substances (TBARS) concentration of ground beef coated with an edible coating, crosslinked by gamma irradiation. The medium fat ground beef patties (23% fat ) were divided into two separate treatment groups: (i) control (ground beef without additive), (ii) ground beef with 0.5% (w/w) ascorbic acid. Meat samples were irradiated at doses of 0, 1, 2, and 3 kGy and stored at 4{+-}2 deg. C. The content of TBARS was evaluated. After 7 days of storage, Enterobacteriaceae, presumptive Staphylococcus aureus, presumptive Pseudomonas spp., Brochothrix thermosphacta and lactic acid bacteria were enumerated. Results showed that lactic acid bacteria and Br. thermosphacta were more resistant to irradiation than Enterobacteriaceae and Pseudomonas. The content in TBARS was stabilized during post-irradiation storage for samples containing ascorbic acid. Shelf life extension periods estimated on the basis of a limit level of 6 log CFU/g for APCs were 4, 7, and 10 days for samples irradiated at 1, 2, and 3 kGy, respectively. However, the incorporation of ascorbic acid in ground beef did not improve significantly (p>0.05) the inhibitory effect of gamma irradiation.
Detection of viable Escherichia coli O157:H7 in ground beef by propidium monoazide real-time PCR.
Liu, Yarui; Mustapha, Azlin
2014-01-17
Escherichia coli O157:H7 associated with food has caused many serious public health problems in recent years. However, only viable cells of this pathogen can cause infections, and false-positive detection caused by dead cells can lead to unnecessary product recalls. The objective of this study was to develop and optimize a method that combines propidium monoazide (PMA) staining with real-time PCR to detect only viable cells of E. coli O157:H7 in ground beef. PMA is a DNA intercalating dye that can penetrate compromised membranes of dead cells and bind to cellular DNA, preventing its amplification via a subsequent PCR. Three strains of E. coli O157:H7 (505B, G5310 and C7927) at concentrations of 10(0) to 10(8)CFU/mL were used as live cells. Dead cells were obtained by heating cell suspensions at 85°C for 15 min. Suspensions were treated with PMA and the optimized assay was applied to artificially contaminated ground beef with two different fat contents (10% and 27%). DNA was extracted and amplified by TaqMan® real-time PCR assay targeting the uidA gene for detection of E. coli O157:H7. Plasmid pUC19 was added as an internal amplification control (IAC). A treatment of 25 μM PMA with a 10-min light exposure on ice was sufficient to eliminate DNA from 10(8) dead E. coli O157:H7 cells/mL. The optimized assay could detect as low as 10(2) CFU/mL viable E. coli O157:H7 in pure culture and 10(5) CFU/g in ground beef, in the presence of 10(6)/mL or g of dead cells. With an 8-h enrichment, 1 CFU/g viable E. coli O157:H7 in ground beef was detectable without interference from 10(6) dead cells/g. In conclusion, the PMA real-time PCR could effectively detect viable E. coli O157:H7 without being compromised by dead cells. Copyright © 2013 Elsevier B.V. All rights reserved.
2013-08-28
... evaluated the FSIS Salmonella detection method (FSIS Microbiology Laboratory Guidebook Chapter 4.06) using... prevalence estimates, FSIS defines prevalence as the proportion of applicable product that would test... that is intended for use as raw, non-intact product tests positive for STEC, the product is adulterated...
Changes in fat content of pork and beef after pan-frying under different conditions
DEFF Research Database (Denmark)
Clausen, Ina; Ovesen, Lars
2005-01-01
) gained 0.4 g. Similar results were obtained for low- (8%) and high-fat (12%) beef patties. Meatballs (7.5% fat initially) gained up to 2.4 g fat/100 g raw product depending on the cooking conditions. The greatest fat loss was 7.2 g for high fat ground beef (12% fat), which was pan-fried and then rinsed...
Ngamsom, Bongkot; Lopez-Martinez, Maria J; Raymond, Jean-Claude; Broyer, Patrick; Patel, Pradip; Pamme, Nicole
2016-04-01
Pathogen analysis in food samples routinely involves lengthy growth-based pre-enrichment and selective enrichment of food matrices to increase the ratio of pathogen to background flora. Similarly, for blood culture analysis, pathogens must be isolated and enriched from a large excess of blood cells to allow further analysis. Conventional techniques of centrifugation and filtration are cumbersome, suffer from low sample throughput, are not readily amenable to automation and carry a risk of damaging biological samples. We report on-chip acoustophoresis as a pre-analytical technique for the resolution of total microbial flora from food and blood samples. The resulting 'clarified' sample is expected to increase the performance of downstream systems for the specific detection of the pathogens. A microfluidic chip with three inlets, a central separation channel and three outlets was utilized. Samples were introduced through the side inlets, and buffer solution through the central inlet. Upon ultrasound actuation, large debris particles (10-100 μm) from meat samples were continuously partitioned into the central buffer channel, leaving the 'clarified' outer sample streams containing both, the pathogenic cells and the background flora (ca. 1 μm) to be collected over a 30 min operation cycle before further analysis. The system was successfully tested with Salmonella typhimurium-spiked (ca. 10(3)CFU mL(-1)) samples of chicken and minced beef, demonstrating a high level of the pathogen recovery (60-90%). When applied to S. typhimurium contaminated blood samples (10(7)CFU mL(-1)), acoustophoresis resulted in a high depletion (99.8%) of the red blood cells (RBC) which partitioned in the buffer stream, whilst sufficient numbers of the viable S. typhimurium remained in the outer channels for further analysis. These results indicate that the technology may provide a generic approach for pre-analytical sample preparation prior to integrated and automated downstream detection of
Hijaz, Faraj M; Smith, J Scott
2010-01-01
Food irradiation improves food safety and maintains food quality by controlling microorganisms and extending shelf life. However, acceptance and commercial adoption of food irradiation is still low. Consumer groups such as Public Citizen and the Food and Water Watch have opposed irradiation because of the formation of 2-alkylcyclobutanones (2-ACBs) in irradiated, lipid-containing foods. The objectives of this study were to measure and to compare the level of 2-dodecylcyclobutanone (2-DCB) in ground beef irradiated by low-energy X-rays and gamma rays. Beef patties were irradiated by low-energy X-rays and gamma rays (Cs-137) at 3 targeted absorbed doses of 1.5, 3.0, and 5.0 kGy. The samples were extracted with n-hexane using a Soxhlet apparatus, and the 2-DCB concentration was determined with gas chromatography-mass spectrometry. The 2-DCB concentration increased linearly (P irradiation dose for gamma-ray and low-energy X-ray irradiated patties. There was no significant difference in 2-DCB concentration between gamma-ray and low-energy X-ray irradiated patties (P > 0.05) at all targeted doses. © 2010 Institute of Food Technologists®
Directory of Open Access Journals (Sweden)
Pedro Del Bianco Benedeti
Full Text Available The objective of this study was to evaluate the effects of replacing dry ground corn with crude glycerol on intake, apparent digestibility, performance, and carcass characteristics of finishing beef bulls. A completely randomized block design experiment with 25 d for adaptation and 100 d for data collection was conducted, in which 3,640 Nellore bulls (367 ± 36.8 kg; 18 ± 3 mo were blocked by body weight and assigned to 20 pens. Bulls were randomly assigned to one of four treatments: 0, 5, 10, and 15% (dry matter basis of crude glycerol in the diet. Initially, 20 bulls were slaughtered to serve as a reference to estimate initial empty body weight, which allowed for carcass gain calculation. Bulls were weighed at the beginning, at two-thirds, and at the end of the experiment for performance calculations. Carcass measurements were obtained by ultrasound. Fecal output was estimated using indigestible neutral detergent fiber as an internal marker. Data were analyzed using the mixed procedures in SAS 9.2 (SAS Institute Inc., Cary, NC. Intake of dry matter, organic matter, and neutral detergent fiber decreased linearly (P 0.05 intakes of crude protein, non-fiber carbohydrates, and total digestible nutrients. Digestibility of dry matter, organic matter, neutral detergent fiber, and total digestible nutrients increased quadratically (P 0.05. These results suggest that crude glycerol may be included in finishing beef diets at levels up to 15% without impairing performance and carcass characteristics.
Tøgersen, G; Arnesen, J F; Nilsen, B N; Hildrum, K I
2003-04-01
The chemical composition of industrial scale batches of frozen beef was measured on-line during grinding by near infrared (NIR) reflectance spectroscopy. The MM55E filter based non-contact NIR instrument was mounted at the outlet of a meat grinder, and the fat, moisture and protein contents determined from the average of each filter reading throughout the grinding of the batch. The filters were selected from full spectra measurements to be as insensitive to water crystallization as possible. For on-line calibration and prediction, 55 beef batches of 400-800 kg in the range of 7.66-22.91% fat, 59.36-71.48% moisture, and 17.04-20.76% protein, were ground through 4 or 13 mm hole plates. The regression results, presented as root mean square error of cross validation (RMSECV) were between 0.48 and 1.11% for fat, 0.43 and 0.97% for moisture and 0.41 and 0.47% for protein.
Introduction: Commonly, ground beef processors conduct studies to model contaminant flow through their production systems using surrogate organisms. Typical surrogate organisms may not behave as Escherichia coli O157:H7 during grinding and are not easy to detect at very low levels. Purpose: Develop...
Disease causing Escherichia coli commonly found in meat and poultry include intestinal pathogenic E. coli (iPEC) as well as extraintestinal types such as the Uropathogenic E. coli (UPEC). In this study we compared the resistance of iPEC (O157:H7) to UPEC in ground beef using High Pressure Processing...
Del Bianco Benedeti, Pedro; Paulino, Pedro Veiga Rodrigues; Marcondes, Marcos Inácio; Maciel, Ivan França Smith; da Silva, Matheus Custódio; Faciola, Antonio Pinheiro
2016-01-01
The objective of this study was to evaluate the effects of replacing dry ground corn with crude glycerol on intake, apparent digestibility, performance, and carcass characteristics of finishing beef bulls. A completely randomized block design experiment with 25 d for adaptation and 100 d for data collection was conducted, in which 3,640 Nellore bulls (367 ± 36.8 kg; 18 ± 3 mo) were blocked by body weight and assigned to 20 pens. Bulls were randomly assigned to one of four treatments: 0, 5, 10, and 15% (dry matter basis) of crude glycerol in the diet. Initially, 20 bulls were slaughtered to serve as a reference to estimate initial empty body weight, which allowed for carcass gain calculation. Bulls were weighed at the beginning, at two-thirds, and at the end of the experiment for performance calculations. Carcass measurements were obtained by ultrasound. Fecal output was estimated using indigestible neutral detergent fiber as an internal marker. Data were analyzed using the mixed procedures in SAS 9.2 (SAS Institute Inc., Cary, NC). Intake of dry matter, organic matter, and neutral detergent fiber decreased linearly (P 0.05) intakes of crude protein, non-fiber carbohydrates, and total digestible nutrients. Digestibility of dry matter, organic matter, neutral detergent fiber, and total digestible nutrients increased quadratically (P carcass gain, carcass dressing, gain-to-feed ratio, Longissimus thoracis muscle area, and back and rump fat thicknesses (P > 0.05). These results suggest that crude glycerol may be included in finishing beef diets at levels up to 15% without impairing performance and carcass characteristics. PMID:26820725
GPM GROUND VALIDATION NOAA UHF 449 PROFILER RAW DATA SPC FORMAT MC3E V1
National Aeronautics and Space Administration — The NOAA UHF 449 Profiler Raw SPC foramt data was collected during the NASA supported Midlatitude Continental Convective Clouds Experiment (MC3E). The Ultra High...
Kerth, Chris R; Harbison, Amanda L; Smith, Stephen B; Miller, Rhonda K
2015-06-01
Brisket, chuck, plate, flank, and round subcutaneous fat trim were used to produce ground beef patties then evaluated for color, lipid oxidation, fatty acid composition, volatile chemical compounds and consumer sensory evaluation. Color, TBARS, consumer sensory evaluation, and cook/freezer loss did not differ (P>0.05) among carcass fat locations. Percentage stearic acid was lower (P=0.044) in the ground beef using brisket fat than using the chuck and flank fat. Patties made with brisket fat were higher in cis-vaccenic acid (P=0.016) and the saturated to monounsaturated fatty acid ratio (P=0.018) than all other sources of subcutaneous fat. Butanedione was highest (P=0.013) in patties using flank and plate fat. Ground beef with brisket fat was higher (P=0.003) than all other sources for beefy aroma. Altering the profile of non-polar, triglyceride fatty acids has no effect on sensory flavor or major volatile chemical compounds. Copyright © 2015 Elsevier Ltd. All rights reserved.
Whole maae versus ground matze in fattening diets for beef steers
African Journals Online (AJOL)
Beide groepe is vir 105 dae teen ad libitum peile gevoer. Geen statisties betekenisvolle verskille, in terme van groei- en doeltreffendheidsparameters, kon tussen die twee .... to that of the complete diet based on ground maue. The added advantage of savings in processing of the maizr, protein and roughage would therefore.
King, L A; Loukiadis, E; Mariani-Kurkdjian, P; Haeghebaert, S; Weill, F-X; Baliere, C; Ganet, S; Gouali, M; Vaillant, V; Pihier, N; Callon, H; Novo, R; Gaillot, O; Thevenot-Sergentet, D; Bingen, E; Chaud, P; de Valk, H
2014-12-01
Sorbitol-fermenting Escherichia coli O157:[H7] is a particularly virulent clone of E. coli O157:H7 associated with a higher incidence of haemolytic uraemic syndrome and a higher case fatality rate. Many fundamental aspects of its epidemiology remain to be elucidated, including its reservoir and transmission routes and vehicles. We describe an outbreak of sorbitol-fermenting E. coli O157:[H7] that occurred in France in 2011. Eighteen cases of paediatric haemolytic uraemic syndrome with symptom onset between 6 June and 15 July 2011 were identified among children aged 6 months to 10 years residing in northern France. A strain of sorbitol-fermenting E. coli O157:[H7] stx2a eae was isolated from ten cases. Epidemiological, microbiological and trace-back investigations identified multiply-contaminated frozen ground beef products bought in a supermarket chain as the outbreak vehicle. Strains with three distinct pulsotypes that were isolated from patients, ground beef preparations recovered from patients' freezers and from stored production samples taken at the production plant were indistinguishable upon molecular comparison. This investigation documents microbiologically confirmed foodborne transmission of sorbitol-fermenting of E. coli O157 via beef and could additionally provide evidence of a reservoir in cattle for this pathogen. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.
International Nuclear Information System (INIS)
Cohen, J.S.; Shults, G.W.; Mason, V.C.; Wierbicki, E.
1977-01-01
A series of experiments was conducted to determine the effect of different variables on the quality of an irradiated ground beef product. Factors studied included: different food-grade phosphates; NaCl content; fat content; and size of grind. The influence of these variables on the cooking loss (moisture retention), shear press values and sensory scores was studied. The addition of phosphates and NaCl was desirable in controlling cooking losses. The most effective phosphate was tetrasodium pyrophosphate. The addition of NaCl decreased the shear press force required to penetrate the beef patty, i.e., it tenderized the product. Phosphate addition did not affect the shear press force. Increased fat content increased the cooking losses, but did not affect the shear press force. Irradiation with sterilizing doses had a marked effect on decreasing the shear press force
International Nuclear Information System (INIS)
O'Farrell, M; Sheridan, C; Lewis, E
2007-01-01
This paper reports on an optical fibre based sensor system to detect the occurrence of premature browning in ground beef. Premature browning (PMB) occurs when, at a temperature below the pasteurisation temperature of 71 deg. C, there are no traces of pink meat left in the patty. PMB is more frequent if poorer quality beef or beef that has been stored under imperfect conditions. The experimental work pertaining to this paper involved cooking fresh meat and meat that has been stored in a freezer for, 1 week, 1 month and 3 months and recording the reflected spectra and temperature at the core of the product, during the cooking process, in order to develop a classifier based on the spectral response and using a Self-Organising Map (SOM) to classify the patties into one of four categories, based on their colour. Further tests were also carried out on developing an all-optical fibre sensor for measuring both the temperature and colour in a single integrated probe. The integrated probe contains two different sensor concepts, one to monitor temperature, based on Fibre Bragg Grating (FBG) technology and a second for meat quality, based on reflection spectroscopy in the visible wavelength range
Jensen, Dane A; Danyluk, Michelle D; Harris, Linda J; Schaffner, Donald W
2015-04-01
Hand washing is recognized as a crucial step in preventing foodborne disease transmission by mitigating crosscontamination among hands, surfaces, and foods. This research was undertaken to establish the importance of several keys factors (soap, soil, time, and drying method) in reducing microorganisms during hand washing. A nonpathogenic nalidixic acid-resistant Enterobacter aerogenes surrogate for Salmonella was used to assess the efficacy of using soap or no soap for 5 or 20 s on hands with or without ground beef debris and drying with paper towel or air. Each experiment consisted of 20 replicates, each from a different individual with ∼ 6 log CFU/ml E. aerogenes on their hands. A reduction of 1.0 ± 0.4 and 1.7 ± 0.8 log CFU of E. aerogenes was observed for a 5-s wash with no soap and a 20-s wash with soap, respectively. When there was no debris on the hands, there was no significant difference between washing with and without soap for 20 s (P > 0.05). Likewise, there was no significant difference in the reductions achieved when washing without soap, whether or not debris was on the hands (P > 0.05). A significantly greater reduction (P soap when there was ground beef debris on the hands. The greatest difference (1.1 log CFU greater average reduction) in effectiveness occurred when ground beef debris was on the hands and a 20-s wash with water was compared with a 20-s wash with soap. Significantly greater (P 4.0 log CFU per towel) when hands are highly contaminated. Our results support future quantitative microbial risk assessments needed to effectively manage risks of foodborne illness in which food workers' hands are a primary cause.
Delignette-Muller, M L; Cornu, M
2008-11-30
A quantitative risk assessment for Escherichia coli O157:H7 in frozen ground beef patties consumed by children under 10 years of age in French households was conducted by a national study group describing an outbreak which occurred in France in 2005. Our exposure assessment model incorporates results from French surveys on consumption frequency of ground beef patties, serving size and consumption preference, microbial destruction experiments and microbial counts on patties sampled from the industrial batch which were responsible for the outbreak. Two different exposure models were proposed, respectively for children under the age of 5 and for children between 5 and 10 years. For each of these two age groups, a single-hit dose-response model was proposed to describe the probability of hemolytic and uremic syndrome (HUS) as a function of the ingested dose. For each group, the single parameter of this model was estimated by Bayesian inference, using the results of the exposure assessment and the epidemiological data collected during the outbreak. Results show that children under 5 years of age are roughly 5 times more susceptible to the pathogen than children over 5 years. Exposure and dose-response models were used in a scenario analysis in order to validate the use of the model and to propose appropriate guidelines in order to prevent new outbreaks. The impact of the cooking preference was evaluated, showing that only a well-done cooking notably reduces the HUS risk, without annulling it. For each age group, a relation between the mean individual HUS risk per serving and the contamination level in a ground beef batch was proposed, as a tool to help French risk managers.
Directory of Open Access Journals (Sweden)
Iličković Zoran
2012-01-01
Full Text Available The aim of this paper was to investigate the possibility of obtaining oil from spent coffee grounds, which are left behind after the coffee is prepared, as the potential feedstock for biodiesel production. The effect of process parameters, such as are the type of solvent, the ratio of spent coffee grounds/solvent and the extraction time on oil yielded from coffee grounds was examined. The oil was obtained by maceration and extraction in the Soxhlet apparatus. The obtain results show that the spent coffee grounds could be used as an alternative raw material for biodiesel production, because it contains a significant amount of oil that can be extracted. The oil yield depends on the extraction (maceration process parameters. The maximum oil yield obtained by the Soxhlet extraction with the n-hexane for the period of 5 h was 11.85% (the weight percentage of oil on dry mater, whereas with petroleum ether the oil yield was slightly lower and amounted to 10.44%. The yield of the oil extracted by maceration increases with the decrease of spent coffee grounds/solvent ratio from 1/3 to 1/7 g/cm3, and other parameters being constant. The oil yield increases with the duration of the maceration. Greater oil yield, ranging from 3 to 8.5%, can be obtained with n-hexane compared to the extraction with petroleum ether. Furthermore, n-hexane is less volatile and flammable, compared to petroleum ether, so it is more convenient to use.
Wang, Luxin; Wu, Chung-Shieh; Fan, Xudong; Mustapha, Azlin
2012-05-01
The aims of this study were to introduce a new immunological bead-free cell detection method using quantum dots (QDs) as reporter markers for foodborne pathogen detection. QDs are nanosized particles with long-term photostability, high quantum yield, broad absorption spectra, and narrow, symmetric emission and high signal-to-noise ratio. The chemical compound [(1-ethyl-3-3-dimethylaminopropyl) carbodiimide hydrochloride] (EDC) and protein A were used as crosslinkers for manufacturing QD-antibody conjugates. To minimize the inhibition of QD fluorescence by the magnetic beads, the beads were removed after the primary pathogen isolation and before fluorescence measurement. Detection signals were increased four-fold after employing the bead-free isolation method. With a 24-h enrichment, the bead-free QD-facilitated detection method was able to detect 10 CFU/g Escherichia coli O157:H7 and Salmonella from artificially contaminated ground beef. To our knowledge, this detection method is the first research that combined a new EDC-protein A QD-labeling technique and bead-free fluorescence measurement to detect E. coli O157:H7 and Salmonella in ground beef. Copyright © 2012 Elsevier B.V. All rights reserved.
Farrell, B L; Ronner, A B; Wong, A C
1998-07-01
The potential for transfer of Escherichia coli O157:H7 from contaminated ground beef to grinding equipment and the inactivation of attached cells during cleaning and sanitizing was examined. Chub-packed ground beef with lean:fat ratios of 75:25, 80:20 or 90:10 was inoculated with 6 log CFU/g or 2 log CFU/g E. coli O157:H7 strain FRIK 910. Samples were consecutively ground in a Hobart meat grinder with stainless steel (SS) chips (1 cm2) glued to the auger housing. Chips were harvested after grinding, detergent washing with or without manual scrubbing and rinsing, sanitizing in a chlorine or peroxyacetic acid sanitizer, and overnight storage. Survival of E. coli O157:H7 was evaluated both by plate count and enrichment in trypticase soy broth. Approximately 3 to 4 log CFU/cm2 were attached to the SS after grinding with all three fat contents. After washing and sanitizing in a chlorine or peroxyacetic acid sanitizer, viable bacteria were infrequently recovered by plate count. Enrichment of chips resulted in a higher survival rate with both sanitizing treatments, indicating that cell numbers below the limit of detection (5 CFU/cm2) or potentially injured organisms remained on the surface. Manual scrubbing during the washing step reduced the recovery rate. The scrubbing step also increased the number of passing scores assigned using an ATP bioluminescence assay of total residual soil on the chips sanitized in chlorine. The overall results indicate that plate counts alone may not be a reliable indicator of sanitation efficacy and may be validated by enrichment assay.
Gunes, Gurbuz; Ozturk, Aylin; Yilmaz, Neriman; Ozcelik, Beraat
2011-08-01
Meatballs were prepared by mixing ground beef and spices and inoculated with E. coli O157:H7, L. monocytogenes, and S. enteritidis before packaged in modified atmosphere (3% O₂ + 50% CO₂ + 47% N₂) or aerobic conditions. The packaged samples were irradiated at 0.75, 1.5, and 3 kGy doses and stored at 4 °C for 21 d. Survival of the pathogens, total plate count, lipid oxidation, color change, and sensory quality were analyzed during storage. Irradiation at 3 kGy inactivated all the inoculated (approximately 10⁶ CFU/g) S. enteritidis and L. monocytogenes cells in the samples. The inoculated (approximately 10⁶ CFU/g) E. coli O157:H7 cells were totally inactivated by 1.5 kGy irradiation. D¹⁰-values for E. coli O157:H7, S. enteritidis, and L. monocytogenes were 0.24, 0.43, and 0.41 kGy in MAP and 0.22, 0.39, and 0.39 kGy in aerobic packages, respectively. Irradiation at 1.5 and 3 kGy resulted in 0.13 and 0.36 mg MDA/kg increase in 2-thiobarbituric acid-reactive substances (TBARS) reaching 1.02 and 1.49 MDA/kg, respectively, on day 1. Irradiation also caused significant loss of color and sensory quality in aerobic packages. However, MAP effectively inhibited the irradiation-induced quality degradations during 21-d storage. Thus, combining irradiation (3 kGy) and MAP (3% O₂ + 50% CO₂ + 47% N₂) controlled the safety risk due to the potential pathogens and maintained qualities of meatballs during 21-d refrigerated storage. Combined use of gamma irradiation and modified atmosphere packaging (MAP) can maintain quality and safety of seasoned ground beef (meatball). Seasoned ground beef can be irradiated at 3 kGy and packaged in MAP with 3% O₂ + 50% CO₂ + 47% N₂ gas mixture in a high barrier packaging materials. These treatments can significantly decrease risk due to potential pathogens including E. coli O157:H7, L. monocytogenes, and S. enteritidis in the product. The MAP would reduce the undesirable effects of
Directory of Open Access Journals (Sweden)
Alireza Goodarzi
2016-06-01
Full Text Available Background and Objective: Constant use of limited number of lactic acid bacteria species in biopreservation can cause genetic degradation and or rising resistance against food pathogens or antimicrobial substances they produce. For this objective, a newly isolated strain of Lactobacillus acidophilus possessing high antimicrobial activity was evaluated as a candidate for use in biopreservation.Materials and Methods: Antibacterial activity was evaluated by agar disk diffusion method. Hydrogen peroxide amount was measured by Merckoquant Peroxide test strips. Microbiological analysis of the ground beef infected by Escherichia coli O157:H7 and treated by Lactobacillus acidophilus GH 201was done by plating of serial dilution in physiological saline on Tryptose agar.Results and Conclusion: The cells (109 CFU ml-1 of Lactobacillus acidophilus produced significant amount of antibacterial substances mainly hydrogen peroxide (28 and 30 μg ml-1 in sodium phosphate buffer (0.2 M, pH 6.5 and LAPTg at 5°C during submerged cultivation with no growth, respectively. Submerged co-cultivation of Escherichia coli O157:H7 with lactobacilli in LAPTg broth at 5°C reduced the total number of the pathogen more than 2 log for 5 days. In case of solid state cultivation on agar-based medium, the maximum inhibitory zones on Escherichia coli O157:H7 lawn around the disks soaked by different amounts of washed Lactobacillus acidophilus cells appear for one-day cold exposition. The size of inhibition zone depends on the concentration of lactic acid bacteria cells. The cell suspension intended for treatment must contain 108-9CFU ml-1 of lactic acid bacteria. Lactobacillus acidophilus reduced the initial amount (2×105 CFU ml-1 of Escherichia coli O157:H7 in ground beef up to 2 log for 5 days of solid-state co-cultivation. The application of Lactobacillus acidophilus bacteria expanded the shelf-life of ground beef due to inhibition of
Aims: To evaluate the performance of the IQ-Check kits and the USDA Microbiology Laboratory Guidebook (MLG) methods for detection of the top 7 Shiga toxin-producing E. coli (STEC) (O157:H7, O26, O45, O103, O111, O121, and O145) in ground beef and both STEC and Salmonella in co-inoculated samples. M...
Devatkal, Suresh K; Naveena, B M
2010-06-01
Effects of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat stored at 4+/-1 degrees C was evaluated. Five treatments evaluated include: control (only meat), MS (meat+2% salt), KRP (meat+2% salt+2% kinnow rind powder), PRP (meat+2% salt+2% pomegranate rind powder) and PSP (meat+2% salt+2% pomegranate seed powder). Addition of salt resulted in reduction of redness scores. Lightness increased in control and unchanged in others during storage. Redness scores declined and yellowness showed inconsistent changes during storage. Thiobarbituric acid reactive substances (TBARS) values were higher (PPRP>KRP>control>MS. Therefore, these powders have potential to be used as natural antioxidants to minimize the auto-oxidation and salt induced lipid oxidation in raw ground goat meat. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
de Barcellos, Marcia Dutra; Pedrozo, Eugenio A.; van der Lans, Ivo A.
2009-01-01
In this chapter we will explore beef consumption behaviour from a cross-cultural perspective. Data collected in Brazil, Australia and the Netherlands supports the main objectives of identifying consumers' anticipated emotions, degree of involvement, attitudes and main concerns towards beef...
GPM GROUND VALIDATION NOAA S-BAND PROFILER RAW DATA NETCDF FORMAT MC3E V1
National Aeronautics and Space Administration — The S-band Profiler Raw dataset was saved in two data formats: netCDF anda proprietary Vaisala SPC format. The numeric values in both formats are exactly the same....
Komiskey, Matthew J.; Stuntebeck, Todd D.; Frame, Dennis R.; Madison, Fred W.
2011-01-01
Nutrients and sediment in surface runoff from frozen agricultural fields were monitored within three small (16.0 ha [39.5 ac] or less), adjacent basins at a no-till farm in southwest Wisconsin during four winters from 2003 to 2004 through 2006 to 2007. Runoff depths and flow-weighted constituent concentrations were compared to determine the impacts of surface-applied liquid-dairy or solid-beef manure to frozen and/or snow-covered ground. Despite varying the manure type and the rate and timing of applications, runoff depths were not significantly different among basins within each winter period. Sediment losses were low (generally less than 22 kg ha−1 [20 lb ac−1] in any year) and any statistical differences in sediment concentrations among basins were not related to the presence or absence of manure or the amount of runoff. Concentrations and losses of total nitrogen and total phosphorus were significantly increased in basins that had either manure type applied less than one week preceding runoff. These increases occurred despite relatively low application rates. Lower concentrations and losses were measured in basins that had manure applied in fall and early winter and an extended period of time (months) had elapsed before the first runoff event. The highest mean, flow-weighted concentrations of total nitrogen (31.8 mg L−1) and total phosphorus (10.9 mg L−1) occurred in winter 2003 to 2004, when liquid-dairy manure was applied less than one week before runoff. On average, dissolved phosphorus accounted for over 80% of all phosphorus measured in runoff during frozen-ground periods. The data collected as part of this study add to the limited information on the quantity and quality of frozen-ground runoff at field edges, and the results highlight the importance of manure management decisions during frozen-ground periods to minimize nutrients lost in surface runoff.
de Oliveira, Thales Leandro Coutinho; Soares, Rodrigo de Araújo; Piccoli, Roberta Hilsdorf
2013-03-01
The antimicrobial effect of oregano (Origanum vulgare L.) and lemongrass (Cymbopogon citratus (DC.) Stapf.) essential oils (EOs) against Salmonella enterica serotype Enteritidis in in vitro experiments, and inoculated in ground bovine meat during refrigerated storage (4±2 °C) for 6 days was evaluated. The Weibull model was tested to fit survival/inactivation bacterial curves (estimating of p and δ parameters). The minimum inhibitory concentration (MIC) value for both EOs on S. Enteritidis was 3.90 μl/ml. The EO concentrations applied in the ground beef were 3.90, 7.80 and 15.60 μl/g, based on MIC levels and possible activity reduction by food constituents. Both evaluated EOs in all tested levels, showed antimicrobial effects, with microbial populations reducing (p≤0.05) along time storage. Evaluating fit-quality parameters (RSS and RSE) Weibull models are able to describe the inactivation curves of EOs against S. Enteritidis. The application of EOs in processed meats can be used to control pathogens during refrigerated shelf-life. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
María Gabriela Gallego
2016-03-01
Full Text Available The development of antioxidant-active packaging has numerous advantages, such as the reduction of synthetic additives in food, the reduction of plastic waste and food protection against oxidation reactions. Different concentrations of extracts of the plants Caesalpinia decapetala (CD and Caesalpinia spinosa “Tara” (CS were incorporated into gelatine films as natural antioxidants. The physical, mechanical and antioxidant properties of these films were studied. Films containing plant extracts at a high concentration had lower tensile strength with higher elongation at break points, compared to the control film (p < 0.05. Films exhibited antioxidant activity in the oxygen radical absorbance capacity (ORAC and Trolox equivalence antioxidant capacity (TEAC assays when added at 0.2%. The application of gelatine film containing CD and CS was found to be effective in delaying lipid oxidation and deterioration of beef patty quality during storage. Therefore, the films prepared in this study offered an alternative edible coating for the preservation of fresh food.
2013-03-12
... Labeling of Beef, Pork, Lamb, Chicken, Goat Meat, Wild and Farm-Raised Fish and Shellfish, Perishable...), lamb, chicken, goat, and pork; ground beef, ground lamb, ground chicken, ground goat, and ground pork... The baseline for this analysis is the present state of the beef, chicken, goat, lamb and pork...
International Nuclear Information System (INIS)
El-Zawahry, Y.A.; Mostafa, S.A.; Awny, N.M.
1986-01-01
The combination of two lethal agents such as irradiation and temperature (high or sub zero) resulted in synergistic death or B. subtilis spores (as indicated by decrease in the thermal D-value). The extent of this synergism in killing a spore population depended mainly on the sequence on application of the two physical agents. Irradiation-temperature (high or sub zero) sequence killed more but injured less B. subtilis spores than temperature irradiation sequence or irradiation and temperature applied separately. Storage at -20 0 C killed more spores than storage at -2 0 C if carried after irradiation, while the reverse was true of storage was prior irradiation. An irradiation dose of 8 KGY followed by thermal exposure to 70 0 C for 1 hr is suggested for the sterilization of ground beef. Irradiation induced certain quantitative changes on the amino-N, protein-N, RNA and DNA of the first subcultures of irradiated spores with stimulatory effect at low irradiation doses and inhibitory effect at the high irradiation doses. This might explain the increased sensitivity of irradiated spores to subsequent exposure to unfavourable temperature (high or sub zero). Exposure of B. subtilis spore to 70 0 C induced a stimulation in the amino- and protein-N of the resulting cells while exposure to 80 0 C resulted in a significant decrease in the amino-N. The protein-N remained more or less the same
Directory of Open Access Journals (Sweden)
Claudia Foerster
2012-09-01
Full Text Available The aims of this study were to determine the occurrence of Listeria monocytogenes in cattle feces and ground beef, to characterize these strains by pulsed-field gel electrophoresis and to compare them to three listeria strains found in humans. Cattle from different origins (n = 250 and ground beef obtained from supermarkets (n = 40 were sampled. The results show low occurrence in cattle feces (0.4 % but a higher presence in ground beef (37 %. An important part of the ground beef strains (80 % had > 95 % similarity with a strain isolated from a human sporadic case and the ATCC 19115 used as control. The strain isolated from cattle feces had 93 % similarity to clone 009, previously associated with a listeriosis outbreak related to cheese. Cattle and ground beef can harbor virulent L. monocytogenes strains. Further studies in animals and animal products are needed to improve listeriosis control.Los objetivos de este estudio fueron determinar la presencia de Listeria monocytogenes en el ganado y en la carne molida de vacuno comercializada en Chile, caracterizar los aislados mediante electroforesis de campo pulsado y compararlos con los obtenidos en tres cepas que han producido listeriosis en humanos, en ese país. Se tomaron muestras de heces de bovinos (n = 250 y de carne molida obtenida en supermercados (n = 40. Se encontró una baja incidencia de este patógeno en las heces de bovinos (0,4 %; un solo animal, pero mayores porcentajes en la carne molida (37 %. Gran parte de las cepas encontradas en la carne molida (80 % mostraron una similitud mayor del 95 % con un caso esporádico de listeriosis y con la cepa de referencia ATCC 19115. La cepa aislada de bovino tuvo un 93 % de similitud con el clon 009, responsable de un brote asociado al consumo de queso, ocurrido en 2008. Se concluye que el ganado y la carne molida pueden albergar cepas virulentas de L. monocytogenes. Se necesita un mayor número de estudios en animales y en los productos que se
Presence of Shiga toxin-producing Escherichia coli (STEC) is a major concern in ground beef. Several methods for sampling beef trim prior to grinding are currently used in the beef industry. The purpose of this study was to determine the efficacy of the sampling methods for detecting STEC in beef ...
Gunes, Gurbuz; Yilmaz, Neriman; Ozturk, Aylin
2012-01-01
Combined effects of gamma irradiation and concentrations of O(2) (0, 5, 21%) and CO(2) (0, 50%) on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball) during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O(2) and CO(2) levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy) caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O(2), respectively, compared to 21% O(2). Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg(-1), respectively, compared to control. In reduced-O(2) packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO(2) or 5% O(2) + 50% CO(2) maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O(2) + 50% CO(2) combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality.
Gunes, Gurbuz; Yilmaz, Neriman; Ozturk, Aylin
2012-01-01
Combined effects of gamma irradiation and concentrations of O2 (0, 5, 21%) and CO2 (0, 50%) on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball) during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O2 and CO2 levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy) caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O2, respectively, compared to 21% O2. Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg−1, respectively, compared to control. In reduced-O2 packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO2 or 5% O2 + 50% CO2 maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O2 + 50% CO2 combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality. PMID:22566763
Directory of Open Access Journals (Sweden)
Gurbuz Gunes
2012-01-01
Full Text Available Combined effects of gamma irradiation and concentrations of O2 (0, 5, 21% and CO2 (0, 50% on survival of Escherichia coli O157:H7, Salmonella enteritidis, Listeria monocytogenes, lipid oxidation, and color changes in ready-to-cook seasoned ground beef (meatball during refrigerated storage were investigated. Ground beef seasoned with mixed spices was packaged in varying O2 and CO2 levels and irradiated at 2 and 4 kGy. Irradiation (4 kGy caused about 6 Log inactivation of the inoculated pathogens. Inactivation of Salmonella was 0.9- and 0.4-Log lower in 0 and 5% O2, respectively, compared to 21% O2. Irradiation at 2 and 4 kGy increased thiobarbituric acid reactive substances in meatballs by 0.12 and 0.28 mg malondialdehyde kg−1, respectively, compared to control. In reduced-O2 packages, radiation-induced oxidation was lower, and the initial color of an irradiated sample was maintained. Packaging with 0% + 50% CO2 or 5% O2 + 50% CO2 maintained the oxidative and the color quality of irradiated meatballs during 14-day refrigerated storage. MAP with 5%O2 + 50% CO2 combined with irradiation up to 4 kGy is suggested for refrigerated meatballs to reduce the foodborne pathogen risk and to maintain the quality.
Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland
DEFF Research Database (Denmark)
Scullion, R.; Harrington, C.S.; Madden, R.H.
2006-01-01
A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....
Shiga toxin-producing E. coli (STEC) O157:H7 and serogroups O26, O45, O103, O111, O121, and O145 are often referred to as the “top 7” STEC, and these have been declared as adulterants in beef by the USDA Food Safety and Inspection Service (FSIS). The aim of this work was to compare the methods des...
prevalence of escherichia coli 0157:h7 in fresh and roasted beef
African Journals Online (AJOL)
DR. AMINU
The prevalence of Enterohemorrhagic Escherichia coli 0157:H7 in 300 fresh beef and 150 roasted beef samples from ... likely cause of E. coli O157:H7 infection is undercooked ground beef. ..... coli O157:H7 in a sheep model. Appl. Environ.
Consumer attitudes towards beef and acceptability of enhanced beef.
Robbins, K; Jensen, J; Ryan, K J; Homco-Ryan, C; McKeith, F K; Brewer, M S
2003-10-01
The objective of this study was to evaluate consumer quality characteristics of enhanced steaks and roasts derived from cattle supplemented with vitamin E during finishing, and to assess the attitudes of these consumers towards beef. Twelve steers were fed either a control (E-) diet or a diet supplemented with dl-alpha tocopheryl acetate (E+). Paired strip loins and rounds were either used as controls (C) or were pumped (P) to 110% of raw weight to contain 0.4% sodium chloride and 0.4% sodium tripolyphosphate in the final product. Consumers (n=103) evaluated roasts and steaks for juiciness, tenderness, saltiness, and overall acceptability on a 9-point hedonic scale. Enhanced steaks and roasts were more acceptable than non-enhanced controls; E+ steaks were less acceptable than E- steaks. A beef quality questionnaire revealed that color, price, visible fat and cut were the most important factors underlying beef steak purchase, while tenderness, flavor and juiciness were weighted most heavily with regard to eating satisfaction.
Effect of marination in gravy on the radio frequency and microwave processing properties of beef
Basaran-Akgul, Nese; Rasco, Barbara A.
2013-01-01
Dielectric properties (the dielectric constant (ε′) and the dielectric loss factor (ε″)) and the penetration depth of raw eye of round beef Semitendinosus muscle, raw beef marinated in gravy, raw beef cooked in gravy, and gravy alone were determined as a function of the temperature (20–130 °C) and frequency (27–1,800 MHz). Both ε′ and ε″ values increased as the temperature increased at low frequencies (27 and 40 MHz). At high frequencies (915 and 1,800 MHz), ε′ showed a 50 % decrease while ε″...
DEFF Research Database (Denmark)
de Barcellos, Marcia Dutra; Brei, Vinicius A.
indicated similarities amongst Brazilian and Australian consumers regarding their positive attitude towards beef and main concerns regarding its consumption. Dutch consumers, although presented negative attitudes, considered beef consumption as important. In general respondents presented a high degree...
Environmental sustainability of beef
A national assessment of the sustainability of beef is being conducted in collaboration with the National Cattlemen’s Beef Association through the support of the Beef Checkoff. This includes surveys and visits to cattle operations throughout the U.S. to gather production information. With this infor...
DEFF Research Database (Denmark)
Walford, Antonia
2017-01-01
. Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....
Detection of horse meat contamination in raw and heat-processed meat products.
Hsieh, Yun-Hwa P; Ofori, Jack A
2014-12-31
Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.
European consumers and beef safety
DEFF Research Database (Denmark)
Van Wezemael, Lynn; Verbeke, Wim; Kügler, Jens Oliver
2010-01-01
European beef consumption has been gradually declining during the past decades, while consumers' concerns about beef safety have increased. This paper explores consumer perceptions of and interest in beef safety and beef safety information, and their role in beef safety assessment and the beef...... consumption decision making process. Eight focus group discussions were performed with a total of 65 beef consumers in four European countries. Content analysis revealed that European consumers experienced difficulties in the assessment of the safety of beef and beef products and adopted diverging uncertainty...... reduction strategies. These include the use of colour, labels, brands and indications of origin as cues signalling beef safety. In general, consumer trust in beef safety was relatively high, despite distrust in particular actors....
Maughan, Curtis; Martini, Silvana
2012-02-01
The objectives of this study were to use a meat flavor lexicon to identify and quantify flavor differences among different types of meats such as beef, chicken, lamb, pork, and turkey, and to identify and quantify specific flavor attributes associated with "beef flavor" notes. A trained descriptive panel with 11 participants used a previously developed meat lexicon composed of 18 terms to evaluate the flavor of beef, chicken, pork, turkey, and lamb samples. Results show that beef and lamb samples can be described by flavor attributes such as barny, bitter, gamey, grassy, livery, metallic, and roast beef. Inversely related to these samples were pork and turkey and those attributes that were closely related to them, namely brothy, fatty, salty, sweet, and umami. Chicken was not strongly related to the other types of meats or the attributes used. The descriptive panel also evaluated samples of ground beef mixed with chicken to identify and quantify flavor attributes associated with a "beef flavor." Meat patties for this portion consisted of ground beef mixed with ground chicken in varying amounts: 0%, 25%, 50%, 75%, and 100% beef, with the remainder made up of chicken. Beef and beef-rich patties (75% beef) were more closely related to flavor attributes such as astringent, bloody, fatty, gamey, metallic, livery, oxidized, grassy, and roast beef, while chicken was more closely associated with brothy, juicy, sour, sweet, and umami. This research provides information regarding the specific flavor attributes that differentiate chicken and beef products and provides the first set of descriptors that can be associated with "beefy" notes. POTENTIAL APPLICATION: The use of a standardized flavor lexicon will allow meat producers to identify specific flavors present in their products. The impact is to identify and quantify negative and positive flavors in the product with the ultimate goal of optimizing processing or cooking conditions and improve the quality of meat products.
Safety of street vended meat products - chicken and beef suya ...
African Journals Online (AJOL)
leftover, heated, spiced and roasted suya of the following day, were collected from three locations in Ibadan metropolis, to identify the specific microorganisms in street vended chicken and beef suya and measure the microbial count at each stage of handling from the raw state to marketing and consumption. The plate count ...
Directory of Open Access Journals (Sweden)
shohreh Dadfar
2014-09-01
Conclusion: The results indicated that both essential oil and dried powder of Ocimum basilicum increased the microbial stability of ground meat during storage, whereas dried powder showed more preservative capability at final days of storage. So it is possible to use this kind of natural product instead of synthetic one to reduce the disease of consumers and enhancing the organoleptic features of food
Consumer perceptions of beef healthiness
DEFF Research Database (Denmark)
Van Wezemael, Lynn; Verbeke, Wim; Dutra de Barcellos, Marcia
2010-01-01
of beef consumed. Focus group participants were not in favour of improving beef healthiness during processing, but rather focussed on appropriate consumption behaviour and preparation methods. CONCLUSIONS: The individual responsibility for health implies that consumers should be able to make correct......BACKGROUND: Consumer perception of the healthiness of beef is an important determinant of beef consumption. However, little is known about how consumers perceive the healthiness of beef. The aim of this study is to shed light on the associations between beef and health. METHODS: Eight focus group...... as well as negative effects of beef consumption on their health. Labelled, branded, fresh and lean beef were perceived as signalling healthful beef, in contrast with further processed and packaged beef. Consumers felt that their individual choices could make a difference with respect to the healthiness...
Rossetti, Piergiorgio; Antonella Dino, Giovanna; de la Feld, Marco; Pizza, Antonietta; Coulon, Frederic; Wagland, Stuart; Gomes, Diogo
2016-04-01
The issue of resource security has come to the forefront of the debate over recent years, partly due to considerable concern over the security of supply of the so called 'critical' materials, with rare earths attracting the greatest attention in the press. Their supply is fundamental to maintain and develop EU economy and its industries relied on a steady supply of Raw Materials. Thus considering the increasing scarcity and raising prices of both, energy raw materials and other raw materials, such as metals and minerals, the recycling and recovery of these materials from anthropogenic deposits such as landfills is of increasing relevance. Europe has somewhere between 150,000 and 500,000 landfill sites, with an estimated 90% of them being "non-sanitary" pre-dating the EU Landfill Directive of 1999. Thus historical background makes the numerous old waste dumps as possible sources of critical and secondary raw materials (SRM and CRM). However, to date there is no inventory available of SRM and CRM present in EU landfills, and best management practices to recover SRM from landfill activities are inefficient. In this context, the EU SMART GROUND (SG) project (Grant Agreement No 641988) intends to foster resource recovery in landfills by improving both the availability and the accessibility of data and information on SRM in the EU and creating synergies among the different stakeholders involved in the SRM value chain. To do so, the project aims to collect and integrate in a single EU databank (SMART GROUND Data Bank) all the data from existing databases and new information retrieved during project activities. Such data will be collected from the different waste streams including municipal, industrial and mining wastes across EU landfills. It will improve data gathering on SRM from different types of waste, by defining new and integrated data acquisition methods and standards. At last, but not least, the project will also improve the SRM economic and employment potential
Directory of Open Access Journals (Sweden)
Elena SOARE
2015-04-01
Full Text Available This scientific paper presents the cattle market dynamics in Romania during 2007-2013. In order to realize this research there were used certain indicators, as following: herds of cattle, realized beef production, selling price, human consumption, import and export. The data were collected from the Ministry of Agriculture and Rural Development, National Institute of Statistics and Faostat. During the analysis, the presented indicators were modified from a period to another, because of both internal and external factors. Consumption demand is being influenced by: beef price, beef quality, price of other meat categories, consumers incomes, population’s food consumption pattern and so on.
Directory of Open Access Journals (Sweden)
M. A. Marzocca
2006-03-01
Full Text Available Escherichia coli O157:H7 es un patógeno emergente asociado a enfermedades transmitidas por alimentos. En el año 1982 fue reconocido por primera vez, en los Estados Unidos, como causante de dos brotes de colitis hemorrágica. Hoy se sabe que la mayoría de los casos de síndrome urémico hemolítico son ocasionados por este microorganismo. El objetivo del trabajo fue detectar su presencia en carne picada fresca y hamburguesas congeladas, muestras obtenidas en puntos de venta de nuestra cadena de supermercados en un total de 37 y 43, respectivamente, en el período comprendido entre abril de 2003 y agosto de 2004. Las mismas fueron procesadas utilizando el caldo selectivo para enriquecimiento EC modificado conteniendo novobiocina, seguido de la aplicación de un método de inmunocaptura (TECRA E. COLI O157 IMMUNOCAPTURE TM ECOICM 20, y posterior aislamiento en agar MacConkey sorbitol suplementado con cefixima y telurito de potasio y un medio cromogénico. Las cepas sospechosas fueron caracterizadas a genotípicamente mediante la detección de los genes de virulencia stx1, stx2, eaeA y EHEC-hlyA por PCR e hibridación con sondas genéticas, b fenotípicamente mediante la determinación del serotipo, sensibilidad a los antimicrobianos por el método de difusión de Kirby-Bauer y producción de Stx por ensayo de citotoxicidad específica en células Vero. Se aisló E. coli O157:H7 en una sola muestra de carne picada fresca (2,7% caracterizada como gen eae (+/stx2/EHEC-hlyA.Escherichia coli O157:H7 is an emergent pathogen associated with food transmitted diseases. In 1982, Escherichia coli 0157:H7 was for the first time identified as the cause of two hemorrhagic colitis outbreaks in the United States. It is now well known that most cases of hemolytic uremic syndrome are caused by these bacteria. The objective of this work was to detect the microorganism in fresh ground beef and hamburgers. From April 2003 to August 2004 samples were taken at sale
Naveena, Basappa M; Jagadeesh, Deepak S; Jagadeesh Babu, A; Madhava Rao, T; Kamuni, Veeranna; Vaithiyanathan, S; Kulkarni, Vinayak V; Rapole, Srikanth
2017-10-15
The present study compared the accuracy of an OFFGEL electrophoresis and tandem mass spectrometry-based proteomic approach with a DNA-based method for meat species identification from raw and cooked ground meat mixes containing cattle, water buffalo and sheep meat. The proteomic approach involved the separation of myofibrillar proteins using OFFGEL electrophoresis, SDS-PAGE and protein identification by MALDI-TOF MS. Species-specific peptides derived from myosin light chain-1 and 2 were identified for authenticating buffalo meat spiked at a minimum 0.5% level in sheep meat with high confidence. Relative quantification of buffalo meat mixed with sheep meat was done by quantitative label-free mass spectrometry using UPLC-QTOF and PLGS search engine to substantiate the confidence level of the data. In the DNA-based method, PCR amplification of mitochondrial D loop gene using species specific primers found 226bp and 126bp product amplicons for buffalo and cattle meat, respectively. The method was efficient in detecting a minimum of 0.5% and 1.0% when buffalo meat was spiked with cattle meat in raw and cooked meat mixes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Goran, Gheorghe Valentin; Tudoreanu, Liliana; Rotaru, Elena; Crivineanu, Victor
2016-08-01
This study focuses on the effects of three different thermal preparation methods (roasting, boiling, and microwave cooking) on the mineral concentrations of beef and pork, as well as on the comparison of mineral levels between these two types of meat. In this study, raw and cooked beef and pork samples were selected and analyzed by ICP-OES in order to determine mineral concentrations. In general, thermal preparation clearly increased mineral concentrations in cooked samples compared to raw meat. The highest mineral concentration was identified in the roasted samples. Trace element concentrations in beef were significantly higher compared to pork. In pork, Na concentration decreased in all samples, suggesting that Na is lost with water. Zn mean content in cooked beef samples registered significant differences compared to pork cooked samples. The percentage of water loss during the microwave thermal preparation for beef samples was higher than the other two treatments. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chemistry in the kitchen. Making ground meat more healthful.
Small, D M; Oliva, C; Tercyak, A
1991-01-10
The National Cholesterol Education Program recommends a diet containing less than 30 percent of calories in the form of fat, less than 10 percent in the form of saturated fat, and less than 300 mg of cholesterol per day. Since Americans' diets generally exceed these recommendations, we wished to find an easy kitchen method to reduce substantially saturated fat and cholesterol in ground meat. Raw ground meat was heated in vegetable oil and rinsed with boiling water to extract fat and cholesterol. The fat-free broth was recombined with the meat to restore flavor. The amounts of total fat, saturated fat, and cholesterol in the meat after extraction were compared with the amounts in meat cooked as patties and in stir-fried, rinsed meat. When raw ground beef containing 9.6 to 20.8 percent fat was cooked as patties and the fat poured off, 6 to 17 percent of the fat and 1.3 to 4.3 percent of the cholesterol were lost. In stir-fried, rinsed ground beef, 23 to 59 percent of the fat and 9.0 to 18.8 percent of the cholesterol were lost. When vegetable oil was used to extract fat and cholesterol from beef containing 20.7 percent fat, a mean (+/- SD) of 67.7 +/- 1.6 percent of the fat and 39.2 +/- 5.1 percent of the cholesterol were lost. The differences between conventionally cooked meat and meat prepared by the extraction of fat were significant (P less than 0.001). An average of 43 percent (range, 38 to 49) of cholesterol was extracted from a wide variety of ground meats. Although conventional cooking produced no change in fatty-acid composition as compared with raw meat, our extraction process greatly increased the ratio of unsaturated to saturated fat, from 1.32 in conventionally cooked meat to 2.92 to 4.56 in meat after extraction. Extraction resulted in the loss of 72 to 87 percent of saturated fat. This method produces a tasty meat product that is much lower in saturated fat and cholesterol than conventionally cooked meat, and that can be used in sauces, soups, and
Bacterial isolates from raw beef retailed at Rukuba market, Jos ...
African Journals Online (AJOL)
%), Bacillus (2.3%), Micrococcus (2.0%), Corynebacterium (1.7%), Clostridium and Serratia (1.0%). Mean count of E. coli (5.5x107 cfu/g) and Proteus (1.8x107 cfu/g) were the highest of the microbial density. There was higher contamination of ...
Nova Nayarit-Ballesteros; María Salud Rubio-Lozano; Enrique Delgado-Suárez; Danilo Méndez-Medina; Diego Braña-Varela; Oscar Rodas-Suárez
2016-01-01
Objective. To determine the serotype and antibiotic resistance profile of Salmonella spp. isolated from retail ground beef in Mexico City. Materials and methods. A total of 100 samples of ground beef were analyzed. The pathogen was isolated by conventional methods and confirmed by PCR (invA gene, 284 bp). The antibiotic resistance profile was determined by the Kirby-Bauer method while serotyping was performed according to the Kauffman-White scheme. Results. We isolated a total of 19 strains o...
Characterization of radiation-resistant vegetative bacteria in beef
International Nuclear Information System (INIS)
Welch, A.B.; Maxcy, R.B.
1975-01-01
Ground beef contains numerous microorganisms of various types. The commonly recognized bacteria are associated with current problems of spoilage. Irradiation, however, contributes a new factor through selective destruction of the microflora. The residual microorganisms surviving a nonsterilizing dose are predominantly gram-negative coccobacilli. Various classifications have been given, e.g., Moraxella, Acinetobacter, Achromobacter, etc. For a more detailed study of these radiation-resistant bacteria occurring in ground beef, an enrichment procedure was used for isolation. By means of morphological and biochemical tests, most of the isolates were found to be Moraxella, based on current classifications. The range of growth temperatures was from 2 to 50 C. These bacteria were relatively heat sensitive, e.g., D 10 of 5.4 min at 70 0 C or less. The radiation resistance ranged from D 10 values of 273 to 2,039 krad. Thus, some were more resistant than any presently recognized spores. A reference culture of Moraxella osloensis was irradiated under conditions comparable to the enrichment procedure used with the ground beef. The only apparent changes were in morphology and penicillin sensitivity. However, after a few subcultures these bacteria reverted to the characteristics of the parent strain. Thus, it is apparent that these isolates are a part of the normal flora of ground beef and not aberrant forms arising from the irradiation procedure. The significance, if any, of these bacteria is not presently recognized. (auth)
Tapeworm infection - beef or pork
Teniasis; Pork tapeworm; Beef tapeworm; Tapeworm; Taenia saginata; Taenia solium; Taeniasis ... undercooked meat of infected animals. Cattle usually carry Taenia saginata ( T saginata ). Pigs carry Taenia solium (T ...
Escherichia coli O157:H7 Outbreak Associated with Restaurant Beef Grinding.
Torso, Lauren M; Voorhees, Ronald E; Forest, Stephen A; Gordon, Andrew Z; Silvestri, Sharon A; Kissler, Bonnie; Schlackman, Jessica; Sandt, Carol H; Toma, Paul; Bachert, Joel; Mertz, Kristen J; Harrison, Lee H
2015-07-01
Escherichia coli O157:H7 is a common cause of foodborne illness in the United States. Beef ground at establishments regulated by the U.S. Department of Agriculture, Food Safety and Inspection Service is routinely tested for E. coli O157:H7. Prior to December 2013, boxed beef product (wholesale cuts of beef, such as beef loin, packaged into bags and boxed for shipping) was not always tested for this pathogen. Downstream processors or retailers may grind the product; and, if the ground beef is not cooked to the recommended temperature, pathogens on the exterior of the beef introduced to the interior through grinding may survive. On 18 October 2013, the Allegheny County Health Department identified two E. coli O157:H7 cases, both of whom were food handlers at restaurant A, a restaurant that ground locally produced boxed beef for hamburgers on site. Case finding was conducted through public messaging, employee surveys, and disease surveillance. All potential cases were interviewed using a standard questionnaire. A confirmed case was defined as laboratory-confirmed E. coli O157:H7 with exposure to restaurant A. A probable case was defined as a patient with compatible symptoms and exposure to restaurant A but without laboratory confirmation. All human and food isolates were characterized by pulsed-field gel electrophoresis and multilocus variable-number tandem repeat analysis. The analysis identified 14 confirmed and 10 probable cases of E. coli; 18 nonintact ground beef samples tested positive for E. coli O157:H7. Nine confirmed cases were restaurant A employees. All confirmed cases recalled eating a restaurant A hamburger in the 10 days before illness onset; most cases reported consuming medium to rare hamburgers. Multiple pulsed-field gel electrophoresis and multilocus variable-number tandem repeat analysis patterns were identified among both the human and ground beef isolates, and the patient isolates matched those found in ground beef samples. Restaurant A
Raw material versus processing
International Nuclear Information System (INIS)
Berg, E.A.T.
1989-01-01
Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt
9 CFR 319.313 - Beef with gravy and gravy with beef.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Beef with gravy and gravy with beef. 319.313 Section 319.313 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF... Dehydrated Meat Food Products § 319.313 Beef with gravy and gravy with beef. “Beef with Gravy” and “Gravy...
Beef Cattle: Selection and Evaluation.
Clemson Univ., SC. Vocational Education Media Center.
Designed for secondary vocational agriculture students, this text provides an overview of selecting and evaluating beef cattle in Future Farmers of America livestock judging events. The first of four major sections addresses topics such as the ideal beef animal, selecting steers, selecting breeding animals, studying the animal systematically, and…
Nutrient analysis of the Beef Alternative Merchandising cuts.
Desimone, T L; Acheson, R A; Woerner, D R; Engle, T E; Douglass, L W; Belk, K E
2013-03-01
The objective of this study was to generate raw and cooked nutrient composition data to identify Quality Grade differences in proximate values for eight Beef Alternative Merchandising (BAM) cuts. The data generated will be used to update the nutrient data in the USDA National Nutrient Database for Standard Reference (SR). Beef Rib, Oven-Prepared, Beef Loin, Strip Loin, and Beef Loin, Top Sirloin Butt subprimals were collected from a total of 24 carcasses from four packing plants. The carcasses were a combination of USDA Yield Grades 2 (n=12) and 3 (n=12), USDA Quality Grades upper two-thirds Choice (n=8), low Choice (n=8), and Select (n=8), and two genders, steer (n=16) and heifer (n=8). After aging, subprimals were fabricated into the BAM cuts, dissected, and nutrient analysis was performed. Sample homogenates from each animal were homogenized and composited for analysis of the following: proximate analysis, long chain and trans-fatty acids, conjugated linoleic acid, total cholesterol, vitamin B-12, and selenium. This study identified seven BAM cuts from all three Quality Grades that qualify for USDA Lean; seven Select cuts that qualify for USDA Extra Lean; and three Select cuts that qualify for the American Heart Association's Heart Healthy Check. Copyright © 2012 Elsevier Ltd. All rights reserved.
Artificial neural network as the tool in prediction rheological features of raw minced meat
Edyta Balejko; Zbigniew Nowak; Jerzy A. Balejko
2012-01-01
Background. The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. Material and methods. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed us...
... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...
Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran
Directory of Open Access Journals (Sweden)
Mohammad Hossein Sarrafzadeh Zargar
2014-07-01
Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.
Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z
2013-07-01
The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground lamb. 65.170 Section 65.170 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.170 Ground lamb. Ground lamb means comminuted...
7 CFR 65.160 - Ground chicken.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground chicken. 65.160 Section 65.160 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.160 Ground chicken. Ground chicken means...
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground goat. 65.165 Section 65.165 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.165 Ground goat. Ground goat means comminuted...
Ishihara, Ayaka; Hashimoto, Etaro; Ishioka, Haruhiko; Kobayashi, Hiroyuki; Gomi, Harumi
2018-01-01
Meningitis caused by the zoonotic pathogen Campylobacter fetus in immunocompetent adults is rare. We report a 48-year-old Japanese woman with no underlying disease who was found to have meningitis caused by C. fetus . Both C. fetus subsp. fetus and C. fetus subsp. venerealis were isolated from the cerebrospinal fluid culture. The mode of infection in our patient was considered to be associated with the consumption of raw beef and raw cattle liver on a regular basis. Public awareness and education to avoid the consumption of raw or undercooked meat might help prevent C. fetus meningitis.
DEFF Research Database (Denmark)
Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask
2005-01-01
The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...
Effect of marination in gravy on the radio frequency and microwave processing properties of beef.
Basaran-Akgul, Nese; Rasco, Barbara A
2015-02-01
Dielectric properties (the dielectric constant (ε') and the dielectric loss factor (ε″)) and the penetration depth of raw eye of round beef Semitendinosus muscle, raw beef marinated in gravy, raw beef cooked in gravy, and gravy alone were determined as a function of the temperature (20-130 °C) and frequency (27-1,800 MHz). Both ε' and ε″ values increased as the temperature increased at low frequencies (27 and 40 MHz). At high frequencies (915 and 1,800 MHz), ε' showed a 50 % decrease while ε″ increased nearly three fold with increasing temperature in the range from 20 to 130 °C. ε' increased gradually while ε″ increased five fold when the temperature increased from 20 to 130 °C. Both ε' and ε″ of all samples decreased with increase in frequency. Marinating the beef in gravy dramatically increased the ε″ values, particularly at the lower frequencies. Power penetration depth of all samples decreased with increase temperature and frequency. These results are expected to provide useful data for modeling dielectric heating processes of marinated muscle food.
Consumer preferences for beef color and packaging did not affect eating satisfaction.
Carpenter, C E; Cornforth, D P; Whittier, D
2001-04-01
We investigated whether consumer preferences for beef colors (red, purple, and brown) or for beef packaging systems (modified atmosphere, MAP; vacuum skin pack, VSP; or overwrap with polyvinyl chloride, PVC) influenced taste scores of beef steaks and patties. To test beef color effects, boneless beef top loin steaks (choice) and ground beef patties (20% fat) were packaged in different atmospheres to promote development of red, purple, and brown color. To test effects of package type, steaks and patties were pre-treated with carbon monoxide in MAP to promote development of red color, and some meat was repackaged using VSP or PVC overwrap. The differently colored and packaged meats were separately displayed for members of four consumer panels who evaluated appearance and indicated their likelihood to purchase similar meat. Next, the panelists tasted meat samples from what they had been told were the packaging treatments just observed. However, the meat samples actually served were from a single untreated steak or patty. Thus, any difference in taste scores should reflect expectations established during the visual evaluation. The same ballot and sample coding were used for both the visual and taste evaluations. Color and packaging influenced (Ppurple >brown and PVC >VSP>MAP. Appearance scores and likelihood to purchase were correlated (r=0.9). However, color or packaging did not affect (P>0.5) taste scores. Thus, consumer preferences for beef color and packaging influenced likelihood to purchase, but did not bias eating satisfaction.
BIODIESEL DARI CAMPURAN LEMAK SAPI (Beef Tallow DAN MINYAK SAWIT
Directory of Open Access Journals (Sweden)
Wara Dyah Pita Rengga
2013-05-01
Full Text Available Cadangan minyak bumi semakin menipis, sehingga dicari bahan bakar alternatif, salah satunya adalah biodiesel. Minyak nabati terutama minyak sawit merupakan bahan baku edible sedangkan lemak sapi merupakan bahan baku non-edible dengan biaya rendah dan memiliki ketersediaan tinggi pada produksi sapi. Pemanfaatan lemak sapi yang belum maksimal dapat digunakan bersama minyak sawit untuk menghasilkan biodiesel. Lemak sapi dicairkan supaya menjadi minyak sapi. Bahan baku minyak sapi dan minyak sawit dicampur dengan perban-dingan 3:1. Campuran minyak ditransesterifikasi dengan metanol dengan perbandingan molar (1:6 dan katalis NaOH. Proses dilakukan selama 90 menit pada suhu ±65°C. Hasil proses transesterifikasi adalah metil ester dan gliserol. Metil ester pada lapisan atas dipisahkan dari gliserol kemudian dilakukan pencucian. Metil ester atau biodiesel selanjutnya diuji angka asam, viskositas, densitas, dan analisis menggunakan GC-MS. Yield biodiesel yang dihasilkan dari campuran minyak sapi dan minyak sawit adalah 76%, angka asam 0,67124 mg-KOH/g, densitas 857,76 kg/cm³, dan viskositas 3,0074 mm2/s. Kesemua parameter tersebut sesuai dengan standart mutu SNI biodiesel. Kandungan metil ester dari minyak sawit dan lemak sapi adalah metiloleat dan metil palmitat. The availability of the fossil fuel is decreasing; hence the finding of an alternative fuels is very important. One of those alternative fuels is biodiesel. Vegetable oil, especially palm oil is the edible raw material, while the beef tallow is the non-edible raw material with low cost production and the availability is huge in the cattle production. The beef tallow mixed with palm oil can be used as raw material for producing biodiesel. Firstly, the beef tallow was melted into beef oil. The raw materials of beef tallow and palm oil were mixed with the composition ratio of 3:1. The resulted mixed-oil was transesterificated by adding methanol with molar ratio of 1:6 and NaOH as
Directory of Open Access Journals (Sweden)
Jayasekara M. K. J. K. Premarathne
2017-12-01
Full Text Available Campylobacter is a major foodborne pathogen frequently associated with human bacterial gastroenteritis in the world. This study was conducted to determine the prevalence and antibiotic resistance of Campylobacter spp. in the beef food system in Malaysia. A total of 340 samples consisting of cattle feces (n = 100, beef (n = 120 from wet markets and beef (n = 120 from hypermarkets were analyzed for Campylobacter spp. The overall prevalence of Campylobacter was 17.4%, consisting of 33% in cattle fecal samples, 14.2% in raw beef from wet market and 7.5% in raw beef from the hypermarket. The multiplex-polymerase chain reaction (PCR identified 55% of the strains as C. jejuni, 26% as C. coli, and 19% as other Campylobacter spp. A high percentage of Campylobacter spp. were resistant to tetracycline (76.9% and ampicillin (69.2%, whilst low resistance was exhibited to chloramphenicol (7.6%. The MAR Index of Campylobacter isolates from this study ranged from 0.09 to 0.73. The present study indicates the potential public health risk associated with the beef food system, hence stringent surveillance, regulatory measures, and appropriate interventions are required to minimize Campylobacter contamination and prudent antibiotic usage that can ensure consumer safety.
Premarathne, Jayasekara M K J K; Anuar, Aimi S; Thung, Tze Young; Satharasinghe, Dilan A; Jambari, Nuzul Noorahya; Abdul-Mutalib, Noor-Azira; Huat, John Tang Yew; Basri, Dayang F; Rukayadi, Yaya; Nakaguchi, Yoshitsugu; Nishibuchi, Mitsuaki; Radu, Son
2017-01-01
Campylobacter is a major foodborne pathogen frequently associated with human bacterial gastroenteritis in the world. This study was conducted to determine the prevalence and antibiotic resistance of Campylobacter spp. in the beef food system in Malaysia. A total of 340 samples consisting of cattle feces ( n = 100), beef ( n = 120) from wet markets and beef ( n = 120) from hypermarkets were analyzed for Campylobacter spp. The overall prevalence of Campylobacter was 17.4%, consisting of 33% in cattle fecal samples, 14.2% in raw beef from wet market and 7.5% in raw beef from the hypermarket. The multiplex-polymerase chain reaction (PCR) identified 55% of the strains as C. jejuni , 26% as C. coli , and 19% as other Campylobacter spp. A high percentage of Campylobacter spp. were resistant to tetracycline (76.9%) and ampicillin (69.2%), whilst low resistance was exhibited to chloramphenicol (7.6%). The MAR Index of Campylobacter isolates from this study ranged from 0.09 to 0.73. The present study indicates the potential public health risk associated with the beef food system, hence stringent surveillance, regulatory measures, and appropriate interventions are required to minimize Campylobacter contamination and prudent antibiotic usage that can ensure consumer safety.
Effects of conventional and grass-feeding systems on the nutrient composition of beef.
Leheska, J M; Thompson, L D; Howe, J C; Hentges, E; Boyce, J; Brooks, J C; Shriver, B; Hoover, L; Miller, M F
2008-12-01
The objectives of this study were to determine the nutrient composition of grass-fed beef in the United States for inclusion in the USDA National Nutrient Database for Standard Reference, and to compare the fatty acid composition of grass-fed and conventionally fed (control) beef. Ground beef (GB) and strip steaks (SS) were collected on 3 separate occasions from 15 grass-fed beef producers that represented 13 different states, whereas control beef samples were collected from 3 regions (Ohio, South Dakota, and Texas) of the United States on 3 separate occasions. Concentrations of minerals, choline, vitamin B(12), and thiamine were determined for grass-fed beef samples. Grass-fed GB samples had less Mg, P, and K (P < 0.05), and more Na, Zn, and vitamin B(12) (P < 0.05) than SS samples. Fat color, marbling, and pH were assessed for grass-fed and control SS. Subjective evaluation of the SS indicated that grass-fed beef had fat that was more yellow in color than control beef. Percentages of total fat, total cholesterol, and fatty acids along with trans fatty acids and CLA were determined for grass-fed and control SS and GB. Grass-fed SS had less total fat than control SS (P = 0.001), but both grass-fed and control SS were considered lean, because their total fat content was 4.3% or less. For both GB and SS, grass-fed beef had significantly less (P = 0.001 and P = 0.023, respectively) content of MUFA and a greater content of SFA, n-3 fatty acids, CLA, and trans-vaccenic acid than did the control samples. Concentrations of PUFA, trans fatty acids, n-6 fatty acids, and cholesterol did not differ between grass-fed and control ground beef. Trans-vaccenic acid (trans-11 18:1) made up the greatest concentration of the total trans fats in grass-fed beef, whereas CLA accounted for approximately 15% of the total trans fats. Although the fatty acid composition of grass-fed and conventionally fed beef was different, conclusions on the possible effects of these differences on human
Directory of Open Access Journals (Sweden)
Nova Nayarit-Ballesteros
2016-05-01
Full Text Available Objective. To determine the serotype and antibiotic resistance profile of Salmonella spp. isolated from retail ground beef in Mexico City. Materials and methods. A total of 100 samples of ground beef were analyzed. The pathogen was isolated by conventional methods and confirmed by PCR (invA gene, 284 bp. The antibiotic resistance profile was determined by the Kirby-Bauer method while serotyping was performed according to the Kauffman-White scheme. Results. We isolated a total of 19 strains of Lomita (6, Derby (4, Senftenberg (2, Javiana and Cannsttat (1 and undeter- mined (5 serotypes. The strains showed a high resistance rate to ampicillin (18/19, carbenicillin (16/19, tetracyclin (13/19, and trimethoprim-sulfamethoxazole (13/19. Multidrug resistance was observed in 14 isolates. Conclusions. Several Salmonella spp. serotypes of public health significance are circulating in ground beef sold in the major Mexican city. Some of these strains are multi-drug resistance.
The effects of feeding broiler litter on microbial contamination of beef carcasses
Energy Technology Data Exchange (ETDEWEB)
Davis, J.R.; Apple, J.K.; Hellwig, D.H.; Kegley, E.B.; Pohlman, F.W. [University of Arkansas, Fayetteville, AR (United States). Department of Animal Science
2002-09-01
Two experiments were conducted to test the effects of feeding broiler litter, either directly in the diet or indirectly through pasture-fertilization, to beef cattle on the incidence of Salmonella typhimurium (S) and Escherichia coli O157:H7 (EC) contamination of carcasses and ground beef. In Experiment 1, beef cows (n=32) were allotted either ad libitum access to grass hay or a formulated diet (80% deep-stacked broiler litter and 20% corn). In Experiment 2, beef cows (n=32) were assigned to graze on pastures fertilized with a commercial fertilizer or fresh broiler litter. Cows in Experiment 1 were harvested following a 56-d feeding period; whereas, cows in Experiment 2 were harvested after 5, 10, 20, and 40 d of grazing pastures. All samples of muscle, purge, and ground beef were culture-negative for S and EC, suggesting that beef cattle may consume properly handled deep-stacked broiler litter, or pastures fertilized with fresh litter, without increasing the likelihood of carcass/meat contamination with S and (or) EC. (author)
International Nuclear Information System (INIS)
Arnold, O.
1975-01-01
In this paper some aspects are being considered, in as far as they can contribute to a better understanding of uranium as a raw material and an energy carrier, and as they can indicate the possible ways and means open to the German Federal Republic for securing this highly desirable raw material, without becoming even more dependent on the economic and political views of the producing countries, than it is the case in respect of oil. (orig.) [de
Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D
2008-10-01
The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.
IceBridge GPS L0 Raw Satellite Navigation Data
National Aeronautics and Space Administration — The NASA IceBridge GPS L0 Raw Satellite Navigation Data (IPUTG0) data set contains GPS readings, including latitude, longitude, track, ground speed, off distance,...
Corned Beef: an Enigmatic Irish Dish
Mac Con Iomaire, Máirtín; Gallagher, Pádraic Óg
2011-01-01
Corned beef and cabbage, which is consumed in America in large quantities each Saint Patrick’s Day (17th March), is considered by most Americans to be the ultimate Irish dish. However, corned beef and cabbage is seldom eaten in modern day Ireland. It is widely reported that Irish immigrants replaced their beloved bacon and cabbage with corned beef and cabbage when they arrived in America, drawing on the corned beef supplied by their neighbouring Jewish butchers, but not all commentators beli...
Nutrient Composition of Retail Samples of Australian Beef Sausages
Directory of Open Access Journals (Sweden)
Judy Cunningham
2015-11-01
Full Text Available Some nutrient data for beef sausages in Australia’s food composition table, NUTTAB 2010, is over 25 years old and may no longer reflect the composition of this popular food. To update this, 41 retail samples of fresh beef sausages were purchased in Melbourne, Australia, in May 2015. Each purchase was analysed, uncooked, for moisture, protein and fat. Sausages were then grouped by fat content into one of three composites and analysed for a wide range of nutrients, before and after dry heat cooking, the most popular sausage cooking method. Fat content in raw sausages averaged 14.9 g/100 g, 30% lower than NUTTAB values, varying from 7.3 to 22.6 g/100 g. This indicates it is possible to formulate leaner sausages that meet consumer expectations and may qualify for certain nutrition labelling statements. Under current Australian labelling requirements, two low fat sausages contain sufficient protein, B12, niacin, phosphorus and zinc to qualify as a good source of these nutrients and sufficient iron, selenium and vitamin A to qualify as a source of these. Sodium levels are higher than fresh beef, ranging from 680 to 840 mg/100 g. These data will be used to update NUTTAB and support product labelling and consumer education.
Vismeh, Ramin; Haddad, Diane; Moore, Janette; Nielson, Chandra; Bals, Bryan; Campbell, Tim; Julian, Allen; Teymouri, Farzaneh; Jones, A Daniel; Bringi, Venkataraman
2018-01-10
Acetamide has been classified as a possible human carcinogen, but uncertainties exist about its levels in foods. This report presents evidence that thermal decomposition of N-acetylated sugars and amino acids in heated gas chromatograph injectors contributes to artifactual acetamide in milk and beef. An alternative gas chromatography/mass spectrometry protocol based on derivatization of acetamide with 9-xanthydrol was optimized and shown to be free of artifactual acetamide formation. The protocol was validated using a surrogate analyte approach based on d 3 -acetamide and applied to analyze 23 pasteurized whole milk, 44 raw sirloin beef, and raw milk samples from 14 different cows, and yielded levels about 10-fold lower than those obtained by direct injection without derivatization. The xanthydrol derivatization procedure detected acetamide in every food sample tested at 390 ± 60 ppb in milk, 400 ± 80 ppb in beef, and 39 000 ± 9000 ppb in roasted coffee beans.
Minerals Concentration and Textural Properties of Romanian Beef Row and Cooked Meat and Offal
Directory of Open Access Journals (Sweden)
Liliana Tudoreanu
2013-11-01
Full Text Available Introduction: Consumers preferences for solid food are, for the majority of foods groups, influenced by their textural properties. Romanian traditional cuisine is rich in meat foods and therefore this food group has an important contribution to the total mineral intake as well as the ingestion of potentially toxic metals such as Cd and Pb. Although beef liver is an important source of minerals for human consumption, its concentrations in Cd and Pb and heterogeneous textural properties may hinder its acceptability. Aims: The purpose of the work was to estimate raw and cooked beef meat and offal mineral quality including Cd and Pb concentrations and their contribution to a balanced human diet and health as well as the influenced of thermal preparation on their mineral and textural properties. Materials and methods: Beef liver, kidney and longissimus dorsi muscle were bought from local markets. Thermal preparation was conducted by microwave and boiling with no water contact. Texture profile analyses was conducted for quantifying textural properties such as Hardness, Cohesiveness, Springiness, Springiness Index, Chewiness, Adhesiveness and Stiffness. The mineral concentrations of the raw and cooked samples were analyzed by ICP-MS. Conclusion: The offal textural parameters variability was very large within the same organ and compared to the muscle textural parameters variability too. Muscle and offal thermal preparation strongly influenced their minerals’ concentrations as well as their textural properties. Thermal preparation significantly decreased beef liver and kidney samples’ total K and Na concentrations. It is suggested that for improving beef liver acceptability, the consumer has to be advised on the influence of the thermal preparation on beef liver parts’ textural properties as well as minerals concentrations.
Directory of Open Access Journals (Sweden)
Benjamin Goldstein
Full Text Available The food demands of the United States (US impart significant environmental pressures. The high rate of consumption of beef has been shown to be the largest driver of food-borne greenhouse gas emissions, water use and land occupation in the US diet. The environmental benefits of substituting animal products with vegetal foods are well documented, but significant psychological barriers persist in reducing meat consumption. Here we use life cycle assessment to appraise the environmental performance of a novel vegetal protein source in the mean US diet where it replaces ground beef, and in vegetarian and vegan diets where it substitutes for legumes, tofu and other protein sources. We find that relative to the mean US diet, vegetarian and vegan diets significantly reduce per-capita food-borne greenhouse gas emission (32% and 67%, respectively, blue water use (70% and 75%, respectively and land occupation (70% and 79%, respectively, primarily in the form of rangeland. The substitution of 10%, 25% and 50% of ground beef with plant-based burger (PBB at the national scale results in substantial reductions in annual US dietary greenhouse gas emissions (4.55-45.42 Mt CO2 equivalents, water consumption (1.30-12.00 km3 and land occupation (22300-190100 km2. Despite PBB's elevated environmental pressures compared to other vegetal protein sources, we demonstrate that minimal risk exists for the disservices of PBB substitution in non-meat diets to outweigh the benefits of ground-beef substitution in the omnivorous American diet. Demand for plant-based oils in PBB production has the potential to increase land use pressures in biodiversity hotspots, though these could be obviated through responsible land stewardship. Although the apparent environmental benefits of the PBB are contingent on actual uptake of the product, this study demonstrates the potential for non-traditional protein substitutes to play a role in a transition towards more sustainable consumption
Directory of Open Access Journals (Sweden)
Sephora Baugreet
2018-01-01
Full Text Available Restructured beef steaks were formulated by adding protein-rich ingredients (pea protein isolate (PPI, rice protein (RP, and lentil flour (LF (at 4 and 8%, phosphate (0.2%, and two binding agents: 1% (TG and 0.15% (TS. The effects of their addition on the physicochemical properties of the beef steaks were investigated. Protein content of the RP8TG sample was significantly higher than that of the control in both the raw and cooked state. Raw LF4TS exhibited greater (P<0.01 a∗ values than the control; however, after the cooking process, L∗, a∗, and b∗ values were similar for all treatments. Textural assessment showed that elevating protein level increased (P<0.001 hardness, chewiness, cohesiveness, and gumminess in cooked restructured steaks. LF addition reduced all textural values assessed, indicating a strong plant protein effect on texture modification. The commercial binder produced a better bind in combination with protein ingredients. This facilitated the production of uniformed restructured beef steaks from low-value beef muscles with acceptable quality parameters using a novel process technology.
CSIR Research Space (South Africa)
Joseph, S
2010-01-01
Full Text Available in the permeability of the membrane and HO H3C H3C H2C H2C HO OH NH NH OH O OC C n O O O O Fig. 4 Structure of Chitin Raw and Renewable Polymers promoting internal osmotic imbalances. This results in leaching of electrolytes and proteins. 2... is often lost. In most cases this denaturation is not reversible. R-CH-COOH NH2 w Amino acid H2N COOHR a Amino acid Fig. 5 Structure of amino acid Raw and Renewable Polymers The solubilities of proteins vary considerably based on compositions...
Directory of Open Access Journals (Sweden)
Hossein Dabiri
2014-05-01
Full Text Available Background: To study prevalence of Campylobacter spp. in chicken and beef meat, and determine the drug susceptibility of strains, 450 samples in Tehran, Iran were investigated. Objectives: This study aimed to determine the prevalence and the antimicrobial resistance of entropathogenic Campylobacter strains ,especially C. jejuni isolated from raw chicken and beef meat in Tehran- Iran. Materials and Methods: Out of 250 chickens and 200 beef meats, 121(26.8 % contaminated cases with Campylobacter strains were isolated. Campylobacter was isolated from a significantly larger number of chickens (44% than beef meats (5.5 % (P < 0.05. Results: From all isolated Campylobacter organisms, 93 (76.8% species were identified as C. jejuni and 28 cases (23.1% as C. coli. Susceptibilities of 121 strains (93 C. jejuni and 28 C. coli were determined against 12 antimicrobial drugs using the disk agar diffusion method. Resistance to nalidixic acid (75% and ciprofloxacin (50% was an alarming finding, moreover, 32.6% of isolates was resistant to tetracycline, 10.8% to ampicillin, 29.3% to colisitin and 26.1% to amoxicillin. The highest sensitivity was seen to erythromycin (95 % and gentamicin (96%. Conclusions: These results showed that a high proportion of chicken and beef meat in Iran is contaminated with Campylobacter, particularly with Campylobacter jejuni. The high rate of contamination, especially chicken is a significant public health concern. Most of the isolates were resistant; therefore, human infection with Campylobacter spp. via consumption of these products is possible.
SAR Raw Data Generation for Complex Airport Scenes
Directory of Open Access Journals (Sweden)
Jia Li
2014-10-01
Full Text Available The method of generating the SAR raw data of complex airport scenes is studied in this paper. A formulation of the SAR raw signal model of airport scenes is given. Via generating the echoes from the background, aircrafts and buildings, respectively, the SAR raw data of the unified SAR imaging geometry is obtained from their vector additions. The multipath scattering and the shadowing between the background and different ground covers of standing airplanes and buildings are analyzed. Based on the scattering characteristics, coupling scattering models and SAR raw data models of different targets are given, respectively. A procedure is given to generate the SAR raw data of airport scenes. The SAR images from the simulated raw data demonstrate the validity of the proposed method.
Centers for Disease Control (CDC) Podcasts
2013-08-05
Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters. Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID). Date Released: 8/7/2013.
Environmental impacts of beef production
Gerber, P.J.; Mottet, Anne; Opio, C.I.; Falcucci, Alessandra; Teillard, Félix
2015-01-01
Beef makes a substantial contribution to food security, providing protein, energy and also essential micro-nutrients to human populations. Rumination allows cattle - and other ruminant species - to digest fibrous feeds that cannot be directly consumed by humans and thus to make a net positive
Bunyaratvej, Sukhum; Unpunyo, Piyapong; Pongtippan, Atcharaporn
2007-10-01
Human intestinal sarcocystosis is a zoonotic disease caused by two coccidians, i.e. Sarcocystis fusiformis (syn. S. bovihominis, S. hominis) due to consumption of raw infected beef and Sarcocystis meischeriana (syn. S. suihominis) due to consumption of infected raw pork. In 1987, survey of the macroscopic S. fusiformis cysts in market beef mainly from old water buffalos aged more than 15 years were commonly observed in Bangkok. In 2005, the macroscopic cyst was no longer seen in beef of cattle and water buffalo aged less than three years. The epidemiological investigation of Sarcocystis spp. infected meat in Bangkok and Lampang. Samples for each of the tongue and beef of cattle and water buffalo, pork from Bangkok markets and pork of domestic swine from some remote villages in various subprovinces (Ampurs) in Lampang were obtained for microscopic examination by H and E and selectively by PAS staining. The microscopic S. fusiformis cysts were seen in all five specimens of tongues and ten specimens of muscles of cattle and water buffalo obtained from fresh-food markets in Bangkok. Ten samples of pork from Bangkok markets revealed no coccidian infection. The microscopic S. meischeriana cysts were seen in three specimens of swine muscles collected from two subprovinces in Lampang. The present merozoites in coccidian cysts retrieved from beef and pork are similar to those previously observed in human intestine. This may histologically indicate an invasive sarcocystosis by both species leading to a condition presently known as chronic inflammation of undetermined etiology in man.
Van Donkersgoed, J; Jewison, G; Mann, M; Cherry, B; Altwasser, B; Lower, R; Wiggins, K; Dejonge, R; Thorlakson, B; Moss, E; Mills, C; Grogan, H
1997-01-01
aged. Based on January 1996 prices, the economic analysis showed that the Canadian beef industry lost $70.52 per head or $189.6 million annually from quality nonconformities. Methods identified to reduce these nonconformities included improvements in management, animal identification, handling, genetic selection, marketing, grading, and information transfer. PMID:9105719
Energy Technology Data Exchange (ETDEWEB)
Jakabi, M.; Gelli, D. S.; Ristori, C. A.; De Paula, A. M.R.; Sakuma, H.; Lopez, G. I.S. [Seção de Microbiologia Alimentar (Brazil); Fernandes, S. A. [Seção de Bacteriologia Médica (Brazil); Luchesi, R. B. [Seção de Meios de Cultura (Brazil); Instituto Adolfo Lutz, São Paulo (Brazil)
2005-01-15
A total of 253 samples of raw meat (bovine, swine and poultry) were collected in local supermarkets in Sao Paulo, Brazil, and analysed for Salmonella and E. coli 0157:H7, in order to determine their microbiological quality and compliance with the established standards for these two bacteria. Additionally, samples of ground beef were artificially contaminated with S. enteritidis and E. coli 0157:H7, in order to determine the effect of refrigeration and freezing temperature during the storage period (4ºC for 5 days, and - 18ºC for 90 days, respectively). Twenty-three samples (9.1%) were positive to Salmonella and seven different serotypes were isolated, S. enteritidis being the most common serotype founded (34,8%). The results of the artificially contaminated samples showed that E. coli 0157:H7 was sensitive to refrigeration as well as freezing temperature. S. enteritidis was only affected by freezing temperature during the storage time. (author)
Consumer perception of Brazilian traced beef
Directory of Open Access Journals (Sweden)
Júlio Otávio Jardim Barcellos
2012-03-01
Full Text Available The objective of this study was to determine consumers understanding of beef traceability, identifying how consumers value this meat and traceability elements to be presented on retail shelves. The method used in this study was a survey through the internet applying the Sphinx software. The sample consisted of 417 consumers, mostly living in Porto Alegre, Brazil. Consumers are aware of certified beef, consider it important, but this is not a demand. As to traced beef, most consumers (62.4% are in favor of mandatory traceability of beef cattle in Brazil, but 86.6% disagree with the destination of traced beef only to the foreign market. The majority of people are willing to pay more for traced beef and consider traceability a market opportunity, used as a differentiating tool.
Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A
2010-11-01
The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.
Strategic raw materials. Risk management
International Nuclear Information System (INIS)
Bertau, Martin; Matschullat, Joerg; Kausch, Peter
2014-01-01
This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de
Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert
2006-11-01
The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.
High Sierra Beef Progress Update
Ingram, Roger
2004-01-01
Research similar efforts in other regions Research was completed on similar efforts in other regions. There are over 300 grass-fed beef marketing operations across the United States. Here in California, there are approximately 10. Most are selling approximately 50-60 head per year. This appears to be a marketing limit for those who produce, process, market and distribute on their own. Additional labor and space requirements for marketing, storage for dry-aging, and distribution appea...
DEFF Research Database (Denmark)
Wilson, Alexander
2014-01-01
, and a contemporary zeitgeist marked by a general relativisation of aesthetic values has emerged, exploding into a plethora of parallel discourses on art. Perhaps there is no longer such a thing (if there ever was) as Culture with a capital C, which Dubuffet so vehemently opposed in his championing of art brut......’s adolescence without hypostatizing distinctions between inside and outside, or between culture and its raw or primitive origins, while nevertheless not conflating the dissolution of boundaries and hierarchies with a possible end to territoriality and control, nor promoting a resignation of thought...
Directory of Open Access Journals (Sweden)
Naim Deniz Ayaz
2016-08-01
Full Text Available Background: Staphylococcus aureus and Shiga toxin producing Escherichia coli O157:H7 (EHEC are significant foodborne pathogens worldwide. While S. aureus can cause mild superficial skin infections or life-threatening bacteremia and endocarditis, as well as toxininduced cases such as toxic shock syndrome; E. coli O157:H7 can cause symptoms from mild diarrhea to severe hemorrhagic colitis (HC, hemolytic uremic syndrome (HUS, thrombotic thrombocytopenic purpura (TTP. Objectives: The objectives of this study were to find out the prevalence and seasonal distribution of S. aureus in 214 frozen raw meat (turkey, chicken and beef and the prevalence of E. coli O157:H7 in 70 raw beef with the characterization of the E. coli O157:H7 isolate by multiplex polymerase chain reaction (PCR. Materials and Methods: For the detection of S. aureus, a total of 214 frozen raw meat samples including 74 turkey meat, 70 chicken meat and 70 beef cuts (approximately 2 × 3 cm cubic parts; and for the detection of E. coli O157:H7, a total of 70 frozen raw beef samples that all were produced from national companies and consumed in Ağrı, Turkey were analyzed. Results: Out of 214 meat samples, 25.7 % (18/70 of the beef, 11.4 % (8/74 of the chicken meat, and 5.4 % (4/70 of the turkey meat samples were contaminated with S. aureus. Out of 70 frozen raw beef samples, only 1 (1.4% was identified as both Shiga toxin 1 and 2producing E. coli O157:H7 by the detection of stx1, stx2, eaeA, hly, and fliCh7 according to multiplex PCR analysis. Conclusion: Our findings demonstrate that occurrence frequency of S. aureus was higher in frozen raw beef than in raw chicken and turkey meat samples. Although the prevalence of E. coli O157:H7 was low in beef, the presence of virulence genes, especially toxin genesrema in a significant public health concern.
Variables affecting the propensity to buy branded beef among groups of Australian beef buyers.
Morales, L Emilio; Griffith, Garry; Wright, Victor; Fleming, Euan; Umberger, Wendy; Hoang, Nam
2013-06-01
Australian beef consumers have different preferences given their characteristics and the effect on expected quality of cues related to health, production process and eating experience. Beef brands using Meat Standards Australia (MSA) grades can help to signal quality and reduce consumers' uncertainty when shopping. The objective of this study is to identify the characteristics of beef buyers and their perceptions about product attributes that affect the propensity to buy branded beef. Binary logistic models were applied identifying differences between all respondents and the potential target market, including buyers in medium to high income segments, and between buyers in the target market who would buy branded beef for taste and health reasons. Variables increasing the propensity to buy branded beef include previous experience, appreciation for branded cuts and concern about quality more than size. Finally, variations in preferences for marbling and cut were found between buyers who would buy branded beef for taste and health reasons. Copyright © 2013 Elsevier Ltd. All rights reserved.
9 CFR 319.81 - Roast beef parboiled and steam roasted.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Roast beef parboiled and steam roasted... beef parboiled and steam roasted. “Roast Beef Parboiled and Steam Roasted” shall be prepared so that... “Roast Beef Parboiled and Steam Roasted.” When beef cheek meat, beef head meat, or beef heart meat is...
An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.
Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar
2016-11-01
Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.
Antimicrobial resistance issues in beef production
Antimicrobial resistance threats to human health as identified have been recognized as a critical global public health concern. Linkage of some threats to beef production is discussed. The relevance to beef production of recent government actions will be examined. Prominent antimicrobial resistance ...
People on the Farm: Raising Beef Cattle.
Crain, Robert L.
This booklet provides information on raising beef cattle through profiles of two families, the Ritschards of Colorado and the Schuttes of Missouri. Through descriptions of daily life for these families, the booklet discusses the way of life on modern beef cattle farms and the problems and decisions faced by farmers. The booklet explains how…
Directory of Open Access Journals (Sweden)
Éberson de Castilho Barnabé
2007-04-01
Full Text Available O objetivo deste trabalho foi avaliar a combinação de fontes de energia e proteína com diferentes degradabilidades ruminais. Foram utilizadas quatro vacas multíparas (23 kg leite dia-1 em Quadrado Latino 4 x 4 com arranjo fatorial 2 x 2: duas fontes de proteína (soja crua ou tostada e duas de energia (milho moído, grosso oufloculado. O tratamento com milho moído grosso e soja tostada resultou em maior consumo de matéria seca (p 0,05 o desempenho lactacional. A tostagem da soja e a floculação do milho diminuíram (p The objective of this trial was the evaluation of ruminal degradation synchrony of protein and energy sources. Four Holstein cows (23 kg day-1 were used in a 4 x 4 Latin Square design and 2 x 2 factorial arrangement: two protein (raw vs. roasted soybeans with two energy sources (coarsely ground vs. steam-flaked corn. Dry matter intake was higher for cows fed coarsely ground corn with roasted soybean (p 0.05. Rumen pH was not affected by treatments (p > 0.05. Both roasted soybeans and flaking of corn decreased rumen ammonia nitrogen (p < 0.01. Animal fed steamflaked corn tended showed higher total VFA molar concentrations (p = 0.10, but there were no treatments effect on ruminal pH. A higher (p = 0.06 ruminal starch digestibility was observed for raw soybean treatment.
Anaerobic digestibility of beef hooves with swine manure or slaughterhouse sludge.
Xia, Yun; Wang, Ding-Kang; Kong, Yunhong; Ungerfeld, Emilio M; Seviour, Robert; Massé, Daniel I
2015-04-01
Anaerobic digestion is an effective method for treating animal by-products, generating at the same time green energy as methane (CH4). However, the methods and mechanisms involved in anaerobic digestion of α-keratin wastes like hair, nails, horns and hooves are still not clear. In this study we investigated the feasibility of anaerobically co-digesting ground beef hooves in the presence of swine manure or slaughterhouse sludge at 25 °C using eight 42-L Plexiglas lab-scale digesters. Our results showed addition of beef hooves statistically significantly increased the rate of CH4 production with swine manure, but only increased it slightly with slaughterhouse sludge. After 90-day digestion, 73% of beef hoof material added to the swine manure-inoculated digesters had been converted into CH4, which was significantly higher than the 45% level achieved in the slaughterhouse sludge inoculated digesters. BODIPY-Fluorescent casein staining detected proteolytic bacteria in all digesters with and without added beef hooves, and their relative abundances corresponded to the rate of methanogenesis of the digesters with the different inocula. Fluorescence in situ hybridization in combination with BODIPY-Fluorescent casein staining identified most proteolytic bacteria as members of genus Alkaliphilus in the subfamily Clostridiaceae 2 of family Clostridiaceae. They thus appear to be the bacteria mainly responsible for digestion of beef hooves. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.
Authentication of beef versus horse meat using 60 MHz 1H NMR spectroscopy
Jakes, W.; Gerdova, A.; Defernez, M.; Watson, A.D.; McCallum, C.; Limer, E.; Colquhoun, I.J.; Williamson, D.C.; Kemsley, E.K.
2015-01-01
This work reports a candidate screening protocol to distinguish beef from horse meat based upon comparison of triglyceride signatures obtained by 60 MHz 1H NMR spectroscopy. Using a simple chloroform-based extraction, we obtained classic low-field triglyceride spectra from typically a 10 min acquisition time. Peak integration was sufficient to differentiate samples of fresh beef (76 extractions) and horse (62 extractions) using Naïve Bayes classification. Principal component analysis gave a two-dimensional “authentic” beef region (p = 0.001) against which further spectra could be compared. This model was challenged using a subset of 23 freeze–thawed training samples. The outcomes indicated that storing samples by freezing does not adversely affect the analysis. Of a further collection of extractions from previously unseen samples, 90/91 beef spectra were classified as authentic, and 16/16 horse spectra as non-authentic. We conclude that 60 MHz 1H NMR represents a feasible high-throughput approach for screening raw meat. PMID:25577043
Authentication of beef versus horse meat using 60 MHz 1H NMR spectroscopy.
Jakes, W; Gerdova, A; Defernez, M; Watson, A D; McCallum, C; Limer, E; Colquhoun, I J; Williamson, D C; Kemsley, E K
2015-05-15
This work reports a candidate screening protocol to distinguish beef from horse meat based upon comparison of triglyceride signatures obtained by 60 MHz (1)H NMR spectroscopy. Using a simple chloroform-based extraction, we obtained classic low-field triglyceride spectra from typically a 10 min acquisition time. Peak integration was sufficient to differentiate samples of fresh beef (76 extractions) and horse (62 extractions) using Naïve Bayes classification. Principal component analysis gave a two-dimensional "authentic" beef region (p=0.001) against which further spectra could be compared. This model was challenged using a subset of 23 freeze-thawed training samples. The outcomes indicated that storing samples by freezing does not adversely affect the analysis. Of a further collection of extractions from previously unseen samples, 90/91 beef spectra were classified as authentic, and 16/16 horse spectra as non-authentic. We conclude that 60 MHz (1)H NMR represents a feasible high-throughput approach for screening raw meat. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
European consumers' acceptance of beef processing technologies
DEFF Research Database (Denmark)
de Barcellos, Marcia Dutra; Kügler, Jens Oliver; Grunert, Klaus G.
2010-01-01
The use of new technologies in beef production chains may affect consumers' opinion of meat products. A qualitative study was performed to investigate consumers' acceptance of seven beef processing technologies: marinating by injection aiming for increased 1) healthiness; 2) safety; and 3) eating...... adults (19-60 years old) participated in eight focus groups in Spain, France, Germany and the UK. Results suggested a relationship between acceptance of new beef products, technology familiarity and perceived risks related to its application. Excessive manipulation and fear of moving away from 'natural......' beef were considered negative outcomes of technological innovations. Beef processing technologies were predominantly perceived as valuable options for convenience shoppers and less demanding consumers. Overall, respondents supported the development of 'non-invasive' technologies that were able...
The beef market in the European Union
DEFF Research Database (Denmark)
Nielsen, Niels Asger
small with the largest slaughtering company slaughtering only 3% of the total. 9. Relations between industry (slaughterhouses) and farmers tend to be much looser in the beef market than it is in other agricultural markets, eg the milk market. Cattle markets are still quite important although the share......'s share of total meat consumption 3. As a consequence of the consumers' demand for convenient shopping, butcher's share of total beef sales is rapidly decreasing in Europe. 4. Changes in meat consumption have traditionally been explained by relative price and per capita income, but these economic demand...... analyses can explain a rapidly decreasing share of the variation in beef consumption. 5. Studies show that beef consumption tends to increase with age; the heavy users are found among middle-aged men. Beef consumption also increases with income and social class. 6. The most important user-oriented quality...
QUALITY MANAGEMENT IN ECOLOGICAL BEEF PRODUCTION
Directory of Open Access Journals (Sweden)
Cornelia Petroman
2012-09-01
Full Text Available Producing high quality beef asks for the implementation of a performing management of raising cattle ecologically. The main ways of improving beef quality management have a technical nature: sustaina ble grazing management to conserve floral diversity and to obtain ecological beef and rational distribution of the cattle over the grassland to facilitate vegetation recovery and to avoid the setting of invasive species. Implementing a sustainable manageme nt of the resources in the neighborhood of animal farms has beneficial effects on beef quality, brings good economic income through the practice of best beef quality management, protects the environment long - term, and reduces infrastructure expenses thus a voiding the risks of meat contamination.
MOET Utility in Beef Production Strategies
Directory of Open Access Journals (Sweden)
Marcel Theodor Paraschivescu
2012-10-01
Full Text Available The paper presents the reason of beef production for human food security and the necessity of special dairy and beefbreeds in order to balance the milk and the meat production in cattle farming. That is a difficult target for manycountries since they don’t dispose of large natural pastures to extensively feed the beef cattle herds. At the same timemany European countries breed only dual purpose cattle breeds. So the idea of intensive farming with beef breeds orcrosses is developed. To speed up this kind of programs Open MOET (Multiple Ovulation Embryo Transfer Farmtechnology is proposed and it is completed with the needed facilities for production and preservation of embryos.Concerning the MOET Farm which confers directly pure bred beef calves, emphases is put on veterinary quarantineand heifer receptors conditioning. Concerning embryo conservation the direct transfer (DT technique isrecommended. Modalities of integrating dairy farms and beef cattle farms are finally discussed as recommendedstrategy for Romanian Agriculture.
Beef traders' and consumers' perceptions on the development of a ...
African Journals Online (AJOL)
Beef traders' and consumers' perceptions on the development of a natural pasture-fed beef (NPB) brand by smallholder cattle producers were investigated. In total, 18 meat traders (five abattoirs and 13 beef retailers) and 155 beef consumers were interviewed using structured questionnaires. All meat traders had the ...
The North Dakota Beef Industry Survey: Implications for Extension
Dahlen, Carl R.; Hadrich, Joleen C.; Lardy, Gregory P.
2014-01-01
A portion of the North Dakota Beef Industry Survey was developed to determine how educational programs can evolve to meet future needs of North Dakota beef producers. Of the 2,500 surveys mailed out to beef producers, 527 responses were completed and returned. Results highlight the level of education of North Dakota beef producers, anticipated use…
9 CFR 319.15 - Miscellaneous beef products.
2010-01-01
..., the amount of such cheek meat shall be limited to 25 percent; and if in excess of natural proportions..., binders, or extenders. Beef cheek meat (trimmed beef cheeks) may be used in the preparation of hamburger... levels of up to 65 ppm may be used as a binder. Beef cheek meat (trimmed beef cheeks) may be used in the...
Space Weather: Where Is The Beef?
Koskinen, H. E. J.
Space weather has become a highly fashionable topic in solar-terrestrial physics. It is perhaps the best tool to popularise the field and it has contributed significantly to the dialogue between solar, magnetospheric, and ionospheric scientist, and also to mu- tual understanding between science and engineering communities. While these are laudable achievements, it is important for the integrity of scientific space weather re- search to recognise the central open questions in the physics of space weather and the progress toward solving them. We still lack sufficient understanding of the solar physics to be able to tell in advance when and where a solar eruption will take place and whether it will turn to a geoeffective event. There is much to do to understand ac- celeration of solar energetic particles and propagation of solar mass ejecta toward the Earth. After more than 40 years of research scientific discussion of energy and plasma transfer through the magnetopause still deals mostly with qualitative issues and the rapid acceleration processes in the magnetosphere are not yet explained in a satisfac- tory way. Also the coupling to the ionosphere and from there to the strong induction effects on ground is another complex of research problems. For space weather science the beef is in the investigation of these and related topics, not in marketing half-useful space weather products to hesitant customers.
Cardiotoxic Effects of Raw Opium.
Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj
2018-01-01
While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.
Cardiotoxic Effects of Raw Opium
Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj
2018-01-01
While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.
Erdawati
2010-10-01
Chitosan nanoparticles were prepared based on the ionic gelation of chitosan with tripolyphosphate anions. The physicochemical properties of the chitosan nanoparticles were determined by FTIR analysis, XRD pattern and TEM. The effects of chitosan nanoparticles treatment on the shelf-life extension of minced beef stored at 20±1° C were studied, including chemical and microbiological,. Results indicated that chitosan nanoparticle treatment reduced the total microbial load of fresh minced beef about 10-fold (from 3.2×104 CFU/g to 5.4×102 CFU/g) before storage and the microbial flora was different with that of raw samples. The wide-spectrum antibacterial property of chitosan against bacteria isolated from minced beef was confirmed, and chitosan concentration of 400 ppm was eventually determined for application in minced beef. Based on microbiological analysis, biochemical indices determination and sensory evaluation, shelf-lives of 2-3 days for control, 4-5 days for nanoparticle chitosan treatment samples, were observed, indicating that chitosan nanoparticle have a great potential for minced beef preservation.
Directory of Open Access Journals (Sweden)
Ediclei Lima do Carmo
Full Text Available Abstract The relevance of consuming raw or undercooked beef in the transmission of toxoplasmosis is unclear due to the high resistance of cattle to infection. However, this possibility needs to be considered in endemic areas, such as the Amazon, where the consumption of beef is frequent. The objective of this study was to determine the frequency of anti-Toxoplasma gondii IgG antibodies in beef cattle slaughtered in the metropolitan region of Belem, Pará state, Brazil. Blood samples were collected from 500 animals of both genders in a licensed slaughterhouse in Belém. Anti-T. gondii IgG antibodies were detected by an indirect immunofluorescence assay (IFA with a cut-off titer of 1:64. Anti-T. gondii antibodies were found in 203 animals (40.6%, with a titer of 64 in 112 animals (55.2%, 128 in 68 animals (33.5%, 256 in 15 animals (7.4%, 512 in 5 animals (2.5%, and 1,024 in 3 animals (1.4%. No significant difference was observed between males and females (p > 0.05. The high frequency of anti-T. gondii antibodies observed in beef cattle slaughtered in Belém indicates that the meat of these animals may be an important source of infection for humans and carnivorous domestic animals when inadequately cooked beef is consumed.
Energy Technology Data Exchange (ETDEWEB)
Teixeira, Leonardo S.G. [Instituto de Quimica, Universidade Federal da Bahia, Campus Universitario de Ondina, 40.170-280, Salvador, Bahia (Brazil); INCT de Energia e Ambiente, Universidade Federal da Bahia, 40.170-280, Salvador, Bahia (Brazil); Couto, Marcelo B.; Filho, Miguel Andrade; Assis, Julio C.R.; Guimaraes, Paulo R.B.; Pontes, Luiz A.M.; Almeida, Selmo Q. [Departamento de Engenharia e Arquitetura, Universidade Salvador - UNIFACS, Av. Cardeal da Silva 132, 40.220-141, Salvador, Bahia (Brazil); Souza, Giancarlos S. [Instituto de Quimica, Universidade Federal da Bahia, Campus Universitario de Ondina, 40.170-280, Salvador, Bahia (Brazil); Teixeira, Josanaide S.R. [Instituto Federal de Educacao Ciencia e Tecnologica da Bahia - IFBAHIA, Rua Emidio de Morais S/N, 40.625-650, Salvador, Bahia (Brazil)
2010-04-15
Tallow is a raw material for biodiesel production that, due to their highly centralized generation in slaughter/processing facilities and historically low prices, may have energy, environmental, and economic advantages that could be exploited. However beef tallow biodiesel have unfavorable properties due the presence of high concentration of saturated fatty esters. One way to overcome these inconveniences is using blending procedures. In this way, blends of beef tallow biodiesel with soybean biodiesel and with conventional mineral diesel fuel were prepared and the quality of the mixtures was monitored with the purpose to study ideal proportions of the fuels. By measurement of the viscosity, density, cold filter plugging point, and flash point, it was demonstrated that tallow biodiesel can be blended with both mineral diesel and soybean biodiesel to improve the characteristics of the blend fuels, over that of the tallow. (author)
Occurrence of Salmonella in retail beef and related meat products in Zaria, Nigeria
DEFF Research Database (Denmark)
Tafida, S.Y.; Kabir, J.; Kwaga, J.K.P.
2013-01-01
Salmonella is among the most important food borne pathogens worldwide contaminating a wide range of animal products including meat products. Human illnesses due to this pathogen are attributed to poor biosecurity in production, improper processing and handling of meat and meat products....... This is more likely where surveillance and regulatory control is weak. There is however limited information on the occurrence of these pathogens in foods in Nigeria. The extent of contamination of retail-beef and related meat products with Salmonellae in Zaria was evaluated. A total of 435 retailed beef...... and related meat products consisting of muscle meat, offal and processed meat products were tested for the presence of Salmonella species. Sample types included raw meat, ‘suya’ (roasted meat), ‘balangu’ (barbequed meat), ‘Kilishi’ (spiced sun dried meat) and ‘dambu’ (shredded fried meat). Samples were...
Beef healthiness and nutritional enhancement in beef as perceived by European consumers
DEFF Research Database (Denmark)
de Barcellos, Marcia Dutra; Kügler, Jens Oliver; van Wezemael, Lynn
Introduction: A trend towards a higher awareness of health with respect to food intake has been noticed during the last years. This makes the concept of health in relation to beef production and consumption a highly relevant research topic. Objective: To investigate beef healthiness and nutritional...... discussions were based on a common topic guide, translated into each language. The guide consisted of several sections, including one designed to elicit information on their opinions about beef healthiness and nutritional enhancement of beef. Results: Consumers associated health with wellbeing, an absence...... of disease and a good quality of life. Healthy beef was associated with a certain bias towards a "romantic view", a concept of the traditional encompassing grass-fed beef, raised outdoors with natural food. A healthy cut of meat was expected to be natural and without additives and hormones that could affect...
A model for 'sustainable' US beef production.
Eshel, Gidon; Shepon, Alon; Shaket, Taga; Cotler, Brett D; Gilutz, Stav; Giddings, Daniel; Raymo, Maureen E; Milo, Ron
2018-01-01
Food production dominates land, water and fertilizer use and is a greenhouse gas source. In the United States, beef production is the main agricultural resource user overall, as well as per kcal or g of protein. Here, we offer a possible, non-unique, definition of 'sustainable' beef as that subsisting exclusively on grass and by-products, and quantify its expected US production as a function of pastureland use. Assuming today's pastureland characteristics, all of the pastureland that US beef currently use can sustainably deliver ≈45% of current production. Rewilding this pastureland's less productive half (≈135 million ha) can still deliver ≈43% of current beef production. In all considered scenarios, the ≈32 million ha of high-quality cropland that beef currently use are reallocated for plant-based food production. These plant items deliver 2- to 20-fold more calories and protein than the replaced beef and increase the delivery of protective nutrients, but deliver no B 12 . Increased deployment of rapid rotational grazing or grassland multi-purposing may increase beef production capacity.
Beef, Real Food for Real People: An Industrial Analysis of the Beef Industry
1992-04-01
poultry . In 1989 Amrericans spent an average of $3.89 per person per week on beef products. Consumer bought $21 billion in beef products in 1989; they...or decreases in price. If the price of beef gets to high, consumers will switch their purchase to another red meat, poultry or seafood. TECHNOLOGY...The beginning of organized labor in meatpacking occurred with the -- •formation of the Amalgamated Meat Cutters and Butcher Workman of North America
European beef consumers' interest in a beef eating-quality guarantee
DEFF Research Database (Denmark)
Verbeke, Wim; Van Wezemael, Lyn; de Barcellos, Marcia Dutra
2010-01-01
and Germany to assess their opinions about beef muscle profiling and their interest in a beef eating-quality guarantee. Findings indicate that both concepts are well accepted by European beef consumers, although not unconditional. Besides acknowledging the opportunity to purchase beef with guaranteed...... tenderness, consumers express some reserve related to the possible upgrading of lower value cuts, too much standardisation, and the fact that tenderness is to some extent subjective. They further require the system to be simple, sufficiently documented and independent-party controlled. The insights obtained...
Directory of Open Access Journals (Sweden)
M. A. Jure
2010-12-01
Full Text Available Escherichia coli productor de toxina Shiga (STEC es un patógeno emergente transmitido por alimentos. Existen numerosos serotipos de STEC asociados a enfermedad en humanos, entre los cuales prevalece el serotipo O157:H7. La carne molida es el principal vehículo de transmisión. En la ciudad de Concepción, provincia de Tucumán, entre setiembre y diciembre de 2004 se diagnosticaron dos casos de síndrome urémico hemolítico (SUH. El objetivo de este trabajo fue detectar, aislar y caracterizar STEC O157 y no-O157 a partir de muestras de carne molida fresca obtenidas en las bocas de expendio. Entre los meses de setiembre y diciembre de 2004 se recolectaron 53 muestras de carne molida fresca en carnicerías de la ciudad de Concepción. Para la detección, el aislamiento y la caracterización de STEC O157:H7 se utilizó la metodología USDA-FSIS 2002. Para la detección de E. coli no-O157 se utilizaron dos técnicas de PCR; para el aislamiento y la caracterización se utilizó una metodología previamente validada en una etapa intralaboratorio. Siete muestras fueron positivas para el gen stx2, de las cuales 4 también fueron positivas para el gen rfbO157. Sin embargo, solo se aisló una cepa de E. coli O157:H7 biotipo C, portadora de los genes eae, stx2 y ehxA. El presente trabajo refleja la importancia de implementar técnicas que permitan detectar este grupo de patógenos emergentes a partir de productos cárnicos.Shiga toxin-producing Escherichia coli is an emerging foodborne pathogen. There are many STEC serotypes associated with human diseases, being the O157:H7 serotype the most prevalent. Ground beef is the main transmission vehicle. In Concepción city, Tucumán Province, between September and December 2004, two hemolytic uremic syndrome (HUS cases were diagnosed. The main objective of this work was to detect, isolate and characterize STEC O157 and non-O157 strains in fresh ground beef. Between September and December 2004, 53 fresh ground
Stable isotope variation as a tool to trace the authenticity of beef
International Nuclear Information System (INIS)
Boner, M.; Foerstel, H.
2004-01-01
Organic beef coming principally from Germany was analysed for the hydrogen, carbon, oxygen, nitrogen and sulfur stable isotopic composition to test the possibility of tracing back the geographical origin. Since there is a well-known pattern of D/H and 18 O/ 16 O in meteoric water and in ground water, there is an existing link to tissue water in the beef. By including the stable isotope ratios of the other elements of life further information is available: soils show different isotope ratios of 15 N/ 14 N and 34 S/ 32 S depending on the geological composition, cultivation and atmospheric sulfur deposition. As organic farming is mainly obliged to use only their produced fodder, that ratio is reflected in the beef as well. Different organic beef samples from various German farms have been collected and analysed over nearly two years. To check the differentiation of foreign beef, samples from Argentina and Chile were also included in the study. The analyses of meat samples indicate that it is possible to trace back the region (e.g. Argentina and Germany) by using isotopes of oxygen and hydrogen. A local geographical differentiation can be done by using the stable isotopes of nitrogen and sulfur, as was demonstrated for three farms in Colonia Bay. An optimal differentiation also depends on the quality of further information (e.g. the season, kind of cattle breeding or the declaration of the local geographical origin). Certainly authenticity of beef is not only linked with the geographical origin but can also reflect the differentiation of organic and conventional farming. The fodder of organic cattle farming consists mainly of C 3 plants and the use of C 4 plants is more usual in conventional cattle farming. A 13 C/ 12 C ratio above -20 permille appears as a limit for organic farming. Increased values have to be controlled based on their authenticity. (orig.)
Juneja, Vijay K; Baker, David A; Thippareddi, H; Snyder, O Peter; Mohr, Tim B
2013-01-01
The ability of Clostridium perfringens to germinate and grow in acidified ground beef as well as in 10 commercially prepared acidified beef, pork, and poultry products was assessed. The pH of ground beef was adjusted with organic vinegar to achieve various pH values between 5.0 and 5.6; the pH of the commercial products ranged from 4.74 to 6.35. Products were inoculated with a three-strain cocktail of C. perfringens spores to achieve ca. 2-log (low) or 4-log (high) inoculum levels, vacuum packaged, and cooled exponentially from 54.4 to 7.2°C for 6, 9, 12, 15, 18, or 21 h to simulate abusive cooling; the U.S. Department of Agriculture, Food Safety and Inspection Service (USDA-FSIS) recommends a cooling time of 6.5 h. Total germinated C. perfringens populations were determined after plating on tryptose-sulfite-cycloserine agar and incubating the plates anaerobically at 37°C for 48 h. In addition, C. perfringens growth from spores was assessed at an isothermal temperature of 44°C. Growth from spores was inhibited in ground beef with a pH of 5.5 or below, even during extended cooling from 54.4 to 7.2°C in 21 h. In ground beef with a pH of 5.6, the growth was >1 log after 18 h of cooling from 54.4 to 7.2°C. However, 15 h of cooling controlled the growth to product with a pH ranging from 4.74 to 5.17, both during exponential abusive cooling periods of up to 21 h and during storage for 21 h at 44°C. While product cooled exponentially from 54.4 to 7.2°C in 15 h or less, the pH 6.35 product supported growth, even after 6 h of cooling from 54.4 to 7.2°C. These challenge tests demonstrate that adjustment of ground beef to pH of 5.5 or less and of barbeque products to pH of 5.63 or less inhibits C. perfringens spore germination and outgrowth during extended cooling periods from 54.4 to 7.2°C up to 15 h. Therefore, safe cooling periods for products with homogeneous, lower pHs can be substantially longer.
Quality of beef burger with addition of wet okara along the storage
Directory of Open Access Journals (Sweden)
Rafaela Bergmann Strada de Oliveira
Full Text Available ABSTRACT Combining the consuming of agricultural residues with satisfying consumers is a challenge that may result in financial income for the frozen meat industries, besides generating products with different nutritional value and satisfactory technological quality. Thus, we aimed at elaborating and assessing the physical, chemical and microbiological characteristics of frozen raw and fried beef hamburgers with addition of okara in its wet form throughout their storage over a period of 120 days. The inclusion of okara was proportional to the reduction in the content of protein, and to the increase of the lipid and moisture amount in the fried and raw formulations. Okara increased the luminosity and dimmed along the storage period. In the raw formulations at zero time lower values for b*, a* were observed when compared to the zero time of the fried hamburgers. This leaded to a light brown color and highlighting the clearing of the color due to the inclusion of okara. The fried hamburgers also featured this clearing, but they were darker brown. Chromaticity was greater with the inclusion of okara and with the passage of time. It can be concluded after 120 days storage the levels of protein, lipid and moisture of the formulations were according to the recommended by the Technical Regulation for Identity and Quality of Hamburgers and comply with the requirements of the Brazilian Law for microbiological standards. The brown colour changed with the inclusion of okara but without alterations in the characteristic colour for beef burguers.
ROMANIAN BEEF AND VEAL MEAT MARKET ANALYSIS
Directory of Open Access Journals (Sweden)
ilvius T. STANCIU
2014-06-01
Full Text Available Current nutritional trends, oriented towards a healthy nutrition, lead to the re-evaluation of the share held by beef in the diet of the population. The demand for beef and veal at European and global market level can represent a significant opportunity to increase domestic producers’ business. Though cattle breeding is a traditional activity for the indigenous population from rural areas, livestock for slaughter have decreased steadily in the last years, thus the domestic market being dependent on imports. Romanian natural potential allows the achievement of sufficient production to meet domestic and export demand for beef, which brings high income for producers. The article proposes a review of the domestic production of beef and veal, their consumption and the origin of products on the domestic market in the European and international context.
Antimicrobial usage and resistance in beef production
Cameron, Andrew; McAllister, Tim A.
2016-01-01
Antimicrobials are critical to contemporary high-intensity beef production. Many different antimicrobials are approved for beef cattle, and are used judiciously for animal welfare, and controversially, to promote growth and feed efficiency. Antimicrobial administration provides a powerful selective pressure that acts on the microbial community, selecting for resistance gene determinants and antimicrobial-resistant bacteria resident in the bovine flora. The bovine microbiota includes many harm...
Hedonic Retail Beef and Pork Product Prices
Parcell, Joseph L.; Schroeder, Ted C.
2007-01-01
Consumer-level hedonic models are estimated to determine factors affecting retail pork and beef meat cuts. Results indicate that brand premium and discount varies across private, national, and store brands and that brand premium varies across meat cuts carrying the same brand name. Product size discounts are linear for beef and nonlinear for pork, meat items on sale are significantly discounted to non-sale items, specialty stores typically will not garner higher prices than supermarket/grocer...
Salmonella in beef and produce from honduras.
Maradiaga, Martha; Miller, Mark F; Thompson, Leslie; Pond, Ansen; Gragg, Sara E; Echeverry, Alejandro; Garcia, Lyda G; Loneragan, Guy H; Brashears, Mindy M
2015-03-01
Salmonella continues to cause a considerable number of foodborne illnesses worldwide. The sources of outbreaks include contaminated meat and produce. The purpose of this study was to establish an initial investigation of the burden of Salmonella in produce and beef from Honduras by sampling retail markets and abattoirs. Retail produce samples (cantaloupes, cilantro, cucumbers, leafy greens, peppers, and tomatoes; n = 573) were purchased in three major cities of Honduras, and retail whole-muscle beef (n = 555) samples were also purchased in four major cities. Additionally, both hide and beef carcass (n = 141) samples were collected from two Honduran abattoirs. Whole-muscle beef samples were obtained using a sponge hydrated with buffered peptone water, and 10 ml of the buffered peptone water rinsate of each produce sample was collected with a dry sponge and placed in a bag to be transported back to the United States. Salmonella was detected using a commercially available, closeplatform PCR system, and positive samples were subjected to culture on selective media to obtain isolates. Overall, the prevalence of Salmonella-positive samples, based on PCR detection in Honduras (n = 555) retail beef was 10.1% (95% confidence interval = 7.8, 12.9), whereas 7.8% (n = 141) of beef carcass and hides samples were positive in both beef plants. The overall Salmonella prevalence for all produce samples (n = 573) collected was 2.1% (95% confidence interval = 1.2, 3.6). The most common serotypes identified in Honduras were Salmonella Typhimurium followed by Derby. These results provide an indication of Salmonella contamination of beef and produce in Honduras. Developing a Salmonella baseline for Latin America through an initial investigation like the one presented here contributes to a broader global understanding of the potential exposure through food, thus providing insight into the needs for control strategies.
DEFF Research Database (Denmark)
Duffy, Sarah K.; O'Doherty, John V.; Rajauria, Gaurav
2018-01-01
This study investigates dietary fortification of heifer feeds with cholecalciferol and ergocalciferol sources and effects on beef total vitamin D activity, vitamer, respective 25-hydroxymetabolite contents, and meat quality. Thirty heifers were allocated to one of three dietary treatments [(1......) basal diet + 4000 IU of vitamin D3 (Vit D3); (2) basal diet + 4000 IU of vitamin D2 (Vit D2); and (3) basal diet + 4000 IU of vitamin D2-enriched mushrooms (Mushroom D2)] for a 30 day pre-slaughter period. Supplementation of heifer diets with Vit D3 yielded higher (p ...) total vitamin D activity (by 38–56%; p vitamin D source, carcass characteristics, sensory and meat quality parameter were unaffected (p > 0.05) by the dietary...
Creep feeding nursing beef calves.
Lardy, Gregory P; Maddock, Travis D
2007-03-01
Creep feeding can be used to increase calf weaning weights. However, the gain efficiency of free-choice, energy-based creep feeds is relatively poor. Generally, limit-feeding, high-protein creep feeds are more efficient, and gains may be similar to those produced by creep feeds offered free choice. Creep feeding can increase total organic matter intake and improve the overall energy status of the animal. Creep-fed calves tend to acclimate to the feedlot more smoothly than unsupplemented calves. Furthermore, provision of a high-starch creep feed may have a positive influence on subsequent carcass quality traits. Creep feeding can be applied to numerous environmental situations to maximize calf performance; however, beef cattle producers should consider their individual situations carefully before making the decision to creep feed.
Köppel, René; Eugster, Albert; Ruf, Jürg; Rentsch, Jürg
2012-01-01
The quantification of meat proportions in raw and boiled sausage according to the recipe was evaluated using three different calibrators. To measure the DNA contents from beef, pork, sheep (mutton), and horse, a tetraplex real-time PCR method was applied. Nineteen laboratories analyzed four meat products each made of different proportions of beef, pork, sheep, and horse meat. Three kinds of calibrators were used: raw and boiled sausages of known proportions ranging from 1 to 55% of meat, and a dilution series of DNA from muscle tissue. In general, results generated using calibration sausages were more accurate than those resulting from the use of DNA from muscle tissue, and exhibited smaller measurement uncertainties. Although differences between uses of raw and boiled calibration sausages were small, the most precise and accurate results were obtained by calibration with fine-textured boiled reference sausages.
DEMAND FOR BEEF IN THE PROVINCE OF YOGYAKARTA
Directory of Open Access Journals (Sweden)
Sulistiya
2014-07-01
Full Text Available RACT Protein consumption level of society in Yogyakarta Province has yet to meet the target, but the beef is a source of animal protein that is easily obtainable. Therefore, research on the analysis of demand for beef in this province needs to be done. Objective: (1 Determine the factors that affect the demand for beef in Yogyakarta. (2 Determine the own price elasticity and income elasticity of demand for beef in this province, and to know the cross-price elasticity of demand for beef to changes in the price of mutton, chicken, rice, and cooking oil. Metode: descriptive statistics, followed by inductive statistics , and hypothesis testing. The data used are primary and secondary data. Data were analyzed by multiple linear regression with the value of t and F tests, and analysis of the coefficient of determination. Results: Taken together, the factors that affect the demand for beef in the province is the price of beef, mutton, chicken, rice, cooking oil, income, number of inhabitants. Individually, beef demand is influenced by the price of beef and income residents. Beef inelastic demand means that beef is the daily necessities that are affordable and easy to obtain population of Yogyakarta Province. The increase in income population does not add to demand for beef. Substitutes of beef in the province is goat and chicken, while the complementary goods are rice and cooking oil.
Raw materials for aluminium production
International Nuclear Information System (INIS)
Galushkin, N.V.
1995-01-01
This chapter of monograph is devoted to to raw materials which used in aluminium production. Therefore, the using of alumina, and fluoride salts in aluminium production was considered. The physical properties of alumina were studied.
Effects of Flaxseed and pH on the Emulsion Properties of Beef by Using a Model System
Şükrü Kurt; Huriye Gözde Ceylan
2018-01-01
The effects of ground flaxseed (0-0.5%) and pH (3.88-8.12) on the emulsion properties of beef were studied using a model system. A central composite rotatable design was used to determine the response surface. pH, flaxseed and their interactions had significant effects on the emulsion properties of beef. pH and the interaction between pH and flaxseed increased emulsion capacity (EC). Flaxseed and pH increased emulsion stability (ES) until a critical point, which was reached at a flaxseed lev...
OZONE ABSORPTION IN RAW WATERS
Directory of Open Access Journals (Sweden)
LJILJANA TAKIĆ
2008-03-01
Full Text Available The ozone absorption in raw water entering the main ozonization step at the Belgrade drinking water supply plant was investigated in a continuous stirred tank reactor (CSTR. A slow chemical reaction rate of dissolved ozone and pollutants present in raw water have been experimentally determined. The modified Hatta number was defined and calculated as a criterion which determines whether and to which extent the reactions of ozone and pollutants influence the rate of the pure physical ozone absorption.
Directory of Open Access Journals (Sweden)
Dmitry Alexandrovich Izotov
2013-12-01
Full Text Available Deficit of raw materials is becoming an important concern for the Chinese economy as it continues to grow. This deficit is amended with imports, which – in their own turn – are limited by the high level of global prices. The build-up issue of raw materials imports is going to solve by the measures of monetary policy (RMB’s revaluation against the USD. Analysis of China’s market of raw materials reveals that the largest increase in the physical volume of imports is concentrated in crude oil, LNG, iron ore and coal. As for Russia, its supplies and share in total Chinese imports of raw materials tend to increase. Author employs regression equations based on international statistics data to show that RMB’s revaluation, ceteris paribus, increases physical volumes of raw materials imports. However, the main factor of coal and LNG imports growth is energy consumption by Chinese heavy industry; imports of oil products – producers’ prices; meanwhile imports of steel products tend to decrease with the growth of steel exports. RMB’s revaluation increases physical volumes of imports of low value added raw materials from Russia (coal, crude oil, iron ore
IceBridge GPS L0 Raw Satellite Navigation Data, Version 1
National Aeronautics and Space Administration — The NASA IceBridge GPS L0 Raw Satellite Navigation Data (IPUTG0) data set contains GPS readings, including latitude, longitude, track, ground speed, off distance,...
BRRISON GROUND CALIBRATION - BIRC RAW DATA V1.0
National Aeronautics and Space Administration — This is a saved data archive of the Balloon Rapid Response for Comet ISON (BRRISON) mission. This mission was performed by The Johns Hopkins University Applied...
HEDONIC DEMAND ANALYSIS FOR BEEF IN BENIN METROPOLIS
African Journals Online (AJOL)
BIUAGRIC2
2013-02-11
Feb 11, 2013 ... implicit demand for beef within the framework of a hedonic analysis, and the implicit or shadow price of beef were examined. Primary data ... results of the Hedonic analysis showed that, with an average unit price of N836.57 for beef, a consumer is strongly willing to pay ... method and strategies. Lancaster ...
Where's the beef? Retail channel choice and beef preferences in Argentina.
Colella, Florencia; Ortega, David L
2017-11-01
Argentinean beef is recognized and demanded internationally. Locally, consumers are often unable to afford certified beef products, and may rely on external cues to determine beef quality. Uncovering demand for beef attributes and marketing them accordingly, may require an understanding of consumers' product purchasing strategies, which involves retailer choice. We develop a framework utilizing latent class analysis to identify consumer groups with different retailer preferences, and separately estimate their demand for beef product attributes. This framework accounts for the interrelationship between consumers' choice of retail outlets and beef product preferences. Our analysis of data from the city of Buenos Aires identifies two groups of consumers, a convenience- (67%) and a service- (33%) oriented group. We find significant differences in demand for beef attributes across these groups, and find that the service oriented group, while not willing to pay for credence attributes, relies on a service-providing retailer-namely a butcher-as a source of product quality assurance. Copyright © 2017. Published by Elsevier Ltd.
BeefTracker: Spatial Tracking and Geodatabase for Beef Herd Sustainability and Lifecycle Analysis
Oltjen, J. W.; Stackhouse, J.; Forero, L.; Stackhouse-Lawson, K.
2015-12-01
We have developed a web-based mapping platform named "BeefTracker" to provide beef cattle ranchers a tool to determine how cattle production fits within sustainable ecosystems and to provide regional data to update beef sustainability lifecycle analysis. After initial identification and mapping of pastures, herd data (class and number of animals) are input on a mobile device in the field with a graphical pasture interface, stored in the cloud, and linked via the web to a personal computer for inventory tracking and analysis. Pasture use calculated on an animal basis provides quantifiable data regarding carrying capacity and subsequent beef production to provide more accurate data inputs for beef sustainability lifecycle analysis. After initial testing by university range scientists and ranchers we have enhanced the BeefTracker application to work when cell service is unavailable and to improve automation for increased ease of use. Thus far experiences with BeefTracker have been largely positive, due to livestock producers' perception of the need for this type of software application and its intuitive interface. We are now in the process of education to increase its use throughout the U.S.
O'Quinn, T G; Woerner, D R; Engle, T E; Chapman, P L; Legako, J F; Brooks, J C; Belk, K E; Tatum, J D
2016-02-01
Sensory analysis of ground LL samples representing 12 beef product categories was conducted in 3 different regions of the U.S. to identify flavor preferences of beef consumers. Treatments characterized production-related flavor differences associated with USDA grade, cattle type, finishing diet, growth enhancement, and postmortem aging method. Consumers (N=307) rated cooked samples for 12 flavors and overall flavor desirability. Samples were analyzed to determine fatty acid content. Volatile compounds produced by cooking were extracted and quantified. Overall, consumers preferred beef that rated high for beefy/brothy, buttery/beef fat, and sweet flavors and disliked beef with fishy, livery, gamey, and sour flavors. Flavor attributes of samples higher in intramuscular fat with greater amounts of monounsaturated fatty acids and lesser proportions of saturated, odd-chain, omega-3, and trans fatty acids were preferred by consumers. Of the volatiles identified, diacetyl and acetoin were most closely correlated with desirable ratings for overall flavor and dimethyl sulfide was associated with an undesirable sour flavor. Copyright © 2015 Elsevier Ltd. All rights reserved.
Rajić, Andrijana; Waddell, Lisa A; Sargeant, Jan M; Read, Susan; Farber, Jeff; Firth, Martin J; Chambers, Albert
2007-05-01
Canada's vision for the agri-food industry in the 21st century is the establishment of a national food safety system employing hazard analysis and critical control point (HACCP) principles and microbiological verification tools, with traceability throughout the gate-to-plate continuum. Voluntary on-farm food safety (OFFS) programs, based in part on HACCP principles, provide producers with guidelines for good production practices focused on general hygiene and biosecurity. OFFS programs in beef cattle, swine, and poultry are currently being evaluated through a national recognition program of the Canadian Food Inspection Agency. Mandatory HACCP programs in federal meat facilities include microbial testing for generic Escherichia coli to verify effectiveness of the processor's dressing procedure, specific testing of ground meat for E. coli O157:H7, with zero tolerance for this organism in the tested lot, and Salmonella testing of raw products. Health Canada's policy on Listeria monocytogenes divides ready-to-eat products into three risk categories, with products previously implicated as the source of an outbreak receiving the highest priority for inspection and compliance. A national mandatory identification program to track livestock from the herd of origin to carcass inspection has been established. Can-Trace, a data standard for all food commodities, has been designed to facilitate tracking foods from the point of origin to the consumer. Although much work has already been done, a coherent national food safety strategy and concerted efforts by all stakeholders are needed to realize this vision. Cooperation of many government agencies with shared responsibility for food safety and public health will be essential.
77 FR 31975 - Shiga Toxin-Producing Escherichia coli in Certain Raw Beef Products
2012-05-31
... International, the French Association for Standardization (AFNOR), the European organization for the validation... correlates with the concentration or frequency of another organism. FSIS-Recommended Cooking Temperatures Comment: One commenter stated that if STECs can survive ``ordinary'' or ``typical'' cooking, FSIS should...
Feuz, Dillon M; Umberger, Wendy J
2003-07-01
Cow-calf production occurs in all 50 states over varied resource bases and under vastly different environmental conditions. Multiple breeds exist and management styles and objectives are as numerous as the number of cow-calf producers. There is not one area of the country, one breed of cattle, or one management style that is most profitable for producing cows and calves. There are, however, some common strategies that can be employed by cow-calf producers to enhance profitability. Costs need to be controlled without jeopardizing cow herd productivity or net returns. It appears that the cost associated with purchased and harvested feeds varies considerably across operations. Understanding cyclic and seasonal price patterns, weight-price slides, cattle shrink, and other marketing costs can help producers enhance their profit by marketing (and not by just selling) their cattle. Producers with superior cattle genetics can become part of a specific alliance or, at a minimum, document the performance of their cattle so that they can get paid for the superior genetics. The beef industry is changing and will likely continue to change. Cow-calf producers will need to examine their own management practices to determine whether they are optimal for the current industry. Those producers who are most adept at matching their management abilities to their cattle type, their resource base, and the appropriate market outlet will be the most successful in the future.
Directory of Open Access Journals (Sweden)
Sarah E. Dickinson
2018-06-01
Full Text Available The reproductive performance of heifers within their first breeding season influences the success of beef cattle operations. Therefore, a means to identify infertile and late breeding heifers before the start of the breeding season holds great promise for the future of the beef industry. Pubertal beef heifers were subjected to estrous synchronization and fixed time artificial insemination (FTAI. We collected peripheral blood from the heifers at the time of artificial insemination (AI and generated RNA sequencing data to characterize the transcriptome of peripheral white blood cells (PWBC. Following insemination, heifers were exposed to natural service for a defined breeding season, and pregnancy was evaluated to classify heifers into one of three groups: AI-pregnant, natural-bred (NB pregnant, and non-pregnant. The raw transcriptome data of PWBC is available on the NCBI GEO repository (GSE103628 where the reader can also find raw read counts and normalized gene expression data. The normalized data on transcript coverage can be visualized as a genome browser at HeiferFertilityRNAseq.org. Keywords: Biomarkers, Infertility, Pregnancy
Prospects of the "VT-Pro" series beef protein using in the sausages products technology
Directory of Open Access Journals (Sweden)
O. P. Dvoryaninova
2017-01-01
Full Text Available Recently, the negative attitude of consumers towards soy protein has been formed. Therefore, to increase the mass fraction of protein in the finished product, it is advisable to use animal proteins, the main advantage of which is multipurpose designation, easy use and the ability to ensure an increase in the finished products yield and high production profitability due to their use . The application of beef proteins from collagen-containing raw materials makes it possible to enrich meat products with dietary fiber, to improve the rheological properties of food products significantly, especially their consistency. High functional properties of animal proteins are manifested in their water-retaining capacity. The company "TRUMP Food Technologies" introduced several new positions into its assortment - beef proteins of the "VT-Pro" trade mark (fibrillar fraction collagen, the manufacturer of which is JSC "Verkhnevolzhsky tannery" (Tver region. Proteins of the "VT-Pro" trademark are unique in their characteristics and are natural, environmentally friendly products. Beef protein "VT-Pro" is suitable for the production of cooked sausage and ham products, semi-smoked and boiled-smoked sausages, canned goods, chopped semi-finished products and other meat products. It is used as a full-fledged stabilizing additive for the preparation of meat products with a specified yield and certain organoleptic characteristics (hydration 1: 10-15. It is determined that it is possible to use this protein in dry form, as a protein-fat emulsion, in the form of gel and granules. According to the pilot-industrial approbation under the conditions of AIC "PROMAGRO" LLC, it is possible to underline a number of advantages of beef protein "VT-Pro" using: it possesses high water-retaining and emulsifying ability; allows to process low-grade and fired raw materials and to replace expensive meat raw materials; it reduces the risk of broth-fat swelling; it improves the structure of
Incorporating reproductive management of beef heifers into a veterinary practice.
Poock, Scott E; Payne, Craig A
2013-11-01
Veterinarians play an important role in reproductive management of dairy herds across the United States; however, in many cases, their involvement in reproductive management of beef herds has been limited. The reasons for this vary; however, there are ways for veterinarians to become more actively involved in reproductive management of US beef herds. Veterinarians can have an impact on producers' profits by implementing their skills and knowledge to beef heifer development programs. This article provides an overview of the services veterinarians can provide to beef cattle producers that pertain to reproductive management of replacement beef heifers. Published by Elsevier Inc.
Impact of product familiarity on beef quality perception
DEFF Research Database (Denmark)
Banovic, Marija; Fontes, Magda Aguiar; Barreira, Maria Madalena
2012-01-01
This study examines the use of intrinsic and extrinsic cues in beef quality perception at the point of purchase and upon consumption by consumers with varying levels of familiarity with a particular beef product. High-familiarity consumers tend to use the color of the meat to assess beef quality......, whereas low-familiarity consumers tend to believe that the brand is the most valid cue for assessing beef quality. However, due to the lack of consistency in sensory beef quality, high-familiarity consumers’ ability to form quality expectations that are predictive of their quality experience is no better...
IMPACT OF EXPORTS ON THE U.S. BEEF INDUSTRY
Van Eenoo, Edward, Jr.; Peterson, Everett B.; Purcell, Wayne D.
2000-01-01
Policy and programmatic decisions dealing with beef exports require good information as to the impact of exports on the domestic beef industry. This paper utilizes a partial equilibrium model of the world beef market to assess the impacts on the U.S. beef sector of increases in real income in major beef importing countries, the impacts of changes in the prices of pork and poultry products, and the impacts of changes in the price of feedgrains. A one percent increase in real GDP in Canada, Jap...
Directory of Open Access Journals (Sweden)
Daiana Novello
2013-09-01
Full Text Available Flaxseed application in meat and meat products by adding not flesh ingredients has not yet been properly assessed. This technology strategy, if well optimized, could substantially improve the nutritional value of meat products and promote healthy appeals consistent. Knowing that, this study aimed to evaluate the effect of adding golden flaxseed oil, or flour, or seed in the physico-chemical properties and fatty acid profile of beef patties. Beef patties were prepared with 5.0% of oil (FO, or flour (FF, or seed (FS, plus a control formulation (FC. For raw products containing flaxseed, the moisture content (74.22 to 68.61% was decreased and the ash (1.61 to 2.00g 100g-1, protein (15.62 to 16.46g 100g-1, fat (6.20 to 9.74g 100g-1, carbohydrate (2.02 to 3.97 g 100g-1, and calorie (127.71 to 161.62kcal 100g-1 contents were increased. The raw and grilled samples containing golden flaxseed had increased beneficial omega-3 (n-3 fatty acids (0.85 a 2.98g 100g-1, a decreased n-6/n-3 ratio (0.50, thus improving the nutritional profile.
Evaluation of chemical immersion treatments to reduce microbial populations in fresh beef.
Kassem, Ahmed; Meade, Joseph; Gibbons, James; McGill, Kevina; Walsh, Ciara; Lyng, James; Whyte, Paul
2017-11-16
The aim of the current study was to assess the ability of a number of chemicals (acetic Acid (AA), citric acid (CA) lactic acid (LA), sodium decanoate (SD) and trisodium phosphate (TSP)) to reduce microbial populations (total viable count, Campylobacter jejuni, Escherichia coli, Salmonella typhimurium and Listeria monocytogenes) on raw beef using an immersion system. The following concentrations of each chemical were used: 3 & 5% for AA, CA, LA, SD and 10 &12% for TSP. Possible synergistic effects of using combinations of two chemicals sequentially (LA+CA and LA+AA) were also investigated. L*, a* and b* values were measured before and after treatments and ΔE* values were calculated in order to determine any changes in the color of meat due to the use of these chemicals. In general, all chemical treatments resulted in significantly (p0.05). The application of combinations of chemical immersion treatments (LA3%+AA3% and LA3%+CA3%) did not result in further significant reductions in microbial populations when compared to single chemical treatments (P3 immediately after treatment and after 24h storage. The remaining treatments did not result in significant changes to the color of raw beef. Copyright © 2017 Elsevier B.V. All rights reserved.
The beef market in the European Union
DEFF Research Database (Denmark)
Nielsen, Niels Asger; Jeppesen, Lisbeth Fruensgaard
characteristics determining the consumers' value perception of a piece of meat appear to be fat, tenderness, taste and freshness. 7. The primary production of beef is fragmented in most European countries and the average number of cattle at a European cattle farm is only slowly rising. Two thirds of the cows...... of cattle going through markets is declining. 10. Product quality has been very difficult to control in the beef sector. The cattle supplied for slaughtering is of a very varying quality with regard to important consumer-oriented quality characteristics like tenderness and taste, and the lack...
Topical papers on raw materials
International Nuclear Information System (INIS)
1978-01-01
In the papers of this working group, the availability of uranium and the long-term supply situation for this raw material are discussed. A problem closely connected with uranium supply are the commercial contracts and their particularities. The points of view of the reporting countries of Great Britain, South Africa, Switzerland, Australia, Japan, and Korea are made clear
Waterman, R C; Caton, J S; Löest, C A; Petersen, M K; Roberts, A J
2014-07-01
Interannual variation of forage quantity and quality driven by precipitation events influence beef livestock production systems within the Southern and Northern Plains and Pacific West, which combined represent 60% (approximately 17.5 million) of the total beef cows in the United States. The beef cattle requirements published by the NRC are an important tool and excellent resource for both professionals and producers to use when implementing feeding practices and nutritional programs within the various production systems. The objectives of this paper include evaluation of the 1996 Beef NRC model in terms of effectiveness in predicting extensive range beef cow performance within arid and semiarid environments using available data sets, identifying model inefficiencies that could be refined to improve the precision of predicting protein supply and demand for range beef cows, and last, providing recommendations for future areas of research. An important addition to the current Beef NRC model would be to allow users to provide region-specific forage characteristics and the ability to describe supplement composition, amount, and delivery frequency. Beef NRC models would then need to be modified to account for the N recycling that occurs throughout a supplementation interval and the impact that this would have on microbial efficiency and microbial protein supply. The Beef NRC should also consider the role of ruminal and postruminal supply and demand of specific limiting AA. Additional considerations should include the partitioning effects of nitrogenous compounds under different physiological production stages (e.g., lactation, pregnancy, and periods of BW loss). The intent of information provided is to aid revision of the Beef NRC by providing supporting material for changes and identifying gaps in existing scientific literature where future research is needed to enhance the predictive precision and application of the Beef NRC models.
Raw milk consumption and health
Directory of Open Access Journals (Sweden)
Popović-Vranješ Anka
2015-01-01
Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095
Raw material uranium; Rohstoff Uran
Energy Technology Data Exchange (ETDEWEB)
NONE
2017-03-15
Uranium is an important raw material in human life. Mostly using nuclear fission uranium is used in nuclear medicine, industry and research. The most important application is the generation of electricity in nuclear power plants. Due to the global availability the worldwide uranium supply is guaranties for a long time. The contribution covers the issues medicine, neutron research, energy generation, occurrence, mining, processing, recycling and disposal.
Several emission estimation methods can be used to determine emission fluxes from ground-level area sources, including open-lot beef cattle feedlots. This research determined PM10 emission fluxes from a commercial cattle feedlot in Kansas using WindTrax, a backward Lagrangian stochastic-based atmosp...
Coopman, F.; Gengler, N.; Groen, A.F.; Smet, de S.; Zeveren, van A.
2004-01-01
In the double-muscled (DM) Belgian Blue Beef (BBB) breed, caesarean section (CS) is used as a routine management tool to prevent dystocia. This practice is criticized on animal welfare grounds. With unassisted (natural) births, difficulties arise because of disproportion between the sizes of the
The objective was to investigate the effects of ground beef from cattle administered commercial growth promotants on puberty attainment and body composition in female swine. Twenty-four gilts were selected based on strict selection criteria to reduce piglet variation. Treatments were randomly assign...
Yang, Jun; Goddard, Ellen
2011-01-01
Cluster analysis is applied in this study to group Canadian households by two characteristics, their risk perceptions and risk attitudes toward beef. There are some similarities in demographic profiles, meat purchases, and bovine spongiform encephalopathy (BSE) media recall between the cluster that perceives beef to be the most risky and the cluster that has little willingness to accept the risks of eating beef. There are similarities between the medium risk perception cluster and the medium risk attitude cluster, as well as between the cluster that perceives beef to have little risk and the cluster that is most willing to accept the risks of eating beef. Regression analysis shows that risk attitudes have a larger impact on household-level beef purchasing decisions than do risk perceptions for all consumer clusters. This implies that it may be more effective to undertake policies that reduce the risks associated with eating beef, instead of enhancing risk communication to improve risk perceptions. Only for certain clusters with higher willingness to accept the risks of eating beef might enhancing risk communication increase beef consumption significantly. The different role of risk perceptions and risk attitudes in beef consumption needs to be recognized during the design of risk management policies.
Directory of Open Access Journals (Sweden)
Hugo Imaizumi
2007-11-01
Full Text Available O objetivo deste trabalho foi avaliar a combinação de fontes de energia e proteína com diferentes degradabilidades ruminais. Foram utilizadas quatro vacas multíparas (23 kg leite dia-1 em Quadrado Latino 4 x 4 com arranjo fatorial 2 x 2: duas fontes de proteína (soja crua ou tostada e duas de energia (milho moído, grosso ou floculado. O tratamento com milho moído grosso e soja tostada resultou em maior consumo de matéria seca (p 0,05 o desempenho lactacional. A tostagem da soja e a floculação do milho diminuíram (p The objective of this trial was the evaluation of ruminal degradation synchrony of protein and energy sources. Four Holstein cows (23 kg day-1 were used in a 4 x 4 Latin Square design and 2 x 2 factorial arrangement: two protein (raw vs. roasted soybeans with two energy sources (coarsely ground vs. steam-flaked corn. Dry matter intake was higher for cows fed coarsely ground corn with roasted soybean (p 0.05. Rumen pH was not affected by treatments (p > 0.05. Both roasted soybeans and flaking of corn decreased rumen ammonia nitrogen (p < 0.01. Animal fed steamflaked corn tended showed higher total VFA molar concentrations (p = 0.10, but there were no treatments effect on ruminal pH. A higher (p = 0.06 ruminal starch digestibility was observed for raw soybean treatment.
Artificial neural network as the tool in prediction rheological features of raw minced meat.
Balejko, Jerzy A; Nowak, Zbigniew; Balejko, Edyta
2012-01-01
The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed using the artificial neural network module in Statistica 9.0 software. The model that reached the lowest training error was a multi-layer perceptron MLP with three neural layers and architecture 7:7-11-7:7. Correlation coefficients between the experimental and calculated values in training, verification and testing subsets were similar and rather high (around 0.65) which indicated good network performance. High percentage of the total variance explained in PCA analysis (73.5%) indicated that the percentage composition of raw minced meat can be successfully used in the prediction of its rheological features. Statistical analysis of the results revealed, that artificial neural network model is able to predict rheological parameters and thus a complete texture profile of raw minced meat.
Optimal Replacement and Management Policies for Beef Cows
W. Marshall Frasier; George H. Pfeiffer
1994-01-01
Beef cow replacement studies have not reflected the interaction between herd management and the culling decision. We demonstrate techniques for modeling optimal beef cow replacement intervals and discrete management policies by incorporating the dynamic effects of management on future productivity when biological response is uncertain. Markovian decision analysis is used to identify optimal beef cow management on a ranch typical of the Sandhills region of Nebraska. Issues of breeding season l...
Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A
2016-05-01
Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Beef cattle growing and backgrounding programs.
Peel, Derrell S
2003-07-01
The stocker industry is one of many diverse production and marketing activities that make up the United States beef industry. The stocker industry is probably the least understood industry sector and yet it plays a vital role in helping the industry exploit its competitive advantage of using forage resources and providing an economical means of adjusting the timing and volume of cattle and meat in a complex market environment.
Irish Corned Beef: A Culinary History
Mac Con Iomaire, Máirtín; Gallagher, Pádraic Óg
2011-01-01
This article proposes that a better knowledge of culinary history enriches all culinary stakeholders. The article will discuss the origins and history of corned beef in Irish cuisine and culture. It outlines how cattle have been central to the ancient Irish way of life for centuries, but were cherished more for their milk than their meat. In the early modern period, with the decline in the power of the Gaelic lords, cattle became and economic commodity that was exported to England. The Cattle...
Determinants of Beef and Pork Brand Equity
Parcell, Joseph L.; Schroeder, Ted C.
2003-01-01
A set of consumer-level characteristic demand models were estimated to determine the level of brand equity for pork and beef meat cuts. Results indicate that brand premiums and discounts vary by private, national, and store brands; and brand equity varies across meat cuts carrying the same brand name. Other results are that product size discounts are linear, meat items on sale are significantly discounted to non-sale items, specialty stores typically do not garner higher prices than supermark...
Distinct physicochemical characteristics of different beef from ...
African Journals Online (AJOL)
Jane
2011-04-11
Apr 11, 2011 ... A total of 30 Qinchuan cattle were used to investigate the physicochemical characteristics of beef from three different parts of cattle carcass, ... fed the same diets at 4 to 5 kg/day (48.78% corn, 20.43% bran, 26% corn grit, 1.97% cotton cake, 2.3% vitamin and mineral supplement and 0.5% salt) for a fattening ...
Environmental Awareness on Beef Cattle Technology
Directory of Open Access Journals (Sweden)
Abdullah M Bamualim
2008-09-01
Full Text Available The acceleration program to meet beef self sufficient in 2010 is expected to increase animal protein consumption of Indonesian people in order to be equal with other countries as well as to improve the livestock farmer’s income. The main objective of the program is to increase cattle population. Since the availability of forage and grassland is limited, beef cattle development is driven to the crop and plantation integration approach by using their by-product as cattle feed. Crop and plantation by-products, generally are considered to be fiber source with high lignocellulose’s and low nutritive value. Feeding high fiber would increase methane gas production, and faeces and grass cultivation also contributed on greenhouse emission. Methane is one of the main greenhouse gases contributed by agriculture sector; increasing beef cattle population using high fiber feed is predicted to increase methane production. Good management is expected to improve productivity and to reduce methane production on livestock. Some efforts could be done such as good feeding management and nutrition manipulation, environment friendly cattle waste management, improving management on roughage cultivation, and improving management on cattle production.
Samaxa, Ronald Gaelekolwe; Matsheka, Maitshwarelo Ignatius; Mpoloka, Sununguko Wata; Gashe, Berhanu Abegaz
2012-04-01
The objective of the study was to provide baseline data on the prevalence and antimicrobial susceptibility of Salmonella in different types of raw meat sausages directly accessible to the consumers in Gaborone, Botswana. A total of 300 raw sausages comprising 79 beef, 78 pork, 72 chicken, and 71 mutton samples were concurrently analyzed for the presence of Salmonella using a conventional culture method and a validated PCR method. The PCR assay results were in full concordance with those of the conventional culture method for the detection of Salmonella. Sixty-five (21.7%) of 300 samples were positive for Salmonella by both the conventional culture method and PCR assay. Even though more chicken samples contained Salmonella than did any other sausage type, the difference in the presence of Salmonella among the four sausages types was not significant. Eleven serotypes were identified, and Salmonella enterica subsp. salamae II was most prevalent in all the sausage types. Beef sausages generally had higher mesophilic bacterial counts than did the other three sausage types. However, higher microbial counts were not reflective of the presence of salmonellae. Susceptibility of the Salmonella enterica serotypes to 20 antimicrobial agents was determined, and Salmonella Muenchen was resistant to the widest array of agents and was mostly isolated from chicken sausages. Regardless of the meat of origin, all 65 Salmonella isolates were resistant to at least four antimicrobial agents: amikacin, gentamicin, cefuroxime, and tombramycin. This resistance profile group was the most common in all four sausage types, comprising 90% of all Salmonella isolates from beef, 71% from pork, 63% from mutton, and 35% from chicken. These results suggest that raw sausages pose a risk of transmitting multidrug-resistant Salmonella isolates to consumers.
Current situation and future prospects for the Australian beef industry.
Greenwood, Paul Leo; Ferguson, Drewe M
2018-04-12
Beef production extends over almost half of Australia, with about 47,000 cattle producers that contribute about 20% ($A12.7 billion GVP) of the total value of farm production in Australia. Australia is one of the world's most efficient producers of cattle and was the world's third largest beef exporter in 2016. The Australian beef industry had 25 million head of cattle in 2016-17, with a national beef breeding herd of 11.5 million head. Australian beef production includes pasture based cow-calf systems, a backgrounding or grow-out period on pasture, and feedlot or pasture finishing. Feedlot finishing has assumed more importance in recent years to assure the eating quality of beef entering the relatively small Australian domestic market, and to enhance the supply of higher value beef for export markets. Maintenance of Australia's preferred status as a quality assured supplier of high value beef produced under environmentally sustainable systems from 'disease-free' cattle is of highest importance. Stringent livestock and meat quality regulations and quality assurance systems, and productivity growth and efficiency across the supply chain to ensure price competiveness, are crucial for continued export market growth in the face of increasing competition. Major industry issues, that also represent research, development and adoption priorities and opportunities for the Australian beef industry have been captured within exhaustive strategic planning processes by the red meat and beef industries. At the broadest level, these issues include consumer and industry support, market growth and diversification, supply chain efficiency, productivity and profitability, environmental sustainability, and animal health and welfare. This review provides an overview of the Australian beef industry including current market trends and future prospects, and major issues and opportunities for the continued growth, development and profitability of the industry.
Brusa, Victoria; Restovich, Viviana; Galli, Lucía; Teitelbaum, David; Signorini, Marcelo; Brasesco, Hebe; Londero, Alejandra; García, Diego; Padola, Nora Lía; Superno, Valeria; Sanz, Marcelo; Petroli, Sandra; Costa, Magdalena; Bruzzone, Mariana; Sucari, Adriana; Ferreghini, Marcela; Linares, Luciano; Suberbie, Germán; Rodríguez, Ricardo
2017-01-01
Several foods contaminated with Shiga toxin-producing Escherichia coli (STEC) are associated with human diseases. Some countries have established microbiological criteria for non-O157 STEC, thus, the absence of serogroups O26, O45, O103, O104, O111, O121, and O145 in sprouts from the European Union or ground beef and beef trimmings from the United States is mandatory. While in Argentina screening for O26, O103, O111, O145 and O121 in ground beef, ready-to-eat food, sausages and vegetables is mandatory, other countries have zero-tolerance for all STEC in chilled beef. The aim of this study was to provide data on the prevalence of non-O157 STEC isolated from beef processed in eight Argentinean cattle slaughterhouses producing beef for export and local markets, and to know the non-O157 STEC profiles through strain characterization and genotypic analysis. Samples (n = 15,965) from 3,205 beef carcasses, 9,570 cuts and 3,190 trimmings collected between March and September 2014 were processed in pools of five samples each. Pools of samples (n = 3,193) from 641 carcasses, 1,914 cuts and 638 trimming were analyzed for non-O157 STEC isolation according to ISO/CEN 13136:2012. Of these, 37 pools of carcasses (5.8%), 111 pools of cuts (5.8%) and 45 pools of trimmings (7.0%) were positive for non-O157 STEC. STEC strains (n = 200) were isolated from 193 pools of samples. The most prevalent serotypes were O174:H21, O185:H7, O8:H19, O178:H19 and O130:H11, and the most prevalent genotypes were stx2c(vh-b) and stx2a/saa/ehxA. O103:H21 strain was eae-positive and one O178:H19 strain was aggR/aaiC-positive. The prevalence of non-O157 STEC in beef carcasses reported here was low. None of the non-O157 STEC strains isolated corresponded to the non-O157 STEC serotypes and virulence profiles isolated from human cases in Argentina in the same study period. The application of microbiological criteria for each foodstuff should be determined by risk analysis in order to have a stringent
Directory of Open Access Journals (Sweden)
Victoria Brusa
Full Text Available Several foods contaminated with Shiga toxin-producing Escherichia coli (STEC are associated with human diseases. Some countries have established microbiological criteria for non-O157 STEC, thus, the absence of serogroups O26, O45, O103, O104, O111, O121, and O145 in sprouts from the European Union or ground beef and beef trimmings from the United States is mandatory. While in Argentina screening for O26, O103, O111, O145 and O121 in ground beef, ready-to-eat food, sausages and vegetables is mandatory, other countries have zero-tolerance for all STEC in chilled beef. The aim of this study was to provide data on the prevalence of non-O157 STEC isolated from beef processed in eight Argentinean cattle slaughterhouses producing beef for export and local markets, and to know the non-O157 STEC profiles through strain characterization and genotypic analysis. Samples (n = 15,965 from 3,205 beef carcasses, 9,570 cuts and 3,190 trimmings collected between March and September 2014 were processed in pools of five samples each. Pools of samples (n = 3,193 from 641 carcasses, 1,914 cuts and 638 trimming were analyzed for non-O157 STEC isolation according to ISO/CEN 13136:2012. Of these, 37 pools of carcasses (5.8%, 111 pools of cuts (5.8% and 45 pools of trimmings (7.0% were positive for non-O157 STEC. STEC strains (n = 200 were isolated from 193 pools of samples. The most prevalent serotypes were O174:H21, O185:H7, O8:H19, O178:H19 and O130:H11, and the most prevalent genotypes were stx2c(vh-b and stx2a/saa/ehxA. O103:H21 strain was eae-positive and one O178:H19 strain was aggR/aaiC-positive. The prevalence of non-O157 STEC in beef carcasses reported here was low. None of the non-O157 STEC strains isolated corresponded to the non-O157 STEC serotypes and virulence profiles isolated from human cases in Argentina in the same study period. The application of microbiological criteria for each foodstuff should be determined by risk analysis in order to have a
Study of the combined effect of spices and marination on beef meat vacuum packaged
Directory of Open Access Journals (Sweden)
DANIELA ISTRATI
2011-12-01
Full Text Available Fresh beef slices were marinated by immersion in marinades based on dry red wine, lime-tree honey, salt, spices and seasoning plants as thyme (Thymus vulgaris, marjoram (Majorana hortensis, garlic (Allium sativum and horseradish (Armoracia rusticana. Control samples were represented by raw meat without marination treatment but stored in the same conditions as marinated samples. After marination, meat pieces were packed under vacuum and stored at refrigeration temperature of 4°C for 12 days. The influence of the combined effect of spices and marination on beef stability was evaluated by monitoring pH evolution, degree of lipid oxidation and by microbiological analysis. For control samples, a mean increase of 0.47 log CFU/g of total mesophilic aerobic bacteria was observed during the 48 h of storage, but for the samples marinated with the addition of spices was observed a decrease of 0.57 log CFU/g. The growth of LAB in control samples was generally limited and did not exceed 5 log CFU/g. During storage at 4°C, marination with the addition in the base marinade (wine, honey, garlic, pepper and salt of thyme, marjoram and horseradish separately inhibited the growth of LAB while marination with the addition in the base marinade of thyme, marjoram and horseradish together resulted in significantly lower levels of LAB. All marination treatments resulted in significantly lower TBA and POV values at the end of storage compared to the control. Marination with dry red wine, lime-tree honey, thyme marjoram, garlic, and horseradish can evidently control total mesophilic aerobic bacteria, lactic acid bacteria and oxidation of beef meat.
Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging
International Nuclear Information System (INIS)
Castejón, David; García-Segura, Juan Manuel; Escudero, Rosa; Herrera, Antonio; Cambero, María Isabel
2015-01-01
In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by "1H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.
Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging
Energy Technology Data Exchange (ETDEWEB)
Castejón, David [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); García-Segura, Juan Manuel [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Escudero, Rosa [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain); Herrera, Antonio [Departamento de Química Orgánica, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Cambero, María Isabel, E-mail: icambero@vet.ucm.es [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain)
2015-12-11
In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by {sup 1}H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.
Validation of a One-Step Method for Extracting Fatty Acids from Salmon, Chicken and Beef Samples.
Zhang, Zhichao; Richardson, Christine E; Hennebelle, Marie; Taha, Ameer Y
2017-10-01
Fatty acid extraction methods are time-consuming and expensive because they involve multiple steps and copious amounts of extraction solvents. In an effort to streamline the fatty acid extraction process, this study compared the standard Folch lipid extraction method to a one-step method involving a column that selectively elutes the lipid phase. The methods were tested on raw beef, salmon, and chicken. Compared to the standard Folch method, the one-step extraction process generally yielded statistically insignificant differences in chicken and salmon fatty acid concentrations, percent composition and weight percent. Initial testing showed that beef stearic, oleic and total fatty acid concentrations were significantly lower by 9-11% with the one-step method as compared to the Folch method, but retesting on a different batch of samples showed a significant 4-8% increase in several omega-3 and omega-6 fatty acid concentrations with the one-step method relative to the Folch. Overall, the findings reflect the utility of a one-step extraction method for routine and rapid monitoring of fatty acids in chicken and salmon. Inconsistencies in beef concentrations, although minor (within 11%), may be due to matrix effects. A one-step fatty acid extraction method has broad applications for rapidly and routinely monitoring fatty acids in the food supply and formulating controlled dietary interventions. © 2017 Institute of Food Technologists®.
Directory of Open Access Journals (Sweden)
Ilona Kołodziejska
2013-01-01
Full Text Available The effect of moderate pressure at subzero temperature on natural microflora of minced cod, salmon, pork and beef meat was studied. Pressure of 193 MPa at –20 °C caused the reduction of total bacterial count in pork and beef meat by 1.1 and 0.6 log cycles, respectively, and by about 1.5 log cycles in fish meat. Under these conditions the psychrophilic and psychrotrophic bacteria were below the detection limit (<10 CFU/g of sample in pork and beef meat, while in cod and salmon meat they were reduced only by 1.3 and 2.0 log cycles, respectively. In all tested samples of meat treated with the pressure of 193 MPa at –20 °C, the number of coliforms was below 10 CFU/g. Under these conditions a significant reduction in the number of coagulase-positive Staphylococcus was also observed. During storage of samples at 4 °C after pressurization at 193 MPa and –20 °C, the inhibition of growth of all tested groups of bacteria was observed. Moderate pressure at subzero temperature does not ensure complete inactivation of bacteria; however, it allows the improvement of microbiological quality and extension of shelf life of food, which depends on the level of bacterial contamination of the initial raw material.
Khan, Madiha; Nazir, Jawad; Anjum, Aftab Ahmad; Ahmad, Mansur-Ud-Din; Nawaz, Muhammad; Shabbir, Muhammad Zubair
2015-08-01
A total of 300 meat samples comprising mutton, beef, and chicken meat (n = 100) collected from either local butcher shops or large meat outlets situated at various areas of Lahore City located in Punjab province of Pakistan were tested for the isolation of Clostridium perfringens. Prevalence of the organism was highest in the chicken (6 %) followed by mutton (5 %) and beef (1 %). Contamination level was high (10/150) in the samples collected from local butcher shops in comparison to the samples collected from large meat outlets (2/150). All of the raw meat samples were negative for the presence of alpha, beta and epsilon toxins of C. perfringens as detected through ELISA. Out of a total number of 12 isolates only half were capable of producing enterotoxins when cultured in trypticase glucose yeast (TGY) broth. Toxinotyping of the isolates showed that 3 were of type A while one each of the remaining three belonged to type B, C, and D. Antibiotic susceptibility testing of the toxin producing isolates revealed that C. perfringens were susceptible to chloramphenicol, ciprofloxacin, metronidazole, and ceftriaxone. All of the other drugs were relatively less effective with a least activity of amoxicillin against the isolates.
Nanopurification of semen improves AI pregnancy rates in beef cattle
Reproductive efficiency is several times more important than any other factor affecting economic efficiency in beef production. Multiple studies have been conducted to improve fertility of beef cows, but few studies have been conducted to improve fertility in sires. Also, with current improvements...
Reproduction performance of beef cattle mated naturally following ...
African Journals Online (AJOL)
mgrobler
2014-08-24
Aug 24, 2014 ... The estimated calving percentage of beef cattle is 62% in the commercial sector of South ... Cows that calve early also have a better chance of conceiving in the next ..... reproductive tract scoring in beef heifers in South Africa.
Influence of mitochondrial efficiency on beef lean color stability
Loss of electrons in the electron transport chain has been implicated as a source of variation in feed efficiency of meat producing animals. The present study was conducted to evaluate the effects of electron loss during electron transport on beef lean color stability. Beef carcasses (n = 91) were...
Mitigating greenhouse gas emissions from beef cattle housing
Beef cattle are potential sources of greenhouse gases (GHG). These emissions include methane produced by fermentation within the gut (enteric), and methane and nitrous oxide emissions from manure. Life Cycle Analysis of North American (NA) beef cattle production systems consistently indicate that...
Comparative analysis of the demand for beef and mutton among ...
African Journals Online (AJOL)
Beef and mutton are meat types derived from cattle and sheep respectively. They are popular meat sources for households in Enugu metropolis Nigeria, although in ... that was significant in explaining the household expenditure on mutton. The expenditure elasticity for beef was 0.885, while that of mutton was 0.00073.
Antagonism in the carbon footprint between beef and dairy ...
African Journals Online (AJOL)
The higher increase in production (milk) of intensive dairy cows, compared to the increase in production (calf weight) of intensive beef cows, explains the antagonism in the carbon footprint between different beef and dairy production systems. Unfortunately, carbon sequestration estimates have been neglected and thus the ...
Environmentally Optimal, Nutritionally Aware Beef Replacement Plant-Based Diets.
Eshel, Gidon; Shepon, Alon; Noor, Elad; Milo, Ron
2016-08-02
Livestock farming incurs large and varied environmental burdens, dominated by beef. Replacing beef with resource efficient alternatives is thus potentially beneficial, but may conflict with nutritional considerations. Here we show that protein-equivalent plant based alternatives to the beef portion of the mean American diet are readily devisible, and offer mostly improved nutritional profile considering the full lipid profile, key vitamins, minerals, and micronutrients. We then show that replacement diets require on average only 10% of land, 4% of greenhouse gas (GHG) emissions, and 6% of reactive nitrogen (Nr) compared to what the replaced beef diet requires. Applied to 320 million Americans, the beef-to-plant shift can save 91 million cropland acres (and 770 million rangeland acres), 278 million metric ton CO2e, and 3.7 million metric ton Nr annually. These nationwide savings are 27%, 4%, and 32% of the respective national environmental burdens.
PREFERENCES AND BUYING BEHAVIOUR OF BEEF CONSUMERS IN TUSCANY
Directory of Open Access Journals (Sweden)
Marija RADMAN
2005-07-01
Full Text Available Tuscany, probably the most famous Italian region, is known because of many typical food specialities. One of them is the “fi orentina” - a thick, fi rst quality beef, called after the name of the city of Florence. However, recent trends in consumers’ behaviour and the BSE crisis have affected the attitude of consumers toward such products. In this study are presented the results of a mail survey about beef consumption and preferences that was conducted in Tuscany in May 2002. The survey showed that, despite recent food scares and new consumption behaviour, Tuscany consumers still like and prefer beef that has guarantees of quality. Therefore, there are good market opportunities for the Italian and foreign beef producers in Tuscany if they will provide consumers with not only good quality beef, but also more information about the meat.
Mukhabarah as Sharia Financing Model in Beef Cattle Farm Entrepise
Asnawi, A.; Amrawaty, A. A.; Nirwana
2018-02-01
Financing constraints on beef cattle farm nowadays have received attention by the government through distributed various assistance programs and program loans through implementing banks. The existing financing schemes are all still conventional yet sharia-based. The purpose of this research is to formulate financing pattern for sharia beef cattle farm. A qualitative and descriptive approach is used to formulate the pattern by considering the profit-sharing practices of the beef cattle farmers. The results of this study have formulated a financing pattern that integrates government, implementing banks, beef cattle farmers group and cooperative as well as breeders as its members. This pattern of financing is very accommodating of local culture that develops in rural communities. It is expected to be an input, especially in formulating a business financing policy Sharia-based beef cattle breeding.
Use of high irradiation doses for preservation of canned beef
International Nuclear Information System (INIS)
Hammad, A.A.I; Salem, F.A.; El-Sahy, K.M.; Rady, A.; Badr, H.H.
1997-01-01
The effect of high irradiation doses (11.25,22.5 and 45 KGy) on the bacteriology, organoleptic quality and shelf - life extension of beef meat that are hermetically sealed in metal cans was investigated in comparison with commercial heat sterilization. The unirradiated cans of pre cooked (enzyme inactivated) unirradiated beef were swollen after only one month of storage at ambient temperature (20-30 degree). Application of 11.25 and 22.5 kGy to vacuum packed and enzyme inactivated beef was not enough for sterilization and only delayed swelling of beef cans. Application of 45 KGy irradiation dose prevented swelling of beef vans up to 12 months at ambient temperature and provided meat product, similar to the commercial heat sterilized one, organoleptically acceptable and microbiologically safe. Running title: Radiation sterilization of meat
77 FR 12752 - Beef Promotion and Research; Amendment to the Order
2012-03-02
... possessing the requisite experience, skills and information related to the marketing of beef and beef..., skills and information related to the marketing of beef and beef products, as is intended under the Act... DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 1260 [Doc. No. AMS-LS-11-0086...
CO2 Capture by Cement Raw Meal
DEFF Research Database (Denmark)
Pathi, Sharat Kumar; Lin, Weigang; Illerup, Jytte Boll
2013-01-01
The cement industry is one of the major sources of CO2 emissions and is likely to contribute to further increases in the near future. The carbonate looping process has the potential to capture CO2 emissions from the cement industry, in which raw meal for cement production could be used...... as the sorbent. Cyclic experiments were carried out in a TGA apparatus using industrial cement raw meal and synthetic raw meal as sorbents, with limestone as the reference. The results show that the CO2 capture capacities of the cement raw meal and the synthetic raw meal are comparable to those of pure limestone...... that raw meal could be used as a sorbent for the easy integration of the carbonate looping process into the cement pyro process for reducing CO2 emissions from the cement production process....
Directory of Open Access Journals (Sweden)
Sani R.
2017-12-01
Full Text Available The purpose of this study is to describe the supply chain management of imported frozen beef from Australia to Indonesia; to analyze where the strengths, weaknesses, opportunities, and threats for the frozen meat distributor, and what strategy should be chosen; and to analyze alternatives of cooperation between imported frozen beef distribution with local beef distribution chain. The research approach is qualitative, and the research strategy is a case study. This research was conducted in Jakarta, data collecting technique by interview method and literature study. Data analysis techniques use supply chain management (SCM and strengths, weaknesses, opportunities, and threats (SWOT analysis. The results show that the distribution chain management of imported frozen beef needs to tripartite cooperation with government and local beef distributors to conduct joint marketing of imported frozen beef and cooler procurement to the point of retailers in traditional markets; expanding the market share of imported frozen beef to industrial segments (hotels, restaurant, catering company; and meat processing factories; and cooperate with imported beef suppliers to overcome the problem of taste flavor and lack of weight of imported frozen meat, and clarify halal certification.
Postrigor citric acid enhancement can alter cooked color but not fresh color of dark-cutting beef.
Stackhouse, R J; Apple, J K; Yancey, J W S; Keys, C A; Johnson, T M; Mehall, L N
2016-04-01
In 2 experiments, dark-cutting (DC) beef strip loins were used to test the effects of citric acid-enhancement pH on visual and instrumental color of fresh and cooked steaks. In Exp. 1 and 2, each DC (mean pH = 6.57 and 6.65, respectively) and normal-pH, low USDA Choice (CH; mean pH = 5.48 and 5.51, respectively) strip loin was cut into 2 equal-length sections, and DC sections were injected to 111% of raw section weight with pH 3.5 to 5.0 (Exp. 1) or pH 2.0 to 3.5 (Exp. 2) solutions made by mixing citric acid in either 0.05% orthophosphate (PO) solution or tap water (HO) base solutions (Exp. 1) and 0.5% PO or 0.5% tripolyphosphate solution base solutions (Exp. 2). After enhancement, sections were cut into steaks, which were assigned to either 5 d of simulated retail display or cooked to 71°C for cooked color measurement. Postenhancement pH of DC steaks enhanced with pH 3.5 to 5.0 solutions did not ( ≥ 0.180) differ from that of nonenhanced DC steaks (Exp. 1) but linearly decreased ( citric acid enhancement over untreated DC steaks during the first 3 d of display, fresh steak color never ( citric acid enhancement solutions, regardless of base solution, were insufficient to improve the fresh color of DC beef; however, enhancement with pH 2.5 citric acid solutions effectively eliminated the persistent red cooked color typically associated with DC beef comparable with that of normal-pH beef.
Schneider, L G; Stromberg, Z R; Lewis, G L; Moxley, R A; Smith, D R
2018-03-25
Cattle hides are an important source of enterohaemorrhagic Escherichia coli (EHEC) carcass contamination at slaughter. Seven EHEC serogroups are adulterants in raw, non-intact beef: EHEC O26, O45, O103, O111, O121, O145 and O157. The objective of this study was to estimate the probability for hide contamination with EHEC among US market beef cows at slaughter and to test the effects of season and geographic region on prevalence of hide contamination. Hides (n = 800) of market cows were swabbed at slaughter immediately after exsanguination, prior to hide removal. Cows were sampled from two geographically distinct beef packing plants during four seasons of 2015. Cattle source was categorized by northern or southern region. Samples were tested for EHEC by a molecular screening assay. The effects of region, season and their interaction on the probability of hide contamination by each EHEC serogroup were tested in separate multilevel multivariable logistic regression models, accounting for the random effect of clustering by plant. Statistical significance was set α = .05. Of 800 total samples, at least one EHEC was detected on 630 (79%) hides. Enterohaemorrhagic E. coli O26 was detected on 129 (16%) of all hides sampled, EHEC O45 on 437 (55%), EHEC O103 on 289 (36%), EHEC O111 on 189 (24%), EHEC O121 on 140 (18%), EHEC O145 on 171 (21%) and EHEC O157 on 89 (11%). Detection of EHEC O26 and EHEC O121 was associated with season. Season and region were associated with detecting EHEC O45 and EHEC O157. Season-by-region interactions were associated with the outcome of detecting EHEC O103, EHEC O111 and EHEC O145. Season, region of origin and the interaction of these factors affect hide contamination of market beef cattle at slaughter by EHEC, and each serogroup responds to these factors uniquely. © 2018 Blackwell Verlag GmbH.
Photoshop CS3 RAW Transforming your RAW data into works of art
Aaland, Mikkel
2008-01-01
Because RAW files remain virtually untouched by in-camera processing, working with them has given digital photographers greater flexibility and control during the editing process -- for those who are familiar enough with the format. Camera RAW, the plug in for Adobe Photoshop CS3, has emerged as one of the best and most familiar tools for editing RAW images, and the best way to master this workflow is with Photoshop CS3 RAW. Award-winning author Mikkel Aaland explores the entire RAW process, from the practical reasons to shoot RAW, to managing the images with the new features of Bridge 2.0 n
Managing the reproductive performance of beef cows.
Diskin, M G; Kenny, D A
2016-07-01
A reproductively efficient beef cow herd will be fundamental to meeting the protein and specifically, red meat demand of an ever increasing global population. However, attaining a high level of reproductive efficiency is underpinned by producers being cognizant of and achieving many key targets throughout the production cycle and requires considerable technical competency. The lifetime productivity of the beef-bred female commences from the onset of puberty and will be dictated by subsequent critical events including age at first calving, duration of the postpartum interval after successive calvings, conception and pregnancy rate, and ultimately manifested as length of intercalving intervals. In calved heifers and mature cows, the onset of ovarian activity, postpartum is a key event dictating the calving interval. Again, this will be the product mainly of prepartum nutrition, manifested through body condition score and the strength of the maternal bond between cow and calf, though there is increasing evidence of a modest genetic influence on this trait. After the initiation of postpartum ovarian cyclicity, conception and subsequent pregnancy rate is generally a function of bull fertility in natural service herds and heat detection and timing of insemination in herds bred through AI. Cows and heifers should be maintained on a steady plane of nutrition during the breeding season, but the contribution of significant excesses or deficiencies of nutrients including protein and trace elements is likely to be minor where adequate pasture is available. Although increased efforts are being made internationally to genetically identify and select for more reproductively efficient beef cows, this is a more long-term strategy and will not replace the need for a high level of technical efficiency and management practice at farm level. Copyright © 2016 Elsevier Inc. All rights reserved.
Harris, Tina
2015-04-29
Grounded theory is a popular research approach in health care and the social sciences. This article provides a description of grounded theory methodology and its key components, using examples from published studies to demonstrate practical application. It aims to demystify grounded theory for novice nurse researchers, by explaining what it is, when to use it, why they would want to use it and how to use it. It should enable nurse researchers to decide if grounded theory is an appropriate approach for their research, and to determine the quality of any grounded theory research they read.
Maxillary osteosarcoma in a beef suckler cow
Directory of Open Access Journals (Sweden)
Prins Diether G J
2012-07-01
Full Text Available Abstract A ten-year-old beef suckler cow was referred to the Scottish Centre for Production Animal Health & Food Safety of the University of Glasgow, because of facial swelling in the region of the right maxilla. The facial swelling was first noticed three months earlier and was caused by a slow growing oral mass which contained displaced, loosely embedded teeth. The radiographic, laboratory and clinicopathological findings are described. Necropsy, gross pathology and histological findings confirmed the mass as a maxillary osteosarcoma.
Van Wezemael, Lynn; Verbeke, Wim; de Barcellos, Marcia D; Scholderer, Joachim; Perez-Cueto, Federico
2010-06-15
Consumer perception of the healthiness of beef is an important determinant of beef consumption. However, little is known about how consumers perceive the healthiness of beef. The aim of this study is to shed light on the associations between beef and health. Eight focus group discussions were conducted in four European countries (France, UK, Germany, Spain), each consisting of seven to nine participants. A content analysis was performed on the transcripts of these discussions. Although beef was generally perceived as healthful, focus group participants expected positive as well as negative effects of beef consumption on their health. Labelled, branded, fresh and lean beef were perceived as signalling healthful beef, in contrast with further processed and packaged beef. Consumers felt that their individual choices could make a difference with respect to the healthiness of beef consumed. Focus group participants were not in favour of improving beef healthiness during processing, but rather focussed on appropriate consumption behaviour and preparation methods. The individual responsibility for health implies that consumers should be able to make correct judgements about how healthful their food is. However, the results of this study indicate that an accurate assessment of beef healthiness is not always straightforward. The presented results on consumer perceptions of beef healthiness provide insights into consumer decision making processes, which are important for the innovation and product differentiation in the European beef sector, as well as for public health policy decisions related to meat consumption in general and beef consumption in particular.
Fluoroquinolone residues in raw meat from open markets in Ibadan, Southwest, Nigeria
Directory of Open Access Journals (Sweden)
Adekunbi Bridget Omotoso
2015-07-01
Full Text Available Misuse of fluoroquinolones in livestock production may lead to the presence of their residues in tissues of meat animals after slaughter, constituting health hazards to consumers. The present study was designed to screen for residues of three fluoroquinolones (ciprofloxacin, norfloxacin and ofloxacin in raw meat. Microbiological assay, followed by High Performance Liquid Chromatography (HPLC was used to screen three hundred and twenty samples of beef, chicken, pork and chevon purchased from open markets. Initial screening by microbiological assay revealed that 50%, 55%, 40% and 40% of beef, chicken, pork and chevon, respectively were positive for residues of antibiotics. Further analysis by HPLC with UV detection revealed the presence of ciprofloxacin, norfloxacin and ofloxacin at varying concentrations in the meat samples. Ofloxacin was the least in frequency and abundance in all meat types. Results obtained in this study have implications for public health and will lead to steps that will further enhance the safety of animal foods in order to protect consumers and the animal production industry
Beef flavor: a review from chemistry to consumer.
Kerth, Chris R; Miller, Rhonda K
2015-11-01
This paper briefly reviews research that describes the sensation, generation and consumer acceptance of beef flavor. Humans sense the five basic tastes in their taste buds, and receptors in the nasal and sinus cavities sense aromas. Additionally, trigeminal senses such as metallic and astringent are sensed in the oral and nasal cavities and can have an effect on the flavor of beef. Flavors are generated from a complex interaction of tastes, tactile senses and aromas taken collectively throughout the tongue, nasal, sinus and oral cavities. Cooking beef generates compounds that contribute to these senses and result in beef flavor, and the factors that are involved in the cookery process determine the amount and type of these compounds and therefore the flavor generated. A low-heat, slow cooking method generates primarily lipid degradation products, while high-heat, fast cookery generates more Maillard reaction products. The science of consumer acceptance, cluster analyses and drawing relationships among all flavor determinants is a relatively new discipline in beef flavor. Consumers rate beef that has lipid degradation products generated from a low degree of doneness and Maillard flavor products from fast, hot cookery the highest in overall liking, and current research has shown that strong relationships exist between beef flavor and consumer acceptability, even more so than juiciness or tenderness. © 2015 Society of Chemical Industry.
Factors influencing intention to purchase beef in the Irish market.
McCarthy, M; de Boer, M; O'Reilly, S; Cotter, L
2003-11-01
This paper reports on the findings of a study into consumer perceptions towards beef and the influence of these perceptions on consumption. Fishbein and Ajzen's [Belief, attitude, intention and behaviour. An introduction to theory and research (1995) Reading, MA: Addison-Wesley] Theory of Reasoned Action (TRA) provided a useful framework for this analysis. The influence of attitudes and important others (subjective norm) on intention to consume beef were explored. The findings support the usefulness of this model in understanding behaviour towards beef. In this study both attitude and the subjective norm influenced intention to consume beef, but it was attitude that was of greater importance. Health, eating enjoyment and safety were most important determinants of attitude with price, environment and animal welfare less so. An evaluation of the impact of the introduction of new information which related to one belief (health) was also conducted. Those indicating that they would consider increasing their consumption of beef had a more positive attitude towards beef and had more positive health and eating enjoyment beliefs about beef than the 'no' group who had significantly higher safety concerns.
Modeling to control spores in raw milk
Vissers, M.
2007-01-01
A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type
Data extraction from proteomics raw data
DEFF Research Database (Denmark)
Mancuso, Francesco; Bunkenborg, Jakob; Wierer, Michael
2012-01-01
In shot-gun proteomics raw tandem MS data are processed with extraction tools to produce condensed peak lists that can be uploaded to database search engines. Many extraction tools are available but to our knowledge, a systematic comparison of such tools has not yet been carried out. Using raw data...
Current situation and future prospects for beef production in Europe.
Hocquette, Jean-Francois; Ellies-Oury, Marie-Pierre; Lherm, Michel; Pineau, Christele; Deblitz, Claus; Farmer, Linda
2018-05-24
The European Union (EU) is the world's third largest producer of beef. This contributes to the economy, rural development, social life, culture and gastronomy of Europe. The diversity of breeds, animal types (cows, bulls, steers, heifers) and farming systems (intensive, extensive on permanent or temporary pastures, mixed, breeders, feeders, etc) is a strength, and a weakness as the industry is often fragmented and poorly connected. There are also societal concerns regarding animal welfare and environmental issues, despite some positive environmental impacts of farming systems. The EU is amongst the most efficient for beef production as demonstrated by a relative low production of greenhouse gases. Due to regional differences in terms of climate, pasture availability, livestock practices and farms characteristics, productivity and incomes of beef producers vary widely across regions, being among the lowest of the agricultural systems. The beef industry is facing unprecedented challenges related to animal welfare, environmental impact, origin, authenticity, nutritional benefits and eating quality of beef. These may affect the whole industry, especially its farmers. It is therefore essential to bring the beef industry together to spread best practice and better exploit research in order to maintain and develop an economically viable and sustainable beef industry. Meeting consumers' expectations may be achieved by a better prediction of beef palatability using a modelling approach, such as in Australia. There is a need for accurate information and dissemination on the benefits and issues of beef for human health and for environmental impact. A better objective description of goods and services derived from livestock farming is also required. Putting into practice "agroecology" and organic farming principles are other potential avenues for the future. Different future scenarios can be written depending on the major driving forces, notably meat consumption, climate
Assessment of hardened characteristics of raw fly ash blended self-compacting concrete
Directory of Open Access Journals (Sweden)
B. Mahalingam
2016-09-01
Full Text Available Fly ash is widely used as a supplementary cementitious material in concrete. Due to the implementation of new thermal power plants as a consequence of electricity demand, generation of fly ash is noticeably increased. In addition to pozzolana blended cement production, it is very imperative to use raw fly ash in concrete. Earlier research studies investigated the performance of processed fly ash in blended cement production as well as in concrete. In general, ground fly ash is used in blended cement production. A comprehensive study on the performance evaluation of raw fly ash in self-compacting concrete is not available in the existing literature. Moreover, utilization of raw fly ash in special concrete such as self-compacting concrete is essential to comprehend the performance of raw fly ash blended concrete compared to ordinary Portland concrete. Additionally, it will help to achieve maximum utilization of raw fly ash as a supplementary cementitious material rather than disposal as a waste, which eventually leads to several environmental issues. In the study, raw fly ash was collected and is directly used in development of self-compacting concrete. Two mixes were cast and hardened characteristics of blended concrete were investigated. Results from the study showed comparable performance with control concrete. Furthermore, significant reduction in chloride permeability was observed for raw fly ash blended concrete.
Mead, G.; Lammerding, A.M.; Cox, N.; Doyle, M.P.; Humbert, F.; Kulikovskiy, A.; Panin, A.; Pinheiro do Nascimento, V.; Wierup, M.; Zwietering, M.H.
2010-01-01
Concerns about foodborne salmonellosis have led many countries to introduce microbiological criteria for certain food products. If such criteria are not well-grounded in science, they could be an unjustified obstacle to trade. Raw poultry products are an important part of the global food market.
International Nuclear Information System (INIS)
Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.
1998-01-01
The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-01-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-12-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
Directory of Open Access Journals (Sweden)
Chee Hao Kuan
2013-12-01
Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
Funston, R N; Summers, A F; Roberts, A J
2012-07-01
The beef cattle industry relies on the use of high-forage diets to develop replacement females, maintain the cow herd, and sustain stocker operations Forage quantity and quality fluctuate with season and environmental conditions Depending on class and physiological state of the animal, a forage diet may not always meet nutritional requirements, resulting in reduced ADG or BW loss if supplemental nutrients are not provided It is important to understand the consequences of such BW loss and the economics of providing supplementation to the beef production system Periods of limited or insufficient nutrient availability can be followed by periods of compensatory BW gain once dietary conditions improve This may have less impact on breeding animals, provided reproductive efficiency is not compromised, where actual BW is not as important as it is in animals destined for the feedlot A rapidly evolving body of literature is also demonstrating that nutritional status of cows during pregnancy can affect subsequent offspring development and production characteristics later in life The concept of fetal programming is that maternal stimuli during critical periods of fetal development have long-term implications for offspring Depending on timing, magnitude, and duration of nutrient limitation or supplementation, it is possible that early measures in life, such as calf birth BW, may be unaffected, whereas measures later in life, such as weaning BW, carcass characteristics, and reproductive traits, may be influenced This body of research provides compelling evidence of a fetal programming response to maternal nutrition in beef cattle Future competitiveness of the US beef industry will continue to be dependent on the use of high-forage diets to meet the majority of nutrient requirements Consequences of nutrient restriction or supplementation must be considered not only on individual animal performance but also the developing fetus and its subsequent performance throughout life.
Igo, J L; VanOverbeke, D L; Woerner, D R; Tatum, J D; Pendell, D L; Vedral, L L; Mafi, G G; Moore, M C; McKeith, R O; Gray, G D; Griffin, D B; Hale, D S; Savell, J W; Belk, K E
2013-04-01
The National Beef Quality Audit (NBQA)-2011 benchmarked the current status of and assessed progress being made toward quality and consistency of U.S. cattle, carcasses, and beef products after the completion of the first NBQA in 1991. Unlike previous NBQA, objectives of the 2011 Phase I study were to determine how each beef market sector defined 7 quality categories, estimate willingness-to-pay (WTP) for the same quality categories by market sector, and establish a best-worst (B/W) scaling for the quality categories. Structured face-to-face interviews were conducted and responses were recorded using dynamic routing software over an 11-mo period (February to December 2011) with decision makers in each of the following beef market sectors: Feeders (n = 59), Packers (n = 26), Food Service, Distribution, and Further Processors (n = 48), Retailers (n = 30), and Government and Allied Industries (n = 47). All respondents participated in a structured interview consisting of WTP and B/W questions that were tied to 7 quality categories and then were asked to "define" each of the 7 categories in terms of what the category meant to them, resulting in completely unbiased results. The 7 quality categories were a) how and where the cattle were raised, b) lean, fat, and bone, c) weight and size, d) cattle genetics, e) visual characteristics, f) food safety, and g) eating satisfaction. Overall, "food safety" and "eating satisfaction" were the categories of greatest and second most importance, respectively, to all beef market sectors except for Feeders. Feeders ranked "how and where the cattle were raised" and "weight and size" as the most important and second most important, respectively. Overall, "how and where the cattle were raised" had the greatest odds of being considered a nonnegotiable requirement before the raw material for each sector would be considered for purchase and was statistically more important (P market sectors were considered, "eating satisfaction" was shown to
2010-01-01
... Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY... OFFICIAL ESTABLISHMENTS; REINSPECTION AND PREPARATION OF PRODUCTS General § 318.17 Requirements for the... must include a cooking step. Controlled intermediate step(s) applied to raw product may form part of...
sensory analysis of cooked fresh meat sausages containing beef offal
African Journals Online (AJOL)
user
Sensory analysis of cooked fresh meat sausages containing beef offal. 22 .... Trained and consumer pan- els from the local black ... selected as the best formulations or recipes, as judged by the ... loosening of the sausage from the pan with a.
Identification of Social Capital on Beef Cattle Farmers Group
Lestari, V. S.; Sirajuddin, S. N.; Abdullah, A.
2018-02-01
Social capital plays an important role in the development of beef cattle farms in South Sulawesi. The aim of this research was to know the social capital of beef cattle farmers in South Sulawesi. Population of this research was 31 beef cattle farmers. Variable of social capital was mutual trust, norms and linkage. The data were collected from observation and depth interview by using questionnaire. There were 10 questions which were adopted from Australian Center for International Agriculture Research. The answer was scored by using Likert scale ranging from 1 refer to strongly disagree; 2 refer to disagree; 3 refer to not sure; 4 refer to agree and 5 refer to strongly agree. The data were analyzed descriptively by using frequency distribution. The research revealed that the social capital of beef cattle farmers was categorized as “high”.
Genetic parameters for reproductive traits in a beef cattle herd ...
African Journals Online (AJOL)
Unknown
Keywords: beef cattle, breeding, genetics, heritability, reproduction .... nature of the female reproductive traits or to the large influence of unidentified environmental effects on ..... Factors affecting some performance traits in Friesian cattle.
Safety of street vended meat products - chicken and beef suya
African Journals Online (AJOL)
USER
2010-06-28
Jun 28, 2010 ... suya (105 and 105/g and beef suya (102/g) before and after heating the following ... treatments in a completely randomized design of collected samples ... bacillus to differentiate between lactose and non-lactose fermenting.
Changes in the beef cattle industry through application of scientific ...
African Journals Online (AJOL)
insemination, oestrus synchronization, and management systems for ... Most of these changes have had and will have an economic impact on the ..... of ET to produce bulls for use in AI in beef cattle is still in ..... and future implications - 1983.
The profitability of beef production under semi-extensive conditions
African Journals Online (AJOL)
used and discussed included nett farm income per R100 capital investment and .... Although depreciation of fixed improvements and on equip- ment was calculated ..... Furthermore, another practice commonly found· amongst beef producers.
Factors influencing Consumer Preference for Fresh Beef in Sokoto ...
African Journals Online (AJOL)
SH
selected and interviewed to identify factors that affect preference for fresh beef and to determine the nature of the ... preference are appreciated by the food ... composition and household income .... habit and flavor, made them to prefer fresh.
Towards a regional beef carcass classification system for Southern ...
African Journals Online (AJOL)
Mapiye, C, Dr
2017-05-15
May 15, 2017 ... beef carcass grading and classification systems used in the region ..... between cattle breeds (genetic), pre-slaughter stress and growth- ..... Nguni cattle for example, owing to their adaptability (i.e. drought and heat tolerant,.
National genetic improvement programmes in the United States beef ...
African Journals Online (AJOL)
cattle industry is accepting, in fact, demanding estimates of genetic values on yearling bulls. Single and multiple analy ... ordinary event occurred with the formation of the Beef ... assumed genetic trend was non-existent or relatively unimportant ...
Raw materials policy: implications for Germany
Energy Technology Data Exchange (ETDEWEB)
Gaertner, E
1978-04-01
The contribution characterizes the situation of the national mining industry in 1977, deals with international raw materials policies within the framework of the North-South dialogue and with the policies of the western industrial countries, points out the dangers of worldwide state-controlled raw materials policies and calls for a) the political risk of enterprise cooperation with developing countries to be covered and b) double taxation to be avoided. Finally, the problems of securing the Federal Republic of Germany's raw materials supplies on a long-term basis are portrayed.
Value-added beef products (Productos Carnicos con Valor Agregado)
Mac Donaldson; Will Holder; Jan Holder
2006-01-01
I'm speaking for Will and Jan Holder, who couldn't be here. I happen to be familiar with Will and Jan's company, Ervin's Natural Beef, and its program because I've sold them cattle. Will and Jan's value-added beef program is based on their family ranch in the area known as The Blue, in the mountains of eastern Arizona.
Directory of Open Access Journals (Sweden)
Yimin Zhang
2018-04-01
Full Text Available Objective This study was to determine the bacterial diversity and monitor the community dynamic changes during storage of vacuum-packaged sliced raw beef as affected by Lactobacillus sakei and Lactobacillus curvatus. Methods L. sakei and L. curvatus were separately incubated in vacuumed-packaged raw beef as bio-protective cultures to inhibit the naturally contaminating microbial load. Dynamic changes of the microbial diversity of inoculated or non-inoculated (control samples were monitored at 4°C for 0 to 38 days, using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE. Results The DGGE profiles of DNA directly extracted from non-inoculated control samples highlighted the order of appearance of spoilage bacteria during storage, showing that Enterbacteriaceae and Pseudomonas fragi emerged early, then Brochothrix thermosphacta shared the dominant position, and finally, Pseudomonas putida showed up became predominant. Compared with control, the inoculation of either L. sakei or L. curvatus significantly lowered the complexity of microbial diversity and inhibited the growth of spoilage bacteria (p<0.05. Interestingly, we also found that the dominant position of L. curvatus was replaced by indigenous L. sakei after 13 d for L. curvatus-inoculated samples. Plate counts on selective agars further showed that inoculation with L. sakei or L. curvatus obviously reduced the viable counts of Enterbacteraceae, Pseudomonas spp. and B. thermosphacta during later storage (p< 0.05, with L. sakei exerting greater inhibitory effect. Inoculation with both bio-protective cultures also significantly decreased the total volatile basic nitrogen values of stored samples (p<0.05. Conclusion Taken together, the results proved the benefits of inoculation with lactic acid bacteria especially L. sakei as a potential way to inhibit growth of spoilage-related bacteria and improve the shelf life of vacuum-packaged raw beef.
Beef alliances: motivations, extent, and future prospects.
Schroeder, Ted C; Kovanda, Joseph
2003-07-01
With their growth, it is important to consider how alliances will impact the beef industry in the future. Alliances have the potential to make sweeping changes to cattle production, live and feeder cattle marketing, food safety protocols, use of government grades and standards, ownership structure, supply chain management, wholesale and retail product marketing, risk management, and many other industry activities. In an effort to address these issues, this article addresses the following questions: What is an alliance? What has motivated their proliferation? What have we learned from alliances? What aspects of alliances affect their likelihood of success or failure? What is the future of alliances? Are they a fad or a long-term evolving industry structural change?
Mexican consumers at the point of meat purchase. Beef choice.
Ngapo, T M; Braña Varela, D; Rubio Lozano, M S
2017-12-01
Within-consumer preference replication achieved through systematic image manipulation was used in consumer surveys in four cities across Mexico (Mexico City, n=195; Guadalajara, n=100; Hermosillo, n=132; Veracruz, n=61) to study beef preferences. Images of beef steaks controlled for lean and fat colour, fat cover and marbling were presented to consumers to determine the characteristics used in beef choice and the levels of preference of these characteristics. The most important choice criteria were fat cover (62% preferring little fat cover) and marbling (59% preferring non-marbled). Lean colour was also important with 24% and 29% choosing light and dark red beef, respectively. Fat colour was the least important of the four attributes studied (18% and 19% choosing white and yellow, respectively), but was nevertheless important given that 43% of consumers used three or four characteristics to make their choice. Imported and domestic beef in the Mexican marketplace appear to respond to the range of consumers' beef preferences at the point of purchase. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.
Irradiation of refrigerated corned beef for shelf-life extension
International Nuclear Information System (INIS)
Sallam, Y.I.; El-Magoli, S.B.M.; Mohamed, H.H.; El-Mongy, T.M.
2000-01-01
The development of the microflora of unirradiated and irradiated cowed beef was followed during storage at 5 degree. The total aerobic counts in unirradiated corned beef samples reached x 10 7 cfu/g after 10 days and after 15, 20 , 25 and 30 days of cold storage in irradiated samples at 2, 4, 6, 8 kGy, respectively, accompanied with obvious organoleptic evidence of microbial. Radiation doses up to 8 kGy and cold storage (5 degree) of cowed beef had no effect on the major constituents (moisture, protein and lipids) of these products. During storage, total volatile bases nitrogen (TVBN) and thiobarbituric acid (TBA) values tended to increase; the Ph of corned beef fall down to ca. 5. 7. Increasing the radiation dose level to 6 and 8 kGy, to increase the product shelf-life, affects generally the physical properties of the corned beef samples, and therefore, it could be concluded that the radiation dose level should be chosen to inhibit public health concern bacteria and reduce spoilage organisms, and at the same time preserve the natural properties of the food. At the present study a dose level of 4 kGy was found to be quite enough to reach such requirements for corned beef samples
Production Flexibility in Extensive Beef Farming Systems
Directory of Open Access Journals (Sweden)
Laura Astigarraga
2011-03-01
Full Text Available The aim of this work is to assess the flexibility of production allowed by extensive production conditions faced with variations in the environment, i.e., market variations and climatic fluctuations, of Limousin beef systems. The study used a case-based methodology in which seven beef farms with less than 1 LU/ha were chosen. Data collection was based on three interviews using a semistructured questionnaire and on the analysis of productive and economic results over a 15-year period (1991-2005. The main evolution of these farms is related to a rise in work productivity associated with an increase in herd size. Herd increase was made possible by enlarging the area, the margin of intensification being limited in these regions. To take advantage of the enlarged land area, females were reared for fattening or for reproduction instead of selling them at weaning. The Limousin female provides a wide product mix because of its plasticity, as has been studied by several researchers. This mix flexibility is achieved by delaying product differentiation, a form of production flexibility that can reduce the risk of under-producing or over-producing varied product configurations. On the other hand, calves sold to the Italian market after weaning are generic products, associated with a flexible production process to overcome fluctuations in forage availability due to climatic variations. The introduction of maize silage for feeding acts as an alternative route, actual and potential, through the system to overcome unexpected forage shortage from natural grasslands as a result of droughts. The study shows that extensive farming systems have developed types of flexibility to match different factors of uncertainty from the environment. Finally, the issue of farm system performance is thus not so much a question of whether a farm is fit at a specific moment in time, but whether it transforms into a less or more sustainable orientation.
Quality quantification model of basic raw materials
Directory of Open Access Journals (Sweden)
Š. Vilamová
2016-07-01
Full Text Available Basic raw materials belong to the key input sources in the production of pig iron. The properties of basic raw materials can be evaluated using a variety of criteria. The essential ones include the physical and chemical properties. Current competitive pressures, however, force the producers of iron more and more often to include cost and logistic criteria into the decision-making process. In this area, however, they are facing a problem of how to convert a variety of vastly different parameters into one evaluation indicator in order to compare the available raw materials. This article deals with the analysis of a model created to evaluate the basic raw materials, which was designed as part of the research.
raw data collected from Malvern Instrument
U.S. Environmental Protection Agency — These are raw data/image files from the Malvern Zetasizer Instrument. This dataset is associated with the following publication: Buse, H., J. Hoelle, C. Muhlen, and...
Annual report 1997. Energies and raw materials
International Nuclear Information System (INIS)
1997-01-01
This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)
Aluminium reprocessing with local mineral raw material
International Nuclear Information System (INIS)
Mirsaidov, U.M.
2002-01-01
With the purpose of utilization of ice sediment, receiving from mud fields solutions and flotation tails and at using local aluminium and fluorine-containing raw material was elaborated fundamental technologic scheme presented in this chapter of book
Plastic raw materials in Neolithic pottery production
Directory of Open Access Journals (Sweden)
Alexander A. Bobrinsky
2012-12-01
Full Text Available The paper is dedicated to the investigation of various natural silts as the most ancient type of raw material used in pottery production. The authors describe the specific features of the composition of plain and mountain silts, and discover the same features in ancient ceramics from different regions in Russia. It can be concluded that silts were the earliest raw material used, a tradition that faded away during the evolution of pottery production.
Price stabilization for raw jute in Bangladesh
Takamasa Akiyama; Varangis, Panos
1991-01-01
Fluctuating prices for raw jute have been viewed as contributing to economic problems in the jute subsector. Price fluctuations were thought to reduce the jute farmers'welfare and there has been concern about the costs of parastatals'stocking operations in attempts to stabilize jute prices and incomes. The authors examine these fluctuations and analyze policies that might reduce them. They find that price fluctuations for raw jute reduce farmers'welfare only slightly because farmers'activitie...
Temperature Effects on Free Radicals in Gamma-sterilized Beef
Pramanik, S. I.; Jahan, M. S.
1999-11-01
Gamma irradiation has become the method of choice for sterilizing frozen meat and their products to reduce levels of food-borne pathogens and to extend shelf life. In this report we have employed ESR technique for detection of free radicals in sterilized and non-sterilized dry beef without bone. We have also determined the heating effects on free radicals at temperatures 176^°C and 250^°C. Meat samples were dried in a food dehydrator at 60^°C and were packaged in dry N_2. They were then sterilized by γ-irradiation (2.5 MRad), ground into powder, and placed in ESR sample tubes. Non-sterilized powder samples were used as control. While all powder samples, sterilized or not, produced a broad single line in the ESR spectra with (Δ H_pp ~ 9 G) and g = 2.013, the radical concentration in the sterilized samples increased by a factor of five. Heat treatment at 176^°C produced similar radicals. But, when samples were heated 250^°C different radical species were formed which are characterized by narrow width (Δ H_pp ~ 6 G) and lower g-value (g =2.010). In contrast with previous work, where free radicals in chicken bones were reduced by heating [1], we observed an increase in concentration. Results of structural analyses of the radicals will be presented. Ref.[1]: Radiat. Phys. Chem., 49, 477-481, 1997. Work supported by Grants from the University of Memphis
Mason, C L; Nicholson, K L; Brooks, J C; Delmore, R J; Henning, W R; Johnson, D D; Lorenzen, C L; Maddock, R J; Miller, R K; Morgan, J B; Wasser, B E; Gwartney, B L; Harris, K B; Griffin, D B; Hale, D S; Savell, J W
2009-02-01
A market basket survey for beef retail cut composition at the retail level (four stores each from two chains in each city) was conducted in 11 US cities from January to March 2006. Beef cuts (n=17,495) were measured for external fat thickness with cuts from the chuck (0.05cm), round (0.05cm), and miscellaneous (0.04cm) having less (Pmarketing purposes.
Andrews, Philip
2007-01-01
One of the most important technologies a photographer can master is shooting and working with raw images. However, figuring out the best way to work with raw files can be confusing and overwhelming. What's the advantage to working in raw? How do you manage, organize, and store raw files? What's the best way to process your files to meet your photographic needs? How do Photoshop, Lightroom and Adobe Camera Raw work together? Is it possible to keep your photos in the raw format and still enhance them extensively? Philip Andrews answers these questions and more in his all-new essential raw workfl
Caesalpinia decapetala Extracts as Inhibitors of Lipid Oxidation in Beef Patties
Directory of Open Access Journals (Sweden)
Maria G. Gallego
2015-07-01
Full Text Available In this study we investigated the effects of Caesalpinia decapetala (CD extracts on lipid oxidation in ground beef patties. Plant extracts and butylated hydroxytoluene (BHT were individually added to patties at both 0.1% and 0.5% (w/w concentrations. We assessed the antioxidant efficacy of CD by the ferric reducing antioxidant power (FRAP assay and evaluated their potential as natural antioxidants for meat preservation by thiobarbituric acid reactive substance (TBARS values, hexanal content, fatty acid composition and color parameters. These were tested periodically during 11 days of refrigerated storage. TBARS levels were significantly lower (p ≤ 0.05 in the samples containing plant extracts or BHT than in the non-treated control. In addition, the beef patties formulated with the selected plant extracts showed significantly (p ≤ 0.05 better color stability than those without antioxidants. These results indicate that edible plant extracts are promising sources of natural antioxidants and can potentially be used as functional preservatives in meat products.
Comparison of flavor changes in cooked-refrigerated beef, pork and chicken meat patties.
Rhee, K S; Anderson, L M; Sams, A R
2005-10-01
Beef and pork longissimus dorsi (LD) and semimembranosus (SM) and chicken breast (B) and thigh (T) muscles excised 24 h postmortem were ground by muscle/species group, formed into patties, pan-fried, refrigerated for 0, 3 or 6 days, and evaluated by a trained sensory panel for intensity of specific flavors. The rate of decline in species-specific natural meat flavor intensity and the rate of increase in "cardboard" (CBD) flavor intensity during the first half of the 6-day storage were fastest for beef, while such decline and increase during the entire storage period were slowest for chicken B. Overall trends of natural meat flavor and CBD intensity changes for chicken T appeared more like those for the red meats than chicken B. It was concluded that, while flavor deterioration can occur in cooked-stored meats from all the species, quantitative or the magnitude of differences between species would depend on muscle types and sensory terms/method used.
ISMRM Raw data format: A proposed standard for MRI raw datasets
DEFF Research Database (Denmark)
Inati, Souheil; Naegle, Joseph; R. Zwart, Nicholas
2016-01-01
programming languages (C++, MATLAB, Python). Results Images were obtained by reconstructing the raw data from all vendors. The source code, raw data, and images comprising this work are shared online, serving as an example of an image reconstruction project following a paradigm of reproducible research......Purpose This work proposes the ISMRM Raw Data format as a common MR raw data format, which promotes algorithm and data sharing. Methods A file format consisting of a flexible header and tagged frames of k-space data was designed. Application Programming Interfaces were implemented in C/C++, MATLAB......, and Python. Converters for Bruker, General Electric, Philips, and Siemens proprietary file formats were implemented in C++. Raw data were collected using magnetic resonance imaging scanners from four vendors, converted to ISMRM Raw Data format, and reconstructed using software implemented in three...
Wells, J E; Kim, M; Bono, J L; Kuehn, L A; Benson, A K
2014-04-01
Shiga-toxigenic Escherichia coli, such as E. coli O157:H7, are foodborne zoonotic pathogens that can cause severe illness and death in humans. The gastrointestinal tract of ruminant animals has been identified as a primary habitat for E. coli O157:H7 and, in cattle, the hindgut tract appears to be a primary site for colonization. This pathogen has been found in cattle feces, on cattle hides, and in the production environment, and transmission to humans has occurred as a result of consumption of contaminated ground beef, water, and produce. Interventions to reduce the pathogen at beef harvest have significantly reduced the occurrence of the pathogen, but outbreaks and recalls due to the pathogen still occur for beef products. Interventions in the feedyard before harvest have had little success, but critical control points for implementing interventions are limited compared with the beef abattoir. The percentage of animals shedding E. coli O157:H7 in the feces can be highly variable from pen to pen, and the levels in the feces can vary from animal to animal. Animals colonized and shedding E. coli O157:H7 at high levels are a small fraction of animals in a pen but are important source for transferring the pathogen amongst the penmates. Recent research has indicated that diet may greatly influence the shedding of E. coli O157:H7. In addition, diet can influence the microbiota composition of the feces. However, little is known about the interaction between the indigenous microbiota and fecal shedding of E. coli O157:H7. Understanding the influence of indigenous microbiota on the colonization and shedding of E. coli O157:H7 will provide a potential avenue for intervention in the preharvest production environment not yet exploited.
DEFF Research Database (Denmark)
Møller, Cleide Oliveira de Almeida; Hansen, Tina Beck; Aabo, Søren
2015-01-01
Introduction: The cross contamination model (Møller et al. 2012) was evaluated to investigate its capability of describing transfer of Salmonella spp. and Listeria monocytogenes during grinding of pork and beef of varying sizes (50 – 324 g) and numbers of pieces to be ground (10 – 100), in two...... processing. QMRA risk estimates and TTP both revealed that risk attribution from grinding was mainly influenced by sharpness of grinder knife > specific grinder > grinding temperature whereas the specific pathogen was of minor importance....
Model system evaluation of the effects of pea and pH on the emulsion properties of beef
Kurt, Ş.; Ceylan, H. G.
2018-01-01
The effects of dried ground pea (0 - 1%) and pH (4.80 - 7.20) on the emulsion properties of beef were investigated using the model system. The study was designed according to the central composite rotatable design using the Response Surface Methodology. Pea had significant effects on emulsion activity and stability. The effects of pH on emulsion capacity, stability, activity, density, viscosity and apparent yield stress were significant. In addition, the interaction of both factors (pea and p...
Effect of chronological age of beef steers of different maturity types ...
African Journals Online (AJOL)
Effect of chronological age of beef steers of different maturity types on their growth ... and carcass studies have been conducted in the sourveld regions of the country. ... different beef maturity types which differ in body frame size were used, viz.
Improving the raw management in Ukraine
Energy Technology Data Exchange (ETDEWEB)
Jung, H.G.; Koever, M. [NUKEM Technologies GmbH, Alzenau (Germany)
2013-07-01
In Ukraine 13 VVER-1000 and 2 VVER-440 reactor units generate about 50 % of the country's energy production. By contrast, when looking at the large volume of radioactive waste of all categories, which is produced by these nuclear power plants (NPP), the radioactive waste (RAW) management - onsite of NPP, towards interim storage as well as towards final disposal - is still not adequately developed. Currently all operational waste of Ukrainian NPP is incompletely treated/conditioned and stored onsite, though insufficient storage capacity is available at the NPP. As no effective Ukraine-wide strategy is yet established to manage RAW beyond NPP a serious situation could arise, which even leads to constrained temporary shut-down of reactor units, threatening the energy supply of whole the country. In addition large quantities of RAW, partly badly sorted, derive from decommissioning of the shut-down Chernobyl NPP. Also other sources of RAW contribute to the whole volume, which has to be managed in Ukraine, as research reactors, reprocessing of spent nuclear fuel and other nuclear facilities and applications. Nevertheless, operational and shut-down NPP in Ukraine are by far the largest producers. To support Ukraine in managing their radioactive waste NUKEM Technologies GmbH was appointed to provide technical support for the improvement of the current situation in cooperation with responsible Ukrainian experts towards a targeted, comprehensive and effective RAW management. (orig.)
Metzger, Bruce; Iverson, Maynard J.
The unit on beef cattle production is designed primarily for the adult farmer program in Kentucky as an aid to making the beef enterprise more profitable. It is aimed primarily at the commercial producer. The lessons center on some of the more important economic points in beef cattle production. Ten lessons comprise the unit, which can be adapted…
9 CFR 94.27 - Importation of whole cuts of boneless beef from Japan.
2010-01-01
... beef from Japan. 94.27 Section 94.27 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION... IMPORTATIONS § 94.27 Importation of whole cuts of boneless beef from Japan. Notwithstanding any other... slaughtered in Japan may be imported into the United States under the following conditions: (a) The beef is...
77 FR 52597 - Beef Promotion and Research; Amendment to the Order
2012-08-30
... experience, skills and information related to the marketing of beef and beef products, as is intended under... DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 1260 [Doc. No. AMS-LS-11-0086] Beef Promotion and Research; Amendment to the Order AGENCY: Agricultural Marketing Service, USDA...
Effect of composting on the fate of steroids in beef cattle manure
In this study, the fate of steroid hormones in beef cattle manure composting is evaluated. The fate of 16 steroids and metabolites was evaluated in composted manure from beef cattle administered growth promotants and from beef cattle with no steroid hormone implants. The fate of estrogens (primary...
Chail, A; Legako, J F; Pitcher, L R; Griggs, T C; Ward, R E; Martini, S; MacAdam, J W
2016-05-01
Consumer liking, proximate composition, pH, Warner-Bratzler shear force, fatty acid composition, and volatile compounds were determined from the LM (longissimus thoracis) of cattle ( = 6 per diet) finished on conventional feedlot (USUGrain), legume, and grass forage diets. Forage diets included a condensed tannin-containing perennial legume, birdsfoot trefoil (; USUBFT), and a grass, meadow brome ( Rehmann; USUGrass). Moreover, representative retail forage (USDA Certified Organic Grass-fed [OrgGrass]) and conventional beef (USDA Choice, Grain-fed; ChGrain) were investigated ( = 6 per retail type). The ChGrain had the greatest ( 0.05) to that of both USUGrain and USUGrass. Both grain-finished beef treatments were rated greater ( Consumer liking of USUBFT beef tenderness, fattiness, and overall liking were comparable ( > 0.05) with that of USUGrain and ChGrain. Flavor liking was rated greatest ( 0.05) to those of ChGrain, USUGrass, and OrgGrass. Cumulative SFA and MUFA concentrations were greatest ( 0.05) to those of USUGrain and USUGrass. Each forage-finished beef treatment, USUGrass, OrgGrass, and USUBFT, had lower ( < 0.001) ratios of -6:-3 fatty acids. Hexanal was the most numerically abundant volatile compound. The concentration of hexanal increased with increasing concentrations of total PUFA. Among all the lipid degradation products (aldehydes, alcohols, furans, carboxylic acids, and ketones) measured in this study, there was an overall trend toward greater quantities in grain-finished products, lower quantities in USUGrass and OrgGrass, and intermediate quantities in USUBFT. This trend was in agreement with IMF content, fatty acid concentrations, and sensory attributes. These results suggest an opportunity for a birdsfoot trefoil finishing program, which results in beef comparable in sensory quality with grain-finished beef but with reduced -6 and SFA, similar to grass-finished beef.
Directory of Open Access Journals (Sweden)
Rafael Alves Esteves
2017-12-01
Full Text Available The present paper sought compare the environmental impacts throughout the life cycle of biodiesel production obtained from the two raw materials most used in Brazil (soybean oil and beef tallow through the process ethyl transesterification in an alkaline medium. The reference flow adopted for the work was the generation of power supplied 1GJ from the produced biodiesel. The data used in the inventory life cycle were calculated based on similar scientific papers. The method of assessment of environmental impacts chosen was the CML 2001 modified. Altogether, it were analyzed nine categories of environmental impacts for both processes (abiotic depletion (kg Sb eq, land use (m2a, global warming (kg CO2 eq, ozone layer depletion (kg CFC-11 eq, human toxicity (kg 1,4-DB eq, freshwater ecotoxicity (kg 1,4-DB eq, terrestrial ecotoxicity (kg 1,4-DB eq, acidification (kg SO2 eq and eutrophication (kg PO43- eq. The results of evaluation of environmental impacts show that the biodiesel production process from soybean oil presents major environmental damage in seven categories of analyzed impacts (destruction of abiotic resources, destruction of the ozone layer, human toxicity, freshwater ecotoxicity, terrestrial ecotoxicity, acidification and eutrophication. The production process of biodiesel from tallow presents major environmental damage in two categories of impacts analyzed (land use and global warming. However, the results show that the absolute values of environmental damage caused by impacts of the production process using beef tallow are much more aggressive.
Characterization of Limestone as Raw Material to Hydrated Lime
Salem Hwidi, Rajeb; Nuraiti Tengku Izhar, Tengku; Saad, Farah Naemah Mohd
2018-03-01
In Malaysia, limestone is essentially important for the economic growth as raw materials in the industry sector. Nevertheless, a little attention was paid to the physical, chemical, mineralogical, and morphological properties of the limestone using X-ray fluorescence (X-RF), X-ray diffraction (X-RD), Fourier transform infrared spectroscopy (FTIR), and Scanning electron microscopy / energy dispersive x-ray spectroscopy (SEM-EDS) respectively. Raw materials (limestone rocks) were collected from Bukit Keteri area, Chuping, Kangar, Perlis, Malaysia. Lab crusher and lab sieved were utilized to prepare five different size of ground limestone at (75 µm, 150 µm, 225 µm, 300, and 425 µm) respectively. It is found that the main chemical composition of bulk limestone was Calcium oxide (CaO) at 97.58 wt.% and trace amount of MnO, Al2O3, and Fe2O3 at 0.02%, 0.35%, and 0.396% respectively. XRD diffractograms showed characteristic peaks of calcite and quartz. Furthermore, main FTIR absorption bands at 1,419, 874.08 and 712.20 cm-1 indicated the presence of calcite. The micrographs showed clearly the difference of samples particle size. Furthermore, EDS peaks of Ca, O, and C elements confirmed the presence of CaCO3 in the samples.
Quality factors in beef, pork, and lamb cooked by microwaves.
Korschgen, B M; Baldwin, R E; Snider, S
1976-12-01
Three cooking treatments were applied to the longissimus muscle of beef and of pork and to deboned leg of lamb. Cooking treatments included: Intermittent energy application (3-min. cycle) with a microwave range operated at 220V and intermittent energy application (6-min. cycle) with a microwave range operated at 115V. Control roasts were cooked in a conventional gas oven (163+/-3 degrees C.). Cooking was adjusted so that roasts achieved an internal temperature of 70 degrees C. when cut for analyses. Cooking losses were significantly greater for microwave than for conventionally cooked beef. However, microwave cooking resulted in beef, pork, and lamb roasts with flavor of interior portions similar to those prepared conventionally. Flavor differences in samples from the edge of the slices of lamb and of pork and tenderness of lamb appeared to be related to cooking method. For these attributes, meat cooked conventionally was superior. In contrast, patterns in significant differences in tenderness and juiciness of beef and of pork were not consistent and were not related solely to method of cookery. Neither creatine nor creatinine was a good index of flavor of meat cooked by these methods. Aside from the time-saving aspect of microwave heating, there was no major advantage of one method of cooking over another. Thus, either high- or low- powered microwave equipment, operated at 2450 MHz, can be used satisfactorily for cooking tender cuts of beef, pork, and lamb.
Industrial development of beef and pork cecina with different flavors
Directory of Open Access Journals (Sweden)
Francisco A. Nuñez-Gonzalez
2013-12-01
Full Text Available Cecina used traditional technique for salting and preserving meat as well as to impart flavor; however, addition of spices is a viable alternative to diversify the flavors of the product. The objective of this research was to develop beef and pork cecina of flavors and evaluate lipid oxidation after 30 days of storage. Beef and pork cecina were distributed independently in four treatments: Formulation 1 or base (10.7% salt, 1.3% sugar, 0.5% nitrite and seasoning 0.1%; formulation 2, base plus 10 g of mixture of coriander, celery, parsley dehydrated/kg meat; formulation 3, base plus 10 g dry mirasol chilli/kg of meat and liquid smoke (2 mL/L and formulation 4, base plus 0.80 mL of essential oregano oil/L. Beef cecina was dried at 80 °C for 150 minutes and pork cecina for 180 minutes until these achieved a water activity (aw of 0.75. Beef cecina was packaged in cellophane bag, while for pork cecina in vacuum bags. Lipid oxidation was determined using thiobarbituric acid test (TBA. The results revealed that only beef cecina presented fat rancidity.
Environmental consequences of different beef production systems in the EU
DEFF Research Database (Denmark)
Nguyen, T Lan T; Hermansen, John Erik; Mogensen, Lisbeth
2010-01-01
The aim of this paper is to examine the environmental consequences of beef meat production in the EU, using a life cycle approach. Four beef production systems were studied - three from intensively reared dairy calves and one from suckler herds. According to the results of the analysis......, the contributions from the production of 1 kg beef meat (slaughter weight) to global warming, acidification, eutrophication, land use and non-renewable energy use were lower for beef from dairy calves than from suckler herds (16.0-19.9 versus 27.3 kg CO2e, 101-173 versus 210 g SO2e, 622-1140 versus 1651 g NO3e, 16.......5-22.7 versus 42.9 m2year, and 41.3-48.2 versus 59.2 MJ, respectively). The breakdown analysis helped identify the key areas in the "cradle to farm gate" beef production system where sustainable management strategies are needed to improve environmental performance. The study also included a sensitivity analysis...
DEFF Research Database (Denmark)
Kobayashi, Ken-ichi; Nishino, Ken; Dissing, Bjørn Skovlund
2011-01-01
Quantification of specific compounds in a food-matrix is a very important factor for an overall quantification of the quality. Near infrared (NIR) hyperspectral imaging is a powerful technique to quantify specific constituents as well as its spatial distribution of the foodmatrix. Hyperspectral i...
Ethanol is a strategic raw material
Directory of Open Access Journals (Sweden)
Baras Josip K.
2002-01-01
Full Text Available The first part of this review article considers general data about ethanol as an industrial product, its qualities and uses. It is emphasized that, if produced from biomass as a renewable raw material, its perspectives as a chemical raw material and energent are brilliant. Starchy grains, such as corn, must be used as the main raw materials for ethanol production. The production of bioethanol by the enzyme-catalyzed conversion of starch followed by (yeast fermentation, distillation is the process of choice. If used as a motor fuel, anhydrous ethanol can be directly blended with gasoline or converted into an oxygenator such as ETBE. Finally, bioethanol production in Yugoslavia and the possibilities for its further development are discussed.
PERSPECTIVE NONMETALLIC RAW MATERIALS AND THEIR UTILIZATION
Directory of Open Access Journals (Sweden)
Havelka Jaroslav
1997-10-01
Full Text Available It is the existence of the domestic base of raw materials and stable or growing markets that are a precondition for the prospectiveness industrial minerals. Traditional and non-traditional prospective nonmetal-liferous raw materials can be distinguished. The main trends in new industrial applications of industrial minerals are being stated. In the Czech Republic, the following may be ranked among the traditional prospective nonme-talliferous raw materials: kaoline, refractory clays, ceramic and expandable clays, glass and foundry sands, li-mestones, building stones, gypsum, cast basalt, bentonite, diatomite, feldspars, graphite. Alkali rocks, industrial garnets, flaky mica, wollastonite and yet unmined staurolite, minerals of the sillimanite group and others belong to the non-traditional prospective industrial minerals.
Huang, Lihan
2018-05-01
The objective of this study was to investigate the growth kinetics of Clostridium botulinum LNT01, a non-toxigenic mutant of C. botulinum 62A, in cooked ground beef. The spores of C. botulinum LNT01 were inoculated to ground beef and incubated anaerobically under different temperature conditions to observe growth and develop growth curves. A one-step kinetic analysis method was used to analyze the growth curves simultaneously to minimize the global residual error. The data analysis was performed using the USDA IPMP-Global Fit, with the Huang model as the primary model and the cardinal parameters model as the secondary model. The results of data analysis showed that the minimum, optimum, and maximum growth temperatures of this mutant are 11.5, 36.4, and 44.3 °C, and the estimated optimum specific growth rate is 0.633 ln CFU/g per h, or 0.275 log CFU/g per h. The maximum cell density is 7.84 log CFU/g. The models and kinetic parameters were validated using additional isothermal and dynamic growth curves. The resulting residual errors of validation followed a Laplace distribution, with about 60% of the residual errors within ±0.5 log CFU/g of experimental observations, suggesting that the models could predict the growth of C. botulinum LNT01 in ground beef with reasonable accuracy. Comparing with C. perfringens, C. botulinum LNT01 grows at much slower rates and with much longer lag times. Its growth kinetics is also very similar to C. sporogenes in ground beef. The results of computer simulation using kinetic models showed that, while prolific growth of C. perfringens may occur in ground beef during cooling, no growth of C. botulinum LNT01 or C. sporogenes would occur under the same cooling conditions. The models developed in this study may be used for prediction of the growth and risk assessments of proteolytic C. botulinum in cooked meats. Published by Elsevier Ltd.
Evaluation of bull fertility in dairy and beef cattle using cow field data.
Berry, D P; Evans, R D; Mc Parland, S
2011-01-01
A successful outcome to a given service is a combination of both male and female fertility. Despite this, most national evaluations for fertility are generally confined to female fertility with evaluations for male fertility commonly undertaken by individual breeding organisations and generally not made public. The objective of this study was to define a pertinent male fertility trait for seasonal calving production systems, and to develop a multiple regression mixed model that may be used to evaluate male fertility at a national level. The data included in the study after editing consisted of 361,412 artificial inseminations from 206,683 cow-lactations (134,911 cows) in 2,843 commercial dairy and beef herds. Fixed effects associated with whether a successful pregnancy ensued (pregnant = 1) or not (pregnant = 0) from a given service were year by month of service, day of the week, days since calving, cow parity, level of calving difficulty experienced, whether or not the previous calving was associated with perinatal mortality, and age of the service bull at the date of insemination. Non-additive genetic effects such as heterosis and recombination loss as well as inbreeding level of the service bull, dam or mating were not associated with a successful pregnancy; there was no difference in pregnancy rate between fresh or frozen semen. Random effects included in the model were the additive genetic effect of the cow, as well as a within lactation and across lactation permanent environmental effect of the cow; pedigree group effects based on cow breed were also included via the relationship matrix. Temporal differences in the AI technician and service bull were also included as random effects. A difference in five percentage units in male fertility was evident between the average effects of different dairy and beef breeds. The correlation between raw pregnancy rates for bulls with more than 100 services (n = 431) and service bull solutions from the mixed model analysis
Using reflectance spectroscopy to predict beef tenderness.
Bowling, M B; Vote, D J; Belk, K E; Scanga, J A; Tatum, J D; Smith, G C
2009-05-01
A study was conducted to determine if reflectance measurements made in the near-infrared region of the spectrum were additive to reflectance measurements made in the visible region of the spectrum for predicting Warner-Bratzler shear force (WBSF) values. Eighty seven strip loins were collected following fabrication over 3d at a commercial beef processing facility from heifer carcasses with Slight or Traces marbling scores. Spectroscopic measurements were made at approximately 50h postmortem using a Hunter-Lab UltraScan. Subsequently, all strip loins were aged for 14d, cooked to an internal temperature of 70°C, and sheared to obtain WBSF values. Reflectance measurements obtained in the near-infrared region of the spectrum were correlated with WBSF values, however, these measurements were not additive to the predictive ability of reflectance measurements (R(2) values did not differ) made in the visible portion of the spectrum when the use of broad-band wavelength filters were simulated. It was therefore determined, that both the visible and near-infrared spectra measure reflectance and that both methods are acceptable methods of tenderness prediction.
Preoperational test report, raw water system
Energy Technology Data Exchange (ETDEWEB)
Clifton, F.T.
1997-10-29
This represents the preoperational test report for the Raw Water System, Project W-030. Project W-030 provides a ventilation upgrade for the four Aging Waste Facility tanks. The system supplies makeup water to the W-030 recirculation evaporative cooling towers for tanks AY1O1, AY102, AZ1O1, AZ102. The Raw Water pipe riser and associated strainer and valving is located in the W-030 diesel generator building. The tests verify correct system operation and correct indications displayed by the central Monitor and Control System.
Preoperational test report, raw water system
International Nuclear Information System (INIS)
Clifton, F.T.
1997-01-01
This represents the preoperational test report for the Raw Water System, Project W-030. Project W-030 provides a ventilation upgrade for the four Aging Waste Facility tanks. The system supplies makeup water to the W-030 recirculation evaporative cooling towers for tanks AY1O1, AY102, AZ1O1, AZ102. The Raw Water pipe riser and associated strainer and valving is located in the W-030 diesel generator building. The tests verify correct system operation and correct indications displayed by the central Monitor and Control System
Microbial production of raw starch digesting enzymes | Sun | African ...
African Journals Online (AJOL)
Raw starch digesting enzymes refer to enzymes that can act directly on raw starch granules below the gelatinization temperature of starch. With the view of energy-saving, a worldwide interest has been focused on raw starch digesting enzymes in recent years, especially since the oil crisis of 1973. Raw starch digesting ...
DEFF Research Database (Denmark)
Petersen, Heidi Huus; Enemark, Heidi L.; Olsen, Annette
2012-01-01
to determine the effectiveness of different slurry separation technologies to remove oocysts and other pathogens, as well as whether application of separated liquid slurry to agricultural land may represent higher risks for ground water contamination as compared to application of raw slurry.......The potential for transport of viable Cryptosporidium parvum oocysts through soil to land drains and groundwater was studied using simulated rainfall and intact soil columns which were applied raw slurry or separated liquid slurry. Following irrigation and weekly samplings over a four week period......, C. parvum oocysts were detected from all soil columns regardless of slurry type and application method although recovery rates were low (liquid slurry leached 73% and 90% more oocysts compared with columns with injected and surface applied raw slurry, respectively...
International Nuclear Information System (INIS)
Osmond, J.K.; Cowart, J.B.
1982-01-01
The subject is discussed under the headings: background and theory (introduction; fractionation in the hydrosphere; mobility factors; radioisotope evolution and aquifer classification; aquifer disequilibria and geochemical fronts); case studies (introduction; (a) conservative, and (b) non-conservative, behaviour); ground water dating applications (general requirements; radon and helium; radium isotopes; uranium isotopes). (U.K.)
International Nuclear Information System (INIS)
Osmond, J.K.; Cowart, J.B.
1992-01-01
The great variations in concentrations and activity ratios of 234 U/ 238 U in ground waters and the features causing elemental and isotopic mobility in the hydrosphere are discussed. Fractionation processes and their application to hydrology and other environmental problems such as earthquake, groundwater and aquifer dating are described. (UK)
RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY
Directory of Open Access Journals (Sweden)
A. Y. Prosekov
2016-01-01
Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.
Improvements in Iron Status and Cognitive Function in Young Women Consuming Beef or Non-Beef Lunches
Directory of Open Access Journals (Sweden)
Cynthia Blanton
2013-12-01
Full Text Available Iron status is associated with cognitive performance and intervention trials show that iron supplementation improves mental function in iron-deficient adults. However, no studies have tested the efficacy of naturally iron-rich food in this context. This investigation measured the hematologic and cognitive responses to moderate beef consumption in young women. Participants (n = 43; age 21.1 ± 0.4 years were randomly assigned to a beef or non-beef protein lunch group [3-oz (85 g, 3 times weekly] for 16 weeks. Blood was sampled at baseline, and weeks 8 and 16, and cognitive performance was measured at baseline and week 16. Body iron increased in both lunch groups (p < 0.0001, with greater improvement demonstrated in women with lower baseline body iron (p < 0.0001. Body iron had significant beneficial effects on spatial working memory and planning speed (p < 0.05, and ferritin responders (n = 17 vs. non-responders (n = 26 showed significantly greater improvements in planning speed, spatial working memory strategy, and attention (p < 0.05. Lunch group had neither significant interactions with iron status nor consistent main effects on test performance. These findings support a relationship between iron status and cognition, but do not show a particular benefit of beef over non-beef protein consumption on either measure in young women.
Lyles, J L; Calvo-Lorenzo, M S
2014-12-01
Interest in the welfare of cattle in the beef industry has intensified over time because of ethical concerns and varying societal perceptions that exist about the treatment and living conditions of farm animals. The definition of welfare will vary according to an individual's philosophies (how one defines and prioritizes what is "good"), experiences (societal and cultural influences of animal roles and relationships), and involvement in the livestock industry (knowledge of how livestock operations work and why). Many welfare concerns in the beef industry could be mitigated by enhancing traditional husbandry practices that utilize practical improvements to alleviate or eliminate heat stress, pain from routine husbandry procedures, negative cattle handling, and the transitional effects of weaning, dry feeding, transportation, and comingling of calves. Recent concerns about the potential welfare effects of feeding technologies such as β-adrenergic agonists (BAA) have emerged and led to industry-wide effects, including the removal of a single BAA product from the market and the development of BAA-specific welfare audits. Altogether, the beef industry continues to be challenged by welfare issues that question a large range of practices, from traditional husbandry to newer technological advancements. As welfare awareness increases, efforts to improve livestock care and management must focus on scientific investigations, practical solutions, consumer perceptions, and educational tools that advance knowledge and training in livestock welfare. Furthermore, the future of beef cattle welfare must align welfare concerns with other aspects of sustainable beef production such as environmental quality, profitability, food safety, and nutritional quality.
Factors affecting beef consumption in the valley of Mexico
Directory of Open Access Journals (Sweden)
Ricardo Tellez Delgado
2015-10-01
Full Text Available ABSTRACTThe objective of this study was to know the factors that determine the consumption of beef in the Metropolitan Area of the Valley of Mexico, using logit and probit modeling (nominal variable with 400 surveys. The results showed that significant variables that determine the probability of purchasing beef are schooling, number of members per family, meat preference, family income, and presence of disease in the individual. The largest marginal effects on the purchase decision were provided by the income and the meat preference variables, while the price was not significant. The main factors that determine the consumption of beef are schooling and the number of members in the family, while the meat preference and income are dismissed.
Development of a modified dry curing process for beef.
Hayes, J E; Kenny, T A; Ward, P; Kerry, J P
2007-11-01
The development of a dry curing process using physical treatments to promote the diffusion of the cure ingredients was studied. Vacuum pulsing with and without tumbling, continuous vacuum, and tumbling only treatments were compared with a conventional static dry cure control method on beef M. supraspinatus. Vacuum tumble and tumble only treatments gave highest core salt content after 7 days conditioning (3.3% and 3.1%, respectively). All test treatments resulted in higher colour uniformity and lower % cook loss in comparison to control (PCured beef slices were stored in modified atmosphere packs (MAP) (80%N(2):20%CO(2)) for up to 28 day at 4°C. Redness (a(∗), Pcured beef products with enhanced organoleptic quality and increased yields.
European consumers' acceptance and rejection of novel beef technologies
DEFF Research Database (Denmark)
de Barcellos, Marcia Dutra; Kügler, Jens Oliver; Grunert, Klaus G.
As part of ProSafeBeef, an integrated research project funded by the European Commission, the present qualitative study was carried out with European consumers to obtain insights into their acceptance or rejection of eight selected novel beef production and processing technologies, identified here...... capital cities: Madrid, Paris, Berlin and London. A common and translated topic guide was developed prior to the field work. A ranking exercise was applied, where the participants classified the technologies into accepted, neutral or rejected concepts, after discussing the perceived benefits and risks...... in society, global warming crisis, disease outbreaks and degradation of the environment are shaping consumers' opinion in regard to food production. There was a severe criticism about too much intervention in food and a strong desire to keep food and beef processing as simple and natural as possible....
Magwedere, Kudakwashe; Dang, Huu Anh; Mills, Edward W; Cutter, Catherine N; Roberts, Elisabeth L; DeBroy, Chitrita
2013-03-01
The objective of the current study was to determine the incidence of contamination by the top 7 Shiga toxin-producing Escherichia coli (STEC) O-groups, responsible for the majority of E. coli infections in human beings, in retail meat from different animal species. Samples from ground beef (n = 51), ground pork (n = 16), ground chicken (n = 16), and game meat (deer, wild boar, bison, and rabbit; n = 55) were collected from retail vendors for the detection of 7 STEC O-groups (O26, O45, O103, O111, O121, O145, and O157). Meat samples were tested by using a multiplex polymerase chain reaction assay targeting the wzx gene of O antigen gene clusters of the 7 STEC O-groups. The positive samples were further tested for Shiga toxin genes (stx1 and stx2). Out of a total of 83 ground beef, pork, and chicken samples, 17 (20%) carried O121, 9 (10%) carried O45, 8 (9%) carried O157, 3 (3%) carried O103, and 1 (1%) carried O145. None of the samples were positive for O26, O111, or the stx gene. All 3 white-tailed deer samples (100%) were positive for O45, O103, or both, 2 (10%) out of 20 red deer samples exhibited the presence of O103, and all 3 bison samples were contaminated with either O121, O145, or O157. One sample from ground deer, contaminated with E. coli O45, carried the stx1 gene. This preliminary investigation illustrates the importance of microbiological testing of pathogens in meat products, as well as the recognized need for increased surveillance and research on foodborne pathogens.
Winkowski, K; Crandall, A D; Montville, T J
1993-01-01
The ability of Lactobacillus bavaricus, a meat isolate, to inhibit the growth of three Listeria monocytogenes strains was examined in three beef systems: beef cubes, beef cubes in gravy, and beef cubes in gravy containing glucose. The beef was minimally heat treated, inoculated with L. bavaricus at 10(5) or 10(3) CFU/g and L. monocytogenes at 10(2) CFU/g, vacuum sealed, and stored at 4 or 10 degrees C. The meat samples were monitored for microbial growth, pH, and bacteriocin production. The p...
Lucherk, L W; O'Quinn, T G; Legako, J F; Rathmann, R J; Brooks, J C; Miller, M F
2016-12-01
The palatability of USDA graded beef strip loins of seven treatments [High Enhanced (HE: 112% of raw weight) Select, Low Enhanced (LE: 107% of raw weight) Select, Prime, upper 2/3 Choice (Top Choice), lower 1/3 Choice (Low Choice), Select, and Standard] cooked to three degrees of doneness [DOD; rare (60°C), medium (71°C), or well-done (77°C)] was evaluated by consumer and trained sensory panelists. For consumers, Select HE steaks rated higher (P0.05) were observed between Select LE and Prime samples for most traits evaluated. The effect of USDA grade and enhancement on trained panel palatability scores was independent of DOD for all traits other than juiciness, with the role of marbling in juiciness increasing as DOD increased from rare to well-done. These results indicate enhancement as an effective method to improve the palatability of lower grading beef. Copyright © 2016 Elsevier Ltd. All rights reserved.
Beef identification in industrial slaughterhouses using machine vision techniques
Directory of Open Access Journals (Sweden)
J. F. Velez
2013-10-01
Full Text Available Accurate individual animal identification provides the producers with useful information to take management decisions about an individual animal or about the complete herd. This identification task is also important to ensure the integrity of the food chain. Consequently, many consumers are turning their attention to issues of quality in animal food production methods. This work describes an implemented solution for individual beef identification, taking in the time from cattle shipment arrival at the slaughterhouse until the animals are slaughtered and cut up. Our beef identification approach is image-based and the pursued goals are the correct automatic extraction and matching between some numeric information extracted from the beef ear-tag and the corresponding one from the Bovine Identification Document (BID. The achieved correct identification results by our method are near 90%, by considering the practical working conditions of slaughterhouses (i.e. problems with dirt and bad illumination conditions. Moreover, the presence of multiple machinery in industrial slaughterhouses make it difficult the use of Radio Frequency Identification (RFID beef tags due to the high risks of interferences between RFID and the other technologies in the workplace. The solution presented is hardware/software since it includes a specialized hardware system that was also developed. Our approach considers the current EU legislation for beef traceability and it reduces the economic cost of individual beef identification with respect to RFID transponders. The system implemented has been in use satisfactorily for more than three years in one of the largest industrial slaughterhouses in Spain.
RAWS II: A MULTIPLE REGRESSION ANALYSIS PROGRAM,
This memorandum gives instructions for the use and operation of a revised version of RAWS, a multiple regression analysis program. The program...of preprocessed data, the directed retention of variable, listing of the matrix of the normal equations and its inverse, and the bypassing of the regression analysis to provide the input variable statistics only. (Author)
Raw materials resources classification and characterisation for ...
African Journals Online (AJOL)
Raw materials resources classification and characterisation for ceramic tableware production in Nigeria. PSA Irabor. Abstract. No Abstract. Journal of Applied Science, Engineering and Technology Vol. 2(1) 2002: 48-52. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.
Extraction of protoactinium from silicaceous raw material
Energy Technology Data Exchange (ETDEWEB)
Broda, E.
1946-07-01
This report was written by E. Broda and P.K. Wright at the Cavendish Laboratory (Cambridge) in March 1946 and is about the Extraction of protoactinium from a silicaceous raw material. In this report the isolation of Pa on Er carrier is described and it includes the experiment description and the discussion of the results. (nowak)
Recovery of the secondary raw materials, recycling
International Nuclear Information System (INIS)
Chmielewska, E.
2010-01-01
In this chapter the recovery and recycling of secondary raw materials is explained. This chapter consists of the following parts: Paper and tetrapaks; Car wrecks; Scrap metal; Plastics; Used tires; Electrical and electronic equipment; Glass; Accumulators and batteries; Spent oil; Low-and non-waste technology.
Zvereva, Elena A; Kovalev, Leonid I; Ivanov, Alexei V; Kovaleva, Marina A; Zherdev, Anatoly V; Shishkin, Sergey S; Lisitsyn, Andrey B; Chernukha, Irina M; Dzantiev, Boris B
2015-07-01
The skeletal muscle protein troponin I (TnI) has been characterized as a potential thermally stable and species-specific biomarker of mammalian muscle tissues in raw meat and meat products. This study proposed a technique for the quantification of TnI comprising protein extraction and sandwich enzyme-linked immunosorbent assay (ELISA). The technique is characterized by a TnI detection limit of 4.8 ng/ml with quantifiable concentrations ranging from 8.7 to 52 ng/ml. The method was shown to be suitable for detection of TnI in mammalian (beef, pork, lamb, and horse) meat but not in poultry (chicken, turkey, and duck) meat. In particular, the TnI content in beef was 0.40 3 ± 0.058 mg/g of wet tissue. The TnI estimations obtained for the pork and beef samples using ELISA were comparable to the proteomic analysis results. Thus, the quantitative study of TnI can be a convenient way to assess the mammalian muscle tissue content of various meat products. Copyright © 2015. Published by Elsevier Ltd.
Carbon footprint and ammonia emissions of California beef production systems.
Stackhouse-Lawson, K R; Rotz, C A; Oltjen, J W; Mitloehner, F M
2012-12-01
Beef production is a recognized source of greenhouse gas (GHG) and ammonia (NH(3)) emissions; however, little information exists on the net emissions from beef production systems. A partial life cycle assessment (LCA) was conducted using the Integrated Farm System Model (IFSM) to estimate GHG and NH(3) emissions from representative beef production systems in California. The IFSM is a process-level farm model that simulates crop growth, feed production and use, animal growth, and the return of manure nutrients back to the land to predict the environmental impacts and economics of production systems. Ammonia emissions are determined by summing the emissions from animal housing facilities, manure storage, field applied manure, and direct deposits of manure on pasture and rangeland. All important sources and sinks of methane, nitrous oxide, and carbon dioxide are predicted from primary and secondary emission sources. Primary sources include enteric fermentation, manure, cropland used in feed production, and fuel combustion. Secondary emissions occur during the production of resources used on the farm, which include fuel, electricity, machinery, fertilizer, and purchased animals. The carbon footprint is the net exchange of all GHG in carbon dioxide equivalent (CO(2)e) units per kg of HCW produced. Simulated beef production systems included cow-calf, stocker, and feedlot phases for the traditional British beef breeds and calf ranch and feedlot phases for Holstein steers. An evaluation of differing production management strategies resulted in ammonia emissions ranging from 98 ± 13 to 141 ± 27 g/kg HCW and carbon footprints of 10.7 ± 1.4 to 22.6 ± 2.0 kg CO(2)e/kg HCW. Within the British beef production cycle, the cow-calf phase was responsible for 69 to 72% of total GHG emissions with 17 to 27% from feedlot sources. Holstein steers that entered the beef production system as a by-product of dairy production had the lowest carbon footprint because the emissions
Parsing and Quantification of Raw Orbitrap Mass Spectrometer Data Using RawQuant.
Kovalchik, Kevin A; Moggridge, Sophie; Chen, David D Y; Morin, Gregg B; Hughes, Christopher S
2018-06-01
Effective analysis of protein samples by mass spectrometry (MS) requires careful selection and optimization of a range of experimental parameters. As the output from the primary detection device, the "raw" MS data file can be used to gauge the success of a given sample analysis. However, the closed-source nature of the standard raw MS file can complicate effective parsing of the data contained within. To ease and increase the range of analyses possible, the RawQuant tool was developed to enable parsing of raw MS files derived from Thermo Orbitrap instruments to yield meta and scan data in an openly readable text format. RawQuant can be commanded to export user-friendly files containing MS 1 , MS 2 , and MS 3 metadata as well as matrices of quantification values based on isobaric tagging approaches. In this study, the utility of RawQuant is demonstrated in several scenarios: (1) reanalysis of shotgun proteomics data for the identification of the human proteome, (2) reanalysis of experiments utilizing isobaric tagging for whole-proteome quantification, and (3) analysis of a novel bacterial proteome and synthetic peptide mixture for assessing quantification accuracy when using isobaric tags. Together, these analyses successfully demonstrate RawQuant for the efficient parsing and quantification of data from raw Thermo Orbitrap MS files acquired in a range of common proteomics experiments. In addition, the individual analyses using RawQuant highlights parametric considerations in the different experimental sets and suggests targetable areas to improve depth of coverage in identification-focused studies and quantification accuracy when using isobaric tags.
The effect of technology information on consumer expectations and liking of beef
DEFF Research Database (Denmark)
van Wezemael, Lynn; Ueland, Øydis; Rødbotten, Rune
2012-01-01
European consumers increasingly attach value to process characteristics of food. Although beef technologies are hardly communicated to consumers, providing consumer-oriented information about technology application might increase perceived transparency and consumer acceptance. This study...... investigates how information about beef technologies influences consumer expectations and liking of beef. Beef consumers in Belgium (n=108) and Norway (n=110) participated in an information experiment combined with sensory testing in which each consumer tasted three beef muscles treated with different...... technologies: unprocessed tenderloin M. Psoas major, muscle profiled M. Infraspinatus, and marinated (by injection) M. Semitendinosus. The findings indicate that detailed information about beef technologies can enhance consumers' expectations and liking of beef. However, this effect differs between countries...
Van Wezemael, Lynn; De Smet, Stefaan; Ueland, Øydis; Verbeke, Wim
2014-07-01
The supply of tender beef is an important challenge for the beef industry. Knowledge about the profile of consumers who are more optimistic or more accurate in their tenderness evaluations is important for product development and beef marketing purposes. Central location tests of beef steaks were performed in Norway and Belgium (n=218). Instrumental and sensorial tenderness of three muscles from Belgian Blue and Norwegian Red cattle was reported. Consumers who are optimistically evaluating tenderness were found to be more often male, less food neophobic, more positive towards beef healthiness, and showed fewer concerns about beef safety. No clear profile emerged for consumers who assessed tenderness similar to shear force measurements, which suggests that tenderness is mainly evaluated subjectively. The results imply a window of opportunities in tenderness improvements, and allow targeting a market segment which is less critical towards beef tenderness. © 2013 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Oh, Jong Min; Bae, Jae Geun
1997-08-01
This book deals with ground pollution science and soil science, classification of soil and fundamentals, ground pollution and human, ground pollution and organic matter, ground pollution and city environment, environmental problems of the earth and ground pollution, soil pollution and development of geological features of the ground, ground pollution and landfill of waste, case of measurement of ground pollution.
International Nuclear Information System (INIS)
Moreno, Maria Margarita Torres; Rocha, Rogers Raphael da; Zanard, Antenor
2012-01-01
We studied the raw materials used in a factory building blocks, located in Cesario Lange city (SP). It extracts raw materials from various sources in the region to make the dough. The mixtures were prepared from dry milled powders based on data related to the plasticity of the raw materials. It was obtained with the apparatus Vicat-cone in order to obtain similar levels of water absorption of the samples burned at 900 deg C for all compositions. To quantify the proportion of each clay was used the Lever Rule. In this firing temperature, where sintering is mainly by diffusion from a solid state, different compositions of the same set of four raw materials resulted in similar values. (author)
Energy Technology Data Exchange (ETDEWEB)
Boonyanuwat, K. [Beef Cattle Research and Development Group, Division of Animal Husbandry, Department of Livestock Development, Bangkok (Thailand)], E-mail: kalayabo@yahoo.com; Sirisom, P [Tak Livestock Breeding and Research Center, Meung (Thailand); Putharatanung, A [Nongkwang Livestock Research and Breeding Center, Photharam (Thailand)
2009-07-01
The rural innovation research and development (R and D) in beef cattle genetics, biotechnology, climate science and production systems, supported profitable and sustainable beef cattle production in Thailand. Department of Livestock Development (DLD) undertakes R and D to achieve continuous improvement in genetics, production technologies to improve productivity, profitability and sustainability of beef cattle production and quality of products. Efficiencies were achieved through improvements in genetics, nutrition and grazing management, use of information, meat science, and reduction in ruminant methane production. This function was essential to maintain long-term production competitiveness and achieve sustained economic growth in rural Thailand, where the beef cattle production was the important livestock production, accounting for 36.99% of the value of livestock production in Thailand. Molecular, quantitative genetics, and biotechnology tool were being combined in the development of genetic improvement. In 2006, beef meat was imported 1,842.53 thousand tons (0.41% of all consumption, 120.84 baht/kg). For the big size cattle, such as Tak cattle, Kabinburi cattle (Thai synthetic breeds by DLD, Tak = 62.5 Charoles-Brahman, Kabinburi = 50 Simental- Brahman), and cross breed cattle, they were in fattening period for 6-12 month. Fattening group, they were raised for restaurant, hotel, super market, and steak house. Data were collected from 2 parts: 1) 354 cattle of experimental trial in DLD part, and 2) 492 fattening cattle of small holders in Tak province and Nakorn Pathom province during October 2004-September 2007. Data collecting was separated into 2 parts (performance data and reference). Data were adjusted by group location month and year to analyze for growth, carcass performance and economic performances). There were 5 breeds of fattening beef cattle: 1) Thai Native, 2) Thai Brahman, 3) Kabinburi, 4) Tak, and 5) Tajima-Native. The first group was around 41
Differentiation of pork from beef, chicken, mutton and chevon ...
African Journals Online (AJOL)
The detection of pork in various food products has been an important subject of study in many countries. The current study was aimed to differentiate pork from selected meats of beef, mutton, chevon and chicken based on their primary amino acid contents using reverse phase-high performance liquid chromatography ...
Beef Production on Rotationally Grazed F1 Pennisetum Hybrid and ...
African Journals Online (AJOL)
Comparative studies of elephant grass and the F1 hybrids between the 'maiwa' cultivar of millet (Pennisetum americanum) and elephant grass (P. purpureum) indicated a superiority in quality of the hybrids. To ascertain this potential superiority animal performance was measured by estimating beef production on F1 ...
Management characteristics of beef cattle production in Hawaii
A comprehensive life cycle assessment of the United States’ beef value chain requires the collection of region-specific data for accurate characterization of the country’s diverse production practices. Cattle production in Hawaii is very different from the rest of the country due to its unique ecosy...
Modeling growth from weaning to maturity in beef cattle breeds
To better understand growth trajectory and maturity differences between beef breeds, three models – Brody, spline, and quadratic – were fit to cow growth data, and resulting parameter estimates were evaluated for 3 breed categories – British, continental, and Brahman-influenced. The data were weight...
Increase in. gamma. -radiation from powdered milk and beef
Energy Technology Data Exchange (ETDEWEB)
Sievert, R M; Gustafsson, S; Sylander, C G
1956-01-01
Samples of powdered milk and beef preserved during the years 1953 to 1956 were examined for the presence of ..gamma..-radiation. The higher ..gamma..-radiation found in the last year was attributed to an increase in fission products. Data are compared with measurements on a series of children.
76 FR 42012 - Beef Promotion and Research; Reapportionment
2011-07-18
... Agricultural Marketing Service (AMS) has considered the economic effect of this action on small entities and..., methods of production and distribution, marketing strategies, and other distinguishing factors that will... DEPARTMENT OF AGRICULTURE Agricultural Marketing Service 7 CFR Part 1260 [No. AMS-LS-10-0086] Beef...
Crossbreeding to increase beef production: additive and non ...
African Journals Online (AJOL)
GScholtz
2013-06-06
Jun 6, 2013 ... Crossbreeding to increase beef production: additive and non-additive effects on weight traits ... total weight of weaned calves. ... Weight traits are not all equally important to efficiency ... values to model total herd productivity. ..... The maintenance requirement of a cow is affected by her weight: the larger the.
Population structure and genetic trends for indigenous African beef ...
African Journals Online (AJOL)
The aim of this study was to investigate population structure and genetic trends based on pedigree and performance records of five indigenous African beef cattle breeds (Afrikaner, Boran, Drakensberger, Nguni and Tuli) in South Africa. Pedigree completeness over six generations was higher than 88.5% in the first ...
Determinants and opportunities for commercial marketing of beef ...
African Journals Online (AJOL)
The objective of this study was to examine the factors influencing smallholder producers' potential to sell cattle and identify marketing opportunities for sustainable beef production in South Africa. A total of 95 structured questionnaires was administered to the Ncorha and Gxwalibomvu communities in the Eastern Cape ...
Bacteriological Quality of Dried Sliced Beef (Kilishi) Sold In Ilorin ...
African Journals Online (AJOL)
DR. MIKE HORSFALL
ABSTRACT: The bacteriological quality of dried sliced beef (kilishi) obtained from three selling points in. Ilorin metropolis was determined in order to ascertain its safety. The total bacterial count, Enterobacteriaceae count, Staphylococcus aureus count and E.coli counts were used as index of bacteriological quality. Samples.
Potential use of gas sensors in beef manure nutrient content ...
African Journals Online (AJOL)
The purpose of this study was to develop a gas sensor array to estimate the manure nutrient contents. Three metal-oxide gas sensors including methane, ammonia and hydrogen sulfide were used. Forty manure samples were collected from four beef operations in Southwest North Dakota. Manure samples were sent to be ...
Sustainable crossbreeding systems of beef cattle in the era of ...
African Journals Online (AJOL)
An effective way to reduce the carbon footprint from beef cattle would be to reduce the numbers and increase the production per animal, thereby improving their productivity. Sustainable crossbreeding systems can be an effective way to reduce GHG, as it has been shown to increase production. There are a wide range of ...
Selection for beef traits and calving performance in Piemontese cattle
Albera, A.
2006-01-01
Beef cattle selection programmes are usually focused on the improvement of production traits. However, also functional traits play an important role for the efficiency of animal production. Among these traits calving performance, affecting stillbirth of calves, fertility of cows, animal welfare and
Towards a regional beef carcass classification system for Southern ...
African Journals Online (AJOL)
This is partly because the current beef carcass grading and classification systems used in the region value inappropriately carcasses from slow-maturing indigenous cattle breeds that are ideally suited to being marketed off natural pasture. The existing systems use carcass yield and quality attributes, but do not predict ...
Quality related principles of the South African beef classification ...
African Journals Online (AJOL)
This paper addresses the principles related to different grading and classification systems of the world with specific focus on beef quality related outcomes. The paper uses the definitions that classification is a set of descriptive terms describing features of the carcass that are useful as guidelines to those involved in the ...
Comparative analysis of beef and fish consumption in Ekwusigo ...
African Journals Online (AJOL)
The study isolated and discussed the factors driving beef and fish consumption in Ekwusigo Local Government Area (L.G.A.) of Anambra State, Nigeria. Cross sectional data generated from 120 households randomly selected from five villages in Ekwusigo L.G.A was used. Descriptive statistics and regression analysis was ...
Physiology and Endocrinology Symposium. Factors controlling puberty in beef heifers
The Physiology and Endocrinology Symposium on “Factors controlling puberty in beef heifers” was held at the joint annual meeting of the American Dairy Science Association and the American Society of Animal Science in New Orleans, Louisiana, USA, July 10 to 14, 2011. The objective of the symposium w...
A survey of grass-finished beef producers in Pennsylvania
To meet our goal of quantifying the environmental impacts of grass-finished beef production, data on production practices in Pennsylvania were collected at the farm level via visits and online surveys. Twenty-three responses represented a total of 1,055 animals on 2,155 acres of land. Farms were rel...
In Vitro Iron Availability from Insects and Sirloin Beef.
Latunde-Dada, Gladys O; Yang, Wenge; Vera Aviles, Mayra
2016-11-09
Interest in the consumption of insects (entomophagy) as an alternative environmentally sustainable source of protein in the diet of humans has recently witnessed a surge. Knowledge of the nutrient composition and, in particular, the bioavailability of minerals from insects is currently sparse. This study evaluated the availability of Fe, Ca, Cu, Mg, Mn, and Zn from four commonly eaten insects and compared these to sirloin beef. Soluble iron from the samples was measured by inductively coupled plasma optical emission spectrometry (ICP-OES). Iron bioavailability was determined using an in vitro simulated peptic-pancreatic digestion, followed by measurement of ferritin (a surrogate marker for iron absorption) in Caco-2 cells. Cricket and sirloin beef had comparably higher levels of Fe, Ca, and Mn than grasshopper, meal, and buffalo worms. However, iron solubility was significantly higher from the insect samples than from beef. The complementation of whole-wheat flour with insect or beef protein resulted in overall decreases in mineral content and iron solubility in the composite mixtures. Collectively, the data show that grasshopper, cricket, and mealworms contain significantly higher chemically available Ca, Cu, Mg, Mn, and Zn than sirloin. However, buffalo worms and sirloin exhibited higher iron bioavailability comparable to that of FeSO 4 . Commonly consumed insect species could be excellent sources of bioavailable iron and could provide the platform for an alternative strategy for increased mineral intake in the diets of humans.
Crossbreeding to increase beef production: Additive and non ...
African Journals Online (AJOL)
Fitness is of paramount importance to efficient and profitable beef production. Thus, the objective of this study was to estimate genetic components of fitness traits measured in Afrikaner (A), Brahman (B), Charolais (C), Hereford (H) and Simmentaler (S). For this study, the fitness traits recorded were percentage of cows ...
Characterization of beef cattle breeds by virtue of their performances ...
African Journals Online (AJOL)
young bulls of l6 breeds were obtained fiorn the National Beef Cattle Performance and Progeny Testing Scheme and used in this re-analysis to characterize ... breeds for their effective use in either straight breeding or cross- breeding programmes. ... Scheme as the only data source for breed characterization pur- poses.
Potential use of gas sensors in beef manure nutrient content ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... manure samples were collected from four beef operations in Southwest North Dakota. Manure samples were sent to be ... cation rate at spreading time instead of waiting two or three weeks to receive the results ... Operation mechanism of metal-oxide gas sensors. The sensors used in this study were ...
Evaluation of hair cortisol in beef cattle of divergent temperaments
The objective of this research project was to evaluate the relationships among hair and serum cortisol concentrations and cattle disposition. Spring born (n = 101) crossbred beef heifers (7 to 8 mo. of age) were evaluated for temperament preweaning and at weaning by pen score (PS; 1 = calm and 5 = e...
Supplementary winter feeding and reproduction of beef heifers on ...
African Journals Online (AJOL)
Supplementary winter feeding and reproduction of beef heifers on Dohne sourveld. JA Erasmus, HH Barnard. Abstract. No Abstract. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for ...
76 FR 18422 - Beef Promotion and Research; Reapportionment
2011-04-04
... in cattle inventories and cattle and beef imports that have occurred since the most recent Board... Farms, and Livestock Operations,'' USDA's National Agricultural Statistics Service (NASS) estimates that in 2009 the number of operations in the United States with cattle totaled approximately 950,000. The...
Effect of winter nutritional levels on subsequent growth of beef ...
African Journals Online (AJOL)
Effect of winter nutritional levels on subsequent growth of beef heifers in the Highland Sourveld of Natal. ... Teen 'n lae veebelading van 0,75 GVE/ha (vir die weiperiode) op somerveld, het verse betekenisvol (P < 0,01) meer in massa toegeneem vergeleke met 'n hoë veebelading (1,25 GVE/ha). Binne elk van die ...
Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O
2016-09-24
The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.
Communication grounding facility
International Nuclear Information System (INIS)
Lee, Gye Seong
1998-06-01
It is about communication grounding facility, which is made up twelve chapters. It includes general grounding with purpose, materials thermal insulating material, construction of grounding, super strength grounding method, grounding facility with grounding way and building of insulating, switched grounding with No. 1A and LCR, grounding facility of transmission line, wireless facility grounding, grounding facility in wireless base station, grounding of power facility, grounding low-tenton interior power wire, communication facility of railroad, install of arrester in apartment and house, install of arrester on introduction and earth conductivity and measurement with introduction and grounding resistance.
High temperature cement raw meal flowability
DEFF Research Database (Denmark)
Maarup, Claus; Hjuler, Klaus; Dam-Johansen, Kim
2014-01-01
The flowability of cement raw meal is investigated at temperatures up to 850°C in a specially designed monoaxial shear tester. Consolidation stresses of 0.94, 1.87 and 2.79kPa are applied. The results show that the flowability is reduced as temperature is increased above 550°C, indicated by incre......The flowability of cement raw meal is investigated at temperatures up to 850°C in a specially designed monoaxial shear tester. Consolidation stresses of 0.94, 1.87 and 2.79kPa are applied. The results show that the flowability is reduced as temperature is increased above 550°C, indicated...
Radiation hygienization of raw sewage sludge
International Nuclear Information System (INIS)
Shah, M.R.; Lavale, D.S.; Rawat, P.; Benny, P.G.; Sharma, A.K.; Dey, G.R.; Bhave, V.
2001-01-01
'Radiation treatment of municipal sewage sludge can achieve resource conservation and recovery objectives. The liquid sludge irradiator of Sludge Hygienization Research Irradiator at Baroda (India) was operated for generating data on treatment of raw sludge containing 3-4 % solids. The plant system was modified for irradiating raw sludge without affecting basic irradiator initially designed to treat digested sludge. Hourly samples were analysed for estimation of disinfection dose requirement. Sand separated from the sludge was used as in-situ dosimeter by making use of its thermoluminescence property. Investigations are being carried out for regrowth of Total Coliforms in the sludge samples from this irradiator. Possibility of inadequate treatment due to geometric configuration of irradiator is being checked. (author)
Determination of essential nutrients in raw milk
Directory of Open Access Journals (Sweden)
Penphimon Phongphanphanee
2006-03-01
Full Text Available Milk production in Thailand has gradually increased since 1961. Occasional oversupply of raw milk has become one of dairy farmers' major problems. Increasing the consumption of milk by making use of its separated nutrients may offer a solution. This study was to assess the composition of raw milk produced in Thailand, which included fat, protein, lactose, solid-not-fat (SNF and total solid (TS. A large dairy cooperatives in Saraburi Province was selected for the study. About 9% of its total members, constituting 108 farms, were randomly chosen. They consisted of small size (less than 20 cows/farm, medium size (21-100 cows/farm and large size (>100 cows/farm. The majority was medium-size. Raw milk from each farm was sampled at the delivery site of the cooperatives in the morning. Milk data of the 108 farms were compiled at 3 different periods between February and July 2003. The raw milk was analyzed by the Fourier Transform Infrared Analysis (FTIR using MilkoScan FT6000. The results showed the average fat content of 3.50±0.47%, protein of 3.13±0.16%, lactose of 4.59±0.12%, SNF of 8.42±0.20%, and TS of 11.92±0.54%. The samples were superior in all of the nutrients as compared to the standard levels set by the Department of Livestock Development, except for TS. This indicates the possibility of a local production of milk nutrients such as lactose and protein as ingredients for the pharmaceutical and health food industries.
Raw material studies of West Central Serbia
Directory of Open Access Journals (Sweden)
Vera Bogosavljević Petrović
2014-03-01
Full Text Available This paper deals with raw material problems in the territory of West Central Serbia geologically determined as the Čačak-Kraljevo (or West Morava basin. Our research is presented through the most striking case studies, Lojanik, Vlaška Glava and Lazac. The Lojanik hill is a silicified forest by origin. It has occasionally been in use from the earliest periods of prehistory until today as a source of black and ochre-coloured flint, opal and silicified wood. A detailed prospection, including the mapping of surface finds using square nets, was conducted during two research campaigns.The Vlaška Glava is an open-air Palaeolithic site at which artefacts made of white, ochre, red, brown and black chert, silicified magnesite, volcanic and metamorphic rocks were found. Our research of primary and secondary geological deposits in the vicinity of the site showed equivalent raw material. We also found an interesting primary deposit of high quality bluish grey flint with outcrop activities (Workshop 1.The Lazac shaft is a contemporary magnesite mine, recently abandoned because of the high percentage of silicon-dioxide. We determined the same raw material in collections found at nearby Neolithic sites. Certain similarities between the wooden support systems of ore exploration in the Middle Ages and modern times were established at the entrance of the shaft.Our research in the territory of the West Morava basin resulted in reconstruction of some links between geological deposits and settlements and also creation of a relevant base for future raw material studies.
Monitoring of psychrotrophic microorganisms in raw milk
Directory of Open Access Journals (Sweden)
Radka Burdychová
2008-01-01
Full Text Available The group of psychrotrophic microorganisms belongs to the microorganisms representing a risk for human health as well as a risk of milk and milk products spoilage. Some genus are considered to be significant producers of proteolytic and lipolytic enzymes. In this work, we analysed raw milk samples (n = 109 originated from 26 different suppliers from the area of North and Middle Moravia. The screening was performed from March 2007 to February 2008. The total bacterial counts (TBC ranged between 3.2 × 103 to 8.3 × 106 CFU/ml. The psychrotrophic bacterial counts (PBC ranged between 1.0 × 103 to 8.2 × 106 CFU/ml. Total of 48.62 % and 48.62 % of samples exceeded the hygienic limit in raw milk for TBC and PBC, respectively. The correlation between TBC and PBC was highly significant (r = 0.87.Significantly higher (P < 0.05 numbers of psychrotrophic microorganisms were detected in summer months. The identification of isolates was carried out and all strains were sreened for ability to produce proteolytic and lipolytic enzymes. The most commonly identified genus in raw milk was of the genus Pseudomonas. The ability to produce proteases or lipases was found at 76 % identified bacterial strains.
RAW CHICKEN LEG AND BREAST SENSORY EVALUATION
Directory of Open Access Journals (Sweden)
Octavian Baston
2010-01-01
Full Text Available In the paper we presented a method of sensorial evaluation for chicken meat (red and white. This is a descriptive method of analysis. It was perform with trained assessors for chicken refrigerated raw meat organoleptical evaluation. The sensorial attributes considered were: external aspect of anatomical part of chicken analyzed by slime, the surface odor, the skin and muscle color and muscular elasticity. Color was determined for the skin and white and red muscles. Our scale of analysis is formed by three values that characterize each quality attribute. The trained assessor appreciated the sensorial quality of raw anatomical part of chicken as excellent, acceptable and unacceptable. The objectives were: to establish the sensorial attributes to be analyzed for each type of muscular fiber, to describe the quality of each considered attribute and to realize a sensorial scale of quantification for the considered sensorial attributes. Our purpose was to determine the quality of the red and white refrigerated raw chicken anatomical parts (respectively for legs and breasts after one week of storage.
Sasaki, Keisuke; Ooi, Motoki; Nagura, Naoto; Motoyama, Michiyo; Narita, Takumi; Oe, Mika; Nakajima, Ikuyo; Hagi, Tatsuro; Ojima, Koichi; Kobayashi, Miho; Nomura, Masaru; Muroya, Susumu; Hayashi, Takeshi; Akama, Kyoko; Fujikawa, Akira; Hokiyama, Hironao; Kobayashi, Kuniyuki; Nishimura, Takanori
2017-08-01
Over the past few decades, beef producers in Japan have improved marbling in their beef products. It was recently reported that marbling is not well correlated with palatability as rated by Japanese consumers. This study sought to identify the consumer segments in Japan that prefer sensory characteristics of beef other than high marbling. Three Wagyu beef, one Holstein beef and two lean imported beef longissimus samples were subjected to a descriptive sensory test, physicochemical analysis and a consumer (n = 307) preference test. According to consumer classification and external preference mapping, four consumer segments were identified as 'gradual high-fat likers', 'moderate-fat and distinctive taste likers', 'Wagyu likers' and 'distinctive texture likers'. Although the major trend of Japanese consumers' beef preference was 'marbling liking', 16.9% of the consumers preferred beef samples that had moderate marbling and distinctive taste. The consumers' attitudes expressed in a questionnaire survey were in good agreement with the preference for marbling among the 'moderate-fat and distinctive taste likers'. These results indicate that moderately marbled beef is a potent category in the Japanese beef market. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Food safety hazards associated with consumption of raw milk.
Oliver, Stephen P; Boor, Kathryn J; Murphy, Steven C; Murinda, Shelton E
2009-09-01
An increasing number of people are consuming raw unpasteurized milk. Enhanced nutritional qualities, taste, and health benefits have all been advocated as reasons for increased interest in raw milk consumption. However, science-based data to substantiate these claims are limited. People continue to consume raw milk even though numerous epidemiological studies have shown clearly that raw milk can be contaminated by a variety of pathogens, some of which are associated with human illness and disease. Several documented milkborne disease outbreaks occurred from 2000-2008 and were traced back to consumption of raw unpasteurized milk. Numerous people were found to have infections, some were hospitalized, and a few died. In the majority of these outbreaks, the organism associated with the milkborne outbreak was isolated from the implicated product(s) or from subsequent products made at the suspected dairy or source. In contrast, fewer milkborne disease outbreaks were associated with consumption of pasteurized milk during this same time period. Twenty nine states allow the sale of raw milk by some means. Direct purchase, cow-share or leasing programs, and the sale of raw milk as pet food have been used as means for consumers to obtain raw milk. Where raw milk is offered for sale, strategies to reduce risks associated with raw milk and products made from raw milk are needed. Developing uniform regulations including microbial standards for raw milk to be sold for human consumption, labeling of raw milk, improving sanitation during milking, and enhancing and targeting educational efforts are potential approaches to this issue. Development of pre- and postharvest control measures to effectively reduce contamination is critical to the control of pathogens in raw milk. One sure way to prevent raw milk-associated foodborne illness is for consumers to refrain from drinking raw milk and from consuming dairy products manufactured using raw milk.
Directory of Open Access Journals (Sweden)
E Harlia
2010-01-01
Full Text Available The aims of animal husbandry improvements are to increase both the quality and the quantity of livestock production and to ensure the safety of the product. It is necessarry for consumers to pay attention to the food safety of livestock product because it is related to human's health. The research was conducted to determine the food safety of livestock product condition by detecting heavy metal residues on several food products from livestock like meatball, corned beef, burger’s beef, and sausages. This research was explored by using survey's method and purposive technique sampling, then the resulted data were descriptively analyzed. The observed variables were heavy metal contents such as Plumbum (Pb and Cadmium (Cd in which being measured by using AAS (Atomic Absorption Spectrophotometri . The result showed that in general, heavy metal residue of Pb from several livestock products (meatball, corned beef, beef burger, and sausages were smaller than Maximum Residue Limit (MRL, while the Cd’s residue was partly over the MRL concentration, therefore further action has to be taken as it affects the human's health. (Animal Production 12(1: 50-54 (2010 Key words : food safety, MRL, heavy metal Pb, Cd.
Rrsm: The European Rapid Raw Strong-Motion Database
Cauzzi, C.; Clinton, J. F.; Sleeman, R.; Domingo Ballesta, J.; Kaestli, P.; Galanis, O.
2014-12-01
We introduce the European Rapid Raw Strong-Motion database (RRSM), a Europe-wide system that provides parameterised strong motion information, as well as access to waveform data, within minutes of the occurrence of strong earthquakes. The RRSM significantly differs from traditional earthquake strong motion dissemination in Europe, which has focused on providing reviewed, processed strong motion parameters, typically with significant delays. As the RRSM provides rapid open access to raw waveform data and metadata and does not rely on external manual waveform processing, RRSM information is tailored to seismologists and strong-motion data analysts, earthquake and geotechnical engineers, international earthquake response agencies and the educated general public. Access to the RRSM database is via a portal at http://www.orfeus-eu.org/rrsm/ that allows users to query earthquake information, peak ground motion parameters and amplitudes of spectral response; and to select and download earthquake waveforms. All information is available within minutes of any earthquake with magnitude ≥ 3.5 occurring in the Euro-Mediterranean region. Waveform processing and database population are performed using the waveform processing module scwfparam, which is integrated in SeisComP3 (SC3; http://www.seiscomp3.org/). Earthquake information is provided by the EMSC (http://www.emsc-csem.org/) and all the seismic waveform data is accessed at the European Integrated waveform Data Archive (EIDA) at ORFEUS (http://www.orfeus-eu.org/index.html), where all on-scale data is used in the fully automated processing. As the EIDA community is continually growing, the already significant number of strong motion stations is also increasing and the importance of this product is expected to also increase. Real-time RRSM processing started in June 2014, while past events have been processed in order to provide a complete database back to 2005.
Feeding value of field pea as a protein source in forage-based diets fed to beef cattle.
Soto-Navarro, S A; Encinias, A M; Bauer, M L; Lardy, G P; Caton, J S
2012-02-01
Three studies were conducted to evaluate the feasibility of field peas as a protein source in diets for beef cattle. In the first study, 4 cultivars of field pea were incubated in situ to determine rate and extent of CP disappearance. Results indicate that field pea cultivars vary in CP content (22.6, 26.1, 22.6, and 19.4%, DM basis for Profi, Arvika, Carneval, and Trapper, respectively). Soluble protein fraction ranged from 34.9% for Trapper to 54.9% for Profi. Degradable CP fraction was greater (P = 0.01) for Trapper compared with the other cultivars, and no differences (P ≥ 0.25) were observed among Profi, Arvika, and Carneval. Rate of CP degradation differed (P ≤ 0.03) for all cultivars, with Profi being the greatest and Trapper the smallest (10.8, 10.0, 8.1, and 6.3 ± 1.4%/h for Profi, Carneval, Arvika, and Trapper, respectively). Estimated RDP was not different (P = 0.21) for all 4 cultivars. In the second study, 30 crossbred beef steers (301 ± 15 kg) were individually fed and used to evaluate effects of field pea processing (whole, rolled, or ground) on steer performance. Diets contained 40% field pea grain. Growing steers consuming whole field pea had greater ADG (P = 0.08) than those consuming processed field pea (1.69, 1.52, and 1.63 ± 0.05 kg/d, for whole, rolled, and ground, respectively). However, DMI (kg/d and as % of BW) and G:F were not different (P ≥ 0.24). In the third study, 35 individually fed gestating beef cows (694 ± 17 kg) were used to evaluate the use of field pea as a protein supplement for medium quality grass hay (9.3% CP). Treatments consisted of whole field peas at 1) 0 g (CON), 2) 680 g (FP680), 3) 1,360 g (FP1360), and 4) 2,040 g (FP2040), and 5) 1,360 g of 74% barley and 26% canola meal (BCM). Total intake (forage + supplement) of gestating beef cows increased with increasing field pea level (linear, P = 0.01; supplemented vs. nonsupplemented, P = 0.01). In summary, protein quantity and rate of ruminal protein degradation
Effect of raw soya bean particle size on productive performance and digestion of dairy cows.
Naves, A B; Freitas Júnior, J E; Barletta, R V; Gandra, J R; Calomeni, G D; Gardinal, R; Takiya, C S; Vendramini, T H A; Mingoti, R D; Rennó, F P
2016-08-01
Differing soya bean particle sizes may affect productive performance and ruminal fermentation due to the level of fatty acid (FA) exposure of the cotyledon in soya bean grain and because the protein in small particles is more rapidly degraded than the protein in large particles, which influence ruminal fibre digestion and the amounts of ruminally undegradable nutrients. The objective of this experiment was to investigate the effects of raw soya bean particle size on productive performance, digestion and milk FA profile of dairy cows. Twelve Holstein cows were assigned to three 4 × 4 Latin squares with 21-day periods. At the start of the experiment, cows were 121 days in milk (DIM) and yielded 30.2 kg/day of milk. Cows were fed 4 diets: (i) control diet (CO), without raw soya bean; (ii) whole raw soya bean (WRS); (iii) cracked raw soya bean in Wiley mill 4-mm screen (CS4); and (iv) cracked raw soya bean in Wiley mill 2-mm screen (CS2). The inclusion of soya beans (whole or cracked) was 200 g/kg on dry matter (DM) basis and partially replaced ground corn and soya bean meal. Uncorrected milk yield and composition were not influenced by experimental diets; however, fat-corrected milk (FCM) decreased when cows were fed soya bean treatments. Soya bean diets increased the intake of ether extract (EE) and net energy of lactation (NEL ), and decreased the intake of DM and non-fibre carbohydrate (NFC). Ruminal propionate concentration was lower in cows fed WRS than cows fed CS2 or CS4. Cows fed cracked raw soya bean presented lower nitrogen in faeces than cows fed WRS. The milk of cows fed WRS, CS2 and CS4 presented higher unsaturated FA than cows fed CO. The addition of raw soya bean in cow diets, regardless of the particle size, did not impair uncorrected milk yield and nutrient digestion, and increased the concentration of unsaturated FA in milk. Cows fed cracked raw soya bean presented similar productive performance to cows fed whole raw soya bean. Journal of
Candia, A.
2008-01-01
The theme of the research is “Possibility of introducing smallholder Beef Cattle Farmers Association as a starting point to develop the beef chain and improve their income in Arua district, Uganda”. The study was carried out in two Sub Counties of Arua district, Uganda. The objective was to
Realini, C E; Font i Furnols, M; Sañudo, C; Montossi, F; Oliver, M A; Guerrero, L
2013-09-01
The effect of country of origin (local, Switzerland, Argentina, Uruguay), finishing diet (grass, grass plus concentrate, concentrate), and price (low, medium, high) on consumer's beef choice and segmentation was evaluated in Spain, France and United Kingdom. Sensory acceptability of Uruguayan beef from different production systems was also evaluated and contrasted with consumers' beef choices. Origin was the most important characteristic for the choice of beef with preference for meat produced locally. The second most important factor was animal feed followed by price with preference for beef from grass-fed animals and lowest price. The least preferred product was beef from Uruguay, concentrate-fed animals and highest price. Sensory data showed higher acceptability scores for Uruguayan beef from grass-fed animals with or without concentrate supplementation than animals fed concentrate only. Consumer segments with distinct preferences were identified. Foreign country promotion seems to be fundamental for marketing beef in Europe, as well as the development of different marketing strategies to satisfy each consumer segment. Copyright © 2013 Elsevier Ltd. All rights reserved.
United States Climate Reference Network (USCRN) Raw Observations from Datalogger
National Oceanic and Atmospheric Administration, Department of Commerce — Datalogger files are raw USCRN data. However, instead of being collected via satellite, the raw data are collected from station dataloggers (also referred to as...
DEFF Research Database (Denmark)
Schmidt, Garbi
2012-01-01
play within one particular neighbourhood: Nørrebro in the Danish capital, Copenhagen. The article introduces the concept of grounded politics to analyse how groups of Muslim immigrants in Nørrebro use the space, relationships and history of the neighbourhood for identity political statements....... The article further describes how national political debates over the Muslim presence in Denmark affect identity political manifestations within Nørrebro. By using Duncan Bell’s concept of mythscape (Bell, 2003), the article shows how some political actors idealize Nørrebro’s past to contest the present...... ethnic and religious diversity of the neighbourhood and, further, to frame what they see as the deterioration of genuine Danish identity....
Aleksić, S.; Fang, Sun; Di, Liu; Petrović, M.M.; Pantelić, V.; Stanišić, N.; Ostojić-Andrić, D.; Petričević, M.; Nikšić, D.; Delić, N.
2013-01-01
This paper presents the results of crossing Domestic Spotted breed with beef cattle breeds in the People's Republic of China and the Republic of Serbia. China is a big country of beef production and consumption. In 2012, beef production in China was 5,540,000 tons, which accounted for 9.7% of the global beef production, ranking the third in the world. The main sources of China’s beef are from crossbreeding cattle (native breed crossbred with foreign beef ca...
Chapter No.6. Radioactive waste (RAW)
International Nuclear Information System (INIS)
2002-01-01
installation 'Technologies for treatment and conditioning of radwaste' consists mainly of two bituminization plants and Bohunice Conditioning Centre (BSC RAW). Bituminization plants with capacity of 120 l/hour each are determined for bituminization of concentrates from VVER type NPPs and from A1 NPP Bohunice which are put into 200 l drums. The first one has been in operation since 1994 and its modification for discontinuous bituminization of ion-exchange resins and sludge is under way. The second one the commissioning of which has been finished successfully is now under licensing process for operation. At the end of 2001 total amount of concentrates treated by bituminization reached 941,7 m3. BSC RAW is the basic installed facility for final radwaste conditioning is. Besides cementation the technologies of incineration, fragmentation, high-pressure compaction as well as evaporation are used for radwaste treatment and conditioning at BSC RAW. Due to a complexity of commissioning of individual technologies, BSC RAW commissioning was divided in two phases which were realised in 2000. At the beginning of 2001 UJD issued the permission for BSC RAW operation on the basis of assessment of commissioning report. 144 pieces of FRC containers have been filled in during BSC RAW operation in 2001. As much as 51 t of solid radwaste and 3,9 m3 of liquid radwaste were incinerated, 85,7 t of solid radwaste were compacted and 186 m3 of concentrates were treated by cementation. Two treatment facilities are operated by VUJE Trnava. The bituminization plant has been out of operation during 2001 and incinerator with additional cementation facility have been used only for experimental purposes. National near surface repository in Mochovce is determined for the disposal of low and intermediate level short-living radwaste in special FRC containers as additional engineering barrier of repository. The repository construction was finished in November 1992. 52 containers with radwaste were disposed of
Evaluation of a rapid method for measurement of catalase activity in cooked beef and sausage.
Davis, C E; Cyrus, S
1998-02-01
Catalase (CAT) activity in ground beef and pork was determined on samples cooked from 60 to 71.1 degrees C. One-gram samples of ground round (4% fat), hamburger (24% fat), and commercial pork sausage (38%fat) were cooked in a controlled-temperature waterbath at 65, 68.3 and 71 degrees C. Chilled samples were immersed in direct contact with the cooking water; the test samples were removed every 15 s and immediately immersed in an ice-water bath (O to 1 degrees C) to quick-chill the samples to prevent temperature over-run. Samples retained high (HMB value 20+, over range) CAT activity through 90, 60, and 45 s at 65, 68.3, and 71 degrees C, respectively, before showing rapid activity decreases. Four USDA-FSIS approved meat patty heating processes (66.1 degrees C, 41 s; 67.2 degrees C, 26 s; 68.3 degrees C, 16 s; and 69.4 degrees C, 10 s) were analyzed for CAT activity in meat frozen prior to cooking was slightly lower (P sausage products and may be useful to USDA FSIS process inspectors and food processors in quality assurance and HACCP (hazard analysis critical control points) programs for thermal input verification.
19 CFR 151.22 - Estimated duties on raw sugar.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Estimated duties on raw sugar. 151.22 Section 151... THE TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Sugars, Sirups, and Molasses § 151.22 Estimated duties on raw sugar. Estimated duties shall be taken on raw sugar, as defined...
Effect Of Dietary Raw, Cooked And Toasted Mucuna Pruriens Seeds ...
African Journals Online (AJOL)
A 5-week feeding trial was conducted to determine the effect or dietary raw, cooked and toasted Mucuna pruriens seeds (velvet bean) on the performance of finisher broilers. Raw Mucuna pruriens seeds contained 30.3% crude protein. At 10% dietary level, raw and toasted Mucuna pruriens seed meals significantly (P ...
Beef customer satisfaction: factors affecting consumer evaluations of clod steaks.
Goodson, K J; Morgan, W W; Reagan, J O; Gwartney, B L; Courington, S M; Wise, J W; Savell, J W
2002-02-01
An in-home beef study evaluated consumer ratings of clod steaks (n = 1,264) as influenced by USDA quality grade (Top Choice, Low Choice, High Select, and Low Select), city (Chicago and Philadelphia), consumer segment (Beef Loyals, who are heavy consumers of beef; Budget Rotators, who are cost-driven and split meat consumption between beef and chicken; and Variety Rotators, who have higher incomes and education and split their meat consumption among beef, poultry, and other foods), degree of doneness, and cooking method. Consumers evaluated each steak for Overall Like, Tenderness, Juiciness, Flavor Like, and Flavor Amount using 10-point scales. Grilling was the predominant cooking method used, and steaks were cooked to medium-well and greater degrees of doneness. Interactions existed involving the consumer-controlled factors of degree of doneness and(or) cooking method for all consumer-evaluated traits for the clod steak (P affect any consumer evaluation traits or Warner-Bratzler shear force values (P > 0.05). One significant main effect, segment (P = 0.006), and one significant interaction, cooking method x city (P = 0.0407), existed for Overall Like ratings. Consumers in the Beef Loyals segment rated clod steaks higher in Overall Like than the other segments. Consumers in Chicago tended to give more uniform Overall Like ratings to clod steaks cooked by various methods; however, consumers in Philadelphia gave among the highest ratings to clod steaks that were fried and among the lowest to those that were grilled. Additionally, although clod steaks that were fried were given generally high ratings by consumers in Philadelphia, consumers in Chicago rated clod steaks cooked in this manner significantly lower than those in Philadelphia. Conversely, consumers in Chicago rated clod steaks that were grilled significantly higher than consumers in Philadelphia. Correlation and stepwise regression analyses indicated that Flavor Like was driving customer satisfaction of the
Shen, Cangliang; Geornaras, Ifigenia; Belk, Keith E; Smith, Gary C; Sofos, John N
2011-01-01
This study evaluated inactivation of Escherichia coli O157:H7 in moisture-enhanced restructured nonintact beef cooked to 65 °C using different cooking appliances set at different temperatures. Batches (2 kg) of coarse-ground beef (approximately 5% fat) were mixed with an 8-strain composite (100 mL) of rifampicin-resistant E. coli O157:H7 (6.4 ± 0.1 log CFU/g) and a solution (100 mL) of sodium chloride plus sodium tripolyphosphate to yield concentrations (wt/wt) of 0.5% and 0.25%, respectively, in the final product. Beef portions of 2.54 cm thickness (15 cm dia) were prepared and were vacuum-packaged and frozen (-20 °C, 42 h). Partially thawed (-2.5 ± 1.0 °C) portions were pan-broiled (Presto electric skillet and Sanyo grill) or roasted (Oster toaster oven and Magic Chef kitchen oven) to 65 °C. The appliances were set at, and preheated before cooking to 149 or 204 °C (electric skillet), 149 or 218 °C (grill), 149 or 232 °C (toaster oven), and 149, 204, or 260 °C (kitchen oven). Temperatures of appliances and beef samples were monitored with thermocouples, and meat samples were analyzed for surviving microbial populations. In general, the higher the appliance temperature setting, the shorter the time needed to reach 65 °C, and the higher the edge and surface temperatures of the meat samples. Temperatures of 204 to 260 °C, regardless of appliance, resulted in greater (P kitchen oven set at 260 °C. The results should be useful to the food service industry for selection of effective nonintact beef cooking protocols, and for use in risk assessments for nonintact meat products. Practical Application: Results of this study should be useful for developing cooking recommendations to enhance the safety of nonintact beef products, and for use in risk assessments of such products.
San-Julián, R.; Campo, M. M.; Nute, G.; Montossi, F.; Font-i-Furnols, M.; Guerrero, L.; Oliver, M. A.; Sañudo, C.
2012-01-01
The main goal of this study was to characterize and compare the organoleptic quality of beef from Uruguay and from three European countries. In Uruguay, 40 Hereford steers were raised exclusively under grazing conditions up to either two or three years old. Meat samples were aged for 20 days, matching commercial conditions. In Europe, one commercial local beef type, with two ageing times (7 and 20 days), from Germany, Spain and the United Kingdom were compared with Uruguayan beef samples, usi...
The Economic Effects of New-Product Beef Promotion in Guatemala
Leister, Amanda M.; Capps, Oral, Jr.; Rosson, C. Parr, III
2010-01-01
The implementation of the Central America-Dominican Republic Free Trade Agreement (CAFTA-DR) has expanded trade opportunities for U.S. agricultural producers. U.S. beef is an important product affected by the agreement, and the United States Meat Export Federation (USMEF) invested in a new product promotion program to increase exports of U.S. beef to Guatemala. Consumer responsiveness and the effectiveness of the U.S. branded beef promotion program are analyzed in this study. Demand responses...
Rahayu, Wiranti Sri; Rohman, Abdul; Martono, Sudibyo; Sudjadi, Sudjadi
2018-01-01
Beef meatball is one of the favorite meat-based food products among Indonesian community. Currently, beef is very expensive in Indonesian market compared to other common meat types such as chicken and lamb. This situation has intrigued some unethical meatball producers to replace or adulterate beef with lower priced-meat like dog meat. The objective of this study was to evaluate the capability of FTIR spectroscopy combined with chemometrics for identification and quantification of dog meat (D...
Bagirov, V A; Chernukha, I M; Lisitsin, A V; Zinovieva, N A
2014-01-01
The comparative study of the chemical composition and biological values of beef produced by hybrids of Angus cattle with wild yaks (hybrid beef) and pure-bred Angus cattle (traditional beef) has been carried out. Longissimus muscle samples were used for analysis. It was observed, that the hybrid beef samples had the practically equal protein content comparing to traditional beef (21.1 vs. 21.6 per cent) but were characterized by the lower fat content (1.2 vs. 2.5 per cent). The higher biological value of hybrid beef comparing to traditional beef has been shown. The value of protein-quality index, calculated as the ratio of tryptophan amino acid to oxyprolin and characterizing the ratio of high biological value proteins to low biological value proteins was 8.1 vs. 5.7. The values of amino acid indexes [ratio of essential amino acids (EAA) to non-essential amino acids (NAA) and ratio of EAA to the total amount of amino acids (TAA)] were EAA/NAA = 0.77 vs. 0.65 and EAA/TAA = 0.43 vs. 0.39. The protein of hybrid beef was characterized by the higher content of a number of the essential amino acids: by a factor of 1, 77 for threonin, 1.23--for valin, 1.09--for lysin, 1.17--for leucine and 1.19--for tryptophan. The amount of the essential amino acids in 1 gram of protein of the hybrid beef was 434.7 mg against 393.1 mg for traditional beef It has been shown, that the protein of the hybrid beef comparing to traditional beef is characterized by the higher values of the amino acid scores calculated for EAA.
Meat Standards Australia as an Innovation in the Australian Beef Production and Marketing System
Griffith, Garry R.; Thompson, John M.; Polkinghorne, Rod; Gunner, Richard
2010-01-01
Variable eating quality was identified as a major contributor to declining Australian beef consumption in the early 1990s. The primary issue was the inability to predict the eating quality of cooked beef before consumption. A R&D program funded by industry and Meat and Livestock Australia investigated the relationships between critical control points along the supply chain, cooking methods and beef palatability. These relationships were underpinned by extensive consumer taste panels. Out of t...
VALUE OF BEEF STEAK BRANDING: HEDONIC ANALYSIS OF RETAIL SCANNER DATA
Schulz, Lee L.; Schroeder, Ted C.; White, Katharine L.
2010-01-01
Consumers rely on experience and credence attributes when purchasing beef from retailers. It is essential for all beef industry sectors to recognize the complexity of consumer buying behavior. A hedonic model is estimated to determine if there are incentives to brand beef steaks, the types of brands that entertain price premiums, and the level of existing premiums. Most branded steaks garnered premiums along with organic claims, religious processing claims, and premium cuts. Factors influenci...
Raw materials for pellets; Rohstoffe fuer Pellets
Energy Technology Data Exchange (ETDEWEB)
Neumann, H.
2008-01-15
In order to keep the pellet prices stable, producers look for new raw materials. Sawdust as a former basis also competes with the manufacturers of chip boards and paper. Three classes of quality are discussed by the pellet manufacturers: (a) the DINplus pellet as a premium segment for which high-quality sawdust are used; (b) a wood pellet from natural wood with varying quality for the utilization in larger plants with filters; (c) the inexpensive industrial wood pellet which deviates from the DINplus commodity regarding to the ingredients and form and could be fired in larger power stations.
Globalization determinants of raw materials markets development
Directory of Open Access Journals (Sweden)
Olga Yatsenko
2013-02-01
Full Text Available The determinants of development of raw materials markets and the peculiarities of their formation in the terms of world economy globalization have been researched. The empirical base of research is the agricultural food market as one of the most important bases in the sphere of material production and provision of food security of the country. The important social and economic mission of the agricultural sector has been highlighted, along with the export competitiveness and import dependence of agricultural food products in the international trade. The imperative norms have been substantiated and conclusions have been drawn regarding the establishment of respective conditions for the operation of globally integrated markets in Ukraine.
Energies and raw materials. Letter n.28
International Nuclear Information System (INIS)
2007-01-01
This letter of the DGEMP (General Direction of the Energy and the Raw Materials) deals with the following four main topics: the main recommendations of the final report of the working Group ''Factor 4'' concerning the energy policy; the energy conservation certificates as a tool of the energy control with their implication in the residential and ternary sector; the increase of the solar water heaters and heat pumps sales thanks to the tax credits; the California example facing the climatic change and the energy policy. (A.L.B.)
Raw material selection for object construction
CSIR Research Space (South Africa)
Perlow, J
2017-11-01
Full Text Available on their visual appearance. In particular, we present a method for an agent to recognise the required unseen raw material images and link them to corresponding novel object images. This capability provides an agent with an increased degree of resourcefulness... construction from component parts, and in doing so we provide a benchmark for future work to compare against within Minecraft and ShapeNet domains. II. BACKGROUND Our model is inspired by Siamese neural networks, a class of neural network that includes multiple...
Contamination of beef products with staphylococcal classical enterotoxins in Egypt and Saudi Arabia
Directory of Open Access Journals (Sweden)
Shawish, Reyad R.
2016-04-01
Full Text Available Food-borne pathogens are of high concern for public health and food safety. food poisoning is one of the most economically devastating types of food poisoning globally. The purpose of this study was to detect staphylococcal classical enterotoxins (SEs in processed beef from Kingdom of Saudi Arabia (KSA and Egypt. In the present investigation a total of 250 random processed meat samples (50 each of minced meat, beef burger, beef sausage, beef kofta and beef luncheon were collected from different super markets in the study area. Using conventional cultural methods, samples were cultured for isolation and identification of . Multiplex PCR was used to detect SEs of the classical type SEA, SEB, SEC and SED from isolates.The percentage presence of in minced meat, beef burger, beef sausage, beef kofta and beef luncheon was 38%, 22%, 30%, 32% and 12%, respectively. Multiplex PCR indicated that all examined samples contain different types of classical staphylococcal enterotoxins and only minced meat samples contained all four types of toxins. Multiplex PCR is efficient in detection of SEs from food and may be used in tracing of toxins to promote food hygiene. Implications of contamination of processed meat to food hygiene in the study area are highlighted.
Draft Genome Sequence of Lactobacillus salivarius L28 Isolated from Ground Beef.
Ayala, Diana I; Cook, Peter W; Campos, David L; Brashears, Mindy M; den Bakker, Henk; Nightingale, Kendra K
2017-09-28
In this report, we describe the draft genome sequence of a newly discovered probiotic strain, Lactobacillus salivarius L28. L. salivarius L28 demonstrates antagonistic effects against human foodborne pathogens, including Escherichia coli O157:H7, Salmonella spp., and Listeria monocytogenes , in coculture experiments and food matrices. Copyright © 2017 Ayala et al.
Inactivation of shiga toxin-producing Escherichia coli in lean ground beef by gamma irradiation
Non-O157 serovars of Shiga Toxin-producing Escherichia coli (STEC) are now responsible for over 60% of STEC induced illnesses. The majority of illnesses caused by non-O157:H7 STEC have been due to serogroups O26, O121, O103, O45, O111, and O145, “the big/top six”, which are now considered adulterant...
A balancing method for calculating a component raw involving CGF
International Nuclear Information System (INIS)
Kim, K.; Kang, D.; Yang, J.E.
2004-01-01
In this paper, a method called the 'Balancing Method' to derive a component RAW (Risk Achievement Worth) with basic event RAWs including a CCF (Common Cause Failure) RAW is summarized, and compared with the method proposed by the NEI (Nuclear Energy Institute) by mathematically checking the background on which the two methods are based. It is proved that the Balancing Method has a strong mathematically background. While the NEI method significantly underestimates the component RAW and is a little bit ad hoc in handling CCF RAW, the Balancing Method estimates the true component RAW very closely. Validity of the Balancing Method is based on the fact that if an component is out-of-service, it does not mean that the component is non-existent, but integrates the possibility that the component might fail due to CCF. The validity of the Balancing Method is proved by comparing it to the exact component RAW generated from the fault tree model
Raw materials for reflector graphite (for reactors)
International Nuclear Information System (INIS)
Wilhelmi, G.; Mindermann, D.
1992-01-01
The manufacturing concept for the core components of German high temperature reactor (HTR) types of graphite was previously entirely directed to the use of German tar coke (St coke). As the plants for producing this material no longer complied technically with the current environmental protection requirements, one had to assume that they would soon be shut down. To prevent bottlenecks in the erection of future HTR plants, alternative cokes produced by modern processes by Japanese manufacturers were checked for their suitability for the manufacture of reactor graphite. This report describes the investigations carried out on these materials from the safe delayed coking process. The project work, apart from analysis of the main data of the candidate coke considered, included the processing of the raw materials into directly and secondarily extruded graphite rods on the laboratory scale, including characterisation. As the results show, the material data achieved with the previous raw material can be reproduced with Japanese St coke. The tar coke LPC-A from the Nippon Steel Chemical Co., Ltd was decided on as the new standard coke for manufacturing reflector graphite. (orig.) With 15 tabs., 2 figs [de
Comparison between conventional and ultrasonic preparation of beef tallow biodiesel
Energy Technology Data Exchange (ETDEWEB)
Teixeira, Leonardo S.G. [Instituto de Quimica - Universidade Federal da Bahia, Campus Universitario de Ondina, 40.170-280 - Salvador, Bahia (Brazil); Assis, Julio C.R.; Santos, Iran T.V.; Guimaraes, Paulo R.B.; Pontes, Luiz A.M. [Universidade Salvador - UNIFACS - Departamento de Engenharia e Arquitetura, - Av. Cardeal da Silva 132, 40.220-141 - Salvador, Bahia (Brazil); Mendonca, Daniel R. [Escola Politecnica - Universidade Federal da Bahia, Av. Aristides Novis 2, 40.210-630, Salvador, Bahia (Brazil); Teixeira, Josanaide S.R. [Instituto Federal de Educacao Ciencia e Tecnologica da Bahia - IFBAHIA - Rua Emidio de Morais S/N, 40.625-650, Salvador - BA (Brazil)
2009-09-15
Tallow is biodiesel feedstock that, due to its highly centralized generation in slaughter/processing facilities and historically low prices, may have energetic, environmental, and economic advantages that could be exploited. Transesterification of fatty acids by means of ultrasonic energy has been used for biodiesel production from different vegetable oils. However, application of ultrasonic irradiation for biodiesel production from beef tallow has received little attention. In this work, the transesterification of beef tallow with methanol was performed in the presence of potassium hydroxide as a catalyst using ultrasound irradiation (400 W, 24 kHz). The reaction time, conversion and biodiesel quality were compared with that seen in conventional transesterification. The results indicated that the reaction conversion and biodiesel quality were similar; however, the use of ultrasonic irradiation decreased the reaction time, showing that this method may be a promising alternative to the conventional method. (author)
You say "lean finely textured beef," I say "pink slime".
Reid, Rita-Marie Cain
2014-01-01
In 2012, American Broadcasting Companies, Inc. (ABC) broadcast a segment on its evening news show regarding the manufacture of "lean finely textured beef" by Beef Products, Inc. (BPI). The broadcast, as well as follow-up reports and social media communications, repeatedly referred to the product as "pink slime," a term originated by a United States Department of Agriculture (USDA) employee for the processed meat. The market backlash against the product was immediate and intense. Ultimately, BPI closed three processing plants, cut hundreds of jobs, and filed for bankruptcy. BPI sued ABC and others for food libel, defamation, and tortious interference. This research analyzes those claims and defenses and discusses the future of such cases.
Comparison between conventional and ultrasonic preparation of beef tallow biodiesel
International Nuclear Information System (INIS)
Teixeira, Leonardo S.G.; Assis, Julio C.R.; Santos, Iran T.V.; Guimaraes, Paulo R.B.; Pontes, Luiz A.M.; Mendonca, Daniel R.; Teixeira, Josanaide S.R.
2009-01-01
Tallow is biodiesel feedstock that, due to its highly centralized generation in slaughter/processing facilities and historically low prices, may have energetic, environmental, and economic advantages that could be exploited. Transesterification of fatty acids by means of ultrasonic energy has been used for biodiesel production from different vegetable oils. However, application of ultrasonic irradiation for biodiesel production from beef tallow has received little attention. In this work, the transesterification of beef tallow with methanol was performed in the presence of potassium hydroxide as a catalyst using ultrasound irradiation (400 W, 24 kHz). The reaction time, conversion and biodiesel quality were compared with that seen in conventional transesterification. The results indicated that the reaction conversion and biodiesel quality were similar; however, the use of ultrasonic irradiation decreased the reaction time, showing that this method may be a promising alternative to the conventional method. (author)
Optimising reproductive performance of beef cows and replacement heifers.
Diskin, M G; Kenny, D A
2014-05-01
A reproductively efficient beef cow herd is fundamental to meeting the protein and specifically, red meat demand of an ever increasing global population. However, attaining a high level of reproductive efficiency is underpinned by producers being cognisant of and achieving many key targets throughout the production cycle and requires significant technical competency. The lifetime productivity of the beef bred female commences from the onset of puberty and will be dictated by subsequent critical events including age at first calving, duration of the postpartum interval for each successive calving, conception and pregnancy rate and ultimately manifested as length of intercalving intervals and number of calves weaned over her lifetime. Puberty in heifers is a consequence of the interactive effects of genetics and both pre- and post-weaning nutrition. Early onset of puberty is essential to achieving the first main reproductive target for beef cow herds; first calving at 2 years of age. In calved heifers and mature cows, the onset of ovarian activity, postpartum is a key event dictating the calving interval. Again, this will be the product mainly of prepartum nutrition, manifested through body condition and the strength of the maternal bond between cow and calf, though there is increasing evidence of a modest genetic influence on this trait. Following the initiation of postpartum ovarian cyclicity, conception and subsequent pregnancy rate is generally a function of bull fertility in natural service herds and heat detection and timing of insemination in herds bred through artificial insemination. Cows and heifers should be maintained on a steady plane of nutrition during the breeding season, but the contribution of significant excesses or deficiencies of nutrients including protein and trace elements is likely to be minor where adequate pasture is available. While, increased efforts are being made internationally to genetically identify and select for more reproductively
Identifying efficiency trends for Queensland broad-acre beef enterprises
Gregg, Daniel; Rolfe, John
2010-01-01
Productivity and efficiency improvements in agriculture have recently been targeted as Federal Government priorities in Australia. This research examined a dataset of 116 broad-acre beef enterprises from Queensland who participated in a program, Profit Probe, developed to improve management and profitability of enterprises. The aim of this research was to identify the sources, if any, of productivity growth for this sample of enterprises. Two potential sources of productivity growth were iden...
Evaluation of Fresh Food Internet Shopping in Korean Beef
金, 鍾和; 森高, 正博; 福田, 晋; Kim, Jong-hwa; Moritaka, Masahiro; Fukuda, Susumu
2013-01-01
This paper focuses on consumer reactions to the fresh food internet shopping on Korea beef. In the paper, we have analyzed an effective relation in consumer's perceived qualities, the evaluation of commodities and the evaluation of fresh food internet shopping. As a result, two effective relations were found. Firstly, consumer's perceived qualities affect the evaluation of commodities. Secondly, the evaluation of commodities affects t-he evaluation of fresh food internet shopping. This result...
Electrophoretic comparison of nuclear and nucleolar proteins : I. Beef Pancreas
Poort, C.
1961-01-01
Nuclei and nucleoli, isolated from beef pancreas, are extracted with 0.14 M NaCl, 1 M NaCl and 0.1 N NaOH in the order given. The 0.14 M NaCl and 0.1 N NaOH extracts lend themselves to paper and agar electrophoresis and the electropherograms obtained from these extracts of nuclei and nucleoli are
Assessing impacts of organic production on pork and beef quality
Sundrum, Albert
2010-01-01
Organic livestock farming is based on a low input production method, aiming to provide products of a high product and process quality rather than maximizing production. The production of a high meat quality corresponds to the expectations of consumers who are both seeking a premium product and who are willing to pay premium prices. This review focuses on the question of whether organic pork and beef production currently meet consumer demands, and it elaborates the potentials and limitations f...
Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A
2014-08-01
Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.
Calm temperament improves reproductive performance of beef cows.
Kasimanickam, R; Asay, M; Schroeder, S; Kasimanickam, V; Gay, J M; Kastelic, J P; Hall, J B; Whittier, W D
2014-12-01
Profitability of a beef operation is determined by the proportion of cows attaining pregnancy early in the breeding season and those that are pregnant at the end of breeding season. Many factors, including temperament, contribute to those reproductive parameters. The objective of this study was to evaluate effects of temperament on reproductive performance of beef cows. In Experiment 1, Angus and Angus-cross beef cows (n = 1546) from eight locations were assigned a body condition score (BCS; 1 = emaciated; 9 = obese) and chute exit and gait score (1 = slow exit, walk; calm temperament; 2 = jump, trot or run; excitable temperament). Cows were grouped with bulls (1 : 25 to 1 : 30; with satisfactory breeding potential and free of venereal disease) for an 85-day breeding season. Pregnancy status and stage of gestation were determined (transrectal palpation) 35 days after the end of the breeding season. Controlling for BCS (p score interaction (p scores for body condition and chute exit and gait (as described in Experiment 1) and assigned to bulls (breeding sound and free of venereal disease; 1 : 25 to 1 : 30) for 85 days. Pregnancy status was determined by transrectal palpation at 2 and 6 months after the onset of the breeding season. Controlling for BCS (p reproductive performance than calmer cows. The modified two-point chute exit-gait scoring method was repeatable and identified cattle with an excitable temperament. © 2014 Blackwell Verlag GmbH.
Cooking frozen and thawed roasts: beef, pork, and lamb cuts.
Fulton, C; Davis, C
1975-09-01
Cooking time, yield, and palatability of paired beef, pork, and lamb roasts cooked from the frozen and thawed states were compared. Cooking time for all roasts averaged from 3 to 22 min. per pound longer for meat cooked from the frozen state. The longer cooking time from the frozen state. The longer cooking time from the frozen state was greater for roasts with a large amount of bone and for cuts cooked by braising than for less bony roasts and cuts cooked by roasting. Except for thawed beef rump roasts, which had a higher yield of cooked lean meat, yield of cooked lean meat from the various cuts of beef, pork, and lamb was not affected by the state at the start of cooking. Collectively, all pork roasts had a higher yield of cooked lean meat when cooked from the frozen state. Juiciness and natural flavor of the roasts were not affected by the state at the start of cooking. Lamb leg and rib roasts were more tender when cooked from the thawed state.
Sensory quality of beef from different finishing diets.
Resconi, V C; Campo, M M; Font i Furnols, M; Montossi, F; Sañudo, C
2010-11-01
Beef production under different local husbandry systems might have meat sensory quality implications for the marketing of these products abroad. In order to assess the effect of finishing diet systems on beef quality, a trained sensory taste panel assessed meat aged for 20 days from 80 Uruguayan Hereford steers that were finished on one of the following diets: T1=Pasture [4% of animal live weight (LW)], T2=Pasture [3% LW plus concentrate (0.6% LW)], T3=Pasture [3% LW plus concentrate (1.2% LW)], or T4=Concentrate plus hay ad libitum. Beef odour and flavour intensities decreased with an increase in the energy content of the diet. The meat from T2 had the lowest acid flavour and strange odours intensities. In general, steers fed only concentrate plus hay (T4) produced meat that had an inferior sensory quality because they had more pronounced off-flavours and was tougher. Copyright © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Říha, J.; Kadlec, R.; Vondra, Vlastimil; Bezdíček, J.
2009-01-01
Roč. 51, č. 4 (2009), s. 38-49 ISSN 0139-7265 Institutional research plan: CEZ:AV0Z20650511 Keywords : beef quality * biompedance * basic chemical composition of beef Subject RIV: GM - Food Processing
Directory of Open Access Journals (Sweden)
Mustafa KARAKAYA
1997-02-01
Full Text Available Emulsion parameters of different meat by-products (beef head-meat, beef heart and liver and animal fats and oil (beef fat, mutton fat, sheep tail-fat and corn oil were studied in a model system. The results of the study showed that the highest emulsion capacity (EC was with the heart meat and beef fat emulsion while the lowest EC was measured in the beef head-meat and sheep tail-fat combination. Corn oil gave the best emulsification with beef head-meat and liver, and beef fat resulted the second best results. Beef head-meat gave the most stable emulsion with all fats, but the emulsions prepared with heart and liver were generally unstable.
Amylolysis of raw corn by Aspergillus niger for simultaneous ethanol fermentation
Energy Technology Data Exchange (ETDEWEB)
Han, I.Y.; Steinberg, M.P.
1987-01-01
The novelty of this approach was hydrolysis of the raw starch in ground corn to fermentable sugars that are simultaneously fermented to ethanol by yeast in a nonsterile environment. Thus, the conventional cooking step can be eliminated for energy conservation. A koji of Aspergillus niger grown on whole corn for 3 days was the crude enzyme source. A ratio of 0.2 g dry koji/g total solids was found sufficient. Optimum pH was 4.2. Ethanol concentration was 7.7% (w/w) in the aqueous phase with 92% raw starch conversion. Agitation increased rate. Sacharification was the rate-limiting step. The initial ethanol concentration preventing fermentation was estimated to be 8.3% by weight. (Refs. 96).
Lime kiln dust as a potential raw material in portland cement manufacturing
Miller, M. Michael; Callaghan, Robert M.
2004-01-01
In the United States, the manufacture of portland cement involves burning in a rotary kiln a finely ground proportional mix of raw materials. The raw material mix provides the required chemical combination of calcium, silicon, aluminum, iron, and small amounts of other ingredients. The majority of calcium is supplied in the form of calcium carbonate usually from limestone. Other sources including waste materials or byproducts from other industries can be used to supply calcium (or lime, CaO), provided they have sufficiently high CaO content, have low magnesia content (less than 5 percent), and are competitive with limestone in terms of cost and adequacy of supply. In the United States, the lime industry produces large amounts of lime kiln dust (LKD), which is collected by dust control systems. This LKD may be a supplemental source of calcium for cement plants, if the lime and cement plants are located near enough to each other to make the arrangement economical.
Hocquette, Jean-Francois; Bernard-Capel, Carine; Vidal, Veronique; Jesson, Beline; Levéziel, Hubert; Renand, Gilles; Cassar-Malek, Isabelle
2012-08-15
Previous research programmes have described muscle biochemical traits and gene expression levels associated with beef tenderness. One of our results concerning the DNAJA1 gene (an Hsp40) was patented. This study aims to confirm the relationships previously identified between two gene families (heat shock proteins and energy metabolism) and beef quality. We developed an Agilent chip with specific probes for bovine muscular genes. More than 3000 genes involved in muscle biology or meat quality were selected from genetic, proteomic or transcriptomic studies, or from scientific publications. As far as possible, several probes were used for each gene (e.g. 17 probes for DNAJA1). RNA from Longissimus thoracis muscle samples was hybridised on the chips. Muscles samples were from four groups of Charolais cattle: two groups of young bulls and two groups of steers slaughtered in two different years. Principal component analysis, simple correlation of gene expression levels with tenderness scores, and then multiple regression analysis provided the means to detect the genes within two families (heat shock proteins and energy metabolism) which were the most associated with beef tenderness. For the 25 Charolais young bulls slaughtered in year 1, expression levels of DNAJA1 and other genes of the HSP family were related to the initial or overall beef tenderness. Similarly, expression levels of genes involved in fat or energy metabolism were related with the initial or overall beef tenderness but in the year 1 and year 2 groups of young bulls only. Generally, the genes individually correlated with tenderness are not consistent across genders and years indicating the strong influence of rearing conditions on muscle characteristics related to beef quality. However, a group of HSP genes, which explained about 40% of the variability in tenderness in the group of 25 young bulls slaughtered in year 1 (considered as the reference group), was validated in the groups of 30 Charolais young
Directory of Open Access Journals (Sweden)
Hocquette Jean-Francois
2012-08-01
Full Text Available Abstract Background Previous research programmes have described muscle biochemical traits and gene expression levels associated with beef tenderness. One of our results concerning the DNAJA1 gene (an Hsp40 was patented. This study aims to confirm the relationships previously identified between two gene families (heat shock proteins and energy metabolism and beef quality. Results We developed an Agilent chip with specific probes for bovine muscular genes. More than 3000 genes involved in muscle biology or meat quality were selected from genetic, proteomic or transcriptomic studies, or from scientific publications. As far as possible, several probes were used for each gene (e.g. 17 probes for DNAJA1. RNA from Longissimus thoracis muscle samples was hybridised on the chips. Muscles samples were from four groups of Charolais cattle: two groups of young bulls and two groups of steers slaughtered in two different years. Principal component analysis, simple correlation of gene expression levels with tenderness scores, and then multiple regression analysis provided the means to detect the genes within two families (heat shock proteins and energy metabolism which were the most associated with beef tenderness. For the 25 Charolais young bulls slaughtered in year 1, expression levels of DNAJA1 and other genes of the HSP family were related to the initial or overall beef tenderness. Similarly, expression levels of genes involved in fat or energy metabolism were related with the initial or overall beef tenderness but in the year 1 and year 2 groups of young bulls only. Generally, the genes individually correlated with tenderness are not consistent across genders and years indicating the strong influence of rearing conditions on muscle characteristics related to beef quality. However, a group of HSP genes, which explained about 40% of the variability in tenderness in the group of 25 young bulls slaughtered in year 1 (considered as the reference group, was
Application of Technology on Improving Beef Cattle Productivity in East Nusa Tenggara
Directory of Open Access Journals (Sweden)
Wirdahayati R B
2010-03-01
Full Text Available The Province of East Nusa Tenggara (NTT had been one of the major beef cattle suppliers under traditional management system in Indonesia. The beef cattle farming that based on grazing native pasture and the introduction of shrub legumes (Leucaena leucocephala may contribute to around 15 – 50% of the farmers’ household income. In the last few years, supply of beef cattle tended to decline due to the decrease in cattle population in NTT. Some basic improvements in management and feeding toward increasing beef cattle productivities had been carried out in Nusa Tenggara, such as a baseline survey on Cattle Health and Productivity Survey (CHAPS conducted in 1990 – 1992. The objective of the program was to identify the existing beef cattle productivity and health condition throughout Nusa Tenggara. A collaborative research with the Ministry of Research and Technology (Integrated Prime Research had also been carried out and the result showed that early weaning in Bali calves that can be practised as early as 3 – 6 months to prevent calves losses during the dry season. A program of the Assessment on Beef Cattle Base Farming Activities had also been conducted to improve fattening and breeding practices through the improvement in beef cattle management and feeding systems. At the latest development, fattening scheme has been introduced under a partnership approach involving private sectors and cooperatives. This needs to be facilitated by the government to accelerate the program such as access to capital and intensive extension services to build farmers awareness toward profit oriented beef cattle farming. Optimalization of the available potential resources and technology in NTT, will be an opportunity to enhance beef cattle production and gains back the reputation as one of the major producing beef cattle in the past. This will also support the national livestock program nowadays, called Beef Cattle Self Sufficiency Program 2014.
Savadkoohi, Sobhan; Hoogenkamp, Henk; Shamsi, Kambiz; Farahnaky, Asgar
2014-08-01
The present investigation focuses on the textural properties, sensory attributes and color changes of beef frankfurter, beef ham and meat-free sausage produced by different levels of bleached tomato pomace. The texture and color profile were performed using an instrumental texture analyzer and colorimeter. The findings indicated that tomato pomace-added sausages had higher water holding capacity (WHC) compared to that of commercial samples. The frankfurters containing 5 and 7% (w/w) tomato pomace had the highest redness (a*), chroma (C*) and color differences (ΔE) values, while the meat-free sausages containing 7% (w/w) tomato pomace had significant (p0.05) color differences between beef ham samples (with and without tomato pomace). A significant progression in the textural hardness and chewiness of systems containing tomato pomace was observed as well as higher sensory scores by panelists. According to sensorial evaluations, bleached tomato pomace improved the consumer acceptability and preference. Copyright © 2014 Elsevier Ltd. All rights reserved.
Energies and raw materials. The energy situation
International Nuclear Information System (INIS)
1997-11-01
Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in November 1997: primary energy total consumption has increased (mobile year) of 0.6%, at a slightly inferior rate than the rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 9.3%), slight increase for petroleum products (+ 1.2%), markedly slowing down increase for gas (+ 1.4%) and moderate increase for electricity (+ 1.3%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a maintained high energy cost level with + 14% on one year, reaching 86.8 billions Francs, to be compared to 76.1 in November 1996
WATER NETWORK INTEGRATION IN RAW SUGAR PRODUCTION
Directory of Open Access Journals (Sweden)
Junior Lorenzo Llanes
2017-07-01
Full Text Available One of the main process industries in Cuba is that of the sugarcane. Among the characteristics of this industry is the high demand of water in its processes. In this work a study of water integration was carried out from the different operations of the production process of raw sugar, in order to reduce the fresh water consumption. The compound curves of sources and demands were built, which allowed the determination of the minimum water requirement of the network (1587,84 m3/d, as well as the amount of effluent generated (0,35 m3/tcane.The distribution scheme of fresh water and water reuse among different operations were obtained from the nearest neighbor algorithm. From considering new quality constrains was possible to eliminate the external water consumption, as well as to reduce the amount of effluent in a 37% in relation to the initial constrains.
The hygienic quality of raw reindeer milk
Directory of Open Access Journals (Sweden)
Joanna Kurki
2004-04-01
Full Text Available The somatic cell count (SCC and total bacterial count (TBC as well as the presence of major food-borne pathogens and udder pathogens in reindeer raw milk were studied. Two groups of 4 female reindeer were milked on alternate days for six weeks. A milk sample from each quarter was taken before milking and of the bulk milk at the end of milking. Micrococcus sp. was observed in one, Staphylococcus aureus in one and coagulase-negative staphylococci in five of the quarter samples (n=318. In the bulk milk (n=19 TBC varied between 700 and 1 700 000 cfu (colony forming units/ml and SCC between 52 000 and 183 000 cells/ml. No Bacillus cereus, S. aureus or Listeria monocytogenes were detected in the bulk milk, but Escherichia coli and Enterobacteriaceae were found in 5 bulk milk samples. According to the bacteriological examination the udder health of the reindeer was good. Indicative information on the SCC of healthy reindeer was obtained. None of the common potential food-poisoning bacteria were found in raw milk. There was great variation in the bulk milk TBC and the average TBC was rather high (ca. 300 000 cfu/ml. The hygienic quality of raw reindeer milk makes it well suited for food manufacture. However, the results indicate that the milking conditions may be crucial for the quality of raw milk.Abstract in Finnish / Yhteenveto:Tutkimuksen kohteena oli poron raakamaidon solupitoisuus ja kokonaispesäkeluku sekä tärkeimpien elintarvike- ja utarepatogeenien esiintyminen raakamaidossa. Kaksi 4 vaatimen ryhmää lypsettiin vuoropäivinä 6 viikon ajan. Ennen lypsyä vaatimista otettiin vedinkohtaiset näytteet ja lypsyn päätyttyä näyte yhteismaidosta. Micrococcus sp. todettiin yhdessä, Staphylococcus aureus yhdessä ja koagulaasinegatiivisia stafylokokkeja viidessä vedinkohtaisessa näytteessä (n=318. Yhteismaitonäytteiden (n=19 kokonaispesäkeluvut vaihtelivat välillä 700-1 700 000 pmy (pesäkkeitä muodostava yksikkö/ml ja somaattisten
Norwalk virus gastroenteritis following raw oyster consumption.
Gunn, R A; Janowski, H T; Lieb, S; Prather, E C; Greenberg, H B
1982-03-01
In January, 1980, six out of 13 persons (46%) attending a party in a small northwest Florida town near the Gulf of Mexico became ill with Norwalk virus gastroenteritis after eating raw oysters. Symptoms experienced by the ill persons were principally nausea (100%), vomiting (83%) and diarrhea (50%) and were of brief duration. The symptom complex and epidemiology of Norwalk virus infection closely resemble the gastrointestinal illness commonly referred to as the 24-hour intestinal flu or "stomach flu." Norwalk virus infection was identified in this outbreak by application of a recently developed sensitive and specific serologic radioimmunoassay. Oysters from the incriminated batch had fecal coliform levels above recommended standards; however, recent studies of oyster-harvesting waters have shown only a weak correlation between fecal coliforms and the presence of enteric viruses. Further studies are needed to determine whether modifications of monitoring modalities for oyster-harvesting waters are needed.
From Raw Data to Physics Results course
CERN. Geneva HR-RFA
2006-01-01
It would be helpful for students to know: a) How measurements are made in physical detectors, for example how a tracking chamber "sees" a charged particle or how a calorimeter measures energy. b) That physics processes result in photons, leptons, etc., which we then want to detect and analyze. These series of lectures describes the work that lies between the raw data taken by the detector elements and the physics variables used to study particular reactions. We start with an example analysis to show the kinds of information needed. We then describe the fitting process used to extract values from the observed patterns in typical detectors. This is followed by a discussion of the various problems of pattern recognition in tracking, calorimetry and particle identification detectors. The role of Monte Carlo simulation in understanding the quality of the obtained information is examined. We discuss how the use of "composite" observables is required due to what our instrumentation and reconstruction can achieve. Th...
From Raw Data to Physics Results
CERN. Geneva
2005-01-01
These series of lectures describes the work that lies between the raw data taken by the detector elements and the physics variables used to study particular reactions. We start by defining some simple physics variables of interest, then describe the fitting process used to extract values from the observed patterns in typical detectors. This is followed by a discussion of the various problems of pattern recognition in tracking, calorimetry and particle identification detectors. The process of calibration and alignment is surveyed, with emphasis on getting "reasonable" results in the absence of formally complete information. Finally, the role of Monte Carlo simulation in understanding the quality of the obtained information is examined. Throughout, we emphasize how the use of "composite" observables is required due to what our instrumentation and reconstruction can achieve.
Energies and raw materials. The energy situation
International Nuclear Information System (INIS)
1997-09-01
Statistics are given on the energy and raw materials (coal, oil, etc.) production and consumption levels in France in September 1997: primary energy total consumption has increased (mobile year) of 1.1%, at the same rate since 3 years. Interior demand has varied depending on the energy: strong decrease for coal (- 5.9%), slight increase for petroleum products (+ 0.8%), strong increase for gas (+ 3.2%) and moderate increase for electricity (+ 1.7%). An increase in the dollar exchange rate and a high level of oil and gas imports have induced a record energy cost level with + 30% on one year, reaching 89.2 billions Francs, to be compared to 68.5 in September 1996
2011-12-09
.... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... major cuts of single-ingredient, raw meat and poultry products and ground or chopped meat and poultry... Ground or Chopped Meat and Poultry Products'' in the Federal Register (75 FR 82148) that, among other...
Raw Sewage Harbors Diverse Viral Populations
Cantalupo, Paul G.; Calgua, Byron; Zhao, Guoyan; Hundesa, Ayalkibet; Wier, Adam D.; Katz, Josh P.; Grabe, Michael; Hendrix, Roger W.; Girones, Rosina; Wang, David; Pipas, James M.
2011-01-01
ABSTRACT At this time, about 3,000 different viruses are recognized, but metagenomic studies suggest that these viruses are a small fraction of the viruses that exist in nature. We have explored viral diversity by deep sequencing nucleic acids obtained from virion populations enriched from raw sewage. We identified 234 known viruses, including 17 that infect humans. Plant, insect, and algal viruses as well as bacteriophages were also present. These viruses represented 26 taxonomic families and included viruses with single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), positive-sense ssRNA [ssRNA(+)], and dsRNA genomes. Novel viruses that could be placed in specific taxa represented 51 different families, making untreated wastewater the most diverse viral metagenome (genetic material recovered directly from environmental samples) examined thus far. However, the vast majority of sequence reads bore little or no sequence relation to known viruses and thus could not be placed into specific taxa. These results show that the vast majority of the viruses on Earth have not yet been characterized. Untreated wastewater provides a rich matrix for identifying novel viruses and for studying virus diversity. Importance At this time, virology is focused on the study of a relatively small number of viral species. Specific viruses are studied either because they are easily propagated in the laboratory or because they are associated with disease. The lack of knowledge of the size and characteristics of the viral universe and the diversity of viral genomes is a roadblock to understanding important issues, such as the origin of emerging pathogens and the extent of gene exchange among viruses. Untreated wastewater is an ideal system for assessing viral diversity because virion populations from large numbers of individuals are deposited and because raw sewage itself provides a rich environment for the growth of diverse host species and thus their viruses. These studies suggest that
Serdaroğlu, M.; Nacak, B.; Karabıyıkoğlu, M.; Tepe, M.; Baykara, I.; Kökmen, Y.
2017-09-01
In this study, the effects of adding pumpkin seed oil (PSO) in water emulsion to model system chicken meat emulsions (MSME) on product quality and oxidative stability were investigated. MSME were produced by replacing 25% (P25) and 50% (P50) of beef fat with PSO-in-water emulsion (PSO/W) while control treatment was prepared with only beef fat. Addition of PSO/W to the formulation resulted in significant differences in chemical composition and pH values of both raw and cooked MSME treatments. The use of PSO/W produced significant improvements to emulsion stability, oxidative stability and cooking yield of MSME. It was determined that the use of PSO/W formulation results in decreased total expressible fluid values and increased cooking yields of the emulsions. It was observed that the highest cooking yield and the lowest total expressible fluid were found in the sample containing 50% PSO/W. It should be a feasible strategy to produce fat-reduced meat products with healthier lipid profiles by using PSO/W.
Genotype x Nutritional Environment Interaction in a Composite Beef Cattle Breed
Environmental effects have been shown to influence several economically important traits in beef cattle. In this study, genetic x nutritional environment interaction has been evaluated in a composite beef cattle breed(50% Red Angus, 25% Charolais, 25% Tarentaise).Cows were randomly assigned to be fe...
9 CFR 319.312 - Pork with barbecue sauce and beef with barbecue sauce.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Pork with barbecue sauce and beef with barbecue sauce. 319.312 Section 319.312 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE..., Frozen, or Dehydrated Meat Food Products § 319.312 Pork with barbecue sauce and beef with barbecue sauce...
Suckling behaviour and fertility in beef cows on pasture 2. Influence ...
African Journals Online (AJOL)
For two weeks prior to the start of the breeding season, the sucklingbehaviour of beef calves, separated from their dams for 12 h out of ..... BARB., C.R.. 1986. Naloxone infusion increases pulsatile luteinizing hormone release in post partum beef cows. Dom. Anim. Endocrin. 3, 49. WILLIAMS. G.L., KOTWICA. 1., SLANGER ...
Mazzetto, A.M.; Feigl, B.J.; Schils, R.L.M.; Cerri, C.E.P.; Cerri, C.C.
2015-01-01
Brazilian farms produce 15% of the world[U+05F3]s beef, and consequently they are important sources of greenhouse gases (GHG). The beef sector faces the challenge to meet the increasing demand without further increase of GHG emissions. To reduce the pressure on forests it is essential that
Rincker, P.J.; Bechtel, P.J.; Finstadt, G.; Buuren, Van R.G.C.; Killefer, J.; McKeith, F.K.
2006-01-01
The longissimus from caribou (n = 6), reindeer (n = 6) and beef (n = 6) were evaluated to determine differences in composition, color and sensory properties. Caribou contained the least fat followed by reindeer, and then beef (P <0.05). Both venison sources contained more heme pigment and had a
Economics and environmental footprints of beef cattle raised on natural pasture or combined with soybean in specific biomes are still not well evaluated. The objective of this research was to simulate and evaluate the economics of three common pastured beef grazing systems in southern Brazil along w...
Documentation of 50% water conservation in a single process at a beef abattoir
Beef slaughter is water intensive due to stringent food safety requirements. We conducted a study at a commercial beef processor to demonstrate water conservation by modifying the mechanical head wash. We documented the initial nozzle configuration (112 nozzles), water pressure (275 kPa), and flowra...
NITROUS OXIDE EMISSIONS FROM SOUTHERN HIGH PLAINS BEEF CATTLE FEEDYARDS: MEASUREMENT AND MODELING
Predictive models for nitrous oxide emission are crucial for assessing the greenhouse gas footprint of beef cattle production. The Texas Panhandle produces approximately 42% of finished beef in the U.S. and cattle production is estimated to contribute 8 Tg carbon dioxide equivalents from nitrous oxi...
Spatial variability in nitrous oxide and methane emissions from beef cattle feedyard pen surfaces
Greenhouse gas emissions from beef cattle feedlots include enteric carbon dioxide and methane, and manure-derived methane, nitrous oxide and carbon dioxide. Enteric methane comprises the largest portion of the greenhouse gas footprint of beef cattle feedyards. For the manure component, methane is th...
Association of microRNAs with antibody response to mycoplasma bovis in beef cattle
The objective of this study was to identify microRNAs associated with a serum antibody response to Mycoplasma bovis in beef cattle. Serum from sixteen beef calves was collected at three points: in summer after calves were born, in fall at weaning, and in the following spring. All sera collected in t...
Derivation of economic values for veal, beef and milk production traits using profit equations.
Bekman, H.; Arendonk, van J.A.M.
1993-01-01
In this study profit equations for milk, veal and beef bull production were developed to obtain economic values for different traits. Veal and beef production were described in terms of fat and protein daily gain. For categorical traits, dystocia and carcass quality traits, economic values were
Transcriptome differences in the rumen of beef steers with variation in feed intake and gain
Feed efficiency is an economically important trait in beef production. The rumen wall interacts with feed, microbial populations and volatile fatty acids important to ruminant nutrition indicating it may play a critical role in the beef steer’s ability to utilize feedstuffs efficiently. To identif...
Fatty acid profile of zebu beef cattle from the Central African sub ...
African Journals Online (AJOL)
Additionally, based on the polyunsaturated FA (PUFA) proportion, 13.9% of the total lipids and n-6/n-3 PUFA ratio, 1.95, consumption of beef from these breeds could be beneficial to human health. This is possibly owing to the pasture feeding and low fat content of the beef. Keywords: Intramuscular fat; fatty acid composition ...
Documentation of 50% water conservation in a single process at a beef abattoir. Meat Science
Beef slaughter is water intensive due to stringent food safety requirements. We conducted a study at a commercial beef processor to demonstrate water conservation by modifying the mechanical head wash. We documented the initial nozzle configuration (112 nozzles), water pressure (275 kPa), and flowra...
An environmental assessment of grass-finishing beef operations in Pennsylvania
Concern for the environmental sustainability of traditional beef production has increased consumer interest in alternatively produced beef products perceived to be more environmentally friendly. This includes those marketed under “grassfed beef” labels. However, little information exists on the env...
The effects of degree of dark cutting on tenderness and sensory attributes of beef
The objective of this study was to determine the effect of degree of dark cutting (DC) on the tenderness, juiciness, and flavor attributes of beef. During carcass grading at a large U.S. commercial beef harvesting facility, DC carcasses (n = 160) and matching normal control (NC) carcasses (n = 160)...
The effect of technology information on consumer expectations and liking of beef.
Van Wezemael, Lynn; Ueland, Øydis; Rødbotten, Rune; De Smet, Stefaan; Scholderer, Joachim; Verbeke, Wim
2012-02-01
European consumers increasingly attach value to process characteristics of food. Although beef technologies are hardly communicated to consumers, providing consumer-oriented information about technology application might increase perceived transparency and consumer acceptance. This study investigates how information about beef technologies influences consumer expectations and liking of beef. Beef consumers in Belgium (n = 108) and Norway (n = 110) participated in an information experiment combined with sensory testing in which each consumer tasted three beef muscles treated with different technologies: unprocessed tenderloin M. Psoas major, muscle profiled M. Infraspinatus, and marinated (by injection) M. Semitendinosus. The findings indicate that detailed information about beef technologies can enhance consumers' expectations and liking of beef. However, this effect differs between countries and beef technologies. Information becomes either less relevant when the product is actually tasted, as indicated by the findings in Norway, or more relevant when information is confirmed by own experience during tasting, as indicated by the findings in Belgium. Copyright © 2011 Elsevier Ltd. All rights reserved.
An index for beef and veal characteristics in dairy cattle based on carcass traits.
Werf, van der J.H.J.; Waaij, van der E.H.; Groen, A.F.; Jong, de G.
1998-01-01
Carcass data are nowadays routinely collected from Dutch slaughterhouses. The aim of this study was to develop a selection index for beef production traits in a dairy cattle population based upon such data. Records were available from three categories of animals: veal calves, beef bulls, and cows
What Brings People to Leadership Roles: A Phenomenological Study of Beef Industry Leaders
Gordon, B. Lynn; Ellis, Jason D.
2013-01-01
Leadership has been deeply studied in the literature; however, little research exists studying the role of volunteer peer leaders in non-formalized leadership roles in membership-based organizations. This phenomenological study was designed to explore the experience of beef industry leaders in leadership roles. Twelve active beef industry…