
Sample records for griffiss afb integrated

  1. Griffiss Air Force Base integrated resource assessment. Volume 3, Electric resource assessment

    Energy Technology Data Exchange (ETDEWEB)

    Armstrong, P.R.; Shankle, S.A.; Elliott, D.B.; Stucky, D.J.; Keller, J.M.; Wahlstrom, R.R.; Dagle, J.E.; Gu, A.Y.


    The US Air Force Air Combat Command (ACC) has tasked the US Department of Energy (DOE) Federal Energy Management Program (FEMP) to identify, evaluate, and assist in acquiring all cost-effective energy projects at Griffiss Air Force Base (AFB). FEMP, with support from the Pacific Northwest Laboratory (PNL), is designing this model program for federal customers served by the Niagara Mohawk Power Company. The program with Griffiss AFB will (1) identify and evaluate all cost-effective electric energy projects; (2) develop a schedule for project acquisition considering project type, size, timing, capital requirements, as well as energy and dollar savings; and (3) secure 100% of the financing required to implement electric energy efficiency projects from Niagara Mohawk and have them procure the necessary contractors to perform detailed audits and install the technologies. This report provides the results of the electric energy resource opportunity (ERO) assessments performed by PNL at one of Niagara Mohawk`s primary federal facilities, the ACC Griffiss AFB facility located near Rome, New York. The results of the analyses of EROs are presented in seven common energy end-use categories. A narrative description of each ERO provides information on the initial cost, energy and dollar savings; impacts on operations and maintenance (O&M); and, when applicable, a discussion of energy supply and demand, energy security, and environmental issues. The evaluation methodology and technical and cost assumptions are also described for each ERO. Summary tables present the operational performance of energy end-use equipment before and after the implementation of each ERO and the results of the life-cycle cost analysis indicating the net present value (NPV) and savings-to-investment ratio (SIR) of each ERO.

  2. Proceedings of Joint RL/AFOSR Workshop on Intelligent Information Systems Held at Griffiss AFB, New York on October 22-23, 1991 (United States)


    OF PENNSYLVANIA F. "HErEROGENOUS KNOWLEDGE BASES" GIO WIEDERHOLD, DARPA G. "SIMS: SERVICES AND INFORMATION MANAGEMENT FOR DECISION SUPPORT", YIGAL...Pennsylvania 9:00 - 9:30 "Heterogenous Knowledge Bases", Gio Wiederhold - Darpa iv 9:30 - 9:45 Break 9:45 - 10:15 "Services and Information Management ...Ohio Sam University Met;tphors fir Problem Solving in Al Reasoning Deliberation - Knowlede Rules of Inference Problem Solving - Initial state - Goal

  3. The electromagnetic α3 contributions to e+e--annihilation into fermions in the electroweak theory. Total cross section σT and integrated asymmetry AFB

    International Nuclear Information System (INIS)

    Bardin, D.Yu.; Bilenky, S.M.; Riemann, T.


    Analytic expressions are obtained for the integrated α 3 QED contributions to the total cross section σ T and the forward-backward asymmtery A FB in the process e + e - → f + f - γ. Photons from soft and hard bremsstrahlung are assumed not to be observed. The calculations are performed in the ultrarelativistic approximation in fermion masses, m f 2 Z 2 , M Z I Z , but the mass M Z and width Γ Z of the neutral weak gauge boson Z are treated without any further approximations

  4. Environmental Assessment, Minuteman III and Peacekeeper Silo Elimination, Malmstrom AFB, Montana; F. E. Warren AFB, Wyoming; and Vandenberg AFB, California (United States)


    Baccharis pilularis), California sagebrush (Artemisia californica), and poison hemlock ( Conium maculatum ) are common species in the area (Vandenberg AFB...spotted bat (Euderma maculatum ) and Preble’s shrew (Sorex preblei). Habitat for the spotted bat is most often in rough, rocky, semiarid, and arid

  5. Survey of Wastewater Discharge, Eielson AFB, Alaska, EHL(K) 73-24

    National Research Council Canada - National Science Library

    Thomas, Jerry F; Pauls, Chester F


    This report contains the results of a wastewater survey at Eielson AFB, Alaska, conducted by the USAF Environmental Health Laboratories, Kelly AFB, Texas and McClellan AFB, CA, between 22 and 27 June 1973...

  6. Level II Ergonomic Analyses, Dover AFB, DE (United States)


    IERA-RS-BR-TR-1999-0002 UNITED STATES AIR FORCE IERA Level II Ergonomie Analyses, Dover AFB, DE Andrew Marcotte Marilyn Joyce The Joyce...Project (070401881, Washington, DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE 4. TITLE AND SUBTITLE Level II Ergonomie Analyses, Dover...1.0 INTRODUCTION 1-1 1.1 Purpose Of The Level II Ergonomie Analyses : 1-1 1.2 Approach 1-1 1.2.1 Initial Shop Selection and Administration of the

  7. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    International Nuclear Information System (INIS)

    Theumer, M.G.; Lopez, A.G.; Masih, D.T.; Chulze, S.N.; Rubinstein, H.R.


    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H 2 O 2 , while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H 2 O 2 . These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins

  8. Immunobiological effects of AFB1 and AFB1-FB1 mixture in experimental subchronic mycotoxicoses in rats

    Energy Technology Data Exchange (ETDEWEB)

    Theumer, M G; Lopez, A G; Masih, D T; Chulze, S N; Rubinstein, H R


    Maize co-contamination with aflatoxin B1 (AFB1) and fumonisin B1 (FB1) is frequently found in several countries. Although the alterations on nutritional and immunologic parameters induced by these mycotoxins, when administered individually, are partially characterised, little is known about the effects induced in animals by a subchronic administration of both toxins mixtures. We have studied the nutritional and immunological alterations induced in rats fed during 90 days with a diet without mycotoxins, containing 40 ppb AFB1, and with a diet containing a mixture of 40 ppb AFB1 and 100 ppm FB1. Animals fed with the mixture of toxins obtained lower body weight than the control ones. The mitogenic response of spleen mononuclear cells (SMC) in vivo was higher in animals fed with AFB1. In in vitro studies, lower proliferations of SMC pre-exposed to AFB1 and to the mixture of toxins were detected. The SMC of animals fed with AFB1 produced lower levels of IL-2, higher of IL-4 and equal levels of IL-10. The SMC of animals fed with both toxins produced higher levels of IL-4, lower of IL-10 and equal levels of IL-2. The SMC preincubated with an AFB1-FB1 mixture produced higher concentrations of IL-4, lower of IL-10 and equal levels of IL-2. The peritoneal macrophages of animals that consumed AFB1 released less H{sub 2}O{sub 2}, while animals fed with the mixture of toxins produced higher levels. In in vitro studies, macrophages pre-exposed to the mixture of toxins released less H{sub 2}O{sub 2}. These results show different immunobiological effects produced by a mixture of mycotoxins in comparison to the individual action of the same toxins.

  9. AFB/open cycle gas turbine conceptual design study (United States)

    Dickinson, T. W.; Tashjian, R.


    Applications of coal fired atmospheric fluidized bed gas turbine systems in industrial cogeneration are identified. Based on site-specific conceptual designs, the potential benefits of the AFB/gas turbine system were compared with an atmospheric fluidized design steam boiler/steam turbine system. The application of these cogeneration systems at four industrial plant sites is reviewed. A performance and benefit analysis was made along with a study of the representativeness of the sites both in regard to their own industry and compared to industry as a whole. A site was selected for the conceptual design, which included detailed site definition, AFB/gas turbine and AFB/steam turbine cogeneration system designs, detailed cost estimates, and comparative performance and benefit analysis. Market and benefit analyses identified the potential market penetration for the cogeneration technologies and quantified the potential benefits.

  10. CloudSat Safety Operations at Vandenberg AFB (United States)

    Greenberg, Steve


    CloudSat safety operations at Vendenberg AFB is given. The topics include: 1) CloudSat Project Overview; 2) Vandenberg Ground Operations; 3) Delta II Launch Vehicle; 4) The A-Train; 5) System Safety Management; 6) CALIPSO Hazards Assessment; 7) CALIPSO Supplemental Safeguards; 8) Joint System Safety Operations; 9) Extended Stand-down; 10) Launch Delay Safety Concerns; and 11) Lessons Learned.

  11. Environmental Assessment of Beale AFB Grazing Lease Program (United States)


    Beale AFB will use livestock (cattle, sheep and goats ) on its properties throughout the year as needed for the control of noxious weeds, reduction...initiating a wildfire. California Farm Bureau Federation policy recognizes that grazing is the most practical and environmentally acceptable way to...Site Monitoring Well Installation and Annual Targeted Goat Grazing Project, Placer County, California. 21 September 2011.  

  12. Building Energy Audit Report, for Hickam AFB, HI

    Energy Technology Data Exchange (ETDEWEB)

    Chvala, William D.; De La Rosa, Marcus I.; Brown, Daryl R.; Dixon, Douglas R.


    A building energy assessment was performed by a team of engineers from Pacific Northwest National Laboratory (PNNL) under contract to the Department of Energy/Federal Energy Management program (FEMP). The effort used the Facility Energy Decision System (FEDS) model to determine how energy is consumed at Hickam AFB, identify the most cost-effective energy retrofit measures, and calculate the potential energy and cost savings. This documents reports the results of that assessment.

  13. Final Environmental Assessment: Replace Hanscom AFB Middle School (United States)


    2012 iv RFTA Reserve Forces Training Area SAPS Satellite Accumulation Points SF Square feet SIP State Implementation Plan SO2 Sulfur dioxide...Restoration Program (IRP), now called the Environmental Restoration Program ( ERP ). Subsequent discoveries increased the number of sites to 22. Each...EPA under CERCLA or by the Commonwealth of Massachusetts. No sites listed in the ERP for Hanscom AFB are located on or near the existing Middle

  14. 33 CFR 334.1130 - Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones. (United States)


    ... Missile Center (WSMC), Vandenberg AFB, Calif.; danger zones. 334.1130 Section 334.1130 Navigation and... RESTRICTED AREA REGULATIONS § 334.1130 Pacific Ocean, Western Space and Missile Center (WSMC), Vandenberg AFB... (WSMC) at Vandenberg AFB, California. (3) The impacting of missile debris from launch operations will...

  15. AFB-NETT - business opportunities for European biomass industry

    International Nuclear Information System (INIS)

    Higham, I.


    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  16. AFB-NETT - business opportunities for European biomass industry

    Energy Technology Data Exchange (ETDEWEB)

    Higham, I. [ETSU, Oxfordshire (United Kingdom)


    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  17. AFB-NETT - business opportunities for European biomass industry

    Energy Technology Data Exchange (ETDEWEB)

    Higham, I [ETSU, Oxfordshire (United Kingdom)


    The AFB-NETT is an ALTENER funded project lead by ETSU. The project was started in 1995 with 11 partner nations. The initial aim was to bring together the whole biomass supply and use chain, not just within countries but across the Europe. At present more than 280 people take part in the network. The four objectives of the project are: detection and promotion of business opportunities; transfer of knowledge and experience; promotion of collaboration and co-ordination; and implementation of National and European Strategies. The effort in 1997 split into four main activities, 2 of which based on market sectors and two on improving the market conditions. The activities for 1997 were (the leader in parentheses): Co-combustion and gasification (Finland); Small scale and district heat (Austria); Financial incentives (the Netherlands); Wood fuel and emission standards (UK)

  18. Aerospace medicine at Brooks AFB, TX: hail and farewell. (United States)

    Nunneley, Sarah A; Webb, James T


    With the impending termination of USAF operations at Brooks Air Force Base (AFB) in San Antonio, TX, it is time to consider its historic role in Aerospace Medicine. The base was established in 1917 as a flight training center for the U.S. Army Air Service and in 1926 became home to its School of Aviation Medicine. The school moved to San Antonio's Randolph Field in 1931, but in 1959 it returned to Brooks where it occupied new facilities to support its role as a national center for U.S. Air Force aerospace medicine, including teaching, clinical medicine, and research. The mission was then expanded to encompass support of U.S. military and civilian space programs. With the abrupt termination of the military space program in 1969, research at Brooks focused on clinical aviation medicine and support of advanced military aircraft while continuing close cooperation with NASA in support of orbital spaceflight and the journey to the Moon. Reorganization in the 1990s assigned all research functions at Brooks to the Human Systems Division and its successors, leaving to USAFSAM the missions related to clinical work and teaching. In 2002 the USAF and the city of San Antonio implemented shared operation of Brooks as a "City-Base" in the hope of deflecting threatened closure. Nevertheless, under continuing pressure to consolidate military facilities in the United States, the 2005 Base Closure and Realignment Commission ordered Brooks closed by 2011, with its aerospace medicine functions relocated to new facilities at Wright-Patterson AFB in Dayton, OH.

  19. The Griffiss Institute Summer Faculty Program (United States)


    multicore architectures and distributed HPC Condor environment with respect to video processing algorithms such as flux tensor , morphology, connected...visualization using Kolam. Refined 3D multiview reconstruction algorithm based on a ray casting and voxel- voting scheme. Worked on initial...implementation of 3D reconstruction using a synthetic 3D scene with a few buildings incorporating a camera model and realistic flight parameters. Votes

  20. Very High-Performance Advanced Filter Bank Analog-to-Digital Converter (AFB ADC) Project

    National Research Council Canada - National Science Library

    Velazquez, Scott


    ... of the art by using a parallel array of individual commercial off the shelf converters. The significant performance improvements afforded by the Advanced Filter Bank Analog to Digital Converter (AFB ADC...

  1. Burrowing Owl and Other Migratory Bird Mitigation for a Runway Construction Project at Edwards AFB


    Hoehn, Amber L.; Hagan, Mark; Bratton, Mark


    Edwards Air Force Base (AFB) scheduled the construction of a runway in the spring of 2007. The runway would be in an area that contained migratory birds and their habitat. The construction project would be near Edwards AFB main runway and had the potential not only to impact species protected under the Migratory Bird Treaty Act (MBTA), including the burrowing owl (Athene cunicularia), but also to increase bird and wildlife–aircraft strike hazards in the active flightline areas. To discourage ...

  2. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)


    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.

  3. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)


    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  4. Shemya AFB, Alaska 1992 IRP field investigation report

    Energy Technology Data Exchange (ETDEWEB)


    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force's Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island's drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  5. Environmental Assessment: Conversion of the 820th Security Forces Group at Moody AFB, Georgia to a Contingency Response Group (United States)


    Contingency Response Group (CRG) at Moody Air Force Base (AFB), GA . DESCRIPTION OF THE PROPOSED ACTION AND ALTERNATIVES. The United States Air Force...sinkhole formation. Soils Moody AFB Moody AFB is located in the Tifton Upland District of the Lower Coastal Plain. In general, soils on...base. Arsenic, barium, chromium, copper, iron, selenium, and zinc have been found to be naturally occurring in the area. Predominant soils are Tifton

  6. Installation Restoration Program. Phase 1. Records Search, Hazardous Materials Disposal Sites, Eglin AFB, Florida (United States)


    Okaloosa Co. 3-12 Crestview South Quadrangle, Florida-Okaloosa Co. -13 Mossy ead Quadrangle, Florida-Walton Co 3-14 E-1 EGUN AFB 4,h aa V, WRAMATIO...I) Um AYPM hIN1DS SP * So". AM T 0 Tou A is a O I. h E-2 ES ENGINEERING -SCIENCE V%777-7NN7 .7-7 EGUN AFB 0.4 .m ... (1) WMg LAN DOSAMU *Y* CO u...r Oumm *p S(S Ann~ Il~~O 0*aAMa 2-3 ES ENGINEER ING - SCIENCE EGUN AFB %Tt MAR ESTHER * : . . - . - ~ - ~ r W R G H T L A N D F I L L 3 SITE 0296

  7. Surface to 90 km winds for Kennedy Space Center, Florida, and Vandenberg AFB, California (United States)

    Johnson, D. L.; Brown, S. C.


    Bivariate normal wind statistics for a 90 degree flight azimuth, from 0 through 90 km altitude, for Kennedy Space Center, Florida, and Vandenberg AFB, California are presented. Wind probability distributions and statistics for any rotation of axes can be computed from the five given parameters.

  8. Finding No Significant Impact: Aircraft Weather Shelter at Laughlin AFB, TX (United States)


    surface water flow is southeast into the Ro Grande and down toward the Gulf of Mexico. Lake Amistad reservoir, located approximately 12 miles northwest...characterized Lake Amistad reservoir as having excellent water quality (USAF, 1997). Laughlin AFB contains a total of 19 acres of surface water

  9. Relocation of the Air National Guard 176th Wing to Elmendorf AFB, Alaska (United States)


    Park. Between 20 and 70 moose are estimated by Alaska Fish and Game to live on Elmendorf AFB, depending on the time of year, as portions of the herd ...also supports populations of small mammals including beaver (Castor canadensis), muskrat (Ondatra zibethicus), porcupine (Erethizon dorsatum), red

  10. Final Confirmation Sampling and Analysis Report for the POL Yard, Sites SS-06 and ST-40, Wurtsmith AFB, Michigan

    National Research Council Canada - National Science Library


    .... Wurtsmith AFBCA and AFCEE/ERT had no comments on the draft final report. This report represents the final contract deliverable for the AFCEE Extended Bioventing Project at the Wurtsmith AFB POL Yard...

  11. Environmental Assessment Construction of a New Hazardous Cargo Pad Davis-Monthan AFB (United States)


    PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 355th Civil Engineer Squadron (CES/CEVA),710 Third Street,Davis-Monthan AFB,AZ,85707 8. for certain projects. Details of the preparation of this EA are mandated by the Council of Enviromental Quality (CEQ) in the series of...Base, Tucson, Arizona." October 1996. James M. Montgomery, Consulting Engineers for US army Corps of Engineers , Omaha Dist., Apri11990

  12. Williams AFB, Arizona Revised Uniform Summary of Surface Weather Observations (RUSSWO) Parts A-F. (United States)



  13. Integration

    DEFF Research Database (Denmark)

    Emerek, Ruth


    Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration......Bidraget diskuterer de forskellige intergrationsopfattelse i Danmark - og hvad der kan forstås ved vellykket integration...

  14. [Integrity]. (United States)

    Gómez Rodríguez, Rafael Ángel


    To say that someone possesses integrity is to claim that that person is almost predictable about responses to specific situations, that he or she can prudentially judge and to act correctly. There is a closed interrelationship between integrity and autonomy, and the autonomy rests on the deeper moral claim of all humans to integrity of the person. Integrity has two senses of significance for medical ethic: one sense refers to the integrity of the person in the bodily, psychosocial and intellectual elements; and in the second sense, the integrity is the virtue. Another facet of integrity of the person is la integrity of values we cherish and espouse. The physician must be a person of integrity if the integrity of the patient is to be safeguarded. The autonomy has reduced the violations in the past, but the character and virtues of the physician are the ultimate safeguard of autonomy of patient. A field very important in medicine is the scientific research. It is the character of the investigator that determines the moral quality of research. The problem arises when legitimate self-interests are replaced by selfish, particularly when human subjects are involved. The final safeguard of moral quality of research is the character and conscience of the investigator. Teaching must be relevant in the scientific field, but the most effective way to teach virtue ethics is through the example of the a respected scientist.

  15. Perseus B over Edwards AFB on a Development Flight (United States)


    from a mobile flight control station on the ground. A Global Positioning System (GPS) unit provides navigation data for continuous and precise location during flight. The ground control station features dual independent consoles for aircraft control and systems monitoring. A flight termination system, required for all remotely piloted aircraft being flown in military-restricted airspace, includes a parachute system deployed on command plus a C-Band radar beacon and a Mode-C transponder to aid in location. Dryden has provided hanger and office space for the Perseus B aircraft and for the flight test development team when on site for flight or ground testing. NASA's ERAST project is developing aeronautical technologies for a new generation of remotely piloted and autonomous aircraft for a variety of upper-atmospheric science missions and commercial applications. Dryden is the lead center in NASA for ERAST management and operations. Perseus B is approximately 25 feet long, has a wingspan of 71.5 feet, and stands 12 feet high. Perseus B is powered by a Rotax 914, four-cylinder piston engine mounted in the mid-fuselage area and integrated with an Aurora-designed three-stage turbocharger, connected to a lightweight two-blade propeller.

  16. PART I: Bioventing Pilot Test Work Plan for Fire Protection Training Area Site FY-03, Charleston AFB, South Carolina. PART II: Draft Interim Pilot Test Results Report for Fire Protection Training Area Site FT-03, Charleston AFB, South Carolina

    National Research Council Canada - National Science Library


    This site-specific work plan presents the scope of a bioventing pilot test for in situ treatment of fuel contaminated soils at the Fire Protection Training Area designated as Site FT-O3, Charleston Air Force Base (AFB), South Carolina...

  17. Eielson AFB, Alaska. Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F. (United States)


    PERCENTACE FREQUENCY Of WIND DIRECTION AND SPEED (FROM HOURLY OBSERVATIONS) 7- 2650 EIELSON AF6 AK 73-8? *pp ALL WEATHER ISO -1 700 (KNEED I .3 4.6 7. 10...HOURLY OBSERVATIONS) 7 265C EIELSON AFB AX 73-82 DEC mn~y.. .y.rm,Io u ii. n~lu Sr.m ALL kEATHER ISO -1700 CLAm -- IL.S T.) SPEED i( MEA (KNTS) 1 - 3...fis r, i- &hS.2? q i- 7 &S2 kL%- &.S-2. fq 7Sf..7:p U8000 7Z.1 73. 73. 73. 73. ?6 73. 73. 38?8le 73.8 73.8 73.8 73.81 73., 27000 ’ ,i. 800 I 8t

  18. 'Integration'

    DEFF Research Database (Denmark)

    Olwig, Karen Fog


    , while the countries have adopted disparate policies and ideologies, differences in the actual treatment and attitudes towards immigrants and refugees in everyday life are less clear, due to parallel integration programmes based on strong similarities in the welfare systems and in cultural notions...... of equality in the three societies. Finally, it shows that family relations play a central role in immigrants’ and refugees’ establishment of a new life in the receiving societies, even though the welfare society takes on many of the social and economic functions of the family....

  19. Proposed Expansion of German Air Force Operations at Holloman AFB, New Mexico. Final Environmental Impact Statement. Volume III: Comment Letters and Responses to Comments

    National Research Council Canada - National Science Library


    The Final Environmental Impact Statement analyzed the potential environmental consequences from the proposal to beddown 30 additional German Air Force Tornado aircraft and 640 personnel at Holloman Air Force Base (AFB) New Mexico...

  20. Monoclonal antibody anti-AFB1: scale-up in vitro for biotools development Anticorpo monoclonal antiAFB1: produção in vitro visando desenvolvimento de bioferramentas

    Directory of Open Access Journals (Sweden)

    Eiko Nakagawa Itano


    Full Text Available Aflatoxin B1 (AFB1 is a mycotoxin classified as group 1 (human carcinogen by International Agency for Research on Cancer - IARC, causing hazardous contamination in a wide variety of food and feed, where the monitoring depends on precision and accuracy of analytical method. The culture of AFB1 specific monoclonal antibody (mAb secreting hybridoma was performed for further development of immunochemical methods. The growth of hybridoma AF2 was carried out in RPMI medium + 15 % fetal bovine serum (FBS, as well as the same medium gradually amended with H-SFM medium (25, 50, 75 and 100 % H-SFM. The protein concentration in the culture supernatant ranged from 1.80 to 10.88 mg/mL. The culture amended with FBS-free synthetic H-SFM medium reached production of reagent with higher degree of purity and lower risk, in addition to lower protein content (2.29 mg/mL reached with 100 % H-SFM, which approaches the real content of pure mAb. The indirect competitive enzyme-linked immunosorbent assay (ic-ELISA and SDS-polyacrylamide gel electrophoresis (SDS-PAGE showed anti-AFB1 activity and IgG corresponding bands, respectively, indicating feasible application of mAb produced in 100, 75 and 50 % H-SFM for further use in the development of AFB1 detecting biotools. This mAb production can be an initial step that can supply the self-sufficient immune-reagent in the rapid diagnosis at national condition, which is essential in the food quality and safety.Aflatoxina B1 (AFB1 é uma micotoxina classificada pela International Agency for Research on Cancer - IARC no Grupo 1 (carcinógeno ao humano, responsável pelo perigo de contaminação em ampla variedade de alimento e ração, cujo monitoramento depende de metodologia analítica precisa e exata. O trabalho visou cultivo do hibridoma secretor de anticorpo monoclonal (AcM específico para AFB1 visando desenvolvimento de métodos imunoquímicos. Hibridoma AF2 foi cultivado em meio RPMI + 15 % de soro fetal bovino (SFB

  1. Transcriptome, antioxidant enzyme activity and histopathology analysis of hepatopancreas from the white shrimp Litopenaeus vannamei fed with aflatoxin B1(AFB1). (United States)

    Zhao, Wei; Wang, Lei; Liu, Mei; Jiang, Keyong; Wang, Mengqiang; Yang, Guang; Qi, Cancan; Wang, Baojie


    Aflatoxin produced by Aspergillus flavus or Aspergillus parasiticus fungi during grain and feed processing and storage. Aflatoxins cause severe health problems reducing the yield and profitability of shrimp cultures. We sought to understand the interaction between shrimp immunity and aflatoxin B1 (AFB1), analyzing transcriptome expression, antioxidant enzyme activity, and histological features of the hepatopancreas of shrimp fed with AFB1. From over 4 million high-quality reads, de novo unigene assembly produced 103,644 fully annotated genes. A total of 1024 genes were differentially expressed in shrimp fed with AFB1, being involved in functions, such as peroxidase metabolism, signal transduction, transcriptional control, apoptosis, proteolysis, endocytosis, and cell adhesion and cell junction. Upon AFB1 challenge, there were severe histological alterations in shrimp hepatopancreas. AFB1 challenge increased the activity of several antioxidant enzymes. Our data contribute to improve the current understanding of host-AFB1 interaction, providing an abundant source for identification of novel genes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Laser Reliability Prediction (United States)


    qovernment aqencies on request from RADC ( nCTM ) Griffiss AFP NY 13441. 71. Cochran, Albert L., "Check Test of Rangefinder, AN/GVS-3 (SM23E2)," Army...Qualified military and oovemnent aoencles on request from RAOC ( ncTM ) Griff Iss AFB NY 13441. 222. This reference will be made available to Qualified

  3. Detection of serum AFB1-lysine adduct in Malaysia and its association with liver and kidney functions. (United States)

    Mohd Redzwan, S; Rosita, Jamaluddin; Mohd Sokhini, A M; Nurul 'Aqilah, A R; Wang, Jia-Sheng; Kang, Min-Su; Zuraini, Ahmad


    Aflatoxin is ubiquitously found in many foodstuffs and produced by Aspergillus species of fungi. Of many aflatoxin metabolites, AFB1 is classified by the International Agency for Research on Cancer (IARC) as group one carcinogen and linked to the development of hepatocellular carcinoma (HCC). The study on molecular biomarker of aflatoxin provides a better assessment on the extent of human exposure to aflatoxin. In Malaysia, the occurrences of aflatoxin-contaminated foods have been documented, but there is a lack of data on human exposure to aflatoxin. Hence, this study investigated the occurrence of AFB1-lysine adduct in serum samples and its association with liver and kidney functions. 5ml fasting blood samples were collected from seventy-one subjects (n=71) for the measurement of AFB1-lysine adduct, albumin, total bilirubin, AST (aspartate aminotransferase), ALT (alanine transaminase), ALP (alkaline phosphatase), GGT (gamma-glutamyl transpeptidase), creatinine and BUN (blood urea nitrogen). The AFB1-lysine adduct was detected in all serum samples (100% detection rate) with a mean of 6.85±3.20pg/mg albumin (range: 1.13-18.85pg/mg albumin). Male subjects (mean: 8.03±3.41pg/mg albumin) had significantly higher adduct levels than female subjects (mean: 5.64±2.46pg/mg albumin) (p6.85pg/mg albumin) had significantly elevated level of total bilirubin (pMalaysia. Given that aflatoxin can pose serious problem to the health, intervention strategies should be implemented to limit/reduce human exposure to aflatoxin. Besides, a study with a big sample size should be warranted in order to assess aflatoxin exposure in the general population of Malaysia. Copyright © 2013 Elsevier GmbH. All rights reserved.

  4. Response of Intestinal Bacterial Flora to the Long-term Feeding of Aflatoxin B1 (AFB1) in Mice. (United States)

    Yang, Xiai; Liu, Liangliang; Chen, Jing; Xiao, Aiping


    In order to investigate the influence of aflatoxin B1 (AFB1) on intestinal bacterial flora, 24 Kunming mice (KM mice) were randomly placed into four groups, which were labeled as control, low-dose, medium-dose, and high-dose groups. They were fed intragastrically with 0.4 mL of 0 mg/L, 2.5 mg/L, 4 mg/L, or 10 mg/L of AFB1 solutions, twice a day for 2 months. The hypervariable region V3 + V4 on 16S rDNA of intestinal bacterial flora was sequenced by the use of a high-flux sequencing system on a Miseq Illumina platform; then, the obtained sequences were analyzed. The results showed that, when compared with the control group, both genera and phyla of intestinal bacteria in the three treatment groups decreased. About one third of the total genera and one half of the total phyla remained in the high-dose group. The dominant flora were Lactobacillus and Bacteroides in all groups. There were significant differences in the relative abundance of intestinal bacterial flora among groups. Most bacteria decreased as a whole from the control to the high-dose groups, but several beneficial and pathogenic bacterial species increased significantly with increasing dose of AFB1. Thus, the conclusion was that intragastric feeding with 2.5~10 mg/mL AFB1 for 2 months could decrease the majority of intestinal bacterial flora and induce the proliferation of some intestinal bacteria flora.

  5. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 1: Final report

    Energy Technology Data Exchange (ETDEWEB)


    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). As a part of the IRP program, field investigations were performed in 1992 to obtain the information needed to assess what future actions willneed to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites during the 1992 field investigation included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities.

  6. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 4, Appendixes E and F: Final report

    Energy Technology Data Exchange (ETDEWEB)


    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. In addition, geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal, to be avoided during drilling activities. This report contains appendices E and F with information on the following: soil boring logs, and data validation of samples analyzed.

  7. Transformación de la aflatoxina B1 de alimentos, en el cancerígeno humano, aducto AFB1-ADN

    Directory of Open Access Journals (Sweden)

    Magda Carvajal


    Full Text Available Las aflatoxinas (AF son metabolitos secundarios tóxicos principalmente de los hongos Aspergillus flavus y A. parasiticus, son potentes mutágenos y cancerígenos de alimentos y la exposición del hombre a ellas es continuo. Las AF se ligan al ADN, ARN y proteínas formando aductos AFB1-ADN que se acumulan por años y dañan desde los virus hasta el hombre. Es importante identificar y cuantificar estos aductos como biomarcadores de largo tiempo de riesgo de enfermedad, ya que originan mutaciones y cáncer, y están validados en animales y humanos. Las AF se activan en presencia del citocromo P450 como una molécula inestable 8,9 epóxido AFB1, que se liga al N7 de la guanina, y se transforma en los cancerígenos activos o aductos AFB1-Gua y, finalmente, en los aductos AFB1-FAPY y son una medida objetiva de la exposición humana a cancerígenos ambientales. Los aductos representan la exposición, absorción, distribución, metabolismo, reparación del ADN y cambio celular. Los temas tratados aquí son la formación de aductos AFB1-ADN, estudios in vitro e in vivo, exposición a una dieta con AFB1, efectos, desarrollo de cáncer y mutaciones en el gen supresor p53, rutas de exposición, vitaminas, tipos de aducto AFB1-ADN, metodología y su control.

  8. Evaluation of bromide mass discharge in a sandy aquifer at Vandenberg AFB, CA (United States)

    Mackay, D. M.; Rasa, E.; Einarson, M.; Kaiser, P.; Chakraborty, I.; Scow, K. M.


    Side-by-side experiments were conducted by UC Davis research team at a former fuel station at Vandenberg Air Force Base (AFB) to evaluate the rate of transformation of methyl tert-butyl ether (MTBE) to tert-butyl alcohol (TBA) impacted by ethanol and to investigate evidence of TBA degradation under sulfate reducing conditions. On one side we injected groundwater amended with ethanol and MTBE. In the other lane we injected groundwater amended with TBA. On both sides, injected ground water was spiked with bromide tracer to provide estimates of groundwater flow direction variations, flow velocity, dispersion, and mobile mass loss resulting from diffusive sequestration into aquitards. 162 monitoring wells were aligned into seven transects located downgradient of the injection wells. The mass discharge approach was used to evaluate the natural attenuation of the injected constituents. In this talk we will focus on calculations of mass discharge of the bromide tracer at each of the seven monitoring well transects. The amount of bromide mass discharged through each transect was calculated for any sampling time using field measurements of break through curves. Cumulative mass discharges were estimated and, by iteration based on mass balance, the flow properties of the aquifer were estimated. The calibration process resulted in subtle but quantitatively important changes in our assumptions regarding key physical properties of the aquifer (thickness, porosity) which could be only approximately estimated by standard methods (coring, CPT, etc.). On the basis of this calibration, a more robust approach was devised for evaluating the source and fate of TBA in the aquifer.

  9. Frequency of sputum positive AFB cases among patients of pulmonary tuberculosis in tertiary care hospitals of northern Pakistan

    International Nuclear Information System (INIS)

    Khattak, M.I.; Zaman, M.; Ihsanullah; Muhammad, A.; Khan, N.


    Objective: This study was aimed to find out the frequency of sputum positive Acid Fast Bacilli (AFB) cases among pulmonary tuberculosis patients and to determine those patients who are the potential source of transmitting infection. Methods: This study was conducted in four medical units of Khyber Teaching Hospital, Peshawar and Chest Unit, Ayub Teaching Hospital, Abbottabad in collaboration with the pathology unit of Khyber Teaching Hospital, Peshawar, and Kohat Institute of Medical Sciences, Kohat. Three specimens of sputum were collected for three consecutive days in the morning and were transported immediately to the laboratory along with full details of the patients. Results: Out of two hundred total patients studied, 104 patients (52%) were sputum AFB positive. Among the 104 patients 60 patients (57.4%) were females. Sixty-four (61.52%) individuals were between 20-50 years. Majority of the patients were from poor, deprived and lower social class. Fifty-two (50%) patients had monthly income of less than Rs. 4,000; only 8 patients (7.67%) had monthly income of more than Rs. 12,000). Forty-eight patients <46.12% were house wives, 10 patients (9.61%) were unemployed. Most of the patients were under weight for their age and height. 24 patients (23.06%) were below 42 kg. The maximum (53.84%) number of patients was in weight range of 43-50 kg. Conclusion: Sputum AFB positive pulmonary tuberculosis is more in individuals of low socioeconomic group and in females. The patients put their children and family members at risk of tuberculosis infection. For the control of this disease early diagnosis of active disease and their treatment under supervision is important. (author)

  10. Pope AFB, Fayetteville, North Carolina Revised Uniform Summary of Surface Weather Observations (RUSSWO). Parts A-F. (United States)


    SERVICE/HAC T23030 POPE AFB NC 7[-81111 STAT ION STATION lNA&Ayl MSSgll’ TemN. WIT SULS TEMPERATURE DEPRESSIO (F) TOTAL TOTAL (F) 0 1.2 3 - 5 - 1- 19...STATINASha T PAGE 1 TWET BULB TEMPERATURE DEPRESSIO (F) TOTAL TOTAL * (F) 0 1.2 3-4 3-6 7-8 9.10 11-12113-14 15.16 17-1 19-.20 21.22123-24 25.2627.3 29.n 30 l

  11. Label Free QCM Immunobiosensor for AFB1 Detection Using Monoclonal IgA Antibody as Recognition Element

    Directory of Open Access Journals (Sweden)

    Özlem Ertekin


    Full Text Available This study introduces the use of an IgA isotype aflatoxin (AF specific monoclonal antibody for the development of a highly sensitive Quartz Crystal Microbalance (QCM immunobiosensor for the detection of AF in inhibitory immunoassay format. The higher molecular weight of IgA antibodies proved an advantage over commonly used IgG antibodies in label free immunobiosensor measurements. IgA and IgG antibodies with similar affinity for AF were used in the comparative studies. Sensor surface was prepared by covalent immobilization of AFB1, using self assembled monolayer (SAM formed on gold coated Quartz Crystal, with 1-Ethyl-3-(3-dimethylaminopropyl carbodiimide/N-hydroxy succinimide (EDC/NHS method using a diamine linker. Nonspecific binding to the surface was decreased by minimizing the duration of EDC/NHS activation. Sensor surface was chemically blocked after AF immobilization without any need for protein blocking. This protein free sensor chip endured harsh solutions with strong ionic detergent at high pH, which is required for the regeneration of the high affinity antibody-antigen interaction. According to the obtained results, the detection range with IgA antibodies was higher than IgG antibodies in QCM immunosensor developed for AFB1.

  12. Environmental Assessment Preparation for Air Force Test Mission in the 21st Century: Upgrade and Improve the Test Capability at the Edwards AFB Test Complex (United States)


    waste NAA Nonattainment Area NAAQS National Ambient Air Quality Standards NAGPRA Native American Graves Protection and Repatriation Act NDMA N...nitrate, and N- Nitrosodimethylamine ( NDMA ) plumes exist in these OUs. Locations of groundwater plumes at Edwards AFB are indicated by their respective

  13. Pure neuritic leprosy: Resolving diagnostic issues in acid fast bacilli (AFB)-negative nerve biopsies: A single centre experience from South India. (United States)

    Hui, Monalisa; Uppin, Megha S; Challa, Sundaram; Meena, A K; Kaul, Subhash


    Demonstration of lepra bacilli is essential for definite or unequivocal diagnosis of pure neuritic leprosy (PNL) on nerve biopsy. However, nerves always do not show bacilli owing to the changes of previous therapy or due to low bacillary load in tuberculoid forms. In absence of granuloma or lepra bacilli, other morphologic changes in endoneurium and perineurium can be of help in making a probable diagnosis of PNL and treating the patient with multidrug therapy. Forty-six biopsies of PNL were retrospectively reviewed and histologic findings were compared with 25 biopsies of non leprosy neuropathies (NLN) including vasculitic neuropathy and chronic inflammatory demyelinating polyneuropathy (CIDP). The distribution of endoneurial infiltrate and fibrosis, perineurial thickening, and myelin abnormalities were compared between PNL and NLN biopsies and analyzed by Chi-square test. Out of 46 PNL casses, 24 (52.17 %) biopsies were negative for acid fast bacilli (AFB). In these cases, the features which favor a diagnosis of AFB-negative PNL were endoneurial infiltrate (51.1%), endoneurial fibrosis (54.2%), perineurial thickening (70.8%), and reduced number of myelinated nerve fibers (75%). Nerve biopsy is an efficient tool to diagnose PNL and differentiate it from other causes of NLN. In absence of AFB, the diagnosis of PNL is challenging. In this article, we have satisfactorily evaluated the various hisopthological features and found that endoneurial inflammation, dense fibrosis, and reduction in the number of myelinated nerve fibers are strong supportive indicators of PNL regardless of AFB positivity.

  14. Clinical value of whole-blood interferon-gamma assay in patients with suspected pulmonary tuberculosis and AFB smear- and polymerase chain reaction-negative bronchial aspirates. (United States)

    Lee, Jaehee; Lee, Shin Yup; Yoo, Seung Soo; Cha, Seung Ick; Won, Dong Il; Park, Jae Yong; Lee, Won-Kil; Kim, Chang Ho


    Combining a polymerase chain reaction (PCR) test with bronchoscopy is frequently performed to allow a rapid diagnosis of smear-negative pulmonary tuberculosis (PTB). However, limited data are available concerning clinical judgment in patients with suspected PTB and AFB smear- and PCR-negative bronchial aspirates (BA). The present study evaluated the usefulness of whole-blood QuantiFERON-TB Gold In-Tube (QFT) testing in these patients. Of 166 patients with suspected PTB who had undergone bronchoscopy because of smear-negative sputum or inadequate sputum production, 93 (56%) were diagnosed with culture-positive PTB. Seventy-four patients were either AFB smear- or PCR-positive. In the 75 patients whose BA AFB smear and PCR results were both negative, 19 were finally diagnosed with PTB by culture. The QFT test had a negative predictive value of 91% for PTB. The QFT test may be useful for excluding PTB in patients with suspected PTB whose BA AFB smear and PCR results are both negative. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    Energy Technology Data Exchange (ETDEWEB)

    De Guzman, Zenaida M. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Cervancia, Cleofas R. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C. [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C. [Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines, Los Banos, Laguna (Philippines); Feliciano, Chitho P., E-mail: [Microbiological Research and Service Laboratory, Atomic Research Division, Philippine Nuclear Research Institute, Diliman, Quezon City (Philippines); Institute of Biology, College of Science, University of the Philippines, Diliman, Quezon City (Philippines)


    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a {sup 60}Co source. Surviving spores were counted and used to estimate the decimal reduction (D{sub 10}) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10{sup 5}-9x10{sup 3} spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D{sub min}) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to {gamma}-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: > We characterized Paenibacillus larvae and determined its radiation sensitivity. > We investigated the effectiveness of gamma rays in inactivating P. larvae. > Gamma radiation inactivates P. larvae. > 15 kGy is effective for the sterilization of P. larvae-infected hives. > Irradiation produces no visible changes in the hives' body, waxes and frames.

  16. Radiation inactivation of Paenibacillus larvae and sterilization of American Foul Brood (AFB) infected hives using Co-60 gamma rays

    International Nuclear Information System (INIS)

    De Guzman, Zenaida M.; Cervancia, Cleofas R.; Dimasuay, Kris Genelyn B.; Tolentino, Mitos M.; Abrera, Gina B.; Cobar, Ma. Lucia C.; Fajardo, Alejandro C.; Sabino, Noel G.; Manila-Fajardo, Analinda C.; Feliciano, Chitho P.


    The effectiveness of gamma radiation in inactivating the Philippine isolate of Paenibacillus larvae was investigated. Spores of P. larvae were irradiated at incremental doses (0.1, 0.2, 0.4, 0.8 and 1.6 kGy) of gamma radiation emitted by a 60 Co source. Surviving spores were counted and used to estimate the decimal reduction (D 10 ) value. A dose of 0.2 kGy was sufficient to inactivate 90% of the total recoverable spores from an initial count of 10 5 -9x10 3 spores per glass plate. The sterilizing effect of high doses of gamma radiation on the spores of P. larvae in infected hives was determined. In this study, a minimum dose (D min ) of 15 kGy was tested. Beehives with sub-clinical infections of AFB were irradiated and examined for sterility. All the materials were found to be free of P. larvae indicating its susceptibility to γ-rays. After irradiation, there were no visible changes in the physical appearance of the hives' body, wax and frames. Thus, a dose of 15 kGy is effective enough for sterilization of AFB-infected materials. - Highlights: → We characterized Paenibacillus larvae and determined its radiation sensitivity. → We investigated the effectiveness of gamma rays in inactivating P. larvae. → Gamma radiation inactivates P. larvae. → 15 kGy is effective for the sterilization of P. larvae-infected hives. → Irradiation produces no visible changes in the hives' body, waxes and frames.

  17. Time to Detection in Culture Supports Prediction of Low Transmissibility of Tuberculosis and Discontinuation of Isolation for Low-Risk Patients With A Single AFB-Negative and NAAT-Negative Respiratory Specimen. (United States)

    Khan, Saahir; Nakasone, Audrey; Ghajar, Minoo; Zhowandai, Mariam; Prabhu, Sunita; Alexander, Rick; Low, Julie; Peterson, Ellena; Thrupp, Lauri


    For 94 patients with culture-positive pulmonary tuberculosis, time-to-detection (TTD), acid-fast bacilli (AFB) smear, and nucleic acid amplification test (NAAT) results were reviewed. All 12 patients whose first specimen was negative by AFB smear and NAAT had prolonged TTD, indicating low transmissibility and supporting discontinuing isolation for low-risk patients.Infect Control Hosp Epidemiol 2018;39:619-621.

  18. Statistical analysis of ground-water contamination at the alert apron and northern landfill areas of Wurtsmith AFB, Michigan. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, P.; Naber, S.; Verducci, J.


    Two plumes of contamination are analyzed to determine their extent, composition, and movement. The large number of ground-water monitoring wells sampled over the past eight years at Wurtsmith AFB allow this analysis to be performed directly from empirical data, with minimal assumptions about solute transport mechanisms. Conclusions are drawn about the likely sources of contamination in the two plumes, the adequacy of the data for making risk assessments, and the likely consequences of alternative programs of remediation.

  19. Environmental Assessment Addressing FTFA07-1174, Repair Approach Lighting System at the North End of Runway 01/19 at Eglin AFB, Florida (United States)


    Hyla andersonii Mammals American beaver Castor canadensis Florida black bear2 Ursus americanus floridanus Raccoon Procyon lotor Source: Eglin...water at a frequency and duration to support, and that under normal circumstances do support, a prevalence of vegetation typically adapted to life...virginiana American Beaver Castor canadensis Redbay Persea borbonia Little Blue Heron Egretta caerulea Source: USAF 2006 E-3 E.2 Eglin AFB

  20. Aflatoxin B1 inhibition in Aspergillus flavus by Aspergillus niger through down-regulating expression of major biosynthetic genes and AFB1 degradation by atoxigenic A. flavus. (United States)

    Xing, Fuguo; Wang, Limin; Liu, Xiao; Selvaraj, Jonathan Nimal; Wang, Yan; Zhao, Yueju; Liu, Yang


    Twenty Aspergillus niger strains were isolated from peanuts and 14 strains were able to completely inhibit AFB 1 production with co-cultivation. By using a Spin-X centrifuge system, it was confirmed that there are some soluble signal molecules or antibiotics involved in the inhibition by A. niger, although they are absent during the initial 24h of A. flavus growth when it is sensitive to inhibition. In A. flavus, 19 of 20 aflatoxin biosynthetic genes were down-regulated by A. niger. Importantly, the expression of aflS was significantly down-regulated, resulting in a reduction of AflS/AflR ratio. The results suggest that A. niger could directly inhibit AFB 1 biosynthesis through reducing the abundance of aflS to aflR mRNAs. Interestingly, atoxigenic A. flavus JZ2 and GZ15 effectively degrade AFB 1 . Two new metabolites were identified and the key toxic lactone and furofuran rings both were destroyed and hydrogenated, meaning that lactonase and reductase might be involved in the degradation process. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Factors which contributed for low quality sputum smears for the detection of acid fast bacilli (AFB) at selected health centers in Ethiopia: A quality control perspective. (United States)

    Mekonen, Ayehu; Ayele, Yeshi; Berhan, Yifru; Woldeyohannes, Desalegn; Erku, Woldaregay; Sisay, Solomon


    Quality of tuberculosis (TB) microscopy diagnosis is not a guarantee despite implementation of External Quality Assurance (EQA) service in all laboratories of health facilities. Hence, we aimed at evaluating the technical quality and the findings of sputum smear microscopy for acid fast bacilli (AFB) at health centers in Hararge Zone, Oromia Region, Ethiopia. A cross-sectional study was carried out between July 8, 2014 and July 7, 2015.A pre-tested structured questionnaire was used to collect data. Lot Quality Assurance Sampling (LQAS) method was put into practice for collecting all necessary sample slides. Data were analyzed by using SPSS (Statistical Package for Social Sciences) version 20 software. P-value quality, smear size, smear thickness, staining and evenness were indicated in 40 (72.7%), 39 (70.9%), 37 (67.3%), 27(49.1%) and 37 (67.3%) of the collected samples, respectively. False negative AFB findings were significantly associated with lack of Internal Quality Control (IQC) measures (AOR (Adjusted Odds Ratio): 2.90 (95% CI (Confidence Interval): 1.25,6.75) and poor staining procedures (AOR: 2.16(95% CI: 1.01, 5.11). The qualities of AFB smear microscopy reading and smearing were low in most of the laboratories of the health centers. Therefore, it is essential to strength EQA program through building the capacity of laboratory professionals.

  2. Vector wind and vector wind shear models 0 to 27 km altitude for Cape Kennedy, Florida, and Vandenberg AFB, California (United States)

    Smith, O. E.


    The techniques are presented to derive several statistical wind models. The techniques are from the properties of the multivariate normal probability function. Assuming that the winds can be considered as bivariate normally distributed, then (1) the wind components and conditional wind components are univariate normally distributed, (2) the wind speed is Rayleigh distributed, (3) the conditional distribution of wind speed given a wind direction is Rayleigh distributed, and (4) the frequency of wind direction can be derived. All of these distributions are derived from the 5-sample parameter of wind for the bivariate normal distribution. By further assuming that the winds at two altitudes are quadravariate normally distributed, then the vector wind shear is bivariate normally distributed and the modulus of the vector wind shear is Rayleigh distributed. The conditional probability of wind component shears given a wind component is normally distributed. Examples of these and other properties of the multivariate normal probability distribution function as applied to Cape Kennedy, Florida, and Vandenberg AFB, California, wind data samples are given. A technique to develop a synthetic vector wind profile model of interest to aerospace vehicle applications is presented.

  3. Shemya AFB, Alaska 1992 IRP field investigation report. Volume 3, Appendixes B, C, and D: Final report

    Energy Technology Data Exchange (ETDEWEB)


    The US Air Force is currently investigating 22 sites on Shemya Air Force Base (AFB) to determine if past spill and disposal activities have caused environmental damage. These investigations are being carried out under the Air Force`s Installation Restoration Program (IRP). Field investigations were performed in 1992 to obtain the information needed to assess what future actions will need to be carried out at each site. The island`s drinking water supply was also investigated. Activities completed at 10 selected sites included surface sampling to determine the lateral extent of contamination, subsurface sampling to determine the vertical extent of contamination, and the installation of well points and monitoring wells to determine the direction of groundwater flow and if the groundwater has been affected by a site. Geophysical surveys were performed at most sites to identify site boundaries and check for the presence of buried metal to be avoided during drilling activities. This report, appendices B, C, and D contains information on the following: geophysical contour maps and profile plots; human health risk assessment; and ecological risk assessment.


    Directory of Open Access Journals (Sweden)

    Nilotpal Banerjee


    Full Text Available BACKGROUND The geographically isolated underdeveloped state, Tripura of north-eastern region of India has been facing multidimensional problems like unemployment, lack of hygiene, illiteracy, lack of industrialisation, etc. So, it was intended to study the magnitude of reported tuberculosis in the community around the Tripura Medical College through RNTCP. MATERIALS AND METHODS Questionnaire, interrogative methods was primarily adopted. Inspection to different villages around and direct interrogation was done on awareness about the programme. Self-modified innovative method was also adopted to compare scientific reproducibility along with conventional method for AFB staining. RESULTS Analysis of results reveal 28% of people interrogated knew about RNTC programme. 16% of people had seen and heard about the TB staff. 56% of people said that no health staff enquired on other factors like drinking water, mosquito and hygiene, etc. The innovative method of staining proved 100% successful, which was also easier, cheaper and more rapid. CONCLUSION DMC and DOTs services had been quite good as evident from document records and on interrogation to the attendees. 80% of attendees said that they would complete the course of treatment. 83% were happy with the provisions of DOTs and DMC.

  5. External quality assessment of AFB smear microscopy performances and its associated factors in selected private health facilities in Addis Ababa, Ethiopia. (United States)

    Mosissa, Lemi; Kebede, Abebaw; Mindaye, Tedla; Getahun, Muluwork; Tulu, Sisay; Desta, Kassu


    Tuberculosis (TB) is still a public health problem in sub Saharan African countries. In resource-limited settings, TB diagnosis relies on sputum smear microscopy, with low and variable sensitivities, especially in paucibacillary pediatric and HIV-associated TB patients. Tuberculosis microscopy centers have several weaknesses like overworking, insufficiently trained personnel, inconsistent reagent supplies, and poorly maintained equipments; thus, there is a critical need for investments in laboratory infrastructure, capacity building, and quality assurance schemes. The performance of TB microscopy centers in the private health facilities in Addis Ababa is not known so far. The main objective of the study was to assess laboratory performance of acid fast bacilli (AFB) smear microscopy and its associated factors in selected private health facilities in Addis Ababa, Ethiopia. A cross-sectional study was conducted in 33 selected private health facilities of Addis Ababa, Ethiopia comprising 7 hospitals, 2 NGO health centers, 23 higher clinics and 1 diagnostic laboratory that provide AFB smear microscopy services. The study was conducted from January to April 2014. A total of 283 stained sputum smears were randomly collected from participant laboratories for blinded rechecking, 320 panel slides were sent to 32 microscopy centers to evaluate their performance on AFB reading, staining and reporting. Checklists were used to assess quality issues of laboratories. Data were captured, cleaned, and analyzed using SPSS version 16.0; χ(2) tests, kappa statistics were used for comparison purpose. P value laboratories, 2-scored 100%, 15 scored 80-95% & the remaining 15 scored 50-75% for overall proficiency test performance. There were 10 (3.15%) major errors and 121 (37.8%) minor errors. The sensitivity, specificity, PPV and NPV of panel reading by microscopy centers were 89%, 96%, 96%, and 90% respectively. Out of 283 randomly selected slides for blind rechecking, 11 (3.9%) slides

  6. Test and Evaluation of Reduced Rate Multiplexers. (United States)


    employed by your organization , please notify RADC. (DCLp) Griffiss AFB NY 13441. This will assist .us in maintaining a current mailin list. Do not organized as follows. There will be some general discussions applicable to the overall program. A separate section will be devoted to each of the...modulation transmitted as a vestigial . sideband line signal, -16 dB carrier 2853 Hz added in quadrature, 4 level 4800 baud 9600 BIS, 4800/7200/9600 B

  7. The pea branching RMS2 gene encodes the PsAFB4/5 auxin receptor and is involved in an auxin-strigolactone regulation loop. (United States)

    Ligerot, Yasmine; de Saint Germain, Alexandre; Waldie, Tanya; Troadec, Christelle; Citerne, Sylvie; Kadakia, Nikita; Pillot, Jean-Paul; Prigge, Michael; Aubert, Grégoire; Bendahmane, Abdelhafid; Leyser, Ottoline; Estelle, Mark; Debellé, Frédéric; Rameau, Catherine


    Strigolactones (SLs) are well known for their role in repressing shoot branching. In pea, increased transcript levels of SL biosynthesis genes are observed in stems of highly branched SL deficient (ramosus1 (rms1) and rms5) and SL response (rms3 and rms4) mutants indicative of negative feedback control. In contrast, the highly branched rms2 mutant has reduced transcript levels of SL biosynthesis genes. Grafting studies and hormone quantification led to a model where RMS2 mediates a shoot-to-root feedback signal that regulates both SL biosynthesis gene transcript levels and xylem sap levels of cytokinin exported from roots. Here we cloned RMS2 using synteny with Medicago truncatula and demonstrated that it encodes a putative auxin receptor of the AFB4/5 clade. Phenotypes similar to rms2 were found in Arabidopsis afb4/5 mutants, including increased shoot branching, low expression of SL biosynthesis genes and high auxin levels in stems. Moreover, afb4/5 and rms2 display a specific resistance to the herbicide picloram. Yeast-two-hybrid experiments supported the hypothesis that the RMS2 protein functions as an auxin receptor. SL root feeding using hydroponics repressed auxin levels in stems and down-regulated transcript levels of auxin biosynthesis genes within one hour. This auxin down-regulation was also observed in plants treated with the polar auxin transport inhibitor NPA. Together these data suggest a homeostatic feedback loop in which auxin up-regulates SL synthesis in an RMS2-dependent manner and SL down-regulates auxin synthesis in an RMS3 and RMS4-dependent manner.

  8. Risk assessment of aflatoxins B1 (AFB1) in corn arepas in Colombia and chemical risk assessment case study mercury in Fish

    International Nuclear Information System (INIS)

    Correa Lizarazo, D.


    The power point presentation is about: Identify the pair substrate (corn, wheat and rice) - mycotoxin (DON, AFB1) higher risk for the Colombian population, based on the exposure assessment and mercury in freshwater fish from Colombia. This report answer some the following questions: what are the most consumed products in the country, which may create a risk for the Colombian population, what are the prevention and control recommendations to reduce potential contamination of the products selected, what are economic activities and their impact areas that contribute most to the incorporation of of mercury in freshwater fish from Colombia,what are the species that may pose greater accumulation of mercury and methylmercury identified , what is the risk associated with the consumption of the species, what are the preventive measures to minimize exposure from consumption of fish with mercury and methylmercury and possible intervention strategies

  9. Interaction of mammary bovine ABCG2 with AFB1 and its metabolites and regulation by PCB 126 in a MDCKII in vitro model. (United States)

    Manzini, L; Halwachs, S; Girolami, F; Badino, P; Honscha, W; Nebbia, C


    The ATP-binding cassette efflux transporter ABCG2 plays a key role in the mammary excretion of drugs and toxins in humans and animals. Aflatoxins (AF) are worldwide contaminants of food and feed commodities, while PCB 126 is a dioxin-like PCB which may contaminate milk and dairy products. Both compounds are known human carcinogens. The interactions between AF and bovine ABCG2 (bABCG2) as well as the effects of PCB 126 on its efflux activity have been investigated by means of the Hoechst H33342 transport assay in MDCKII cells stably expressing mammary bABCG2. Both AFB1 and its main milk metabolite AFM1 showed interaction with bABCG2 even at concentrations approaching the legal limits in feed and food commodities. Moreover, PCB 126 significantly enhanced bABCG2 functional activity. Specific inhibitors of either AhR (CH233191) or ABCG2 (Ko143) were able to reverse the PCB 126-induced increase in bABCG2 transport activity, showing the specific upregulation of the efflux protein by the AhR pathway. The incubation of PCB 126-pretreated cells with AFM1 was able to substantially reverse such effect, with still unknown mechanism(s). Overall, results from this study point to AFB1 and AFM1 as likely bABCG2 substrates. The PCB 126-dependent increased activity of the transporter could enhance the ABCG2-mediated excretion into dairy milk of chemicals (i.e., drugs and toxins) potentially harmful to neonates and consumers. © 2017 John Wiley & Sons Ltd.

  10. Forty Years of Research and Development at Griffiss Air Force Base, June 1951-June 1991 (United States)


    display-assisted intercept association capability. -1962 - 61 Reliability and Maintainability Reliability Physics Symposium The Armour Research...communications links. Status Control and Alerting and Reporting System ( SCARS ) RADC produced the Status Control and Alerting and Reporting System ( SCARS ...Acquisition, Tracking, and Kill Assessment SCARS Status Control and Alerting and Reporting System SDI Space Defense Initiative SEA Southeast Asia SEMANOL

  11. Smear-positive pulmonary tuberculosis and AFB examination practices according to the standard checklist of WHO's tuberculosis laboratory assessment tool in three governmental hospitals, Eastern Ethiopia. (United States)

    Mekonnen, Abiyu


    Using the Directly Observed Treatment-Short course (DOTS) program the World Health Organization's global target was to detect 70% of new sputum-smear positive PTB cases. Smear positive PTB cases are more infectious than the smear negative cases. The TB case detection rate remains very low in Ethiopia, but there are increases in smear-negative PTB diagnosis which could be attributed to several factors including poor quality of sputum smear-microscopy. A five years retrospective record review of data between September, 2007 and August, 2012 and an in-depth assessment of AFB staining practices of sputum smear using a standard checklist were made. The proportion of smear positive cases relative to overall Acid Fast Bacilli (AFB) screened was determined over a five year period to indicate the overall prevalence and the trend. Odds ratio with 95 percent confidence interval was calculated for categorical variables using multivariate Logistic Regression model to assess the strength of association. A total of 1266 individuals' data were reviewed. The majority of the study participants were male, 704 (55.6%), and rural residents, 690 (54.5%). The overall prevalence rate of smear positive PTB was 21.6%. Age categories between 15-24 and 25-34 years were independent predictors of smear positive PTB with adjusted odds ratio of 2.246 [95% CI (1.098-4.597)] and 2.267 [95% CI (1.107-4.642)], respectively. More males were affected by PTB than females with an adjusted odds ratio of 1.426 [95% CI (1.083-1.879)]. An in-depth interview with the respective laboratory chiefs showed that quality control measures for sputum smear microscopy were used at different levels of the testing activities; however, equipment function verification as a quality control measure was not accomplished regularly in all of the study hospital laboratories. The smear positive PTB case detection rate indicated in this study is significantly lower than the countries which met the 70% target of the World Health

  12. Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Nestani Tukvadze

    Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

  13. Integral or integrated marketing

    Directory of Open Access Journals (Sweden)

    Davčik Nebojša


    Full Text Available Marketing theorists and experts try to develop business efficient organization and to get marketing performance at higher, business integrated level since its earliest beginnings. The core issue in this paperwork is the dialectic and practical approach dilemma should we develop integrated or integral marketing approach in the organization. The presented company cases as well as dialectic and functional explanations of this dilemma clearly shows that integrated marketing is narrower approach than integral marketing if we take as focal point new, unique and completed entity. In the integration the essence is in getting different parts together, which do not have to make necessary the new entity. The key elements in the definition of the integral marketing are necessity and holistic, e.g. necessity to develop new, holistic entity.

  14. Evaluación de adsorbentes para la reducción de aflatoxina M1 en leche de vacas alimentadas con dietas contaminadas artificialmente con AFB

    Directory of Open Access Journals (Sweden)

    Federico Rojo


    Full Text Available Los adsorbentes han sido utilizados ampliamente para prevenir las micotoxicosis y la transferencia d e toxinas o sus metabolitos dentro de la cadena alimentaria. Particularmente, se unen a las aflatoxinas dentro del tracto gastrointestinal de los rumiantes, disminuyendo su biodisponibilidad y la transferencia de aflatoxin a M 1 (AFM 1 a la leche. El presente estudio se desarrolló para evaluar dos métodos de exposición a aflatoxina B 1 en vacas Holstein y monitorear la transferencia AFM 1 a la leche. Adicionalmente, se analizó el potencial de tres adsorbentes de aflatoxinas en ambos experimentos. Los resultados mostraron una tasa de trasferencia de AFB 1 a AFM 1 / día de 3.35 y 1.8 % en los dos experimentos respectivamente. La transferencia estimada de AFM 1 en la leche observada en el segundo método fue cercana a las obtenidas de vacas alimentadas con alimentos natura lmente contaminados con aflatoxinas. A diferencia de los glucomananos de paredes cel ulares de levaduras, ambos adsorbentes de aluminosilicatos disminuyeron significativamente los niveles de AFM 1 en la leche ( P <0.05.

  15. Integral-preserving integrators

    International Nuclear Information System (INIS)

    McLaren, D I; Quispel, G R W


    Ordinary differential equations having a first integral may be solved numerically using one of several methods, with the integral preserved to machine accuracy. One such method is the discrete gradient method. It is shown here that the order of the method can be bootstrapped repeatedly to higher orders of accuracy. The method is illustrated using the Henon-Heiles system. (letter to the editor)

  16. Automatic Strain-Rate Controller, (United States)


    D—AO37 9~e2 ROME AIR DEVELOPMENT CENTER GRIFFISS AFB N 1’ FIG 13/ 6AUTOMATIC STRAIN—RATE CONTROLLER, (U) DEC 76 R L HUNTSINGER. J A ADAMSK I...goes to zero. CONTROLLER, Leeds and Northrup Series 80 CAT with proportional band , rate , reset, and approach controls . Input from deviation output...8) through ( 16) . (8) Move the set-point slowl y up to 3 or 4. (9) If the recorder po inter hunts , adjust the func t ion controls on tine Ser

  17. AM Broadcast Emergency Relay (AMBER) (United States)


    TIFTON GA US FC-n 3 5000 1000 31.456 -83.561 231 4989 1430 WMNC MORGANTOWN NC US F--n 3 5000 1000 35.752 -81.717 232 5080 1440 KODL THE DALLES OR US FC-n...Loring, ME Cutter, ME Alt. CINCSAC Plattsburgh, NY March AFB, CA Barksdale, LA Pease, Nil CINCLANT Griffiss, NY Norfolk, VA Sy Johnson, NC Robbins, GA ...retransmission. This process is repeated at AM stations located on the A k 0. AA 0o. .... - ° o" : 331 s os 0,u . psi risk area .. 001 0 00 ga Haqua

  18. Ergonomic Survey, Hill AFB, UT (United States)


    Hygiene NIOSH a. CAPT Roger Jensen, Division of Safety Research b. LCDR Patricia Schnitzer, Division of Safety Research c. GS-14 Vern Putz-Anderson... Patricia Schnitzer was provided a current listing (October 1988-October 1990) of the CTD cases from the PHOENIX data base for review. There were a...MOTIVE AERO-MOTIVE U.K. LTD. RO. Box 2678 1090 Brevik Place Rassau Industrial Estate Kalamazoo, M1 49003 Mississauga, Ontario Ebbw Vale Gwent NP3 5SD Ph

  19. AFB Directory of Services Listings (United States)

    ... radio-talking-book/index.jsp Minnesota STAR Program Centennial Office Building Room 358 658 Cedar Street St. ... and Human Services Nebraska State Office Building 301 Centennial Mall South Lincoln, NE 68508 http://www.adrcnebraska. ...

  20. GPS Measurements at Vandenberg, AFB (United States)


    friorov, S A Ahic Aia.. SSSR DoAf US9. Ill𔃺 1113 I Iughison. J I (ec O Clmate chirie The 07CC scientific Assessment (Cambridge ni~v Pressý 16 snez. MC... Change or Climate (Wolo~ng GrOAI Viii eHefta Comm’ents 14 Timerev A A & Egorov S A A4lereotof G&droi lo 7 50-56 e91e .r condied 13 A A TsonoS...Complex. might easily be recovering from the mainshock accelerations An examination of the station displacements indicates that Comparing the changing

  1. Integrated economics

    International Nuclear Information System (INIS)

    Bratton, T.J.


    This article offers ideas for evaluating integrated solid waste management systems through the use of a conceptual cost overview. The topics of the article include the integrated solid waste management system; making assumptions about community characteristics, waste generation rates, waste collection responsibility, integrated system components, sizing and economic life of system facilities, system implementation schedule, facility ownership, and system administration; integrated system costs; integrated system revenues; system financing; cost projections; and making decisions

  2. Gauge Integral

    Directory of Open Access Journals (Sweden)

    Coghetto Roland


    Full Text Available Some authors have formalized the integral in the Mizar Mathematical Library (MML. The first article in a series on the Darboux/Riemann integral was written by Noboru Endou and Artur Korniłowicz: [6]. The Lebesgue integral was formalized a little later [13] and recently the integral of Riemann-Stieltjes was introduced in the MML by Keiko Narita, Kazuhisa Nakasho and Yasunari Shidama [12].


    NARCIS (Netherlands)

    Thomas, E. G. F.


    This paper deals with the theory of integration of scalar functions with respect to a measure with values in a, not necessarily locally convex, topological vector space. It focuses on the extension of such integrals from bounded measurable functions to the class of integrable functions, proving

  4. Interorganisational Integration

    DEFF Research Database (Denmark)

    Lyngsø, Anne Marie; Godtfredsen, Nina Skavlan; Frølich, Anne


    INTRODUCTION: Despite many initiatives to improve coordination of patient pathways and intersectoral cooperation, Danish health care is still fragmented, lacking intra- and interorganisational integration. This study explores barriers to and facilitators of interorganisational integration...... at a university hospital in the Capital Region of Denmark. RESULTS AND DISCUSSION: Our results can be grouped into five influencing areas for interorganisational integration: communication/information transfer, committed leadership, patient engagement, the role and competencies of the general practitioner...... and organisational culture. Proposed solutions to barriers in each area hold the potential to improve care integration as experienced by individuals responsible for supporting and facilitating it. Barriers and facilitators to integrating care relate to clinical, professional, functional and normative integration...

  5. Vertical integration

    International Nuclear Information System (INIS)

    Antill, N.


    This paper focuses on the trend in international energy companies towards vertical integration in the gas chain from wellhead to power generation, horizontal integration in refining and marketing businesses, and the search for larger projects with lower upstream costs. The shape of the petroleum industry in the next millennium, the creation of super-major oil companies, and the relationship between size and risk are discussed. The dynamics of vertical integration, present events and future developments are considered. (UK)

  6. Integral equations

    CERN Document Server

    Moiseiwitsch, B L


    Two distinct but related approaches hold the solutions to many mathematical problems--the forms of expression known as differential and integral equations. The method employed by the integral equation approach specifically includes the boundary conditions, which confers a valuable advantage. In addition, the integral equation approach leads naturally to the solution of the problem--under suitable conditions--in the form of an infinite series.Geared toward upper-level undergraduate students, this text focuses chiefly upon linear integral equations. It begins with a straightforward account, acco

  7. Integrated Design

    DEFF Research Database (Denmark)

    Lenau, Torben Anker


    A homepage on the internet with course material, lecture plan, student exercises, etc. Continuesly updated during the course Integrated Design (80402, 80403)......A homepage on the internet with course material, lecture plan, student exercises, etc. Continuesly updated during the course Integrated Design (80402, 80403)...

  8. Organising integration

    DEFF Research Database (Denmark)

    Axelsson, Runo


    Background: In Sweden, as in many other countries, there has been a succession of trends in the organisation of health care and other welfare services. These trends have had different implications for the integration of services in the health and welfare system. Aims: One aim is to discuss...... the implications of different organisational trends for the integration of health and welfare services. Another aim is to introduce a Swedish model of financial coordination as a flexible way to organise integration. Organisational trends: In the 1960’s there was an expansion of health and welfare services leading...... an increasing lack of integration in the health and welfare system. In the 2000’s, there has been a re-centralisation through mergers of hospitals, regions and state agencies. It has become clear, however, that mergers do not promote integration but rather increase the bureaucratisation of the system. Model...

  9. The integration of immigrants


    Bauböck, Rainer


    from the Table of Contents: Migration and integration - Basic concepts and definitions; Immigration and Integration policies; The legal framework for integration; Dimension of social integration; Cultural integration; Conclusions;

  10. Integrative psychotherapy. (United States)

    Kozarić-Kovacić, Dragica


    The main purposes of the article are to present the history of integration in psychotherapy, the reasons of the development integrative approaches, and the approaches to integration in psychotherapy. Three approaches to integration in psychotherapy exist: theoretical integration, theoretical eclecticism, and common factors in different psychotherapeutic trends. In integrative psychotherapy, the basic epistemology, theory, and clinical practice are based on the phenomenology, field theory, holism, dialogue, and co-creation of dialogue in the therapeutic relationship. The main criticism is that integrative psychotherapy suffers from confusion and many unresolved controversies. It is difficult to theoretically and methodologically define the clinically applied model that is based on such a different epistemological and theoretical presumptions. Integrative psychotherapy is a synthesis of humanistic psychotherapy, object relations theory, and psychoanalytical self psychology. It focuses on the dynamics and potentials of human relationships, with a goal of changing the relations and understanding internal and external resistances. The process of integrative psychotherapy is primarily focused on the developmental-relational model and co-creation of psychotherapeutic relationship as a single interactive event, which is not unilateral, but rather a joint endeavor by both the therapist and the patient/client. The need for a relationship is an important human need and represents a process of attunement that occurs as a response to the need for a relationship, a unique interpersonal contact between two people. If this need is not met, it manifests with the different feelings and various defenses. To meet this need, we need to have another person with whom we can establish a sensitive, attuned relationship. Thus, the therapist becomes this person who tries to supplement what the person did not receive. Neuroscience can be a source of integration through different therapies. We

  11. Integration of Chandrasekhar's integral equation

    International Nuclear Information System (INIS)

    Tanaka, Tasuku


    We solve Chandrasekhar's integration equation for radiative transfer in the plane-parallel atmosphere by iterative integration. The primary thrust in radiative transfer has been to solve the forward problem, i.e., to evaluate the radiance, given the optical thickness and the scattering phase function. In the area of satellite remote sensing, our problem is the inverse problem: to retrieve the surface reflectance and the optical thickness of the atmosphere from the radiance measured by satellites. In order to retrieve the optical thickness and the surface reflectance from the radiance at the top-of-the atmosphere (TOA), we should express the radiance at TOA 'explicitly' in the optical thickness and the surface reflectance. Chandrasekhar formalized radiative transfer in the plane-parallel atmosphere in a simultaneous integral equation, and he obtained the second approximation. Since then no higher approximation has been reported. In this paper, we obtain the third approximation of the scattering function. We integrate functions derived from the second approximation in the integral interval from 1 to ∞ of the inverse of the cos of zenith angles. We can obtain the indefinite integral rather easily in the form of a series expansion. However, the integrals at the upper limit, ∞, are not yet known to us. We can assess the converged values of those series expansions at ∞ through calculus. For integration, we choose coupling pairs to avoid unnecessary terms in the outcome of integral and discover that the simultaneous integral equation can be deduced to the mere integral equation. Through algebraic calculation, we obtain the third approximation as a polynomial of the third degree in the atmospheric optical thickness

  12. Integrated services

    International Nuclear Information System (INIS)

    Chafcouloff, S.; Michel, G.; Trice, M.; Clark, G.; Cosad, C.; Forbes, K.


    Integrated services is the name given to several services grouped together under a single contract. Four key factors determine the success of integrated services projects: teamwork, common objectives, technology, and shared benefits. For oil companies, integration means smoother, more efficient operations by bringing service companies on board as part of the team. For the service industry, it means a radical change in the way business is conducted, taking on more responsibility in return for greater incentives. This article reviews the need for change and the approach Schlumberger has adopted to meet this challenge. 20 figs., 20 refs

  13. Integrated services

    Energy Technology Data Exchange (ETDEWEB)

    Chafcouloff, S.; Michel, G.; Trice, M. [Schlumberger Integrated Project Management Group, Montrouge (France); Clark, G. [Schlumberger Testing Services, Aberdeen (United Kingdom); Cosad, C.; Forbes, K. [Schlumberger Integrated Project Management Group, Aberdeen (United Kingdom)


    Integrated services is the name given to several services grouped together under a single contract. Four key factors determine the success of integrated services projects: teamwork, common objectives, technology, and shared benefits. For oil companies, integration means smoother, more efficient operations by bringing service companies on board as part of the team. For the service industry, it means a radical change in the way business is conducted, taking on more responsibility in return for greater incentives. This article reviews the need for change and the approach Schlumberger has adopted to meet this challenge. 20 figs., 20 refs


    Directory of Open Access Journals (Sweden)

    Lioara-Bianca BUBOIU


    Full Text Available Accepting and valuing people with disabilities is a key aspect of social policies promoted worldwide. The implementation of these policies aim normalize the lives of people with disabilities through full integration in the society to which they belong. Removing discrimination and social barriers equates to a maturing of the society, maturing translated by accepting diversity that surrounds us. Each person must be appreciated at its true value regardless of its condition of normality or deviation from it. Valuing individuals can be achieved only through a full acceptance in society, by assigning statuses and fulfilling social roles. School integration of children with special educational needs in mainstream education is a challenge and involves many aspects to be successful. It is the premise of social integration, the basis for future socio-professional insertion. Integrated education is the first step towards a world of equal opportunities, a world without discrimination.

  15. Integral cryptanalysis

    DEFF Research Database (Denmark)

    Knudsen, Lars Ramkilde; Wagner, David


    This paper considers a cryptanalytic approach called integral cryptanalysis. It can be seen as a dual to differential cryptanalysis and applies to ciphers not vulnerable to differential attacks. The method is particularly applicable to block ciphers which use bijective components only.......This paper considers a cryptanalytic approach called integral cryptanalysis. It can be seen as a dual to differential cryptanalysis and applies to ciphers not vulnerable to differential attacks. The method is particularly applicable to block ciphers which use bijective components only....

  16. Systems integration. (United States)

    Siemieniuch, C E; Sinclair, M A


    The paper presents a view of systems integration, from an ergonomics/human factors perspective, emphasising the process of systems integration as is carried out by humans. The first section discusses some of the fundamental issues in systems integration, such as the significance of systems boundaries, systems lifecycle and systems entropy, issues arising from complexity, the implications of systems immortality, and so on. The next section outlines various generic processes for executing systems integration, to act as guides for practitioners. These address both the design of the system to be integrated and the preparation of the wider system in which the integration will occur. Then the next section outlines some of the human-specific issues that would need to be addressed in such processes; for example, indeterminacy and incompleteness, the prediction of human reliability, workload issues, extended situation awareness, and knowledge lifecycle management. For all of these, suggestions and further readings are proposed. Finally, the conclusions section reiterates in condensed form the major issues arising from the above.

  17. Functional Integration (United States)

    Cartier, Pierre; DeWitt-Morette, Cecile


    Acknowledgements; List symbols, conventions, and formulary; Part I. The Physical and Mathematical Environment: 1. The physical and mathematical environment; Part II. Quantum Mechanics: 2. First lesson: gaussian integrals; 3. Selected examples; 4. Semiclassical expansion: WKB; 5. Semiclassical expansion: beyond WKB; 6. Quantum dynamics: path integrals and operator formalism; Part III. Methods from Differential Geometry: 7. Symmetries; 8. Homotopy; 9. Grassmann analysis: basics; 10. Grassmann analysis: applications; 11. Volume elements, divergences, gradients; Part IV. Non-Gaussian Applications: 12. Poisson processes in physics; 13. A mathematical theory of Poisson processes; 14. First exit time: energy problems; Part V. Problems in Quantum Field Theory: 15. Renormalization 1: an introduction; 16. Renormalization 2: scaling; 17. Renormalization 3: combinatorics; 18. Volume elements in quantum field theory Bryce DeWitt; Part VI. Projects: 19. Projects; Appendix A. Forward and backward integrals: spaces of pointed paths; Appendix B. Product integrals; Appendix C. A compendium of gaussian integrals; Appendix D. Wick calculus Alexander Wurm; Appendix E. The Jacobi operator; Appendix F. Change of variables of integration; Appendix G. Analytic properties of covariances; Appendix H. Feynman's checkerboard; Bibliography; Index.

  18. Case study of an approved corrective action integrating active remediation with intrinsic remediation

    International Nuclear Information System (INIS)

    Teets, D.B.; Guest, P.R.; Blicker, B.R.


    Parsons Engineering Science, Inc., performed UST removals and/or site assessments at UST system locations at a former US Air Force Base (AFB) in Denver, Colorado. Four UST systems, incorporating 17 USTs, were located within the petroleum, oils, and lubricants bulk storage yard (POL Yard) of the former AFB. During the tank removals and subsequent site investigations, petroleum hydrocarbon contamination was found in soils at each site. Significant releases from two of the UST systems resulted in a dissolved benzene, toluene, ethylbenzene, and xylenes (BTEX) plume in the groundwater, and smear-zone contamination of soils beneath the majority of the POL Yard. Because of the close proximity of the UST systems, and the presence of the groundwater plume beneath the POL Yard, a corrective action plan (CAP) was prepared that encompassed all four UST systems. An innovative, risk-based CAP integrated active remediation of petroleum-contaminated soils with intrinsic remediation of groundwater. A natural attenuation evaluation for the dissolved BTEX was performed to demonstrate that natural attenuation processes are providing adequate remediation of groundwater and to predict the fate of the groundwater plume. BTEX concentrations versus distance were regressed to obtain attenuation rates, which were then used to calculate BTEX degradation rates using a one-dimensional, steady-state analytical solution. Additionally, electron acceptor concentrations in groundwater were compared to BTEX concentrations to provide evidence that natural attenuation of BTEX compounds was occurring. The natural attenuation evaluation was used in the CAP to support the intrinsic remediation with long-term monitoring alternative for groundwater, thereby avoiding the installation of an expensive groundwater remediation system

  19. Integrated Toys

    DEFF Research Database (Denmark)

    Petersson, Eva


    the theoretical foundations of play and learning. In this presentation, we explore pedagogical potentials of new technologies and traditional toys integrated into a physical and virtual toy (hereinafter called integrated toy) with specific focus on the open-ended toy and non-formal learning. The integrated toy......Toys play a crucial role in supporting children’s learning and creation of meaning in their everyday life. Children also play with toys out of an interest to interact with others e.g. peers and adults. Tendencies of digital technology in toys have led to greater opportunities for manipulation...... and interaction supporting children’s play and learning such that technology is ever-present in the play environments of children. Although electronics have been deployed in tools for play and learning, most of it has facilitated individual learning. Computer games, for instance, most often are designed...

  20. Scientific integrity

    DEFF Research Database (Denmark)

    Merlo, Domenico Franco; Vahakangas, Kirsi; Knudsen, Lisbeth E.


    consent was obtained.Integrity is central to environmental health research searching for causal relations. It requires open communication and trust and any violation (i.e., research misconduct, including fabrication or falsification of data, plagiarism, conflicting interests, etc.) may endanger...

  1. Integrated marketing. (United States)


    St. John Health consists of nine hospitals throughout southern Michigan. Recently, in an attempt to brand the system as the state's premiere place for medical services, the system launched 'Real Medicine', a campaign that brands all nine hospitals together. Using print, radio, and television spots, the effort also integrates direct mail collateral and brochures to reach consumers.

  2. Integrative teaching

    NARCIS (Netherlands)

    Harris, Robert; Smids, Annejoke; Kors, Ninja


    This is an article about the integration of instrumental teaching, aural skills and keyboard skills and music theory at the pre-tertiary level. Team teaching and discipline crossover offer a possible solution to students’ inability to apply skills taught by specialists in separate fields. A personal

  3. Box Integrals

    Energy Technology Data Exchange (ETDEWEB)

    Bailey, David H.; Borwein, Jonathan M.; Crandall, Richard E.


    By a "box integral" we mean here an expectation $\\langle|\\vec r - \\vec q|^s \\rangle$ where $\\vec r$runs over the unit $n$-cube,with $\\vec q$ and $s$ fixed, explicitly:\\begin eqnarray*&&\\int_01 \\cdots \\int_01 \\left((r_1 - q_1)2 + \\dots+(r_n-q_n)2\\right)^ s/2 \\ dr_1 \\cdots dr_n.\\end eqnarray* The study ofbox integrals leads one naturally into several disparate fields ofanalysis. While previous studies have focused upon symbolic evaluationand asymptotic analysis of special cases (notably $s = 1$), we workherein more generally--in interdisciplinary fashion--developing resultssuch as: (1) analytic continuation (in complex $s$), (2) relevantcombinatorial identities, (3) rapidly converging series, (4) statisticalinferences, (5) connections to mathematical physics, and (6)extreme-precision quadrature techniques appropriate for these integrals.These intuitions and results open up avenues of experimental mathematics,with a view to new conjectures and theorems on integrals of thistype.

  4. Integrated Design

    DEFF Research Database (Denmark)

    Jørgensen, Michael; Nielsen, M. W.; Strømann-Andersen, Jakob Bjørn


    and describe the decision process. Specific attention is given to how the engineering input was presented and how it was able to facilitate the design development. Site and context, building shape, organization of functions and HVAC-systems were all included to obtain a complete picture of the building......, low-energy consumption, and high-quality indoor environment. We use this case study to investigate how technical knowledge about building performance can be integrated into the conceptual design stage. We have selected certain points during the design process that represented design challenges...

  5. Integrated controls

    International Nuclear Information System (INIS)

    Hollaway, F.W.


    During 1984, all portions of the Nova control system that were necessary for the support of laser activation and completion of the Nova project were finished and placed in service on time. The Nova control system has been unique in providing, on schedule, the capabilities required in the central control room and in various local control areas throughout the facility. The ambitious goal of deploying this system early enough to use it as an aid in the activation of the laser was accomplished; thus the control system made a major contribution to the completion of Nova activation on schedule. Support and enhancement activities continued during the year on the VAX computer systems, central control room, operator consoles and displays, Novanet data communications network, system-level software for both the VAX and LSI-11 computers, Praxis control system computer language, software management tools, and the development system, which includes office terminals. Computational support was also supplied for a wide variety of test fixtures required by the optical and mechanical subsystems. Significant new advancements were made in four areas in integrated controls this year: the integration software (which includes the shot scheduler), the Praxis language, software quality assurance audit, and software development and data handling. A description of the accomplishments in each of these areas follows

  6. Multidimensional singular integrals and integral equations

    CERN Document Server

    Mikhlin, Solomon Grigorievich; Stark, M; Ulam, S


    Multidimensional Singular Integrals and Integral Equations presents the results of the theory of multidimensional singular integrals and of equations containing such integrals. Emphasis is on singular integrals taken over Euclidean space or in the closed manifold of Liapounov and equations containing such integrals. This volume is comprised of eight chapters and begins with an overview of some theorems on linear equations in Banach spaces, followed by a discussion on the simplest properties of multidimensional singular integrals. Subsequent chapters deal with compounding of singular integrals

  7. Potential Impacts Related to the Air Training Command Realignments. Institutional Characteristics, Transportation, Civilian Community Utilities, Land Use for Craig AFB, Alabama, Webb AFB, Texas, Columbus AFB, Mississippi, Laughlin AFB, Texas, Reese AFB, Texas, Vance AFB, Oklahoma (United States)


    response and 70.4 percent civilian response, extend to 100 percent population, 1975; Counity Census Data, General Social =0 Economic Characteristics. 25...transportation problems exist and the alternative action is not txpected to disturb the situation in the future. 86 On-Base (AFERN No major problema of...values could increase in specific residential areas that are perceived as meeting certain economic and social needs where current 7acancies are minimal

  8. Integrated care. (United States)

    Warwick-Giles, Lynsey; Checkland, Kath


    Purpose The purpose of this paper is to try and understand how several organisations in one area in England are working together to develop an integrated care programme. Weick's (1995) concept of sensemaking is used as a lens to examine how the organisations are working collaboratively and maintaining the programme. Design/methodology/approach Qualitative methods included: non-participant observations of meetings, interviews with key stakeholders and the collection of documents relating to the programme. These provided wider contextual information about the programme. Comprehensive field notes were taken during observations and analysed alongside interview transcriptions using NVIVO software. Findings This paper illustrates the importance of the construction of a shared identity across all organisations involved in the programme. Furthermore, the wider policy discourse impacted on how the programme developed and influenced how organisations worked together. Originality/value The role of leaders from all organisations involved in the programme was of significance to the overall development of the programme and the sustained momentum behind the programme. Leaders were able to generate a "narrative of success" to drive the programme forward. This is of particular relevance to evaluators, highlighting the importance of using multiple methods to allow researchers to probe beneath the surface of programmes to ensure that evidence moves beyond this public narrative.

  9. Baseline Noise Measurements at Vandenberg AFB, California. (United States)


    CCCMCC0ACC. 4 4;; l;1;9 4CPI* ACCA . 9 ; 4 1 4 #mr nvvr.&%0naof w# ed .4 in l-4P" a a .4 mIAPl~ PlC C4 toi v .4 m t a A Cr l %n .Cl w o m a m ww...cooo, O 999944444992144.4449999 9. 49999999994444444449944944 in- Is f5 If 4n % r, A : O IV .0 :, :,o t g Xw g V ;o oe a w I fft w q on f" 4 f 4 ’ i w

  10. Severe Weather Forecasting for Laughlin AFB, TX

    National Research Council Canada - National Science Library

    Cercone, Eric J


    .... Indices, including convective available potential energy (CAPE) and mean layer CAPE (MLCAPE), along with sounding parameters and combinations of such as 0-2 and 0-6 km bulk shear, 700-500 mb lapse rate, lifted condensation level...

  11. Historic Landscape Survey, Randolph AFB, Texas (United States)


    listed men. Throughout 1930 and 1931, construction at the base was steady in spite of the nation’s depressed economy.22 Figure 3. The road... centennial year of 1932, during which patriotic societies planted trees throughout the country in honor of the first president. During the next year, the

  12. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland AFB, White Sands Missile Range/ Holloman AFB, New Mexico; Edwards AFB, Vandenberg AFB, California (United States)


    Sneed pincushion cactus T Kuen_zler hedgehog cactus - Sacramento oricklv ooppy - I Sacramento Mountains checkerspot - ! butterfly . . Federal Status E...caiifomicus Coho salmon ~_j_Pncorhynchus kisutch , Unarmoured three- spined 1 C~asterosleus aculeatus- ----: stickleback , wi/liamsoni 1 E T E...septentrionalis) Kuenzler hedgehog cachts (Echinocereus fendleri var. kuenzleri) THREATENED Bald eagle (Haliaeetus /.:ucocephalus) Mexican spotted owl (Strix

  13. Herbicide Orange Site Characterization Study, Eglin AFB (United States)


    F THIS PAGE Availabilit o this r is sp f o.n" the reverse of fo cove* . - .’.r. 717 CSAT CO ES ’SU JEC TE MS Coninu onrevrseif ece~ar an idntiy b...of Hardstand 7 and Surface Water Drainages ......... 4 3 Hardstand 7 Herbicide Oran&e Storage Locations .............. 5 4 Concentrations (in ppb) of...insoluble in water . The formula contained an approximate 50/50 mixture of the herbicides 2,4-dichlorophenoxyacetic acid (2,4,-D) and 2,4,5

  14. Historic Landscape Survey, Maxwell AFB, Alabama (United States)


    signifies Maxwell AFB’s historic landscapes. 2.1 The pre-military landscape Prehistory in the southeastern United States is generally designated as...the period of Native American occupation before Spanish explorers made contact in the fifteenth and sixteenth centuries. In Alabama, the prehistory ... prehistory or history is made clear.56 A historic property is determined to be either significant or not significant by applying standardized National

  15. Definite Integrals using Orthogonality and Integral Transforms

    Directory of Open Access Journals (Sweden)

    Howard S. Cohl


    Full Text Available We obtain definite integrals for products of associated Legendre functions with Bessel functions, associated Legendre functions, and Chebyshev polynomials of the first kind using orthogonality and integral transforms.

  16. Integrated project delivery : The designer as integrator

    NARCIS (Netherlands)

    Wamelink, J.W.F.; Koolwijk, J.S.J.; van Doorn, A.J.


    Process innovation related to integrated project delivery is an important topic in the building industry. Studies on process innovation through the use of integrated contracts usually focus on contractors, and particularly on the possibility of forward integration into the building process. Three

  17. Pro Spring Integration

    CERN Document Server

    Lui, M; Chan, Andy; Long, Josh


    Pro Spring Integration is an authoritative book from the experts that guides you through the vast world of enterprise application integration (EAI) and application of the Spring Integration framework towards solving integration problems. The book is:. * An introduction to the concepts of enterprise application integration * A reference on building event-driven applications using Spring Integration * A guide to solving common integration problems using Spring Integration What makes this book unique is its coverage of contemporary technologies and real-world information, with a focus on common p

  18. Tactical Systems Integration Laboratory (United States)

    Federal Laboratory Consortium — The Tactical Systems Integration Laboratory is used to design and integrate computer hardware and software and related electronic subsystems for tactical vehicles....

  19. SAP crm integration testing


    Černiavskaitė, Marija


    This Bachelor's thesis presents SAP CRM and integration systems testing analysis: investigation in SAP CRM and SAP PO systems, presentation of relationship between systems, introduction to third-party system (non-SAP) – Network Informational System (NIS) which has integration with SAP, presentation of best CRM testing practises, analysis and recommendation of integration testing. Practical integration testing is done in accordance to recommendations.

  20. Pipeline integrity management

    Energy Technology Data Exchange (ETDEWEB)

    Guyt, J.; Macara, C.


    This paper focuses on some of the issues necessary for pipeline operators to consider when addressing the challenge of managing the integrity of their systems. Topics are: Definition; business justification; creation and safeguarding of technical integrity; control and deviation from technical integrity; pipelines; pipeline failure assessment; pipeline integrity assessment; leak detection; emergency response. 6 figs., 3 tabs.

  1. Integral consideration of integrated management systems

    International Nuclear Information System (INIS)

    Frauenknecht, Stefan; Schmitz, Hans


    Aim of the project for the NPPs Kruemmel and Brunsbuettel (Vattenfall) is the integral view of the business process as basis for the implementation and operation of management systems in the domains quality, safety and environment. The authors describe the integral view of the business processes in the frame of integrated management systems with the focus nuclear safety, lessons learned in the past, the concept of a process-based controlling system and experiences from the practical realization.

  2. Buried waste integrated demonstration technology integration process

    International Nuclear Information System (INIS)

    Ferguson, J.S.; Ferguson, J.E.


    A Technology integration Process was developed for the Idaho National Energy Laboratories (INEL) Buried Waste Integrated Demonstration (BWID) Program to facilitate the transfer of technology and knowledge from industry, universities, and other Federal agencies into the BWID; to successfully transfer demonstrated technology and knowledge from the BWID to industry, universities, and other Federal agencies; and to share demonstrated technologies and knowledge between Integrated Demonstrations and other Department of Energy (DOE) spread throughout the DOE Complex. This document also details specific methods and tools for integrating and transferring technologies into or out of the BWID program. The document provides background on the BWID program and technology development needs, demonstrates the direction of technology transfer, illustrates current processes for this transfer, and lists points of contact for prospective participants in the BWID technology transfer efforts. The Technology Integration Process was prepared to ensure compliance with the requirements of DOE's Office of Technology Development (OTD)

  3. Power Systems Integration Laboratory | Energy Systems Integration Facility (United States)

    | NREL Power Systems Integration Laboratory Power Systems Integration Laboratory Research in the Energy System Integration Facility's Power Systems Integration Laboratory focuses on the microgrid applications. Photo of engineers testing an inverter in the Power Systems Integration Laboratory

  4. Grid Integration Research | Wind | NREL (United States)

    Grid Integration Research Grid Integration Research Researchers study grid integration of wind three wind turbines with transmission lines in the background. Capabilities NREL's grid integration electric power system operators to more efficiently manage wind grid system integration. A photo of

  5. Distribution Integration | Grid Modernization | NREL (United States)

    Distribution Integration Distribution Integration The goal of NREL's distribution integration research is to tackle the challenges facing the widespread integration of distributed energy resources NREL engineers mapping out a grid model on a whiteboard. NREL's research on the integration of

  6. Transmission Integration | Grid Modernization | NREL (United States)

    Transmission Integration Transmission Integration The goal of NREL's transmission integration integration issues and provide data, analysis, and models to enable the electric power system to more and finding solutions to address them to enable transmission grid integration. Capabilities Power

  7. One loop integrals reduction

    International Nuclear Information System (INIS)

    Sun Yi; Chang Haoran


    By further examining the symmetry of external momenta and masses in Feynman integrals, we fulfilled the method proposed by Battistel and Dallabona, and showed that recursion relations in this method can be applied to simplify Feynman integrals directly. (authors)

  8. Laplace Transforms without Integration (United States)

    Robertson, Robert L.


    Calculating Laplace transforms from the definition often requires tedious integrations. This paper provides an integration-free technique for calculating Laplace transforms of many familiar functions. It also shows how the technique can be applied to probability theory.

  9. Sesquilinear uniform vector integral

    Indian Academy of Sciences (India)

    theory, together with his integral, dominate contemporary mathematics. ... directions belonging to Bartle and Dinculeanu (see [1], [6], [7] and [2]). ... in this manner, namely he integrated vector functions with respect to measures of bounded.

  10. The Integrated Renovation Process

    DEFF Research Database (Denmark)

    Galiotto, Nicolas; Heiselberg, Per; Knudstrup, Mary-Ann

    The Integrated Renovation Process (IRP) is a user customized methodology based on judiciously selected constructivist and interactive multi-criteria decision making methods (Galiotto, Heiselberg, & Knudstrup, 2014 (expected)). When applied for home renovation, the Integrated Renovation Process...

  11. Multisensory Integration for Pilot Spatial Orientation (United States)


    1993-0022). Wright-Patterson AFB, OH: Air Force Armstrong Laboratories. Gilson, R.D., Ventola, R.W., & Fenton , R.E. (1975). A kinesthetic...Ventola, R.W., & Fenton , R.E. (1975). A kinesthetic-tactual display for stall deterrence. In Eleventh Annual Conference on Manual Control (NASA TM...M., L) 2 = Impact (H, M, L) 3 = Persistence/Difficulty to work-around (H, M., L) 4 = Overall Severity: 1=Severe, 2=Major, 3=Minor, 4= Cosmetic

  12. Spring integration essentials

    CERN Document Server

    Pandey, Chandan


    This book is intended for developers who are either already involved with enterprise integration or planning to venture into the domain. Basic knowledge of Java and Spring is expected. For newer users, this book can be used to understand an integration scenario, what the challenges are, and how Spring Integration can be used to solve it. Prior experience of Spring Integration is not expected as this book will walk you through all the code examples.

  13. Boolean integral calculus (United States)

    Tucker, Jerry H.; Tapia, Moiez A.; Bennett, A. Wayne


    The concept of Boolean integration is developed, and different Boolean integral operators are introduced. Given the changes in a desired function in terms of the changes in its arguments, the ways of 'integrating' (i.e. realizing) such a function, if it exists, are presented. The necessary and sufficient conditions for integrating, in different senses, the expression specifying the changes are obtained. Boolean calculus has applications in the design of logic circuits and in fault analysis.

  14. Integrated vs. Federated Search

    DEFF Research Database (Denmark)

    Løvschall, Kasper


    Oplæg om forskelle og ligheder mellem integrated og federated search i bibliotekskontekst. Holdt ved temadag om "Integrated Search - samsøgning i alle kilder" på Danmarks Biblioteksskole den 22. januar 2009.......Oplæg om forskelle og ligheder mellem integrated og federated search i bibliotekskontekst. Holdt ved temadag om "Integrated Search - samsøgning i alle kilder" på Danmarks Biblioteksskole den 22. januar 2009....

  15. Integrated nursery pest management (United States)

    R. Kasten Dumroese


    What is integrated pest management? Take a look at the definition of each word to better understand the concept. Two of the words (integrated and management) are relatively straightforward. Integrated means to blend pieces or concepts into a unified whole, and management is the wise use of techniques to successfully accomplish a desired outcome. A pest is any biotic (...

  16. Sledge-Hammer Integration (United States)

    Ahner, Henry


    Integration (here visualized as a pounding process) is mathematically realized by simple transformations, successively smoothing the bounding curve into a straight line and the region-to-be-integrated into an area-equivalent rectangle. The relationship to Riemann sums, and to the trapezoid and midpoint methods of numerical integration, is…

  17. Discrete bipolar universal integrals

    Czech Academy of Sciences Publication Activity Database

    Greco, S.; Mesiar, Radko; Rindone, F.


    Roč. 252, č. 1 (2014), s. 55-65 ISSN 0165-0114 R&D Projects: GA ČR GAP402/11/0378 Institutional support: RVO:67985556 Keywords : bipolar integral * universal integral * Choquet integral Subject RIV: BA - General Mathematics Impact factor: 1.986, year: 2014

  18. Responsibility and Integrated Thinking


    Robinson, SJ


    Integrated thinking is essentially focused in dialogue and communication. This is partly because relationships and related purpose focus on action, which itself acts as a means of integration, and partly because critical dialogue enables better, more responsive, integrated thinking and action.

  19. Ramjets: Airframe integration

    NARCIS (Netherlands)

    Moerel, J.L.; Halswijk, W.


    These notes deal with the integration of a (sc)ramjet engine in either an axisymmetric or a waverider type of cruise missile configuration. The integration aspects relate to the integration of the external and internal flow paths in geometrical configurations that are being considered worldwide.

  20. Foundations for Psychotherapy Integration

    Directory of Open Access Journals (Sweden)

    António Branco Vasco


    Full Text Available The movement for integration in psychotheray is clearly one of the main trends that can be observed in the field. The author stresses three main reasons for this state of affairs and as a way of justifying the importance of integration: historical and psychosocial, empirical and philosophical. A specific way of thinking in integrative terms is also outlined - "paradigmatic complementarity."

  1. Steffensen's integral inequality for conformable fractional integrals

    Directory of Open Access Journals (Sweden)

    Mehmet Zeki Sarikaya


    Full Text Available The aim of this paper is to establish some Steffensen’s type inequalities for conformable fractional integral. The results presented here would provide generalizations of those given in earlier works.

  2. Dover AFB Catchment Area TRICARE Marketing Plan, 436th Medical Group, Dover AFB, Delaware, (United States)


    cosmetic changes (Nadiu, Kleimenhagen, and Pillari 1992). Berkowitz classifies the debate in terms of eras. During the production era, the function was to...facilities in Smyrna and Fenton , Delaware. KGH has aggressive marketing and community education programs which include classes on: cardiopulmonary

  3. Integrated cryogenic sensors

    International Nuclear Information System (INIS)

    Juanarena, D.B.; Rao, M.G.


    Integrated cryogenic pressure-temperature, level-temperature, and flow-temperature sensors have several advantages over the conventional single parameter sensors. Such integrated sensors were not available until recently. Pressure Systems, Inc. (PSI) of Hampton, Virginia, has introduced precalibrated precision cryogenic pressure sensors at the Los Angeles Cryogenic Engineering Conference in 1989. Recently, PSI has successfully completed the development of integrated pressure-temperature and level-temperature sensors for use in the temperature range 1.5-375K. In this paper, performance characteristics of these integrated sensors are presented. Further, the effects of irradiation and magnetic fields on these integrated sensors are also reviewed

  4. Nature-based integration

    DEFF Research Database (Denmark)

    Pitkänen, Kati; Oratuomi, Joose; Hellgren, Daniela

    Increased attention to, and careful planning of the integration of migrants into Nordic societies is ever more important. Nature based integration is a new solution to respond to this need. This report presents the results of a Nordic survey and workshop and illustrates current practices of nature...... based integration by case study descriptions from Denmark, Sweden Norway and Finland. Across Nordic countries several practical projects and initiatives have been launched to promote the benefits of nature in integration and there is also growing academic interest in the topic. Nordic countries have...... the potential of becoming real forerunners in nature based integration even at the global scale....

  5. Photonic Integrated Circuits (United States)

    Krainak, Michael; Merritt, Scott


    Integrated photonics generally is the integration of multiple lithographically defined photonic and electronic components and devices (e.g. lasers, detectors, waveguides passive structures, modulators, electronic control and optical interconnects) on a single platform with nanometer-scale feature sizes. The development of photonic integrated circuits permits size, weight, power and cost reductions for spacecraft microprocessors, optical communication, processor buses, advanced data processing, and integrated optic science instrument optical systems, subsystems and components. This is particularly critical for small spacecraft platforms. We will give an overview of some NASA applications for integrated photonics.

  6. Integration of generic issues

    International Nuclear Information System (INIS)

    Thatcher, D.


    The NRC has recognized the need to integrate generic issues (GIs). The GI process includes a number of phases, all of which should recognize the potential for overlap and conflict among related issues. In addition to the issues themselves, other related NRC and industry programs and activities need to be factored into the GI process. Integration has taken place, or is taking place, for a number of GIs. Each case of integration involves a specific set of circumstances and, as a result, the way in which integration proceeds can vary. This paper discusses the integration of issues in the generic issue process and provides a number of examples

  7. Four integration patterns

    DEFF Research Database (Denmark)

    Bygstad, Bendik; Nielsen, Peter Axel; Munkvold, Bjørn Erik


    This paper aims to contribute to a theory of integration within the field of IS project management. Integration is a key IS project management issue when new systems are developed and implemented into an increasingly integrated information infrastructure in corporate and governmental organizations....... Expanding the perspective of traditional project management research, we draw extensively on central insights from IS research. Building on socio-technical IS research and Software Engineering research we suggest four generic patterns of integration: Big Bang, Stakeholder Integration, Technical Integration...... and Socio-Technical Integration. We analyze and describe the advantages and disadvantages of each pattern. The four patterns are ideal types. To explore the forces and challenges in these patterns three longitudinal case studies were conducted. In particular we investigate the management challenges for each...

  8. Searching for integrable systems

    International Nuclear Information System (INIS)

    Cary, J.R.


    Lack of integrability leads to undesirable consequences in a number of physical systems. The lack of integrability of the magnetic field leads to enhanced particle transport in stellarators and tokamaks with tearing-mode turbulence. Limitations of the luminosity of colliding beams may be due to the onset of stochasticity. Enhanced radial transport in mirror machines caused by the lack of integrability and/or the presence of resonances may be a significant problem in future devices. To improve such systems one needs a systematic method for finding integrable systems. Of course, it is easy to find integrable systems if no restrictions are imposed; textbooks are full of such examples. The problem is to find integrable systems given a set of constraints. An example of this type of problem is that of finding integrable vacuum magnetic fields with rotational transform. The solution to this problem is relevant to the magnetic-confinement program

  9. Energy Systems Integration Facility Videos | Energy Systems Integration (United States)

    Facility | NREL Energy Systems Integration Facility Videos Energy Systems Integration Facility Integration Facility NREL + SolarCity: Maximizing Solar Power on Electrical Grids Redefining What's Possible for Renewable Energy: Grid Integration Robot-Powered Reliability Testing at NREL's ESIF Microgrid

  10. Energy Systems Integration Laboratory | Energy Systems Integration Facility (United States)

    | NREL Integration Laboratory Energy Systems Integration Laboratory Research in the Energy Systems Integration Laboratory is advancing engineering knowledge and market deployment of hydrogen technologies. Applications include microgrids, energy storage for renewables integration, and home- and station

  11. Transdisciplinary knowledge integration : cases from integrated assessment and vulnerability assessment

    NARCIS (Netherlands)

    Hinkel, J.


    Keywords: climate change, integrated assessment, knowledge integration, transdisciplinary research, vulnerability, vulnerability assessment.
    This thesis explores how transdisciplinary knowledge integration can be facilitated in the context of integrated assessments and vulnerability

  12. Immigrant Integration: Acculturation and Social Integration

    Directory of Open Access Journals (Sweden)

    Astrid HAMBERGER


    Full Text Available This article tackles the concept of “immigrant integration” as it is analyzed by different authors in the international migration field. In this article, I will use the terms “refugee” and “immigrant” as equivalent to each other due to the interchangeable character of these concepts throughout the integration literature. First, the article brings into discussion the definitional and conceptual battle around the concept of immigrant “integration”, and second, it will describe and analyze cultural and social integration with their presupposing processes.

  13. What constitutes information integrity?

    Directory of Open Access Journals (Sweden)

    S. Flowerday


    Full Text Available This research focused on what constitutes information integrity as this is a problem facing companies today. Moreover, information integrity is a pillar of information security and is required in order to have a sound security management programme. However, it is acknowledged that 100% information integrity is not currently achievable due to various limitations and therefore the auditing concept of reasonable assurance is adopted. This is in line with the concept that 100% information security is not achievable and the notion that adequate security is the goal, using appropriate countermeasures. The main contribution of this article is to illustrate the importance of and provide a macro view of what constitutes information integrity. The findings are in harmony with Samuel Johnson's words (1751: 'Integrity without knowledge is weak and useless, and knowledge without integrity is dangerous and dreadful.'

  14. What constitutes information integrity?

    Directory of Open Access Journals (Sweden)

    S. Flowerday


    Full Text Available This research focused on what constitutes information integrity as this is a problem facing companies today. Moreover, information integrity is a pillar of information security and is required in order to have a sound security management programme. However, it is acknowledged that 100% information integrity is not currently achievable due to various limitations and therefore the auditing concept of reasonable assurance is adopted. This is in line with the concept that 100% information security is not achievable and the notion that adequate security is the goal, using appropriate countermeasures. The main contribution of this article is to illustrate the importance of and provide a macro view of what constitutes information integrity. The findings are in harmony with Samuel Johnson's words (1751: 'Integrity without knowledge is weak and useless, and knowledge without integrity is dangerous and dreadful.'

  15. Exact Slater integrals

    International Nuclear Information System (INIS)

    Golden, L.B.


    In atomic structure calculations, one has to evaluate the Slater integrals. In the present program, the authors evaluate exactly the Slater integral when hydrogenic wave functions are used for the bound-state orbitals. When hydrogenic wave functions are used, the Slater integrals involve integrands which can be written in the form of a product of an exponential, exp(ax) and a known analytic polynomial function, f(x). By repeated partial integration such an integral can be expressed in terms of a finite series involving the exponential, the polynomial function and its derivatives. PL/1-FORMAC has a built-in subroutine that will analytically find the derivatives of any multinomial. Thus, the finite series and hence the Slater integral can be evaluated analytically. (Auth.)

  16. Integrated security system definition

    International Nuclear Information System (INIS)

    Campbell, G.K.; Hall, J.R. II


    The objectives of an integrated security system are to detect intruders and unauthorized activities with a high degree of reliability and the to deter and delay them until effective response/engagement can be accomplished. Definition of an effective integrated security system requires proper application of a system engineering methodology. This paper summarizes a methodology and describes its application to the problem of integrated security system definition. This process includes requirements identification and analysis, allocation of identified system requirements to the subsystem level and provides a basis for identification of synergistic subsystem elements and for synthesis into an integrated system. The paper discusses how this is accomplished, emphasizing at each step how system integration and subsystem synergism is considered. The paper concludes with the product of the process: implementation of an integrated security system

  17. Integrated management systems

    CERN Document Server

    Bugdol, Marek


    Examining the challenges of integrated management, this book explores the importance and potential benefits of using an integrated approach as a cross-functional concept of management. It covers not only standardized management systems (e.g. International Organization for Standardization), but also models of self-assessment, as well as different types of integration. Furthermore, it demonstrates how processes and systems can be integrated, and how management efficiency can be increased. The major part of this book focuses on management concepts which use integration as a key tool of management processes (e.g. the systematic approach, supply chain management, virtual and network organizations, processes management and total quality management). Case studies, illustrations, and tables are also provided to exemplify and illuminate the content, as well as examples of successful and failed integrations. Providing a particularly useful resource to managers and specialists involved in the improvement of organization...

  18. Integration of reusable systems

    CERN Document Server

    Rubin, Stuart


    Software reuse and integration has been described as the process of creating software systems from existing software rather than building software systems from scratch. Whereas reuse solely deals with the artifacts creation, integration focuses on how reusable artifacts interact with the already existing parts of the specified transformation. Currently, most reuse research focuses on creating and integrating adaptable components at development or at compile time. However, with the emergence of ubiquitous computing, reuse technologies that can support adaptation and reconfiguration of architectures and components at runtime are in demand. This edited book includes 15 high quality research papers written by experts in information reuse and integration to cover the most recent advances in the field. These papers are extended versions of the best papers which were presented at IEEE International Conference on Information Reuse and Integration and IEEE International Workshop on Formal Methods Integration, which wa...

  19. A general integral identity

    Energy Technology Data Exchange (ETDEWEB)

    Glasser, M L, E-mail: [Department of Physics, Clarkson University, Potsdam, NY 13699-5820 (United States); Departamento de Fisica Teorica, Atomica y Optica, Universidad de Valladolid, Valladolid 470071 (Spain)


    The identity {integral}{sub 0}{sup {pi}/2}d{Phi}{integral}{sub 0}{sup {pi}/2}d{Theta} sin{Phi} F(x sn{Phi} sin{Phi})={pi}/2 {integral}{sub 0}{sup 1}F(xt)dt, where F is any function, is derived. Several extensions are given and a few examples of physical interest are described.

  20. An integral heuristic

    International Nuclear Information System (INIS)

    Kauffman, L.H.


    This paper gives a heuristic derivation of the skein relation for the Homfly polynomial in an integral formalism. The derivation is formally correct but highly simplified. In the light of Witten's proposal for invariants of links via functional integrals, it is useful to have a formal pattern to compare with the complexities of the full approach. The formalism is a heuristic. However, it is closely related to the actual structure of the Witten functional integral



    AFRL-RY-WP-TR-2017-0168 HETEROGENEOUS INTEGRATION TECHNOLOGY Dr. Burhan Bayraktaroglu Devices for Sensing Branch Aerospace Components & Subsystems...Final September 1, 2016 – May 1, 2017 4. TITLE AND SUBTITLE HETEROGENEOUS INTEGRATION TECHNOLOGY 5a. CONTRACT NUMBER In-house 5b. GRANT NUMBER N/A...provide a structure for this review. The history and the current status of integration technologies in each category are examined and product examples are

  2. Branching trajectory continual integral

    International Nuclear Information System (INIS)

    Maslov, V.P.; Chebotarev, A.M.


    Heuristic definition of the Feynman continual integral over branching trajectories is suggested which makes it possible to obtain in the closed form the solution of the Cauchy problem for the model Hartree equation. A number of properties of the solution is derived from an integral representation. In particular, the quasiclassical asymptotics, exact solution in the gaussian case and perturbation theory series are described. The existence theorem for the simpliest continual integral over branching trajectories is proved [ru

  3. The integrated PWR

    International Nuclear Information System (INIS)

    Gautier, G.M.


    This document presents the integrated reactors concepts by a presentation of four reactors: PIUS, SIR, IRIS and CAREM. The core conception, the operating, the safety, the economical aspects and the possible users are detailed. From the performance of the classical integrated PWR, the necessity of new innovative fuels utilization, the research of a simplified design to make easier the safety and the KWh cost decrease, a new integrated reactor is presented: SCAR 600. (A.L.B.)

  4. Classical Mechanics and Symplectic Integration

    DEFF Research Database (Denmark)

    Nordkvist, Nikolaj; Hjorth, Poul G.


    Content: Classical mechanics: Calculus of variations, Lagrange’s equations, Symmetries and Noether’s theorem, Hamilton’s equations, cannonical transformations, integrable systems, pertubation theory. Symplectic integration: Numerical integrators, symplectic integrators, main theorem on symplectic...

  5. Handbook of integral equations

    CERN Document Server

    Polyanin, Andrei D


    This handbook contains over 2,500 integral equations with solutions as well as analytical and numerical methods for solving linear and nonlinear equations. It explores Volterra, Fredholm, WienerHopf, Hammerstein, Uryson, and other equations that arise in mathematics, physics, engineering, the sciences, and economics. This second edition includes new chapters on mixed multidimensional equations and methods of integral equations for ODEs and PDEs, along with over 400 new equations with exact solutions. With many examples added for illustrative purposes, it presents new material on Volterra, Fredholm, singular, hypersingular, dual, and nonlinear integral equations, integral transforms, and special functions.

  6. Avionics systems integration technology (United States)

    Stech, George; Williams, James R.


    A very dramatic and continuing explosion in digital electronics technology has been taking place in the last decade. The prudent and timely application of this technology will provide Army aviation the capability to prevail against a numerically superior enemy threat. The Army and NASA have exploited this technology explosion in the development and application of avionics systems integration technology for new and future aviation systems. A few selected Army avionics integration technology base efforts are discussed. Also discussed is the Avionics Integration Research Laboratory (AIRLAB) that NASA has established at Langley for research into the integration and validation of avionics systems, and evaluation of advanced technology in a total systems context.

  7. Towards THz integrated photonics


    Hübers, Heinz-Wilhelm


    The demonstration of an integrated terahertz transceiver featuring a quantum cascade laser and a Schottky diode mixer promises new applications for compact and convenient terahertz photonic instrumentation.

  8. Extending Database Integration Technology

    National Research Council Canada - National Science Library

    Buneman, Peter


    Formal approaches to the semantics of databases and database languages can have immediate and practical consequences in extending database integration technologies to include a vastly greater range...

  9. Modularly Integrated MEMS Technology

    National Research Council Canada - National Science Library

    Eyoum, Marie-Angie N


    Process design, development and integration to fabricate reliable MEMS devices on top of VLSI-CMOS electronics without damaging the underlying circuitry have been investigated throughout this dissertation...

  10. Integrated Information Management (IIM)

    National Research Council Canada - National Science Library

    McIlvain, Jason


    Information Technology is the core capability required to align our resources and increase our effectiveness on the battlefield by integrating and coordinating our preventative measures and responses...

  11. Building integrated photovoltaic; Photovaltaique integre aux batiments

    Energy Technology Data Exchange (ETDEWEB)



    Durable, modular and flexible in use, as demonstrated by the different case studies in this publication, photovoltaic can replace diverse building elements, from glass facades to weather proof roofs. This leaflet towards architects describes aesthetic, technical, economic and environmental interest of building integrated photovoltaic. (author)

  12. Simplification of integrity constraints for data integration

    DEFF Research Database (Denmark)

    Christiansen, Henning; Martinenghi, Davide


    , because either the global database is known to be consistent or suitable actions have been taken to provide consistent views. The present work generalizes simplification techniques for integrity checking in traditional databases to the combined case. Knowledge of local consistency is employed, perhaps...

  13. Feynman integrals and hyperlogarithms

    Energy Technology Data Exchange (ETDEWEB)

    Panzer, Erik


    We study Feynman integrals in the representation with Schwinger parameters and derive recursive integral formulas for massless 3- and 4-point functions. Properties of analytic (including dimensional) regularization are summarized and we prove that in the Euclidean region, each Feynman integral can be written as a linear combination of convergent Feynman integrals. This means that one can choose a basis of convergent master integrals and need not evaluate any divergent Feynman graph directly. Secondly we give a self-contained account of hyperlogarithms and explain in detail the algorithms needed for their application to the evaluation of multivariate integrals. We define a new method to track singularities of such integrals and present a computer program that implements the integration method. As our main result, we prove the existence of infinite families of massless 3- and 4-point graphs (including the ladder box graphs with arbitrary loop number and their minors) whose Feynman integrals can be expressed in terms of multiple polylogarithms, to all orders in the ε-expansion. These integrals can be computed effectively with the presented program. We include interesting examples of explicit results for Feynman integrals with up to 6 loops. In particular we present the first exactly computed counterterm in massless φ{sup 4} theory which is not a multiple zeta value, but a linear combination of multiple polylogarithms at primitive sixth roots of unity (and divided by the √(3)). To this end we derive a parity result on the reducibility of the real- and imaginary parts of such numbers into products and terms of lower depth.

  14. Feynman integrals and hyperlogarithms

    International Nuclear Information System (INIS)

    Panzer, Erik


    We study Feynman integrals in the representation with Schwinger parameters and derive recursive integral formulas for massless 3- and 4-point functions. Properties of analytic (including dimensional) regularization are summarized and we prove that in the Euclidean region, each Feynman integral can be written as a linear combination of convergent Feynman integrals. This means that one can choose a basis of convergent master integrals and need not evaluate any divergent Feynman graph directly. Secondly we give a self-contained account of hyperlogarithms and explain in detail the algorithms needed for their application to the evaluation of multivariate integrals. We define a new method to track singularities of such integrals and present a computer program that implements the integration method. As our main result, we prove the existence of infinite families of massless 3- and 4-point graphs (including the ladder box graphs with arbitrary loop number and their minors) whose Feynman integrals can be expressed in terms of multiple polylogarithms, to all orders in the ε-expansion. These integrals can be computed effectively with the presented program. We include interesting examples of explicit results for Feynman integrals with up to 6 loops. In particular we present the first exactly computed counterterm in massless φ 4 theory which is not a multiple zeta value, but a linear combination of multiple polylogarithms at primitive sixth roots of unity (and divided by the √(3)). To this end we derive a parity result on the reducibility of the real- and imaginary parts of such numbers into products and terms of lower depth.

  15. Factorization of Behavioral Integrity

    DEFF Research Database (Denmark)

    Li, Ximeng; Nielson, Flemming; Nielson, Hanne Riis


    We develop a bisimulation-based nonintereference property that describes the allowed dependencies between communication behaviors of different integrity levels. The property is able to capture all possible combinations of integrity levels for the “presence” and “content” of actual communications...

  16. On an integral transform

    Directory of Open Access Journals (Sweden)

    D. Naylor


    Full Text Available This paper establishes properties of a convolution type integral transform whose kernel is a Macdonald type Bessel function of zero order. An inversion formula is developed and the transform is applied to obtain the solution of some related integral equations.

  17. Integrated Marketing Communications (United States)

    Black, Jim


    Integration has become a cliche in enrollment management and student services circles. The term is used to describe everything from integrated marketing to seamless services. Often, it defines organizational structures, processes, student information systems, and even communities. In Robert Sevier's article in this issue of "College and…

  18. Integrated Optical Circuit Engineering (United States)

    Sriram, S.


    Implementation of single-mode optical fiber systems depends largely on the availability of integrated optical components for such functions as switching, multiplexing, and modulation. The technology of integrated optics is maturing very rapidly, and its growth justifies the optimism that now exists in the optical community.

  19. Fuzzy measures and integrals

    Czech Academy of Sciences Publication Activity Database

    Mesiar, Radko


    Roč. 28, č. 156 (2005), s. 365-370 ISSN 0165-0114 R&D Projects: GA ČR(CZ) GA402/04/1026 Institutional research plan: CEZ:AV0Z10750506 Keywords : fuzzy measures * fuzzy integral * regular fuzzy integral Subject RIV: BA - General Mathematics Impact factor: 1.039, year: 2005

  20. Hamiltonian path integrals

    International Nuclear Information System (INIS)

    Prokhorov, L.V.


    The properties of path integrals associated with the allowance for nonstandard terms reflecting the operator nature of the canonical variables are considered. Rules for treating such terms (''equivalence rules'') are formulated. Problems with a boundary, the behavior of path integrals under canonical transformations, and the problem of quantization of dynamical systems with constraints are considered in the framework of the method

  1. Ethnic Minorities and Integration

    NARCIS (Netherlands)

    Mérove Gijsberts


    There has been a great deal of discussion in the Netherlands recently about the integration of ethnic minorities. The tenor of that discussion is sombre: some observers speak of a 'multicultural drama', while others claim that the government's integration policy has failed completely. Recent

  2. Backtracking Incremental Continuous Integration

    NARCIS (Netherlands)

    T. van der Storm (Tijs); K. Kontogiannis (Kostas); C. Tjortjis; A. Winter


    htmlabstractFailing integration builds are show stoppers. Development activity is stalled because developers have to wait with integrating new changes until the problem is fixed and a successful build has been run. We show how backtracking can be used to mitigate the impact of build failures in the

  3. Integral fast reactor concept

    International Nuclear Information System (INIS)

    Chang, Y.I.; Marchaterre, J.F.; Sevy, R.H.


    Key features of the IFR consist of a pool-type plant arrangement, a metal fuel-based core design, and an integral fuel cycle with colocated fuel cycle facility. Both the basic concept and the technology base have been demonstrated through actual integral cycle operation in EBR-II. This paper discusses the inherent safety characteristics of the IFR concept

  4. Musik, Sprog og Integration

    DEFF Research Database (Denmark)

    Holst, Finn


    Evaluering af projektet Musik, Sprog og Integration, Søndermarkskolen, Horsens. Andenårsevaluering af et treårigt projekt.......Evaluering af projektet Musik, Sprog og Integration, Søndermarkskolen, Horsens. Andenårsevaluering af et treårigt projekt....

  5. Kanonisk sikkerhed og integration

    DEFF Research Database (Denmark)

    Larsen, Vibe; Øland, Trine


    Artiklen diskuterer, med indragelse af den lignende debat i andre europæiske lande, kulturkanonen i forhold til integration......Artiklen diskuterer, med indragelse af den lignende debat i andre europæiske lande, kulturkanonen i forhold til integration...

  6. Integrity, Concept of

    DEFF Research Database (Denmark)

    Rendtorff, Jacob Dahl


    Integrity can be defined in the following sense: Integrity accounts for the inviolability of the human being. Although originally a virtue of uncorrupted character, expressing uprightness, honesty, and good intentions, it has, like dignity, been universalized as a quality of the person as such...

  7. Integral transformational coaching

    NARCIS (Netherlands)

    Keizer, W.A.J.; Nandram, S.S.


    In Chap. 12, Keizer and Nandram present the concept of Integral Transformational Coaching based on the concept of Flow and its effects on work performance. Integral Transformational Coaching is a method that prevents and cures unhealthy stress and burnout. They draw on some tried and tested

  8. Laboring for integration

    DEFF Research Database (Denmark)

    Fogelman, Tatiana

    Over the past fifteen years the district of Berlin-Marzahn became home to the largest concentration of post-Soviet migrants of German ancestry in the former East Germany. Drawing on my research in the district, including two of its integration projects for middle-aged, unemployed migrants, I...... examine these projects’ failed attempts to create spaces of encounter between the migrants and district’s long-term residents. In this presentation I focus specifically on the structural position of integration work (Integrationsarbeit) that creates first and foremost conditions of possibility for its...... temporal imaginaries underpinning the ideas of integration through encounter, as well as integration more broadly, I argue for reflexivity-centric public reformulations of both integration and encounter....

  9. Retroviral integration: Site matters (United States)

    Demeulemeester, Jonas; De Rijck, Jan


    Here, we review genomic target site selection during retroviral integration as a multistep process in which specific biases are introduced at each level. The first asymmetries are introduced when the virus takes a specific route into the nucleus. Next, by co‐opting distinct host cofactors, the integration machinery is guided to particular chromatin contexts. As the viral integrase captures a local target nucleosome, specific contacts introduce fine‐grained biases in the integration site distribution. In vivo, the established population of proviruses is subject to both positive and negative selection, thereby continuously reshaping the integration site distribution. By affecting stochastic proviral expression as well as the mutagenic potential of the virus, integration site choice may be an inherent part of the evolutionary strategies used by different retroviruses to maximise reproductive success. PMID:26293289

  10. Neuroeconomics and Integrated Care

    DEFF Research Database (Denmark)

    Larsen, Torben


    Background: Fragmented specialized care for the frail elderly as claimed by WHO needs horizontal integration across settings. The home of the patient seems to be a promising place to integrate hospital care, primary care and social services for high-risk discharges where the quality...... of rehabilitation makes a difference. Objective: The study aims to reveal how integrated home care may be organised to improve quality of care as compared to usual hospital care. Method: A qualitative case study of the use of a neuroeconomic model in relation to multidisciplianry collaboration on a RCT...... of integrated home care for stroke patients. Results: (1) The classical understanding of CNS is that of a dual system of ANS and Cortex. The new neuroeconomic understanding is that of a reciprocal balance of Limbic System (LS) and Neocortex (NC). This applies directly in favour of integrated homecare compared...

  11. Does energy integrate?

    International Nuclear Information System (INIS)

    Hira, Anil; Amaya, Libardo


    Amidst the international movement to privatize and deregulate electricity and gas sectors of economies, the question of the integration of those sectors has been somewhat underestimated. In fact, the integration of energy markets across boundaries is occurring. We examine this process in three regions: Europe, Central America, and South America. We analyze the forces driving integration in each area, and estimate the prospects for progress. We take a close look at Nordpool, which is now the most integrated market in the world, to see if it can serve as a model for other regions. We close with a set of conditions that we suggest are necessary for a successful international integration of energy markets

  12. Does energy integrate?

    International Nuclear Information System (INIS)

    Hira, A.; Amaya, L.


    Amidst the international movement to privatize and deregulate electricity and gas sectors of economics, the question of the integration of those sectors has been somewhat underestimated. In fact, the integration of energy markets across boundaries is occurring. We examine this process in three regions: Europe, Central America, and South America. We analyze the forces driving integration in each area, and estimate the prospects for progress. We take a close look at Nordpool, which is now the most integrated market in the world, to see if it can serve as a model for other regions. We close with a set of conditions that we suggest are necessary for a successful international integration of energy markets. (author)

  13. Technology integration plan

    International Nuclear Information System (INIS)

    Henry, R.; Sumpter, K.C.


    In 1992, the Secretary of Energy directed the Assistant Secretary for Environmental Management (EM) to develop an integrated, long-term, spent nuclear fuel (SNF) management program. In response, EM created the Integrated SNF Program to assess the US Department of Energy (DOE) SNF and SNF storage facilities. As shown in Figure 1 the Integrated SNF Program is responsible for life-cycle management of DOE SNF; that is characterization, processing, interim storage and preparation for disposal. In order to implement the Program it was recognized that technology needs must be identified. A Technology Integration Program was formed to integrate the DOE complex-wide efforts for establishing timely, cost effective and consistent technical criteria for the development of technical solutions. The program is directed toward identification of: (a) what activities need to be done, (b) when they need to be completed, and (c) what priority should be assigned to the various activities

  14. Integrated silicon optoelectronics

    CERN Document Server

    Zimmermann, Horst


    'Integrated Silicon Optoelectronics'assembles optoelectronics and microelectronics The book concentrates on silicon as the major basis of modern semiconductor devices and circuits Starting from the basics of optical emission and absorption and from the device physics of photodetectors, the aspects of the integration of photodetectors in modern bipolar, CMOS, and BiCMOS technologies are discussed Detailed descriptions of fabrication technologies and applications of optoelectronic integrated circuits are included The book, furthermore, contains a review of the state of research on eagerly expected silicon light emitters In order to cover the topic of the book comprehensively, integrated waveguides, gratings, and optoelectronic power devices are included in addition Numerous elaborate illustrations promote an easy comprehension 'Integrated Silicon Optoelectronics'will be of value to engineers, physicists, and scientists in industry and at universities The book is also recommendable for graduate students speciali...

  15. Feynman integral calculus

    CERN Document Server

    Smirnov, Vladimir A


    The problem of evaluating Feynman integrals over loop momenta has existed from the early days of perturbative quantum field theory. The goal of the book is to summarize those methods for evaluating Feynman integrals that have been developed over a span of more than fifty years. `Feynman Integral Calculus' characterizes the most powerful methods in a systematic way. It concentrates on the methods that have been employed recently for most sophisticated calculations and illustrates them with numerous examples, starting from very simple ones and progressing to nontrivial examples. It also shows how to choose adequate methods and combine them in a non-trivial way. This is a textbook version of the previous book (Evaluating Feynman integrals, STMP 211) of the author. Problems and solutions have been included, Appendix G has been added, more details have been presented, recent publications on evaluating Feynman integrals have been taken into account and the bibliography has been updated.

  16. Personal Integrity and Leadership

    Directory of Open Access Journals (Sweden)

    Antonius Gea


    Full Text Available Generally, integrity is associated with leadership, especially in the organization or company. Integrity in leadership becomes a growing concern in business and organizations. The aim of this study was to find out the connection that could be shaped between personal integrity and the skill of leadership especially in the performance of work. This study used a library research, a literature study that done by using the available resources and relevant literature, related to the topic being discussed by the author. Books or journal articles related to topics were used as background reading to understand well about the problems of integrity and leadership, especially in the organization or company. This study finds out that the leader integrity is related to follower work role performance and that this effect is fully mediated through follower affective organizational commitment. 

  17. Vertcal integration: origins of oil industry integration

    International Nuclear Information System (INIS)

    Rainbow, R.


    This article examines the structure of the US oil industry in relation to the history of the industry, capital market assumptions, and advice on the enhancement of 'shareholder value'. The driving forces behind the attempts to establish cartels and vertical integration are considered, and the emergence of US companies resulting from the break-up of the Standard Oil Trust cartel, the influence of costs and logistics on the structure of the industry outside the USA , and the structure of the natural gas industry are discussed along with the discovery of large Middle East oil reserves, the enormous growth in demand for oil products in Europe and Japan, and the formation of the OPEC cartel. Details are given of the breaking down of vertical integration in the big oil companies, the theory of conglomerates, the success of big companies, the importance of scale to balance exploration risks, and the need to adjust in time to shifts in the business environment

  18. Long Pulse Integrator of Variable Integral Time Constant

    International Nuclear Information System (INIS)

    Wang Yong; Ji Zhenshan; Du Xiaoying; Wu Yichun; Li Shi; Luo Jiarong


    A kind of new long pulse integrator was designed based on the method of variable integral time constant and deducting integral drift by drift slope. The integral time constant can be changed by choosing different integral resistors, in order to improve the signal-to-noise ratio, and avoid output saturation; the slope of integral drift of a certain period of time can be calculated by digital signal processing, which can be used to deduct the drift of original integral signal in real time to reduce the integral drift. The tests show that this kind of long pulse integrator is good at reducing integral drift, which also can eliminate the effects of changing integral time constant. According to experiments, the integral time constant can be changed by remote control and manual adjustment of integral drift is avoided, which can improve the experiment efficiency greatly and can be used for electromagnetic measurement in Tokamak experiment. (authors)

  19. Integrated assessment briefs

    Energy Technology Data Exchange (ETDEWEB)



    Integrated assessment can be used to evaluate and clarify resource management policy options and outcomes for decision makers. The defining characteristics of integrated assessment are (1) focus on providing information and analysis that can be understood and used by decision makers rather than for merely advancing understanding and (2) its multidisciplinary approach, using methods, styles of study, and considerations from a broader variety of technical areas than would typically characterize studies produced from a single disciplinary standpoint. Integrated assessment may combine scientific, social, economic, health, and environmental data and models. Integrated assessment requires bridging the gap between science and policy considerations. Because not everything can be valued using a single metric, such as a dollar value, the integrated assessment process also involves evaluating trade-offs among dissimilar attributes. Scientists at Oak Ridge National Laboratory (ORNL) recognized the importance and value of multidisciplinary approaches to solving environmental problems early on and have pioneered the development of tools and methods for integrated assessment over the past three decades. Major examples of ORNL`s experience in the development of its capabilities for integrated assessment are given.

  20. Measure and integration theory

    CERN Document Server

    Burckel, Robert B


    This book gives a straightforward introduction to the field as it is nowadays required in many branches of analysis and especially in probability theory. The first three chapters (Measure Theory, Integration Theory, Product Measures) basically follow the clear and approved exposition given in the author's earlier book on ""Probability Theory and Measure Theory"". Special emphasis is laid on a complete discussion of the transformation of measures and integration with respect to the product measure, convergence theorems, parameter depending integrals, as well as the Radon-Nikodym theorem. The fi

  1. Path integration quantization

    International Nuclear Information System (INIS)

    DeWitt-Morette, C.


    Much is expected of path integration as a quantization procedure. Much more is possible if one recognizes that path integration is at the crossroad of stochastic and differential calculus and uses the full power of both stochastic and differential calculus in setting up and computing path integrals. In contrast to differential calculus, stochastic calculus has only comparatively recently become an instrument of thought. It has nevertheless already been used in a variety of challenging problems, for instance in the quantization problem. The author presents some applications of the stochastic scheme. (Auth.)

  2. Hamiltonian path integrals

    International Nuclear Information System (INIS)

    Prokhorov, L.V.


    Problems related to consideration of operator nonpermutability in Hamiltonian path integral (HPI) are considered in the review. Integrals are investigated using trajectories in configuration space (nonrelativistic quantum mechanics). Problems related to trajectory integrals in HPI phase space are discussed: the problem of operator nonpermutability consideration (extra terms problem) and corresponding equivalence rules; ambiguity of HPI usual recording; transition to curvilinear coordinates. Problem of quantization of dynamical systems with couplings has been studied. As in the case of canonical transformations, quantization of the systems with couplings of the first kind requires the consideration of extra terms

  3. SQL Server Integration Services

    CERN Document Server

    Hamilton, Bill


    SQL Server 2005 Integration Services (SSIS) lets you build high-performance data integration solutions. SSIS solutions wrap sophisticated workflows around tasks that extract, transform, and load (ETL) data from and to a wide variety of data sources. This Short Cut begins with an overview of key SSIS concepts, capabilities, standard workflow and ETL elements, the development environment, execution, deployment, and migration from Data Transformation Services (DTS). Next, you'll see how to apply the concepts you've learned through hands-on examples of common integration scenarios. Once you've

  4. MOS integrated circuit design

    CERN Document Server

    Wolfendale, E


    MOS Integral Circuit Design aims to help in the design of integrated circuits, especially large-scale ones, using MOS Technology through teaching of techniques, practical applications, and examples. The book covers topics such as design equation and process parameters; MOS static and dynamic circuits; logic design techniques, system partitioning, and layout techniques. Also featured are computer aids such as logic simulation and mask layout, as well as examples on simple MOS design. The text is recommended for electrical engineers who would like to know how to use MOS for integral circuit desi

  5. Silicon hybrid integration

    International Nuclear Information System (INIS)

    Li Xianyao; Yuan Taonu; Shao Shiqian; Shi Zujun; Wang Yi; Yu Yude; Yu Jinzhong


    Recently,much attention has concentrated on silicon based photonic integrated circuits (PICs), which provide a cost-effective solution for high speed, wide bandwidth optical interconnection and optical communication.To integrate III-V compounds and germanium semiconductors on silicon substrates,at present there are two kinds of manufacturing methods, i.e., heteroepitaxy and bonding. Low-temperature wafer bonding which can overcome the high growth temperature, lattice mismatch,and incompatibility of thermal expansion coefficients during heteroepitaxy, has offered the possibility for large-scale heterogeneous integration. In this paper, several commonly used bonding methods are reviewed, and the future trends of low temperature wafer bonding envisaged. (authors)

  6. Three dimensional system integration

    CERN Document Server

    Papanikolaou, Antonis; Radojcic, Riko


    Three-dimensional (3D) integrated circuit (IC) stacking is the next big step in electronic system integration. It enables packing more functionality, as well as integration of heterogeneous materials, devices, and signals, in the same space (volume). This results in consumer electronics (e.g., mobile, handheld devices) which can run more powerful applications, such as full-length movies and 3D games, with longer battery life. This technology is so promising that it is expected to be a mainstream technology a few years from now, less than 10-15 years from its original conception. To achieve thi

  7. Principles of data integration

    CERN Document Server

    Doan, AnHai; Ives, Zachary


    How do you approach answering queries when your data is stored in multiple databases that were designed independently by different people? This is first comprehensive book on data integration and is written by three of the most respected experts in the field. This book provides an extensive introduction to the theory and concepts underlying today's data integration techniques, with detailed, instruction for their application using concrete examples throughout to explain the concepts. Data integration is the problem of answering queries that span multiple data sources (e.g., databases, web

  8. The Structural Integrity Centre

    International Nuclear Information System (INIS)

    Tomkins, B.


    The paper concerns the development and work of the Structural Integrity Centre (SIC) at Risley Nuclear Laboratories, United Kingdom. The centre was set up to provide authoritative advice to plant designers and operators on the integrity and life assessment of structures and components across the reactor projects in the United Kingdom. A description is given of the structure and role of the SIC, as well as the Structural Integrity Assessment work. The assessment methods are described for thermally loaded structures and welded structures. Finally, defect significance assessment and environmental effects are outlined. (U.K.)

  9. GMRES and integral operators

    Energy Technology Data Exchange (ETDEWEB)

    Kelley, C.T.; Xue, Z.Q. [North Carolina State Univ., Raleigh, NC (United States)


    Many discretizations of integral equations and compact fixed point problems are collectively compact and strongly convergent in spaces of continuous functions. These properties not only lead to stable and convergent approximations but also can be used in the construction of fast multilevel algorithms. Recently the GMRES algorithm has become a standard coarse mesh solver. The purpose of this paper is to show how the special properties of integral operators and their approximations are reflected in the performance of the GMRES iteration and how these properties can be used to strengthen the norm in which convergence takes place. The authors illustrate these ideas with composite Gauss rules for integral equations on the unit interval.

  10. Definition of metabolism-dependent xenobiotic toxicity with co-cultures of human hepatocytes and mouse 3T3 fibroblasts in the novel integrated discrete multiple organ co-culture (IdMOC) experimental system: results with model toxicants aflatoxin B1, cyclophosphamide and tamoxifen. (United States)

    Li, Albert P; Uzgare, Aarti; LaForge, Yumiko S


    The integrated discrete multiple organ co-culture system (IdMOC) allows the co-culturing of multiple cell types as physically separated cells interconnected by a common overlying medium. We report here the application of IdMOC with two cell types: the metabolically competent primary human hepatocytes, and a metabolically incompetent cell line, mouse 3T3 fibroblasts, in the definition of the role of hepatic metabolism on the cytotoxicity of three model toxicants: cyclophosphamide (CPA), aflatoxin B1 (AFB) and tamoxifen (TMX). The presence of hepatic metabolism in IdMOC with human hepatocytes was demonstrated by the metabolism of the P450 isoform 3A4 substrate, luciferin-IPA. The three model toxicants showed three distinct patterns of cytotoxic profile: TMX was cytotoxic to 3T3 cells in the absence of hepatocytes, with slightly lower cytotoxicity towards both 3T3 cells and hepatocytes in the IdMOC. AFB was selective toxic towards the human hepatocytes and relatively noncytotoxic towards 3T3 cells both in the presence and absence of the hepatocytes. CPA cytotoxicity to the 3T3 cells was found to be significantly enhanced by the presence of the hepatocytes, with the cytotoxicity dependent of the number of hepatocytes, and with the cytotoxicity attenuated by the presence of a non-specific P450 inhibitor, 1-aminobenzotriazole. We propose here the following classification of toxicants based on the role of hepatic metabolism as defined by the human hepatocyte-3T3 cell IdMOC assay: type I: direct-acting cytotoxicants represented by TMX as indicated by cytotoxicity in 3T3 cells in the absence of hepatocytes; type II: metabolism-dependent cytotoxicity represented by AFB1 with effects localized within the site of metabolic activation (i. e. hepatocytes); and type III: metabolism-dependent cytotoxicity with metabolites that can diffuse out of the hepatocytes to cause toxicity in cells distal from the site of metabolism, as exemplified by CPA. Copyright © 2012 Elsevier Ireland

  11. Integrated Data Collection Analysis (IDCA) Program - Final Review September 12, 2012 at DHS

    Energy Technology Data Exchange (ETDEWEB)

    Sandstrom, Mary M. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Brown, Geoffrey W. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Warner, Kirstin F. [Naval Surface Warfare Center (NSWC), Indian Head, MD (United States). Indian Head Division; Phillips, Jason J. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Shelley, Timothy J. [Air Force Research Lab. (AFRL), Tyndall AFB, FL (United States); Reyes, Jose A. [Applied Research Associates, Tyndall AFB, FL (United States); Hsu, Peter C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Reynolds, John G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    The Integrated Data Collection Analysis (IDCA) program conducted a final program review at the Department of Homeland Security on September 12, 2012. The review was focused on the results of the program over the complete performance period. A summary presentation delineating the accomplished tasks started the meeting, followed by technical presentations on various issues that arose during the performance period. The presentations were completed with a statistical evaluation of the testing results from all the participants in the IDCA Proficiency Test study. The meeting closed with a discussion of potential sources of funding for continuing work to resolve some of these technical issues. This effort, funded by the Department of Homeland Security (DHS), put the issues of safe handling of these materials in perspective with standard military explosives. The study added Small-Scale Safety and Thermal (SSST) testing results for a broad suite of different HMEs to the literature, and suggested new guidelines and methods to develop safe handling practices for HMEs. Each participating testing laboratory used identical test materials and preparation methods wherever possible. Note, however, the test procedures differ among the laboratories. The results were compared among the laboratories and then compared to historical data from various sources. The testing performers involved were Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), Naval Surface Warfare Center, Indian Head Division (NSWC IHD), Sandia National Laboratories (SNL), and Air Force Research Laboratory, Tyndall AFB (AFRL/RXQL). These tests were conducted as a proficiency study in order to establish some consistency in test protocols, procedures, and experiments and to compare results when these testing variables cannot be made consistent.

  12. Wellbore Integrity Network

    Energy Technology Data Exchange (ETDEWEB)

    Carey, James W. [Los Alamos National Laboratory; Bachu, Stefan [Alberta Innovates


    In this presentation, we review the current state of knowledge on wellbore integrity as developed in the IEA Greenhouse Gas Programme's Wellbore Integrity Network. Wells are one of the primary risks to the successful implementation of CO{sub 2} storage programs. Experimental studies show that wellbore materials react with CO{sub 2} (carbonation of cement and corrosion of steel) but the impact on zonal isolation is unclear. Field studies of wells in CO{sub 2}-bearing fields show that CO{sub 2} does migrate external to casing. However, rates and amounts of CO{sub 2} have not been quantified. At the decade time scale, wellbore integrity is driven by construction quality and geomechanical processes. Over longer time-scales (> 100 years), chemical processes (cement degradation and corrosion) become more important, but competing geomechanical processes may preserve wellbore integrity.

  13. Integration, measure and probability

    CERN Document Server

    Pitt, H R


    Introductory treatment develops the theory of integration in a general context, making it applicable to other branches of analysis. More specialized topics include convergence theorems and random sequences and functions. 1963 edition.

  14. Introduction to integral discriminants

    International Nuclear Information System (INIS)

    Morozov, A.; Shakirov, Sh.


    The simplest partition function, associated with homogeneous symmetric forms S of degree r in n variables, is integral discriminant J n|r (S) = ∫e -S(x 1 ,...,x n ) dx 1 ...dx n . Actually, S-dependence remains the same if e -S in the integrand is substituted by arbitrary function f(S), i.e. integral discriminant is a characteristic of the form S itself, and not of the averaging procedure. The aim of the present paper is to calculate J n|r in a number of non-Gaussian cases. Using Ward identities - linear differential equations, satisfied by integral discriminants - we calculate J 2|3 ,J 2|4 ,J 2|5 and J 3|3 . In all these examples, integral discriminant appears to be a generalized hypergeometric function. It depends on several SL(n) invariants of S, with essential singularities controlled by the ordinary algebraic discriminant of S.

  15. Entrepreneurial Integration Skills

    DEFF Research Database (Denmark)

    Bauer, Florian; Schriber, Svante; King, David R.


    on 116 acquisitions, we find that entrepreneurial integration skills can display both advantages and disadvantages. While it helps to realize expected and serendipitous synergies, it can also trigger employee uncertainty due to decreased transparency. In supplementary analysis, we show measures...

  16. Managing for Organizational Integrity. (United States)

    Paine, Lynn Sharp


    Compliance-based ethics programs focus on prevention, detection, and punishment. Companies should adopt an integrity-based approach to ethics management that combines a concern for the law with an emphasis on managerial responsibility for ethical behavior. (JOW)

  17. Integrals of Bessel functions


    Babusci, D.; Dattoli, G.; Germano, B.; Martinelli, M. R.; Ricci, P. E.


    We use the operator method to evaluate a class of integrals involving Bessel or Bessel-type functions. The technique we propose is based on the formal reduction of these family of functions to Gaussians.

  18. Integration, Informationslogistik und Architektur


    Turowski, Klaus


    Integration, Informationslogistik und Architektur : DW2006 ; 21./22.09.2006 in Friedrichshafen, Germany / Klaus Turowski ... (Hrsg.). - Bonn : Ges. für Informatik, 2006. - 490 S. - (GI-Edition / Proceedings ; 90)

  19. Integrated inventory information system

    Digital Repository Service at National Institute of Oceanography (India)

    Sarupria, J.S.; Kunte, P.D.

    The nature of oceanographic data and the management of inventory level information are described in Integrated Inventory Information System (IIIS). It is shown how a ROSCOPO (report on observations/samples collected during oceanographic programme...

  20. Integrated Surface Dataset (Global) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Integrated Surface (ISD) Dataset (ISD) is composed of worldwide surface weather observations from over 35,000 stations, though the best spatial coverage is...

  1. Retroviral DNA Integration (United States)


    The integration of a DNA copy of the viral RNA genome into host chromatin is the defining step of retroviral replication. This enzymatic process is catalyzed by the virus-encoded integrase protein, which is conserved among retroviruses and LTR-retrotransposons. Retroviral integration proceeds via two integrase activities: 3′-processing of the viral DNA ends, followed by the strand transfer of the processed ends into host cell chromosomal DNA. Herein we review the molecular mechanism of retroviral DNA integration, with an emphasis on reaction chemistries and architectures of the nucleoprotein complexes involved. We additionally discuss the latest advances on anti-integrase drug development for the treatment of AIDS and the utility of integrating retroviral vectors in gene therapy applications. PMID:27198982

  2. Integrated Reporting Information System - (United States)

    Department of Transportation — The Integrated Reporting Information System (IRIS) is a flexible and scalable web-based system that supports post operational analysis and evaluation of the National...

  3. Crisis and Regional Integration

    DEFF Research Database (Denmark)

    Dosenrode, Søren

    , Tunisia, Egypt …. ), where the crisis referred to could be humanitarian, environmental, economic, political … Europe, too, has also according to mass media, been a victim of a crisis, the financial one. Could ‘crisis’ be a beginning of enhanced regional integration? This paper will try to look...... at the processes of regional integration in relation to ‘crisis’ in Africa and Europe. First, this paper will look at the concept of ‘crisis’, before it moves on to discuss ‘regional integration’ and the correlation between the two, emphasizing the approaches of neo-functionalism and federal theory....... This is the basis for two short case studies of African and European regional integration. The paper tentative answers to the question: will the crisis in Africa and Europe respectively further or block regional integration? With a ‘that depends’. But the use of Federalism theory and neo-functionalism is seen...

  4. European Economic Integration (United States)

    Huston, James A.


    Recounts the history and problems of European Economic Integration from the first post World War II organization, the OEEC, to the EEC (Common Market) and the EFTA. Suggestions for further reading are included. (JB)

  5. Integrated Sight Boresighting

    National Research Council Canada - National Science Library

    Gilstrap, Jeff


    ... (IR) pointer into an advanced weapon sight and surveillance system. The Integrated Sight is being developed as a technology demonstrator and potential future upgrade to the Land Warrior and Thermal Weapon Sight Programs...

  6. Integrating Forensic Science. (United States)

    Funkhouser, John; Deslich, Barbara J.


    Explains the implementation of forensic science in an integrated curriculum and discusses the advantages of this approach. Lists the forensic science course syllabi studied in three high schools. Discusses the unit on polymers in detail. (YDS)

  7. On Kontsevich integrals

    International Nuclear Information System (INIS)

    Itzykson, C.


    Some mathematical results are described on a remarkable application of matrix interaction due to Witten and Kontsevich, to study topological invariants. Some interesting properties of the Kontsevich integrals are identified. (K.A.) 4 refs

  8. Integrated Transdisciplinary Teams. (United States)

    Gallivan-Fenlon, Amanda


    This article reviews the use of transdisciplinary teaming and integrated therapy for young children with multiple disabilities. It presents examples and suggestions for implementation, in the areas of flexibility, Individualized Education Program development, and parent participation. (JDD)

  9. Lectures on integral transforms

    CERN Document Server

    Akhiezer, N I


    This book, which grew out of lectures given over the course of several years at Kharkov University for students in the Faculty of Mechanics and Mathematics, is devoted to classical integral transforms, principally the Fourier transform, and their applications. The author develops the general theory of the Fourier transform for the space L^1(E_n) of integrable functions of n variables. His proof of the inversion theorem is based on the general Bochner theorem on integral transforms, a theorem having other applications within the subject area of the book. The author also covers Fourier-Plancherel theory in L^2(E_n). In addition to the general theory of integral transforms, connections are established with other areas of mathematical analysis--such as the theory of harmonic and analytic functions, the theory of orthogonal polynomials, and the moment problem--as well as to mathematical physics.

  10. Complementary and Integrative Medicine (United States)

    ... medical treatments that are not part of mainstream medicine. When you are using these types of care, it may be called complementary, integrative, or alternative medicine. Complementary medicine is used together with mainstream medical ...

  11. Integration a functional approach

    CERN Document Server

    Bichteler, Klaus


    This book covers Lebesgue integration and its generalizations from Daniell's point of view, modified by the use of seminorms. Integrating functions rather than measuring sets is posited as the main purpose of measure theory. From this point of view Lebesgue's integral can be had as a rather straightforward, even simplistic, extension of Riemann's integral; and its aims, definitions, and procedures can be motivated at an elementary level. The notion of measurability, for example, is suggested by Littlewood's observations rather than being conveyed authoritatively through definitions of (sigma)-algebras and good-cut-conditions, the latter of which are hard to justify and thus appear mysterious, even nettlesome, to the beginner. The approach taken provides the additional benefit of cutting the labor in half. The use of seminorms, ubiquitous in modern analysis, speeds things up even further. The book is intended for the reader who has some experience with proofs, a beginning graduate student for example. It might...

  12. Varieties of Cognitive Integration (United States)

    Scott, William A.


    The author examines how students in three countries use four styles of cognitive integration (affective balance, affective-evaluative consistency, centralization, and image comparability) within the cognitive domains of nations, acquaintances, self-roles, and family relations. (DE)

  13. Advances in integrated optics

    CERN Document Server

    Chester, A; Bertolotti, M


    This volwne contains the Proceedings of a two-week summer conference titled "Advances in Integrated Optics" held June 1-9, 1993, in Erice, Sicily. This was the 18th annual course organized by the International School of Quantum Electronics, under the auspices of the "Ettore Majorana" Centre for Scientific Culture. The term Integrated Optics signifies guided-wave optical circuits consisting of two or more devices on a single substrate. Since its inception in the late 1960's, Integrated Optics has evolved from a specialized research topic into a broad field of work, ranging from basic research through commercial applications. Today many devices are available on market while a big effort is devolved to research on integrated nonlinear optical devices. This conference was organized to provide a comprehensive survey of the frontiers of this technology, including fundamental concepts, nonlinear optical materials, devices both in the linear and nonlinear regimes, and selected applications. These Proceedings update a...

  14. Integrated Health Management Definitions (United States)

    National Aeronautics and Space Administration — The Joint Army Navy NASA Air Force Modeling and Simulation Subcommittee's Integrated Health Management panel was started about 6 years ago to help foster...

  15. State Program Integrity Reviews (United States)

    U.S. Department of Health & Human Services — State program integrity reviews play a critical role in how CMS provides effective support and assistance to states in their efforts to combat provider fraud and...

  16. Systems Integration Fact Sheet

    Energy Technology Data Exchange (ETDEWEB)



    This fact sheet is an overview of the Systems Integration subprogram at the U.S. Department of Energy SunShot Initiative. The Systems Integration subprogram enables the widespread deployment of safe, reliable, and cost-effective solar energy technologies by addressing the associated technical and non-technical challenges. These include timely and cost-effective interconnection procedures, optimal system planning, accurate prediction of solar resources, monitoring and control of solar power, maintaining grid reliability and stability, and many more. To address the challenges associated with interconnecting and integrating hundreds of gigawatts of solar power onto the electricity grid, the Systems Integration program funds research, development, and demonstration projects in four broad, interrelated focus areas: grid performance and reliability, dispatchability, power electronics, and communications.

  17. The Executive as Integrator. (United States)

    Cohn, Hans M.


    Argues that although the executive has many tasks, he or she must view internal organizational integration as a primary task, making use of organizational charts, job descriptions, statements of goals and objectives, evaluations, and feedback devices. (RH)

  18. Measuring integrated care

    DEFF Research Database (Denmark)

    Strandberg-Larsen, Martin


    respond to these needs, patients and providers face the multiple challenges of today's healthcare environment. Decision makers, planners and managers need evidence based policy options and information on the scope of the integrated care challenges they are facing. The US managed care organization Kaiser...... differences were found in the perception of clinical integration in the two settings. More primary care clinicians in the Northern California region of Kaiser Permanente reported being part of a clinical integrated environment than did Danish general practitioners. By measuring the level of clinical...... and performance of the Danish healthcare system and the managed care organization Kaiser Permanente, California, US. 5) To compare primary care clinicians' perception of clinical integration in two healthcare systems: Kaiser Permanente, Northern California and the Danish healthcare system. Further to examine...

  19. Integrated Criteria Document Chromium

    NARCIS (Netherlands)

    Slooff W; Cleven RFMJ; Janus JA; van der Poel P; van Beelen P; Boumans LJM; Canton JH; Eerens HC; Krajnc EI; de Leeuw FAAM; Matthijsen AJCM; van de Meent D; van der Meulen A; Mohn GR; Wijland GC; de Bruijn PJ; van Keulen A; Verburgh JJ; van der Woerd KF


    Betreft de engelse versie van rapport 758701001
    Bij dit rapport behoort een appendix onder hetzelfde nummer getiteld: "Integrated Criteria Document Chromium: Effects" Auteurs: Janus JA; Krajnc EI
    (appendix: see 710401002A)

  20. Financial Integrity Benchmarks (United States)

    City of Jackson, Mississippi — This data compiles standard financial integrity benchmarks that allow the City to measure its financial standing. It measure the City's debt ratio and bond ratings....

  1. Integrated Disposal Facility (United States)

    Federal Laboratory Consortium — Located near the center of the 586-square-mile Hanford Site is the Integrated Disposal Facility, also known as the IDF.This facility is a landfill similar in concept...

  2. 4 pitfalls to clinical integration. (United States)

    Redding, John


    Four common mistakes can easily thwart clinical integration: Assuming that EHR adoption is the cornerstone of successful integration; Delaying the development of ambulatory services that support clinical integration; Believing that knowledge of clinical integration initiatives will passively diffuse through the ranks; Attaching too much weight to Federal Trade Commission/Department of Justice approval of a clinical integration model.

  3. Heterogeneous Integration Technology (United States)


    integrated CMOS imaging system for high frame rate applications [171]. .................... 68 Figure 83: CPU-DRAM Memory Landscape . [127... film transistors (TFT) were integrated with GaN HEMTs on the same wafer at AFRL. The thin film transistor fabrication using metal-oxide...second layer. Layer transfer produces the best quality devices compared to other additive technologies such as re-crystallization of thin films [148

  4. Function integrated track system


    Hohnecker, Eberhard


    The paper discusses a function integrated track system that focuses on the reduction of acoustic emissions from railway lines. It is shown that the combination of an embedded rail system (ERS), a sound absorbing track surface, and an integrated mini sound barrier has significant acoustic advantages compared to a standard ballast superstructure. The acoustic advantages of an embedded rail system are particularly pronounced in the case of railway bridges. Finally, it is shown that a...

  5. Functional integration over geometries

    International Nuclear Information System (INIS)

    Mottola, E.


    The geometric construction of the functional integral over coset spaces M/G is reviewed. The inner product on the cotangent space of infinitesimal deformations of M defines an invariant distance and volume form, or functional integration measure on the full configuration space. Then, by a simple change of coordinates parameterizing the gauge fiber G, the functional measure on the coset space M/G is deduced. This change of integration variables leads to a Jacobian which is entirely equivalent to the Faddeev--Popov determinant of the more traditional gauge fixed approach in non-abelian gauge theory. If the general construction is applied to the case where G is the group of coordinate reparameterizations of spacetime, the continuum functional integral over geometries, i.e. metrics modulo coordinate reparameterizations may be defined. The invariant functional integration measure is used to derive the trace anomaly and effective action for the conformal part of the metric in two and four dimensional spacetime. In two dimensions this approach generates the Polyakov--Liouville action of closed bosonic non-critical string theory. In four dimensions the corresponding effective action leads to novel conclusions on the importance of quantum effects in gravity in the far infrared, and in particular, a dramatic modification of the classical Einstein theory at cosmological distance scales, signaled first by the quantum instability of classical de Sitter spacetime. Finite volume scaling relations for the functional integral of quantum gravity in two and four dimensions are derived, and comparison with the discretized dynamical triangulation approach to the integration over geometries are discussed. Outstanding unsolved problems in both the continuum definition and the simplicial approach to the functional integral over geometries are highlighted

  6. Fakta om integration

    DEFF Research Database (Denmark)

    Frederiksen, Hanne Winther; Nørredam, Marie

    Afsnit i Social- og Integrationsministeriets årlige publikation "Fakta om integration". Bygger på et litteraturreview foretaget i 2012 i samarbejde med Forskningscenter for Migration, Etnicitet og Sundhed (MESU) på opdrag af Social- og Integrationsministeriet.......Afsnit i Social- og Integrationsministeriets årlige publikation "Fakta om integration". Bygger på et litteraturreview foretaget i 2012 i samarbejde med Forskningscenter for Migration, Etnicitet og Sundhed (MESU) på opdrag af Social- og Integrationsministeriet....

  7. Experimental integrated photovoltaic systems

    International Nuclear Information System (INIS)

    Pop-Jordanov, Jordan; Markovska, Natasha; Dimitrov, D.; Kocev, K.; Dimitrovski, D.


    Recently, the interest in building-integrated photovoltaic installations has started to increase within governmental and municipality authorities, as well as some industrial companies. To serve a national public-awareness program of solar electricity promotion and education, the indigenous solar energy potential, optimization of possible PV installation, and three test cases of building-integrated grid-connected experimental facilities have been studied. The results showed the feasibility and performance of the proposed concepts. (Original)

  8. Discrete pseudo-integrals

    Czech Academy of Sciences Publication Activity Database

    Mesiar, Radko; Li, J.; Pap, E.


    Roč. 54, č. 3 (2013), s. 357-364 ISSN 0888-613X R&D Projects: GA ČR GAP402/11/0378 Institutional support: RVO:67985556 Keywords : concave integral * pseudo-addition * pseudo-multiplication Subject RIV: BA - General Mathematics Impact factor: 1.977, year: 2013 pseudo-integrals.pdf

  9. Integrative Pedagogical Bioethics

    Directory of Open Access Journals (Sweden)

    Anna Hubenko


    Full Text Available The state of bioethics in Ukraine, as well as in the world has been analyzed in this article. The author offers a model of integrative pedagogical bioethics and substantiates the necessity of the organization of the bioethics education and confirms the topicality of adoption of the new specialty – educator-bioethicist. The author defines the structure and method of the educational process and the new curriculum «Integrative Bioethics» for preparing educator-bioethicist specialist.

  10. Integration gennem kroppen

    DEFF Research Database (Denmark)

    Bonde, Hans


    Den dansk-jødiske idrætsforening Hakoah er et godt eksempel på, at idrætten historisk har fungeret som en arena for integration i det danske samfund.......Den dansk-jødiske idrætsforening Hakoah er et godt eksempel på, at idrætten historisk har fungeret som en arena for integration i det danske samfund....

  11. Idrott som integration


    Karlefors, Inger; Hertting, Krister


    Competitive sport is a global phenomenon with a common language, but at the same time locally embedded in the national culture. The global character gives competitive sport an attraction, which can create an important arena for integration when people arrive to a new country. Problems can rise when diverse expectations and images meet. To create understanding and facilitate integration for children and youth from different countries it is important to understand which images of sport that is ...

  12. Integrated Renovation Process

    DEFF Research Database (Denmark)

    Galiotto, Nicolas; Heiselberg, Per; Knudstrup, Mary-Ann


    renovation to be overcome. The homeowners were better integrated and their preferences and immaterial values were better taken into account. To keep the decision-making process economically viable and timely, the process as known today still needs to be improved, and new tools need to be developed....... This paper presents a new scheme: the integrated renovation process. One successful case study is introduced, and recommendations for future developments needed in the field are provided....

  13. Fostering Integrity in Research (United States)

    McNutt, M. K.


    The responsible conduct of research requires that all involved in the research enterprise - researchers, sponsors, reviewers, publishers, and communicators - adhere to a set of integrity principles to protect the public's investment. Given the increasing complexity and globalization of the research enterprise, the National Academies recently re-examined and updated its integrity recommendations for researchers in the report Fostering Integrity in Research, with sponsorship from the National Science Foundation. Major departures from the previous recommendations 25-years earlier are the recognition that practices that were previously classified as merely questionable are indeed detrimental to the responsible conduct of research. Furthermore, the report concludes that there has been insufficient effort to respond to the threats that lapses in research integrity pose to the quality of research products and the reputation of researchers as deserving of the public trust. It recommends the creation of an independent, non-profit entity dedicated to promoting research integrity by serving as a resource and clearing house for expertise, advice, materials, and best practices on fostering research integrity and responding to allegations of research misconduct.

  14. Integrated smart structures wingbox (United States)

    Simon, Solomon H.


    One objective of smart structures development is to demonstrate the ability of a mechanical component to monitor its own structural integrity and health. Achievement of this objective requires the integration of different technologies, i.e.: (1) structures, (2) sensors, and (3) artificial intelligence. We coordinated a team of experts from these three fields. These experts used reliable knowledge towards the forefront of their technologies and combined the appropriate features into an integrated hardware/software smart structures wingbox (SSW) test article. A 1/4 in. hole was drilled into the SSW test article. Although the smart structure had never seen damage of this type, it correctly recognized and located the damage. Based on a knowledge-based simulation, quantification and assessment were also carried out. We have demonstrated that the SSW integrated hardware & software test article can perform six related functions: (1) identification of a defect; (2) location of the defect; (3) quantification of the amount of damage; (4) assessment of performance degradation; (5) continued monitoring in spite of damage; and (6) continuous recording of integrity data. We present the successful results of the integrated test article in this paper, along with plans for future development and deployment of the technology.

  15. Imagery Integration Team (United States)

    Calhoun, Tracy; Melendrez, Dave


    The Human Exploration Science Office (KX) provides leadership for NASA's Imagery Integration (Integration 2) Team, an affiliation of experts in the use of engineering-class imagery intended to monitor the performance of launch vehicles and crewed spacecraft in flight. Typical engineering imagery assessments include studying and characterizing the liftoff and ascent debris environments; launch vehicle and propulsion element performance; in-flight activities; and entry, landing, and recovery operations. Integration 2 support has been provided not only for U.S. Government spaceflight (e.g., Space Shuttle, Ares I-X) but also for commercial launch providers, such as Space Exploration Technologies Corporation (SpaceX) and Orbital Sciences Corporation, servicing the International Space Station. The NASA Integration 2 Team is composed of imagery integration specialists from JSC, the Marshall Space Flight Center (MSFC), and the Kennedy Space Center (KSC), who have access to a vast pool of experience and capabilities related to program integration, deployment and management of imagery assets, imagery data management, and photogrammetric analysis. The Integration 2 team is currently providing integration services to commercial demonstration flights, Exploration Flight Test-1 (EFT-1), and the Space Launch System (SLS)-based Exploration Missions (EM)-1 and EM-2. EM-2 will be the first attempt to fly a piloted mission with the Orion spacecraft. The Integration 2 Team provides the customer (both commercial and Government) with access to a wide array of imagery options - ground-based, airborne, seaborne, or vehicle-based - that are available through the Government and commercial vendors. The team guides the customer in assembling the appropriate complement of imagery acquisition assets at the customer's facilities, minimizing costs associated with market research and the risk of purchasing inadequate assets. The NASA Integration 2 capability simplifies the process of securing one

  16. Integrating the Integrators - A Roadmap to Success

    International Nuclear Information System (INIS)

    Olson, Craig Stott; Conner, Craig C


    The U.S. Department of Energy Environmental Management's (DOE-EM) investments in science and technology, as well as science and technology investments associated with other parts of the DOE are aimed at meeting the Departments cleanup goals. These investments, primarily focused on EM's cleanup mission, comprise the Environmental Quality Research and Development (R and D) portfolios. Synchronizing EM's Cleanup Project Managers (operations facility and process owners throughout the DOE complex) operational needs with EM R and D including the extensive work of the six Focus Areas (major thrust areas within DOE-EM) has been a continuing challenge. This recent initiative to better integrate the R and D program is in response to evolving needs within the Department to apply proven system engineering methods to clarify requirements and define EM's process to effectively orchestrate their R and D Program. To optimize this partnership, DOE-EM's Integration Program is successfully unifying the operational needs with the R and D as described in this paper

  17. Economic integration in the Americas


    Uitdewilligen, G.


    This pioneering study shows that economic integration in the Americas is not simply a matter of removing trade barriers. Economic Integration in the Americas addresses the pervasive effects of economic integration on the economy as a whole.

  18. Necessity of Integral Formalism

    International Nuclear Information System (INIS)

    Tao Yong


    To describe the physical reality, there are two ways of constructing the dynamical equation of field, differential formalism and integral formalism. The importance of this fact is firstly emphasized by Yang in case of gauge field [Phys. Rev. Lett. 33 (1974) 445], where the fact has given rise to a deeper understanding for Aharonov-Bohm phase and magnetic monopole [Phys. Rev. D 12 (1975) 3845]. In this paper we shall point out that such a fact also holds in general wave function of matter, it may give rise to a deeper understanding for Berry phase. Most importantly, we shall prove a point that, for general wave function of matter, in the adiabatic limit, there is an intrinsic difference between its integral formalism and differential formalism. It is neglect of this difference that leads to an inconsistency of quantum adiabatic theorem pointed out by Marzlin and Sanders [Phys. Rev. Lett. 93 (2004) 160408]. It has been widely accepted that there is no physical difference of using differential operator or integral operator to construct the dynamical equation of field. Nevertheless, our study shows that the Schrödinger differential equation (i.e., differential formalism for wave function) shall lead to vanishing Berry phase and that the Schrödinger integral equation (i.e., integral formalism for wave function), in the adiabatic limit, can satisfactorily give the Berry phase. Therefore, we reach a conclusion: There are two ways of describing physical reality, differential formalism and integral formalism; but the integral formalism is a unique way of complete description. (general)

  19. A Comprehensive Theory of Integration. (United States)

    Singer, Sara J; Kerrissey, Michaela; Friedberg, Mark; Phillips, Russell


    Efforts to transform health care delivery to improve care have increasingly focused on care integration. However, variation in how integration is defined has complicated efforts to design, synthesize, and compare studies of integration in health care. Evaluations of integration initiatives would be enhanced by describing them according to clear definitions of integration and specifying which empirical relationships they seek to test-whether among types of integration or between integration and outcomes of care. Drawing on previous work, we present a comprehensive theoretical model of relationships between types of integration and propose how to measure them.

  20. Reconfigurable Integrated Optoelectronics

    Directory of Open Access Journals (Sweden)

    Richard Soref


    Full Text Available Integrated optics today is based upon chips of Si and InP. The future of this chip industry is probably contained in the thrust towards optoelectronic integrated circuits (OEICs and photonic integrated circuits (PICs manufactured in a high-volume foundry. We believe that reconfigurable OEICs and PICs, known as ROEICs and RPICs, constitute the ultimate embodiment of integrated photonics. This paper shows that any ROEIC-on-a-chip can be decomposed into photonic modules, some of them fixed and some of them changeable in function. Reconfiguration is provided by electrical control signals to the electro-optical building blocks. We illustrate these modules in detail and discuss 3D ROEIC chips for the highest-performance signal processing. We present examples of our module theory for RPIC optical lattice filters already constructed, and we propose new ROEICs for directed optical logic, large-scale matrix switching, and 2D beamsteering of a phased-array microwave antenna. In general, large-scale-integrated ROEICs will enable significant applications in computing, quantum computing, communications, learning, imaging, telepresence, sensing, RF/microwave photonics, information storage, cryptography, and data mining.

  1. Integrated care information technology. (United States)

    Rowe, Ian; Brimacombe, Phil


    Counties Manukau District Health Board (CMDHB) uses information technology (IT) to drive its Integrated Care strategy. IT enables the sharing of relevant health information between care providers. This information sharing is critical to closing the gaps between fragmented areas of the health system. The tragic case of James Whakaruru demonstrates how people have been falling through those gaps. The starting point of the Integrated Care strategic initiative was the transmission of electronic discharges and referral status messages from CMDHB's secondary provider, South Auckland Health (SAH), to GPs in the district. Successful pilots of a Well Child system and a diabetes disease management system embracing primary and secondary providers followed this. The improved information flowing from hospital to GPs now enables GPs to provide better management for their patients. The Well Child system pilot helped improve reported immunization rates in a high health need area from 40% to 90%. The diabetes system pilot helped reduce the proportion of patients with HbA1c rang:9 from 47% to 16%. IT has been implemented as an integral component of an overall Integrated Care strategic initiative. Within this context, Integrated Care IT has helped to achieve significant improvements in care outcomes, broken down barriers between health system silos, and contributed to the establishment of a system of care continuum that is better for patients.

  2. Integration i flere variable

    DEFF Research Database (Denmark)

    Markvorsen, Steen


    Denne note handler om parameterfremstillinger for kurver, flader og rumlige områder og om integration af funktioner på sådanne geometriske objekter. Formålet er primært at opstille og motivere de generelle definitioner og beregninger af henholdsvis kurve- \\, flade- \\, og rum-integraler. Udgangspu......Denne note handler om parameterfremstillinger for kurver, flader og rumlige områder og om integration af funktioner på sådanne geometriske objekter. Formålet er primært at opstille og motivere de generelle definitioner og beregninger af henholdsvis kurve- \\, flade- \\, og rum......-integralerne. Undervejs introduceres \\texttt{Integrator8}. Det er en pakke med Maple procedurer, som er udviklet specielt med henblik på eksempelbaseret visuel læring af de indledende integrationsbegreber og deres mangfoldige anvendelser. Vi giver eksempler på, hvordan integration i flere variable anvendes til beregning...... og forståelse af rumfang, vægt, massemidtpunkter, inertimomenter, kraftmomenter, etc. Flowkurverne for et givet vektorfelt i rummet kan findes og visualiseres med \\texttt{Integrator8}. De vigtige begreber divergens og rotation for et vektorfelt fremtræder derved som naturlige størrelser til...

  3. Wind integration in Alberta

    International Nuclear Information System (INIS)

    Frost, W.


    This presentation described the role of the Alberta Electric System Operator (AESO) for Alberta's interconnected electric system with particular reference to wind integration in Alberta. The challenges of wind integration were discussed along with the requirements for implementing the market and operational framework. The AESO is an independent system operator that directs the reliable operation of Alberta's power grid; develops and operates Alberta's real-time wholesale energy market to promote open competition; plans and develops the province's transmission system to ensure reliability; and provides transmission system access for both generation and load customers. Alberta has over 280 power generating station, with a total generating capacity of 11,742 MW, of which 443 is wind generated. Since 2004, the AESO has been working with industry on wind integration issues, such as operating limits, need for mitigation measures and market rules. In April 2006, the AESO implemented a temporary 900 MW reliability threshold to ensure reliability. In 2006, a Wind Forecasting Working Group was created in collaboration with industry and the Canadian Wind Energy Association in an effort to integrate as much wind as is feasible without compromising the system reliability or the competitive operation of the market. The challenges facing wind integration include reliability issues; predictability of wind power; the need for dispatchable generation; transmission upgrades; and, defining a market and operational framework for the large wind potential in Alberta. It was noted that 1400 MW of installed wind energy capacity can be accommodated in Alberta with approved transmission upgrades. figs

  4. Integrated Budget Office Toolbox (United States)

    Rushing, Douglas A.; Blakeley, Chris; Chapman, Gerry; Robertson, Bill; Horton, Allison; Besser, Thomas; McCarthy, Debbie


    The Integrated Budget Office Toolbox (IBOT) combines budgeting, resource allocation, organizational funding, and reporting features in an automated, integrated tool that provides data from a single source for Johnson Space Center (JSC) personnel. Using a common interface, concurrent users can utilize the data without compromising its integrity. IBOT tracks planning changes and updates throughout the year using both phasing and POP-related (program-operating-plan-related) budget information for the current year, and up to six years out. Separating lump-sum funds received from HQ (Headquarters) into separate labor, travel, procurement, Center G&A (general & administrative), and servicepool categories, IBOT creates a script that significantly reduces manual input time. IBOT also manages the movement of travel and procurement funds down to the organizational level and, using its integrated funds management feature, helps better track funding at lower levels. Third-party software is used to create integrated reports in IBOT that can be generated for plans, actuals, funds received, and other combinations of data that are currently maintained in the centralized format. Based on Microsoft SQL, IBOT incorporates generic budget processes, is transportable, and is economical to deploy and support.

  5. Impairments in Skin Integrity. (United States)

    Murphree, Rose W


    Altered skin integrity increases the chance of infection, impaired mobility, and decreased function and may result in the loss of limb or, sometimes, life. Skin is affected by both intrinsic and extrinsic factors. Intrinsic factors can include altered nutritional status, vascular disease issues, and diabetes. Extrinsic factors include falls, accidents, pressure, immobility, and surgical procedures. Ensuring skin integrity in the elderly requires a team approach and includes the individual, caregivers, and clinicians. The twenty-first century clinician has several online, evidence-based tools to assist with optimal treatment plans. Understanding best practices in addressing skin integrity issues can promote positive outcomes with the elderly. Copyright © 2017 Elsevier Inc. All rights reserved.


    Directory of Open Access Journals (Sweden)

    Lionel Manuel Carbonell-Zamora


    Full Text Available The Integrated Strategic Direction constitutes a superior stage of Direction that expresses the coordinated system of external and internal relations with full participation in order to reach the vision of the organization. It can be insured by the use of the Strategic Direction model for the integration of the Company Direction System. This model has been applied in several companies. Recently, it was applied in the Inspection State Unit of MICONS in Santiago de Cuba through the investigation thesis for master degree developed during 18 months which objective was to validate its effectiveness in a budgeted unit, obtaining positive results when the levels of integration in the direction system increased in their external and internal relations expressed in a 37 % and 15 % respectively, which impacted the increment of the efficiency and effectiveness of all processes of the organization. 

  7. New integrable lattice hierarchies

    International Nuclear Information System (INIS)

    Pickering, Andrew; Zhu Zuonong


    In this Letter we give a new integrable four-field lattice hierarchy, associated to a new discrete spectral problem. We obtain our hierarchy as the compatibility condition of this spectral problem and an associated equation, constructed herein, for the time-evolution of eigenfunctions. We consider reductions of our hierarchy, which also of course admit discrete zero curvature representations, in detail. We find that our hierarchy includes many well-known integrable hierarchies as special cases, including the Toda lattice hierarchy, the modified Toda lattice hierarchy, the relativistic Toda lattice hierarchy, and the Volterra lattice hierarchy. We also obtain here a new integrable two-field lattice hierarchy, to which we give the name of Suris lattice hierarchy, since the first equation of this hierarchy has previously been given by Suris. The Hamiltonian structure of the Suris lattice hierarchy is obtained by means of a trace identity formula

  8. Signal integrity characterization techniques

    CERN Document Server

    Bogatin, Eric


    "Signal Integrity Characterization Techniques" addresses the gap between traditional digital and microwave curricula all while focusing on a practical and intuitive understanding of signal integrity effects within the data transmission channel. High-speed interconnects such as connectors, PCBs, cables, IC packages, and backplanes are critical elements of differential channels that must be designed using today's most powerful analysis and characterization tools.Both measurements and simulation must be done on the device under test, and both activities must yield data that correlates with each other. Most of this book focuses on real-world applications of signal integrity measurements - from backplane for design challenges to error correction techniques to jitter measurement technologies. The authors' approach wisely addresses some of these new high-speed technologies, and it also provides valuable insight into its future direction and will teach the reader valuable lessons on the industry.

  9. Integrative Scenario Development

    Directory of Open Access Journals (Sweden)

    Joerg A. Priess


    Full Text Available Scenarios are employed to address a large number of future environmental and socioeconomic challenges. We present a conceptual framework for the development of scenarios to integrate the objectives of different stakeholder groups. Based on the framework, land-use scenarios were developed to provide a common base for further research. At the same time, these scenarios assisted regional stakeholders to bring forward their concerns and arrive at a shared understanding of challenges between scientific and regional stakeholders, which allowed them to eventually support regional decision making. The focus on the integration of views and knowledge domains of different stakeholder groups, such as scientists and practitioners, required rigorous and repeated measures of quality control. The application of the integrative concept provided products for both stakeholder groups, and the process of scenario development facilitated cooperation and learning within both the scientist and practitioner groups as well as between the two groups.

  10. Integration eller Illusion

    DEFF Research Database (Denmark)

    Rezaei, Shahamak; Goli, Marco


    Integration or illusion – a deviance perspective Denmark experienced one of its most successful periods of economic growth in 2004–2008 with a tremendous reduction of unemployment, which in June 2008 was around. 1.5 percent, far below the expected level of structural unemployment. In the wake...... of migrants’ skills. 2. Whether there were patterns of over-education as expression of institutional and societal discrimination. The focus of the present study is, however, quite different: We examine the pattern of deviance in relation to labour market participation (not integration), and instead...... of searching for explanations for the lack of integration, we attempt to identify and explain the deviance pattern as a product of institutionally inherent possibilities and barriers on the one hand and articulating immigrants as rational actors (not victims) on the other. We argue that deviance is not only...

  11. An integrated magnetics component

    DEFF Research Database (Denmark)


    The present invention relates to an integrated magnetics component comprising a magnetically permeable core comprising a base member extending in a horizontal plane and first, second, third and fourth legs protruding substantially perpendicularly from the base member. First, second, third...... and fourth output inductor windings are wound around the first, second, third and fourth legs, respectively. A first input conductor of the integrated magnetics component has a first conductor axis and extends in-between the first, second, third and fourth legs to induce a first magnetic flux through a first...... flux path of the magnetically permeable core. A second input conductor of the integrated magnetics component has a second coil axis extending substantially perpendicularly to the first conductor axis to induce a second magnetic flux through a second flux path of the magnetically permeable core...

  12. Writing against integration

    DEFF Research Database (Denmark)

    Rytter, Mikkel


    The article addresses some of the problems related to the concept of integration, which has been used (and abused) in Denmark since the 1980s to discuss socio-economic, cultural and religious challenges related to the everyday life of ethnic minorities. The concept of integration is not innocent...... three scenarios: ‘welfare reciprocity’, ‘host and guests’ and ‘the Danes as an indigenous people’. These scenarios consolidate an asymmetrical relationship between majorities and minorities because they simultaneously cast integration as desirable and impossible. Finally, inspired by Lila Abu......-Lughod’s seminal article “writing against culture”, the article suggests strategies of “writing against integration” in order to regain the critical potential of academic analysis....

  13. Semantic Observation Integration

    Directory of Open Access Journals (Sweden)

    Werner Kuhn


    Full Text Available Although the integration of sensor-based information into analysis and decision making has been a research topic for many years, semantic interoperability has not yet been reached. The advent of user-generated content for the geospatial domain, Volunteered Geographic Information (VGI, makes it even more difficult to establish semantic integration. This paper proposes a novel approach to integrating conventional sensor information and VGI, which is exploited in the context of detecting forest fires. In contrast to common logic-based semantic descriptions, we present a formal system using algebraic specifications to unambiguously describe the processing steps from natural phenomena to value-added information. A generic ontology of observations is extended and profiled for forest fire detection in order to illustrate how the sensing process, and transformations between heterogeneous sensing systems, can be represented as mathematical functions and grouped into abstract data types. We discuss the required ontological commitments and a possible generalization.


    Directory of Open Access Journals (Sweden)



    Full Text Available Corporations are at present operating in demanding and highly unsure periods, facing a mixture of increased macroeconomic need, competitive and capital market dangers, and in many cases, the prospect for significant technical and regulative gap. Throughout these demanding and highly unsure times, the corporations must pay particular attention to corporate strategy. In present times, corporate strategy must be perceived and used as a function of various fields, covers, and characters as well as a highly interactive system. For the corporation's strategy to become a competitive advantage is necessary to understand and also to integrate it in a holistic model to ensure sustainable progress of corporation activities under the optimum conditions of profitability. The model proposed in this paper is aimed at integrating the two strategic models, Hoshin Kanri and Integrated Strategy Model, as well as their consolidation with the principles of sound corporate governance set out by the OECD.

  15. Integrating education and incubation

    DEFF Research Database (Denmark)

    Hjortsø, Carsten Nico Portefée; Riis, Nina Louise Fynbo

    During the last decade student business incubation activities have become mainstream activities in Western universities. This is also the case in Danish higher education where all universities have established in-house student incubators. The models applied are different and place varied emphasis...... on the integration of extracurricular activities with formal credit awarding activities. In a Danish context, such integration has become increasingly important due to recent political reforms aimed at shortening the time it takes students to graduate in order to reduce national higher education expenditures....... On this backdrop, this paper explores the following questions: • How and to what extent do university student incubators collaborate with formal study programmes? • And which factors influence this integration of curricular and extracurricular activities?...

  16. Integrated magnetic transformer assembly

    DEFF Research Database (Denmark)


    The present invention relates to an integrated magnetics transformer assembly comprising a first magnetically permeable core forming a first substantially closed magnetic flux path and a second magnetically permeable core forming a second substantially closed magnetic flux path. A first input...... inductor winding is wound around a first predetermined segment of the first magnetically permeable core and a second input inductor winding is wound around a first predetermined segment of the second magnetically permeable core. The integrated magnetics transformer assembly further comprises a first output......-winding of the first output inductor winding and the first half-winding of the second output inductor winding are configured to produce aligned, i.e. in the same direction, magnetic fluxes through the first substantially closed magnetic flux path. The integrated magnetics transformer assembly is well- suited for use...

  17. Policy, sport and integration

    DEFF Research Database (Denmark)

    Agergaard, Sine; Sørensen, Jan Kahr


    Increased public funding, more governmental involvement and an emphasis on the instrumental values of physical activities have in general become characteristic of Western nations’ policies towards sport. Denmark is, however, a little different in that there is still little political intervention...... in sport, although sports clubs do get economic support and are seen as having the potential to solve crucial social issues. The purpose of this article is to analyse and discuss the ways in which the political assumption that sport can enhance social integration is reflected in the practical governance...... of integration issues in particular in sports clubs. The article is based on a local field study in which we interviewed 10 talented football players with ethnic minority backgrounds and eight coaches and club leaders from six different football clubs. Distinguishing between integration and assimilation...

  18. Towards Integrating Realities

    DEFF Research Database (Denmark)

    Henriksen, Lars Bo


    The pragmatic constructivist approach provides us with a social science theory, the theory of reality, and its associated method, the conceptualising method. A key aspect in both the theory of reality and its associated conceptualising method is on the necessity of integratingfour dimensionsof...... conceptualisation of the process of integration is itself not analysed or conceptualised to the same substantive extent as are the other elements ofthe theory of reality.The key questionaddressed here thereforebecomes: how might we betteranalyse and describe this process of integration? To address this question......, Iidentify, albeit in skeletal outline,usefulsocial theoreticalcorrespondences between Arendt’s conceptualisation of action in The Human Condition(1958) and key attributes ofthe theory of reality, which, Iclaim, couldpossibly guide an entry into the ‘how’ of this elusive integration process....

  19. Discrete systems and integrability

    CERN Document Server

    Hietarinta, J; Nijhoff, F W


    This first introductory text to discrete integrable systems introduces key notions of integrability from the vantage point of discrete systems, also making connections with the continuous theory where relevant. While treating the material at an elementary level, the book also highlights many recent developments. Topics include: Darboux and Bäcklund transformations; difference equations and special functions; multidimensional consistency of integrable lattice equations; associated linear problems (Lax pairs); connections with Padé approximants and convergence algorithms; singularities and geometry; Hirota's bilinear formalism for lattices; intriguing properties of discrete Painlevé equations; and the novel theory of Lagrangian multiforms. The book builds the material in an organic way, emphasizing interconnections between the various approaches, while the exposition is mostly done through explicit computations on key examples. Written by respected experts in the field, the numerous exercises and the thoroug...

  20. Integrity and the Value of an Integrated Self

    NARCIS (Netherlands)

    Archer, Alfred

    What is integrity and why is it valuable? One account of the nature of integrity, proposed by John Cottingham (2010) amongst others, is The Integrated Self View. On this account integrity is a formal relation of coherence between various aspects of a person. One problem that has been raised against

  1. What Is Energy Systems Integration? | Energy Systems Integration Facility | (United States)

    NREL What Is Energy Systems Integration? What Is Energy Systems Integration? Energy systems integration (ESI) is an approach to solving big energy challenges that explores ways for energy systems to Research Community NREL is a founding member of the International Institute for Energy Systems Integration

  2. Vehicle-to-Grid Integration | Energy Systems Integration Facility | NREL (United States)

    Vehicle-to-Grid Integration Vehicle-to-Grid Integration NREL's research stands at the forefront of vehicle charging station Our work focuses on building the infrastructure and integration needed for benefit each other. Electric Vehicles NREL's research on electric vehicle (EV) grid integration examines

  3. Grid Integration Webinars | Energy Systems Integration Facility | NREL (United States)

    Grid Integration Webinars Grid Integration Webinars Watch presentations from NREL analysts on various topics related to grid integration. Wind Curtailment and the Value of Transmission under a 2050 renewable curtailment under these high wind scenarios. Text Version Grid Integration Webinar: Exploring

  4. Developing Integrated Care: Towards a development model for integrated care

    NARCIS (Netherlands)

    M.M.N. Minkman (Mirella)


    textabstractThe thesis adresses the phenomenon of integrated care. The implementation of integrated care for patients with a stroke or dementia is studied. Because a generic quality management model for integrated care is lacking, the study works towards building a development model for integrated

  5. Counting master integrals: Integration by parts vs. differential reduction

    International Nuclear Information System (INIS)

    Kalmykov, Mikhail Yu.; Kniehl, Bernd A.


    The techniques of integration by parts and differential reduction differ in the counting of master integrals. This is illustrated using as an example the two-loop sunset diagram with on-shell kinematics. A new algebraic relation between the master integrals of the two-loop sunset diagram that does not follow from the standard integration-by-parts technique is found.

  6. Counting master integrals. Integration by parts vs. differential reduction

    International Nuclear Information System (INIS)

    Kalmykov, Mikhail Yu; Kniehl, Bernd A.


    The techniques of integration by parts and differential reduction differ in the counting of master integrals. This is illustrated using as an example the two- loop sunset diagram with on-shell kinematics. A new algebraic relation between the master integrals of the two-loop sunset diagram that does not follow from the integration-by-parts technique is found. (orig.)

  7. Integrative oncology: an overview. (United States)

    Deng, Gary; Cassileth, Barrie


    Integrative oncology, the diagnosis-specific field of integrative medicine, addresses symptom control with nonpharmacologic therapies. Known commonly as "complementary therapies" these are evidence-based adjuncts to mainstream care that effectively control physical and emotional symptoms, enhance physical and emotional strength, and provide patients with skills enabling them to help themselves throughout and following mainstream cancer treatment. Integrative or complementary therapies are rational and noninvasive. They have been subjected to study to determine their value, to document the problems they ameliorate, and to define the circumstances under which such therapies are beneficial. Conversely, "alternative" therapies typically are promoted literally as such; as actual antitumor treatments. They lack biologic plausibility and scientific evidence of safety and efficacy. Many are outright fraudulent. Conflating these two very different categories by use of the convenient acronym "CAM," for "complementary and alternative therapies," confuses the issue and does a substantial disservice to patients and medical professionals. Complementary and integrative modalities have demonstrated safety value and benefits. If the same were true for "alternatives," they would not be "alternatives." Rather, they would become part of mainstream cancer care. This manuscript explores the medical and sociocultural context of interest in integrative oncology as well as in "alternative" therapies, reviews commonly-asked patient questions, summarizes research results in both categories, and offers recommendations to help guide patients and family members through what is often a difficult maze. Combining complementary therapies with mainstream oncology care to address patients' physical, psychologic and spiritual needs constitutes the practice of integrative oncology. By recommending nonpharmacologic modalities that reduce symptom burden and improve quality of life, physicians also enable

  8. NASA Integrated Network COOP (United States)

    Anderson, Michael L.; Wright, Nathaniel; Tai, Wallace


    Natural disasters, terrorist attacks, civil unrest, and other events have the potential of disrupting mission-essential operations in any space communications network. NASA's Space Communications and Navigation office (SCaN) is in the process of studying options for integrating the three existing NASA network elements, the Deep Space Network, the Near Earth Network, and the Space Network, into a single integrated network with common services and interfaces. The need to maintain Continuity of Operations (COOP) after a disastrous event has a direct impact on the future network design and operations concepts. The SCaN Integrated Network will provide support to a variety of user missions. The missions have diverse requirements and include anything from earth based platforms to planetary missions and rovers. It is presumed that an integrated network, with common interfaces and processes, provides an inherent advantage to COOP in that multiple elements and networks can provide cross-support in a seamless manner. The results of trade studies support this assumption but also show that centralization as a means of achieving integration can result in single points of failure that must be mitigated. The cost to provide this mitigation can be substantial. In support of this effort, the team evaluated the current approaches to COOP, developed multiple potential approaches to COOP in a future integrated network, evaluated the interdependencies of the various approaches to the various network control and operations options, and did a best value assessment of the options. The paper will describe the trade space, the study methods, and results of the study.

  9. Pentaho data integration cookbook

    CERN Document Server

    Meadows, Alex


    Pentaho Data Integration Cookbook Second Edition is written in a cookbook format, presenting examples in the style of recipes.This allows you to go directly to your topic of interest, or follow topics throughout a chapter to gain a thorough in-depth knowledge.Pentaho Data Integration Cookbook Second Edition is designed for developers who are familiar with the basics of Kettle but who wish to move up to the next level.It is also aimed at advanced users that want to learn how to use the new features of PDI as well as and best practices for working with Kettle.

  10. Integrative STEM Education Defined


    Sanders, Mark E.


    “My work with integrative STEM education began in 1990 with the NSF-funded Technology, Science, Mathematics Integration Project… By 2008, I was convinced “STEM Education” was (and always would be) a hopelessly ambiguous phrase, and therefore felt we absolutely needed to rename our “STEM Education” graduate program and develop a tight operational definition of the central idea underlying our program, in hopes of preventing the sort of hopeless ambiguity that ruined the term “STEM education” fr...

  11. Integrated Structural Design Education

    DEFF Research Database (Denmark)

    Bjerregaard Jensen, Lotte; Almegaard, Henrik


    to EU legislation. And a successful engineering student must be prepared to work in the open-ended, multidisciplinary environment necessary to produce structures which comply with EIA demands. This paper describes an innovative course developed at the Technical University of Denmark which integrates...... landscaping and structural design. The integrated courses create a setting for learning about the design of large-scale structures and involve geometry, statics, computer simulation, graphical design and landscape architecture. Together, they educate engineers who can take part in the early design phases...... of a project, function well in design teams, and comply with EU EIA demands....

  12. Acoustic integrated extinction


    Norris, Andrew N.


    The integrated extinction (IE) is defined as the integral of the scattering cross section as a function of wavelength. Sohl et al. (2007 J. Acoust. Soc. Am. 122, 3206–3210. (doi:10.1121/1.2801546)) derived an IE expression for acoustic scattering that is causal, i.e. the scattered wavefront in the forward direction arrives later than the incident plane wave in the background medium. The IE formula was based on electromagnetic results, for which scattering is causal by default. Here, we der...

  13. Integrated heterodyne terahertz transceiver (United States)

    Wanke, Michael C [Albuquerque, NM; Lee, Mark [Albuquerque, NM; Nordquist, Christopher D [Albuquerque, NM; Cich, Michael J [Albuquerque, NM


    A heterodyne terahertz transceiver comprises a quantum cascade laser that is integrated on-chip with a Schottky diode mixer. A terahertz signal can be received by an antenna connected to the mixer, an end facet or sidewall of the laser, or through a separate active section that can amplify the incident signal. The quantum cascade laser couples terahertz local oscillator power to the Schottky diode to mix with the received terahertz signal to provide an intermediate frequency output signal. The fully integrated transceiver optimizes power efficiency, sensitivity, compactness, and reliability. The transceiver can be used in compact, fieldable systems covering a wide variety of deployable applications not possible with existing technology.

  14. Integrated heterodyne terahertz transceiver

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mark [Albuquerque, NM; Wanke, Michael C [Albuquerque, NM


    A heterodyne terahertz transceiver comprises a quantum cascade laser that is integrated on-chip with a Schottky diode mixer. An antenna connected to the Schottky diode receives a terahertz signal. The quantum cascade laser couples terahertz local oscillator power to the Schottky diode to mix with the received terahertz signal to provide an intermediate frequency output signal. The fully integrated transceiver optimizes power efficiency, sensitivity, compactness, and reliability. The transceiver can be used in compact, fieldable systems covering a wide variety of deployable applications not possible with existing technology.

  15. Understanding signal integrity

    CERN Document Server

    Thierauf, Stephen C


    This unique book provides you with practical guidance on understanding and interpreting signal integrity (SI) performance to help you with your challenging circuit board design projects. You find high-level discussions of important SI concepts presented in a clear and easily accessible format, including question and answer sections and bulleted lists.This valuable resource features rules of thumb and simple equations to help you make estimates of critical signal integrity parameters without using circuit simulators of CAD (computer-aided design). The book is supported with over 120 illustratio

  16. Integration i naturen

    DEFF Research Database (Denmark)

    Kjeldsen, Lis Reinholdt


    Artiklen formidler resultaterne af udviklingsprojektet: Outdoor learning for Integration through Nature and Cultural Encounters, som er et europæisk samarbejde. Undervisere af flygtning og indvandrere kan med fordel anvende naturen og de kulturelle omgivelser i byen i læringsøjemed.......Artiklen formidler resultaterne af udviklingsprojektet: Outdoor learning for Integration through Nature and Cultural Encounters, som er et europæisk samarbejde. Undervisere af flygtning og indvandrere kan med fordel anvende naturen og de kulturelle omgivelser i byen i læringsøjemed....

  17. Integrated Nuclear Recycle Plant

    International Nuclear Information System (INIS)

    Patodi, Anuj; Parashar, Abhishek; Samadhiya, Akshay K.; Ray, Saheli; Dey, Mitun; Singh, K.K.


    Nuclear Recycle Board (NRB), Tarapur proposes to set up an 'Integrated Nuclear Recycle Plant' at Tarapur. This will be located in the premises of BARC facilities. The project location is at coastal town of Tarapur, 130 Km north of Mumbai. Project area cover of INRP is around 80 hectares. The plant will be designed to process spent fuel received from Pressurized Heavy Water Reactors (PHWRs). This is the first large scale integrated plant of the country. INRP will process spent fuel obtained from indigenous nuclear power plants and perform left over nuclear waste disposal

  18. Google analytics integrations

    CERN Document Server

    Waisberg, Daniel


    A roadmap for turning Google Analytics into a centralized marketing analysis platform With Google Analytics Integrations, expert author Daniel Waisberg shows you how to gain a more meaningful, complete view of customers that can drive growth opportunities. This in-depth guide shows not only how to use Google Analytics, but also how to turn this powerful data collection and analysis tool into a central marketing analysis platform for your company. Taking a hands-on approach, this resource explores the integration and analysis of a host of common data sources, including Google AdWords, AdSens

  19. Smart Grid Integration Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Troxell, Wade [Colorado State Univ., Fort Collins, CO (United States)


    The initial federal funding for the Colorado State University Smart Grid Integration Laboratory is through a Congressionally Directed Project (CDP), DE-OE0000070 Smart Grid Integration Laboratory. The original program requested in three one-year increments for staff acquisition, curriculum development, and instrumentation all which will benefit the Laboratory. This report focuses on the initial phase of staff acquisition which was directed and administered by DOE NETL/ West Virginia under Project Officer Tom George. Using this CDP funding, we have developed the leadership and intellectual capacity for the SGIC. This was accomplished by investing (hiring) a core team of Smart Grid Systems engineering faculty focused on education, research, and innovation of a secure and smart grid infrastructure. The Smart Grid Integration Laboratory will be housed with the separately funded Integrid Laboratory as part of CSU's overall Smart Grid Integration Center (SGIC). The period of performance of this grant was 10/1/2009 to 9/30/2011 which included one no cost extension due to time delays in faculty hiring. The Smart Grid Integration Laboratory's focus is to build foundations to help graduate and undergraduates acquire systems engineering knowledge; conduct innovative research; and team externally with grid smart organizations. Using the results of the separately funded Smart Grid Workforce Education Workshop (May 2009) sponsored by the City of Fort Collins, Northern Colorado Clean Energy Cluster, Colorado State University Continuing Education, Spirae, and Siemens has been used to guide the hiring of faculty, program curriculum and education plan. This project develops faculty leaders with the intellectual capacity to inspire its students to become leaders that substantially contribute to the development and maintenance of Smart Grid infrastructure through topics such as: (1) Distributed energy systems modeling and control; (2) Energy and power conversion; (3

  20. Silicon integrated circuit process

    International Nuclear Information System (INIS)

    Lee, Jong Duck


    This book introduces the process of silicon integrated circuit. It is composed of seven parts, which are oxidation process, diffusion process, ion implantation process such as ion implantation equipment, damage, annealing and influence on manufacture of integrated circuit and device, chemical vapor deposition process like silicon Epitaxy LPCVD and PECVD, photolithography process, including a sensitizer, spin, harden bake, reflection of light and problems related process, infrared light bake, wet-etch, dry etch, special etch and problems of etching, metal process like metal process like metal-silicon connection, aluminum process, credibility of aluminum and test process.

  1. Cálculo integral


    Acevedo Frías, Bernardo


    Este trabajo tiene como contenido el desarrollo de los temas que corresponden al curso de Cálculo Integral, dirigido básicamente a estudiantes de ingeniería; comprende dos capítulos. El primero se refiere a todo el cálculo integral y el segundo al de sus aplicaciones. En la explicación teórica se omitió dar demostraciones de algunos teoremas o propiedades; en compensación fueron incluidas explicaciones basadas en figuras y representaciones gráficas, para hacer comprensibles dichos teoremas....

  2. Feynman integral calculus

    International Nuclear Information System (INIS)

    Smirnov, V.A.


    The goal of the book is to summarize those methods for evaluating Feynman integrals that have been developed over a span of more than fifty years. The book characterizes the most powerful methods and illustrates them with numerous examples starting from very simple ones and progressing to nontrivial examples. The book demonstrates how to choose adequate methods and combine evaluation methods in a non-trivial way. The most powerful methods are characterized and then illustrated through numerous examples. This is an updated textbook version of the previous book (Evaluating Feynman integrals, STMP 211) of the author. (orig.)

  3. Feynman integral calculus

    Energy Technology Data Exchange (ETDEWEB)

    Smirnov, V.A. [Lomonosov Moscow State Univ. (Russian Federation). Skobeltsyn Inst. of Nuclear Physics


    The goal of the book is to summarize those methods for evaluating Feynman integrals that have been developed over a span of more than fifty years. The book characterizes the most powerful methods and illustrates them with numerous examples starting from very simple ones and progressing to nontrivial examples. The book demonstrates how to choose adequate methods and combine evaluation methods in a non-trivial way. The most powerful methods are characterized and then illustrated through numerous examples. This is an updated textbook version of the previous book (Evaluating Feynman integrals, STMP 211) of the author. (orig.)

  4. Silicon integrated circuit process

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Duck


    This book introduces the process of silicon integrated circuit. It is composed of seven parts, which are oxidation process, diffusion process, ion implantation process such as ion implantation equipment, damage, annealing and influence on manufacture of integrated circuit and device, chemical vapor deposition process like silicon Epitaxy LPCVD and PECVD, photolithography process, including a sensitizer, spin, harden bake, reflection of light and problems related process, infrared light bake, wet-etch, dry etch, special etch and problems of etching, metal process like metal process like metal-silicon connection, aluminum process, credibility of aluminum and test process.

  5. Integrity at CERN

    CERN Document Server

    Department, HR


    In the fulfillment of its mission, CERN relies upon the trust and material support of its Member States and partners, and is committed to exercising exemplary stewardship of the resources with which it is entrusted. Accordingly, CERN expects the highest level of integrity from all its contributors (whether members of the personnel, consultants, contractors working on site, or persons engaged in any other capacity at or on behalf of CERN). Integrity is a core value of CERN, defined in the Code of Conduct as “behaving ethically, with intellectual honesty and being accountable for one’s own actions”.

  6. Auditory Integration Training

    Directory of Open Access Journals (Sweden)

    Zahra Jafari


    Full Text Available Auditory integration training (AIT is a hearing enhancement training process for sensory input anomalies found in individuals with autism, attention deficit hyperactive disorder, dyslexia, hyperactivity, learning disability, language impairments, pervasive developmental disorder, central auditory processing disorder, attention deficit disorder, depressin, and hyperacute hearing. AIT, recently introduced in the United States, and has received much notice of late following the release of The Sound of a Moracle, by Annabel Stehli. In her book, Mrs. Stehli describes before and after auditory integration training experiences with her daughter, who was diagnosed at age four as having autism.

  7. Review: Auditory Integration Training

    Directory of Open Access Journals (Sweden)

    Zahra Ja'fari


    Full Text Available Auditory integration training (AIT is a hearing enhancement training process for sensory input anomalies found in individuals with autism, attention deficit hyperactive disorder, dyslexia, hyperactivity, learning disability, language impairments, pervasive developmental disorder, central auditory processing disorder, attention deficit disorder, depression, and hyper acute hearing. AIT, recently introduced in the United States, and has received much notice of late following the release of the sound of a miracle, by Annabel Stehli. In her book, Mrs. Stehli describes before and after auditory integration training experiences with her daughter, who was diagnosed at age four as having autism.

  8. Control system integration

    CERN Document Server

    Shea, T J


    This lecture begins with a definition of an accelerator control system, and then reviews the control system architectures that have been deployed at the larger accelerator facilities. This discussion naturally leads to identification of the major subsystems and their interfaces. We shall explore general strategies for integrating intelligent devices and signal processing subsystems based on gate arrays and programmable DSPs. The following topics will also be covered: physical packaging; timing and synchronization; local and global communication technologies; interfacing to machine protection systems; remote debugging; configuration management and source code control; and integration of commercial software tools. Several practical realizations will be presented.

  9. Apache Solr PHP integration

    CERN Document Server

    Kumar, Jayant


    This book is full of step-by-step example-oriented tutorials which will show readers how to integrate Solr in PHP applications using the available libraries, and boost the inherent search facilities that Solr offers.If you are a developer who knows PHP and is interested in integrating search into your applications, this is the book for you. No advanced knowledge of Solr is required. Very basic knowledge of system commands and the command-line interface on both Linux and Windows is required. You should also be familiar with the concept of Web servers.

  10. Measuring integrated care. (United States)

    Strandberg-Larsen, Martin


    The positive outcomes of coordination of healthcare services are to an increasing extent becoming clear. However the complexity of the field is an inhibiting factor for vigorously designed trial studies. Conceptual clarity and a consistent theoretical frame-work are thus needed. While researchers respond to these needs, patients and providers face the multiple challenges of today's healthcare environment. Decision makers, planners and managers need evidence based policy options and information on the scope of the integrated care challenges they are facing. The US managed care organization Kaiser Permanente has been put forward as an example for European healthcare systems to follow, although the evidence base is far from conclusive. The thesis has five objectives: 1) To contribute to the understanding of the concept of integration in healthcare systems and to identify measurement methods to capture the multi-dimensional aspects of integrated healthcare delivery. 2) To assess the level of integration of the Danish healthcare system. 3) To assess the use of joint health plans as a tool for coordination between the regional and local level in the Danish healthcare system. 4) To compare the inputs and performance of the Danish healthcare system and the managed care organization Kaiser Permanente, California, US. 5) To compare primary care clinicians' perception of clinical integration in two healthcare systems: Kaiser Permanente, Northern California and the Danish healthcare system. Further to examine the associations between specific organizational factors and clinical integration within each system. The literature was systematically searched to identify methods for measurement of integrated healthcare delivery. A national cross-sectional survey was conducted among major professional stake-holders at five different levels of the Danish healthcare system. The survey data were used to allow for analysis of the level of integration achieved. Data from the survey were

  11. Negative dimensional integrals. Pt. 1

    International Nuclear Information System (INIS)

    Halliday, I.G.; Ricotta, R.M.


    We propose a new method of evaluating integrals based on negative dimensional integration. We compute Feynman graphs by considering analytic extensions. Propagators are raised to negative integer powers and integrated over negative integer dimensions. We are left with the problem of computing polynomial integrals and summing finite series. (orig.)

  12. Diverse methods for integrable models

    NARCIS (Netherlands)

    Fehér, G.


    This thesis is centered around three topics, sharing integrability as a common theme. This thesis explores different methods in the field of integrable models. The first two chapters are about integrable lattice models in statistical physics. The last chapter describes an integrable quantum chain.

  13. Rule-based Information Integration

    NARCIS (Netherlands)

    de Keijzer, Ander; van Keulen, Maurice


    In this report, we show the process of information integration. We specifically discuss the language used for integration. We show that integration consists of two phases, the schema mapping phase and the data integration phase. We formally define transformation rules, conversion, evolution and

  14. Grid Integration | Water Power | NREL (United States)

    Grid Integration Grid Integration For marine and hydrokinetic technologies to play a larger role in supplying the nation's energy needs, integration into the U.S. power grid is an important challenge to address. Efficient integration of variable power resources like water power is a critical part of the

  15. Systems Integration | Photovoltaic Research | NREL (United States)

    Integration Systems Integration The National Center for Photovoltaics (NCPV) at NREL provides grid integration support, system-level testing, and systems analysis for the Department of Energy's solar distributed grid integration projects supported by the SunShot Initiative. These projects address technical

  16. Spin chains and Gustafson's integrals

    International Nuclear Information System (INIS)

    Derkachov, S.E; Manashov, A.N.; Regensburg Univ.


    The Gustafson's integrals are the multidimensional generalization of the classical Mellin-Barnes integrals. We show that some of these integrals arise from relations between matrix elements in the Sklyanin's representation of Separated Variables in the spin chain models. We also present several new integrals.

  17. Integrated management systems

    DEFF Research Database (Denmark)

    Jørgensen, Tine Herreborg; Remmen, Arne; Mellado, M. Dolores


    Different approaches to integration of management systems (ISO 9001, ISO 14001, OHSAS 18001 and SA 8000) with various levels of ambition have emerged. The tendency of increased compatibility between these standards has paved the road for discussions of, how to understand the different aspects of ...

  18. Safeguarding genome integrity

    DEFF Research Database (Denmark)

    Sørensen, Claus Storgaard; Syljuåsen, Randi G


    Mechanisms that preserve genome integrity are highly important during the normal life cycle of human cells. Loss of genome protective mechanisms can lead to the development of diseases such as cancer. Checkpoint kinases function in the cellular surveillance pathways that help cells to cope with D...

  19. Integrality in codimension one

    DEFF Research Database (Denmark)

    Thorup, Anders


    The paper from 2001 by Simis, Ulrich, and Vasconcelos contained deep results on codimension, multiplicity and integral extensions. The results and the ideas of the paper led to substantial simplifications in the treatment of the exceptional fiber of a conormal space, considered previously...

  20. Building integrated photovoltaics

    NARCIS (Netherlands)

    Ritzen, M.J.; Vroon, Z.A.E.P.; Geurts, C.P.W.; Reinders, Angèle; Verlinden, Pierre; Sark, Wilfried; Freundlich, Alexandre


    Photovoltaic (PV) installations can be realized in different situations and on different scales, such as at a building level. PV installations at the building level can either be added to the building envelope, which is called building added PV (BAPV), or they can be integrated into the building

  1. Integrated Optical lightguide device

    NARCIS (Netherlands)

    Heideman, Rene; Lambeck, Paul; Veldhuis, G.J.


    In an integrated optical lightguide device including a light-transmitting core layer, an inclusion or buffer layer, and an active or cladding layer. The cladding layer is divided into segments. Groups of different segments exhibit different refractive indices, light intensity profiles or different

  2. Integrated Optical lightguide device

    NARCIS (Netherlands)

    Heideman, Rene; Lambeck, Paul; Veldhuis, G.J.


    In an integrated optical lightguide device including a light-transmitting core layer, an inclusion or buffer layer, and an active or cladding layer. The cladding layer is divided into segments. Groups of different segments exhibit different refractive indices, light intensity profiles or different

  3. An integrated circuit switch (United States)

    Bonin, E. L.


    Multi-chip integrated circuit switch consists of a GaAs photon-emitting diode in close proximity with S1 phototransistor. A high current gain is obtained when the transistor has a high forward common-emitter current gain.

  4. Integral Fast Reactor concept

    International Nuclear Information System (INIS)

    Till, C.E.; Chang, Y.I.


    The Integral Fast Reactor (IFR) is an innovative LMR concept, being developed at Argonne National Laboratory, that fully exploits the inherent properties of liquid metal cooling and metallic fuel to achieve breakthroughs in economics and inherent safety. This paper describes key features and potential advantages of the IFR concept, technology development status, fuel cycle economics potential, and future development path

  5. [Promoting Research Integrity]. (United States)

    Suzuki, Hiromichi


     Japan Agency for Medical Research and Development (AMED) was launched in April 2015 to promote integrated medical research and development (R&D) ranging from basic research to practical applications, in order to smoothly achieve the nationwide application of research outcomes, and to establish an environment therefor. AMED consolidates budgets for R&D expenses, which had previously been allocated from different sources, such as the Ministry of Education, Culture, Sports, Science and Technology, the Ministry of Health, Labour and Welfare, and the Ministry of Economy, Trade and Industry. It provides funds strategically to universities, research institutions, etc. By promoting medical R&D, AMED aims to achieve the world's highest level of medical care/services to contribute to a society in which people live long and healthy lives. To achieve this mission, it is imperative that R&D funded by AMED is widely understood and supported. Maintaining and improving research integrity is a prerequisite to this end. AMED is taking various measures to ensure fair and appropriate R&D. It is asking researchers to participate in its responsible conduct in research (RCR) education program and to comply with its rules for managing conflicts of interest (COI). In addition, AMED also conducts a grant program to create and distribute a variety of educational materials on RCR and other matters. Further, AMED is establishing a platform that allows researchers to exchange information about research integrity, and it is undertaking additional measures, such as holding meetings and international symposia on research integrity.

  6. ALICE-ARC integration

    DEFF Research Database (Denmark)

    Anderlik, Csaba; Gregersen, Anders Rhod; Kleist, Josva


    Data Grid Facility (NDGF). In this paper we will present our approach to integrate AliEn and ARC, in the sense that ALICE data management and job processing can be carried out on the NDGF infrastructure, using the client tools available in AliEn. The interoperation has two aspects, one is the data...

  7. Integral Fast Reactor concept

    Energy Technology Data Exchange (ETDEWEB)

    Till, C.E.; Chang, Y.I.


    The Integral Fast Reactor (IFR) is an innovative LMR concept, being developed at Argonne National Laboratory, that fully exploits the inherent properties of liquid metal cooling and metallic fuel to achieve breakthroughs in economics and inherent safety. This paper describes key features and potential advantages of the IFR concept, technology development status, fuel cycle economics potential, and future development path.

  8. Chewing Over Physiology Integration (United States)

    Abdulkader, Fernando; Azevedo-Martins, Anna Karenina; de Arcisio Miranda, Manoel; Brunaldi, Kellen


    An important challenge for both students and teachers of physiology is to integrate the differentareas in which physiological knowledge is didactically divided. In developing countries, such an issue is even more demanding, because budget restrictions often affect the physiology program with laboratory classes being the first on the list when it…

  9. Integration in sight?

    NARCIS (Netherlands)

    Willem Huijnk; Iris Andriessen


    Orininal title: Integratie in zicht? Migration and integration top the list of social problems which worry people in the Netherlands the most. Radicalisation, the controversy surrounding the folklore figure Zwarte Piet (‘Black Pete’), the refugee crisis and ethnic profiling are just a

  10. The Integral Fast Reactor

    International Nuclear Information System (INIS)

    Till, C.E.; Chang, Y.I.; Lineberry, M.J.


    Argonne National Laboratory, since 1984, has been developing the Integral Fast Reactor (IFR). This paper will describe the way in which this new reactor concept came about; the technical, public acceptance, and environmental issues that are addressed by the IFR; the technical progress that has been made; and our expectations for this program in the near term. 5 refs., 3 figs

  11. Educational Technology: Integration? (United States)

    Christensen, Dean L.; Tennyson, Robert D.

    This paper presents a perspective of the current state of technology-assisted instruction integrating computer language, artificial intelligence (AI), and a review of cognitive science applied to instruction. The following topics are briefly discussed: (1) the language of instructional technology, i.e., programming languages, including authoring…

  12. Computation of integral bases

    NARCIS (Netherlands)

    Bauch, J.H.P.


    Let $A$ be a Dedekind domain, $K$ the fraction field of $A$, and $f\\in A[x]$ a monic irreducible separable polynomial. For a given non-zero prime ideal $\\mathfrak{p}$ of $A$ we present in this paper a new method to compute a $\\mathfrak{p}$-integral basis of the extension of $K$ determined by $f$.

  13. Computation of integral bases

    NARCIS (Netherlands)

    Bauch, J.D.


    Let A be a Dedekind domain, K the fraction field of A, and f∈. A[. x] a monic irreducible separable polynomial. For a given non-zero prime ideal p of A we present in this paper a new characterization of a p-integral basis of the extension of K determined by f. This characterization yields in an

  14. European Integration and Globalization

    Directory of Open Access Journals (Sweden)

    Diana Bobica


    Full Text Available According to many, the term globalization is able to explain any phenomenon whatsoever, be it positive or negative, that takes place within the global social system. It seems like a sort of magical formula, which is to be found in the speeches of all sorts of people, be they economists, politicians, businessmen or sociologists. However this magical formula of globalization has its limitations, since it encompasses a certain amount of quibbling, beyond which not many can pass. In the context of globalization there appears the question on its role in the process of European integration. Is European integration a part of this global process or, quite on the contrary, does it present certain distinctive features, as it moulds itself differently from the globalization phenomenon? A clear-cut answer seems difficult because of the various aspects involved. Not only the general phenomenon of globalization, but also the economic integration on European level is based on the liberalization of markets and on the opening of national economies towards the exterior,having as direct consequence the intensification of trade exchanges. If from a global point of view one may talk of a market fundamentalism in that the market principles know no boundary, European integration on the other hand implies not only market economy, but also a guided and monitored action of Member Statesaccording to the needs of the whole entity, also taking into consideration - as far as possible – all aspects and consequences on social level.

  15. Laboratories: Integrating Services

    Centers for Disease Control (CDC) Podcasts


    This podcast highlights the importance of integrating laboratory services to maximize service delivery to patients.  Created: 4/4/2011 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 4/7/2011.

  16. Integral Fast Reactor Program

    International Nuclear Information System (INIS)

    Chang, Y.I.; Walters, L.C.; Laidler, J.J.; Pedersen, D.R.; Wade, D.C.; Lineberry, M.J.


    This report summarizes highlights of the technical progress made in the Integral Fast Reactor (IFR) Program in FY 1992. Technical accomplishments are presented in the following areas of the IFR technology development activities: (1) metal fuel performance, (2) pyroprocess development, (3) safety experiments and analyses, (4) core design development, (5) fuel cycle demonstration, and (6) LMR technology R ampersand D

  17. Information Integration Architecture Development


    Faulkner, Stéphane; Kolp, Manuel; Nguyen, Duy Thai; Coyette, Adrien; Do, Thanh Tung; 16th International Conference on Software Engineering and Knowledge Engineering


    Multi-Agent Systems (MAS) architectures are gaining popularity for building open, distributed, and evolving software required by systems such as information integration applications. Unfortunately, despite considerable work in software architecture during the last decade, few research efforts have aimed at truly defining patterns and languages for designing such multiagent architectures. We propose a modern approach based on organizational structures and architectural description lan...

  18. Integrated, Continuous Emulsion Creamer. (United States)

    Cochrane, Wesley G; Hackler, Amber L; Cavett, Valerie J; Price, Alexander K; Paegel, Brian M


    Automated and reproducible sample handling is a key requirement for high-throughput compound screening and currently demands heavy reliance on expensive robotics in screening centers. Integrated droplet microfluidic screening processors are poised to replace robotic automation by miniaturizing biochemical reactions to the droplet scale. These processors must generate, incubate, and sort droplets for continuous droplet screening, passively handling millions of droplets with complete uniformity, especially during the key step of sample incubation. Here, we disclose an integrated microfluidic emulsion creamer that packs ("creams") assay droplets by draining away excess oil through microfabricated drain channels. The drained oil coflows with creamed emulsion and then reintroduces the oil to disperse the droplets at the circuit terminus for analysis. Creamed emulsion assay incubation time dispersion was 1.7%, 3-fold less than other reported incubators. The integrated, continuous emulsion creamer (ICEcreamer) was used to miniaturize and optimize measurements of various enzymatic activities (phosphodiesterase, kinase, bacterial translation) under multiple- and single-turnover conditions. Combining the ICEcreamer with current integrated microfluidic DNA-encoded library bead processors eliminates potentially cumbersome instrumentation engineering challenges and is compatible with assays of diverse target class activities commonly investigated in drug discovery.

  19. Integration of CERN staff

    CERN Multimedia

    CERN PhotoLab


    An example of the integration of CERN staff in the neighbouring communes is provided by the hamlet of Bugnon at St-Genis-Pouilly (Ain), France. The CERN installation on the Swiss site are visible on the left in the background. Behind them the Saleve mountain in Haute-Savoie.

  20. Body Integrity Identity Disorder

    NARCIS (Netherlands)

    Blom, Rianne M.; Hennekam, Raoul C.; Denys, Damiaan


    Introduction: Body Integrity Identity Disorder (BIID) is a rare, infrequently studied and highly secretive condition in which there is a mismatch between the mental body image and the physical body. Subjects suffering from BIID have an intense desire to amputate a major limb or severe the spinal

  1. Sport und soziale Integration


    Turan, Günes


    Sport und soziale Integration : Chancen, Probleme und Perspektiven für Städte und Kommunen ; Tagungsband der gleichnamigen Tagung am 28. und 29. Juni 2011 in Augsburg / Helmut Altenberger ... (Hrsg.). - Hamburg : Feldhaus, Ed. Czwalina, 2012. - 104 S. - (Sportwissenschaft und Sportpraxis ; 161)

  2. Coercion and integration

    NARCIS (Netherlands)

    Vala Elias Pimentel de Oliveira, G.


    Coercion and integration are widely used to reduce transaction costs. The threat of fines is often the most efficient way to make people pay their taxes. M&A consulting firms and the European Union exist because companies and countries perceive value in concentrating some of their functions under

  3. Integrable and superintegrable systems

    CERN Document Server


    Some of the most active practitioners in the field of integrable systems have been asked to describe what they think of as the problems and results which seem to be most interesting and important now and are likely to influence future directions. The papers in this collection, representing their authors' responses, offer a broad panorama of the subject as it enters the 1990's.

  4. Constructive algebraic integration theory

    NARCIS (Netherlands)

    Spitters, B.A.W.


    For a long time people have been trying to develop probability theory starting from ‘finite’ events rather than collections of infinite events. In this way one can find natural replacements for measurable sets and integrable functions, but measurable functions seemed to be more difficult to find. We

  5. Integrated design of MEMS

    DEFF Research Database (Denmark)

    De Grave, Arnaud; Brissaud, Daniel


    Emerging technologies of Micro-Electromechanical Systems (MEMS) are applications such as airbag accelerometers. Micro-products present many physical differences from macro-products. Moreover, there is a high level of integration in multiple fields of physics with strongly coupled effects...... industrial immersion to propose a socio-technological description of the design process and MEMS design tools....

  6. Integrated Pest Management (IPM) (United States)

    Repellents Rodenticides Other types of pesticides Disponible en español Integrated Pest Management (IPM) IPM Company: IPM is the Key - Oregon State University Extension Service Last updated May 11, 2018 Related Insecticides Natural and Biological Pesticides Repellents Rodenticides Other types of pesticides Disponible en

  7. Operational Amplifer Integrator

    NARCIS (Netherlands)

    van Tuijl, Adrianus Johannes Maria


    An integrator circuit comprises an operational amplifier which has a transistor stage (1) with an input terminal (4) and an output terminal (3), a feedback capacitor (2) connected between the input terminal (4) and the output terminal (3), and a resistor (5) connected to the input terminal (4), and

  8. TCR industrial system integration strategy

    CERN Document Server

    Bartolomé, R; Sollander, P; Martini, R; Vercoutter, B; Trebulle, M


    New turnkey data acquisition systems purchased from industry are being integrated into CERN's Technical Data Server. The short time available for system integration and the large amount of data per system require a standard and modular design. Four different integration layers have been defined in order to easily 'plug in' industrial systems. The first layer allows the integration of the equipment at the digital I/O port or fieldbus (Profibus-DP) level. A second layer permits the integration of PLCs (Siemens S5, S7 and Telemecanique); a third layer integrates equipment drivers. The fourth layer integrates turnkey mimic diagrams in the TCR operator console. The second and third layers use two new event-driven protocols based on TCP/IP. Using this structure, new systems are integrated in the data transmission chain, the layer at which they are integrated depending only on their integration capabilities.

  9. GEOSS Water Cycle Integrator (United States)

    Koike, Toshio; Lawford, Richard; Cripe, Douglas


    It is critically important to recognize and co-manage the fundamental linkages across the water-dependent domains; land use, including deforestation; ecosystem services; and food-, energy- and health-securities. Sharing coordinated, comprehensive and sustained observations and information for sound decision-making is a first step; however, to take full advantage of these opportunities, we need to develop an effective collaboration mechanism for working together across different disciplines, sectors and agencies, and thereby gain a holistic view of the continuity between environmentally sustainable development, climate change adaptation and enhanced resilience. To promote effective multi-sectoral, interdisciplinary collaboration based on coordinated and integrated efforts, the intergovernmental Group on Earth Observations (GEO) is implementing the Global Earth Observation System of Systems (GEOSS). A component of GEOSS now under development is the "GEOSS Water Cycle Integrator (WCI)", which integrates Earth observations, modeling, data and information, management systems and education systems. GEOSS/WCI sets up "work benches" by which partners can share data, information and applications in an interoperable way, exchange knowledge and experiences, deepen mutual understanding and work together effectively to ultimately respond to issues of both mitigation and adaptation. (A work bench is a virtual geographical or phenomenological space where experts and managers collaborate to use information to address a problem within that space). GEOSS/WCI enhances the coordination of efforts to strengthen individual, institutional and infrastructure capacities, especially for effective interdisciplinary coordination and integration. GEO has established the GEOSS Asian Water Cycle Initiative (AWCI) and GEOSS African Water Cycle Coordination Initiative (AfWCCI). Through regional, inter-disciplinary, multi-sectoral integration and inter-agency coordination in Asia and Africa, GEOSS

  10. Choosing the Right Systems Integration

    Directory of Open Access Journals (Sweden)

    Péči Matúš


    Full Text Available The paper examines systems integration and its main levels at higher levels of control. At present, the systems integration is one of the main aspects participating in the consolidation processes and financial flows of a company. Systems Integration is a complicated emotionconsuming process and it is often a problem to choose the right approach and level of integration. The research focused on four levels of integration, while each of them is characterized by specific conditions. At each level, there is a summary of recommendations and practical experience. The paper also discusses systems integration between the information and MES levels. The main part includes user-level integration where we describe an example of such integration. Finally, we list recommendations and also possible predictions of the systems integration as one of the important factors in the future.

  11. Integrated turbomachine oxygen plant (United States)

    Anand, Ashok Kumar; DePuy, Richard Anthony; Muthaiah, Veerappan


    An integrated turbomachine oxygen plant includes a turbomachine and an air separation unit. One or more compressor pathways flow compressed air from a compressor through one or more of a combustor and a turbine expander to cool the combustor and/or the turbine expander. An air separation unit is operably connected to the one or more compressor pathways and is configured to separate the compressed air into oxygen and oxygen-depleted air. A method of air separation in an integrated turbomachine oxygen plant includes compressing a flow of air in a compressor of a turbomachine. The compressed flow of air is flowed through one or more of a combustor and a turbine expander of the turbomachine to cool the combustor and/or the turbine expander. The compressed flow of air is directed to an air separation unit and is separated into oxygen and oxygen-depleted air.

  12. Integrated Multidisciplinary Optimization Objects (United States)

    Alston, Katherine


    OpenMDAO is an open-source MDAO framework. It is used to develop an integrated analysis and design environment for engineering challenges. This Phase II project integrated additional modules and design tools into OpenMDAO to perform discipline-specific analysis across multiple flight regimes at varying levels of fidelity. It also showcased a refined system architecture that allows the system to be less customized to a specific configuration (i.e., system and configuration separation). By delivering a capable and validated MDAO system along with a set of example applications to be used as a template for future users, this work greatly expands NASA's high-fidelity, physics-based MDAO capabilities and enables the design of revolutionary vehicles in a cost-effective manner. This proposed work complements M4 Engineering's expertise in developing modeling and simulation toolsets that solve relevant subsonic, supersonic, and hypersonic demonstration applications.

  13. Mange veje til integration

    DEFF Research Database (Denmark)

    Carøe Christiansen, Connie; Schmidt, Garbi

    I rapporten samler Socialforskningsinstituttet op på forskningen fra de seneste år omkring etniske minoriteters levevilkår og integration og belyser emner som kulturel identitet, forbrug, den kommunale integrationsindsats, børn i pasning og skole, utilpasset ungdom, boligplacering, hjemløse m.......m. Rapporten peger bl.a. på, at det kan være dårlige sociale forhold snarere end den etniske oprindelse, der er årsag til manglende integration. Rapporten ser også på, hvordan de etniske minoritetsfamilier præges og ændres af livet hér, både som udtryk for tilpasning, men også til tider som udtryk for socialt...

  14. Collective symplectic integrators

    International Nuclear Information System (INIS)

    McLachlan, Robert I; Modin, Klas; Verdier, Olivier


    We construct symplectic integrators for Lie–Poisson systems. The integrators are standard symplectic (partitioned) Runge–Kutta methods. Their phase space is a symplectic vector space equipped with a Hamiltonian action with momentum map J whose range is the target Lie–Poisson manifold, and their Hamiltonian is collective, that is, it is the target Hamiltonian pulled back by J. The method yields, for example, a symplectic midpoint rule expressed in 4 variables for arbitrary Hamiltonians on so(3) ∗ . The method specializes in the case that a sufficiently large symmetry group acts on the fibres of J, and generalizes to the case that the vector space carries a bifoliation. Examples involving many classical groups are presented. (paper)

  15. Religion, migration og integration

    DEFF Research Database (Denmark)

    Borup, Jørn


    Sammenhængen mellem religion og integration har de sidste år været genstand for debat. Artiklen kommer ind på begreber og sammenhænge relateret til området (migration, diaspora, assimilation, etnicitet, kultur) og ser på religionens mulige rolle som negativ eller positiv ressource i integrationss......Sammenhængen mellem religion og integration har de sidste år været genstand for debat. Artiklen kommer ind på begreber og sammenhænge relateret til området (migration, diaspora, assimilation, etnicitet, kultur) og ser på religionens mulige rolle som negativ eller positiv ressource i...

  16. In times of Integration

    DEFF Research Database (Denmark)

    Val, Maria Rosa Rovira; Lehmann, Martin; Zinenko, Anna

    From late last century there has been a great development of international standards and tools on environment, sustainability and corporate responsibility issues. This has been along with the globalization of economy and politics, as well as a shift in the social responsibilities of the private vis...... procedures, such as cases of for example ISO integrated management systems, mutual equivalences recognition of Global Compact-GRI-ISO26000, or the case of IIRC initiative to develop integrated reporting on an organization’s Financial, Environmental, Social and Governance performance. This paper focuses......-a-vis the public sectors. Internationally, organisations have implemented a collection of these standards to be in line with such development and to obtain or keep their licence to operate globally. After two decades of development and maturation, the scenario is now different: (i) the economic context has changed...

  17. Integrated parasite management

    DEFF Research Database (Denmark)

    Clausen, Jesper Hedegaard; Madsen, Henry; Van, Phan Thi


    communities at risk through mass drug administration. However, we argue that treatment alone will not reduce the risk from eating infected fish and that sustainable effective control must adopt an integrated FZT control approach based on education, infrastructure improvements, and management practices...... that target critical control points in the aquaculture production cycle identified from a thorough understanding of FZT and host biology and epidemiology. We present recommendations for an integrated parasite management (IPM) program for aquaculture farms.......Fishborne zoonotic trematodes (FZT) are an emerging problem and there is now a consensus that, in addition to wild-caught fish, fish produced in aquaculture present a major food safety risk, especially in Southeast Asia where aquaculture is important economically. Current control programs target...

  18. The Integral Fast Reactor

    International Nuclear Information System (INIS)

    Till, C.E.


    During the past two years, scientists from Argonne have developed an advanced breeder reactor with a closed self contained fuel cycle. The Integral Fast Reactor (IFR) is a new reactor concept, adaptable to a variety of designs, that is based on a fuel cycle radically different from the CRBR line of breeder development. The essential features of the IFR are metal fuel, pool layout, and pyro- and electro-reprocessing in a facility integral with the reactor plant. The IFR shows promise to provide an inexhaustible, safe, economic, environmentally acceptable, and diversion resistant source of nuclear power. It shows potential for major improvement in all of the areas that have led to concern about nuclear power

  19. Pedagogical integration and regionalisation

    Directory of Open Access Journals (Sweden)

    Jan Gustafsson


    Full Text Available Abstract: The purpose of this research is concerned with the intentions of pedagogical integration and the notion of an expanded concept of teaching as described in the National School Curriculum of Sweden. In the analysis a theoretical synthesis comprising critical discourse analysis and sociological theories of institutional identities and processes is used through a policy ethnography approach. Purpose has been focus on the relationship between the formal, written curriculum and specific, local, classroom practices. The analysis shows that the Pedagogical dimensions of integration were transformed toward economic interests and control at the local political level. Education work is distinctly regionalising into two so-called safety zones, and a hybrid zone. Four different pedagogical identities are also identified in the analysis. The analysis thus suggests that the creation of safety zones restricts education work to pre-existing patterns. Only the hybrid zone is presently carrying a potential to significantly renew education and encourage and social change.

  20. Performing Task Integration

    DEFF Research Database (Denmark)

    Elkjaer, Bente; Nickelsen, Niels Christian Mossfeldt

    by shared goals and knowledge as well as mutual respect and frequent, timely, accurate and problem-solving ways of communication with the purpose of dealing with the tasks at hand in an integrated way. We introduce and discuss relational coordination theory through a case-study within public healthcare....... Here cross-professional coordination of work was done by scheduled communication twice a day. When we proposed a way for further integration of tasks through an all-inclusive team organization, we were met with resistance. We use the study to discuss whether relational coordination theory is able to do...... away with differences regarding task definitions and working conditions as well as professional knowledge hierarchies and responsibilities for parts and wholes....

  1. The Integrated Renovation Process

    DEFF Research Database (Denmark)

    Galiotto, Nicolas

    and constructivist multiple criteria decision-making analysis method is selected for developing the work further. The method is introduced and applied to the renovation of a multi-residential historic building. Furthermore, a new scheme, the Integrated Renovation Process, is presented. Finally, the methodology...... is applied to two single-family homes. In practice, such a scheme allowed most informational barriers to sustainable home renovation to be overcome. The homeowners were better integrated and their preferences and immaterial values were better taken into account. They assimilated the multiple benefits...... to keep the decision making process economically viable and timely, the process still needs to be improved and new tools need to be developed....

  2. Integrating over Higgs branches

    International Nuclear Information System (INIS)

    Moore, G.; Shatashvili, S.


    We develop some useful techniques for integrating over Higgs branches in supersymmetric theories with 4 and 8 supercharges. In particular, we define a regularized volume for hyperkaehler quotients. We evaluate this volume for certain ALE and ALF spaces in terms of the hyperkaehler periods. We also reduce these volumes for a large class of hyperkaehler quotients to simpler integrals. These quotients include complex coadjoint orbits, instanton moduli spaces on R 4 and ALE manifolds, Hitchin spaces, and moduli spaces of (parabolic) Higgs bundles on Riemann surfaces. In the case of Hitchin spaces the evaluation of the volume reduces to a summation over solutions of Bethe ansatz equations for the non-linear Schroedinger system. We discuss some applications of our results. (orig.)

  3. Integrated mobile robot control (United States)

    Amidi, Omead; Thorpe, Chuck E.


    This paper describes the strucwre implementation and operation of a real-time mobile robot controller which integrates capabilities such as: position estimation path specification and hacking human interfaces fast communication and multiple client support The benefits of such high-level capabilities in a low-level controller was shown by its implementation for the Naviab autonomous vehicle. In addition performance results from positioning and tracking systems are reported and analyzed.

  4. Integrated Reporting: Who Cares?


    Cheok, Mei-Ing


    Integrated reporting (IR) is the latest in the evolution of corporate social and environmental disclosures. It seeks the holy grail of gaining mainstream acceptance in the investment community. I investigate and compare the perceptions of the investment community (considered IR’s primary target audience), sustainability experts and internal stakeholders (report producers), using Unilever as a case study. In this research, I find that while IR can help them make better long-term investment or ...

  5. Integrated crisis management exercises

    International Nuclear Information System (INIS)

    Callen, R.B.; DeHart, R.E.


    This paper describes some of the steps that Mobil has taken to enhance their crisis management capability and to improve their readiness. The approach stretches from the individual plant level to Mobil's Corporate offices in Fairfax, Virginia. Some of the lessons learned from several integrated crisis management exercises are outlined and some areas where additional industry co-operation in crisis management could pay dividends are suggested

  6. Integrated circuit structure

    International Nuclear Information System (INIS)


    The invention describes the fabrication of integrated circuit structures, such as read-only memory components of field-effect transistors, which may be fabricated and then maintained in inventory, and later selectively modified in accordance with a desired pattern. It is claimed that MOS depletion-mode devices in accordance with the invention can be fabricated at lower cost and at higher yields. (U.K.)

  7. Integrable scalar cosmologies

    International Nuclear Information System (INIS)

    Fré, P.; Sorin, A.S.; Trigiante, M.


    The question whether the integrable one-field cosmologies classified in a previous paper by Fré, Sagnotti and Sorin can be embedded as consistent one-field truncations into Extended Gauged Supergravity or in N=1 supergravity gauged by a superpotential without the use of D-terms is addressed in this paper. The answer is that such an embedding is very difficult and rare but not impossible. Indeed, we were able to find two examples of integrable models embedded in supergravity in this way. Both examples are fitted into N=1 supergravity by means of a very specific and interesting choice of the superpotential W(z). The question whether there are examples of such an embedding in Extended Gauged Supergravity remains open. In the present paper, relying on the embedding tensor formalism we classified all gaugings of the N=2 STU model, confirming, in the absence on hypermultiplets, the uniqueness of the stable de Sitter vacuum found several years ago by Fré, Trigiante and Van Proeyen and excluding the embedding of any integrable cosmological model. A detailed analysis of the space of exact solutions of the first supergravity-embedded integrable cosmological model revealed several new features worth an in-depth consideration. When the scalar potential has an extremum at a negative value, the Universe necessarily collapses into a Big Crunch notwithstanding its spatial flatness. The causal structure of these Universes is quite different from that of the closed, positive curved, Universe: indeed, in this case the particle and event horizons do not coincide and develop complicated patterns. The cosmological consequences of this unexpected mechanism deserve careful consideration

  8. Measure and integration

    CERN Document Server

    Bercovici, Hari; Pearcy, Carl


    This book covers the material of a one year course in real analysis. It includes an original axiomatic approach to Lebesgue integration which the authors have found to be effective in the classroom. Each chapter contains numerous examples and an extensive problem set which expands considerably the breadth of the material covered in the text. Hints are included for some of the more difficult problems. .

  9. Integrated Microwave Photonics


    Marpaung, David; Roeloffzen, Chris; Heideman, René; Leinse, Arne; Sales Maicas, Salvador; Capmany Francoy, José


    Microwave photonics (MWP) is an emerging field in which radio frequency (RF) signals are generated, distributed, processed and analyzed using the strength of photonic techniques. It is a technology that enables various functionalities which are not feasible to achieve only in the microwave domain. A particular aspect that recently gains significant interests is the use of photonic integrated circuit (PIC) technology in the MWP field for enhanced functionalities and robustness as well as the r...

  10. Integrated Circuit Immunity (United States)

    Sketoe, J. G.; Clark, Anthony


    This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

  11. Integrated coincidence circuits

    International Nuclear Information System (INIS)

    Borejko, V.F.; Grebenyuk, V.M.; Zinov, V.G.


    The description is given of two coincidence units employing integral circuits in the VISHNYA standard. The units are distinguished for the coincidence selection element which is essentially a combination of a tunnel diode and microcircuits. The output fast response of the units is at least 90 MHz in the mode of the output signal unshaped in duration and 50 MHz minimum in the mode of the output signal shaping. The resolution time of the units is dependent upon the duration of input signals

  12. FRAPCON-3: Integral assessment

    Energy Technology Data Exchange (ETDEWEB)

    Lanning, D.D.; Berna, G.A.; Berna, G.A.


    An integral assessment has been performed for the U.S. Nuclear Regulatory Commission by Pacific Northwest National Laboratory to quantify the predictive capabilities of FRAPCON-3, a steady-state fuel behavior code designed to analyze fuel behavior from beginning-of-life to burnup levels of 65 GWd/MTU. FRAPCON-3 code calculations are shown to compare satisfactorily to a pre-selected set of experimental data with steady-state operating conditions. 30 refs., 27 figs., 18 tabs.

  13. Integrated and interprofessional care

    Directory of Open Access Journals (Sweden)

    Hugh Barr


    Full Text Available No wonder two movements described in such similar terms are so often confused. One strives to knit services together, the other to cultivate collaborative practice amongst their workers.  Dedicated though both of them are to the improvement of health and social care, integrated care falters without engaging the workforce actively as partners in change whilst interprofessional care falters without organisational support. Neither stands alone. Each depends on the other.

  14. Integral fast reactor

    International Nuclear Information System (INIS)

    Chang, Y.I.


    The Integral Fast Reactor (IFR) is an innovative liquid metal reactor concept being developed at Argonne National Laboratory. It seeks to specifically exploit the inherent properties of liquid metal cooling and metallic fuel in a way that leads to substantial improvements in the characteristics of the complete reactor system. This paper describes the key features and potential advantages of the IFR concept, with emphasis on its safety characteristics

  15. Regularization of divergent integrals


    Felder, Giovanni; Kazhdan, David


    We study the Hadamard finite part of divergent integrals of differential forms with singularities on submanifolds. We give formulae for the dependence of the finite part on the choice of regularization and express them in terms of a suitable local residue map. The cases where the submanifold is a complex hypersurface in a complex manifold and where it is a boundary component of a manifold with boundary, arising in string perturbation theory, are treated in more detail.

  16. Technical Assessment: Integrated Photonics (United States)


    and resources we routinely demand are predicated on the delivery of high-bandwidth services. At the same time, new computing paradigms such as cloud ...state of the art IPCs onshore. Recommendation 11: Continue to implement policies designed to ensure production integrity of IPC technology. This...operators include both content providers such as Netflix, and Amazon , and neutral providers such as Digital Realty, Equinix, and Rackspace. Cloud operators

  17. The Integral Fast Reactor

    International Nuclear Information System (INIS)

    Chang, Y.I.


    The Integral Fast Reactor (IFR) is an innovative liquid metal reactor concept being developed at Argonne National Laboratory. It seeks to specifically exploit the inherent properties of liquid metal cooling and metallic fuel in a way that leads to substantial improvements in the characteristics of the complete reactor system. This paper describes the key features and potential advantages of the IFR concept, with emphasis on its safety characteristics. 3 refs., 4 figs., 1 tab

  18. Integrative Bioengineering Institute

    Energy Technology Data Exchange (ETDEWEB)

    Eddington, David; Magin,L,Richard; Hetling, John; Cho, Michael


    Microfabrication enables many exciting experimental possibilities for medicine and biology that are not attainable through traditional methods. However, in order for microfabricated devices to have an impact they must not only provide a robust solution to a current unmet need, but also be simple enough to seamlessly integrate into standard protocols. Broad dissemination of bioMEMS has been stymied by the common aim of replacing established and well accepted protocols with equally or more complex devices, methods, or materials. The marriage of a complex, difficult to fabricate bioMEMS device with a highly variable biological system is rarely successful. Instead, the design philosophy of my lab aims to leverage a beneficial microscale phenomena (e.g. fast diffusion at the microscale) within a bioMEMS device and adapt to established methods (e.g. multiwell plate cell culture) and demonstrate a new paradigm for the field (adapt instead of replace). In order for the field of bioMEMS to mature beyond novel proof-of-concept demonstrations, researchers must focus on developing systems leveraging these phenomena and integrating into standard labs, which have largely been ignored. Towards this aim, the Integrative Bioengineering Institute has been established.

  19. Integral geometry and valuations

    CERN Document Server

    Solanes, Gil


    Valuations are finitely additive functionals on the space of convex bodies. Their study has become a central subject in convexity theory, with fundamental applications to integral geometry. In the last years there has been significant progress in the theory of valuations, which in turn has led to important achievements in integral geometry. This book originated from two courses delivered by the authors at the CRM and provides a self-contained introduction to these topics, covering most of the recent advances. The first part, by Semyon Alesker, is devoted to the theory of convex valuations, with emphasis on the latest developments. A special focus is put on the new fundamental structures of the space of valuations discovered after Alesker's irreducibility theorem. Moreover, the author describes the newly developed theory of valuations on manifolds. In the second part, Joseph H. G. Fu gives a modern introduction to integral geometry in the sense of Blaschke and Santaló, based on the notions and tools presented...

  20. Integral Perspective on Happiness

    Directory of Open Access Journals (Sweden)

    Joonas Uotinen


    Full Text Available A happiness science has emerged amidst, and spans, the social sciences. This research, despite the long philosophical tradition on happiness, is in its infancy and a robust theory of happiness is called for. I will review parts of the literature and some of the main happiness theories using Ken Wilber’s Integral approach. I will concentrate largely on Aristotle’s eudaimonia, as that has re-emerged into the centre of happiness discussions as a possible contender for the prevailing subjective happiness theories. The Integral approach seems to provide valuable insights into many happiness theories, juxtapose them in a comprehensible way, pinpoint deficiencies, and propose enhancements. Amongst other things, I will propose a new happiness theory combining John Kekes’ happiness theory with ecological ethics and I will conclude that enlightenment proves to be a good candidate for the ultimate good, or summum bonum, I will enlarge on Aristotle’s theory and propose that Wilber’s theory provides an ‘Integral road map towards eudaimonia enhanced – the enlightenment’. I will argue that eudaimonia and enlightenment, though superficially dissimilar, accord in surprising ways, to a great extent. I will discuss whether the discussion of happiness and morality is critically biased, and I will discuss the societal implications that Wilber’s conception of the human might have through its implications for happiness theories.

  1. Integrated optoelectronic oscillator. (United States)

    Tang, Jian; Hao, Tengfei; Li, Wei; Domenech, David; Baños, Rocio; Muñoz, Pascual; Zhu, Ninghua; Capmany, José; Li, Ming


    With the rapid development of the modern communication systems, radar and wireless services, microwave signal with high-frequency, high-spectral-purity and frequency tunability as well as microwave generator with light weight, compact size, power-efficient and low cost are increasingly demanded. Integrated microwave photonics (IMWP) is regarded as a prospective way to meet these demands by hybridizing the microwave circuits and the photonics circuits on chip. In this article, we propose and experimentally demonstrate an integrated optoelectronic oscillator (IOEO). All of the devices needed in the optoelectronic oscillation loop circuit are monolithically integrated on chip within size of 5×6cm 2 . By tuning the injection current to 44 mA, the output frequency of the proposed IOEO is located at 7.30 GHz with phase noise value of -91 dBc/Hz@1MHz. When the injection current is increased to 65 mA, the output frequency can be changed to 8.87 GHz with phase noise value of -92 dBc/Hz@1MHz. Both of the oscillation frequency can be slightly tuned within 20 MHz around the center oscillation frequency by tuning the injection current. The method about improving the performance of IOEO is carefully discussed at the end of in this article.

  2. Mechanical integrity of canisters

    International Nuclear Information System (INIS)

    Nilsson, Fred


    This document constitutes the final report from 'SKBs reference group for mechanical integrity of canisters for spent nuclear fuel'. A complete list of all reports initiated by the reference group can be found in the summary report in this document. The main task of the reference group has been to advice SKB regarding the choice (ranking of alternatives) of canister type for different types of storage. The choice should be based on requirements of impermeability for a given time period and identification of possible limiting mechanisms. The main conclusions from the work were: From mechanical point of view, low phosphorous oxygen free copper (Cu-OFP) is a preferred canisters material. It exhibits satisfactory ductility both during tensile and creep testing. The residual stresses in the canisters are of such a magnitude that the estimated time to creep rupture with the data obtained for the Cu-OFP material is essentially infinite. Based on the present knowledge of stress corrosion cracking of copper there appears to be a small risk for such to occur in the projected environment. This risk need some further study. Rock shear movements of the size of 10 cm should pose no direct threat to the integrity of the canisters. Considering mechanical integrity, the composite copper/steel canister is an advantageous alternative. The recommendations for further research included continued studies of the creep properties of copper and of stress corrosion cracking. However, the studies should focus more directly on the design and fabrication aspect of the canister


    Directory of Open Access Journals (Sweden)



    Full Text Available In the context of the European population aging trend, and while the birth rate is still at a low level, the immigrants may contribute to the support of the EU economy and to finance the national social protection systems. But this would be possible only if they have been fully integrated in the host countries, the integration policies being a task of the national governments. The European Union may still offer support and stimulation through financing, policies coordination and good practices exchange facilitation. The new measures should encourage local level actions, including cooperation between local authorities, employers, migrants’ organizations, service providers and local population. Within the EU, there live 20.1 million immigrants (approximately 4% of the entire population coming from outside European area. An important element of the common EU policy on immigration is the one regarding the development of a policy on immigrants’ integration, which should provide a fair treatment within the member states, and guarantee rights and obligations comparable with the ones of the Union citizens.

  4. The INTEGRAL mission

    DEFF Research Database (Denmark)

    Winkler, C.; Courvoisier, T.J.L.; Di Cocco, G.


    in the X-ray (3-35 keV) and optical (V-band, 550 nm) energy ranges. INTEGRAL carries two main gamma-ray instruments, the spectrometer SPI (Vedrenne et al. 2003)-optimized for the high-resolution gamma-ray line spectroscopy (20 keV-8 MeV), and the imager IBIS (Ubertini et al. 2003)-optimized for high......The ESA observatory INTEGRAL (International Gamma-Ray Astrophysics Laboratory) is dedicated to the fine spectroscopy (2.5 keV FWHM @ 1 MeV) and fine imaging (angular resolution: 12 arcmin FWHM) of celestial gamma-ray sources in the energy range 15 keV to 10 MeV with concurrent source monitoring...... Centre at ESTEC and the Science Data Centre near Geneva. INTEGRAL was launched on 17 October 2002. The observing programme is well underway and sky exposure (until June 2003) reaches similar to1800 ks in the Galactic plane. The prospects are excellent for the scientific community to observe the high...

  5. Integrated genetic analysis microsystems

    International Nuclear Information System (INIS)

    Lagally, Eric T; Mathies, Richard A


    With the completion of the Human Genome Project and the ongoing DNA sequencing of the genomes of other animals, bacteria, plants and others, a wealth of new information about the genetic composition of organisms has become available. However, as the demand for sequence information grows, so does the workload required both to generate this sequence and to use it for targeted genetic analysis. Microfabricated genetic analysis systems are well poised to assist in the collection and use of these data through increased analysis speed, lower analysis cost and higher parallelism leading to increased assay throughput. In addition, such integrated microsystems may point the way to targeted genetic experiments on single cells and in other areas that are otherwise very difficult. Concomitant with these advantages, such systems, when fully integrated, should be capable of forming portable systems for high-speed in situ analyses, enabling a new standard in disciplines such as clinical chemistry, forensics, biowarfare detection and epidemiology. This review will discuss the various technologies available for genetic analysis on the microscale, and efforts to integrate them to form fully functional robust analysis devices. (topical review)

  6. Counting master integrals. Integration by parts vs. functional equations

    International Nuclear Information System (INIS)

    Kniehl, Bernd A.; Tarasov, Oleg V.


    We illustrate the usefulness of functional equations in establishing relationships between master integrals under the integration-by-parts reduction procedure by considering a certain two-loop propagator-type diagram as an example.

  7. Energy Systems Integration Facility News | Energy Systems Integration (United States)

    Facility | NREL Energy Systems Integration Facility News Energy Systems Integration Facility Energy Dataset A massive amount of wind data was recently made accessible online, greatly expanding the Energy's National Renewable Energy Laboratory (NREL) has completed technology validation testing for Go

  8. Integrated care: theory to practice. (United States)

    Stokes, Jonathan; Checkland, Kath; Kristensen, Søren Rud


    'Integrated care' is pitched as the solution to current health system challenges. In the literature, what integrated care actually involves is complex and contested. Multi-disciplinary team case management is frequently the primary focus of integrated care when implemented internationally. We examine the practical application of integrated care in the NHS in England to exemplify the prevalence of the case management focus. We look at the evidence for effectiveness of multi-disciplinary team case management, for the focus on high-risk groups and for integrated care more generally. We suggest realistic expectations of what integration of care alone can achieve and additional research questions. © The Author(s) 2016.

  9. Integration of European Bond Markets

    DEFF Research Database (Denmark)

    Christiansen, Charlotte


    I investigate the time variation in the integration of EU government bond markets. The integration is measured by the explanatory power of European factor portfolios for the individual bond markets for each year. The integration of the government bond markets is stronger for EMU than non-EMU memb......I investigate the time variation in the integration of EU government bond markets. The integration is measured by the explanatory power of European factor portfolios for the individual bond markets for each year. The integration of the government bond markets is stronger for EMU than non...

  10. Quantum measure and integration theory

    International Nuclear Information System (INIS)

    Gudder, Stan


    This article begins with a review of quantum measure spaces. Quantum forms and indefinite inner-product spaces are then discussed. The main part of the paper introduces a quantum integral and derives some of its properties. The quantum integral's form for simple functions is characterized and it is shown that the quantum integral generalizes the Lebesgue integral. A bounded, monotone convergence theorem for quantum integrals is obtained and it is shown that a Radon-Nikodym-type theorem does not hold for quantum measures. As an example, a quantum-Lebesgue integral on the real line is considered.

  11. ASEAN: perspectives on economic integration: ASEAN in Asia economic integration


    Shaobang Kang


    Asia is one continent which has the most dynamic and the fastest developing economies in the world. But Asia’s economic integration is developing too slowly and stands at the lowest level in the world. Many factors have affected Asia’s economic integration but, in the current global financial and economic crisis, it is necessary to strengthen Asian countries’ cooperation in finance, investment and trade to promote Asia’s economic integration. As the healthiest and most integrated regional org...

  12. Renewable Electricity-to-Grid Integration | Energy Systems Integration (United States)

    Facility | NREL Renewable Electricity-to-Grid Integration Renewable Electricity-to-Grid Integration NREL works with industry partners to optimize strategies for effectively interconnecting renewable renewable electric grid integration work includes research and development (R&D) on advanced inverters

  13. Energy Systems Integration News - October 2016 | Energy Systems Integration (United States)

    Facility | NREL October 2016 Energy Systems Integration News A monthly recap of the latest energy systems integration (ESI) developments at NREL and around the world. Subscribe Archives October Integration Facility's main control room. OMNETRIC Group Demonstrates a Distributed Control Hierarchy for

  14. Energy Systems Integration News | Energy Systems Integration Facility | (United States)

    the Energy Systems Integration Facility as part of NREL's work with SolarCity and the Hawaiian Electric Companies. Photo by Amy Glickson, NREL Welcome to Energy Systems Integration News, NREL's monthly date on the latest energy systems integration (ESI) developments at NREL and worldwide. Have an item

  15. An integrating factor matrix method to find first integrals

    International Nuclear Information System (INIS)

    Saputra, K V I; Quispel, G R W; Van Veen, L


    In this paper we develop an integrating factor matrix method to derive conditions for the existence of first integrals. We use this novel method to obtain first integrals, along with the conditions for their existence, for two- and three-dimensional Lotka-Volterra systems with constant terms. The results are compared to previous results obtained by other methods.

  16. From integrated control to integrated farming, an experimental approach

    NARCIS (Netherlands)

    Vereijken, P.H.


    Integrated control or integrated pest management (IPM), as envisaged originally, is not being practised to any large extent in arable farming, notwithstanding considerable research efforts. The reasons for this are discussed. A more basic approach called integrated farming is suggested. Preliminary

  17. Transistor and integrated circuit manufacture

    International Nuclear Information System (INIS)

    Colman, D.


    This invention relates to the manufacture of transistors and integrated circuits by ion bombardment techniques and is particularly, but not exclusively, of value in the manufacture of so-called integrated injection logic circuitry. (author)

  18. Perceptual integration without conscious access. (United States)

    Fahrenfort, Johannes J; van Leeuwen, Jonathan; Olivers, Christian N L; Hogendoorn, Hinze


    The visual system has the remarkable ability to integrate fragmentary visual input into a perceptually organized collection of surfaces and objects, a process we refer to as perceptual integration. Despite a long tradition of perception research, it is not known whether access to consciousness is required to complete perceptual integration. To investigate this question, we manipulated access to consciousness using the attentional blink. We show that, behaviorally, the attentional blink impairs conscious decisions about the presence of integrated surface structure from fragmented input. However, despite conscious access being impaired, the ability to decode the presence of integrated percepts remains intact, as shown through multivariate classification analyses of electroencephalogram (EEG) data. In contrast, when disrupting perception through masking, decisions about integrated percepts and decoding of integrated percepts are impaired in tandem, while leaving feedforward representations intact. Together, these data show that access consciousness and perceptual integration can be dissociated.

  19. Best Practice: Integrated Marketing Communications


    Schultz, Don; Macdonald, Emma K.; Baines, Paul R.


    Integrated marketing communications can substantially improve target audience reception, message resonance, and positive behavioural response but, to reach its true potential, the process requires a strong focus on data integration/customer insight.

  20. Regioinal Economic Integration in Africa ...

    African Journals Online (AJOL)


    At the third stage of economic integration common market is formed whereby, not only trade ..... Despite the long history of regional integration efforts in the continent, the level of ...... This enhances the feelings and thoughts of belongingness to.

  1. Integral Presentations of Catalan Numbers (United States)

    Dana-Picard, Thierry


    We compute in three different ways the same definite parametric integral. By-products are the derivation of a combinatorial identity and two integral presentations of Catalan numbers. One of them leads to a presentation using the [gamma] function.

  2. Knowledge integration by thinking along

    NARCIS (Netherlands)

    Berends, J.J.; Debackere, K.; Garud, R.; Weggeman, M.C.D.P.


    Organizing depends on the integration of specialized knowledge that lies distributed across individuals. There are benefits from specialization, and, yet, the integration of knowledge across boundaries is critical for organizational vitality. How do organizations benefit from knowledge that lies in

  3. Common Systems Integration Lab (CSIL) (United States)

    Federal Laboratory Consortium — The Common Systems Integration Lab (CSIL)supports the PMA-209 Air Combat Electronics Program Office. CSIL also supports development, test, integration and life cycle...

  4. Human-Systems Integration Processes (United States)

    National Aeronautics and Space Administration — The goal of this project is to baseline a Human-Systems Integration Processes (HSIP) document as a companion to the NASA-STD-3001 and Human Integration Design...

  5. Integrated Factors Correlating Undergraduate Academic ...

    African Journals Online (AJOL)

    Integrated Factors Correlating Undergraduate Academic Achievement in Bayelsa State, Nigeria. ... AFRREV IJAH: An International Journal of Arts and Humanities ... Thus, it is study investigated the integrated factors determining academic performance of students in public secondary schools in Bayelsa State, Nigeria.

  6. Transistor and integrated circuit manufacture

    Energy Technology Data Exchange (ETDEWEB)

    Colman, D


    This invention relates to the manufacture of transistors and integrated circuits by ion bombardment techniques and is particularly, but not exclusively, of value in the manufacture of so-called integrated injection logic circuitry.

  7. Integrated Compliance Information System (ICIS) (United States)

    U.S. Environmental Protection Agency — The purpose of ICIS is to meet evolving Enforcement and Compliance business needs for EPA and State users by integrating information into a single integrated data...

  8. Domains of bosonic functional integrals

    International Nuclear Information System (INIS)

    Botelho, Luiz C.L.; Para Univ., Belem, PA


    We propose a mathematical framework for bosonic Euclidean quantum field functional integrals based on the theory of integration on the dual algebraic vector space of classical field sources. We present a generalization of the Minlos-Dao Xing theorem and apply it to determine exactly the domain of integration associated to the functional integral representation of the two-dimensional quantum electrodynamics Schwinger generating functional. (author)

  9. Statistical Methods in Integrative Genomics (United States)

    Richardson, Sylvia; Tseng, George C.; Sun, Wei


    Statistical methods in integrative genomics aim to answer important biology questions by jointly analyzing multiple types of genomic data (vertical integration) or aggregating the same type of data across multiple studies (horizontal integration). In this article, we introduce different types of genomic data and data resources, and then review statistical methods of integrative genomics, with emphasis on the motivation and rationale of these methods. We conclude with some summary points and future research directions. PMID:27482531

  10. A successful integrated project. (United States)

    Zheng, P


    The experiences of the Juxian County Family Planning Committee of Shandong Province, China, were discussed in terms of the integration of family planning with income generation activities in rural areas. The integrated program was initiated in 1988 with pilot programs established by the Qiaoshan Family Planning Association to develop marketable skills in carpet weaving and grass braiding in Xiazhuang Town and Qiaoshan Township. The program gave priority of admission to women with only children and those who practiced family planning. 1400 women were recruited in these factories. Other income generation programs were developed for silkworm breeding and silk reeling, woolen embroidery, and printing. High ranking officials of the China Family Planning Association commended the work in income generation and family planning in Juxian County. This recognition spurred the second phase of development by the county family planning association: the establishment of village operated factories and mills for native products. By the end of 1991, there were 26 such projects in the county and per capita income to women increased by RMB 678 yuan. In the third stage of 1992, the number of association enterprises increased to 196 with recruitment of over 18,000 reproductive age women. The programs were initiated with collective funds from farmers and villages. The 170 projects in 1992 were developed with an investment of 9.6 million yuan, of which 2.26 million yuan was from individuals (23.5%). Emphasis was placed on self-reliance and recruitment of women with one child, women with 2 daughters and tubal ligations, and family planning motivators. The consequences of the integrated program were weakening traditional customs of marriage and childbearing, improvement in socioeconomic status of women, and effective service delivery of family planning and maternal and child health care services.

  11. Frontal Integration and Coping

    DEFF Research Database (Denmark)

    Larsen, Torben


    reciprocal to Mesolimbic dopamine activity (mood). The study aims to explore interpersonal differences in coping associated with neural properties. Method: Neuroeconomic literature search of how neural centers of Rc2/L shape risk attitude2 or coping. Results: General risk attitude is a right skewed...... to the classical tempers. In prospect, differentiating the Frontal integration pattern by temper (General risk attitude) opens an evidence-based pathway for individually tailored neural training towards advanced social objectives as multidisciplinary collaboration and healthy living. References 1. Larsen T...

  12. An integrated CANDU system

    International Nuclear Information System (INIS)

    Donnelly, J.


    Twenty years of experience have shown that the early choices of heavy water as moderator and natural uranium as fuel imposed a discipline on CANDU design that has led to outstanding performance. The integrated structure of the industry in Canada, incorporating development, design, supply, manufacturing, and operation functions, has reinforced this performance and has provided a basis on which to continue development in the future. These same fundamental characteristics of the CANDU program open up propsects for further improvements in economy and resource utilization through increased reactor size and the development of the thorium fuel cycle

  13. On an integral transform

    Directory of Open Access Journals (Sweden)

    D. Naylor


    Full Text Available A formula of inversion is established for an integral transform whose kernel is the Bessel function Ju(kr where r varies over the finite interval (0,a and the order u is taken to be the eigenvalue parameter. When this parameter is large the Bessel function behaves for varying r like the power function ru and by relating the Bessel functions to their corresponding power functions the proof of the inversion formula can be reduced to one depending on the Mellin inversion theorem.

  14. Dips spacecraft integration issues

    International Nuclear Information System (INIS)

    Determan, W.R.; Harty, R.B.


    The Department of Energy, in cooperation with the Department of Defense, has recently initiated the dynamic isotope power system (DIPS) demonstration program. DIPS is designed to provide 1 to 10 kW of electrical power for future military spacecraft. One of the near-term missions considered as a potential application for DIPS was the boost surveillance and tracking system (BSTS). A brief review and summary of the reasons behind a selection of DIPS for BSTS-type missions is presented. Many of these are directly related to spacecraft integration issues; these issues will be reviewed in the areas of system safety, operations, survivability, reliability, and autonomy

  15. Integrated material accountancy system

    International Nuclear Information System (INIS)

    Calabozo, M.; Buiza, A.


    In this paper we present the system that we are actually using for Nuclear Material Accounting and Manufacturing Management in our UO 2 Fuel Fabrication Plant located at Juzbado, Salamanca, Spain. The system is based mainly on a real time data base which gather data for all the operations performed in our factory from UO 2 powder reception to fuel assemblies shipment to the customers. The accountancy is just an important part of the whole integrated system covering all the aspects related to manufacturing: planning, traceability, Q.C. analysis, production control and accounting data

  16. An Integrated Desgin Process

    DEFF Research Database (Denmark)

    Petersen, Mads Dines; Knudstrup, Mary-Ann


    Present paper is placed in the discussion about how sustainable measures are integrated in the design process by architectural offices. It presents results from interviews with four leading Danish architectural offices working with sustainable architecture and their experiences with it, as well...... as the requirements they meet in terms of how to approach the design process – especially focused on the early stages like a competition. The interviews focus on their experiences with working in multidisciplinary teams and using digital tools to support their work with sustainable issues. The interviews show...... the environmental measures cannot be discarded due to extra costs....

  17. An Integrated Design Process

    DEFF Research Database (Denmark)

    Petersen, Mads Dines; Knudstrup, Mary-Ann


    Present paper is placed in the discussion about how sustainable measures are integrated in the design process by architectural offices. It presents results from interviews with four leading Danish architectural offices working with sustainable architecture and their experiences with it, as well...... as the requirements they meet in terms of how to approach the design process – especially focused on the early stages like a competition. The interviews focus on their experiences with working in multidisciplinary teams and using digital tools to support their work with sustainable issues. The interviews show...... the environmental measures cannot be discarded due to extra costs....

  18. Continuous Integration in CFMGR

    CERN Document Server

    Frohlingsdorf, David


    Cfmgr is a managing tool for network devices. At the moment there is no way to automatically check the working behaviour of the tool, meaning that a lot of effort is spend into manually testing the tool after an update. During my stay at CERN I developed a black-box testing framework for Cfmgr according to Continuous Integration practices and successfully deployed the framework using Jenkins and Docker. This report discusses in detail how the framework works and how it can be configured, and equally gives a broad problem description and outlines future work directions.

  19. Integrated circuit cell library (United States)

    Whitaker, Sterling R. (Inventor); Miles, Lowell H. (Inventor)


    According to the invention, an ASIC cell library for use in creation of custom integrated circuits is disclosed. The ASIC cell library includes some first cells and some second cells. Each of the second cells includes two or more kernel cells. The ASIC cell library is at least 5% comprised of second cells. In various embodiments, the ASIC cell library could be 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more comprised of second cells.

  20. Nano integrated circuit process

    International Nuclear Information System (INIS)

    Yoon, Yung Sup


    This book contains nine chapters, which are introduction of manufacture of semiconductor chip, oxidation such as Dry-oxidation, wet oxidation, oxidation model and oxide film, diffusion like diffusion process, diffusion equation, diffusion coefficient and diffusion system, ion implantation, including ion distribution, channeling, multiimplantation and masking and its system, sputtering such as CVD and PVD, lithography, wet etch and dry etch, interconnection and flattening like metal-silicon connection, silicide, multiple layer metal process and flattening, an integrated circuit process, including MOSFET and CMOS.

  1. Scientific integrity in Brazil. (United States)

    Lins, Liliane; Carvalho, Fernando Martins


    This article focuses on scientific integrity and the identification of predisposing factors to scientific misconduct in Brazil. Brazilian scientific production has increased in the last ten years, but the quality of the articles has decreased. Pressure on researchers and students for increasing scientific production may contribute to scientific misconduct. Cases of misconduct in science have been recently denounced in the country. Brazil has important institutions for controlling ethical and safety aspects of human research, but there is a lack of specific offices to investigate suspected cases of misconduct and policies to deal with scientific dishonesty.

  2. Regulated functions and integrability

    Directory of Open Access Journals (Sweden)

    Ján Gunčaga


    Full Text Available Properties of functions defined on a bounded closed interval, weaker than continuity, have been considered by many mathematicians. Functions having both sides limits at each point are called regulated and were considered by J. Dieudonné [2], D. Fraňková [3] and others (see for example S. Banach [1], S. Saks [8]. The main class of functions we deal with consists of piece-wise constant ones. These functions play a fundamental role in the integration theory which had been developed by Igor Kluvanek (see Š. Tkacik [9]. We present an outline of this theory.

  3. Linear integrated circuits

    CERN Document Server

    Carr, Joseph


    The linear IC market is large and growing, as is the demand for well trained technicians and engineers who understand how these devices work and how to apply them. Linear Integrated Circuits provides in-depth coverage of the devices and their operation, but not at the expense of practical applications in which linear devices figure prominently. This book is written for a wide readership from FE and first degree students, to hobbyists and professionals.Chapter 1 offers a general introduction that will provide students with the foundations of linear IC technology. From chapter 2 onwa

  4. Nano integrated circuit process

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Yung Sup


    This book contains nine chapters, which are introduction of manufacture of semiconductor chip, oxidation such as Dry-oxidation, wet oxidation, oxidation model and oxide film, diffusion like diffusion process, diffusion equation, diffusion coefficient and diffusion system, ion implantation, including ion distribution, channeling, multiimplantation and masking and its system, sputtering such as CVD and PVD, lithography, wet etch and dry etch, interconnection and flattening like metal-silicon connection, silicide, multiple layer metal process and flattening, an integrated circuit process, including MOSFET and CMOS.

  5. The Integration of Knowledge

    Directory of Open Access Journals (Sweden)

    Carlos Blanco


    Full Text Available The exponential growth of knowledge demands an interdisciplinary reflection on how to integrate the different branches of the natural sciences and the humanities into a coherent picture of world, life, and mind. Insightful intellectual tools, like evolutionary Biology and Neuroscience, can facilitate this project. It is the task of Philosophy to identify those fundamental concepts whose explanatory power can illuminate the thread that leads from the most elementary realities to the most complex spheres. This article aims to explore the importance of the ideas of conservation, selection, and unification for achieving the goal.

  6. Integrable billiards and quadrics

    Energy Technology Data Exchange (ETDEWEB)

    Dragovic, Vladimir I; Radnovic, Milena [Mathematical Institute, Serbian Academy of Sciences and Arts, Belgrad (Serbia)


    Billiards inside quadrics are considered as integrable dynamical systems with a rich geometric structure. The two-way interaction between the dynamics of billiards and the geometry of pencils of quadrics in an arbitrary dimension is considered. Several well-known classical and modern genus-1 results are generalized to arbitrary dimension and genus, such as: the Poncelet theorem, the Darboux theorem, the Weyr theorem, and the Griffiths-Harris space theorem. A synthetic approach to higher-genera addition theorems is presented. Bibliography: 77 titles.

  7. Integral Combinations of Heavisides

    Czech Academy of Sciences Publication Activity Database

    Kainen, P.C.; Kůrková, Věra; Vogt, A.


    Roč. 283, č. 6 (2010), s. 854-878 ISSN 0025-584X R&D Projects: GA ČR GA201/05/0557; GA ČR GA201/08/1744 Institutional research plan: CEZ:AV0Z10300504 Keywords : feedforward neural network * perceptron * heaviside function * plane wave * integral formula * radon transform * Green’s function for iterated Laplacians * order of vanishing * function of controlled decay Subject RIV: BA - General Mathematics Impact factor: 0.653, year: 2010

  8. NET system integration

    International Nuclear Information System (INIS)

    Farfaletti-Casali, F.; Mitchell, N.; Salpietro, E.; Buzzi, U.; Gritzmann, P.


    The NET system integration procedure is the process by which the requirements of the various Tokamak machine design areas are brought together to form a compatible machine layout. Each design area produces requirements which generally allow components to be built at minimum cost and operate with minimum technical risk, and the final machine assembly should be achieved with minimum departure from these optimum designs. This is carried out in NET by allowing flexibility in the maintenance and access methods to the machine internal components which must be regularly replaced by remote handling, in segmentation of these internal components and in the number of toroidal field coils

  9. Integrated Energy Design

    DEFF Research Database (Denmark)

    Brunsgaard, Camilla; Dvořáková, Pavla; Wyckmans, Annemie


    the development, it is essential that educational institutions foster professionals with such knowledge, skills and competences. An initiative toward this direction is the EUproject of IDES-EDU: “Master and Post-Graduate education and training in multi-disciplinary teams”. The paper describes the necessity...... of more integrated and cross-disciplinary approaches to building design through state-of-the-art of the building sector and educational initiatives in the participating countries in the project, and through theory of design processes. The paper also communicates the results of newly developed cross...

  10. Symbolism in European Integration

    DEFF Research Database (Denmark)

    Manners, Ian


    Ernst Haas observed over fifty years ago that ‘United Europe' is a resilient, adaptable, unifying, and yet unspecified symbol'. It is precisely this adaptability and ambiguity that has ensures the continuing importance of European studies as a means of understanding ‘the remarkable social...... of social transformation involved' (Calhoun 2003: 18). This article will consider the role of symbolism in European integration as part of answering Craig Calhoun's call for a means of transcending specific regimes of analysis in order to advance European studies....

  11. Multifuctional integrated sensors (MFISES).

    Energy Technology Data Exchange (ETDEWEB)

    Homeijer, Brian D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Roozeboom, Clifton [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)


    Many emerging IoT applications require sensing of multiple physical and environmental parameters for: completeness of information, measurement validation, unexpected demands, improved performance. For example, a typical outdoor weather station measures temperature, humidity, barometric pressure, light intensity, rainfall, wind speed and direction. Existing sensor technologies do not directly address the demand for cost, size, and power reduction in multi-paramater sensing applications. Industry sensor manufacturers have developed integrated sensor systems for inertial measurements that combine accelerometers, gyroscopes, and magnetometers, but do not address environmental sensing functionality. In existing research literature, a technology gap exists between the functionality of MEMS sensors and the real world applications of the sensors systems.

  12. Camel enterprise integration cookbook

    CERN Document Server

    Cranton, Scott


    This book is written in a Cookbook style with short recipes showing developers how to effectively implement EIP without breaking everything in the process. It is concise and to the point, and it helps developers get their data flowing between different components without the need to read through page upon page of theory, while also enabling the reader to learn how to create exciting new projects.Camel Enterprise Integration Cookbook is intended for developers who have some familiarity with Apache Camel and who want a quick lookup reference to practical, proven tips on how to perform common tas

  13. Acquisition IT Integration

    DEFF Research Database (Denmark)

    Henningsson, Stefan; Øhrgaard, Christian


    of temporary agency workers. Following an analytic induction approach, theoretically grounded in the re-source-based view of the firm, we identify the complimentary and supplementary roles consultants can assume in acquisition IT integration. Through case studies of three acquirers, we investigate how...... the acquirers appropriate the use of agency workers as part of its acquisition strategy. For the investigated acquirers, assigning roles to agency workers is contingent on balancing the needs of knowledge induction and knowledge retention, as well as experience richness and in-depth under-standing. Composition...

  14. Reparametrization in the path integral

    International Nuclear Information System (INIS)

    Storchak, S.N.


    The question of the invariance of a measure in the n-dimensional path integral under the path reparametrization is considered. The non-invariance of the measure through the jacobian is suggeste. After the path integral reparametrization the representatioq for the Green's function of the Hamilton operator in terms of the path integral with the classical Hamiltonian has been obtained

  15. Integrating financial and strategic planning. (United States)

    Pivnicny, V C


    As hospitals face mounting profitability and liquidity concerns, the need to integrate strategic and financial planning also will continue to grow. This article describes a process for integrating these planning functions and the ideal organizational framework to facilitate the process. Obstacles to the integration of these planning processes also are discussed.

  16. On the equality of integrals

    Czech Academy of Sciences Publication Activity Database

    Mesiar, Radko; Li, J.; Ouyang, Y.


    Roč. 393, č. 1 (2017), s. 82-90 ISSN 0020-0255 Institutional support: RVO:67985556 Keywords : Choquet integral * Concave integral * Minimal atom * Monotone measure * Pan-integral Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 4.832, year: 2016

  17. Financial integration and liquidity crises

    NARCIS (Netherlands)

    Castiglionesi, Fabio; Feriozzi, F.; Lorenzoni, G.


    This paper analyzes the effects of financial integration on the stability of the banking system. Financial integration allows banks in different regions to smooth local liquidity shocks by borrowing and lending on a common interbank market. We show under which conditions financial integration

  18. Testing periodically integrated autoregressive models

    NARCIS (Netherlands)

    Ph.H.B.F. Franses (Philip Hans); M.J. McAleer (Michael)


    textabstractPeriodically integrated time series require a periodic differencing filter to remove the stochastic trend. A non-periodic integrated time series needs the first-difference filter for similar reasons. When the changing seasonal fluctuations for the non-periodic integrated series can be

  19. Space shuttle operations integration plan (United States)


    The Operations Integration Plan is presented, which is to provide functional definition of the activities necessary to develop and integrate shuttle operating plans and facilities to support flight, flight control, and operations. It identifies the major tasks, the organizations responsible, their interrelationships, the sequence of activities and interfaces, and the resultant products related to operations integration.

  20. Integrated test schedule for buried waste integrated demonstration

    International Nuclear Information System (INIS)

    Brown, J.T.; McDonald, J.K.


    The Integrated Test Schedule incorporates the various schedules the Buried Waste Integrated Demonstration (BWID) supports into one document. This document contains the Federal Facilities Agreement and Consent Order schedules for the Idaho National Engineering Laboratory, Hanford Reservation, Oak Ridge Reservation, and Fernald Environmental Materials Center. Included in the Integrated Test Schedule is the Buried Waste Integrated Demonstration ''windows of opportunity'' schedule. The ''windows of opportunity'' schedule shows periods of time in which Buried Waste Integrated Demonstration Program-sponsored technology demonstrations could support key decisions in the Federal Facilities Agreement and Consent Order. Schedules for the Buried Waste Integrated Demonstration-sponsored technology task plans are categorized by technology area and divided by current fiscal year and out-year. Total estimated costs for Buried Waste Integrated Demonstration-sponsored Technology Task Plans for FY-92 through FY-97 are $74.756M

  1. Decision-Making for Supply Chain Integration Supply Chain Integration

    CERN Document Server

    Lettice, Fiona; Durowoju, Olatunde


    Effective supply chain integration, and the tight co-ordination it creates, is an essential pre-requisite for successful supply chain management.  Decision-Making for Supply Chain Integration is a practical reference on recent research in the area of supply chain integration focusing on distributed decision-making problems. Recent applications of various decision-making tools for integrating supply chains are covered including chapters focusing on: •Supplier selection, pricing strategy and inventory decisions in multi-level supply chains, •RFID-enabled distributed decision-making, •Operational risk issues and time-critical decision-making for sensitive logistics nodes, Modelling end to end processes to improve supply chain integration, and •Integrated systems to improve service delivery and optimize resource use. Decision-Making for Supply Chain Integration provides an insight into the tools and methodologies of this field with support from real-life case studies demonstrating successful application ...

  2. What is the Integral in Integral Education? From Progressive Pedagogy to Integral Pedagogy

    Directory of Open Access Journals (Sweden)

    Tom Murray


    Full Text Available Integrally-informed educational approaches have much in common withprogressive (including reform, alternative, holistic, and transformative approaches, andshare many of the same values. One function of the integral approach is to provide anoverarching model within which to coordinate different progressive methods. Thoughintegral adds much more than that, descriptions of integral education sometimes soundlike progressive educational principles recast with new terminology. This essay attemptsto clarify what the integral approach adds over and above progressive educationaltheories. After an overview of progressive pedagogical principles, the integral approachis discussed in terms of integral as a model, a method, a community, and a developmentalstage. Integral as a type of consciousness or developmental level is elaborated upon asconsisting of construct-awareness, ego-awareness, relational-awareness, and systemawareness,all important to the educational process. Finally, challenges and supportsystems for realizing integral education are discussed.

  3. Integrable Floquet dynamics

    Directory of Open Access Journals (Sweden)

    Vladimir Gritsev, Anatoli Polkovnikov


    Full Text Available We discuss several classes of integrable Floquet systems, i.e. systems which do not exhibit chaotic behavior even under a time dependent perturbation. The first class is associated with finite-dimensional Lie groups and infinite-dimensional generalization thereof. The second class is related to the row transfer matrices of the 2D statistical mechanics models. The third class of models, called here "boost models", is constructed as a periodic interchange of two Hamiltonians - one is the integrable lattice model Hamiltonian, while the second is the boost operator. The latter for known cases coincides with the entanglement Hamiltonian and is closely related to the corner transfer matrix of the corresponding 2D statistical models. We present several explicit examples. As an interesting application of the boost models we discuss a possibility of generating periodically oscillating states with the period different from that of the driving field. In particular, one can realize an oscillating state by performing a static quench to a boost operator. We term this state a "Quantum Boost Clock". All analyzed setups can be readily realized experimentally, for example in cod atoms.

  4. Pressure vessel integrity 1991

    International Nuclear Information System (INIS)

    Bhandari, S.; Doney, R.O.; McDonald, M.S.; Jones, D.P.; Wilson, W.K.; Pennell, W.E.


    This volume contains papers relating to the structural integrity assessment of pressure vessels and piping, with special emphasis on nuclear industry applications. The papers were prepared for technical sessions developed under the sponsorship of the ASME Pressure Vessels and Piping Division Committees for Codes and Standards, Computer Technology, Design and Analysis, and Materials Fabrication. They were presented at the 1991 Pressure Vessels and Piping Division Conference in San Diego, California, June 23-27. The primary objective of the sponsoring organization is to provide a forum for the dissemination and discussion of information on development and application of technology for the structural integrity assessment of pressure vessels and piping. This publication includes contributions from authors from Australia, France, Japan, Sweden, Switzerland, the United Kingdom, and the United States. The papers here are organized in six sections, each with a particular emphasis as indicated in the following section titles: Fracture Technology Status and Application Experience; Crack Initiation, Propagation and Arrest; Ductile Tearing; Constraint, Stress State, and Local-Brittle-Zones Effects; Computational Techniques for Fracture and Corrosion Fatigue; and Codes and Standards for Fatigue, Fracture and Erosion/Corrosion

  5. An integrated gyrotron controller

    Energy Technology Data Exchange (ETDEWEB)

    Michel, Georg, E-mail:; Sachtleben, Juergen


    The ECRH system of W7-X is composed of 10 independent gyrotron modules. Each module consists of one gyrotron and its peripherals such as power supplies, cooling plants and distributed PLC systems. The fast real-time control functions such as the timing of the two high voltage supplies, trigger pulses, protection, modulation and communication with the central control of W7-X, is implemented in an integrated controller which is described in this paper. As long-term maintainability and sustainability are important for nuclear fusion experiments, the choice fell on an FPGA-based design which is exclusively based on free (as in 'freedom') software and configuration code. The core of the controller consists of a real-time Java virtual machine (JVM) that provides the TCP-IP connectivity as well as more complicated control functions, and which interacts with the gyrotron-specific hardware. Both the gyrotron-specific hardware and the JVM are implemented on the same FPGA, which is the main component of the controller. All 10 controllers are currently completed and operational. All parameters and functions are accessible via Ethernet. Due to the open, FPGA-based design, most hardware modifications can be made via the network as well. This paper discusses the capabilities of the controllers and their integration into the central W7-X control.

  6. Peptide Integrated Optics. (United States)

    Handelman, Amir; Lapshina, Nadezda; Apter, Boris; Rosenman, Gil


    Bio-nanophotonics is a wide field in which advanced optical materials, biomedicine, fundamental optics, and nanotechnology are combined and result in the development of biomedical optical chips. Silk fibers or synthetic bioabsorbable polymers are the main light-guiding components. In this work, an advanced concept of integrated bio-optics is proposed, which is based on bioinspired peptide optical materials exhibiting wide optical transparency, nonlinear and electrooptical properties, and effective passive and active waveguiding. Developed new technology combining bottom-up controlled deposition of peptide planar wafers of a large area and top-down focus ion beam lithography provides direct fabrication of peptide optical integrated circuits. Finding a deep modification of peptide optical properties by reconformation of biological secondary structure from native phase to β-sheet architecture is followed by the appearance of visible fluorescence and unexpected transition from a native passive optical waveguiding to an active one. Original biocompatibility, switchable regimes of waveguiding, and multifunctional nonlinear optical properties make these new peptide planar optical materials attractive for application in emerging technology of lab-on-biochips, combining biomedical photonic and electronic circuits toward medical diagnosis, light-activated therapy, and health monitoring. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Integrated Medical Model Overview (United States)

    Myers, J.; Boley, L.; Foy, M.; Goodenow, D.; Griffin, D.; Keenan, A.; Kerstman, E.; Melton, S.; McGuire, K.; Saile, L.; hide


    The Integrated Medical Model (IMM) Project represents one aspect of NASA's Human Research Program (HRP) to quantitatively assess medical risks to astronauts for existing operational missions as well as missions associated with future exploration and commercial space flight ventures. The IMM takes a probabilistic approach to assessing the likelihood and specific outcomes of one hundred medical conditions within the envelope of accepted space flight standards of care over a selectable range of mission capabilities. A specially developed Integrated Medical Evidence Database (iMED) maintains evidence-based, organizational knowledge across a variety of data sources. Since becoming operational in 2011, version 3.0 of the IMM, the supporting iMED, and the expertise of the IMM project team have contributed to a wide range of decision and informational processes for the space medical and human research community. This presentation provides an overview of the IMM conceptual architecture and range of application through examples of actual space flight community questions posed to the IMM project.

  8. The integral fast reactor

    International Nuclear Information System (INIS)

    Till, C.E.


    On April 3rd, 1986, two dramatic demonstrations of the inherent capability of sodium-cooled fast reactors to survive unprotected loss of cooling accidents were carried out on the experimental sodium-cooled power reactor, EBR-II, on the Idaho site of Argonne National Laboratory. Transients potentially of the most serious kind, one an unprotected loss of flow, the other an unprotected loss of heat sink, both initiated from full power. In both cases the reactor quietly shut itself down, without damage of any kind. These tests were a part of the on-going development program at Argonne to develop an advanced reactor with significant new inherent safety characteristics. Called the Integral Fast Reactor, or IFR, the basic thrust is to develop everything that is needed for a complete nuclear power system - reactor, closed fuel cycle, and waste processing - as a single optimized entity, and, for simplicity in concept, as an integral part of a single plant. The particular selection of reactor materials emphasizes inherent safety characteristics and also makes possible a simplified closed fuel cycle and waste process improvements

  9. The integral fast reactor

    International Nuclear Information System (INIS)

    Till, C.E.


    On April 3rd, 1986, two demonstrations of the inherent capability of sodium-cooled fast reactors to survive unprotected loss of cooling accidents were carried out on the experimental sodium-cooled power reactor, EBR-II, on the Idaho site of Argonne National Laboratory. Transients potentially of the most serious kind, one an unprotected loss of flow, the other an unprotected loss of heat sink, both initiated from full power. In both cases the reactor quietly shut itself down, without damage of any kind. These tests were a part of the on-going development program at Argonne to develop an advanced reactor with significant new inherent safety characteristics. Called the integral fast reactor, or IFR, the basic thrust is to develop everything that is needed for a complete nuclear power system - reactor, closed fuel cycle, and waste processing - as a single optimized entity, and, for simplicity in concept, as an integral part of a single plant. The particular selection of reactor materials emphasizes inherent safety characteristics also makes possible a simplified close fuel cycle and waste process improvements. The paper describes the IFR concept, the inherent safety, tests, and status of IFR development today

  10. Semiconductor integrated circuits

    International Nuclear Information System (INIS)

    Michel, A.E.; Schwenker, R.O.; Ziegler, J.F.


    An improved method involving ion implantation to form non-epitaxial semiconductor integrated circuits. These are made by forming a silicon substrate of one conductivity type with a recessed silicon dioxide region extending into the substrate and enclosing a portion of the silicon substrate. A beam of ions of opposite conductivity type impurity is directed at the substrate at an energy and dosage level sufficient to form a first region of opposite conductivity within the silicon dioxide region. This impurity having a concentration peak below the surface of the substrate forms a region of the one conductivity type which extends from the substrate surface into the first opposite type region to a depth between the concentration peak and the surface and forms a second region of opposite conductivity type. The method, materials and ion beam conditions are detailed. Vertical bipolar integrated circuits can be made this way when the first opposite type conductivity region will function as a collector. Also circuits with inverted bipolar devices when this first region functions as a 'buried'' emitter region. (U.K.)

  11. Buried Waste Integrated Demonstration

    International Nuclear Information System (INIS)


    The Buried Waste Integrated Demonstration (BWID) supports the applied research, development, demonstration, and evaluation of a suite of advanced technologies that offer promising solutions to the problems associated with the remediation of buried waste. BWID addresses the difficult remediation problems associated with DOE complex-wide buried waste, particularly transuranic (TRU) contaminated buried waste. BWID has implemented a systems approach to the development and demonstration of technologies that will characterize, retrieve, treat, and dispose of DOE buried wastes. This approach encompasses the entire remediation process from characterization to post-monitoring. The development and demonstration of the technology is predicated on how a technology fits into the total remediation process. To address all of these technological issues, BWID has enlisted scientific expertise of individuals and groups from within the DOE Complex, as well as experts from universities and private industry. The BWID mission is to support development and demonstration of a suite of technologies that, when integrated with commercially-available technologies, forms a comprehensive, remediation system for the effective and efficient remediation of buried waste throughout the DOE Complex. BWID will evaluate and validate demonstrated technologies and transfer this information and equipment to private industry to support the Office of Environmental Restoration (ER), Office of Waste Management (WM), and Office of Facility Transition (FT) remediation planning and implementation activities

  12. Index of cyber integrity (United States)

    Anderson, Gustave


    Unfortunately, there is no metric, nor set of metrics, that are both general enough to encompass all possible types of applications yet specific enough to capture the application and attack specific details. As a result we are left with ad-hoc methods for generating evaluations of the security of our systems. Current state of the art methods for evaluating the security of systems include penetration testing and cyber evaluation tests. For these evaluations, security professionals simulate an attack from malicious outsiders and malicious insiders. These evaluations are very productive and are able to discover potential vulnerabilities resulting from improper system configuration, hardware and software flaws, or operational weaknesses. We therefore propose the index of cyber integrity (ICI), which is modeled after the index of biological integrity (IBI) to provide a holistic measure of the health of a system under test in a cyber-environment. The ICI provides a broad base measure through a collection of application and system specific metrics. In this paper, following the example of the IBI, we demonstrate how a multi-metric index may be used as a holistic measure of the health of a system under test in a cyber-environment.

  13. Integrating Nephelometer Instrument Handbook

    Energy Technology Data Exchange (ETDEWEB)

    Uin, J. [Brookhaven National Lab. (BNL), Upton, NY (United States)


    The Integrating Nephelometer (Figure 1) is an instrument that measures aerosol light scattering. It measures aerosol optical scattering properties by detecting (with a wide angular integration – from 7 to 170°) the light scattered by the aerosol and subtracting the light scattered by the carrier gas, the instrument walls and the background noise in the detector (zeroing). Zeroing is typically performed for 5 minutes every day at midnight UTC. The scattered light is split into red (700 nm), green (550 nm), and blue (450 nm) wavelengths and captured by three photomultiplier tubes. The instrument can measure total scatter as well as backscatter only (from 90 to 170°) (Heintzenberg and Charlson 1996; Anderson et al. 1996; Anderson and Ogren 1998; TSI 3563 2015) At ARM (Atmospheric Radiation Measurement), two identical Nephelometers are usually run in series with a sample relative humidity (RH) conditioner between them. This is possible because Nephelometer sampling is non-destructive and the sample can be passed on to another instrument. The sample RH conditioner scans through multiple RH values in cycles, treating the sample. This kind of setup allows to study how aerosol particles’ light scattering properties are affected by humidification (Anderson et al. 1996). For historical reasons, the two Nephelometers in this setup are labeled “wet” and “dry”, with the “dry” Nephelometer usually being the one before the conditioner and sampling ambient air (the names are switched for the MAOS measurement site due to the high RH of the ambient air).

  14. The integrated disease network. (United States)

    Sun, Kai; Buchan, Natalie; Larminie, Chris; Pržulj, Nataša


    The growing body of transcriptomic, proteomic, metabolomic and genomic data generated from disease states provides a great opportunity to improve our current understanding of the molecular mechanisms driving diseases and shared between diseases. The use of both clinical and molecular phenotypes will lead to better disease understanding and classification. In this study, we set out to gain novel insights into diseases and their relationships by utilising knowledge gained from system-level molecular data. We integrated different types of biological data including genome-wide association studies data, disease-chemical associations, biological pathways and Gene Ontology annotations into an Integrated Disease Network (IDN), a heterogeneous network where nodes are bio-entities and edges between nodes represent their associations. We also introduced a novel disease similarity measure to infer disease-disease associations from the IDN. Our predicted associations were systemically evaluated against the Medical Subject Heading classification and a statistical measure of disease co-occurrence in PubMed. The strong correlation between our predictions and co-occurrence associations indicated the ability of our approach to recover known disease associations. Furthermore, we presented a case study of Crohn's disease. We demonstrated that our approach not only identified well-established connections between Crohn's disease and other diseases, but also revealed new, interesting connections consistent with emerging literature. Our approach also enabled ready access to the knowledge supporting these new connections, making this a powerful approach for exploring connections between diseases.

  15. [Integrated quality assurance]. (United States)

    Bögel, K; Stöhr, K


    The definition of terms and connotation of "Quality", "Quality Assurance" and "Integration" lead to an analysis and understanding of inhibiting and fostering factors of the "Health Triad" of people, animals and environment. Although "Quality" is largely or ultimately determined by the consumer, there are considerable differences as this term is applied by (a) the individual consumer, (b) the dynamic producer defending or gaining markets, (c) those engaged in traditional product manufacturing, or (d) governments setting (minimum) requirements for the sake of free trade. "Quality Assurance" offers cooperation of partners all along the food chain from "pasture to table". The managerial process turned into a continuum of responsibility and agreement on processes and product characteristics. This overcomes the disadvantages of strategies stressing distinct defense barriers. In practice this philosophy of a predominant role of defence barriers proved largely partnership destructive, in that it permitted to shift responsibilities for failures and to claim administrative competence according to momentary situations and interests. "Integrated Quality Assurance" means mutual agreement of two or more partners along the food chain (e. g. feed producers, farmers, animal health industry, veterinarians and food processors) on product characteristics and production methods. It involves essential system elements including facilities, materials, manpower, information, transport, management etc. Different principles and procedures of quality assurance have been introduced in practice, including agriculture and food processing. These different approaches are not mutually exclusive but largely of complementary nature.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. USGS integrated drought science (United States)

    Ostroff, Andrea C.; Muhlfeld, Clint C.; Lambert, Patrick M.; Booth, Nathaniel L.; Carter, Shawn L.; Stoker, Jason M.; Focazio, Michael J.


    Project Need and OverviewDrought poses a serious threat to the resilience of human communities and ecosystems in the United States (Easterling and others, 2000). Over the past several years, many regions have experienced extreme drought conditions, fueled by prolonged periods of reduced precipitation and exceptionally warm temperatures. Extreme drought has far-reaching impacts on water supplies, ecosystems, agricultural production, critical infrastructure, energy costs, human health, and local economies (Milly and others, 2005; Wihlite, 2005; Vörösmarty and others, 2010; Choat and others, 2012; Ledger and others, 2013). As global temperatures continue to increase, the frequency, severity, extent, and duration of droughts are expected to increase across North America, affecting both humans and natural ecosystems (Parry and others, 2007).The U.S. Geological Survey (USGS) has a long, proven history of delivering science and tools to help decision-makers manage and mitigate effects of drought. That said, there is substantial capacity for improved integration and coordination in the ways that the USGS provides drought science. A USGS Drought Team was formed in August 2016 to work across USGS Mission Areas to identify current USGS drought-related research and core capabilities. This information has been used to initiate the development of an integrated science effort that will bring the full USGS capacity to bear on this national crisis.

  17. A conceptual framework of integrity

    Directory of Open Access Journals (Sweden)

    Antoni Barnard


    Full Text Available This article reports on the fndings of a qualitative study in which the construction of integrity of some business leaders was explored. Data were gathered through ten in-depth interviews with six South African business leaders commended to be champions of integrity. A grounded-theory approach to the data analysis elicited fve themes. These themes and their interrelatedness are discussed in this article and a conceptual framework of integrity is proposed. Integrity is conceptualised as a multifaceted and dynamic construct based on a moral foundation and inner drive that is managed by cognitive and affective processes manifesting various integrity-related behaviours.

  18. Sourcing teams and interdepartmental integration

    DEFF Research Database (Denmark)

    Lidegaard, Nina; Ellegaard, Chris; Møller, Morten Munkgaard


    Internal integration is often mentioned as a prerequisite for conducting strategic sourcing, as multiple functional departments must collaborate on creating value-creating activities amongst them. Though it is one of many possibilities, the use of cross-functional teams is often the most commonly...... proposed solution to ensure internal integration. This paper presents an exploratory case study evaluating the use of internal integration mechanisms in a cross-functional sourcing process. Two commodity categories are examined. One is organised in a cross-functional team, while the other is not. Findings...... indicate that informal integration mechanisms not promoted by management or the organizational structure may contribute to the overall level of integration....

  19. System integration for radiation records

    International Nuclear Information System (INIS)

    Lawson, B.J.; Farrell, L.; Meacham, C.; Tapio, J.


    System integration is the process where through networking and/or software development, necessary business information is available in a common computing environment. System integration is becoming an important objective for many businesses. System integration can improve productivity and efficiency, reduce redundant stored information and errors, and improve availability of information. This paper will discuss the information flow in a radiation health environment, and how system integration can help. Information handled includes external dosimetry and internal dosimetry. The paper will focus on an ORACLE based system integration software product

  20. Community integration after burn injuries. (United States)

    Esselman, P C; Ptacek, J T; Kowalske, K; Cromes, G F; deLateur, B J; Engrav, L H


    Evaluation of community integration is a meaningful outcome criterion after major burn injury. The Community Integration Questionnaire (CIQ) was administered to 463 individuals with major burn injuries. The CIQ results in Total, Home Integration, Social Integration, and Productivity scores. The purposes of this study were to determine change in CIQ scores over time and what burn injury and demographic factors predict CIQ scores. The CIQ scores did not change significantly from 6 to 12 to 24 months postburn injury. Home integration scores were best predicted by sex and living situation; Social Integration scores by marital status; and Productivity scores by functional outcome, burn severity, age, and preburn work factors. The data demonstrate that individuals with burn injuries have significant difficulties with community integration due to burn and nonburn related factors. CIQ scores did not improve over time but improvement may have occurred before the initial 6-month postburn injury follow-up in this study.

  1. Integrative dimensions of psychotherapy training. (United States)

    Greben, Daniel H


    This paper investigates the influence of integrative factors on psychotherapy education. The broad relevance of integrative psychotherapy to residency training and continuing mental health education is discussed. Following a review of the existing literature on the education of integrative psychotherapists, the article systematically examines the integrative and pedagogic issues to be considered in planning psychotherapy training informed by integrative principles. The integrative issues are organized into 5 categories: attitudinal set, knowledge base, clinical techniques and skills, developmental tasks and challenges, and systemic institutional factors. The educational issues can be divided into 4 categories: content, format and process, sequence, and faculty development. Brief descriptions of actual educational interventions illustrate the implementation of such ideas. Specific recommendations are made regarding the development of integrative educational initiatives and future study of unresolved questions.

  2. Line integral on engineering mathematics (United States)

    Wiryanto, L. H.


    Definite integral is a basic material in studying mathematics. At the level of calculus, calculating of definite integral is based on fundamental theorem of calculus, related to anti-derivative, as the inverse operation of derivative. At the higher level such as engineering mathematics, the definite integral is used as one of the calculating tools of line integral. the purpose of this is to identify if there is a question related to line integral, we can use definite integral as one of the calculating experience. The conclusion of this research says that the teaching experience in introducing the relation between both integrals through the engineer way of thinking can motivate and improve students in understanding the material.

  3. Duality for discrete integrable systems

    International Nuclear Information System (INIS)

    Quispel, G R W; Capel, H W; Roberts, J A G


    A new class of discrete dynamical systems is introduced via a duality relation for discrete dynamical systems with a number of explicitly known integrals. The dual equation can be defined via the difference of an arbitrary linear combination of integrals and its upshifted version. We give an example of an integrable mapping with two parameters and four integrals leading to a (four-dimensional) dual mapping with four parameters and two integrals. We also consider a more general class of higher-dimensional mappings arising via a travelling-wave reduction from the (integrable) MKdV partial-difference equation. By differencing the trace of the monodromy matrix we obtain a class of novel dual mappings which is shown to be integrable as level-set-dependent versions of the original ones

  4. Virtual integral holography (United States)

    Venolia, Dan S.; Williams, Lance


    A range of stereoscopic display technologies exist which are no more intrusive, to the user, than a pair of spectacles. Combining such a display system with sensors for the position and orientation of the user's point-of-view results in a greatly enhanced depiction of three-dimensional data. As the point of view changes, the stereo display channels are updated in real time. The face of a monitor or display screen becomes a window on a three-dimensional scene. Motion parallax naturally conveys the placement and relative depth of objects in the field of view. Most of the advantages of "head-mounted display" technology are achieved with a less cumbersome system. To derive the full benefits of stereo combined with motion parallax, both stereo channels must be updated in real time. This may limit the size and complexity of data bases which can be viewed on processors of modest resources, and restrict the use of additional three-dimensional cues, such as texture mapping, depth cueing, and hidden surface elimination. Effective use of "full 3D" may still be undertaken in a non-interactive mode. Integral composite holograms have often been advanced as a powerful 3D visualization tool. Such a hologram is typically produced from a film recording of an object on a turntable, or a computer animation of an object rotating about one axis. The individual frames of film are multiplexed, in a composite hologram, in such a way as to be indexed by viewing angle. The composite may be produced as a cylinder transparency, which provides a stereo view of the object as if enclosed within the cylinder, which can be viewed from any angle. No vertical parallax is usually provided (this would require increasing the dimensionality of the multiplexing scheme), but the three dimensional image is highly resolved and easy to view and interpret. Even a modest processor can duplicate the effect of such a precomputed display, provided sufficient memory and bus bandwidth. This paper describes the

  5. Integrated management system

    International Nuclear Information System (INIS)

    Florescu, N.


    A management system is developed in order to reflect the needs of the business and to ensure that the objectives of the organization will be achieved. The process model and each individual process within the system then needs to identify the drives or requirements from external customers and stakeholders, regulations, and standards such as ISO and 50-C-Q. The processes are then developed to address these drivers. Developing the process in this way makes it fully integrated and capable of incorporating any new requirements. The International Standard (ISO 9000:2000) promotes the adoption of a process approach when developing, implementing and improving the effectiveness of a quality management system to enhance customer satisfaction by meeting customer requirements. The IAEA Code recognizes that the entire work is a process which can be planned, assessed and improved. For an organization to function effectively, numerous linked activities have to be identified and managed. By definition a process is an activity that using resources and taking into account all the constraints imposed executes the necessary operations which transform the inputs in outcomes. Running a system of processes within an organization, identification of the interaction between the processes and their management can be referred to as a 'process approach'. The advantage of such an approach is the ensuring of the ongoing control over the linkage between the individual processes composing the system as well as over their combination and interaction. Developing a management system implies: identification of the process which delivers Critical Success Factor (CSFs) of the business; identifying the support processes enabling the CSFs to be accomplished; identifying the processes that deliver the business fundamentals. An integrated management system should include all activities not only those related to Quality, Health and Safety. When developing an IMS it is necessary to identify all of the drivers

  6. Propagators and path integrals

    Energy Technology Data Exchange (ETDEWEB)

    Holten, J.W. van


    Path-integral expressions for one-particle propagators in scalar and fermionic field theories are derived, for arbitrary mass. This establishes a direct connection between field theory and specific classical point-particle models. The role of world-line reparametrization invariance of the classical action and the implementation of the corresponding BRST-symmetry in the quantum theory are discussed. The presence of classical world-line supersymmetry is shown to lead to an unwanted doubling of states for massive spin-1/2 particles. The origin of this phenomenon is traced to a `hidden` topological fermionic excitation. A different formulation of the pseudo-classical mechanics using a bosonic representation of {gamma}{sub 5} is shown to remove these extra states at the expense of losing manifest supersymmetry. (orig.).

  7. Pair Correlation Function Integrals

    DEFF Research Database (Denmark)

    Wedberg, Nils Hejle Rasmus Ingemar; O'Connell, John P.; Peters, Günther H.J.


    We describe a method for extending radial distribution functions obtained from molecular simulations of pure and mixed molecular fluids to arbitrary distances. The method allows total correlation function integrals to be reliably calculated from simulations of relatively small systems. The long......-distance behavior of radial distribution functions is determined by requiring that the corresponding direct correlation functions follow certain approximations at long distances. We have briefly described the method and tested its performance in previous communications [R. Wedberg, J. P. O’Connell, G. H. Peters......, and J. Abildskov, Mol. Simul. 36, 1243 (2010); Fluid Phase Equilib. 302, 32 (2011)], but describe here its theoretical basis more thoroughly and derive long-distance approximations for the direct correlation functions. We describe the numerical implementation of the method in detail, and report...

  8. Integrated Disability Management

    Directory of Open Access Journals (Sweden)

    Silvia Angeloni


    Full Text Available This article sets out to increase awareness regarding the wide and universal significance of disability, as well as the important benefits of an Integrated Disability Management (IDM approach. The scientific basis for IDM is explored in the first place through an analysis of its relationship to the International Classification of Functioning, Disability and Health (ICF. The conceptual paradigm of the ICF shares an ideological position with the IDM approach in that they are both underpinned by dynamic and multidimensional constructions of disability, which imply equally holistic and interdisciplinary responses. The IDM approach can be applied across a diversity of human situations to provide solutions that reflect the multifaceted and widespread nature of disability. The IDM approach is intended as a strategy capable of handling: inclusion of people with disabilities, active aging of human resources, health and safety in the workplace, prevention of disabilities and various diseases, return-to-work, absenteeism, and presenteeism.

  9. Monitor de Control Integral


    García Corominas, Estefania


    Control Integral es un programa informático especializado en gestión de ferreterías, bricolaje, suministros industriales y centros de construcción. Este programa está formado por dos ejecutables: el primero de ellos es el de ‘Gestión' y el segundo es el llamado ‘Monitor'. El módulo de gestión se compone de diferentes características para satisfacer las necesidades de los clientes, actualización automática de precios de los artículos, terminal punto de venta (TPV) este permite la creación e im...

  10. Integral hierarchies and percolation

    International Nuclear Information System (INIS)

    Klein, W.; Stell, G.


    For a variation of the Potts model which has been shown to describe continuum percolation, we derive a hierarchy of integral equations of Kirkwood-Salsburg type. The distribution functions which are the solutions of this hierarchy can be simply related to the connectedness functions in continuum percolation. From this hierarchy a second set of equations is derived from which the connectedness functions can be obtained directly. This approach is extremely useful when investigating properties of systems far from the percolation transition. These hierarchies are solved exactly in the mean-field (Kac-Baker) limit and possible implications for cluster growth are discussed. The relation between the Potts model for continuum percolation and the Widom-Rowlinson model is also noted

  11. The Integrated Renovation Process

    DEFF Research Database (Denmark)

    Galiotto, Nicolas; Heiselberg, Per; Knudstrup, Mary-Ann

    they get more time for the cost optimization and the qualitative analysis of the users’ needs and behaviours. In order to reach a fossil free energy building stock within an acceptable time frame, it is primordial that researchers, politicians and the building industry work hand in hand. Indeed, in order...... to overcome the financial barriers to energy renovation and bring a new type of building experts in the building renovation sector, cost optimization tools for building renovation have been and can be developed but new legislation and politico-economic supports are still much needed. We present in this report...... a new contribution from the research and industry sides and results reached with the newly developed methodology, but without a significant contribution from the politico-economic and legislation sides . The experiences met during application of the Integrated Renovation Process are described...

  12. Integrated data base program

    International Nuclear Information System (INIS)

    Notz, K.J.


    The IDB Program provides direct support to the DOE Nuclear Waste Management and Fuel Cycle Programs and their lead sites and support contractors by providing and maintaining a current, integrated data base of spent fuel and radioactive waste inventories and projections. All major waste types (HLW, TRU, and LLW) and sources (government, commerical fuel cycle, and I/I) are included. A major data compilation was issued in September, 1981: Spent Fuel and Radioactive Waste Inventories and Projections as of December 31, 1980, DOE/NE-0017. This report includes chapters on Spent Fuel, HLW, TRU Waste, LLW, Remedial Action Waste, Active Uranium Mill Tailings, and Airborne Waste, plus Appendices with more detailed data in selected areas such as isotopics, radioactivity, thermal power, projections, and land usage. The LLW sections include volumes, radioactivity, thermal power, current inventories, projected inventories and characteristics, source terms, land requirements, and a breakdown in terms of government/commercial and defense/fuel cycle/I and I

  13. Between integration and freedom

    DEFF Research Database (Denmark)

    Jørgensen, Simon Laumann


    In the Danish case, school segregation is recognized as a crisis of society, but it is also a crisis in the deeper sense that central actors disagree about in what sense it is a crisis. This raises the general questions: In what sense is school segregation a problem? What exactly is the crisis......? Though these are partly normative questions, in Scandinavian contexts we can interpret them in light of the internal value-commitments of society. Accepting this premise allows us to build on the empirically informed and philosophically rigorous work of Elizabeth Anderson according to which segregation...... should be viewed in light of the imperative of social integration. The demand for citizens’ equal participation in the main institutions of society is, according to her, already entailed immanently if a society is broadly commitment to democracy. Finding this immanent democratic approach...

  14. Integrated Environmental Assessment Modelling

    Energy Technology Data Exchange (ETDEWEB)

    Guardanz, R; Gimeno, B S; Bermejo, V; Elvira, S; Martin, F; Palacios, M; Rodriguez, E; Donaire, I [Ciemat, Madrid (Spain)


    This report describes the results of the Spanish participation in the project Coupling CORINAIR data to cost-effect emission reduction strategies based on critical threshold. (EU/LIFE97/ENV/FIN/336). The subproject has focused on three tasks. Develop tools to improve knowledge on the spatial and temporal details of emissions of air pollutants in Spain. Exploit existing experimental information on plant response to air pollutants in temperate ecosystem and Integrate these findings in a modelling framework that can asses with more accuracy the impact of air pollutants to temperate ecosystems. The results obtained during the execution of this project have significantly improved the models of the impact of alternative emission control strategies on ecosystems and crops in the Iberian Peninsula. (Author) 375 refs.

  15. Integrated biofuels process synthesis

    DEFF Research Database (Denmark)

    Torres-Ortega, Carlo Edgar; Rong, Ben-Guang


    Second and third generation bioethanol and biodiesel are more environmentally friendly fuels than gasoline and petrodiesel, andmore sustainable than first generation biofuels. However, their production processes are more complex and more expensive. In this chapter, we describe a two-stage synthesis......% used for bioethanol process), and steam and electricity from combustion (54%used as electricity) in the bioethanol and biodiesel processes. In the second stage, we saved about 5% in equipment costs and 12% in utility costs for bioethanol separation. This dual synthesis methodology, consisting of a top......-level screening task followed by a down-level intensification task, proved to be an efficient methodology for integrated biofuel process synthesis. The case study illustrates and provides important insights into the optimal synthesis and intensification of biofuel production processes with the proposed synthesis...

  16. Wet storage integrity update

    International Nuclear Information System (INIS)

    Bailey, W.J.; Johnson, A.B. Jr.


    This report includes information from various studies performed under the Wet Storage Task of the Spent Fuel Integrity Project of the Commercial Spent Fuel Management (CSFM) Program at Pacific Northwest Laboratory. An overview of recent developments in the technology of wet storage of spent water reactor fuel is presented. Licensee Event Reports pertaining to spent fuel pools and the associated performance of spent fuel and storage components during wet storage are discussed. The current status of fuel that was examined under the CSFM Program is described. Assessments of the effect of boric acid in spent fuel pool water on the corrosion and stress corrosion cracking of stainless steel and the stress corrosion cracking of stainless steel piping containing stagnant water at spent fuel pools are discussed. A list of pertinent publications is included. 84 references, 21 figures, 11 tables

  17. Integrated refinery waste management

    Energy Technology Data Exchange (ETDEWEB)

    Shieh, Y -S [ETG Environmental, Inc., Blue Bell, PA (US); Sheehan, W J [Separation and Recovery Systems, Inc., Irvine, CA (US)


    In response to the RCRA land ban regulations and TC rule promulgated by the U.S. Federal Environmental Protection Agency (EPA) in 1988-1990, an Integrated Refinery Waste Management (IRWM) program has been developed to provide cost-effective solutions to petroleum industry customers. The goal of IRWM is to provide technology based remediation treatment services to manage sludges and wastewaters generated from the oil refining processes, soils contaminated with petroleum distillates and groundwater contaminated with fuels. Resource recovery, volume reduction and waste minimization are the primary choices to mitigate environmental problems. Oil recovery has been performed through phase separation (such as centrifugation and filtration) and heating of heavy oils. Volume reduction is achieved by dewatering systems such as centrifuges and filter presses, and low temperature thermal treatment. Waste minimization can be accomplished by bioremediation and resource recovery through a cement kiln. (Author).

  18. Integrated microfluidic probe station. (United States)

    Perrault, C M; Qasaimeh, M A; Brastaviceanu, T; Anderson, K; Kabakibo, Y; Juncker, D


    The microfluidic probe (MFP) consists of a flat, blunt tip with two apertures for the injection and reaspiration of a microjet into a solution--thus hydrodynamically confining the microjet--and is operated atop an inverted microscope that enables live imaging. By scanning across a surface, the microjet can be used for surface processing with the capability of both depositing and removing material; as it operates under immersed conditions, sensitive biological materials and living cells can be processed. During scanning, the MFP is kept immobile and centered over the objective of the inverted microscope, a few micrometers above a substrate that is displaced by moving the microscope stage and that is flushed continuously with the microjet. For consistent and reproducible surface processing, the gap between the MFP and the substrate, the MFP's alignment, the scanning speed, the injection and aspiration flow rates, and the image capture need all to be controlled and synchronized. Here, we present an automated MFP station that integrates all of these functionalities and automates the key operational parameters. A custom software program is used to control an independent motorized Z stage for adjusting the gap, a motorized microscope stage for scanning the substrate, up to 16 syringe pumps for injecting and aspirating fluids, and an inverted fluorescence microscope equipped with a charge-coupled device camera. The parallelism between the MFP and the substrate is adjusted using manual goniometer at the beginning of the experiment. The alignment of the injection and aspiration apertures along the scanning axis is performed using a newly designed MFP screw holder. We illustrate the integrated MFP station by the programmed, automated patterning of fluorescently labeled biotin on a streptavidin-coated surface.

  19. Integrative Radiation Biology

    Energy Technology Data Exchange (ETDEWEB)

    Barcellos-Hoff, Mary Helen [New York University School of Medicine, NY (United States)


    We plan to study tissue-level mechanisms important to human breast radiation carcinogenesis. We propose that the cell biology of irradiated tissues reveals a coordinated multicellular damage response program in which individual cell contributions are primarily directed towards suppression of carcinogenesis and reestablishment of homeostasis. We identified transforming growth factor β1 (TGFβ) as a pivotal signal. Notably, we have discovered that TGFβ suppresses genomic instability by controlling the intrinsic DNA damage response and centrosome integrity. However, TGFβ also mediates disruption of microenvironment interactions, which drive epithelial to mesenchymal transition in irradiated human mammary epithelial cells. This apparent paradox of positive and negative controls by TGFβ is the topic of the present proposal. First, we postulate that these phenotypes manifest differentially following fractionated or chronic exposures; second, that the interactions of multiple cell types in tissues modify the responses evident in this single cell type culture models. The goals are to: 1) study the effect of low dose rate and fractionated radiation exposure in combination with TGFβ on the irradiated phenotype and genomic instability of non-malignant human epithelial cells; and 2) determine whether stromal-epithelial interactions suppress the irradiated phenotype in cell culture and the humanized mammary mouse model. These data will be used to 3) develop a systems biology model that integrates radiation effects across multiple levels of tissue organization and time. Modeling multicellular radiation responses coordinated via extracellular signaling could have a significant impact on the extrapolation of human health risks from high dose to low dose/rate radiation exposure.

  20. Integrated formal operations plan

    Energy Technology Data Exchange (ETDEWEB)

    Cort, G.; Dearholt, W.; Donahue, S.; Frank, J.; Perkins, B.; Tyler, R.; Wrye, J.


    The concept of formal operations (that is, a collection of business practices to assure effective, accountable operations) has vexed the Laboratory for many years. To date most attempts at developing such programs have been based upon rigid, compliance-based interpretations of a veritable mountain of Department of Energy (DOE) orders, directives, notices, and standards. These DOE dictates seldom take the broad view but focus on highly specialized programs isolated from the overall context of formal operations. The result is a confusing array of specific, and often contradictory, requirements that produce a patchwork of overlapping niche programs. This unnecessary duplication wastes precious resources, dramatically increases the complexity of our work processes, and communicates a sense of confusion to our customers and regulators. Coupled with the artificial divisions that have historically existed among the Laboratory`s formal operations organizations (quality assurance, configuration management, records management, training, etc.), this approach has produced layers of increasingly vague and complex formal operations plans, each of which interprets its parent and adds additional requirements of its own. Organizational gridlock ensues whenever an activity attempts to implement these bureaucratic monstrosities. The integrated formal operations plan presented is to establish a set of requirements that must be met by an integrated formal operations program, assign responsibilities for implementation and operation of the program, and specify criteria against which the performance of the program will be measured. The accountable line manager specifies the items, processes, and information (the controlled elements) to which the formal operations program specified applies. The formal operations program is implemented using a graded approach based on the level of importance of the various controlled elements and the scope of the activities in which they are involved.

  1. Project Integration Architecture (United States)

    Jones, William Henry


    The Project Integration Architecture (PIA) is a distributed, object-oriented, conceptual, software framework for the generation, organization, publication, integration, and consumption of all information involved in any complex technological process in a manner that is intelligible to both computers and humans. In the development of PIA, it was recognized that in order to provide a single computational environment in which all information associated with any given complex technological process could be viewed, reviewed, manipulated, and shared, it is necessary to formulate all the elements of such a process on the most fundamental level. In this formulation, any such element is regarded as being composed of any or all of three parts: input information, some transformation of that input information, and some useful output information. Another fundamental principle of PIA is the assumption that no consumer of information, whether human or computer, can be assumed to have any useful foreknowledge of an element presented to it. Consequently, a PIA-compliant computing system is required to be ready to respond to any questions, posed by the consumer, concerning the nature of the proffered element. In colloquial terms, a PIA-compliant system must be prepared to provide all the information needed to place the element in context. To satisfy this requirement, PIA extends the previously established object-oriented- programming concept of self-revelation and applies it on a grand scale. To enable pervasive use of self-revelation, PIA exploits another previously established object-oriented-programming concept - that of semantic infusion through class derivation. By means of self-revelation and semantic infusion through class derivation, a consumer of information can inquire about the contents of all information entities (e.g., databases and software) and can interact appropriately with those entities. Other key features of PIA are listed.

  2. Geological data integration techniques

    International Nuclear Information System (INIS)


    The objectives of this Technical Committee are to bring together current knowledge on geological data handling and analysis technologies as developed in the mineral and petroleum industries for geological, geophysical, geochemical and remote sensing data that can be applied to uranium exploration and resource appraisal. The recommendation for work on this topic was first made at the meeting of the NEA-IAEA Joint Group of Experts on R and D in Uranium Exploration Techniques (Paris, May 1984). In their report, processing of integrated data sets was considered to be extremely important in view of the very extensive data sets built up over the recent years by large uranium reconnaissance programmes. With the development of large, multidisciplinary data sets which includes geochemical, geophysical, geological and remote sensing data, the ability of the geologist to easily interpret large volumes of information has been largely the result of developments in the field of computer science in the past decade. Advances in data management systems, image processing software, the size and speed of computer systems and significantly reduced processing costs have made large data set integration and analysis practical and affordable. The combined signatures which can be obtained from the different types of data significantly enhance the geologists ability to interpret fundamental geological properties thereby improving the chances of finding a significant ore body. This volume is the product of one of a number of activities related to uranium geology and exploration during the past few years with the intent of bringing new technologies and exploration techniques to the IAEA Member States

  3. Automatic numerical integration methods for Feynman integrals through 3-loop

    International Nuclear Information System (INIS)

    De Doncker, E; Olagbemi, O; Yuasa, F; Ishikawa, T; Kato, K


    We give numerical integration results for Feynman loop diagrams through 3-loop such as those covered by Laporta [1]. The methods are based on automatic adaptive integration, using iterated integration and extrapolation with programs from the QUADPACK package, or multivariate techniques from the ParInt package. The Dqags algorithm from QuadPack accommodates boundary singularities of fairly general types. PARINT is a package for multivariate integration layered over MPI (Message Passing Interface), which runs on clusters and incorporates advanced parallel/distributed techniques such as load balancing among processes that may be distributed over a network of nodes. Results are included for 3-loop self-energy diagrams without IR (infra-red) or UV (ultra-violet) singularities. A procedure based on iterated integration and extrapolation yields a novel method of numerical regularization for integrals with UV terms, and is applied to a set of 2-loop self-energy diagrams with UV singularities. (paper)

  4. Abuse notation of improper integrals (United States)

    Arfi, E.; Wiryanto, L. H.


    In the definition of \\int_ab {f(x)dx} , it was assumed that the interval [a, b] was finite. However, in many application in physics, engineering, economics, and probability we wish to allow a or b (or both) to be infinite or for the other case when f has an infinite discontinuity in [a, b]. In either case the integral is called improper integral. Definition of improper integral is the limit of a definite integral as an endpoint of the interval of integration approaches either a specified real number or ∞ or -∞ or, in some cases, as both endpoints approach limits. Many of the first-year students in ITERA learning about improper integrals make an abuse notation like written improper integral just like standard definite integral. Based on this situation, we tried to change the habits of the students in the writing of improper integrals by providing sufficient understanding and considerable exercises. It turns out this way gives good result, based on the percentage of the value of the midterms to the problem of improper integrals give a fairly good percentage value.

  5. Terminal Forecast Reference Notebook (TFRN) for Luke AFB, Arizona, (United States)


    due west of the base; the Sierra Estrella , 4,512 feet, about 12 miles to the south; the Phoenix Mountains, 2,740 feet, about 20 miles to the east...from any other direction will usually miss the base by more than 5 nautical miles because of the steering effect of the Sierra Estrella and the White...does the Sierra Estrella between 152 and 210 degrees. Most radar signal blocking can be eliminated, with the exception of the White Tanks, by raising

  6. Results and Lessons Learned Interim Report: Altus AFB Site

    National Research Council Canada - National Science Library

    McHugh, Thomas


    ...) to address the critical groundwater-to-indoor-air vapor intrusion pathway. By increasing our understanding of this critical pathway, guidelines can be improved, thereby better focusing Department of Defense (DoD...

  7. Surface Observation Climatic Summaries for McChord AFB Washington (United States)


    0 .0 .0 .0 TRCE .0 f6 .6 __ 2_.. .. Q .. . __ .3 TR A n - _5.9 .- Z3, - ) 0 , (N T RA C: .9 .0 .3 .0 .0 .0 .2 .3...t 72-0 ....- 930 . .. . .. 7 .2 _ .. .....-3 .. .. i3 O_..... 1 72.) 1.0 7440 ...................... * aCCA *S& - . - -. & -- MO NLi AP-R iJR&j L

  8. Dicty_cDB: AFB241 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available esis elongation factor 1-alpha (tef2) gene, partial cds. 682 0.0 2 AF157274 |AF157274.1 Phascolomyces arti...culosus translation elongation factor 1-alpha (EF-1alpha) gene, partial cds. 105 2e

  9. Surface Observation Climatic Summaries for Richards-Gebaur AFB, Missouri (United States)


    SUPERSEDES: N/A APR 91 LST TOUTC 406 I MONTH IJAN I FEB I MAR IAP IMAY I JUN I JUL IAUG ISEP IOCT INOV I DEC IANN IYOR- EXTRN MAX TERP(F) 71 82 85 92 94 104...ANDVSBILIT *JN I FEB IAR IM I JUN I JUL IAUG IsEP I OCT I V I DEC I YOR LST 00 - 02 10 03 - 05 10 CIG 06 - 08 23.8 31.5 31.0 22.1 24.0 15.0 12.7 17.4

  10. Waste Analysis Plan and Waste Characterization Survey, Barksdale AFB, Louisiana (United States)


    4C ;J4 c Ia’) La C; c) 0C\\Jc 8 "= "A -’O ’ 04 CŔ" c C’j C-J CAJe~ .- 44 C’) 0% C% 40w 0 l0 O LCD LA O L O 0 0 -IT~ LA 0 00- -T 0 0 0 0 rC 0 0 1- -C (D...r" 3flP1 7, r, ’. hrm Ai IP mn- 3f 1 f r1~r~~ r*NP m r.4 . 4 .-1- 1n i ito NP Mn.’ 3 12fl n 4f c;I rn’." ’, rfi 3I A’. 7 7?A I (>nd ht ~ HIM S)A R46 S

  11. Proposed Closure of Myrtle Beach AFB, South Carolina (United States)


    royal fern (Osmunda regalis), poison ivy (Toxicodendron radicans), and cane (Arundinaria gigantea). Common vines are yellow jasmine (Gelsemium... Ledbetter , Major, U.S. Air Force, Attorney, AFRCE-BMS/DES B.S., 1973, Mathematics, University of Georgia. Athens M.A., 1978, 1 ublic Administration...Richard Garthe F. Lee Howell Murray Geddes Sharon F. Howell Peggy J. Geddes Gary Hoyve Fred G. Gerty Greg Hucks C-5 Jeannine Hucks Jessie R. Lee Lacy K

  12. NOAA-L satellite arrives at Vandenberg AFB (United States)


    Outside the B16-10 spacecraft processing hangar at Vandenberg Air Force Base, Calif., a crated National Oceanic and Atmospheric Administration (NOAA-L) satellite is lowered to the ground before being moved inside. NOAA-L is part of the Polar-Orbiting Operational Environmental Satellite (POES) program that provides atmospheric measurements of temperature, humidity, ozone and cloud images, tracking weather patterns that affect the global weather and climate. The launch of the NOAA-L satellite is scheduled no earlier than Sept. 12 aboard a Lockheed Martin Titan II rocket. Installation Restoration Program. Phase 1. Records Search, Scott AFB, Illinois (United States)


    mission of defense of the United States, has long been engaged in a wide variety of opera- tions dealing with toxic and hazardous materials. Federal...Histopathology-Cytology Sewer Dental Clinic/Laboratory 1680 Yes Yes DPDO, Sanitary Sewer, Medical Logistics Radiology/X-Ray 1680 Yes Yes DPDO, Sanitary...disintegrate. HALOGEN: The class of chemical elements including fluorine , chlorine, i bromine, and iodine. HALON 1211: A fire extinguishing agent

  13. Surface Observation Climatic Summaries (SOCS) For Mather AFB, California (United States)


    1100 SPEND (RTS) CE14 GEIS GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS GE14 GEl8 GE25 OBS CATEGORY A 1.7 .5 .1 930 1.6 .6 .1 930 1.6 .4 930 3.4 1.0...ITS) GE14 0E18 GE25 ORS GE14 GEIS GE25 OS GE14 GEl8 GE25 OBS GE14 GE18 GE25 OBS CATEGORY A 5.7 2.4 930 5.2 1.3 .2 930 1.7 .5 .2 930 1.5 .5 .1 930...TIME (LST) 0600 - 2000 ALL HOURS SPEED K75 GE14 GEl8 GE25 OBS GE14 GEl8 UE25 OS CAT Y A 3.5 1.1 .1 4650 2.8 .9

  14. Installation Restoration Program. Phase 1. Records Search, Lackland AFB, Texas (United States)


    governmental environ- mental projects. Environmental Engineering Department Head (1973-1976). Supervised staff involved in auditing environmental practices...V. -4 a a ; to- w w M, 4-. c* a a M - ~ a -- ~= a a a a a aa as-au ’- aC aCca - ~~~ - aa:0 a 0 24 X4 JU 2 a -- a. -~a - .wZ 2kD.4 4 ob0 m C C w 4a

  15. Environmental Impact Statement Space Shuttle Program, Vandenberg AFB, California. Supplement. (United States)


    2 of the Northern Channel Islands, have been motivated in part by concerns identified through interaction between the Air Force and the Coastal...ofA.SrZ 64 0 /OC 2SS - So#e.e. V, f-rrAq ~ WA~oJsie4,e~4 A-I 4&Ajt4 A fLA1//.t"lJAde~ R-SeI~u- dw rwy. £A4Pcr SL3*p~j* ps4 .Prm Al-fdc6k -5)’-ArFkAJ /7

  16. Installation Restoration Program. Phase I. Records Search, Brooks AFB, Texas (United States)


    decay of the cadavers occurred. The waste was packaged in plastic bags, placed in seven 55-gallon drums and buried in a hole 7 to 8 feet deep. The drums...Receptors subscore (I x factor score subtotal/maximm score subtotal) 44 - II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity...subtotal) 44 II. WASTE CARACTERISTICS A. Select the factor score based on the estimated quantity, the degree of hazard, and the confidence level of the

  17. Installation Restoration Program. Phase I. Records. Loring AFB, Maine. (United States)


    periphyton from rivers and streams. Publications Dr. Knight has authored several technical papers on ecosystem metabolism, phytoplankton ecology, and...should be made of glacial till and esker (ice contact) deposits along with the calcareous bedrock (Carys Mills Formation) as they relate to the base...material defects of aircraft struc- tures, component parts, and related ground equipment. Wastes generated by the processes involved include PD-680

  18. Dicty_cDB: AFB514 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TCACTGTTCATCCAAAATTCTTAACAACAAGAAGAAGCGGAACCAAGAACAAGAAGA ACA sequence update 2001. 6. 1 Translated Amino Acid sequence ---atsnnqlmip...skg*ihchrfshc*nq*treristsl rfirsnsreiclyf*fh*tnc*wycrqcfhlkii*cylsl*nhl*rchgyvqenhgkdlv ltvhpkflttrrsgtknkkn Frame B: ---atsnnqlmips

  19. Final Supplemental Environmental Impact Statement for Airborne Laser Program at Kirtland Air Force Base (AFB) and White Sands Missile Range/Holloman AFB, NM, and Edwards AFB and Vandenberg AFB, CA (United States)


    californicus- _" -~ T ~ - 1" T - E I T Coho salmon Unarmoured three- spined stickleback I Tidewater goby 1 Eucyclogobius n e w b e p i ,.I...ENDANGERED Black-footed ferret (Mustela nigripes)"" Northern aplomado falcon (Falcofemoralis septentrionalis) Kuenzler hedgehog cachls (Echi...Empidonax traillii ertimus) Kuenzler hedgehog cactus (Echinocer~.~rendleri var. kuenzleri) Todsen’s pennyroyal (Hedeoma fodsenii) Sacramento