WorldWideScience

Sample records for greater anisotropic diffusion

  1. Finite-volume scheme for anisotropic diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Es, Bram van, E-mail: bramiozo@gmail.com [Centrum Wiskunde & Informatica, P.O. Box 94079, 1090GB Amsterdam (Netherlands); FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, The Netherlands" 1 (Netherlands); Koren, Barry [Eindhoven University of Technology (Netherlands); Blank, Hugo J. de [FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, The Netherlands" 1 (Netherlands)

    2016-02-01

    In this paper, we apply a special finite-volume scheme, limited to smooth temperature distributions and Cartesian grids, to test the importance of connectivity of the finite volumes. The area of application is nuclear fusion plasma with field line aligned temperature gradients and extreme anisotropy. We apply the scheme to the anisotropic heat-conduction equation, and compare its results with those of existing finite-volume schemes for anisotropic diffusion. Also, we introduce a general model adaptation of the steady diffusion equation for extremely anisotropic diffusion problems with closed field lines.

  2. Anisotropic diffusion in a toroidal geometry

    International Nuclear Information System (INIS)

    Fischer, Paul F

    2005-01-01

    As part of the Department of Energy's applications oriented SciDAC project, three model problems have been proposed by the Center for Extended Magnetohydrodynamics Modeling to test the potential of numerical algorithms for challenging magnetohydrodynamics (MHD) problems that are required for future fusion development. The first of these, anisotropic diffusion in a toroidal geometry, is considered in this note

  3. Finite-difference schemes for anisotropic diffusion

    Energy Technology Data Exchange (ETDEWEB)

    Es, Bram van, E-mail: es@cwi.nl [Centrum Wiskunde and Informatica, P.O. Box 94079, 1090GB Amsterdam (Netherlands); FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, Association EURATOM-FOM (Netherlands); Koren, Barry [Eindhoven University of Technology (Netherlands); Blank, Hugo J. de [FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, Association EURATOM-FOM (Netherlands)

    2014-09-01

    In fusion plasmas diffusion tensors are extremely anisotropic due to the high temperature and large magnetic field strength. This causes diffusion, heat conduction, and viscous momentum loss, to effectively be aligned with the magnetic field lines. This alignment leads to different values for the respective diffusive coefficients in the magnetic field direction and in the perpendicular direction, to the extent that heat diffusion coefficients can be up to 10{sup 12} times larger in the parallel direction than in the perpendicular direction. This anisotropy puts stringent requirements on the numerical methods used to approximate the MHD-equations since any misalignment of the grid may cause the perpendicular diffusion to be polluted by the numerical error in approximating the parallel diffusion. Currently the common approach is to apply magnetic field-aligned coordinates, an approach that automatically takes care of the directionality of the diffusive coefficients. This approach runs into problems at x-points and at points where there is magnetic re-connection, since this causes local non-alignment. It is therefore useful to consider numerical schemes that are tolerant to the misalignment of the grid with the magnetic field lines, both to improve existing methods and to help open the possibility of applying regular non-aligned grids. To investigate this, in this paper several discretization schemes are developed and applied to the anisotropic heat diffusion equation on a non-aligned grid.

  4. Extended phase graphs with anisotropic diffusion

    Science.gov (United States)

    Weigel, M.; Schwenk, S.; Kiselev, V. G.; Scheffler, K.; Hennig, J.

    2010-08-01

    The extended phase graph (EPG) calculus gives an elegant pictorial description of magnetization response in multi-pulse MR sequences. The use of the EPG calculus enables a high computational efficiency for the quantitation of echo intensities even for complex sequences with multiple refocusing pulses with arbitrary flip angles. In this work, the EPG concept dealing with RF pulses with arbitrary flip angles and phases is extended to account for anisotropic diffusion in the presence of arbitrary varying gradients. The diffusion effect can be expressed by specific diffusion weightings of individual magnetization pathways. This can be represented as an action of a linear operator on the magnetization state. The algorithm allows easy integration of diffusion anisotropy effects. The formalism is validated on known examples from literature and used to calculate the effective diffusion weighting in multi-echo sequences with arbitrary refocusing flip angles.

  5. Anisotropic diffusion tensor applied to temporal mammograms

    DEFF Research Database (Denmark)

    Karemore, Gopal; Brandt, Sami; Sporring, Jon

    2010-01-01

    changes related to  specific  effects  like  Hormonal  Replacement  Therapy  (HRT) and aging. Given effect-grouped patient data, we demonstrated how  anisotropic  diffusion  tensor  and  its  coherence  features computed in an anatomically oriented breast coordinate system followed by statistical learning...

  6. A new noise erosion operator for anisotropic diffusion

    Institute of Scientific and Technical Information of China (English)

    蔡超; 丁名跃; 周成平; 张天序

    2004-01-01

    A noise erosion operator based on partial differential equation (PDE) is introduced, which has an excellent ability of noise removal and edge preservation for two-dimensional (2D) gradient data. The operator is applied to estimate a new diffusion coefficient. Experimental results demonstrate that anisotropic diffusion based on this new erosion operator can efficiently reduce noise and sharpen object boundaries.

  7. Adaptive weighted anisotropic diffusion for computed tomography denoising

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Zhi; Silver, Michael D. [Toshiba Medical Research Institute USA, Inc., Vernon Hills, IL (United States); Noshi, Yasuhiro [Toshiba Medical System Corporation, Tokyo (Japan)

    2011-07-01

    With increasing awareness of radiation safety, dose reduction has become an important task of modern CT system development. This paper proposes an adaptive weighted anisotropic diffusion method and an adaptive weighted sharp source anisotropic diffusion method as image domain filters to potentially help dose reduction. Different from existing anisotropic diffusion methods, the proposed methods incorporate an edge-sensitive adaptive source term as part of the diffusion iteration. It provides better edge and detail preservation. Visual evaluation showed that the new methods can reduce noise substantially without apparent edge and detail loss. The quantitative evaluations also showed over 50% of noise reduction in terms of noise standard deviations, which is equivalent to over 75% of dose reduction for a normal dose image quality. (orig.)

  8. Adaptive anisotropic diffusion filtering of Monte Carlo dose distributions

    International Nuclear Information System (INIS)

    Miao Binhe; Jeraj, Robert; Bao Shanglian; Mackie, Thomas R

    2003-01-01

    The Monte Carlo method is the most accurate method for radiotherapy dose calculations, if used correctly. However, any Monte Carlo dose calculation is burdened with statistical noise. In this paper, denoising of Monte Carlo dose distributions with a three-dimensional adaptive anisotropic diffusion method was investigated. The standard anisotropic diffusion method was extended by changing the filtering parameters adaptively according to the local statistical noise. Smoothing of dose distributions with different noise levels in an inhomogeneous phantom, a conventional and an IMRT treatment case is shown. The resultant dose distributions were analysed using several evaluating criteria. It is shown that the adaptive anisotropic diffusion method can reduce statistical noise significantly (two to five times, corresponding to the reduction of simulation time by a factor of up to 20), while preserving important gradients of the dose distribution well. The choice of free parameters of the method was found to be fairly robust

  9. An anisotropic diffusion approximation to thermal radiative transfer

    International Nuclear Information System (INIS)

    Johnson, Seth R.; Larsen, Edward W.

    2011-01-01

    This paper describes an anisotropic diffusion (AD) method that uses transport-calculated AD coefficients to efficiently and accurately solve the thermal radiative transfer (TRT) equations. By assuming weak gradients and angular moments in the radiation intensity, we derive an expression for the radiation energy density that depends on a non-local function of the opacity. This nonlocal function is the solution of a transport equation that can be solved with a single steady-state transport sweep once per time step, and the function's second angular moment is the anisotropic diffusion tensor. To demonstrate the AD method's efficacy, we model radiation flow down a channel in 'flatland' geometry. (author)

  10. Anisotropic diffusion of volatile pollutants at air-water interface

    Directory of Open Access Journals (Sweden)

    Li-ping Chen

    2013-04-01

    Full Text Available The volatile pollutants that spill into natural waters cause water pollution. Air pollution arises from the water pollution because of volatilization. Mass exchange caused by turbulent fluctuation is stronger in the direction normal to the air-water interface than in other directions due to the large density difference between water and air. In order to explore the characteristics of anisotropic diffusion of the volatile pollutants at the air-water interface, the relationship between velocity gradient and mass transfer rate was established to calculate the turbulent mass diffusivity. A second-order accurate smooth transition differencing scheme (STDS was proposed to guarantee the boundedness for the flow and mass transfer at the air-water interface. Simulations and experiments were performed to study the trichloroethylene (C2HCl3 release. By comparing the anisotropic coupling diffusion model, isotropic coupling diffusion model, and non-coupling diffusion model, the features of the transport of volatile pollutants at the air-water interface were determined. The results show that the anisotropic coupling diffusion model is more accurate than the isotropic coupling diffusion model and non-coupling diffusion model. Mass transfer significantly increases with the increase of the air-water relative velocity at a low relative velocity. However, at a higher relative velocity, an increase in the relative velocity has no effect on mass transfer.

  11. MR imaging evidence of anisotropic diffusion in the cat brain

    International Nuclear Information System (INIS)

    Moseley, M.E.; Mintorovich, J.; Cohen, Y.; Chilevitt, L.; Tsuruda, J.; Norman, D.; Weinstein, P.

    1989-01-01

    This paper discusses a study of diffusion behavior of brain water in the cat. Diffusion-weighted images, acquired with large gradient b values of 1,000-2,000 sec/mm 2 , showed no clear evidence of anisotropic water diffusion in either gray matter or basal ganglia. Large directional differences in image intensities and diffusion values were observed in cortical and deep white matter. Faster diffusion was sen when the direction of the applied diffusion gradient was parallel to the orientation of the white matter. Diffusion perpendicular to the gradient direction was significantly lower. This effect was proportional to gradient duration and strength and was seen in both pre- and immediate post-mortem images in all axial, sagittal, and coronal images

  12. Anisotropic diffusion within human white matter

    International Nuclear Information System (INIS)

    Chenevert, T.L.; Brunberg, J.A.; Pipe, J.G.

    1990-01-01

    This paper reports on measurements performed to assess the impact of fiber orientation on the apparent diffusion coefficient of human white matter in vivo. Orthogonal section selection pulses and strong motion sensitization gradient pulses were used for localized diffusion measurement along an anteroposteriorly oriented 1 x 1 cm tissue column in the left cerebral hemisphere. This region was selected since white matter fiber orientations are reasonably well defined. Independent acquisitions with motion sensitivity along anteroposterior and right-left directions allowed study of diffusion anisotropy. Motion artifacts were minimized by magnitude summation after one-dimensional Fourier transform of frequency-encoded echoes; consequently, cardiac gating was not required. Five normal volunteers were studied on a 1.5-T clinical MR system

  13. Nanoscale Rheology and Anisotropic Diffusion Using Single Gold Nanorod Probes

    Science.gov (United States)

    Molaei, Mehdi; Atefi, Ehsan; Crocker, John C.

    2018-03-01

    The complex rotational and translational Brownian motion of anisotropic particles depends on their shape and the viscoelasticity of their surroundings. Because of their strong optical scattering and chemical versatility, gold nanorods would seem to provide the ultimate probes of rheology at the nanoscale, but the suitably accurate orientational tracking required to compute rheology has not been demonstrated. Here we image single gold nanorods with a laser-illuminated dark-field microscope and use optical polarization to determine their three-dimensional orientation to better than one degree. We convert the rotational diffusion of single nanorods in viscoelastic polyethylene glycol solutions to rheology and obtain excellent agreement with bulk measurements. Extensions of earlier models of anisotropic translational diffusion to three dimensions and viscoelastic fluids give excellent agreement with the observed motion of single nanorods. We find that nanorod tracking provides a uniquely capable approach to microrheology and provides a powerful tool for probing nanoscale dynamics and structure in a range of soft materials.

  14. Speckle Suppression by Weighted Euclidean Distance Anisotropic Diffusion

    Directory of Open Access Journals (Sweden)

    Fengcheng Guo

    2018-05-01

    Full Text Available To better reduce image speckle noise while also maintaining edge information in synthetic aperture radar (SAR images, we propose a novel anisotropic diffusion algorithm using weighted Euclidean distance (WEDAD. Presented here is a modified speckle reducing anisotropic diffusion (SRAD method, which constructs a new edge detection operator using weighted Euclidean distances. The new edge detection operator can adaptively distinguish between homogenous and heterogeneous image regions, effectively generate anisotropic diffusion coefficients for each image pixel, and filter each pixel at different scales. Additionally, the effects of two different weighting methods (Gaussian weighting and non-linear weighting of de-noising were analyzed. The effect of different adjustment coefficient settings on speckle suppression was also explored. A series of experiments were conducted using an added noise image, GF-3 SAR image, and YG-29 SAR image. The experimental results demonstrate that the proposed method can not only significantly suppress speckle, thus improving the visual effects, but also better preserve the edge information of images.

  15. General PFG signal attenuation expressions for anisotropic anomalous diffusion by modified-Bloch equations

    Science.gov (United States)

    Lin, Guoxing

    2018-05-01

    Anomalous diffusion exists widely in polymer and biological systems. Pulsed-field gradient (PFG) anomalous diffusion is complicated, especially in the anisotropic case where limited research has been reported. A general PFG signal attenuation expression, including the finite gradient pulse (FGPW) effect for free general anisotropic fractional diffusion { 0 integral modified-Bloch equation, were extended to obtain general PFG signal attenuation expressions for anisotropic anomalous diffusion. Various cases of PFG anisotropic anomalous diffusion were investigated, including coupled and uncoupled anisotropic anomalous diffusion. The continuous-time random walk (CTRW) simulation was also carried out to support the theoretical results. The theory and the CTRW simulation agree with each other. The obtained signal attenuation expressions and the three-dimensional fractional modified-Bloch equations are important for analyzing PFG anisotropic anomalous diffusion in NMR and MRI.

  16. Multimodel analysis of anisotropic diffusive tracer-gas transport in a deep arid unsaturated zone

    Science.gov (United States)

    Green, Christopher T.; Walvoord, Michelle Ann; Andraski, Brian J.; Striegl, Robert G.; Stonestrom, David A.

    2015-01-01

    Gas transport in the unsaturated zone affects contaminant flux and remediation, interpretation of groundwater travel times from atmospheric tracers, and mass budgets of environmentally important gases. Although unsaturated zone transport of gases is commonly treated as dominated by diffusion, the characteristics of transport in deep layered sediments remain uncertain. In this study, we use a multimodel approach to analyze results of a gas-tracer (SF6) test to clarify characteristics of gas transport in deep unsaturated alluvium. Thirty-five separate models with distinct diffusivity structures were calibrated to the tracer-test data and were compared on the basis of Akaike Information Criteria estimates of posterior model probability. Models included analytical and numerical solutions. Analytical models provided estimates of bulk-scale apparent diffusivities at the scale of tens of meters. Numerical models provided information on local-scale diffusivities and feasible lithological features producing the observed tracer breakthrough curves. The combined approaches indicate significant anisotropy of bulk-scale diffusivity, likely associated with high-diffusivity layers. Both approaches indicated that diffusivities in some intervals were greater than expected from standard models relating porosity to diffusivity. High apparent diffusivities and anisotropic diffusivity structures were consistent with previous observations at the study site of rapid lateral transport and limited vertical spreading of gas-phase contaminants. Additional processes such as advective oscillations may be involved. These results indicate that gases in deep, layered unsaturated zone sediments can spread laterally more quickly, and produce higher peak concentrations, than predicted by homogeneous, isotropic diffusion models.

  17. Anisotropic Thermal Diffusivities of Plasma-Sprayed Thermal Barrier Coatings

    Science.gov (United States)

    Akoshima, Megumi; Takahashi, Satoru

    2017-09-01

    Thermal barrier coatings (TBCs) are used to shield the blades of gas turbines from heat and wear. There is a pressing need to evaluate the thermal conductivity of TBCs in the thermal design of advanced gas turbines with high energy efficiency. These TBCs consist of a ceramic-based top coat and a bond coat on a superalloy substrate. Usually, the focus is on the thermal conductivity in the thickness direction of the TBC because heat tends to diffuse from the surface of the top coat to the substrate. However, the in-plane thermal conductivity is also important in the thermal design of gas turbines because the temperature distribution within the turbine cannot be ignored. Accordingly, a method is developed in this study for measuring the in-plane thermal diffusivity of the top coat. Yttria-stabilized zirconia top coats are prepared by thermal spraying under different conditions. The in-plane and cross-plane thermal diffusivities of the top coats are measured by the flash method to investigate the anisotropy of thermal conduction in a TBC. It is found that the in-plane thermal diffusivity is higher than the cross-plane one for each top coat and that the top coats have significantly anisotropic thermal diffusivity. The cross-sectional and in-plane microstructures of the top coats are observed, from which their porosities are evaluated. The thermal diffusivity and its anisotropy are discussed in detail in relation to microstructure and porosity.

  18. Numerical analysis of anisotropic diffusion effect on ICF hydrodynamic instabilities

    Directory of Open Access Journals (Sweden)

    Olazabal-Loumé M.

    2013-11-01

    Full Text Available The effect of anisotropic diffusion on hydrodynamic instabilities in the context of Inertial Confinement Fusion (ICF flows is numerically assessed. This anisotropy occurs in indirect-drive when laminated ablators are used to modify the lateral transport [1,2]. In direct-drive, non-local transport mechanisms and magnetic fields may modify the lateral conduction [3]. In this work, numerical simulations obtained with the code PERLE [4], dedicated to linear stability analysis, are compared with previous theoretical results [5]. In these approaches, the diffusion anisotropy can be controlled by a characteristic coefficient which enables a comprehensive study. This work provides new results on the ablative Rayleigh-Taylor (RT, ablative Richtmyer-Meshkov (RM and Darrieus-Landau (DL instabilities.

  19. Inverse anisotropic diffusion from power density measurements in two dimensions

    International Nuclear Information System (INIS)

    Monard, François; Bal, Guillaume

    2012-01-01

    This paper concerns the reconstruction of an anisotropic diffusion tensor γ = (γ ij ) 1⩽i,j⩽2 from knowledge of internal functionals of the form γ∇u i · ∇u j with u i for 1 ⩽ i ⩽ I solutions of the elliptic equation ∇ · γ∇u i = 0 on a two-dimensional bounded domain with appropriate boundary conditions. We show that for I = 4 and appropriately chosen boundary conditions, γ may uniquely and stably be reconstructed from such internal functionals, which appear in coupled-physics inverse problems involving the ultrasound modulation of electrical or optical coefficients. Explicit reconstruction procedures for the diffusion tensor are presented and implemented numerically. (paper)

  20. Explosive anisotropic grain growth of delta-NiMo by solid-state diffusion

    International Nuclear Information System (INIS)

    Chou, T.C.; Nieh, T.G.

    1991-01-01

    Anomalous, anisotropic grain growth has been observed in delta(δ)-NiMo intermetallic compound during the annealings of Mo/Ni thin-film diffusion couples at 700 and 800 degree C. Two layered microstructures showing median-sized, equiaxed grains and large columnar single crystalline grains were generated. The growth direction of the columnar grains was parallel to the direction of Ni diffusion flux. Electron diffraction indicated that both the median-sized and the columnar grains were δ-NiMo. The composition of δ-NiMo was determined to be Ni48-Mo52 (at.%). According to the thickness of reaction-formed δ-NiMo, the apparent interdiffusion coefficient was measured to be about 10 -10 cm 2 /s which is 4 to 5 orders of magnitude greater than literature data. The enhanced diffusion rate in Ni-Mo, and the anomalous anisotropic grain growth of δ-NiMo compound are discussed on the basis of exothermic reactions between Ni and Mo during diffusional intermixing. The enthalpy of the formation of δ-NiMo is calculated and demonstrated to be sufficient to cause melting/solidification of the compound

  1. A GENERALIZED DIFFUSION TENSOR FOR FULLY ANISOTROPIC DIFFUSION OF ENERGETIC PARTICLES IN THE HELIOSPHERIC MAGNETIC FIELD

    International Nuclear Information System (INIS)

    Effenberger, F.; Fichtner, H.; Scherer, K.; Barra, S.; Kleimann, J.; Strauss, R. D.

    2012-01-01

    The spatial diffusion of cosmic rays in turbulent magnetic fields can, in the most general case, be fully anisotropic, i.e., one has to distinguish three diffusion axes in a local, field-aligned frame. We reexamine the transformation for the diffusion tensor from this local to a global frame, in which the Parker transport equation for energetic particles is usually formulated and solved. Particularly, we generalize the transformation formulae to allow for an explicit choice of two principal local perpendicular diffusion axes. This generalization includes the 'traditional' diffusion tensor in the special case of isotropic perpendicular diffusion. For the local frame, we describe the motivation for the choice of the Frenet-Serret trihedron, which is related to the intrinsic magnetic field geometry. We directly compare the old and the new tensor elements for two heliospheric magnetic field configurations, namely the hybrid Fisk and Parker fields. Subsequently, we examine the significance of the different formulations for the diffusion tensor in a standard three-dimensional model for the modulation of galactic protons. For this, we utilize a numerical code to evaluate a system of stochastic differential equations equivalent to the Parker transport equation and present the resulting modulated spectra. The computed differential fluxes based on the new tensor formulation deviate from those obtained with the 'traditional' one (only valid for isotropic perpendicular diffusion) by up to 60% for energies below a few hundred MeV depending on heliocentric distance.

  2. Patch-based anisotropic diffusion scheme for fluorescence diffuse optical tomography—part 1: technical principles

    International Nuclear Information System (INIS)

    Correia, Teresa; Arridge, Simon

    2016-01-01

    Fluorescence diffuse optical tomography (fDOT) provides 3D images of fluorescence distributions in biological tissue, which represent molecular and cellular processes. The image reconstruction problem is highly ill-posed and requires regularisation techniques to stabilise and find meaningful solutions. Quadratic regularisation tends to either oversmooth or generate very noisy reconstructions, depending on the regularisation strength. Edge preserving methods, such as anisotropic diffusion regularisation (AD), can preserve important features in the fluorescence image and smooth out noise. However, AD has limited ability to distinguish an edge from noise. In this two-part paper, we propose a patch-based anisotropic diffusion regularisation (PAD), where regularisation strength is determined by a weighted average according to the similarity between patches around voxels within a search window, instead of a simple local neighbourhood strategy. However, this method has higher computational complexity and, hence, we wavelet compress the patches (PAD-WT) to speed it up, while simultaneously taking advantage of the denoising properties of wavelet thresholding. The proposed method combines the nonlocal means (NLM), AD and wavelet shrinkage methods, which are image processing methods. Therefore, in this first paper, we used a denoising test problem to analyse the performance of the new method. Our results show that the proposed PAD-WT method provides better results than the AD or NLM methods alone. The efficacy of the method for fDOT image reconstruction problem is evaluated in part 2. (paper)

  3. Multiresolution, Multi-Scale Target Identification and Tracking using the Anisotropic Diffusion Pyramid

    National Research Council Canada - National Science Library

    Acton, Scott

    1998-01-01

    ...: the anisotropic diffusion pyramid and the morphological pyramid. Coarse-to-fine target searches are implemented within the image pyramids, providing a lOOX improvement in computational expense over standard correlation-based approaches...

  4. Absence of saturation of void growth in rate theory with anisotropic diffusion

    CERN Document Server

    Hudson, T S; Sutton, A P

    2002-01-01

    We present a first attempt at solution the problem of the growth of a single void in the presence of anisotropically diffusing radiation induced self-interstitial atom (SIA) clusters. In order to treat a distribution of voids we perform ensemble averaging over the positions of centres of voids using a mean-field approximation. In this way we are able to model physical situations in between the Standard Rate Theory (SRT) treatment of swelling (isotropic diffusion), and the purely 1-dimensional diffusion of clusters in the Production Bias Model. The background absorption by dislocations is however treated isotropically, with a bias for interstitial cluster absorption assumed similar to that of individual SIAs. We find that for moderate anisotropy, unsaturated void growth is characteristic of this anisotropic diffusion of clusters. In addition we obtain a higher initial void swelling rate than predicted by SRT whenever the diffusion is anisotropic.

  5. Patch-based anisotropic diffusion scheme for fluorescence diffuse optical tomography--part 2: image reconstruction.

    Science.gov (United States)

    Correia, Teresa; Koch, Maximilian; Ale, Angelique; Ntziachristos, Vasilis; Arridge, Simon

    2016-02-21

    Fluorescence diffuse optical tomography (fDOT) provides 3D images of fluorescence distributions in biological tissue, which represent molecular and cellular processes. The image reconstruction problem is highly ill-posed and requires regularisation techniques to stabilise and find meaningful solutions. Quadratic regularisation tends to either oversmooth or generate very noisy reconstructions, depending on the regularisation strength. Edge preserving methods, such as anisotropic diffusion regularisation (AD), can preserve important features in the fluorescence image and smooth out noise. However, AD has limited ability to distinguish an edge from noise. We propose a patch-based anisotropic diffusion regularisation (PAD), where regularisation strength is determined by a weighted average according to the similarity between patches around voxels within a search window, instead of a simple local neighbourhood strategy. However, this method has higher computational complexity and, hence, we wavelet compress the patches (PAD-WT) to speed it up, while simultaneously taking advantage of the denoising properties of wavelet thresholding. Furthermore, structural information can be incorporated into the image reconstruction with PAD-WT to improve image quality and resolution. In this case, the weights used to average voxels in the image are calculated using the structural image, instead of the fluorescence image. The regularisation strength depends on both structural and fluorescence images, which guarantees that the method can preserve fluorescence information even when it is not structurally visible in the anatomical images. In part 1, we tested the method using a denoising problem. Here, we use simulated and in vivo mouse fDOT data to assess the algorithm performance. Our results show that the proposed PAD-WT method provides high quality and noise free images, superior to those obtained using AD.

  6. Artifact reduction of compressed images and video combining adaptive fuzzy filtering and directional anisotropic diffusion

    DEFF Research Database (Denmark)

    Nadernejad, Ehsan; Forchhammer, Søren; Korhonen, Jari

    2011-01-01

    and ringing artifacts, we have applied directional anisotropic diffusion. Besides that, the selection of the adaptive threshold parameter for the diffusion coefficient has also improved the performance of the algorithm. Experimental results on JPEG compressed images as well as MJPEG and H.264 compressed......Fuzzy filtering is one of the recently developed methods for reducing distortion in compressed images and video. In this paper, we combine the powerful anisotropic diffusion equations with fuzzy filtering in order to reduce the impact of artifacts. Based on the directional nature of the blocking...... videos show improvement in artifact reduction of the proposed algorithm over other directional and spatial fuzzy filters....

  7. Micromagnetic simulation of anisotropic grain boundary diffusion for sintered Nd-Fe-B magnets

    Science.gov (United States)

    Li, W.; Zhou, Q.; Zhao, L. Z.; Wang, Q. X.; Zhong, X. C.; Liu, Z. W.

    2018-04-01

    A systematic investigation on the anisotropic grain boundary diffusion in sintered Nd-Fe-B magnets is carried out by micromagnetic simulation. The results indicate that the critical reason for the anisotropic diffusion effect is not the difference in the amount of Dy diffused along different directions but the macroscopic demagnetizing field. The diffusion parallel to the easy axis from both pole surfaces of the magnet can increase the nucleation fields in the two major regions with large macroscopic demagnetizing fields, where the reverse domains can nucleate easily. As a consequence, the grain boundary diffusion along the directions parallel to the easy axis from two pole surfaces is more effective to improve the coercivity of the magnets than that along other directions. It is also found that, to enhance the coercivity, only a limited diffusion depth is required. The present result is in good agreement with the recent experimental findings.

  8. Survey on visualization and analysis techniques based on diffusion MRI for in-vivo anisotropic diffusion structures

    International Nuclear Information System (INIS)

    Masutani, Yoshitaka; Sato, Tetsuo; Urayama, Shin-ichi; Bihan, D.L.

    2008-01-01

    In association with development of diffusion MR imaging technologies for anisotropic diffusion measurement in living body, related research is explosively increasing including research fields of applied mathematics and visualization in addition to MR imaging, biomedical image technology, and medical science. One of the reasons is that the diffusion MRI data set is a set of high dimensional image information beyond conventional scalar or vector images, and is attractive for the researchers in the related fields. This survey paper is mainly aimed at introducing state-of-the-art of post processing techniques reported in the literature for diffusion MRI data, such as analysis and visualization. (author)

  9. Effects of anisotropic turbulent thermal diffusion on spherical magnetoconvection in the Earth's core

    Science.gov (United States)

    Ivers, D. J.; Phillips, C. G.

    2018-03-01

    We re-consider the plate-like model of turbulence in the Earth's core, proposed by Braginsky and Meytlis (1990), and show that it is plausible for core parameters not only in polar regions but extends to mid- and low-latitudes where rotation and gravity are not parallel, except in a very thin equatorial layer. In this model the turbulence is highly anisotropic with preferred directions imposed by the Earth's rotation and the magnetic field. Current geodynamo computations effectively model sub-grid scale turbulence by using isotropic viscous and thermal diffusion values significantly greater than the molecular values of the Earth's core. We consider a local turbulent dynamo model for the Earth's core in which the mean magnetic field, velocity and temperature satisfy the Boussinesq induction, momentum and heat equations with an isotropic turbulent Ekman number and Roberts number. The anisotropy is modelled only in the thermal diffusion tensor with the Earth's rotation and magnetic field as preferred directions. Nonlocal organising effects of gravity and rotation (but not aspect ratio in the Earth's core) such as an inverse cascade and nonlocal transport are assumed to occur at longer length scales, which computations may accurately capture with sufficient resolution. To investigate the implications of this anisotropy for the proposed turbulent dynamo model we investigate the linear instability of turbulent magnetoconvection on length scales longer than the background turbulence in a rotating sphere with electrically insulating exterior for no-slip and isothermal boundary conditions. The equations are linearised about an axisymmetric basic state with a conductive temperature, azimuthal magnetic field and differential rotation. The basic state temperature is a function of the anisotropy and the spherical radius. Elsasser numbers in the range 1-20 and turbulent Roberts numbers 0.01-1 are considered for both equatorial symmetries of the magnetic basic state. It is found

  10. A simplified model exploration research of new anisotropic diffuse radiation model

    International Nuclear Information System (INIS)

    Yao, Wanxiang; Li, Zhengrong; Wang, Xiao; Zhao, Qun; Zhang, Zhigang; Lin, Lin

    2016-01-01

    Graphical abstract: The specific process of measured diffuse radiation data. - Highlights: • Simplified diffuse radiation model is extremely important for solar radiation simulation and energy simulation. • A new simplified anisotropic diffuse radiation model (NSADR model) is proposed. • The accuracy of existing models and NSADR model is compared based on the measured values. • The accuracy of the NSADR model is higher than that of the existing models, and suitable for calculating diffuse radiation. - Abstract: More accurate new anisotropic diffuse radiation model (NADR model) has been proposed, but the parameters and calculation process of NADR model used in the process are complex. So it is difficult to widely used in the simulation software and engineering calculation. Based on analysis of the diffuse radiation model and measured diffuse radiation data, this paper put forward three hypotheses: (1) diffuse radiation from sky horizontal region is concentrated in a very thin layer which is close to the line source; (2) diffuse radiation from circumsolar region is concentrated in the point of the sun; (3) diffuse radiation from orthogonal region is concentrated in the point located at 90 degree angles with the Sun. Based on these hypotheses, NADR model is simplified to a new simplified anisotropic diffuse radiation model (NSADR model). Then the accuracy of NADR model and its simplified model (NSADR model) are compared with existing models based on the measured values, and the result shows that Perez model and its simplified model are relatively accurate among existing models. However, the accuracy of these two models is lower than the NADR model and NSADR model due to neglect the influence of the orthogonal diffuse radiation. The accuracy of the NSADR model is higher than that of the existing models, meanwhile, another advantage is that the NSADR model simplifies the process of solution parameters and calculation. Therefore it is more suitable for

  11. Magnetic resonance temporal diffusion tensor spectroscopy of disordered anisotropic tissue

    DEFF Research Database (Denmark)

    Nielsen, Jonathan Scharff; Dyrby, Tim B; Lundell, Henrik

    2018-01-01

    Molecular diffusion measured with diffusion weighted MRI (DWI) offers a probe for tissue microstructure. However, inferring microstructural properties from conventional DWI data is a complex inverse problem and has to account for heterogeneity in sizes, shapes and orientations of the tissue...

  12. Magnetic resonance temporal diffusion tensor spectroscopy of disordered anisotropic tissue

    DEFF Research Database (Denmark)

    Nielsen, Jonathan Scharff; Dyrby, Tim Bjørn; Lundell, Henrik

    2018-01-01

    of the oscillating gradient spin echo (OGSE) experiment, giving a basic contrast mechanism closely linked to both the temporal diffusion spectrum and the compartment anisotropy. We demonstrate our new method on post mortem brain tissue and show that we retrieve the correct temporal diffusion tensor spectrum...

  13. Anisotropic diffusion of 51Cr in Zr-α monocrystals

    International Nuclear Information System (INIS)

    Varela, N.; Balart, S.; Tendler, R.

    1983-01-01

    The volume diffusion coefficients of the fast-diffusing solute 51 Cr were obtained in oriented α-Zr single-crystals, in the directions parallel and perpendicular to the c axis. The dependence of those diffusion coefficients with temperature was also measured between 750 0 C and 848 0 C. Single-crystals were grown by thermal cycling through the transformation α β (863 0 C). Diffusion coefficients were measured using the 'thin film' method. In some experiments non-gaussian penetration profiles were obtained and this behaviour is analyzed in the Appendix. The diffusion of 51 Cr is faster in the c axis direction, with Q sub(//) (1.59 eV) [pt

  14. Anisotropic conductivity tensor imaging in MREIT using directional diffusion rate of water molecules

    International Nuclear Information System (INIS)

    Kwon, Oh In; Jeong, Woo Chul; Sajib, Saurav Z K; Kim, Hyung Joong; Woo, Eung Je

    2014-01-01

    Magnetic resonance electrical impedance tomography (MREIT) is an emerging method to visualize electrical conductivity and/or current density images at low frequencies (below 1 KHz). Injecting currents into an imaging object, one component of the induced magnetic flux density is acquired using an MRI scanner for isotropic conductivity image reconstructions. Diffusion tensor MRI (DT-MRI) measures the intrinsic three-dimensional diffusion property of water molecules within a tissue. It characterizes the anisotropic water transport by the effective diffusion tensor. Combining the DT-MRI and MREIT techniques, we propose a novel direct method for absolute conductivity tensor image reconstructions based on a linear relationship between the water diffusion tensor and the electrical conductivity tensor. We first recover the projected current density, which is the best approximation of the internal current density one can obtain from the measured single component of the induced magnetic flux density. This enables us to estimate a scale factor between the diffusion tensor and the conductivity tensor. Combining these values at all pixels with the acquired diffusion tensor map, we can quantitatively recover the anisotropic conductivity tensor map. From numerical simulations and experimental verifications using a biological tissue phantom, we found that the new method overcomes the limitations of each method and successfully reconstructs both the direction and magnitude of the conductivity tensor for both the anisotropic and isotropic regions. (paper)

  15. Imaging of postthalamic visual fiber tracts by anisotropic diffusion weighted MRI and diffusion tensor imaging: principles and applications

    International Nuclear Information System (INIS)

    Reinges, Marcus H.T.; Schoth, Felix; Coenen, Volker A.; Krings, Timo

    2004-01-01

    Diffusion weighted MRI offers the possibility to study the course of the cerebral white matter tracts. In the present manuscript, the basics, the technique and the limitations of diffusion tensor imaging and anisotropic diffusion weighted MRI are presented and their applications in various neurological and neurosurgical diseases are discussed with special emphasis on the visual system. A special focus is laid on the combination of fiber tract imaging, anatomical imaging and functional MRI for presurgical planning and intraoperative neuronavigation of lesions near the visual system

  16. Understanding the anisotropic strain effects on lithium diffusion in graphite anodes: A first-principles study

    Science.gov (United States)

    Ji, Xiang; Wang, Yang; Zhang, Junqian

    2018-06-01

    The lithium diffusion in graphite anode, which is the most widely used commercial electrode material today, affects the charge/discharge performance of lithium-ion batteries. In this study, the anisotropic strain effects on lithium diffusion in graphite anodes are systematically investigated using first-principles calculations based on density functional theory (DFT) with van der Waals corrections. It is found that the effects of external applied strains along various directions of LixC6 (i.e., perpendicular or parallel to the basal planes of the graphite host) on lithium diffusivity are different. Along the direction perpendicular to the graphite planes, the tensile strain facilitates in-plane Li diffusion by reducing the energy barrier, and the compressive strain hinders in-plane Li diffusion by raising the energy barrier. In contrast, the in-plane biaxial tensile strain (parallel to the graphite planes) hinders in-plane Li diffusion, and the in-plane biaxial compressive strain facilitates in-plane Li diffusion. Furthermore, both in-plane and transverse shear strains slightly influence Li diffusion in graphite anodes. A discussion is presented to explain the anisotropic strain dependence of lithium diffusion. This research provides data for the continuum modelling of the electrodes in the lithium-ion batteries.

  17. 3-D anisotropic neutron diffusion in optically thick media with optically thin channels

    International Nuclear Information System (INIS)

    Trahan, Travis J.; Larsen, Edward W.

    2011-01-01

    Standard neutron diffusion theory accurately approximates the neutron transport process for optically thick, scattering-dominated systems in which the angular neutron flux is a weak (nearly linear) function of angle. Therefore, standard diffusion theory is not directly applicable for Very High Temperature Reactor (VHTR) cores, which contain numerous narrow, axially-oriented, nearly-voided coolant channels. However, we have derived a new, accurate diffusion equation for such problems, which contains nonstandard anisotropic diffusion coefficients near and within the channels, but which reduces to the standard diffusion approximation away from the channels. The new diffusion approximation significantly improves the accuracy of VHTR diffusion simulations, while having lower computational cost than higher-order transport methods. (author)

  18. Pulsed neutron determination of anisotropic diffusion constants in multi-layered slabs

    International Nuclear Information System (INIS)

    Sri Ram, K.

    1978-01-01

    Anisotropic neutron diffusion parameters for graphite and plexiglas slab assemblies were calculated using one-dimensional discrete ordinates code ANISN, and also Case's eigenfunction expansion technique as suggested by Leonard. These calculated values were checked with the pulsed neutron experimental results as well as simple diffusion theory calculations of Spinrad. Relatively little experimental work has been done with heterogeneous assemblies which do not contain voids. The present comparison shows that the experimental results agree well with transport theory calculations. It appears from the results and inter-comparison of this work in simple geometries, that the pulsed neutron method can yield accurate experimental anisotropic diffusion constants, and can therefore be applied to more complicated geometries which may be difficult to calculate. (author)

  19. An efficient explicit numerical scheme for diffusion-type equations with a highly inhomogeneous and highly anisotropic diffusion tensor

    International Nuclear Information System (INIS)

    Larroche, O.

    2007-01-01

    A locally split-step explicit (LSSE) algorithm was developed for efficiently solving a multi-dimensional advection-diffusion type equation involving a highly inhomogeneous and highly anisotropic diffusion tensor, which makes the problem very ill-conditioned for standard implicit methods involving the iterative solution of large linear systems. The need for such an optimized algorithm arises, in particular, in the frame of thermonuclear fusion applications, for the purpose of simulating fast charged-particle slowing-down with an ion Fokker-Planck code. The LSSE algorithm is presented in this paper along with the results of a model slowing-down problem to which it has been applied

  20. A review of anisotropic conductivity models of brain white matter based on diffusion tensor imaging.

    Science.gov (United States)

    Wu, Zhanxiong; Liu, Yang; Hong, Ming; Yu, Xiaohui

    2018-06-01

    The conductivity of brain tissues is not only essential for electromagnetic source estimation (ESI), but also a key reflector of the brain functional changes. Different from the other brain tissues, the conductivity of whiter matter (WM) is highly anisotropic and a tensor is needed to describe it. The traditional electrical property imaging methods, such as electrical impedance tomography (EIT) and magnetic resonance electrical impedance tomography (MREIT), usually fail to image the anisotropic conductivity tensor of WM with high spatial resolution. The diffusion tensor imaging (DTI) is a newly developed technique that can fulfill this purpose. This paper reviews the existing anisotropic conductivity models of WM based on the DTI and discusses their advantages and disadvantages, as well as identifies opportunities for future research on this subject. It is crucial to obtain the linear conversion coefficient between the eigenvalues of anisotropic conductivity tensor and diffusion tensor, since they share the same eigenvectors. We conclude that the electrochemical model is suitable for ESI analysis because the conversion coefficient can be directly obtained from the concentration of ions in extracellular liquid and that the volume fraction model is appropriate to study the influence of WM structural changes on electrical conductivity. Graphical abstract ᅟ.

  1. Speckle reduction in echocardiography by temporal compounding and anisotropic diffusion filtering

    Science.gov (United States)

    Giraldo-Guzmán, Jader; Porto-Solano, Oscar; Cadena-Bonfanti, Alberto; Contreras-Ortiz, Sonia H.

    2015-01-01

    Echocardiography is a medical imaging technique based on ultrasound signals that is used to evaluate heart anatomy and physiology. Echocardiographic images are affected by speckle, a type of multiplicative noise that obscures details of the structures, and reduces the overall image quality. This paper shows an approach to enhance echocardiography using two processing techniques: temporal compounding and anisotropic diffusion filtering. We used twenty echocardiographic videos that include one or three cardiac cycles to test the algorithms. Two images from each cycle were aligned in space and averaged to obtain the compound images. These images were then processed using anisotropic diffusion filters to further improve their quality. Resultant images were evaluated using quality metrics and visual assessment by two medical doctors. The average total improvement on signal-to-noise ratio was up to 100.29% for videos with three cycles, and up to 32.57% for videos with one cycle.

  2. Anisotropic Diffusion In Layered Argillaceous Rocks: A Case Study With Opalinus Clay

    International Nuclear Information System (INIS)

    Van Loon, L.R.; Soler, J.; Mueller, W.; Bradbury, M.H.

    2003-01-01

    Anisotropic diffusion was studied in Opalinus Clay, a potential host rock for the disposal of spent fuel, vitrified high-level waste and intermediate-level waste. Diffusion parallel to the bedding was measured using a radial through-diffusion technique, while diffusion perpendicular to the bedding was measured using the classical (planar) through-diffusion method. The materials used were samples from Mont Terri (MT) and Benken (BE), respectively. Diffusion of Tritiated Water (HTO), parallel and perpendicular to the bedding, was studied under confining pressures of 7 MPa (MT) and 14 MPa (BE), respectively. The effective diffusion coefficient for diffusion parallel to the bedding, D e , was found to be 3.20(±0.26)x10 11 m 2 s -1 and for the Benken 5.39(±0.43)x10 -11 m 2 s-1 for the Mont Terri samples. The diffusion accessible porosity was ∼ 0.15(±0.02) in both cases. For diffusion perpendicular to the bedding, the effective diffusion coefficient was 5.44(±0.35)x10 -12 m 2 s-1 and 1.37(±0.08)x10 -11 m 2 s -1 for the Benken and Mont Terri samples, respectively. The diffusion accessible porosity was also ∼0.15(±0.02) in both cases. These first results indicate that diffusion parallel to bedding is larger than that perpendicular to the bedding by a factor of 4 to 6. This might be explained in terms of smaller path lengths (tortuosity) for species diffusing parallel to the fabric. (author)

  3. Anisotropic Diffusion In Layered Argillaceous Rocks: A Case Study With Opalinus Clay

    Energy Technology Data Exchange (ETDEWEB)

    Van Loon, L.R.; Soler, J.; Mueller, W.; Bradbury, M.H

    2003-03-01

    Anisotropic diffusion was studied in Opalinus Clay, a potential host rock for the disposal of spent fuel, vitrified high-level waste and intermediate-level waste. Diffusion parallel to the bedding was measured using a radial through-diffusion technique, while diffusion perpendicular to the bedding was measured using the classical (planar) through-diffusion method. The materials used were samples from Mont Terri (MT) and Benken (BE), respectively. Diffusion of Tritiated Water (HTO), parallel and perpendicular to the bedding, was studied under confining pressures of 7 MPa (MT) and 14 MPa (BE), respectively. The effective diffusion coefficient for diffusion parallel to the bedding, D{sub e}, was found to be 3.20({+-}0.26)x10{sup 11} m{sup 2}s{sup -1} and for the Benken 5.39({+-}0.43)x10{sup -11} m{sup 2}s-1 for the Mont Terri samples. The diffusion accessible porosity was {approx} 0.15({+-}0.02) in both cases. For diffusion perpendicular to the bedding, the effective diffusion coefficient was 5.44({+-}0.35)x10{sup -12} m{sup 2}s-1 and 1.37({+-}0.08)x10{sup -11} m{sup 2}s{sup -1} for the Benken and Mont Terri samples, respectively. The diffusion accessible porosity was also {approx}0.15({+-}0.02) in both cases. These first results indicate that diffusion parallel to bedding is larger than that perpendicular to the bedding by a factor of 4 to 6. This might be explained in terms of smaller path lengths (tortuosity) for species diffusing parallel to the fabric. (author)

  4. Estimating anisotropic diffusion of neutrons near the boundary of a pebble bed random system

    International Nuclear Information System (INIS)

    Vasques, R.

    2013-01-01

    Due to the arrangement of the pebbles in a Pebble Bed Reactor (PBR) core, if a neutron is located close to a boundary wall, its path length probability distribution function in directions of flight parallel to the wall is significantly different than in other directions. Hence, anisotropic diffusion of neutrons near the boundaries arises. We describe an analysis of neutron transport in a simplified 3-D pebble bed random system, in which we investigate the anisotropic diffusion of neutrons born near one of the system's boundary walls. While this simplified system does not model the actual physical process that takes place near the boundaries of a PBR core, the present work paves the road to a formulation that may enable more accurate diffusion simulations of such problems to be performed in the future. Monte Carlo codes have been developed for (i) deriving realizations of the 3-D random system, and (ii) performing 3-D neutron transport inside the heterogeneous model; numerical results are presented for three different choices of parameters. These numerical results are used to assess the accuracy of estimates for the mean-squared displacement of neutrons obtained with the diffusion approximations of the Atomic Mix Model and of the recently introduced [1] Non-Classical Theory with angular-dependent path length distribution. The Non-Classical Theory makes use of a Generalized Linear Boltzmann Equation in which the locations of the scattering centers in the system are correlated and the distance to collision is not exponentially distributed. We show that the results predicted using the Non-Classical Theory successfully model the anisotropic behavior of the neutrons in the random system, and more closely agree with experiment than the results predicted by the Atomic Mix Model. (authors)

  5. Estimating anisotropic diffusion of neutrons near the boundary of a pebble bed random system

    Energy Technology Data Exchange (ETDEWEB)

    Vasques, R. [Department of Mathematics, Center for Computational Engineering Science, RWTH Aachen University, Schinkel Strasse 2, D-52062 Aachen (Germany)

    2013-07-01

    Due to the arrangement of the pebbles in a Pebble Bed Reactor (PBR) core, if a neutron is located close to a boundary wall, its path length probability distribution function in directions of flight parallel to the wall is significantly different than in other directions. Hence, anisotropic diffusion of neutrons near the boundaries arises. We describe an analysis of neutron transport in a simplified 3-D pebble bed random system, in which we investigate the anisotropic diffusion of neutrons born near one of the system's boundary walls. While this simplified system does not model the actual physical process that takes place near the boundaries of a PBR core, the present work paves the road to a formulation that may enable more accurate diffusion simulations of such problems to be performed in the future. Monte Carlo codes have been developed for (i) deriving realizations of the 3-D random system, and (ii) performing 3-D neutron transport inside the heterogeneous model; numerical results are presented for three different choices of parameters. These numerical results are used to assess the accuracy of estimates for the mean-squared displacement of neutrons obtained with the diffusion approximations of the Atomic Mix Model and of the recently introduced [1] Non-Classical Theory with angular-dependent path length distribution. The Non-Classical Theory makes use of a Generalized Linear Boltzmann Equation in which the locations of the scattering centers in the system are correlated and the distance to collision is not exponentially distributed. We show that the results predicted using the Non-Classical Theory successfully model the anisotropic behavior of the neutrons in the random system, and more closely agree with experiment than the results predicted by the Atomic Mix Model. (authors)

  6. Simulation of anisotropic diffusion by means of a diffusion velocity method

    CERN Document Server

    Beaudoin, A; Rivoalen, E

    2003-01-01

    An alternative method to the Particle Strength Exchange method for solving the advection-diffusion equation in the general case of a non-isotropic and non-uniform diffusion is proposed. This method is an extension of the diffusion velocity method. It is shown that this extension is quite straightforward due to the explicit use of the diffusion flux in the expression of the diffusion velocity. This approach is used to simulate pollutant transport in groundwater and the results are compared to those of the PSE method presented in an earlier study by Zimmermann et al.

  7. An Efficient FPGA Implementation of Optimized Anisotropic Diffusion Filtering of Images

    Directory of Open Access Journals (Sweden)

    Chandrajit Pal

    2016-01-01

    Full Text Available Digital image processing is an exciting area of research with a variety of applications including medical, surveillance security systems, defence, and space applications. Noise removal as a preprocessing step helps to improve the performance of the signal processing algorithms, thereby enhancing image quality. Anisotropic diffusion filtering proposed by Perona and Malik can be used as an edge-preserving smoother, removing high-frequency components of images without blurring their edges. In this paper, we present the FPGA implementation of an edge-preserving anisotropic diffusion filter for digital images. The designed architecture completely replaced the convolution operation and implemented the same using simple arithmetic subtraction of the neighboring intensities within a kernel, preceded by multiple operations in parallel within the kernel. To improve the image reconstruction quality, the diffusion coefficient parameter, responsible for controlling the filtering process, has been properly analyzed. Its signal behavior has been studied by subsequently scaling and differentiating the signal. The hardware implementation of the proposed design shows better performance in terms of reconstruction quality and accelerated performance with respect to its software implementation. It also reduces computation, power consumption, and resource utilization with respect to other related works.

  8. Simultaneous characterization of rotational and translational diffusion of optically anisotropic particles by optical microscopy

    International Nuclear Information System (INIS)

    Giavazzi, Fabio; Cerbino, Roberto; Haro-Pérez, Catalina

    2016-01-01

    We probe the roto-translational Brownian motion of optically anisotropic particles suspended in water with a simple and straightforward optical microscopy experiment that does not require positional or rotational particle tracking. We acquire a movie of the suspension placed between two polarizing elements and we extract the translational diffusion coefficient D T and the rotational diffusion coefficient D R from the analysis of the temporal correlation properties of the spatial Fourier modes of the intensity fluctuations in the movie. Our method is successfully tested with a dilute suspension of birefringent spherical colloidal particles obtained by polymerizing an emulsion of droplets of liquid crystal in a nematic phase, whose roto-translational dynamics is found to be well described by theory. The simplicity of our approach makes our method a viable alternative to particle tracking and depolarized dynamic light scattering. (paper)

  9. Speckle Reduction and Structure Enhancement by Multichannel Median Boosted Anisotropic Diffusion

    Directory of Open Access Journals (Sweden)

    Yang Zhi

    2004-01-01

    Full Text Available We propose a new approach to reduce speckle noise and enhance structures in speckle-corrupted images. It utilizes a median-anisotropic diffusion compound scheme. The median-filter-based reaction term acts as a guided energy source to boost the structures in the image being processed. In addition, it regularizes the diffusion equation to ensure the existence and uniqueness of a solution. We also introduce a decimation and back reconstruction scheme to further enhance the processing result. Before the iteration of the diffusion process, the image is decimated and a subpixel shifted image set is formed. This allows a multichannel parallel diffusion iteration, and more importantly, the speckle noise is broken into impulsive or salt-pepper noise, which is easy to remove by median filtering. The advantage of the proposed technique is clear when it is compared to other diffusion algorithms and the well-known adaptive weighted median filtering (AWMF scheme in both simulation and real medical ultrasound images.

  10. Drag and diffusion of heavy quarks in a hot and anisotropic QCD medium

    International Nuclear Information System (INIS)

    Srivastava, P.K.; Patra, Binoy Krishna

    2017-01-01

    The propagation of heavy quarks (HQs) in a medium was quite often modeled by the Fokker-Planck (FP) equation. Since the transport coefficients, related to drag and diffusion processes, are the main ingredients in the FP equation, the evolution of HQs is thus effectively controlled by them. At the initial stage of the relativistic heavy-ion collisions, asymptotic weak-coupling causes the free-streaming motions of partons in the beam direction and the expansions in transverse directions are almost frozen, hence an anisotropy in the momentum space sets in. Since HQs are too produced in the same time, the study of the effect of momentum anisotropy on the drag and diffusion coefficients becomes highly desirable. In this article we have thus studied the drag and diffusion of HQs in the anisotropic medium and found that the presence of the anisotropy reduces both drag and diffusion coefficients. In addition, the anisotropy introduces an angular dependence to both the drag and diffusion coefficients, as a result both coefficients get more inflated when the partons are moving transversely to the direction of anisotropy than when moving parallel to the direction of anisotropy. (orig.)

  11. Drag and diffusion of heavy quarks in a hot and anisotropic QCD medium

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, P.K.; Patra, Binoy Krishna [Indian Institute of Technology Roorkee, Department of Physics, Roorkee (India)

    2017-06-15

    The propagation of heavy quarks (HQs) in a medium was quite often modeled by the Fokker-Planck (FP) equation. Since the transport coefficients, related to drag and diffusion processes, are the main ingredients in the FP equation, the evolution of HQs is thus effectively controlled by them. At the initial stage of the relativistic heavy-ion collisions, asymptotic weak-coupling causes the free-streaming motions of partons in the beam direction and the expansions in transverse directions are almost frozen, hence an anisotropy in the momentum space sets in. Since HQs are too produced in the same time, the study of the effect of momentum anisotropy on the drag and diffusion coefficients becomes highly desirable. In this article we have thus studied the drag and diffusion of HQs in the anisotropic medium and found that the presence of the anisotropy reduces both drag and diffusion coefficients. In addition, the anisotropy introduces an angular dependence to both the drag and diffusion coefficients, as a result both coefficients get more inflated when the partons are moving transversely to the direction of anisotropy than when moving parallel to the direction of anisotropy. (orig.)

  12. Edge Probability and Pixel Relativity-Based Speckle Reducing Anisotropic Diffusion.

    Science.gov (United States)

    Mishra, Deepak; Chaudhury, Santanu; Sarkar, Mukul; Soin, Arvinder Singh; Sharma, Vivek

    2018-02-01

    Anisotropic diffusion filters are one of the best choices for speckle reduction in the ultrasound images. These filters control the diffusion flux flow using local image statistics and provide the desired speckle suppression. However, inefficient use of edge characteristics results in either oversmooth image or an image containing misinterpreted spurious edges. As a result, the diagnostic quality of the images becomes a concern. To alleviate such problems, a novel anisotropic diffusion-based speckle reducing filter is proposed in this paper. A probability density function of the edges along with pixel relativity information is used to control the diffusion flux flow. The probability density function helps in removing the spurious edges and the pixel relativity reduces the oversmoothing effects. Furthermore, the filtering is performed in superpixel domain to reduce the execution time, wherein a minimum of 15% of the total number of image pixels can be used. For performance evaluation, 31 frames of three synthetic images and 40 real ultrasound images are used. In most of the experiments, the proposed filter shows a better performance as compared to the state-of-the-art filters in terms of the speckle region's signal-to-noise ratio and mean square error. It also shows a comparative performance for figure of merit and structural similarity measure index. Furthermore, in the subjective evaluation, performed by the expert radiologists, the proposed filter's outputs are preferred for the improved contrast and sharpness of the object boundaries. Hence, the proposed filtering framework is suitable to reduce the unwanted speckle and improve the quality of the ultrasound images.

  13. Analysis of the Numerical Diffusion in Anisotropic Mediums: Benchmarks for Magnetic Field Aligned Meshes in Space Propulsion Simulations

    Directory of Open Access Journals (Sweden)

    Daniel Pérez-Grande

    2016-11-01

    Full Text Available This manuscript explores numerical errors in highly anisotropic diffusion problems. First, the paper addresses the use of regular structured meshes in numerical solutions versus meshes aligned with the preferential directions of the problem. Numerical diffusion in structured meshes is quantified by solving the classical anisotropic diffusion problem; the analysis is exemplified with the application to a numerical model of conducting fluids under magnetic confinement, where rates of transport in directions parallel and perpendicular to a magnetic field are quite different. Numerical diffusion errors in this problem promote the use of magnetic field aligned meshes (MFAM. The generation of this type of meshes presents some challenges; several meshing strategies are implemented and analyzed in order to provide insight into achieving acceptable mesh regularity. Second, Gradient Reconstruction methods for magnetically aligned meshes are addressed and numerical errors are compared for the structured and magnetically aligned meshes. It is concluded that using the latter provides a more correct and straightforward approach to solving problems where anisotropicity is present, especially, if the anisotropicity level is high or difficult to quantify. The conclusions of the study may be extrapolated to the study of anisotropic flows different from conducting fluids.

  14. Deuterium diffusion along the three principal directions in anisotropic Zr–2.5Nb

    Energy Technology Data Exchange (ETDEWEB)

    Khatamian, D., E-mail: khatamiand@aecl.ca

    2013-12-15

    Highlights: •Diffusivity of deuterium in a Zr–2.5Nb plate was measured. •The plate had similar microstructure to that of a CANDU pressure tube. •Diffusion coefficients in the radial direction were 24% less than in the longitudinal direction. •These findings are in close agreement with the theoretical estimates made in the literature. -- Abstract: Pressure tubes of cold-worked Zr–2.5Nb material are used in the CANDU (CANada Deuterium Uranium is a registered trademark of Atomic Energy of Canada Ltd.) reactors to contain the fuel bundles and the heavy water coolant. The pressure tube microstructure consists of α-Zr platelets, with an aspect ratio of 1:5:50 in the radial, transverse and longitudinal directions, surrounded by a thin layer of β-Zr. The diffusivity of hydrogen in β-Zr is higher than in α-Zr. As a result, the diffusivity of hydrogen in the pressure tube material is enhanced compared to unalloyed α-Zr. Due to the anisotropic microstructure of the pressure tube with respect to the β-Zr network, the diffusivity of hydrogen is thought to be different in the three principal pressure tube directions. Measurements made using specimens machined from an 8 mm thick Zr–2.5Nb plate, with a microstructure similar to that of a CANDU pressure tube, suggest the difference between the diffusion constants for deuterium in different directions of an as-installed pressure tube may be as high as 25%.

  15. Scalable explicit implementation of anisotropic diffusion with Runge-Kutta-Legendre super-time stepping

    Science.gov (United States)

    Vaidya, Bhargav; Prasad, Deovrat; Mignone, Andrea; Sharma, Prateek; Rickler, Luca

    2017-12-01

    An important ingredient in numerical modelling of high temperature magnetized astrophysical plasmas is the anisotropic transport of heat along magnetic field lines from higher to lower temperatures. Magnetohydrodynamics typically involves solving the hyperbolic set of conservation equations along with the induction equation. Incorporating anisotropic thermal conduction requires to also treat parabolic terms arising from the diffusion operator. An explicit treatment of parabolic terms will considerably reduce the simulation time step due to its dependence on the square of the grid resolution (Δx) for stability. Although an implicit scheme relaxes the constraint on stability, it is difficult to distribute efficiently on a parallel architecture. Treating parabolic terms with accelerated super-time-stepping (STS) methods has been discussed in literature, but these methods suffer from poor accuracy (first order in time) and also have difficult-to-choose tuneable stability parameters. In this work, we highlight a second-order (in time) Runge-Kutta-Legendre (RKL) scheme (first described by Meyer, Balsara & Aslam 2012) that is robust, fast and accurate in treating parabolic terms alongside the hyperbolic conversation laws. We demonstrate its superiority over the first-order STS schemes with standard tests and astrophysical applications. We also show that explicit conduction is particularly robust in handling saturated thermal conduction. Parallel scaling of explicit conduction using RKL scheme is demonstrated up to more than 104 processors.

  16. Effects of MR parameter changes on the quantification of diffusion anisotropy and apparent diffusion coefficient in diffusion tensor imaging: Evaluation using a diffusional anisotropic phantom

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang Joon; Choi, Choong Gon; Kim, Jeong Kon [Dept. of Radiology, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Yun, Sung Cheol [Dept. of Biostatistics, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Jeong, Ha Kyu [Dept. of Radiology, East-West Neomedical Center, Kyung Hee University College of Medicine, Seoul (Korea, Republic of); Kim, Eun Ju [Clinical Scientist, MR, Philips Healthcare, Seoul (Korea, Republic of)

    2015-04-15

    To validate the usefulness of a diffusional anisotropic capillary array phantom and to investigate the effects of diffusion tensor imaging (DTI) parameter changes on diffusion fractional anisotropy (FA) and apparent diffusion coefficient (ADC) using the phantom. Diffusion tensor imaging of a capillary array phantom was performed with imaging parameter changes, including voxel size, number of sensitivity encoding (SENSE) factor, echo time (TE), number of signal acquisitions, b-value, and number of diffusion gradient directions (NDGD), one-at-a-time in a stepwise-incremental fashion. We repeated the entire series of DTI scans thrice. The coefficients of variation (CoV) were evaluated for FA and ADC, and the correlation between each MR imaging parameter and the corresponding FA and ADC was evaluated using Spearman's correlation analysis. The capillary array phantom CoVs of FA and ADC were 7.1% and 2.4%, respectively. There were significant correlations between FA and SENSE factor, TE, b-value, and NDGD, as well as significant correlations between ADC and SENSE factor, TE, and b-value. A capillary array phantom enables repeated measurements of FA and ADC. Both FA and ADC can vary when certain parameters are changed during diffusion experiments. We suggest that the capillary array phantom can be used for quality control in longitudinal or multicenter clinical studies.

  17. Perona Malik anisotropic diffusion model using Peaceman Rachford scheme on digital radiographic image

    International Nuclear Information System (INIS)

    Halim, Suhaila Abd; Razak, Rohayu Abd; Ibrahim, Arsmah; Manurung, Yupiter HP

    2014-01-01

    In image processing, it is important to remove noise without affecting the image structure as well as preserving all the edges. Perona Malik Anisotropic Diffusion (PMAD) is a PDE-based model which is suitable for image denoising and edge detection problems. In this paper, the Peaceman Rachford scheme is applied on PMAD to remove unwanted noise as the scheme is efficient and unconditionally stable. The capability of the scheme to remove noise is evaluated on several digital radiography weld defect images computed using MATLAB R2009a. Experimental results obtained show that the Peaceman Rachford scheme improves the image quality substantially well based on the Peak Signal to Noise Ratio (PSNR). The Peaceman Rachford scheme used in solving the PMAD model successfully removes unwanted noise in digital radiographic image

  18. Perona Malik anisotropic diffusion model using Peaceman Rachford scheme on digital radiographic image

    Energy Technology Data Exchange (ETDEWEB)

    Halim, Suhaila Abd; Razak, Rohayu Abd; Ibrahim, Arsmah [Center of Mathematics Studies, Faculty of Computer and Mathematical Sciences, Universiti Teknologi MARA, 40450 Shah Alam. Selangor DE (Malaysia); Manurung, Yupiter HP [Advanced Manufacturing Technology Excellence Center (AMTEx), Faculty of Mechanical Engineering, Universiti Teknologi MARA, 40450 Shah Alam. Selangor DE (Malaysia)

    2014-06-19

    In image processing, it is important to remove noise without affecting the image structure as well as preserving all the edges. Perona Malik Anisotropic Diffusion (PMAD) is a PDE-based model which is suitable for image denoising and edge detection problems. In this paper, the Peaceman Rachford scheme is applied on PMAD to remove unwanted noise as the scheme is efficient and unconditionally stable. The capability of the scheme to remove noise is evaluated on several digital radiography weld defect images computed using MATLAB R2009a. Experimental results obtained show that the Peaceman Rachford scheme improves the image quality substantially well based on the Peak Signal to Noise Ratio (PSNR). The Peaceman Rachford scheme used in solving the PMAD model successfully removes unwanted noise in digital radiographic image.

  19. Antiproton cross-field diffusion in antihydrogen production experiments due to anisotropic binary interactions

    International Nuclear Information System (INIS)

    Ordonez, C.A.; Correa, J.R.

    2007-01-01

    Collisional processes in electrostatic ion storage rings and reflecting-beam-type electrostatic ion traps can be associated with anisotropic binary interactions, because shielding of the Coulomb interactions may not take place in one or more dimensions. Collisional scattering theory has recently been developed for describing the velocity-space scattering processes in such systems [J.R. Correa, Y. Chang, C.A. Ordonez, Phys. Plasmas 12 (2005) 084505]. The theory is extended to enable the effect of a magnetic field to be included. The theory is intended to be applicable, for example, to antiproton scattering within nested Penning traps that are used to produce antihydrogen [M. Amoretti et al., Nature 419 (2002) 456; G. Gabrielse et al., Phys. Rev. Lett. 89 (2002) 213401]. The theory is applied for considering the cross-magnetic-field diffusion of the antiprotons

  20. Dynamics of interface in three-dimensional anisotropic bistable reaction-diffusion system

    International Nuclear Information System (INIS)

    He Zhizhu; Liu, Jing

    2010-01-01

    This paper presents a theoretical investigation of dynamics of interface (wave front) in three-dimensional (3D) reaction-diffusion (RD) system for bistable media with anisotropy constructed by means of anisotropic surface tension. An equation of motion for the wave front is derived to carry out stability analysis of transverse perturbations, which discloses mechanism of pattern formation such as labyrinthine in 3D bistable media. Particularly, the effects of anisotropy on wave propagation are studied. It was found that, sufficiently strong anisotropy can induce dynamical instabilities and lead to breakup of the wave front. With the fast-inhibitor limit, the bistable system can further be described by a variational dynamics so that the boundary integral method is adopted to study the dynamics of wave fronts.

  1. Anisotropic Rotational Diffusion Studied by Nuclear Spin Relaxation and Molecular Dynamics Simulation: An Undergraduate Physical Chemistry Laboratory

    Science.gov (United States)

    Fuson, Michael M.

    2017-01-01

    Laboratories studying the anisotropic rotational diffusion of bromobenzene using nuclear spin relaxation and molecular dynamics simulations are described. For many undergraduates, visualizing molecular motion is challenging. Undergraduates rarely encounter laboratories that directly assess molecular motion, and so the concept remains an…

  2. Development and application of an exchange model for anisotropic water diffusion in the microporous MOF aluminum fumarate

    Science.gov (United States)

    Splith, Tobias; Fröhlich, Dominik; Henninger, Stefan K.; Stallmach, Frank

    2018-06-01

    Diffusion of water in aluminum fumarate was studied by means of pulsed field gradient (PFG) nuclear magnetic resonance (NMR). Due to water molecules exchanging between the intracrystalline anisotropic pore space and the isotropic intercrystalline void space the model of intracrystalline anisotropic diffusion fails to describe the experimental PFG NMR data at high observation times. Therefore, the two-site exchange model developed by Kärger is extended to the case of exchange between an anisotropic and an isotropic site. This extended exchange model is solved by numerical integration. It describes the experimental data very well and yields values for the intracrystalline diffusion coefficient and the mean residence times of the respective sites. Further PFG NMR studies were performed with coatings consisting of small aluminum fumarate crystals, which are used in adsorptive heat transformation applications. The diffusion coefficients of water in the small crystal coating are compared to the values expected from the extended two-site exchange model and from the model of long-range diffusion.

  3. A locally conservative non-negative finite element formulation for anisotropic advective-diffusive-reactive systems

    Science.gov (United States)

    Mudunuru, M. K.; Shabouei, M.; Nakshatrala, K.

    2015-12-01

    Advection-diffusion-reaction (ADR) equations appear in various areas of life sciences, hydrogeological systems, and contaminant transport. Obtaining stable and accurate numerical solutions can be challenging as the underlying equations are coupled, nonlinear, and non-self-adjoint. Currently, there is neither a robust computational framework available nor a reliable commercial package known that can handle various complex situations. Herein, the objective of this poster presentation is to present a novel locally conservative non-negative finite element formulation that preserves the underlying physical and mathematical properties of a general linear transient anisotropic ADR equation. In continuous setting, governing equations for ADR systems possess various important properties. In general, all these properties are not inherited during finite difference, finite volume, and finite element discretizations. The objective of this poster presentation is two fold: First, we analyze whether the existing numerical formulations (such as SUPG and GLS) and commercial packages provide physically meaningful values for the concentration of the chemical species for various realistic benchmark problems. Furthermore, we also quantify the errors incurred in satisfying the local and global species balance for two popular chemical kinetics schemes: CDIMA (chlorine dioxide-iodine-malonic acid) and BZ (Belousov--Zhabotinsky). Based on these numerical simulations, we show that SUPG and GLS produce unphysical values for concentration of chemical species due to the violation of the non-negative constraint, contain spurious node-to-node oscillations, and have large errors in local and global species balance. Second, we proposed a novel finite element formulation to overcome the above difficulties. The proposed locally conservative non-negative computational framework based on low-order least-squares finite elements is able to preserve these underlying physical and mathematical properties

  4. An integrated simulator of structure and anisotropic flow in gas diffusion layers with hydrophobic additives

    Science.gov (United States)

    Burganos, Vasilis N.; Skouras, Eugene D.; Kalarakis, Alexandros N.

    2017-10-01

    The lattice-Boltzmann (LB) method is used in this work to reproduce the controlled addition of binder and hydrophobicity-promoting agents, like polytetrafluoroethylene (PTFE), into gas diffusion layers (GDLs) and to predict flow permeabilities in the through- and in-plane directions. The present simulator manages to reproduce spreading of binder and hydrophobic additives, sequentially, into the neat fibrous layer using a two-phase flow model. Gas flow simulation is achieved by the same code, sidestepping the need for a post-processing flow code and avoiding the usual input/output and data interface problems that arise in other techniques. Compression effects on flow anisotropy of the impregnated GDL are also studied. The permeability predictions for different compression levels and for different binder or PTFE loadings are found to compare well with experimental data for commercial GDL products and with computational fluid dynamics (CFD) predictions. Alternatively, the PTFE-impregnated structure is reproduced from Scanning Electron Microscopy (SEM) images using an independent, purely geometrical approach. A comparison of the two approaches is made regarding their adequacy to reproduce correctly the main structural features of the GDL and to predict anisotropic flow permeabilities at different volume fractions of binder and hydrophobic additives.

  5. Thermal diffusivity and butterfly velocity in anisotropic Q-lattice models

    Science.gov (United States)

    Jeong, Hyun-Sik; Ahn, Yongjun; Ahn, Dujin; Niu, Chao; Li, Wei-Jia; Kim, Keun-Young

    2018-01-01

    We study a relation between the thermal diffusivity ( D T ) and two quantum chaotic properties, Lyapunov time (τ L ) and butterfly velocity ( v B ) in strongly correlated systems by using a holographic method. Recently, it was shown that E_i:={D}_{T,i}/({v}{^{B,i}}^2{τ}_L)(i=x,y) is universal in the sense that it is determined only by some scaling exponents of the IR metric in the low temperature limit regardless of the matter fields and ultraviolet data. Inspired by this observation, by analyzing the anisotropic IR scaling geometry carefully, we find the concrete expressions for E_i in terms of the critical dynamical exponents z i in each direction, E_i={z}_i/2({z}_i-1) . Furthermore, we find the lower bound of E_i is always 1 /2, which is not affected by anisotropy, contrary to the η/s case. However, there may be an upper bound determined by given fixed anisotropy.

  6. Evidence for equivalence of diffusion processes of passive scalar and magnetic fields in anisotropic Navier-Stokes turbulence.

    Science.gov (United States)

    Jurčišinová, E; Jurčišin, M

    2017-05-01

    The influence of the uniaxial small-scale anisotropy on the kinematic magnetohydrodynamic turbulence is investigated by using the field theoretic renormalization group technique in the one-loop approximation of a perturbation theory. The infrared stable fixed point of the renormalization group equations, which drives the scaling properties of the model in the inertial range, is investigated as the function of the anisotropy parameters and it is shown that, at least at the one-loop level of approximation, the diffusion processes of the weak passive magnetic field in the anisotropically driven kinematic magnetohydrodynamic turbulence are completely equivalent to the corresponding diffusion processes of passively advected scalar fields in the anisotropic Navier-Stokes turbulent environments.

  7. A first approximation for modeling the liquid diffusion pathway at the greater confinement disposal facilities

    International Nuclear Information System (INIS)

    Olague, N.E.; Price, L.L.

    1991-01-01

    The greater confinement disposal (GCD) project is an ongoing project examining the disposal of orphan wastes in Area 5 of the Nevada Test Site. One of the major tasks for the project is performance assessment. With regard to performance assessment, a preliminary conceptual model for ground-water flow and radionuclide transport to the accessible environment at the GCD facilities has been developed. One of the transport pathways that has been postulated is diffusion of radionuclides in the liquid phase upward to the land surface. This pathway is not usually considered in a performance assessment, but is included in the GCD conceptual model because of relatively low recharge estimates at the GCD site and the proximity of the waste to the land surface. These low recharge estimates indicate that convective flow downward to the water table may be negligible; thus, diffusion upward to the land surface may then become important. As part of a preliminary performance assessment which considered a basecase scenario and a climate-change scenario, a first approximation for modeling the liquid-diffusion pathway was formulated. The model includes an analytical solution that incorporates both diffusion and radioactivity decay. Overall, these results indicate that, despite the configuration of the GCD facilities that establishes the need for considering the liquid-diffusion pathway, the GCD disposal concept appears to be a technically feasible method for disposing of orphan wastes. Future analyses will consist of investigating the underlying assumptions of the liquid-diffusion model, refining the model is necessary, and reducing uncertainty in the input parameters. 11 refs., 6 figs

  8. In situ gaseous tracer diffusion experiments and predictive modeling at the Greater Confinement Disposal Test

    International Nuclear Information System (INIS)

    Olson, M.C.

    1985-07-01

    The Greater Confinement Disposal Test (GCDT) at the Nevada Test Site is a research project investigating the feasibility of augered shaft disposal of low-level radioactive waste considered unsuitable for shallow land burial. The GCDT contains environmentally mobile and high-specific-activity sources. Research is focused on providing a set of analytically derived hydrogeologic parameters and an empirical database for application in a multiphase, two-dimensional, transient, predictive performance model. Potential contaminant transport processes at the GCDT are identified and their level of significance is detailed. Nonisothermal gaseous diffusion through alluvial sediments is considered the primary waste migration process. Volatile organic tracers are released in the subsurface and their migration is monitored in situ to determine media effective diffusion coefficients, tortuosity, and sorption-corrected porosity terms. The theoretical basis for volatile tracer experiments is presented. Treatment of thermal and liquid flow components is discussed, as is the basis for eliminating several negligible transport processes. Interpretive techniques include correlation, power spectra, and least squares analysis, a graphical analytical solution, and inverse numerical modeling. Model design and application to the GCDT are discussed. GCDT structural, analytical, and computer facilities are detailed. The status of the current research program is reviewed, and temperature and soil moisture profiles are presented along with results of operational tests on the analytical system. 72 refs., 39 figs., 2 tabs

  9. Variational Multiscale error estimator for anisotropic adaptive fluid mechanic simulations: application to convection-diffusion problems

    OpenAIRE

    Bazile , Alban; Hachem , Elie; Larroya-Huguet , Juan-Carlos; Mesri , Youssef

    2018-01-01

    International audience; In this work, we present a new a posteriori error estimator based on the Variational Multiscale method for anisotropic adaptive fluid mechanics problems. The general idea is to combine the large scale error based on the solved part of the solution with the sub-mesh scale error based on the unresolved part of the solution. We compute the latter with two different methods: one using the stabilizing parameters and the other using bubble functions. We propose two different...

  10. Anisotropic diffusion of meteor trails due to the geomagnetic field over King Sejong Station (62.2°S, 58.8°W), Antarctica

    Science.gov (United States)

    Choi, Jong-Min; Kwak, Young-Sil; Kim, Yong Ha; Lee, Changsup; Kim, Jeong-Han; Jee, Geonhwa; Yang, Tae-Yong

    2018-06-01

    We analyzed meteor decay times measured by a VHF meteor radar at King Sejong Station, Antarctica (62.22°S, 58.78°W) to study diffusion processes of the meteor trails above the altitude of ˜93 km. Above this altitude, where the atmospheric density is so dilute that collisions between trail ions and ambient molecules become rare, diffusion of a meteor trail can be greatly affected by the geomagnetic field, resulting in anisotropic distribution of measured decay times over the azimuthal and elevation angles. Our preliminary analysis confirm the anisotropic nature of meteor decay times due to geomagnetic field.

  11. Measurement of Three-Dimensional Anisotropic Thermal Diffusivities for Carbon Fiber-Reinforced Plastics Using Lock-In Thermography

    Science.gov (United States)

    Ishizaki, Takuya; Nagano, Hosei

    2015-11-01

    A new measurement technique to measure the in-plane thermal diffusivity, the distribution of in-plane anisotropy, and the out-of-plane thermal diffusivity has been developed to evaluate the thermal conductivity of anisotropic materials such as carbon fiber-reinforced plastics (CFRPs). The measurements were conducted by using a laser-spot-periodic-heating method. The temperature of the sample is detected by using lock-in thermography. Thermography can analyze the phase difference between the periodic heat input and the temperature response of the sample. Two kinds of samples, unidirectional (UD) and cross-ply (CP) pitch-based CFRPs, were fabricated and tested in an atmospheric condition. All carbon fibers of the UD sample run in one direction [90°]. The carbon fibers of the CP sample run in two directions [0°/90°]. It is found that, by using lock-in thermography, it is able to visualize the thermal anisotropy and calculate the angular dependence of the in-plane thermal diffusivity of the CFRPs. The out-of-plane thermal diffusivity of CFRPs was also measured by analyzing the frequency dependence of the phase difference.

  12. Analysis of an aggregation-based algebraic two-grid method for a rotated anisotropic diffusion problem

    KAUST Repository

    Chen, Meng-Huo; Greenbaum, Anne

    2015-01-01

    Summary: A two-grid convergence analysis based on the paper [Algebraic analysis of aggregation-based multigrid, by A. Napov and Y. Notay, Numer. Lin. Alg. Appl. 18 (2011), pp. 539-564] is derived for various aggregation schemes applied to a finite element discretization of a rotated anisotropic diffusion equation. As expected, it is shown that the best aggregation scheme is one in which aggregates are aligned with the anisotropy. In practice, however, this is not what automatic aggregation procedures do. We suggest approaches for determining appropriate aggregates based on eigenvectors associated with small eigenvalues of a block splitting matrix or based on minimizing a quantity related to the spectral radius of the iteration matrix. © 2015 John Wiley & Sons, Ltd.

  13. Analysis of an aggregation-based algebraic two-grid method for a rotated anisotropic diffusion problem

    KAUST Repository

    Chen, Meng-Huo

    2015-03-18

    Summary: A two-grid convergence analysis based on the paper [Algebraic analysis of aggregation-based multigrid, by A. Napov and Y. Notay, Numer. Lin. Alg. Appl. 18 (2011), pp. 539-564] is derived for various aggregation schemes applied to a finite element discretization of a rotated anisotropic diffusion equation. As expected, it is shown that the best aggregation scheme is one in which aggregates are aligned with the anisotropy. In practice, however, this is not what automatic aggregation procedures do. We suggest approaches for determining appropriate aggregates based on eigenvectors associated with small eigenvalues of a block splitting matrix or based on minimizing a quantity related to the spectral radius of the iteration matrix. © 2015 John Wiley & Sons, Ltd.

  14. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  15. Effects of anisotropic diffusion and finite island sizes in homoepitaxial growth Pt on Pt(100)-hex

    DEFF Research Database (Denmark)

    Mortensen, Jens Jørgen; Linderoth, T.R.; Jacobsen, Karsten Wedel

    1998-01-01

    coverage regime. have been determined for substrate temperatures in the range T = 318-497 K and adatom deposition rates from R=4 x 10(-5) to 7 x 10(-3) site(-1) s(-1). The measurements are compared to the results of kinetic Monte Carlo (KMC) simulations and rate equation theory. The Pt(100)-hex surface...... exhibits a height modulation caused by the misfit between the topmost quasi-hexagonal layer and the quadratic substrate. resulting in a highly anisotropic large scale surface morphology with six-atom wide channels running along the [1(1) over bar0$] direction. From an autocorrelation analysis...... channels. Rate equations incorporating this effect are solved, and a scaling exponent of chi=1/3 is derived in contrast to the chi=1/4 obtained for a 1-D point-island model. (C) 1998 Elsevier Science B.V....

  16. Diffusion is capable of translating anisotropic apoptosis initiation into a homogeneous execution of cell death.

    LENUS (Irish Health Repository)

    Huber, Heinrich J

    2010-01-01

    ABSTRACT: BACKGROUND: Apoptosis is an essential cell death process throughout the entire life span of all metazoans and its deregulation in humans has been implicated in many proliferative and degenerative diseases. Mitochondrial outer membrane permeabilisation (MOMP) and activation of effector caspases are key processes during apoptosis signalling. MOMP can be subject to spatial coordination in human cancer cells, resulting in intracellular waves of cytochrome-c release. To investigate the consequences of these spatial anisotropies in mitochondrial permeabilisation on subsequent effector caspase activation, we devised a mathematical reaction-diffusion model building on a set of partial differential equations. RESULTS: Reaction-diffusion modelling suggested that even if strong spatial anisotropies existed during mitochondrial cytochrome c release, these would be eliminated by free diffusion of the cytosolic proteins that instantiate the apoptosis execution network. Experimentally, rapid sampling of mitochondrial permeabilisation and effector caspase activity in individual HeLa cervical cancer cells confirmed predictions of the reaction-diffusion model and demonstrated that the signalling network of apoptosis execution could efficiently translate spatial anisotropies in mitochondrial permeabilisation into a homogeneous effector caspase response throughout the cytosol. Further systems modelling suggested that a more than 10,000-fold impaired diffusivity would be required to maintain spatial anisotropies as observed during mitochondrial permeabilisation until the time effector caspases become activated. CONCLUSIONS: Multi-protein diffusion efficiently contributes to eliminating spatial asynchronies which are present during the initiation of apoptosis execution and thereby ensures homogeneous apoptosis execution throughout the entire cell body. For previously reported biological scenarios in which effector caspase activity was shown to be targeted selectively to

  17. Experimental evaluation of electrical conductivity imaging of anisotropic brain tissues using a combination of diffusion tensor imaging and magnetic resonance electrical impedance tomography

    Energy Technology Data Exchange (ETDEWEB)

    Sajib, Saurav Z. K.; Jeong, Woo Chul; Oh, Tong In; Kim, Hyung Joong, E-mail: bmekim@khu.ac.kr, E-mail: ejwoo@khu.ac.kr; Woo, Eung Je, E-mail: bmekim@khu.ac.kr, E-mail: ejwoo@khu.ac.kr [Department of Biomedical Engineering, Kyung Hee University, Seoul 02447 (Korea, Republic of); Kyung, Eun Jung [Department of Pharmacology, Chung-Ang University, Seoul 06974 (Korea, Republic of); Kim, Hyun Bum [Department of East-West Medical Science, Kyung Hee University, Yongin 17104 (Korea, Republic of); Kwon, Oh In [Department of Mathematics, Konkuk University, Seoul 05029 (Korea, Republic of)

    2016-06-15

    Anisotropy of biological tissues is a low-frequency phenomenon that is associated with the function and structure of cell membranes. Imaging of anisotropic conductivity has potential for the analysis of interactions between electromagnetic fields and biological systems, such as the prediction of current pathways in electrical stimulation therapy. To improve application to the clinical environment, precise approaches are required to understand the exact responses inside the human body subjected to the stimulated currents. In this study, we experimentally evaluate the anisotropic conductivity tensor distribution of canine brain tissues, using a recently developed diffusion tensor-magnetic resonance electrical impedance tomography method. At low frequency, electrical conductivity of the biological tissues can be expressed as a product of the mobility and concentration of ions in the extracellular space. From diffusion tensor images of the brain, we can obtain directional information on diffusive movements of water molecules, which correspond to the mobility of ions. The position dependent scale factor, which provides information on ion concentration, was successfully calculated from the magnetic flux density, to obtain the equivalent conductivity tensor. By combining the information from both techniques, we can finally reconstruct the anisotropic conductivity tensor images of brain tissues. The reconstructed conductivity images better demonstrate the enhanced signal intensity in strongly anisotropic brain regions, compared with those resulting from previous methods using a global scale factor.

  18. Determination of 13C CSA Tensors: Extension of the Model-independent Approach to an RNA Kissing Complex Undergoing Anisotropic Rotational Diffusion in Solution

    International Nuclear Information System (INIS)

    Ravindranathan, Sapna; Kim, Chul-Hyun; Bodenhausen, Geoffrey

    2005-01-01

    Chemical shift anisotropy (CSA) tensor parameters have been determined for the protonated carbons of the purine bases in an RNA kissing complex in solution by extending the model-independent approach [Fushman, D., Cowburn, D. (1998) J. Am. Chem. Soc. 120, 7109-7110]. A strategy for determining CSA tensor parameters of heteronuclei in isolated X-H two-spin systems (X = 13 C or 15 N) in molecules undergoing anisotropic rotational diffusion is presented. The original method relies on the fact that the ratio κ 2 =R 2 auto /R 2 cross of the transverse auto- and cross-correlated relaxation rates involving the X CSA and the X-H dipolar interaction is independent of parameters related to molecular motion, provided rotational diffusion is isotropic. However, if the overall motion is anisotropic κ 2 depends on the anisotropy D parallel /D -perpendicular of rotational diffusion. In this paper, the field dependence of both κ 2 and its longitudinal counterpart κ 1 =R 1 auto /R 1 cross are determined. For anisotropic rotational diffusion, our calculations show that the average κ av = 1/2 (κ 1 +κ 2 ), of the ratios is largely independent of the anisotropy parameter D parallel /D -perpendicular . The field dependence of the average ratio κ av may thus be utilized to determine CSA tensor parameters by a generalized model-independent approach in the case of molecules with an overall motion described by an axially symmetric rotational diffusion tensor

  19. Anisotropic Oxygen Ion Diffusion in Layered PrBaCo 2 O 5+δ

    KAUST Repository

    Burriel, Mónica

    2012-02-14

    Oxygen diffusion and surface exchange coefficients have been measured on polycrystalline samples of the double perovskite oxide PrBaCo 2O 5+δ by the isotope exchange depth profile method, using a time-of-flight SIMS instrument. The measured diffusion coefficients show an activation energy of 1.02 eV, as compared to 0.89 eV for the surface exchange coefficients in the temperature range from 300 to 670 °C. Inhomogeneity was observed in the distribution of the oxygen-18 isotopic fraction from grain to grain in the ceramic samples, which was attributed to anisotropy in the diffusion and exchange of oxygen. By the use of a novel combination of electron back scattered diffraction measurements, time-of-flight, and focused ion beam SIMS, this anisotropy was confirmed by in-depth analysis of single grains of known orientation in a ceramic sample exchanged at 300 °C. Diffusion was shown to be faster in a grain oriented with the surface normal close to 100 and 010 (ab-plane oriented) than a grain with a surface normal close to 001 (c-axis oriented). The magnitude of this anisotropy is estimated to be close to a factor of 4, but this is only a lower bound due to experimental limitations. These findings are consistent with recent molecular dynamic simulations of this material where anisotropy in the oxygen transport was predicted. © 2012 American Chemical Society.

  20. Antisites and anisotropic diffusion in GaAs and GaSb

    KAUST Repository

    Tahini, H. A.; Bracht, H.; Chroneos, Alexander; Grimes, R. W.; Murphy, S. T.; Schwingenschlö gl, Udo

    2013-01-01

    The significant diffusion of Ga under Ga-rich conditions in GaAs and GaSb is counter intuitive as the concentration of Ga vacancies should be depressed although Ga vacancies are necessary to interpret the experimental evidence for Ga transport

  1. Anisotropic Oxygen Ion Diffusion in Layered PrBaCo 2 O 5+δ

    KAUST Repository

    Burriel, Mó nica; Peñ a-Martí nez, Juan; Chater, Richard J.; Fearn, Sarah; Berenov, Andrey V.; Skinner, Stephen J.; Kilner, John A.

    2012-01-01

    Oxygen diffusion and surface exchange coefficients have been measured on polycrystalline samples of the double perovskite oxide PrBaCo 2O 5+δ by the isotope exchange depth profile method, using a time-of-flight SIMS instrument. The measured diffusion coefficients show an activation energy of 1.02 eV, as compared to 0.89 eV for the surface exchange coefficients in the temperature range from 300 to 670 °C. Inhomogeneity was observed in the distribution of the oxygen-18 isotopic fraction from grain to grain in the ceramic samples, which was attributed to anisotropy in the diffusion and exchange of oxygen. By the use of a novel combination of electron back scattered diffraction measurements, time-of-flight, and focused ion beam SIMS, this anisotropy was confirmed by in-depth analysis of single grains of known orientation in a ceramic sample exchanged at 300 °C. Diffusion was shown to be faster in a grain oriented with the surface normal close to 100 and 010 (ab-plane oriented) than a grain with a surface normal close to 001 (c-axis oriented). The magnitude of this anisotropy is estimated to be close to a factor of 4, but this is only a lower bound due to experimental limitations. These findings are consistent with recent molecular dynamic simulations of this material where anisotropy in the oxygen transport was predicted. © 2012 American Chemical Society.

  2. Anisotropic Lithium Insertion Behavior in Silicon Nanowires: Binding Energy, Diffusion Barrier, and Strain Effect

    KAUST Repository

    Zhang, Qianfan; Cui, Yi; Wang, Enge

    2011-01-01

    Silicon nanowires (SiNWs) have recently been shown to be promising as high capacity lithium battery anodes. SiNWs can be grown with their long axis along several different crystallographic directions. Due to distinct atomic configuration and electronic structure of SiNWs with different axial orientations, their lithium insertion behavior could be different. This paper focuses on the characteristics of single Li defects, including binding energy, diffusion barriers, and dependence on uniaxial strain in [110], [100], [111], and [112] SiNWs. Our systematic ab initio study suggests that the Si-Li interaction is weaker when the Si-Li bond direction is aligned close to the SiNW long axis. This results in the [110] and [111] SiNWs having the highest and lowest Li binding energy, respectively, and it makes the diffusion barrier along the SiNW axis lower than other pathways. Under external strain, it was found that [110] and [001] SiNWs are the most and least sensitive, respectively. For diffusion along the axial direction, the barrier increases (decreases) under tension (compression). This feature results in a considerable difference in the magnitude of the energy barrier along different diffusion pathways. © 2011 American Chemical Society.

  3. Anisotropic Lithium Insertion Behavior in Silicon Nanowires: Binding Energy, Diffusion Barrier, and Strain Effect

    KAUST Repository

    Zhang, Qianfan

    2011-05-19

    Silicon nanowires (SiNWs) have recently been shown to be promising as high capacity lithium battery anodes. SiNWs can be grown with their long axis along several different crystallographic directions. Due to distinct atomic configuration and electronic structure of SiNWs with different axial orientations, their lithium insertion behavior could be different. This paper focuses on the characteristics of single Li defects, including binding energy, diffusion barriers, and dependence on uniaxial strain in [110], [100], [111], and [112] SiNWs. Our systematic ab initio study suggests that the Si-Li interaction is weaker when the Si-Li bond direction is aligned close to the SiNW long axis. This results in the [110] and [111] SiNWs having the highest and lowest Li binding energy, respectively, and it makes the diffusion barrier along the SiNW axis lower than other pathways. Under external strain, it was found that [110] and [001] SiNWs are the most and least sensitive, respectively. For diffusion along the axial direction, the barrier increases (decreases) under tension (compression). This feature results in a considerable difference in the magnitude of the energy barrier along different diffusion pathways. © 2011 American Chemical Society.

  4. Stefan-Maxwell Relations and Heat Flux with Anisotropic Transport Coefficients for Ionized Gases in a Magnetic Field with Application to the Problem of Ambipolar Diffusion

    Science.gov (United States)

    Kolesnichenko, A. V.; Marov, M. Ya.

    2018-01-01

    The defining relations for the thermodynamic diffusion and heat fluxes in a multicomponent, partially ionized gas mixture in an external electromagnetic field have been obtained by the methods of the kinetic theory. Generalized Stefan-Maxwell relations and algebraic equations for anisotropic transport coefficients (the multicomponent diffusion, thermal diffusion, electric and thermoelectric conductivity coefficients as well as the thermal diffusion ratios) associated with diffusion-thermal processes have been derived. The defining second-order equations are derived by the Chapman-Enskog procedure using Sonine polynomial expansions. The modified Stefan-Maxwell relations are used for the description of ambipolar diffusion in the Earth's ionospheric plasma (in the F region) composed of electrons, ions of many species, and neutral particles in a strong electromagnetic field.

  5. Anisotropic O vacancy formation and diffusion in LaMnO3

    KAUST Repository

    Gan, Liyong; Salawu, Omotayo Akande; Schwingenschlö gl, Udo

    2014-01-01

    Anisotropy effects in solid oxide fuel cells are typically not considered because of high operating temperatures. Focusing on the prototypical perovskite LaMnO3, we apply first-principles calculations to demonstrate that this approximation is no longer valid when the operating temperature is reduced and discuss the consequences for the material properties. In addition, we show that strain and Sr doping can be used to further increase the anisotropy. Tensile strain promotes both the O vacancy formation and diffusion in pristine and Sr doped LaMnO3, while Sr doping enhances the O vacancy formation. Both in LaMnO3 and La0.75Sr0.25MnO3 the O diffusion is found to be favorable in the [011] and [011] directions.

  6. Antisites and anisotropic diffusion in GaAs and GaSb

    KAUST Repository

    Tahini, H. A.

    2013-10-02

    The significant diffusion of Ga under Ga-rich conditions in GaAs and GaSb is counter intuitive as the concentration of Ga vacancies should be depressed although Ga vacancies are necessary to interpret the experimental evidence for Ga transport. To reconcile the existence of Ga vacancies under Ga-rich conditions, transformation reactions have been proposed. Here, density functional theory is employed to calculate the formation energies of vacancies on both sublattices and the migration energy barriers to overcome the formation of the vacancy-antisite defect. Transformation reactions enhance the vacancy concentration in both materials and migration energy barriers indicate that Ga vacancies will dominate.

  7. High-coercivity ultrafine-grained anisotropic Nd–Fe–B magnets processed by hot deformation and the Nd–Cu grain boundary diffusion process

    International Nuclear Information System (INIS)

    Sepehri-Amin, H.; Ohkubo, T.; Nagashima, S.; Yano, M.; Shoji, T.; Kato, A.; Schrefl, T.; Hono, K.

    2013-01-01

    The grain boundary diffusion process using an Nd 70 Cu 30 eutectic alloy has been applied to hot-deformed anisotropic Nd–Fe–B magnets, resulting in a substantial enhancement of coercivity, from 1.5 T to 2.3 T, at the expense of remanence. Scanning electron microscopy showed that the areal fraction of an Nd-rich intergranular phase increased from 10% to 37%. The intergranular phase of the hot-deformed magnet initially contained ∼55 at.% ferromagnetic element, while it diminished to an undetectable level after the process. Microscale eutectic solidification of Nd/NdCu as well as a fine lamellae structure of Nd 70 (Co,Cu) 30 /Nd were observed in the intergranular phase. Micromagnetic simulations indicated that the reduction of the magnetization in the intergranular phases leads to the enhancement of coercivity in agreement with the experimental observation

  8. Correlation of Local Structure and Diffusion Pathways in the Modulated Anisotropic Oxide Ion Conductor CeNbO4.25

    KAUST Repository

    Pramana, Stevin S.

    2016-01-15

    CeNbO is reported to exhibit fast oxygen ion diffusion at moderate temperatures, making this the prototype of a new class of ion conductor with applications in a range of energy generation and storage devices. To date, the mechanism by which this ion transport is achieved has remained obscure, in part due to the long-range commensurately modulated structural motif. Here we show that CeNbO forms with a unit cell 12 times larger than the stoichiometric tetragonal parent phase of CeNbO as a result of the helical ordering of Ce and Ce ions along z. Interstitial oxygen ion incorporation leads to a cooperative displacement of the surrounding oxygen species, creating interlayer NbO connectivity by extending the oxygen coordination number to 7 and 8. Molecular dynamic simulations suggest that fast ion migration occurs predominantly within the xz plane. It is concluded that the oxide ion diffuses anisotropically, with the major migration mechanism being intralayer; however, when obstructed, oxygen can readily move to an adjacent layer along y via alternate lower energy barrier pathways.

  9. Correlation of Local Structure and Diffusion Pathways in the Modulated Anisotropic Oxide Ion Conductor CeNbO4.25

    KAUST Repository

    Pramana, Stevin S.; Baikie, Tom; An, Tao; Tucker, Matthew G.; Wu, Ji; Schreyer, Martin K.; Wei, Fengxia; Bayliss, Ryan D.; Kloc, Christian L.; White, Timothy J.; Horsfield, Andrew P.; Skinner, Stephen J.

    2016-01-01

    CeNbO is reported to exhibit fast oxygen ion diffusion at moderate temperatures, making this the prototype of a new class of ion conductor with applications in a range of energy generation and storage devices. To date, the mechanism by which this ion transport is achieved has remained obscure, in part due to the long-range commensurately modulated structural motif. Here we show that CeNbO forms with a unit cell 12 times larger than the stoichiometric tetragonal parent phase of CeNbO as a result of the helical ordering of Ce and Ce ions along z. Interstitial oxygen ion incorporation leads to a cooperative displacement of the surrounding oxygen species, creating interlayer NbO connectivity by extending the oxygen coordination number to 7 and 8. Molecular dynamic simulations suggest that fast ion migration occurs predominantly within the xz plane. It is concluded that the oxide ion diffuses anisotropically, with the major migration mechanism being intralayer; however, when obstructed, oxygen can readily move to an adjacent layer along y via alternate lower energy barrier pathways.

  10. Linear astrophysical dynamos in rotating spheres: Differential rotation, anisotropic turbulent magnetic diffusivity, and solar-stellar cycle magnetic parity

    International Nuclear Information System (INIS)

    Yoshimura, H.; Wang, Z.; Wu, F.

    1984-01-01

    Differential rotation dependence of the selection mechanism for magnetic parity of solar and stellar cycles is studied by assuming various differential rotation profiles inn the dynamo equation. The parity selection depends on propagation direction of oscillating magnetic fields in the form of dynamo waves which propagate along isorotation surfaces. When there is any radial gradient in the differential rotation, dynamo waves propagate either equatorward or poleward. In the former case, field systems of the two hemispheres approach each other and collide at the equator. Then, odd parity is selected. In the latter case, field systems of the two hemispheres recede from each other and do not collide at the equator, an even parity is selected. Thus the equatorial migration of wings of the butterfly iagram of the solar cycle and its odd parity are intrinsically related. In the case of purely latitudibnal differential rotation, dynamo waves propagate purely radially and growth rates of odd and even modes are nearly the same even when dynamo strength is weak when the parity selection mechanism should work most efficiently. In this case, anisotropy of turbulent diffusivity is a decisive factor to separate odd and even modes. Unlike in the case of radial-gradient-dominated differential rotation in which any difference between diffusivities for poloidal and toroidal fields enhancess the parity selection without changing the parity, the parity selection in the case of latitudinal-gradient-dominated differential rotation depends on the difference of diffusivities for poloidal and toroidal fields. When diffusivity for poloidal fields iss larger than that for toroidal fields, odd parity is selected; and when diffusivity for toroidal fields is larger, even parity is selected

  11. SHADOK-3-6, Transport Equation with Anisotropic Diffusion in P1 Approximation for Spherical and Cylindrical Geometry

    International Nuclear Information System (INIS)

    Ligou, J.; Thomi, P.A.

    1973-01-01

    1 - Nature of physical problem solved: Integral transport equation, anisotropy of diffusion in P1 approximation. SHADOK3 - cylindrical geometry; direct solution of the linear system. SHADOK4 - cylindrical geometry; Thermalization iteration; solution of the linear system with inverse matrix calculation. SHADOK5 - like SHADOK3 for spherical geometry. SHADOK6 - like SHADOK4 for spherical geometry. 2 - Method of solution: Analysis in terms of annuli for each of which polynomial approximation is applied. Dynamic allocation (for formulas see report TM(10)). 3 - Restrictions on the complexity of the problem: Relative accuracy of the Bickley functions about 1.0E-13

  12. Anisotropic Weyl invariance

    Energy Technology Data Exchange (ETDEWEB)

    Perez-Nadal, Guillem [Universidad de Buenos Aires, Buenos Aires (Argentina)

    2017-07-15

    We consider a non-relativistic free scalar field theory with a type of anisotropic scale invariance in which the number of coordinates ''scaling like time'' is generically greater than one. We propose the Cartesian product of two curved spaces, the metric of each space being parameterized by the other space, as a notion of curved background to which the theory can be extended. We study this type of geometries, and find a family of extensions of the theory to curved backgrounds in which the anisotropic scale invariance is promoted to a local, Weyl-type symmetry. (orig.)

  13. Fractional Diffusion Equations and Anomalous Diffusion

    Science.gov (United States)

    Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

    2018-01-01

    Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

  14. Diffusion

    International Nuclear Information System (INIS)

    Kubaschewski, O.

    1983-01-01

    The diffusion rate values of titanium, its compounds and alloys are summarized and tabulated. The individual chemical diffusion coefficients and self-diffusion coefficients of certain isotopes are given. Experimental methods are listed which were used for the determination of diffusion coefficients. Some values have been taken over from other studies. Also given are graphs showing the temperature dependences of diffusion and changes in the diffusion coefficient with concentration changes

  15. Modelling anisotropic water transport in polymer composite

    Indian Academy of Sciences (India)

    This work reports anisotropic water transport in a polymer composite consisting of an epoxy matrix reinforced with aligned triangular bars made of vinyl ester. By gravimetric experiments, water diffusion in resin and polymer composites were characterized. Parameters for Fickian diffusion and polymer relaxation models were ...

  16. Continuum mechanics of anisotropic materials

    CERN Document Server

    Cowin, Stephen C

    2013-01-01

    Continuum Mechanics of Anisotropic Materials(CMAM) presents an entirely new and unique development of material anisotropy in the context of an appropriate selection and organization of continuum mechanics topics. These features will distinguish this continuum mechanics book from other books on this subject. Textbooks on continuum mechanics are widely employed in engineering education, however, none of them deal specifically with anisotropy in materials. For the audience of Biomedical, Chemical and Civil Engineering students, these materials will be dealt with more frequently and greater accuracy in their analysis will be desired. Continuum Mechanics of Anisotropic Materials' author has been a leader in the field of developing new approaches for the understanding of anisotropic materials.

  17. Anisotropic diffusion of point defects in a two-dimensional crystal of streptavidin observed by high-speed atomic force microscopy

    International Nuclear Information System (INIS)

    Yamamoto, Daisuke; Uchihashi, Takayuki; Kodera, Noriyuki; Ando, Toshio

    2008-01-01

    The diffusion of individual point defects in a two-dimensional streptavidin crystal formed on biotin-containing supported lipid bilayers was observed by high-speed atomic force microscopy. The two-dimensional diffusion of monovacancy defects exhibited anisotropy correlated with the two crystallographic axes in the orthorhombic C 222 crystal; in the 2D plane, one axis (the a-axis) is comprised of contiguous biotin-bound subunit pairs whereas the other axis (the b-axis) is comprised of contiguous biotin-unbound subunit pairs. The diffusivity along the b-axis is approximately 2.4 times larger than that along the a-axis. This anisotropy is ascribed to the difference in the association free energy between the biotin-bound subunit-subunit interaction and the biotin-unbound subunit-subunit interaction. The preferred intermolecular contact occurs between the biotin-unbound subunits. The difference in the intermolecular binding energy between the two types of subunit pair is estimated to be approximately 0.52 kcal mol -1 . Another observed dynamic behavior of point defects was fusion of two point defects into a larger defect, which occurred much more frequently than the fission of a point defect into smaller defects. The diffusivity of point defects increased with increasing defect size. The fusion and the higher diffusivity of larger defects are suggested to be involved in the mechanism for the formation of defect-free crystals

  18. Modification of anisotropic plasma diffusion via auxiliary electrons emitted by a carbon nanotubes-based electron gun in an electron cyclotron resonance ion source.

    Science.gov (United States)

    Malferrari, L; Odorici, F; Veronese, G P; Rizzoli, R; Mascali, D; Celona, L; Gammino, S; Castro, G; Miracoli, R; Serafino, T

    2012-02-01

    The diffusion mechanism in magnetized plasmas is a largely debated issue. A short circuit model was proposed by Simon, assuming fluxes of lost particles along the axial (electrons) and radial (ions) directions which can be compensated, to preserve the quasi-neutrality, by currents flowing throughout the conducting plasma chamber walls. We hereby propose a new method to modify Simon's currents via electrons injected by a carbon nanotubes-based electron gun. We found this improves the source performances, increasing the output current for several charge states. The method is especially sensitive to the pumping frequency. Output currents for given charge states, at different auxiliary electron currents, will be reported in the paper and the influence of the frequency tuning on the compensation mechanism will be discussed.

  19. Measuring anisotropic muscle stiffness properties using elastography.

    Science.gov (United States)

    Green, M A; Geng, G; Qin, E; Sinkus, R; Gandevia, S C; Bilston, L E

    2013-11-01

    Physiological and pathological changes to the anisotropic mechanical properties of skeletal muscle are still largely unknown, with only a few studies quantifying changes in vivo. This study used the noninvasive MR elastography (MRE) technique, in combination with diffusion tensor imaging (DTI), to measure shear modulus anisotropy in the human skeletal muscle in the lower leg. Shear modulus measurements parallel and perpendicular to the fibre direction were made in 10 healthy subjects in the medial gastrocnemius, soleus and tibialis anterior muscles. The results showed significant differences in the medial gastrocnemius (μ‖ = 0.86 ± 0.15 kPa; μ⊥ = 0.66 ± 0.19 kPa, P < 0.001), soleus (μ‖ = 0.83 ± 0.22 kPa; μ⊥ = 0.65 ± 0.13 kPa, P < 0.001) and the tibialis anterior (μ‖ = 0.78 ± 0.24 kPa; μ⊥ = 0.66 ± 0.16 kPa, P = 0.03) muscles, where the shear modulus measured in the direction parallel is greater than that measured in the direction perpendicular to the muscle fibres. No significant differences were measured across muscle groups. This study provides the first direct estimates of the anisotropic shear modulus in the triceps surae muscle group, and shows that the technique may be useful for the probing of mechanical anisotropy changes caused by disease, aging and injury. Copyright © 2013 John Wiley & Sons, Ltd.

  20. Mean diffusivity discriminates between prostate cancer with grade group 1&2 and grade groups equal to or greater than 3

    International Nuclear Information System (INIS)

    Nezzo, M.; Di Trani, M.G.; Caporale, A.; Miano, R.; Mauriello, A.; Bove, P.; Capuani, S.; Manenti, G.

    2016-01-01

    Purpose: To test the potential ability of mean diffusivity (MD) and fractional anisotropy (FA) in discriminating between PCa of grade group (GG) 1&2, and GGs ≥ 3. Material and methods: Diffusion Tensor Imaging (DTI) experiments at 3T in a cohort of 38 patients with PCa (fifty lesions in total) were performed, by using different diffusion weights (b values) up to 2500 s/mm 2 . Gleason score (GS) and GG data were correlated with DTI parameters (MD and FA) estimated in PCa. The relation between DTI measures and GS was tested by the linear correlation analysis (Pearson's coefficient). One-way analysis of variance to check the statistical significance of the difference between GG 1&2 and GGs 3, 4, 5, ≥3 was used. Results were reported for each of the three b-values ranges: 0–800 s/mm 2 , 0–1500 s/mm 2 , 0–2500 s/mm 2 . Results: A negative correlation was found between MD and GS. The highest linear correlation was observed when the fit was performed with data acquired in the b-values range 0–2500 s/mm 2 . MD values were significantly different between GG 1&2 and GG = 3 and between GG 1&2 and GG ≥3. Moreover this difference is better defined when high b values (higher than b = 800 s/mm 2 ) are used. The specificity, sensitivity and accuracy in the discrimination between GG 1&2 and GG = 3 were: 90%, 66.7% and 82.4%, respectively when MD was estimated in the b-values range 0–2500 s/mm 2 while these values were 85%, 58.3% and 78.4% when MD was estimated in the b-values range 0–800 s/mm 2 . Conversely FA did not discriminate between GG 1&2 and GG ≥3, at any investigated b-values range. Conclusion: This study suggests that MD estimation in PCa, obtained from DTI acquired at high b-values, can contribute to the diagnosis and grading of prostate cancer while FA is not a useful parameter for this purpose.

  1. Mean diffusivity discriminates between prostate cancer with grade group 1&2 and grade groups equal to or greater than 3

    Energy Technology Data Exchange (ETDEWEB)

    Nezzo, M., E-mail: marco.nezzo@gmail.com [Department of Diagnostic and Interventional Radiology, Molecular Imaging and Radiotherapy, PTV Foundation, “Tor Vergata” University of Rome, Viale Oxford 81, 00133 Rome (Italy); Di Trani, M.G. [Physics Department, Sapienza University of Rome, Piazzale Aldo Moro 5, Rome (Italy); Caporale, A. [Department of Anatomical, Histological, Forensic and Locomotor System Science, Morfogenesis and Tissue Homeostasis, Sapienza University of Rome (Italy); CNR ISC, UOS Roma Sapienza, Physics Department Sapienza University of Rome (Italy); Miano, R. [Urology Unit, Department of Experimental Medicine and Surgery, PTV Foundation, “Tor Vergata” University of Rome, Viale Oxford 81, 00133 Rome (Italy); Mauriello, A. [Anatomic Pathology, Department of Biomedicine and Prevention, PTV Foundation, “Tor Vergata” University of Rome, Viale Oxford 81, 00133 Rome (Italy); Bove, P. [Urology Unit, Department of Experimental Medicine and Surgery, PTV Foundation, “Tor Vergata” University of Rome, Viale Oxford 81, 00133 Rome (Italy); Capuani, S. [CNR ISC, UOS Roma Sapienza, Physics Department Sapienza University of Rome (Italy); Manenti, G. [Department of Diagnostic and Interventional Radiology, Molecular Imaging and Radiotherapy, PTV Foundation, “Tor Vergata” University of Rome, Viale Oxford 81, 00133 Rome (Italy)

    2016-10-15

    Purpose: To test the potential ability of mean diffusivity (MD) and fractional anisotropy (FA) in discriminating between PCa of grade group (GG) 1&2, and GGs ≥ 3. Material and methods: Diffusion Tensor Imaging (DTI) experiments at 3T in a cohort of 38 patients with PCa (fifty lesions in total) were performed, by using different diffusion weights (b values) up to 2500 s/mm{sup 2}. Gleason score (GS) and GG data were correlated with DTI parameters (MD and FA) estimated in PCa. The relation between DTI measures and GS was tested by the linear correlation analysis (Pearson's coefficient). One-way analysis of variance to check the statistical significance of the difference between GG 1&2 and GGs 3, 4, 5, ≥3 was used. Results were reported for each of the three b-values ranges: 0–800 s/mm{sup 2}, 0–1500 s/mm{sup 2}, 0–2500 s/mm{sup 2}. Results: A negative correlation was found between MD and GS. The highest linear correlation was observed when the fit was performed with data acquired in the b-values range 0–2500 s/mm{sup 2}. MD values were significantly different between GG 1&2 and GG = 3 and between GG 1&2 and GG ≥3. Moreover this difference is better defined when high b values (higher than b = 800 s/mm{sup 2}) are used. The specificity, sensitivity and accuracy in the discrimination between GG 1&2 and GG = 3 were: 90%, 66.7% and 82.4%, respectively when MD was estimated in the b-values range 0–2500 s/mm{sup 2} while these values were 85%, 58.3% and 78.4% when MD was estimated in the b-values range 0–800 s/mm{sup 2}. Conversely FA did not discriminate between GG 1&2 and GG ≥3, at any investigated b-values range. Conclusion: This study suggests that MD estimation in PCa, obtained from DTI acquired at high b-values, can contribute to the diagnosis and grading of prostate cancer while FA is not a useful parameter for this purpose.

  2. An anisotropic elastoplasticity model implemented in FLAG

    Energy Technology Data Exchange (ETDEWEB)

    Buechler, Miles Allen [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Canfield, Thomas R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-10-12

    Many metals, including Tantalum and Zirconium, exhibit anisotropic elastoplastic behavior at the single crystal level, and if components are manufactured from these metals through forming processes the polycrystal (component) may also exhibit anisotropic elastoplastic behavior. This is because the forming can induce a preferential orientation of the crystals in the polycrystal. One example is a rolled plate of Uranium where the sti /strong orientation of the crystal (c-axis) tends to align itself perpendicular to the rolling direction. If loads are applied to this plate in di erent orientations the sti ness as well as the ow strength of the material will be greater in the through thickness direction than in other directions. To better accommodate simulations of such materials, an anisotropic elastoplasticity model has been implemented in FLAG. The model includes an anisotropic elastic stress model as well as an anisotropic plasticity model. The model could represent single crystals of any symmetry, though it should not be confused with a high- delity crystal plasticity model with multiple slip planes and evolutions. The model is most appropriate for homogenized polycrystalline materials. Elastic rotation of the material due to deformation is captured, so the anisotropic models are appropriate for arbitrary large rotations, but currently they do not account for signi cant change in material texture beyond the elastic rotation of the entire polycrystal.

  3. Diffusion Based Photon Mapping

    DEFF Research Database (Denmark)

    Schjøth, Lars; Fogh Olsen, Ole; Sporring, Jon

    2007-01-01

    . To address this problem we introduce a novel photon mapping algorithm based on nonlinear anisotropic diffusion. Our algorithm adapts according to the structure of the photon map such that smoothing occurs along edges and structures and not across. In this way we preserve the important illumination features......, while eliminating noise. We call our method diffusion based photon mapping....

  4. Diffusion Based Photon Mapping

    DEFF Research Database (Denmark)

    Schjøth, Lars; Olsen, Ole Fogh; Sporring, Jon

    2006-01-01

    . To address this problem we introduce a novel photon mapping algorithm based on nonlinear anisotropic diffusion. Our algorithm adapts according to the structure of the photon map such that smoothing occurs along edges and structures and not across. In this way we preserve the important illumination features......, while eliminating noise. We call our method diffusion based photon mapping....

  5. Anisotropic gravitational instability

    International Nuclear Information System (INIS)

    Polyachenko, V.L.; Fridman, A.M.

    1988-01-01

    Exact solutions of stability problems are obtained for two anisotropic gravitational systems of different geometries - a layer of finite thickness at rest and a rotating cylinder of finite radius. It is shown that the anisotropic gravitational instability which develops in both cases is of Jeans type. However, in contrast to the classical aperiodic Jeans instability, this instability is oscillatory. The physics of the anisotropic gravitational instability is investigated. It is shown that in a gravitating layer this instability is due, in particular, to excitation of previously unknown interchange-Jeans modes. In the cylinder, the oscillatory Jeans instability is associated with excitation of a rotational branch, this also being responsible for the beam gravitational instability. This is the reason why this instability and the anisotropic gravitational instability have so much in common

  6. Anisotropic ray trace

    Science.gov (United States)

    Lam, Wai Sze Tiffany

    Optical components made of anisotropic materials, such as crystal polarizers and crystal waveplates, are widely used in many complex optical system, such as display systems, microlithography, biomedical imaging and many other optical systems, and induce more complex aberrations than optical components made of isotropic materials. The goal of this dissertation is to accurately simulate the performance of optical systems with anisotropic materials using polarization ray trace. This work extends the polarization ray tracing calculus to incorporate ray tracing through anisotropic materials, including uniaxial, biaxial and optically active materials. The 3D polarization ray tracing calculus is an invaluable tool for analyzing polarization properties of an optical system. The 3x3 polarization ray tracing P matrix developed for anisotropic ray trace assists tracking the 3D polarization transformations along a ray path with series of surfaces in an optical system. To better represent the anisotropic light-matter interactions, the definition of the P matrix is generalized to incorporate not only the polarization change at a refraction/reflection interface, but also the induced optical phase accumulation as light propagates through the anisotropic medium. This enables realistic modeling of crystalline polarization elements, such as crystal waveplates and crystal polarizers. The wavefront and polarization aberrations of these anisotropic components are more complex than those of isotropic optical components and can be evaluated from the resultant P matrix for each eigen-wavefront as well as for the overall image. One incident ray refracting or reflecting into an anisotropic medium produces two eigenpolarizations or eigenmodes propagating in different directions. The associated ray parameters of these modes necessary for the anisotropic ray trace are described in Chapter 2. The algorithms to calculate the P matrix from these ray parameters are described in Chapter 3 for

  7. Anisotropic elastic plates

    CERN Document Server

    Hwu, Chyanbin

    2010-01-01

    As structural elements, anisotropic elastic plates find wide applications in modern technology. The plates here are considered to be subjected to not only in plane load but also transverse load. In other words, both plane and plate bending problems as well as the stretching-bending coupling problems are all explained in this book. In addition to the introduction of the theory of anisotropic elasticity, several important subjects have are discussed in this book such as interfaces, cracks, holes, inclusions, contact problems, piezoelectric materials, thermoelastic problems and boundary element a

  8. Anisotropic contrast optical microscope.

    Science.gov (United States)

    Peev, D; Hofmann, T; Kananizadeh, N; Beeram, S; Rodriguez, E; Wimer, S; Rodenhausen, K B; Herzinger, C M; Kasputis, T; Pfaunmiller, E; Nguyen, A; Korlacki, R; Pannier, A; Li, Y; Schubert, E; Hage, D; Schubert, M

    2016-11-01

    An optical microscope is described that reveals contrast in the Mueller matrix images of a thin, transparent, or semi-transparent specimen located within an anisotropic object plane (anisotropic filter). The specimen changes the anisotropy of the filter and thereby produces contrast within the Mueller matrix images. Here we use an anisotropic filter composed of a semi-transparent, nanostructured thin film with sub-wavelength thickness placed within the object plane. The sample is illuminated as in common optical microscopy but the light is modulated in its polarization using combinations of linear polarizers and phase plate (compensator) to control and analyze the state of polarization. Direct generalized ellipsometry data analysis approaches permit extraction of fundamental Mueller matrix object plane images dispensing with the need of Fourier expansion methods. Generalized ellipsometry model approaches are used for quantitative image analyses. These images are obtained from sets of multiple images obtained under various polarizer, analyzer, and compensator settings. Up to 16 independent Mueller matrix images can be obtained, while our current setup is limited to 11 images normalized by the unpolarized intensity. We demonstrate the anisotropic contrast optical microscope by measuring lithographically defined micro-patterned anisotropic filters, and we quantify the adsorption of an organic self-assembled monolayer film onto the anisotropic filter. Comparison with an isotropic glass slide demonstrates the image enhancement obtained by our method over microscopy without the use of an anisotropic filter. In our current instrument, we estimate the limit of detection for organic volumetric mass within the object plane of ≈49 fg within ≈7 × 7 μm 2 object surface area. Compared to a quartz crystal microbalance with dissipation instrumentation, where contemporary limits require a total load of ≈500 pg for detection, the instrumentation demonstrated here improves

  9. Diffusion properties of NAA in human corpus callosum as studied with diffusion tensor spectroscopy.

    Science.gov (United States)

    Upadhyay, Jaymin; Hallock, Kevin; Erb, Kelley; Kim, Dae-Shik; Ronen, Itamar

    2007-11-01

    In diffusion tensor imaging (DTI) the anisotropic movement of water is exploited to characterize microstructure. One confounding issue of DTI is the presence of intra- and extracellular components contributing to the measured diffusivity. This causes an ambiguity in determining the underlying cause of diffusion properties, particularly the fractional anisotropy (FA). In this study an intracellular constituent, N-acetyl aspartate (NAA), was used to probe intracellular diffusion, while water molecules were used to probe the combined intra- and extracellular diffusion. NAA and water diffusion measurements were made in anterior and medial corpus callosum (CC) regions, which are referred to as R1 and R2, respectively. FA(NAA) was found to be greater than FA(Water) in both CC regions, thus indicating a higher degree of anisotropy within the intracellular space in comparison to the combined intra- and extracellular spaces. A decreasing trend in the FA of NAA and water was observed between R1 and R2, while the radial diffusivity (RD) for both molecules increased. The increase in RD(NAA) is particularly significant, thus explaining the more significant decrease in FA(NAA) between the two regions. It is suggested that diffusion tensor spectroscopy of NAA can potentially be used to further characterize microscopic anatomic organization in white matter. Copyright 2007 Wiley-Liss, Inc.

  10. Anisotropic constant-roll inflation

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Asuka; Soda, Jiro [Kobe University, Department of Physics, Kobe (Japan)

    2018-01-15

    We study constant-roll inflation in the presence of a gauge field coupled to an inflaton. By imposing the constant anisotropy condition, we find new exact anisotropic constant-roll inflationary solutions which include anisotropic power-law inflation as a special case. We also numerically show that the new anisotropic solutions are attractors in the phase space. (orig.)

  11. Anisotropic Concrete Compressive Strength

    DEFF Research Database (Denmark)

    Gustenhoff Hansen, Søren; Jørgensen, Henrik Brøner; Hoang, Linh Cao

    2017-01-01

    When the load carrying capacity of existing concrete structures is (re-)assessed it is often based on compressive strength of cores drilled out from the structure. Existing studies show that the core compressive strength is anisotropic; i.e. it depends on whether the cores are drilled parallel...

  12. On some applications of diffusion processes for image processing

    International Nuclear Information System (INIS)

    Morfu, S.

    2009-01-01

    We propose a new algorithm inspired by the properties of diffusion processes for image filtering. We show that purely nonlinear diffusion processes ruled by Fisher equation allows contrast enhancement and noise filtering, but involves a blurry image. By contrast, anisotropic diffusion, described by Perona and Malik algorithm, allows noise filtering and preserves the edges. We show that combining the properties of anisotropic diffusion with those of nonlinear diffusion provides a better processing tool which enables noise filtering, contrast enhancement and edge preserving.

  13. Diffusion Based Photon Mapping

    DEFF Research Database (Denmark)

    Schjøth, Lars; Sporring, Jon; Fogh Olsen, Ole

    2008-01-01

    . To address this problem, we introduce a photon mapping algorithm based on nonlinear anisotropic diffusion. Our algorithm adapts according to the structure of the photon map such that smoothing occurs along edges and structures and not across. In this way, we preserve important illumination features, while...

  14. Anisotropic Rabi model

    OpenAIRE

    Xie, Qiong-Tao; Cui, Shuai; Cao, Jun-Peng; Amico, Luigi; Fan, Heng

    2014-01-01

    We define the anisotropic Rabi model as the generalization of the spin-boson Rabi model: The Hamiltonian system breaks the parity symmetry; the rotating and counterrotating interactions are governed by two different coupling constants; a further parameter introduces a phase factor in the counterrotating terms. The exact energy spectrum and eigenstates of the generalized model are worked out. The solution is obtained as an elaboration of a recently proposed method for the isotropic limit of th...

  15. Quark–gluon plasma phenomenology from anisotropic lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Skullerud, Jon-Ivar; Kelly, Aoife [Department of Mathematical Physics, Maynooth University, Maynooth, Co Kildare (Ireland); Aarts, Gert; Allton, Chris; Amato, Alessandro; Evans, P. Wynne M.; Hands, Simon [Department of Physics, Swansea University, Swansea SA2 8PP, Wales (United Kingdom); Burnier, Yannis [Institut de Théorie des Phénomènes Physiques, Ecole Polytechnique Fédérale de Lausanne, CH–1015 Lausanne (Switzerland); Giudice, Pietro [Institut für Theoretische Physik, Universität Münster, D–48149 Münster (Germany); Harris, Tim; Ryan, Sinéad M. [School of Mathematics, Trinity College, Dublin 2 (Ireland); Kim, Seyong [Department of Physics, Sejong University, Seoul 143-747 (Korea, Republic of); Lombardo, Maria Paola [INFN–Laboratori Nazionali di Frascati, I–00044 Frascati (RM) (Italy); Oktay, Mehmet B. [Department of Physics and Astronomy, University of Iowa, Iowa City, Iowa 52242 (United States); Rothkopf, Alexander [Institut für Theoretische Physik, Universität Heidelberg, Philosophenweg 16, D–69120 Heidelberg (Germany)

    2016-01-22

    The FASTSUM collaboration has been carrying out simulations of N{sub f} = 2 + 1 QCD at nonzero temperature in the fixed-scale approach using anisotropic lattices. Here we present the status of these studies, including recent results for electrical conductivity and charge diffusion, and heavy quarkonium (charm and beauty) physics.

  16. Anisotropic elliptic optical fibers

    Science.gov (United States)

    Kang, Soon Ahm

    1991-05-01

    The exact characteristic equation for an anisotropic elliptic optical fiber is obtained for odd and even hybrid modes in terms of infinite determinants utilizing Mathieu and modified Mathieu functions. A simplified characteristic equation is obtained by applying the weakly guiding approximation such that the difference in the refractive indices of the core and the cladding is small. The simplified characteristic equation is used to compute the normalized guide wavelength for an elliptical fiber. When the anisotropic parameter is equal to unity, the results are compared with the previous research and they are in close agreement. For a fixed value normalized cross-section area or major axis, the normalized guide wavelength lambda/lambda(sub 0) for an anisotropic elliptic fiber is small for the larger value of anisotropy. This condition indicates that more energy is carried inside of the fiber. However, the geometry and anisotropy of the fiber have a smaller effect when the normalized cross-section area is very small or very large.

  17. Computational Study of Subdural Cortical Stimulation: Effects of Simulating Anisotropic Conductivity on Activation of Cortical Neurons.

    Directory of Open Access Journals (Sweden)

    Hyeon Seo

    Full Text Available Subdural cortical stimulation (SuCS is an appealing method in the treatment of neurological disorders, and computational modeling studies of SuCS have been applied to determine the optimal design for electrotherapy. To achieve a better understanding of computational modeling on the stimulation effects of SuCS, the influence of anisotropic white matter conductivity on the activation of cortical neurons was investigated in a realistic head model. In this paper, we constructed pyramidal neuronal models (layers 3 and 5 that showed primary excitation of the corticospinal tract, and an anatomically realistic head model reflecting complex brain geometry. The anisotropic information was acquired from diffusion tensor magnetic resonance imaging (DT-MRI and then applied to the white matter at various ratios of anisotropic conductivity. First, we compared the isotropic and anisotropic models; compared to the isotropic model, the anisotropic model showed that neurons were activated in the deeper bank during cathodal stimulation and in the wider crown during anodal stimulation. Second, several popular anisotropic principles were adapted to investigate the effects of variations in anisotropic information. We observed that excitation thresholds varied with anisotropic principles, especially with anodal stimulation. Overall, incorporating anisotropic conductivity into the anatomically realistic head model is critical for accurate estimation of neuronal responses; however, caution should be used in the selection of anisotropic information.

  18. Inhomogeneous anisotropic cosmology

    International Nuclear Information System (INIS)

    Kleban, Matthew; Senatore, Leonardo

    2016-01-01

    In homogeneous and isotropic Friedmann-Robertson-Walker cosmology, the topology of the universe determines its ultimate fate. If the Weak Energy Condition is satisfied, open and flat universes must expand forever, while closed cosmologies can recollapse to a Big Crunch. A similar statement holds for homogeneous but anisotropic (Bianchi) universes. Here, we prove that arbitrarily inhomogeneous and anisotropic cosmologies with “flat” (including toroidal) and “open” (including compact hyperbolic) spatial topology that are initially expanding must continue to expand forever at least in some region at a rate bounded from below by a positive number, despite the presence of arbitrarily large density fluctuations and/or the formation of black holes. Because the set of 3-manifold topologies is countable, a single integer determines the ultimate fate of the universe, and, in a specific sense, most 3-manifolds are “flat” or “open”. Our result has important implications for inflation: if there is a positive cosmological constant (or suitable inflationary potential) and initial conditions for the inflaton, cosmologies with “flat” or “open” topology must expand forever in some region at least as fast as de Sitter space, and are therefore very likely to begin inflationary expansion eventually, regardless of the scale of the inflationary energy or the spectrum and amplitude of initial inhomogeneities and gravitational waves. Our result is also significant for numerical general relativity, which often makes use of periodic (toroidal) boundary conditions.

  19. Transient anisotropic magnetic field calculation

    International Nuclear Information System (INIS)

    Jesenik, Marko; Gorican, Viktor; Trlep, Mladen; Hamler, Anton; Stumberger, Bojan

    2006-01-01

    For anisotropic magnetic material, nonlinear magnetic characteristics of the material are described with magnetization curves for different magnetization directions. The paper presents transient finite element calculation of the magnetic field in the anisotropic magnetic material based on the measured magnetization curves for different magnetization directions. For the verification of the calculation method some results of the calculation are compared with the measurement

  20. Simple types of anisotropic inflation

    International Nuclear Information System (INIS)

    Barrow, John D.; Hervik, Sigbjoern

    2010-01-01

    We display some simple cosmological solutions of gravity theories with quadratic Ricci curvature terms added to the Einstein-Hilbert Lagrangian which exhibit anisotropic inflation. The Hubble expansion rates are constant and unequal in three orthogonal directions. We describe the evolution of the simplest of these homogeneous and anisotropic cosmological models from its natural initial state and evaluate the deviations they will create from statistical isotropy in the fluctuations produced during a period of anisotropic inflation. The anisotropic inflation is not a late-time attractor in these models but the rate of approach to a final isotropic de Sitter state is slow and is conducive to the creation of observable anisotropic statistical effects in the microwave background. The statistical anisotropy would not be scale invariant and the level of statistical anisotropy will grow with scale.

  1. Anisotropic Rabi model

    Science.gov (United States)

    Xie, Qiong-Tao; Cui, Shuai; Cao, Jun-Peng; Amico, Luigi; Fan, Heng

    2014-04-01

    We define the anisotropic Rabi model as the generalization of the spin-boson Rabi model: The Hamiltonian system breaks the parity symmetry; the rotating and counterrotating interactions are governed by two different coupling constants; a further parameter introduces a phase factor in the counterrotating terms. The exact energy spectrum and eigenstates of the generalized model are worked out. The solution is obtained as an elaboration of a recently proposed method for the isotropic limit of the model. In this way, we provide a long-sought solution of a cascade of models with immediate relevance in different physical fields, including (i) quantum optics, a two-level atom in single-mode cross-electric and magnetic fields; (ii) solid-state physics, electrons in semiconductors with Rashba and Dresselhaus spin-orbit coupling; and (iii) mesoscopic physics, Josephson-junction flux-qubit quantum circuits.

  2. Anisotropic Rabi model

    Directory of Open Access Journals (Sweden)

    Qiong-Tao Xie

    2014-06-01

    Full Text Available We define the anisotropic Rabi model as the generalization of the spin-boson Rabi model: The Hamiltonian system breaks the parity symmetry; the rotating and counterrotating interactions are governed by two different coupling constants; a further parameter introduces a phase factor in the counterrotating terms. The exact energy spectrum and eigenstates of the generalized model are worked out. The solution is obtained as an elaboration of a recently proposed method for the isotropic limit of the model. In this way, we provide a long-sought solution of a cascade of models with immediate relevance in different physical fields, including (i quantum optics, a two-level atom in single-mode cross-electric and magnetic fields; (ii solid-state physics, electrons in semiconductors with Rashba and Dresselhaus spin-orbit coupling; and (iii mesoscopic physics, Josephson-junction flux-qubit quantum circuits.

  3. Enhancing Rotational Diffusion Using Oscillatory Shear

    KAUST Repository

    Leahy, Brian D.

    2013-05-29

    Taylor dispersion - shear-induced enhancement of translational diffusion - is an important phenomenon with applications ranging from pharmacology to geology. Through experiments and simulations, we show that rotational diffusion is also enhanced for anisotropic particles in oscillatory shear. This enhancement arises from variations in the particle\\'s rotation (Jeffery orbit) and depends on the strain amplitude, rate, and particle aspect ratio in a manner that is distinct from the translational diffusion. This separate tunability of translational and rotational diffusion opens the door to new techniques for controlling positions and orientations of suspended anisotropic colloids. © 2013 American Physical Society.

  4. Creating an anisotropic plasma resistivity with waves

    International Nuclear Information System (INIS)

    Fisch, N.J.; Boozer, A.H.

    1980-05-01

    An anisotropic plasma resistivity may be created by preferential heating of electrons traveling in one direction. This can result in a steady-state toroidal current in a tokamak even in the absence of net wave momentum. In fact, at high wave phase velocities, the current associated with the change in resistivity is greater than that associated with net momentum input. An immediate implication is that other waves, such as electron cyclotron waves, may be competitive with lower-hybrid waves as a means for generating current. An analytical expression is derived for the current generated per power dissipated which agrees remarkably well with numerical calculations

  5. Anisotropic swim stress in active matter with nematic order

    Science.gov (United States)

    Yan, Wen; Brady, John F.

    2018-05-01

    Active Brownian particles (ABPs) transmit a swim pressure {{{\\Pi }}}{{swim}}=n\\zeta {D}{{swim}} to the container boundaries, where ζ is the drag coefficient, D swim is the swim diffusivity and n is the uniform bulk number density far from the container walls. In this work we extend the notion of the isotropic swim pressure to the anisotropic tensorial swim stress {{\\boldsymbol{σ }}}{{swim}}=-n\\zeta {{\\boldsymbol{D}}}{{swim}}, which is related to the anisotropic swim diffusivity {{\\boldsymbol{D}}}{{swim}}. We demonstrate this relationship with ABPs that achieve nematic orientational order via a bulk external field. The anisotropic swim stress is obtained analytically for dilute ABPs in both 2D and 3D systems. The anisotropy, defined as the ratio of the maximum to the minimum of the three principal stresses, is shown to grow exponentially with the strength of the external field. We verify that the normal component of the anisotropic swim stress applies a pressure {{{\\Pi }}}{{swim}}=-({{\\boldsymbol{σ }}}{{swim}}\\cdot {\\boldsymbol{n}})\\cdot {\\boldsymbol{n}} on a wall with normal vector {\\boldsymbol{n}}, and, through Brownian dynamics simulations, this pressure is shown to be the force per unit area transmitted by the active particles. Since ABPs have no friction with a wall, the difference between the normal and tangential stress components—the normal stress difference—generates a net flow of ABPs along the wall, which is a generic property of active matter systems.

  6. Introducing Anisotropic Minkowski Functionals and Quantitative Anisotropy Measures for Local Structure Analysis in Biomedical Imaging

    Science.gov (United States)

    Wismüller, Axel; De, Titas; Lochmüller, Eva; Eckstein, Felix; Nagarajan, Mahesh B.

    2017-01-01

    The ability of Minkowski Functionals to characterize local structure in different biological tissue types has been demonstrated in a variety of medical image processing tasks. We introduce anisotropic Minkowski Functionals (AMFs) as a novel variant that captures the inherent anisotropy of the underlying gray-level structures. To quantify the anisotropy characterized by our approach, we further introduce a method to compute a quantitative measure motivated by a technique utilized in MR diffusion tensor imaging, namely fractional anisotropy. We showcase the applicability of our method in the research context of characterizing the local structure properties of trabecular bone micro-architecture in the proximal femur as visualized on multi-detector CT. To this end, AMFs were computed locally for each pixel of ROIs extracted from the head, neck and trochanter regions. Fractional anisotropy was then used to quantify the local anisotropy of the trabecular structures found in these ROIs and to compare its distribution in different anatomical regions. Our results suggest a significantly greater concentration of anisotropic trabecular structures in the head and neck regions when compared to the trochanter region (p < 10−4). We also evaluated the ability of such AMFs to predict bone strength in the femoral head of proximal femur specimens obtained from 50 donors. Our results suggest that such AMFs, when used in conjunction with multi-regression models, can outperform more conventional features such as BMD in predicting failure load. We conclude that such anisotropic Minkowski Functionals can capture valuable information regarding directional attributes of local structure, which may be useful in a wide scope of biomedical imaging applications. PMID:29170580

  7. Disadvantage factor for anisotropic scattering

    International Nuclear Information System (INIS)

    Saad, E.A.; Abdel Krim, M.S.; EL-Dimerdash, A.A.

    1990-01-01

    The invariant embedding method is used to solve the problem for a two region reactor with anisotropic scattering and to compute the disadvantage factor necessary for calculating some reactor parameters

  8. Cracking on anisotropic neutron stars

    Science.gov (United States)

    Setiawan, A. M.; Sulaksono, A.

    2017-07-01

    We study the effect of cracking of a local anisotropic neutron star (NS) due to small density fluctuations. It is assumed that the neutron star core consists of leptons, nucleons and hyperons. The relativistic mean field model is used to describe the core of equation of state (EOS). For the crust, we use the EOS introduced by Miyatsu et al. [1]. Furthermore, two models are used to describe pressure anisotropic in neutron star matter. One is proposed by Doneva-Yazadjiev (DY) [2] and the other is proposed by Herrera-Barreto (HB) [3]. The anisotropic parameter of DY and HB models are adjusted in order the predicted maximum mass compatible to the mass of PSR J1614-2230 [4] and PSR J0348+0432 [5]. We have found that cracking can potentially present in the region close to the neutron star surface. The instability due cracking is quite sensitive to the NS mass and anisotropic parameter used.

  9. Magnetostatics of anisotropic superconducting ellipsoid

    International Nuclear Information System (INIS)

    Saif, A.G.

    1987-09-01

    The magnetization and the magnetic field distribution inside (outside) an anisotropic type II superconducting ellipsoid, with filamentary structure, is formulated. We have shown that the magnetic field in this case is different from that of the general anisotropic one. The nucleations of the flux lines for specimens with large demagnetization factors are theoretically studied. We have shown that the nucleations of the flux lines, for specimens with large demagnetization factor, appears at a field larger than that of ellipsoidal shape. (author). 15 refs

  10. Diffusion tensor optical coherence tomography

    Science.gov (United States)

    Marks, Daniel L.; Blackmon, Richard L.; Oldenburg, Amy L.

    2018-01-01

    In situ measurements of diffusive particle transport provide insight into tissue architecture, drug delivery, and cellular function. Analogous to diffusion-tensor magnetic resonance imaging (DT-MRI), where the anisotropic diffusion of water molecules is mapped on the millimeter scale to elucidate the fibrous structure of tissue, here we propose diffusion-tensor optical coherence tomography (DT-OCT) for measuring directional diffusivity and flow of optically scattering particles within tissue. Because DT-OCT is sensitive to the sub-resolution motion of Brownian particles as they are constrained by tissue macromolecules, it has the potential to quantify nanoporous anisotropic tissue structure at micrometer resolution as relevant to extracellular matrices, neurons, and capillaries. Here we derive the principles of DT-OCT, relating the detected optical signal from a minimum of six probe beams with the six unique diffusion tensor and three flow vector components. The optimal geometry of the probe beams is determined given a finite numerical aperture, and a high-speed hardware implementation is proposed. Finally, Monte Carlo simulations are employed to assess the ability of the proposed DT-OCT system to quantify anisotropic diffusion of nanoparticles in a collagen matrix, an extracellular constituent that is known to become highly aligned during tumor development.

  11. Anisotropic nonequilibrium hydrodynamic attractor

    Science.gov (United States)

    Strickland, Michael; Noronha, Jorge; Denicol, Gabriel S.

    2018-02-01

    We determine the dynamical attractors associated with anisotropic hydrodynamics (aHydro) and the DNMR equations for a 0 +1 d conformal system using kinetic theory in the relaxation time approximation. We compare our results to the nonequilibrium attractor obtained from the exact solution of the 0 +1 d conformal Boltzmann equation, the Navier-Stokes theory, and the second-order Mueller-Israel-Stewart theory. We demonstrate that the aHydro attractor equation resums an infinite number of terms in the inverse Reynolds number. The resulting resummed aHydro attractor possesses a positive longitudinal-to-transverse pressure ratio and is virtually indistinguishable from the exact attractor. This suggests that an optimized hydrodynamic treatment of kinetic theory involves a resummation not only in gradients (Knudsen number) but also in the inverse Reynolds number. We also demonstrate that the DNMR result provides a better approximation of the exact kinetic theory attractor than the Mueller-Israel-Stewart theory. Finally, we introduce a new method for obtaining approximate aHydro equations which relies solely on an expansion in the inverse Reynolds number. We then carry this expansion out to the third order, and compare these third-order results to the exact kinetic theory solution.

  12. Synthetic acceleration methods for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.; Larsen, E.W.

    1992-01-01

    The diffusion synthetic acceleration (DSA) algorithm effectively accelerates the iterative solution of transport problems with isotropic or mildly anisotropic scattering. However, DSA loses its effectiveness for transport problems that have strongly anisotropic scattering. Two generalizations of DSA are proposed, which, for highly anisotropic scattering problems, converge at least an order of magnitude (clock time) faster than the DSA method. These two methods are developed, the results of Fourier analysis that theoretically predict their efficiency are described, and numerical results that verify the theoretical predictions are presented. (author). 10 refs., 7 figs., 5 tabs

  13. Synthetic acceleration methods for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.; Larsen, E.W.

    1991-01-01

    This paper reports on the diffusion synthetic acceleration (DSA) algorithm that effectively accelerates the iterative solution of transport problems with isotropic or mildly anisotropic scattering. However, DSA loses its effectiveness for transport problems that have strongly anisotropic scattering. Two generalizations of DSA are proposed, which, for highly anisotropic scattering problems, converge at least an order of magnitude (clock time) faster than the DSA method. These two methods are developed, the results of Fourier analyses that theoretically predict their efficiency are described, and numerical results that verify the theoretical predictions are presented

  14. Band gaps in periodically magnetized homogeneous anisotropic media

    Science.gov (United States)

    Merzlikin, A. M.; Levy, M.; Vinogradov, A. P.; Wu, Z.; Jalali, A. A.

    2010-11-01

    In [A. M. Merzlikin, A. P. Vinogradov, A. V. Dorofeenko, M. Inoue, M. Levy, A. B. Granovsky, Physica B 394 (2007) 277] it is shown that in anisotropic magnetophotonic crystal made of anisotropic dielectric layers and isotropic magneto-optical layers the magnetization leads to formation of additional band gaps (BG) inside the Brillouin zones. Due to the weakness of the magneto-optical effects the width of these BG is much smaller than that of usual BG forming on the boundaries of Brillouin zones. In the present communication we show that though the anisotropy suppresses magneto-optical effects. An anisotropic magnetophotonic crystal made of anisotropic dielectric layers and anisotropic magneto-optical; the width of additional BG may be much greater than the width of the usual Brillouin BG. Anisotropy tends to suppress Brillouin zone boundary band gap formation because the anisotropy suppresses magneto-optical properties, while degenerate band gap formation occurs around points of effective isotropy and is not suppressed.

  15. Dynamic problem of generalized thermoelastic diffusive medium

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Rajneesh; Kansal, Tarun [Kurukshetra University, Kurukshetra (India)

    2010-01-15

    The equations of generalized thermoelastic diffusion, based on the theory of Lord and Shulman with one relaxation time, are derived for anisotropic media with rotation. The variational principle and reciprocity theorem for the governing equations are derived. The propagation of leaky Rayleigh waves in a viscous fluid layer overlying a homogeneous isotropic, generalized thermoelastic diffusive half space with rotating frame of reference is studied

  16. Dynamics of anisotropic tissue growth

    Energy Technology Data Exchange (ETDEWEB)

    Bittig, Thomas; Juelicher, Frank [Max Planck Institute for the Physics of Complex Systems, Noethnitzer Strasse 38, 01187 Dresden (Germany); Wartlick, Ortrud; Kicheva, Anna; Gonzalez-Gaitan, Marcos [Department of Biochemistry and Department of Molecular Biology, Geneva University, Sciences II, Quai Ernest-Ansermet 30, 1211 Geneva 4 (Switzerland)], E-mail: Marcos.Gonzalez@biochem.unige.ch, E-mail: julicher@pks.mpg.de

    2008-06-15

    We study the mechanics of tissue growth via cell division and cell death (apoptosis). The rearrangements of cells can on large scales and times be captured by a continuum theory which describes the tissue as an effective viscous material with active stresses generated by cell division. We study the effects of anisotropies of cell division on cell rearrangements and show that average cellular trajectories exhibit anisotropic scaling behaviors. If cell division and apoptosis balance, there is no net growth, but for anisotropic cell division the tissue undergoes spontaneous shear deformations. Our description is relevant for the study of developing tissues such as the imaginal disks of the fruit fly Drosophila melanogaster, which grow anisotropically.

  17. An optimization-based framework for anisotropic simplex mesh adaptation

    Science.gov (United States)

    Yano, Masayuki; Darmofal, David L.

    2012-09-01

    We present a general framework for anisotropic h-adaptation of simplex meshes. Given a discretization and any element-wise, localizable error estimate, our adaptive method iterates toward a mesh that minimizes error for a given degrees of freedom. Utilizing mesh-metric duality, we consider a continuous optimization problem of the Riemannian metric tensor field that provides an anisotropic description of element sizes. First, our method performs a series of local solves to survey the behavior of the local error function. This information is then synthesized using an affine-invariant tensor manipulation framework to reconstruct an approximate gradient of the error function with respect to the metric tensor field. Finally, we perform gradient descent in the metric space to drive the mesh toward optimality. The method is first demonstrated to produce optimal anisotropic meshes minimizing the L2 projection error for a pair of canonical problems containing a singularity and a singular perturbation. The effectiveness of the framework is then demonstrated in the context of output-based adaptation for the advection-diffusion equation using a high-order discontinuous Galerkin discretization and the dual-weighted residual (DWR) error estimate. The method presented provides a unified framework for optimizing both the element size and anisotropy distribution using an a posteriori error estimate and enables efficient adaptation of anisotropic simplex meshes for high-order discretizations.

  18. Anisotropic hydrodynamics: Motivation and methodology

    Energy Technology Data Exchange (ETDEWEB)

    Strickland, Michael

    2014-06-15

    In this proceedings contribution I review recent progress in our understanding of the bulk dynamics of relativistic systems that possess potentially large local rest frame momentum-space anisotropies. In order to deal with these momentum-space anisotropies, a reorganization of relativistic viscous hydrodynamics can be made around an anisotropic background, and the resulting dynamical framework has been dubbed “anisotropic hydrodynamics”. I also discuss expectations for the degree of momentum-space anisotropy of the quark–gluon plasma generated in relativistic heavy ion collisions at RHIC and LHC from second-order viscous hydrodynamics, strong-coupling approaches, and weak-coupling approaches.

  19. Anisotropic solutions by gravitational decoupling

    Science.gov (United States)

    Ovalle, J.; Casadio, R.; da Rocha, R.; Sotomayor, A.

    2018-02-01

    We investigate the extension of isotropic interior solutions for static self-gravitating systems to include the effects of anisotropic spherically symmetric gravitational sources by means of the gravitational decoupling realised via the minimal geometric deformation approach. In particular, the matching conditions at the surface of the star with the outer Schwarzschild space-time are studied in great detail, and we describe how to generate, from a single physically acceptable isotropic solution, new families of anisotropic solutions whose physical acceptability is also inherited from their isotropic parent.

  20. Anisotropic solutions by gravitational decoupling

    Energy Technology Data Exchange (ETDEWEB)

    Ovalle, J. [Silesian University in Opava, Institute of Physics and Research Centre of Theoretical Physics and Astrophysics, Faculty of Philosophy and Science, Opava (Czech Republic); Universidad Simon Bolivar, Departamento de Fisica, Caracas (Venezuela, Bolivarian Republic of); Casadio, R. [Alma Mater Universita di Bologna, Dipartimento di Fisica e Astronomia, Bologna (Italy); Istituto Nazionale di Fisica Nucleare, Bologna (Italy); Rocha, R. da [Universidade Federal do ABC (UFABC), Centro de Matematica, Computacao e Cognicao, Santo Andre, SP (Brazil); Sotomayor, A. [Universidad de Antofagasta, Departamento de Matematicas, Antofagasta (Chile)

    2018-02-15

    We investigate the extension of isotropic interior solutions for static self-gravitating systems to include the effects of anisotropic spherically symmetric gravitational sources by means of the gravitational decoupling realised via the minimal geometric deformation approach. In particular, the matching conditions at the surface of the star with the outer Schwarzschild space-time are studied in great detail, and we describe how to generate, from a single physically acceptable isotropic solution, new families of anisotropic solutions whose physical acceptability is also inherited from their isotropic parent. (orig.)

  1. Electrically Anisotropic Layered Perovskite Single Crystal

    KAUST Repository

    Li, Ting-You

    2016-04-01

    Organic-inorganic hybrid perovskites (OIHPs), which are promising materials for electronic and optoelectronic applications (1-10), have made into layered organic-inorganic hybrid perovskites (LOIHPs). These LOIHPs have been applied to thin-film transistors, solar cells and tunable wavelength phosphors (11-18). It is known that devices fabricated with single crystal exhibit the superior performance, which makes the growth of large-sized single crystals critical for future device applications (19-23). However, the difficulty in growing large-sized LOIHPs single crystal with superior electrical properties limits their practical applications. Here, we report a method to grow the centimeter-scaled LOIHP single crystal of [(HOC2H4NH3)2PbI4], demonstrating the potentials in mass production. After that, we reveal anisotropic electrical and optoelectronic properties which proved the carrier propagating along inorganic framework. The carrier mobility of in-inorganic-plane (in-plane) devices shows the average value of 45 cm2 V–1 s–1 which is about 100 times greater than the record of LOIHP devices (15), showing the importance of single crystal in device application. Moreover, the LOIHP single crystals show its ultra-short carrier lifetime of 42.7 ps and photoluminescence quantum efficiency (PLQE) of 25.4 %. We expect this report to be a start of LOIHPs for advanced applications in which the anisotropic properties are needed (24-25), and meets the demand of high-speed applications and fast-response applications.

  2. Greater autonomy at work

    NARCIS (Netherlands)

    Houtman, I.L.D.

    2004-01-01

    In the past 10 years, workers in the Netherlands increasingly report more decision-making power in their work. This is important for an economy in recession and where workers face greater work demands. It makes work more interesting, creates a healthier work environment, and provides opportunities

  3. Failure in imperfect anisotropic materials

    DEFF Research Database (Denmark)

    Legarth, Brian Nyvang

    2005-01-01

    The fundamental cause of crack growth, namely nucleation and growth of voids, is investigated numerically for a two phase imperfect anisotropic material. A unit cell approach is adopted from which the overall stress strain is evaluated. Failure is observed as a sudden stress drop and depending...

  4. Magnetic relaxation in anisotropic magnets

    DEFF Research Database (Denmark)

    Lindgård, Per-Anker

    1971-01-01

    The line shape and the kinematic and thermodynamic slowing down of the critical and paramagnetic relaxation in axially anisotropic materials are discussed. Kinematic slowing down occurs only in the longitudinal relaxation function. The thermodynamic slowing down occurs in either the transverse...... or longitudinal relaxation function depending on the sign of the axial anisotropy....

  5. Anisotropic gradients in the upper mantle

    International Nuclear Information System (INIS)

    Garmany, J.

    1981-01-01

    Pn amplitudes in some widely spaced sets of orthogonal marine refraction lines on young oceanic crust are greater in the fast direction than in the slow direction. This is inconsistent with the predicted amplitude behavior for simple head waves, but can be explained by an increase in anisotropy with depth. It appears that these gradients are due to increasing olivine crystal orientation, although changes in the relative abundance of two anisotropic minerals without variable tectonization could also account for the observations. Depth variation of tectonization most probably indicates very high temperature gradients at the Moho. This would imply a substantial amount of convective heat transport in the whole oceanic crust near mid-ocean rises

  6. Interactions, strings and isotopies in higher order anisotropic superspaces

    CERN Document Server

    Vacaru, Sergiu Ion

    2001-01-01

    The monograph summarizes the author's results on the geometry of anholonomic and locally anisotropic interactions, published in J. Math. Phys., Nucl. Phys. B, Ann. Phys. (NY), JHEP, Rep. Math. Phys., Int. J. Theor. Phys. and in some former Soviet Union and Romanian scientific journals. The main subjects are in the theory of field interactions, strings and diffusion processes on spaces, superspaces and isospaces with higher order anisotropy and inhomogeneity. The approach proceeds by developing the concept of higher order anisotropic (super)space which unifies the logical and manthematical aspects of modern Kaluza--Klein theories and generalized Lagrange and Finsler geometry and leads to modeling of physical processes on higher order fiber (super)bundles provided with nonlinear and distinguished connections and metric structures. This book can be also considered as a pedagogical survey on the mentioned subjects.

  7. A resistor interpretation of general anisotropic cardiac tissue.

    Science.gov (United States)

    Shao, Hai; Sampson, Kevin J; Pormann, John B; Rose, Donald J; Henriquez, Craig S

    2004-02-01

    This paper describes a spatial discretization scheme for partial differential equation systems that contain anisotropic diffusion. The discretization method uses unstructured finite volumes, or the boxes, that are formed as a secondary geometric structure from an underlying triangular mesh. We show how the discretization can be interpreted as a resistive circuit network, where each resistor is assigned at each edge of the triangular element. The resistor is computed as an anisotropy dependent geometric quantity of the local mesh structure. Finally, we show that under certain conditions, the discretization gives rise to negative resistors that can produce non-physical hyperpolarizations near depolarizing stimuli. We discuss how the proper choice of triangulation (anisotropic Delaunay triangulation) can ensure monotonicity (i.e. all resistors are positive).

  8. MULTISCALE TENSOR ANISOTROPIC FILTERING OF FLUORESCENCE MICROSCOPY FOR DENOISING MICROVASCULATURE.

    Science.gov (United States)

    Prasath, V B S; Pelapur, R; Glinskii, O V; Glinsky, V V; Huxley, V H; Palaniappan, K

    2015-04-01

    Fluorescence microscopy images are contaminated by noise and improving image quality without blurring vascular structures by filtering is an important step in automatic image analysis. The application of interest here is to automatically extract the structural components of the microvascular system with accuracy from images acquired by fluorescence microscopy. A robust denoising process is necessary in order to extract accurate vascular morphology information. For this purpose, we propose a multiscale tensor with anisotropic diffusion model which progressively and adaptively updates the amount of smoothing while preserving vessel boundaries accurately. Based on a coherency enhancing flow with planar confidence measure and fused 3D structure information, our method integrates multiple scales for microvasculature preservation and noise removal membrane structures. Experimental results on simulated synthetic images and epifluorescence images show the advantage of our improvement over other related diffusion filters. We further show that the proposed multiscale integration approach improves denoising accuracy of different tensor diffusion methods to obtain better microvasculature segmentation.

  9. Anisotropic transport of microalgae Chlorella vulgaris in microfluidic channel

    International Nuclear Information System (INIS)

    Ishak, Nur Izzati; Muniandy, S V; Periasamy, Vengadesh; Ng, Fong-Lee; Phang, Siew-Moi

    2017-01-01

    In this work, we study the regional dependence of transport behavior of microalgae Chlorella vulgaris inside microfluidic channel on applied fluid flow rate. The microalgae are treated as spherical naturally buoyant particles. Deviation from the normal diffusion or Brownian transport is characterized based on the scaling behavior of the mean square displacement (MSD) of the particle trajectories by resolving the displacements in the streamwise (flow) and perpendicular directions. The channel is divided into three different flow regions, namely center region of the channel and two near-wall boundaries and the particle motions are analyzed at different flow rates. We use the scaled Brownian motion to model the transitional characteristics in the scaling behavior of the MSDs. We find that there exist anisotropic anomalous transports in all the three flow regions with mixed sub-diffusive, normal and super-diffusive behavior in both longitudinal and transverse directions. (paper)

  10. Greater-confinement disposal

    International Nuclear Information System (INIS)

    Trevorrow, L.E.; Schubert, J.P.

    1989-01-01

    Greater-confinement disposal (GCD) is a general term for low-level waste (LLW) disposal technologies that employ natural and/or engineered barriers and provide a degree of confinement greater than that of shallow-land burial (SLB) but possibly less than that of a geologic repository. Thus GCD is associated with lower risk/hazard ratios than SLB. Although any number of disposal technologies might satisfy the definition of GCD, eight have been selected for consideration in this discussion. These technologies include: (1) earth-covered tumuli, (2) concrete structures, both above and below grade, (3) deep trenches, (4) augered shafts, (5) rock cavities, (6) abandoned mines, (7) high-integrity containers, and (8) hydrofracture. Each of these technologies employ several operations that are mature,however, some are at more advanced stages of development and demonstration than others. Each is defined and further described by information on design, advantages and disadvantages, special equipment requirements, and characteristic operations such as construction, waste emplacement, and closure

  11. Holographic models with anisotropic scaling

    Science.gov (United States)

    Brynjolfsson, E. J.; Danielsson, U. H.; Thorlacius, L.; Zingg, T.

    2013-12-01

    We consider gravity duals to d+1 dimensional quantum critical points with anisotropic scaling. The primary motivation comes from strongly correlated electron systems in condensed matter theory but the main focus of the present paper is on the gravity models in their own right. Physics at finite temperature and fixed charge density is described in terms of charged black branes. Some exact solutions are known and can be used to obtain a maximally extended spacetime geometry, which has a null curvature singularity inside a single non-degenerate horizon, but generic black brane solutions in the model can only be obtained numerically. Charged matter gives rise to black branes with hair that are dual to the superconducting phase of a holographic superconductor. Our numerical results indicate that holographic superconductors with anisotropic scaling have vanishing zero temperature entropy when the back reaction of the hair on the brane geometry is taken into account.

  12. Anisotropic inflation with derivative couplings

    Science.gov (United States)

    Holland, Jonathan; Kanno, Sugumi; Zavala, Ivonne

    2018-05-01

    We study anisotropic power-law inflationary solutions when the inflaton and its derivative couple to a vector field. This type of coupling is motivated by D-brane inflationary models, in which the inflaton, and a vector field living on the D-brane, couple disformally (derivatively). We start by studying a phenomenological model where we show the existence of anisotropic solutions and demonstrate their stability via a dynamical system analysis. Compared to the case without a derivative coupling, the anisotropy is reduced and thus can be made consistent with current limits, while the value of the slow-roll parameter remains almost unchanged. We also discuss solutions for more general cases, including D-brane-like couplings.

  13. Anisotropic models for compact stars

    Energy Technology Data Exchange (ETDEWEB)

    Maurya, S.K.; Dayanandan, Baiju [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman); Gupta, Y.K. [Jaypee Institute of Information Technology University, Department of Mathematics, Noida, Uttar Pradesh (India); Ray, Saibal [Government College of Engineering and Ceramic Technology, Department of Physics, Kolkata, West Bengal (India)

    2015-05-15

    In the present paper we obtain an anisotropic analog of the Durgapal and Fuloria (Gen Relativ Gravit 17:671, 1985) perfect fluid solution. The methodology consists of contraction of the anisotropic factor Δ with the help of both metric potentials e{sup ν} and e{sup λ}. Here we consider e{sup λ} the same as Durgapal and Fuloria (Gen Relativ Gravit 17:671, 1985) did, whereas e{sup ν} is as given by Lake (Phys Rev D 67:104015, 2003). The field equations are solved by the change of dependent variable method. The solutions set mathematically thus obtained are compared with the physical properties of some of the compact stars, strange star as well as white dwarf. It is observed that all the expected physical features are available related to the stellar fluid distribution, which clearly indicates the validity of the model. (orig.)

  14. Anisotropic Ripple Deformation in Phosphorene.

    Science.gov (United States)

    Kou, Liangzhi; Ma, Yandong; Smith, Sean C; Chen, Changfeng

    2015-05-07

    Two-dimensional materials tend to become crumpled according to the Mermin-Wagner theorem, and the resulting ripple deformation may significantly influence electronic properties as observed in graphene and MoS2. Here, we unveil by first-principles calculations a new, highly anisotropic ripple pattern in phosphorene, a monolayer black phosphorus, where compression-induced ripple deformation occurs only along the zigzag direction in the strain range up to 10%, but not the armchair direction. This direction-selective ripple deformation mode in phosphorene stems from its puckered structure with coupled hinge-like bonding configurations and the resulting anisotropic Poisson ratio. We also construct an analytical model using classical elasticity theory for ripple deformation in phosphorene under arbitrary strain. The present results offer new insights into the mechanisms governing the structural and electronic properties of phosphorene crucial to its device applications.

  15. Anisotropic charged generalized polytropic models

    Science.gov (United States)

    Nasim, A.; Azam, M.

    2018-06-01

    In this paper, we found some new anisotropic charged models admitting generalized polytropic equation of state with spherically symmetry. An analytic solution of the Einstein-Maxwell field equations is obtained through the transformation introduced by Durgapal and Banerji (Phys. Rev. D 27:328, 1983). The physical viability of solutions corresponding to polytropic index η =1/2, 2/3, 1, 2 is analyzed graphically. For this, we plot physical quantities such as radial and tangential pressure, anisotropy, speed of sound which demonstrated that these models achieve all the considerable physical conditions required for a relativistic star. Further, it is mentioned here that previous results for anisotropic charged matter with linear, quadratic and polytropic equation of state can be retrieved.

  16. Anisotropic superfluidity of hadronic matter

    International Nuclear Information System (INIS)

    Chela Flores, J.

    1977-10-01

    From a model of strong interactions with important general features (f-g model) and from recent experiments of Rudnick and co-workers on thin films of helium II, hadronic matter is considered as a new manifestation of anisotropic superfluidity. In order to test the validity of the suggestion, some qualitative features of multiparticle production of hadrons are considered, and found to have a natural explanation. A prediction is made following a recent experiment on π + p collisions

  17. Anisotropic characterization of magnetorheological materials

    Energy Technology Data Exchange (ETDEWEB)

    Dohmen, E., E-mail: eike.dohmen@tu-dresden.de; Modler, N.; Gude, M.

    2017-06-01

    For the development of energy efficient lightweight parts novel function integrating materials are needed. Concerning this field of application magnetorheological (MR) fluids, MR elastomers and MR composites are promising materials allowing the adjustment of mechanical properties by an external magnetic field. A key issue for operating such structures in praxis is the magneto-mechanical description. Most rheological properties are gathered at laboratory conditions for high magnetic flux densities and a single field direction, which does not correspond to real praxis conditions. Although anisotropic formation of superstructures can be observed in MR suspensions (Fig. 1) or experimenters intentionally polymerize MR elastomers with anisotropic superstructures these MR materials are usually described in an external magnetic field as uniform, isotropic materials. This is due to missing possibilities for experimentally measuring field angle dependent properties and ways of distinguishing between material properties and frictional effects. Just a few scientific works experimentally investigated the influence of different field angles (Ambacher et al., 1992; Grants et al., 1990; Kuzhir et al., 2003) or the influence of surface roughness on the shear behaviour of magnetic fluids (Tang and Conrad, 1996) . The aim of this work is the introduction of a novel field angle cell allowing the determination of anisotropic mechanical properties for various MR materials depending on the applied magnetic field angle. - Highlights: • Novel magnetic field angle testing device (MFATD) presented. • Determination of magnetic field dependent anisotropic mechanical properties. • Experimental data for different field directions shown for a commercial MR fluid. • Material description of MR fluids as transversal-isotropic solids. • Magnetic field angle dependent variations in shear stresses experimentally measured. • Determination of frictional coefficients between the MR fluid and

  18. Cracking of anisotropic cylindrical polytropes

    Energy Technology Data Exchange (ETDEWEB)

    Mardan, S.A. [University of the Management and Technology, Department of Mathematics, Lahore (Pakistan); Azam, M. [University of Education, Division of Science and Technology, Lahore (Pakistan)

    2017-06-15

    We study the appearance of cracking in charged anisotropic cylindrical polytropes with generalized polytropic equation. We investigate the existence of cracking in two different kinds of polytropes existing in the literature through two different assumptions: (a) local density perturbation with conformally flat condition, and (b) perturbing polytropic index, charge and anisotropy parameters. We conclude that cracking appears in both kinds of polytropes for a specific range of density and model parameters. (orig.)

  19. More features, greater connectivity.

    Science.gov (United States)

    Hunt, Sarah

    2015-09-01

    Changes in our political infrastructure, the continuing frailties of our economy, and a stark growth in population, have greatly impacted upon the perceived stability of the NHS. Healthcare teams have had to adapt to these changes, and so too have the technologies upon which they rely to deliver first-class patient care. Here Sarah Hunt, marketing co-ordinator at Aid Call, assesses how the changing healthcare environment has affected one of its fundamental technologies - the nurse call system, argues the case for wireless such systems in terms of what the company claims is greater adaptability to changing needs, and considers the ever-wider range of features and functions available from today's nurse call equipment, particularly via connectivity with both mobile devices, and ancillaries ranging from enuresis sensors to staff attack alert 'badges'.

  20. Greater oil investment opportunities

    International Nuclear Information System (INIS)

    Arenas, Ismael Enrique

    1997-01-01

    Geologically speaking, Colombia is a very attractive country for the world oil community. According to this philosophy new and important steps are being taken to reinforce the oil sector: Expansion of the exploratory frontier by including a larger number of sedimentary areas, and the adoption of innovative contracting instruments. Colombia has to offer, Greater economic incentives for the exploration of new areas to expand the exploratory frontier, stimulation of exploration in areas with prospectivity for small fields. Companies may offer Ecopetrol a participation in production over and above royalties, without it's participating in the investments and costs of these fields, more favorable conditions for natural gas seeking projects, in comparison with those governing the terms for oil

  1. An introduction to visualization of diffusion tensor imaging and its applications

    NARCIS (Netherlands)

    Vilanova, A.; Zhang, S.; Kindlmann, G.; Laidlaw, D.H.; Weickert, J.; Hagen, H.

    2005-01-01

    Summary. Water diffusion is anisotropic in organized tissues such as white matter and muscle. Diffusion tensor imaging (DTI), a non-invasive MR technique, measures water self-diffusion rates and thus gives an indication of the underlying tissue microstructure. The diffusion rate is often expressed

  2. Spatial Mapping of Translational Diffusion Coefficients Using Diffusion Tensor Imaging: A Mathematical Description.

    Science.gov (United States)

    Shetty, Anil N; Chiang, Sharon; Maletic-Savatic, Mirjana; Kasprian, Gregor; Vannucci, Marina; Lee, Wesley

    2014-01-01

    In this article, we discuss the theoretical background for diffusion weighted imaging and diffusion tensor imaging. Molecular diffusion is a random process involving thermal Brownian motion. In biological tissues, the underlying microstructures restrict the diffusion of water molecules, making diffusion directionally dependent. Water diffusion in tissue is mathematically characterized by the diffusion tensor, the elements of which contain information about the magnitude and direction of diffusion and is a function of the coordinate system. Thus, it is possible to generate contrast in tissue based primarily on diffusion effects. Expressing diffusion in terms of the measured diffusion coefficient (eigenvalue) in any one direction can lead to errors. Nowhere is this more evident than in white matter, due to the preferential orientation of myelin fibers. The directional dependency is removed by diagonalization of the diffusion tensor, which then yields a set of three eigenvalues and eigenvectors, representing the magnitude and direction of the three orthogonal axes of the diffusion ellipsoid, respectively. For example, the eigenvalue corresponding to the eigenvector along the long axis of the fiber corresponds qualitatively to diffusion with least restriction. Determination of the principal values of the diffusion tensor and various anisotropic indices provides structural information. We review the use of diffusion measurements using the modified Stejskal-Tanner diffusion equation. The anisotropy is analyzed by decomposing the diffusion tensor based on symmetrical properties describing the geometry of diffusion tensor. We further describe diffusion tensor properties in visualizing fiber tract organization of the human brain.

  3. Anisotropic Diffusion based Brain MRI Segmentation and 3D Reconstruction

    Directory of Open Access Journals (Sweden)

    M. Arfan Jaffar

    2012-06-01

    Full Text Available In medical field visualization of the organs is very imperative for accurate diagnosis and treatment of any disease. Brain tumor diagnosis and surgery also required impressive 3D visualization of the brain to the radiologist. Detection and 3D reconstruction of brain tumors from MRI is a computationally time consuming and error-prone task. Proposed system detects and presents a 3D visualization model of the brain and tumor inside which greatly helps the radiologist to effectively diagnose and analyze the brain tumor. We proposed a multi-phase segmentation and visualization technique which overcomes the many problems of 3D volume segmentation methods like lake of fine details. In this system segmentation is done in three different phases which reduces the error chances. The system finds contours for skull, brain and tumor. These contours are stacked over and two novel methods are used to find the 3D visualization models. The results of these techniques, particularly of interpolation based, are impressive. Proposed system is tested against publically available data set [41] and MRI datasets available from MRI aamp; CT center Rawalpindi, Pakistan [42].

  4. Anisotropic Diffusion based Brain MRI Segmentation and 3D Reconstruction

    OpenAIRE

    M. Arfan Jaffar; Sultan Zia; Ghaznafar Latif; AnwarM. Mirza; Irfan Mehmood; Naveed Ejaz; Sung Wook Baik

    2012-01-01

    In medical field visualization of the organs is very imperative for accurate diagnosis and treatment of any disease. Brain tumor diagnosis and surgery also required impressive 3D visualization of the brain to the radiologist. Detection and 3D reconstruction of brain tumors from MRI is a computationally time consuming and error-prone task. Proposed system detects and presents a 3D visualization model of the brain and tumor inside which greatly helps the radiologist to effectively diagnose and ...

  5. A study on the effective hydraulic conductivity of an anisotropic porous medium

    International Nuclear Information System (INIS)

    Seong, Kwan Jae

    2002-01-01

    Effective hydraulic conductivity of a statistically anisotropic heterogeneous medium is obtained for steady two-dimensional flows employing stochastic analysis. Flow equations are solved up to second order and the effective conductivity is obtained in a semi-analytic form depending only on the spatial correlation function and the anisotropy ratio of the hydraulic conductivity field, hence becoming a true intrinsic property independent of the flow field. Results are obtained using a statistically anisotropic Gaussian correlation function where the anisotropic is defined as the ratio of integral scales normal and parallel to the mean flow direction. Second order results indicate that the effective conductivity of an anisotropic medium is greater than that of an isotropic one when the anisotropy ratio is less than one and vice versa. It is also found that the effective conductivity has upper and lower bounds of the arithmetic and the harmonic mean conductivities

  6. Complex Anisotropic Structure of the Mantle Wedge Beneath Kamchatka Volcanoes

    Science.gov (United States)

    Levin, V.; Park, J.; Gordeev, E.; Droznin, D.

    2002-12-01

    the slab. To explain the vertical stratification of anisotropy implied from receiver functions, and the strong lateral dependence of shear-wave splitting observations, we cannot rely on simple models of mantle wedge behaviour e.g., olivine-crystal alignment through subduction-driven corner flow. Diverse mechanisms can contribute to the observed pattern of anisotropic properties, with volatiles likely being a key influence. For instance, we find evidence in favor of a slow-symmetry-axis anisotropy within the uppermost 10-20 km of the mantle wedge, implying either excessive hydration of the mantle or else a presence of systematically aligned volatile-filled cracks or lenses. Also, shear-wave splitting is weak beneath the Avachinsky-Koryaksky volcanic center, suggesting either vertical flow or the influence of volatiles and/or thermally-enhanced diffusion creep.

  7. Neutron transfer with anisotropic scattering

    International Nuclear Information System (INIS)

    El Wakil, S.A.; Haggag, M.H.; Saad, E.A.

    1979-01-01

    The finite slab problem is reduced to a semi-infinite one by adding an infinitesimally thick layer such that both the added layer and the total layer are semi-infinite. The relation between the reflection and transmission functions for a finite slab and those for an infinite one are obtained in terms of an operator which satisfies a semigroup equation. The method is applied to anisotropic scattering with azimuthal dependence. Numerical calculations are made and the results compared with those of other workers. (author)

  8. Anisotropic densification of reference steel

    International Nuclear Information System (INIS)

    Garner, F.A.; Bates, J.F.; Gilbert, E.R.

    1975-09-01

    A correlation is presented for the densification expected during neutron irradiation of 20 percent CW 316 stainless steel cladding of FTR specification. The densification is known to be a function of time, prior heat treatment, cold work level, irradiation temperature and minor element composition. For FTR fuel pin use, the temperature and carbon composition were chosen as the only relevant variables on which to base the correlation. The densification of FTR cladding is expected to be slightly anisotropic, leading to a diameter change somewhat less than that predicted by the isotropic relationship ΔD = -D 0 /3

  9. Anisotropic and nonlinear optical waveguides

    CERN Document Server

    Someda, CG

    1992-01-01

    Dielectric optical waveguides have been investigated for more than two decades. In the last ten years they have had the unique position of being simultaneously the backbone of a very practical and fully developed technology, as well as an extremely exciting area of basic, forefront research. Existing waveguides can be divided into two sets: one consisting of waveguides which are already in practical use, and the second of those which are still at the laboratory stage of their evolution. This book is divided into two separate parts: the first dealing with anisotropic waveguides, an

  10. Diffusion Influenced Adsorption Kinetics.

    Science.gov (United States)

    Miura, Toshiaki; Seki, Kazuhiko

    2015-08-27

    When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

  11. Radiative Transfer Equation for Anisotropic Spherical Medium with Specular Reflective Index

    International Nuclear Information System (INIS)

    Elghazaly, A.

    2009-01-01

    Radiative transfer problem for anisotropic scattering in a spherical homogeneous, turbid medium with diffuse and angular dependent (specular) reflecting boundaries is solved using the Pomraning-Eddington approximation method. The angular dependent specular reflectivity of the boundary is considered as Fresnel's reflection probability function. The partial heat flux is calculated with anisotropic scattering through a homogeneous solid sphere. The calculations are carried out for spherical media of radii 0.1, 1.0, and 10 mfp and for different scattering albedo. Two different weight functions are used to verify the boundary conditions. Our results are compared with the available data and give an excellent agreement for thick and highly scattering media

  12. The generalized PN synthetic acceleration method for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.

    1998-01-01

    The diffusion synthetic acceleration (DSA) method has been known to be an effective tool for accelerating the iterative solution of transport equations with isotopic or mildly anisotropic scattering. However, the DSA method is not effective for transport equations that have strongly anisotropic scattering. A generalization of the modified DSA (MDSA) methods is proposed. This method converges (Clock time) faster than the MDSA method. It is developed, the results of a Fourier analysis that theoretically predicts its efficiency are described, and numerical results that verify the theoretical prediction are presented. (author). 9 refs., 2 tabs., 5 figs

  13. The generalized PN synthetic acceleration method for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.

    1997-01-01

    The diffusion synthetic acceleration (DSA) method has been known to be an effective tool for accelerating the iterative solution of transport equations with isotropic or mildly anisotropic scattering. However, the DSA method is not effective for transport equations that have strongly anisotropic scattering. A generalization of the modified DSA (MDSA) method is proposed that converges (clock time) faster than the MDSA method. This method is developed, the results of a Fourier analysis that theoretically predicts its efficiency are described, and numerical results that verify the theoretical prediction are presented

  14. Theoretical and numerical study of highly anisotropic turbulent flows

    NARCIS (Netherlands)

    Biferale, L.; Daumont, I.; Lanotte, A.; Toschi, F.

    2004-01-01

    We present a detailed numerical study of anisotropic statistical fluctuations in stationary, homogeneous turbulent flows. We address both problems of intermittency in anisotropic sectors, and the relative importance of isotropic and anisotropic fluctuations at different scales on a direct numerical

  15. Noise-induced drift in two-dimensional anisotropic systems

    Science.gov (United States)

    Farago, Oded

    2017-10-01

    We study the isothermal Brownian dynamics of a particle in a system with spatially varying diffusivity. Due to the heterogeneity of the system, the particle's mean displacement does not vanish even if it does not experience any physical force. This phenomenon has been termed "noise-induced drift," and has been extensively studied for one-dimensional systems. Here, we examine the noise-induced drift in a two-dimensional anisotropic system, characterized by a symmetric diffusion tensor with unequal diagonal elements. A general expression for the mean displacement vector is derived and presented as a sum of two vectors, depicting two distinct drifting effects. The first vector describes the tendency of the particle to drift toward the high diffusivity side in each orthogonal principal diffusion direction. This is a generalization of the well-known expression for the noise-induced drift in one-dimensional systems. The second vector represents a novel drifting effect, not found in one-dimensional systems, originating from the spatial rotation in the directions of the principal axes. The validity of the derived expressions is verified by using Langevin dynamics simulations. As a specific example, we consider the relative diffusion of two transmembrane proteins, and demonstrate that the average distance between them increases at a surprisingly fast rate of several tens of micrometers per second.

  16. Electromagnetism on anisotropic fractal media

    Science.gov (United States)

    Ostoja-Starzewski, Martin

    2013-04-01

    Basic equations of electromagnetic fields in anisotropic fractal media are obtained using a dimensional regularization approach. First, a formulation based on product measures is shown to satisfy the four basic identities of the vector calculus. This allows a generalization of the Green-Gauss and Stokes theorems as well as the charge conservation equation on anisotropic fractals. Then, pursuing the conceptual approach, we derive the Faraday and Ampère laws for such fractal media, which, along with two auxiliary null-divergence conditions, effectively give the modified Maxwell equations. Proceeding on a separate track, we employ a variational principle for electromagnetic fields, appropriately adapted to fractal media, so as to independently derive the same forms of these two laws. It is next found that the parabolic (for a conducting medium) and the hyperbolic (for a dielectric medium) equations involve modified gradient operators, while the Poynting vector has the same form as in the non-fractal case. Finally, Maxwell's electromagnetic stress tensor is reformulated for fractal systems. In all the cases, the derived equations for fractal media depend explicitly on fractal dimensions in three different directions and reduce to conventional forms for continuous media with Euclidean geometries upon setting these each of dimensions equal to unity.

  17. Anisotropic non-Fermi liquids

    Science.gov (United States)

    Sur, Shouvik; Lee, Sung-Sik

    2016-11-01

    We study non-Fermi-liquid states that arise at the quantum critical points associated with the spin density wave (SDW) and charge density wave (CDW) transitions in metals with twofold rotational symmetry. We use the dimensional regularization scheme, where a one-dimensional Fermi surface is embedded in (3 -ɛ ) -dimensional momentum space. In three dimensions, quasilocal marginal Fermi liquids arise both at the SDW and CDW critical points: the speed of the collective mode along the ordering wave vector is logarithmically renormalized to zero compared to that of Fermi velocity. Below three dimensions, however, the SDW and CDW critical points exhibit drastically different behaviors. At the SDW critical point, a stable anisotropic non-Fermi-liquid state is realized for small ɛ , where not only time but also different spatial coordinates develop distinct anomalous dimensions. The non-Fermi liquid exhibits an emergent algebraic nesting as the patches of Fermi surface are deformed into a universal power-law shape near the hot spots. Due to the anisotropic scaling, the energy of incoherent spin fluctuations disperse with different power laws in different momentum directions. At the CDW critical point, on the other hand, the perturbative expansion breaks down immediately below three dimensions as the interaction renormalizes the speed of charge fluctuations to zero within a finite renormalization group scale through a two-loop effect. The difference originates from the fact that the vertex correction antiscreens the coupling at the SDW critical point whereas it screens at the CDW critical point.

  18. High-energy phosphate transfer in human muscle: diffusion of phosphocreatine.

    Science.gov (United States)

    Gabr, Refaat E; El-Sharkawy, Abdel-Monem M; Schär, Michael; Weiss, Robert G; Bottomley, Paul A

    2011-07-01

    The creatine kinase (CK) reaction is central to muscle energetics, buffering ATP levels during periods of intense activity via consumption of phosphocreatine (PCr). PCr is believed to serve as a spatial shuttle of high-energy phosphate between sites of energy production in the mitochondria and sites of energy utilization in the myofibrils via diffusion. Knowledge of the diffusion coefficient of PCr (D(PCr)) is thus critical for modeling and understanding energy transport in the myocyte, but D(PCr) has not been measured in humans. Using localized phosphorus magnetic resonance spectroscopy, we measured D(PCr) in the calf muscle of 11 adults as a function of direction and diffusion time. The results show that the diffusion of PCr is anisotropic, with significantly higher diffusion along the muscle fibers, and that the diffusion of PCr is restricted to a ∼28-μm pathlength assuming a cylindrical model, with an unbounded diffusion coefficient of ∼0.69 × 10(-3) mm(2)/s. This distance is comparable in size to the myofiber radius. On the basis of prior measures of CK reaction kinetics in human muscle, the expected diffusion distance of PCr during its half-life in the CK reaction is ∼66 μm. This distance is much greater than the average distances between mitochondria and myofibrils. Thus these first measurements of PCr diffusion in human muscle in vivo support the view that PCr diffusion is not a factor limiting high-energy phosphate transport between the mitochondria and the myofibrils in healthy resting myocytes.

  19. Efficient Wavefield Extrapolation In Anisotropic Media

    KAUST Repository

    Alkhalifah, Tariq; Ma, Xuxin; Waheed, Umair bin; Zuberi, Mohammad Akbar Hosain

    2014-01-01

    Various examples are provided for wavefield extrapolation in anisotropic media. In one example, among others, a method includes determining an effective isotropic velocity model and extrapolating an equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. The effective isotropic velocity model can be based upon a kinematic geometrical representation of an anisotropic, poroelastic or viscoelastic wavefield. Extrapolating the equivalent propagation can use isotopic, acoustic or elastic operators based upon the determined effective isotropic velocity model. In another example, non-transitory computer readable medium stores an application that, when executed by processing circuitry, causes the processing circuitry to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. In another example, a system includes processing circuitry and an application configured to cause the system to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield.

  20. Nonlinear constitutive relations for anisotropic elastic materials

    Science.gov (United States)

    Sokolova, Marina; Khristich, Dmitrii

    2018-03-01

    A general approach to constructing of nonlinear variants of connection between stresses and strains in anisotropic materials with different types of symmetry of properties is considered. This approach is based on the concept of elastic proper subspaces of anisotropic materials introduced in the mechanics of solids by J. Rychlewski and on the particular postulate of isotropy proposed by A. A. Il’yushin. The generalization of the particular postulate on the case of nonlinear anisotropic materials is formulated. Systems of invariants of deformations as lengths of projections of the strain vector into proper subspaces are developed. Some variants of nonlinear constitutive relations for anisotropic materials are offered. The analysis of these relations from the point of view of their satisfaction to general and limit forms of generalization of partial isotropy postulate on anisotropic materials is performed. The relations for particular cases of anisotropy are written.

  1. Efficient Wavefield Extrapolation In Anisotropic Media

    KAUST Repository

    Alkhalifah, Tariq

    2014-07-03

    Various examples are provided for wavefield extrapolation in anisotropic media. In one example, among others, a method includes determining an effective isotropic velocity model and extrapolating an equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. The effective isotropic velocity model can be based upon a kinematic geometrical representation of an anisotropic, poroelastic or viscoelastic wavefield. Extrapolating the equivalent propagation can use isotopic, acoustic or elastic operators based upon the determined effective isotropic velocity model. In another example, non-transitory computer readable medium stores an application that, when executed by processing circuitry, causes the processing circuitry to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. In another example, a system includes processing circuitry and an application configured to cause the system to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield.

  2. Anisotropic nanomaterials: Synthesis, optical and magnetic properties, and applications

    Science.gov (United States)

    Banholzer, Matthew John

    As nanoscience and nanotechnology mature, anisotropic metal nanostructures are emerging in a variety of contexts as valuable class of nanostructures due to their distinctive attributes. With unique properties ranging from optical to magnetic and beyond, these structures are useful in many new applications. Chapter two discusses the nanodisk code: a linear array of metal disk pairs that serve as surface-enhanced Raman scattering substrates. These multiplexing structures employ a binary encoding scheme, perform better than previous nanowires designs (in the context of SERS) and are useful for both convert encoding and tagging of substrates (based both on spatial disk position and spectroscopic response) as well as biomolecule detection (e.g. DNA). Chapter three describes the development of improved, silver-based nanodisk code structures. Work was undertaken to generate structures with high yield and reproducibility and to reoptimize the geometry of each disk pair for maximum Raman enhancement. The improved silver structures exhibit greater enhancement than Au structures (leading to lower DNA detection limits), convey additional flexibility, and enable trinary encoding schemes where far more unique structures can be created. Chapter four considers the effect of roughness on the plasmonic properties of nanorod structures and introduces a novel method to smooth the end-surfaces of nanorods structures. The smoothing technique is based upon a two-step process relying upon diffusion control during nanowires growth and selective oxidation after each step of synthesis is complete. Empirical and theoretical work show that smoothed nanostructures have superior and controllable optical properties. Chapter five concerns silica-encapsulated gold nanoprisms. This encapsulation allows these highly sensitive prisms to remain stable and protected in solution, enabling their use as class-leading sensors. Theoretical study complements the empirical work, exploring the effect of

  3. Modelling of ultrasonic nondestructive testing in anisotropic materials - Rectangular crack

    International Nuclear Information System (INIS)

    Bostroem, A.

    2001-12-01

    Nondestructive testing with ultrasound is a standard procedure in the nuclear power industry when searching for defects, in particular cracks. To develop and qualify testing procedures extensive experimental work on test blocks is usually required. This can take a lot of time and therefore be quite costly. A good mathematical model of the testing situation is therefore of great value as it can reduce the experimental work to a great extent. A good model can be very useful for parametric studies and as a pedagogical tool. A further use of a model is as a tool in the qualification of personnel. In anisotropic materials, e.g. austenitic welds, the propagation of ultrasound becomes much more complicated as compared to isotropic materials. Therefore, modelling is even more useful for anisotropic materials, and it in particular has a greater pedagogical value. The present project has been concerned with a further development of the anisotropic capabilities of the computer program UTDefect, which has so far only contained a strip-like crack as the single defect type for anisotropic materials. To be more specific, the scattering by a rectangular crack in an anisotropic component has been studied and the result is adapted to include transmitting and receiving ultrasonic probes. The component under study is assumed to be anisotropic with arbitrary anisotropy. On the other hand, it is assumed to be homogeneous, and this in particular excludes most welds, where it is seldom an adequate approximation to assume homogeneity. The anisotropy may be arbitrarily oriented and the same is true of the rectangular crack. The crack may also be located near a backside of the component. To solve the scattering problem for the crack an integral equation method is used. The probe model has been developed in an earlier project and to compute the signal response in the receiving probe an electromechanical reciprocity argument is employed. As a rectangle is a truly 3D scatterer the sizes of the

  4. 2.5D inversion of CSEM data in a vertically anisotropic earth

    International Nuclear Information System (INIS)

    Ramananjaona, Christophe; MacGregor, Lucy

    2010-01-01

    The marine Controlled-Source Electromagnetic (CSEM) method is a low frequency (diffusive) electromagnetic subsurface imaging technique aimed at mapping the electric resistivity of the earth by measuring the response to a source dipole emitting an electromagnetic field in a marine environment. Although assuming isotropy for the inversion is the most straightforward approach, in many situations horizontal layering of the earth strata and grain alignment within earth materials creates electric anisotropy. Ignoring this during interpretation may create artifacts in the inversion results. Accounting for this effect therefore requires adequate forward modelling and inversion procedures. We present here an inversion algorithm for vertically anisotropic media based on finite element modelling, the use of Frechet derivatives, and different types of regularisation. Comparisons between isotropic and anisotropic inversion results are given for the characterisation of an anisotropic earth from data measured in line with the source dipole for both synthetic and real data examples.

  5. Zonal flows in tokamaks with anisotropic pressure

    International Nuclear Information System (INIS)

    Ren, Haijun

    2014-01-01

    Zonal flows (ZFs) in a tokamak plasma with anisotropic pressure are investigated. The dynamics of perpendicular and parallel pressures are determined by the Chew-Goldberger-Low double equations and low-β condition is adopted, where β is the ratio of plasma pressure to the magnetic field pressure. The dispersion relation is analytically derived and illustrates two branches of ZFs. The low frequency zonal flow (LFZF) branch becomes unstable when χ, the ratio of the perpendicular pressure to the parallel one, is greater than a threshold value χ c , which is about 3.8. In the stable region, its frequency increases first and then decreases with increasing χ. For χ = 1, the frequency of LFZF agrees well with the experimental observation. For the instability, the growth rate of LFZF increases with χ. The geodesic acoustic mode branch is shown to be always stable with a frequency increasing with χ. The safety factor is shown to diminish the frequencies of both branches or the growth rate of LFZF

  6. Stability of anisotropic stellar filaments

    Science.gov (United States)

    Bhatti, M. Zaeem-ul-Haq; Yousaf, Z.

    2017-12-01

    The study of perturbation of self-gravitating celestial cylindrical object have been carried out in this paper. We have designed a framework to construct the collapse equation by formulating the modified field equations with the background of f(R , T) theory as well as dynamical equations from the contracted form of Bianchi identities with anisotropic matter configuration. We have encapsulated the radial perturbations on metric and material variables of the geometry with some known static profile at Newtonian and post-Newtonian regimes. We examined a strong dependence of unstable regions on stiffness parameter which measures the rigidity of the fluid. Also, the static profile and matter variables with f(R , T) dark source terms control the instability of compact cylindrical system.

  7. Warm anisotropic inflationary universe model

    International Nuclear Information System (INIS)

    Sharif, M.; Saleem, Rabia

    2014-01-01

    This paper is devoted to the study of warm inflation using vector fields in the background of a locally rotationally symmetric Bianchi type I model of the universe. We formulate the field equations, and slow-roll and perturbation parameters (scalar and tensor power spectra as well as their spectral indices) in the slow-roll approximation. We evaluate all these parameters in terms of the directional Hubble parameter during the intermediate and logamediate inflationary regimes by taking the dissipation factor as a function of the scalar field as well as a constant. In each case, we calculate the observational parameter of interest, i.e., the tensor-scalar ratio in terms of the inflaton. The graphical behavior of these parameters shows that the anisotropic model is also compatible with WMAP7 and the Planck observational data. (orig.)

  8. Warm anisotropic inflationary universe model

    Energy Technology Data Exchange (ETDEWEB)

    Sharif, M.; Saleem, Rabia [University of the Punjab, Department of Mathematics, Lahore (Pakistan)

    2014-02-15

    This paper is devoted to the study of warm inflation using vector fields in the background of a locally rotationally symmetric Bianchi type I model of the universe. We formulate the field equations, and slow-roll and perturbation parameters (scalar and tensor power spectra as well as their spectral indices) in the slow-roll approximation. We evaluate all these parameters in terms of the directional Hubble parameter during the intermediate and logamediate inflationary regimes by taking the dissipation factor as a function of the scalar field as well as a constant. In each case, we calculate the observational parameter of interest, i.e., the tensor-scalar ratio in terms of the inflaton. The graphical behavior of these parameters shows that the anisotropic model is also compatible with WMAP7 and the Planck observational data. (orig.)

  9. Surface diffusion of sorbed radionuclides

    International Nuclear Information System (INIS)

    Berry, J.A.; Bond, K.A.

    1991-01-01

    Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

  10. Anisotropic dynamic mass density for fluidsolid composites

    KAUST Repository

    Wu, Ying; Mei, Jun; Sheng, Ping

    2012-01-01

    By taking the low frequency limit of multiple-scattering theory, we obtain the dynamic effective mass density of fluidsolid composites with a two-dimensional rectangular lattice structure. The anisotropic mass density can be described by an angle

  11. Anisotropic magnetoresistance in a Fermi glass

    International Nuclear Information System (INIS)

    Ovadyahu, Z.; Physics Department, Ben-Gurion University of the Negev, Beer-Sheva, Israel 84120)

    1986-01-01

    Insulating thin films of indium oxide exhibit negative, anisotropic magnetoresistance. The systematics of these results imply that the magnetoresistance mechanism may give different weight to the distribution of the localization lengths than that given by the hopping conductivity

  12. Anisotropic stars obeying Chaplygin equation of state

    Indian Academy of Sciences (India)

    P Bhar

    2017-12-14

    Dec 14, 2017 ... Anisotropic effects may also originate from slow rotation of the core ... to include the effects of pressure anisotropy, electric charge, scalar field, dark energy and the cosmological constant in .... Generating solutions. In order to ...

  13. Anisotropic rectangular metric for polygonal surface remeshing

    KAUST Repository

    Pellenard, Bertrand

    2013-06-18

    We propose a new method for anisotropic polygonal surface remeshing. Our algorithm takes as input a surface triangle mesh. An anisotropic rectangular metric, defined at each triangle facet of the input mesh, is derived from both a user-specified normal-based tolerance error and the requirement to favor rectangle-shaped polygons. Our algorithm uses a greedy optimization procedure that adds, deletes and relocates generators so as to match two criteria related to partitioning and conformity.

  14. Anisotropic rectangular metric for polygonal surface remeshing

    KAUST Repository

    Pellenard, Bertrand; Morvan, Jean-Marie; Alliez, Pierre

    2013-01-01

    We propose a new method for anisotropic polygonal surface remeshing. Our algorithm takes as input a surface triangle mesh. An anisotropic rectangular metric, defined at each triangle facet of the input mesh, is derived from both a user-specified normal-based tolerance error and the requirement to favor rectangle-shaped polygons. Our algorithm uses a greedy optimization procedure that adds, deletes and relocates generators so as to match two criteria related to partitioning and conformity.

  15. 3D controlled-source electromagnetic modeling in anisotropic medium using edge-based finite element method

    DEFF Research Database (Denmark)

    Cai, Hongzhu; Xiong, Bin; Han, Muran

    2014-01-01

    This paper presents a linear edge-based finite element method for numerical modeling of 3D controlled-source electromagnetic data in an anisotropic conductive medium. We use a nonuniform rectangular mesh in order to capture the rapid change of diffusive electromagnetic field within the regions of...... are in a good agreement with the solutions obtained by the integral equation method....

  16. Modeling of anisotropic wound healing

    Science.gov (United States)

    Valero, C.; Javierre, E.; García-Aznar, J. M.; Gómez-Benito, M. J.; Menzel, A.

    2015-06-01

    Biological soft tissues exhibit non-linear complex properties, the quantification of which presents a challenge. Nevertheless, these properties, such as skin anisotropy, highly influence different processes that occur in soft tissues, for instance wound healing, and thus its correct identification and quantification is crucial to understand them. Experimental and computational works are required in order to find the most precise model to replicate the tissues' properties. In this work, we present a wound healing model focused on the proliferative stage that includes angiogenesis and wound contraction in three dimensions and which relies on the accurate representation of the mechanical behavior of the skin. Thus, an anisotropic hyperelastic model has been considered to analyze the effect of collagen fibers on the healing evolution of an ellipsoidal wound. The implemented model accounts for the contribution of the ground matrix and two mechanically equivalent families of fibers. Simulation results show the evolution of the cellular and chemical species in the wound and the wound volume evolution. Moreover, the local strain directions depend on the relative wound orientation with respect to the fibers.

  17. Rotational discontinuities in anisotropic plasmas

    International Nuclear Information System (INIS)

    Omidi, N.

    1992-01-01

    The kinetic structure of rotational discontinuities (RDs) in anisotropic plasmas with T perpendicular /T parallel > 1 is investigated by using a one-dimensional electromagnetic hybrid code. To form the RD, a new approach is used where the plasma is injected from one boundary and reflected from the other, resulting in the generation of a traveling fast shock and an RD. Unlike the previously used methods, no a priori assumptions are made regarding the initial structure (i.e. width or sense of rotation) of the rotational discontinuity. The results show that across the RD both the magnetic field strength and direction, as well as the plasma density change. Given that such a change can also be associated with an intermediate shock, the Rankine-Hugoniot relations are used to confirm that the observed structures are indeed RDs. It is found that the thickness of RDs is a few ion inertial lengths and is independent of the rotation angle. Also, the preferred sense of rotation is in the electron sense; however, RDs with a rotation angle larger than 180 degree are found to be unstable, changing their rotation to a stable ion sense

  18. Mechanics of anisotropic spring networks.

    Science.gov (United States)

    Zhang, T; Schwarz, J M; Das, Moumita

    2014-12-01

    We construct and analyze a model for a disordered linear spring network with anisotropy. The modeling is motivated by, for example, granular systems, nematic elastomers, and ultimately cytoskeletal networks exhibiting some underlying anisotropy. The model consists of a triangular lattice with two different bond occupation probabilities, p(x) and p(y), for the linear springs. We develop an effective medium theory (EMT) to describe the network elasticity as a function of p(x) and p(y). We find that the onset of rigidity in the EMT agrees with Maxwell constraint counting. We also find beyond linear behavior in the shear and bulk modulus as a function of occupation probability in the rigid phase for small strains, which differs from the isotropic case. We compare our EMT with numerical simulations to find rather good agreement. Finally, we discuss the implications of extending the reach of effective medium theory as well as draw connections with prior work on both anisotropic and isotropic spring networks.

  19. Calculation of anisotropic few-group constants in asymptotic cells: the code ANICELL

    International Nuclear Information System (INIS)

    Devenyi, A.

    1985-10-01

    The theoretical background of the ANICELL computer program together with a user's manual is presented. ANICELL is a nuclear reactor neutron transport code which solves the traditional asymptotic and the so-called tilted flux transport problems in one-dimensional cylindrical geometry using linearly anisotropic scattering. The method of solution used is the first flight collision probability technique. Few-group constants including radial and axial diffusion coefficients for the cell are also prepared by the program. (author)

  20. A signature of anisotropic cosmic-ray transport in the gamma-ray sky

    Energy Technology Data Exchange (ETDEWEB)

    Cerri, Silvio Sergio; Grasso, Dario [Dipartimento di Fisica ' ' E. Fermi' ' , Università di Pisa, Largo B. Pontecorvo 3, I-56127 Pisa (Italy); Gaggero, Daniele [GRAPPA, University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Vittino, Andrea [Physik-Department T30d, Technische Universität München, James Franck-Str. 1, D-85748, Garching (Germany); Evoli, Carmelo, E-mail: silvio.cerri@df.unipi.it, E-mail: d.gaggero@uva.nl, E-mail: andrea.vittino@tum.de, E-mail: carmelo.evoli@gssi.it, E-mail: dario.grasso@pi.infn.it [Gran Sasso Science Institute, Viale Francesco Crispi 7, 67100 L' Aquila (Italy)

    2017-10-01

    A crucial process in Galactic cosmic-ray (CR) transport is the spatial diffusion due to the interaction with the interstellar turbulent magnetic field. Usually, CR diffusion is assumed to be uniform and isotropic all across the Galaxy. However, this picture is clearly inaccurate: several data-driven and theoretical arguments, as well as dedicated numerical simulations, show that diffusion exhibits highly anisotropic properties with respect to the direction of a background (ordered) magnetic field (i.e., parallel or perpendicular to it). In this paper we focus on a recently discovered anomaly in the hadronic CR spectrum inferred by the Fermi-LAT gamma-ray data at different positions in the Galaxy, i.e. the progressive hardening of the proton slope at low Galactocentric radii. We propose the idea that this feature can be interpreted as a signature of anisotropic diffusion in the complex Galactic magnetic field: in particular, the harder slope in the inner Galaxy is due, in our scenario, to the parallel diffusive escape along the poloidal component of the large-scale, regular, magnetic field. We implement this idea in a numerical framework, based on the DRAGON code, and perform detailed numerical tests on the accuracy of our setup. We discuss how the effect proposed depends on the relevant free parameters involved. Based on low-energy extrapolation of the few focused numerical simulations aimed at determining the scalings of the anisotropic diffusion coefficients, we finally present a set of plausible models that reproduce the behavior of the CR proton slopes inferred by gamma-ray data.

  1. Analytical and numerical investigation of double diffusion in thermally anisotropy multilayer porous medium

    Energy Technology Data Exchange (ETDEWEB)

    Bennacer, R. [Neuville sur Oise, LEEVAM 5 mail Gay Lussac, Cergy-Pontoise Cedex (France); Mohamad, A.A. [CEERE University of Calgary, Department of Mechanical and Manufacturing Engineering, Calgary, Alberta (Canada); Ganaoui, M.El [Faculte des Sciences et Techniques de Limoges, Limoges (France)

    2005-02-01

    Double-diffusive natural convection within a multilayer anisotropic porous medium is studied numerically and analytically. The domain composed of two horizontal porous layers is subjected to a uniform horizontal heat flux and a vertical mass flux, where only the lower one is thermally anisotropic. Darcy model with classical Boussinesq approximation is used in formulating the mathematical model. The effect of thermal anisotropy and the relative width of the two layers on the flow and transfers is illustrated with characterising the transitions from the diffusive to the convective solution. Results were well compared with respect to a developed analytical approach, based on a parallel flow approximation for thermally anisotropic multilayer media. (orig.)

  2. Numerical Simulation of Anisotropic Preheating Ablative Rayleigh–Taylor Instability

    International Nuclear Information System (INIS)

    Li-Feng, Wang; Wen-Hua, Ye; Ying-Jun, Li

    2010-01-01

    The linear growth rate of the anisotropic preheating ablative Rayleigh–Taylor instability (ARTI) is studied by numerical simulations. The preheating model κ(T) = κ SH [1 + f(T)] is applied, where f(T) is the preheating function interpreting the preheating tongue effect in the cold plasma ahead of the ablative front. An arbitrary coefficient D is introduced in the energy equation to study the influence of transverse thermal conductivity on the growth of the ARTI. We find that enhancing diffusion in a plane transverse to the mean longitudinal flow can strongly reduce the growth of the instability. Numerical simulations exhibit a significant stabilization of the ablation front by improving the transverse thermal conduction. Our results are in general agreement with the theory analysis and numerical simulations by Masse [Phys. Rev. Lett. 98 (2007) 245001]. (physics of gases, plasmas, and electric discharges)

  3. Numerical simulation of anisotropic preheating ablative Rayleigh-Taylor instability

    International Nuclear Information System (INIS)

    Wang Lifeng; Ye Wenhua; Li Yingjun

    2010-01-01

    The linear growth rate of the anisotropic preheating ablative Rayleigh-Taylor instability (ARTI) is studied by numerical simulations. The preheating model κ(T)=κ SH [1+f(T)] is applied, where f(T) is the preheating function interpreting the preheating tongue effect in the cold plasma ahead of the ablative front. An arbitrary coefficient D is introduced in the energy equation to study the influence of transverse thermal conductivity on the growth of the ARTI. We find that enhancing diffusion in a plane transverse to the mean longitudinal flow can strongly reduce the growth of the instability. Numerical simulations exhibit a significant stabilization of the ablation front by improving the transverse thermal conduction. Our results are in general agreement with the theory analysis and numerical simulations by Masse. (authors)

  4. Nano-sized Adsorbate Structure Formation in Anisotropic Multilayer System

    Science.gov (United States)

    Kharchenko, Vasyl O.; Kharchenko, Dmitrii O.; Yanovsky, Vladimir V.

    2017-05-01

    In this article, we study dynamics of adsorbate island formation in a model plasma-condensate system numerically. We derive the generalized reaction-diffusion model for adsorptive multilayer system by taking into account anisotropy in transfer of adatoms between neighbor layers induced by electric field. It will be found that with an increase in the electric field strength, a structural transformation from nano-holes inside adsorbate matrix toward separated nano-sized adsorbate islands on a substrate is realized. Dynamics of adsorbate island sizes and corresponding distributions are analyzed in detail. This study provides an insight into details of self-organization of adatoms into nano-sized adsorbate islands in anisotropic multilayer plasma-condensate systems.

  5. Ion and impurity transport in turbulent, anisotropic magnetic fields

    International Nuclear Information System (INIS)

    Negrea, M; Petrisor, I; Isliker, H; Vogiannou, A; Vlahos, L; Weyssow, B

    2011-01-01

    We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

  6. Ion and impurity transport in turbulent, anisotropic magnetic fields

    Energy Technology Data Exchange (ETDEWEB)

    Negrea, M; Petrisor, I [Department of Physics, Association Euratom-MEdC, Romania, University of Craiova, A.I. Cuza str. 13, Craiova (Romania); Isliker, H; Vogiannou, A; Vlahos, L [Section of Astrophysics, Astronomy and Mechanics, Department of Physics, University of Thessaloniki, Association Euratom-Hellenic Republic, 541 24 Thessaloniki (Greece); Weyssow, B [Physique Statistique-Plasmas, Association Euratom-Etat Belge, Universite Libre de Bruxelles, Campus Plaine, Bd. du Triomphe, 1050 Bruxelles (Belgium)

    2011-08-15

    We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

  7. Ion and impurity transport in turbulent, anisotropic magnetic fields

    Science.gov (United States)

    Negrea, M.; Petrisor, I.; Isliker, H.; Vogiannou, A.; Vlahos, L.; Weyssow, B.

    2011-08-01

    We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

  8. Anisotropic evaluation of synthetic surgical meshes.

    Science.gov (United States)

    Saberski, E R; Orenstein, S B; Novitsky, Y W

    2011-02-01

    The material properties of meshes used in hernia repair contribute to the overall mechanical behavior of the repair. The anisotropic potential of synthetic meshes, representing a difference in material properties (e.g., elasticity) in different material axes, is not well defined to date. Haphazard orientation of anisotropic mesh material can contribute to inconsistent surgical outcomes. We aimed to characterize and compare anisotropic properties of commonly used synthetic meshes. Six different polypropylene (Trelex(®), ProLite™, Ultrapro™), polyester (Parietex™), and PTFE-based (Dualmesh(®), Infinit) synthetic meshes were selected. Longitudinal and transverse axes were defined for each mesh, and samples were cut in each axis orientation. Samples underwent uniaxial tensile testing, from which the elastic modulus (E) in each axis was determined. The degree of anisotropy (λ) was calculated as a logarithmic expression of the ratio between the elastic modulus in each axis. Five of six meshes displayed significant anisotropic behavior. Ultrapro™ and Infinit exhibited approximately 12- and 20-fold differences between perpendicular axes, respectively. Trelex(®), ProLite™, and Parietex™ were 2.3-2.4 times. Dualmesh(®) was the least anisotropic mesh, without marked difference between the axes. Anisotropy of synthetic meshes has been underappreciated. In this study, we found striking differences between elastic properties of perpendicular axes for most commonly used synthetic meshes. Indiscriminate orientation of anisotropic mesh may adversely affect hernia repairs. Proper labeling of all implants by manufacturers should be mandatory. Understanding the specific anisotropic behavior of synthetic meshes should allow surgeons to employ rational implant orientation to maximize outcomes of hernia repair.

  9. Numerical study of the thermal degradation of isotropic and anisotropic polymeric materials

    Energy Technology Data Exchange (ETDEWEB)

    Soler, E. [Departamento de Lenguajes y Ciencias de la Computacion, ETSI Informatica, Universidad de Malaga, 29071 Malaga (Spain); Ramos, J.I. [Room I-320-D, ETS Ingenieros Industriales, Universidad de Malaga, Plaza El Ejido, s/n, 29013 Malaga (Spain)

    2005-08-01

    The thermal degradation of two-dimensional isotropic, orthotropic and anisotropic polymeric materials is studied numerically by means of a second-order accurate (in both space and time) linearly implicit finite difference formulation which results in linear algebraic equations at each time step. It is shown that, for both isotropic and orthotropic composites, the monomer mass diffusion tensor plays a role in initiating the polymerization kinetics, the formation of a polymerization kernel and the initial front propagation, whereas the later stages of the polymerization are nearly independent of the monomer mass diffusion tensor. In anisotropic polymeric composites, it has been found that the monomer mass diffusion tensor plays a paramount role in determining the initial stages of the polymerization and the subsequent propagation of the polymerization front, the direction and speed of propagation of which are found to be related to the principal directions of both the monomer mass and the heat diffusion tensors. It is also shown that the polymerization time and temperatures depend strongly on the anisotropy of the mass and heat diffusion tensors. (authors)

  10. Anisotropic biodegradable lipid coated particles for spatially dynamic protein presentation.

    Science.gov (United States)

    Meyer, Randall A; Mathew, Mohit P; Ben-Akiva, Elana; Sunshine, Joel C; Shmueli, Ron B; Ren, Qiuyin; Yarema, Kevin J; Green, Jordan J

    2018-05-01

    There has been growing interest in the use of particles coated with lipids for applications ranging from drug delivery, gene delivery, and diagnostic imaging to immunoengineering. To date, almost all particles with lipid coatings have been spherical despite emerging evidence that non-spherical shapes can provide important advantages including reduced non-specific elimination and increased target-specific binding. We combine control of core particle geometry with control of particle surface functionality by developing anisotropic, biodegradable ellipsoidal particles with lipid coatings. We demonstrate that these lipid coated ellipsoidal particles maintain advantageous properties of lipid polymer hybrid particles, such as the ability for modular protein conjugation to the particle surface using versatile bioorthogonal ligation reactions. In addition, they exhibit biomimetic membrane fluidity and demonstrate lateral diffusive properties characteristic of natural membrane proteins. These ellipsoidal particles simultaneously provide benefits of non-spherical particles in terms of stability and resistance to non-specific phagocytosis by macrophages as well as enhanced targeted binding. These biomaterials provide a novel and flexible platform for numerous biomedical applications. The research reported here documents the ability of non-spherical polymeric particles to be coated with lipids to form anisotropic biomimetic particles. In addition, we demonstrate that these lipid-coated biodegradable polymeric particles can be conjugated to a wide variety of biological molecules in a "click-like" fashion. This is of interest due to the multiple types of cellular mimicry enabled by this biomaterial based technology. These features include mimicry of the highly anisotropic shape exhibited by cells, surface presentation of membrane bound protein mimetics, and lateral diffusivity of membrane bound substrates comparable to that of a plasma membrane. This platform is demonstrated to

  11. Diffusion of Botulinum Toxins

    Directory of Open Access Journals (Sweden)

    Matthew A. Brodsky

    2012-08-01

    Full Text Available Background: It is generally agreed that diffusion of botulinum toxin occurs, but the extent of the spread and its clinical importance are disputed. Many factors have been suggested to play a role but which have the most clinical relevance is a subject of much discussion.Methods: This review discusses the variables affecting diffusion, including protein composition and molecular size as well as injection factors (e.g., volume, dose, injection method. It also discusses data on diffusion from comparative studies in animal models and human clinical trials that illustrate differences between the available botulinum toxin products (onabotulinumtoxinA, abobotulinumtoxinA, incobotulinumtoxinA, and rimabotulinumtoxinB.Results: Neither molecular weight nor the presence of complexing proteins appears to affect diffusion; however, injection volume, concentration, and dose all play roles and are modifiable. Both animal and human studies show that botulinum toxin products are not interchangeable, and that some products are associated with greater diffusion and higher rates of diffusion-related adverse events than others.Discussion: Each of the botulinum toxins is a unique pharmacologic entity. A working knowledge of the different serotypes is essential to avoid unwanted diffusion-related adverse events. In addition, clinicians should be aware that the factors influencing diffusion may range from properties intrinsic to the drug to accurate muscle selection as well as dilution, volume, and dose injected.

  12. Numerical simulation of anisotropic polymeric foams

    Directory of Open Access Journals (Sweden)

    Volnei Tita

    Full Text Available This paper shows in detail the modelling of anisotropic polymeric foam under compression and tension loadings, including discussions on isotropic material models and the entire procedure to calibrate the parameters involved. First, specimens of poly(vinyl chloride (PVC foam were investigated through experimental analyses in order to understand the mechanical behavior of this anisotropic material. Then, isotropic material models available in the commercial software AbaqusTM were investigated in order to verify their ability to model anisotropic foams and how the parameters involved can influence the results. Due to anisotropy, it is possible to obtain different values for the same parameter in the calibration process. The obtained set of parameters are used to calibrate the model according to the application of the structure. The models investigated showed minor and major limitations to simulate the mechanical behavior of anisotropic PVC foams under compression, tension and multi-axial loadings. Results show that the calibration process and the choice of the material model applied to the polymeric foam can provide good quantitative results and save project time. Results also indicate what kind and order of error one will get if certain choices are made throughout the modelling process. Finally, even though the developed calibration procedure is applied to specific PVC foam, it still outlines a very broad drill to analyze other anisotropic cellular materials.

  13. Effective medium theory for anisotropic metamaterials

    KAUST Repository

    Zhang, Xiujuan

    2015-01-20

    Materials with anisotropic material parameters can be utilized to fabricate many fascinating devices, such as hyperlenses, metasolids, and one-way waveguides. In this study, we analyze the effects of geometric anisotropy on a two-dimensional metamaterial composed of a rectangular array of elliptic cylinders and derive an effective medium theory for such a metamaterial. We find that it is possible to obtain a closed-form analytical solution for the anisotropic effective medium parameters, provided the aspect ratio of the lattice and the eccentricity of the elliptic cylinder satisfy certain conditions. The derived effective medium theory not only recovers the well-known Maxwell-Garnett results in the quasi-static regime, but is also valid beyond the long-wavelength limit, where the wavelength in the host medium is comparable to the size of the lattice so that previous anisotropic effective medium theories fail. Such an advance greatly broadens the applicable realm of the effective medium theory and introduces many possibilities in the design of structures with desired anisotropic material characteristics. A real sample of a recently theoretically proposed anisotropic medium, with a near-zero index to control the flux, is achieved using the derived effective medium theory, and control of the electromagnetic waves in the sample is clearly demonstrated.

  14. Obtuse triangle suppression in anisotropic meshes

    KAUST Repository

    Sun, Feng; Choi, Yi King; Wang, Wen Ping; Yan, Dongming; Liu, Yang; Lé vy, Bruno L.

    2011-01-01

    Anisotropic triangle meshes are used for efficient approximation of surfaces and flow data in finite element analysis, and in these applications it is desirable to have as few obtuse triangles as possible to reduce the discretization error. We present a variational approach to suppressing obtuse triangles in anisotropic meshes. Specifically, we introduce a hexagonal Minkowski metric, which is sensitive to triangle orientation, to give a new formulation of the centroidal Voronoi tessellation (CVT) method. Furthermore, we prove several relevant properties of the CVT method with the newly introduced metric. Experiments show that our algorithm produces anisotropic meshes with much fewer obtuse triangles than using existing methods while maintaining mesh anisotropy. © 2011 Elsevier B.V. All rights reserved.

  15. Elastic properties of spherically anisotropic piezoelectric composites

    International Nuclear Information System (INIS)

    En-Bo, Wei; Guo-Qing, Gu; Ying-Ming, Poon

    2010-01-01

    Effective elastic properties of spherically anisotropic piezoelectric composites, whose spherically anisotropic piezoelectric inclusions are embedded in an infinite non-piezoelectric matrix, are theoretically investigated. Analytical solutions for the elastic displacements and the electric potentials under a uniform external strain are derived exactly. Taking into account of the coupling effects of elasticity, permittivity and piezoelectricity, the formula is derived for estimating the effective elastic properties based on the average field theory in the dilute limit. An elastic response mechanism is revealed, in which the effective elastic properties increase as inclusion piezoelectric properties increase and inclusion dielectric properties decrease. Moreover, a piezoelectric response mechanism, of which the effective piezoelectric response vanishes due to the symmetry of spherically anisotropic composite, is also disclosed. (condensed matter: structure, thermal and mechanical properties)

  16. Obtuse triangle suppression in anisotropic meshes

    KAUST Repository

    Sun, Feng

    2011-12-01

    Anisotropic triangle meshes are used for efficient approximation of surfaces and flow data in finite element analysis, and in these applications it is desirable to have as few obtuse triangles as possible to reduce the discretization error. We present a variational approach to suppressing obtuse triangles in anisotropic meshes. Specifically, we introduce a hexagonal Minkowski metric, which is sensitive to triangle orientation, to give a new formulation of the centroidal Voronoi tessellation (CVT) method. Furthermore, we prove several relevant properties of the CVT method with the newly introduced metric. Experiments show that our algorithm produces anisotropic meshes with much fewer obtuse triangles than using existing methods while maintaining mesh anisotropy. © 2011 Elsevier B.V. All rights reserved.

  17. Generalized Fractional Derivative Anisotropic Viscoelastic Characterization

    Directory of Open Access Journals (Sweden)

    Harry H. Hilton

    2012-01-01

    Full Text Available Isotropic linear and nonlinear fractional derivative constitutive relations are formulated and examined in terms of many parameter generalized Kelvin models and are analytically extended to cover general anisotropic homogeneous or non-homogeneous as well as functionally graded viscoelastic material behavior. Equivalent integral constitutive relations, which are computationally more powerful, are derived from fractional differential ones and the associated anisotropic temperature-moisture-degree-of-cure shift functions and reduced times are established. Approximate Fourier transform inversions for fractional derivative relations are formulated and their accuracy is evaluated. The efficacy of integer and fractional derivative constitutive relations is compared and the preferential use of either characterization in analyzing isotropic and anisotropic real materials must be examined on a case-by-case basis. Approximate protocols for curve fitting analytical fractional derivative results to experimental data are formulated and evaluated.

  18. An axisymmetric diffusion experiment for the determination of diffusion and sorption coefficients of rock samples.

    Science.gov (United States)

    Takeda, M; Hiratsuka, T; Ito, K; Finsterle, S

    2011-04-25

    Diffusion anisotropy is a critical property in predicting migration of substances in sedimentary formations with very low permeability. The diffusion anisotropy of sedimentary rocks has been evaluated mainly from laboratory diffusion experiments, in which the directional diffusivities are separately estimated by through-diffusion experiments using different rock samples, or concurrently by in-diffusion experiments in which only the tracer profile in a rock block is measured. To estimate the diffusion anisotropy from a single rock sample, this study proposes an axisymmetric diffusion test, in which tracer diffuses between a cylindrical rock sample and a surrounding solution reservoir. The tracer diffusion between the sample and reservoir can be monitored from the reservoir tracer concentrations, and the tracer profile could also be obtained after dismantling the sample. Semi-analytical solutions are derived for tracer concentrations in both the reservoir and sample, accounting for an anisotropic diffusion tensor of rank two as well as the dilution effects from sampling and replacement of reservoir solution. The transient and steady-state analyses were examined experimentally and numerically for different experimental configurations, but without the need for tracer profiling. These experimental configurations are tested for in- and out-diffusion experiments using Koetoi and Wakkanai mudstones and Shirahama sandstone, and are scrutinized by a numerical approach to identify favorable conditions for parameter estimation. The analysis reveals the difficulty in estimating diffusion anisotropy; test configurations are proposed for enhanced identifiability of diffusion anisotropy. Moreover, it is demonstrated that the axisymmetric diffusion test is efficient in obtaining the sorption parameter from both steady-state and transient data, and in determining the effective diffusion coefficient if isotropic diffusion is assumed. Moreover, measuring reservoir concentrations in an

  19. An asixymmetric diffusion experiment for the determination of diffusion and sorption coefficients of rock samples

    Energy Technology Data Exchange (ETDEWEB)

    Takeda, M.; Hiratsuka, T.; Ito, K.; Finsterle, S.

    2011-02-01

    Diffusion anisotropy is a critical property in predicting migration of substances in sedimentary formations with very low permeability. The diffusion anisotropy of sedimentary rocks has been evaluated mainly from laboratory diffusion experiments, in which the directional diffusivities are separately estimated by through-diffusion experiments using different rock samples, or concurrently by in-diffusion experiments in which only the tracer profile in a rock block is measured. To estimate the diffusion anisotropy from a single rock sample, this study proposes an axisymmetric diffusion test, in which tracer diffuses between a cylindrical rock sample and a surrounding solution reservoir. The tracer diffusion between the sample and reservoir can be monitored from the reservoir tracer concentrations, and the tracer profile could also be obtained after dismantling the sample. Semi-analytical solutions are derived for tracer concentrations in both the reservoir and sample, accounting for an anisotropic diffusion tensor of rank two as well as the dilution effects from sampling and replacement of reservoir solution. The transient and steady-state analyses were examined experimentally and numerically for different experimental configurations, but without the need for tracer profiling. These experimental configurations are tested for in- and out-diffusion experiments using Koetoi and Wakkanai mudstones and Shirahama sandstone, and are scrutinized by a numerical approach to identify favorable conditions for parameter estimation. The analysis reveals the difficulty in estimating diffusion anisotropy; test configurations are proposed for enhanced identifiability of diffusion anisotropy. Moreover, it is demonstrated that the axisymmetric diffusion test is efficient in obtaining the sorption parameter from both steady-state and transient data, and in determining the effective diffusion coefficient if isotropic diffusion is assumed. Moreover, measuring reservoir concentrations in an

  20. Anisotropic nanomaterials preparation, properties, and applications

    CERN Document Server

    Li, Quan

    2015-01-01

    In this book anisotropic one-dimensional and two-dimensional nanoscale building blocks and their assembly into fascinating and qualitatively new functional structures embracing both hard and soft components are explained. Contributions from leading experts regarding important aspects like synthesis, assembly, properties and applications of the above materials are compiled into a reference book. The anisotropy, i.e. the direction-dependent physical properties, of materials is fascinating and elegant and has sparked the quest for anisotropic materials with useful properties. With such a curiosi

  1. Anisotropic Intervalley Plasmon Excitations in Graphene

    International Nuclear Information System (INIS)

    Chen Jian; Xu Huai-Zhe

    2015-01-01

    We investigate theoretically the intervalley plasmon excitations (IPEs) in graphene monolayer within the random-phase approximation. We derive an analytical expression of the real part of the dielectric function. We find a low-energy plasmon mode with a linear anisotropic dispersion which depends on the Fermi energy and the dielectric constant of substrate. The IPEs show strongly anisotropic behavior, which becomes significant around the zigzag crystallographic direction. More interestingly, the group velocity of IPE varies from negative to positive, and vanishes at special energy. (paper)

  2. On cracking of charged anisotropic polytropes

    Energy Technology Data Exchange (ETDEWEB)

    Azam, M. [Division of Science and Technology, University of Education, Township Campus, Lahore-54590 (Pakistan); Mardan, S.A., E-mail: azam.math@ue.edu.pk, E-mail: syedalimardanazmi@yahoo.com [Department of Mathematics, University of the Management and Technology, C-II, Johar Town, Lahore-54590 (Pakistan)

    2017-01-01

    Recently in [1], the role of electromagnetic field on the cracking of spherical polytropes has been investigated without perturbing charge parameter explicitly. In this study, we have examined the occurrence of cracking of anisotropic spherical polytropes through perturbing parameters like anisotropic pressure, energy density and charge. We consider two different types of polytropes in this study. We discuss the occurrence of cracking in two different ways ( i ) by perturbing polytropic constant, anisotropy and charge parameter ( ii ) by perturbing polytropic index, anisotropy and charge parameter for each case. We conclude that cracking appears for a wide range of parameters in both cases. Also, our results are reduced to [2] in the absence of charge.

  3. Modelling of CMUTs with Anisotropic Plates

    DEFF Research Database (Denmark)

    la Cour, Mette Funding; Christiansen, Thomas Lehrmann; Jensen, Jørgen Arendt

    2012-01-01

    Traditionally, CMUTs are modelled using the isotropic plate equation and this leads to deviations between analytical calculations and FEM simulations. In this paper, the deflection profile and material parameters are calculated using the anisotropic plate equation. It is shown that the anisotropic...... calculations match perfectly with FEM while an isotropic approach causes up to 10% deviations in deflection profile. Furthermore, we show how commonly used analytic modelling methods such as static calculations of the pull-in voltage and dynamic modelling through an equivalent circuit representation can...

  4. Sign rules for anisotropic quantum spin systems

    International Nuclear Information System (INIS)

    Bishop, R. F.; Farnell, D. J. J.; Parkinson, J. B.

    2000-01-01

    We present exact ''sign rules'' for various spin-s anisotropic spin-lattice models. It is shown that, after a simple transformation which utilizes these sign rules, the ground-state wave function of the transformed Hamiltonian is positive definite. Using these results exact statements for various expectation values of off-diagonal operators are presented, and transitions in the behavior of these expectation values are observed at particular values of the anisotropy. Furthermore, the importance of such sign rules in variational calculations and quantum Monte Carlo calculations is emphasized. This is illustrated by a simple variational treatment of a one-dimensional anisotropic spin model

  5. Anisotropic Deformation Behavior of Al2024T351 Aluminum Alloy

    Directory of Open Access Journals (Sweden)

    R Khan

    2013-06-01

    Full Text Available The objective of this work was to investigate the effects of material anisotropy on the yielding and hardening behavior of 2024T351 aluminum alloy using isotropic and anisotropic yield criteria. Anisotropy may be induced in a material during the manufacturing through processes like rolling or forging. This induced anisotropy gives rise to the concept of orientation-dependent material properties such as yield strength, ductility, strain hardening, fracture strength, or fatigue resistance. Inclusion of the effects of anisotropy is essential in correctly predicting the deformation behavior of a material. In this study, uniaxial tensile tests were first performed in all three rolling directions, L , T  and S , for smooth bar specimens made from hot rolled plate of Al2024 alloy. The experimental results showed that the L - and T -directions yielded higher yield strengths and a greater percentage of elongation before fracture than the S -direction. Subsequently, finite element analysis of tensile specimens was performed using isotropic (von Mises and anisotropic (Hill yield criteria to predict the onset of yielding and hardening behaviors during the course of deformation. Hill's criterion perfectly fitted with the test data in the S -direction, but slightly underestimated the yield strength in L -direction. The results indicated that the Hill yield criterion is the most suitable one to predict the onset of yielding and hardening behaviors for 2024T351 aluminum alloy in all directions.

  6. Anisotropic wave-equation traveltime and waveform inversion

    KAUST Repository

    Feng, Shihang; Schuster, Gerard T.

    2016-01-01

    The wave-equation traveltime and waveform inversion (WTW) methodology is developed to invert for anisotropic parameters in a vertical transverse isotropic (VTI) meidum. The simultaneous inversion of anisotropic parameters v0, ε and δ is initially

  7. Anisotropic Conductivity Tensor Imaging of In Vivo Canine Brain Using DT-MREIT.

    Science.gov (United States)

    Jeong, Woo Chul; Sajib, Saurav Z K; Katoch, Nitish; Kim, Hyung Joong; Kwon, Oh In; Woo, Eung Je

    2017-01-01

    We present in vivo images of anisotropic electrical conductivity tensor distributions inside canine brains using diffusion tensor magnetic resonance electrical impedance tomography (DT-MREIT). The conductivity tensor is represented as a product of an ion mobility tensor and a scale factor of ion concentrations. Incorporating directional mobility information from water diffusion tensors, we developed a stable process to reconstruct anisotropic conductivity tensor images from measured magnetic flux density data using an MRI scanner. Devising a new image reconstruction algorithm, we reconstructed anisotropic conductivity tensor images of two canine brains with a pixel size of 1.25 mm. Though the reconstructed conductivity values matched well in general with those measured by using invasive probing methods, there were some discrepancies as well. The degree of white matter anisotropy was 2 to 4.5, which is smaller than previous findings of 5 to 10. The reconstructed conductivity value of the cerebrospinal fluid was about 1.3 S/m, which is smaller than previous measurements of about 1.8 S/m. Future studies of in vivo imaging experiments with disease models should follow this initial trial to validate clinical significance of DT-MREIT as a new diagnostic imaging modality. Applications in modeling and simulation studies of bioelectromagnetic phenomena including source imaging and electrical stimulation are also promising.

  8. A Variational Approach to Perturbed Discrete Anisotropic Equations

    Directory of Open Access Journals (Sweden)

    Amjad Salari

    2016-01-01

    Full Text Available We continue the study of discrete anisotropic equations and we will provide new multiplicity results of the solutions for a discrete anisotropic equation. We investigate the existence of infinitely many solutions for a perturbed discrete anisotropic boundary value problem. The approach is based on variational methods and critical point theory.

  9. Effect of reflecting modes on combined heat transfer within an anisotropic scattering slab

    International Nuclear Information System (INIS)

    Yi Hongliang; Tan Heping; Lu Yiping

    2005-01-01

    Under various interface reflecting modes, different transient thermal responses will occur in the media. Combined radiative-conductive heat transfer is investigated within a participating, anisotropic scattering gray planar slab. The two interfaces of the slab are considered to be diffuse and semitransparent. Using the ray tracing method, an anisotropic scattering radiative transfer model for diffuse reflection at boundaries is set up, and with the help of direct radiative transfer coefficients, corresponding radiative transfer coefficients (RTCs) are deduced. RTCs are used to calculate the radiative source term in energy equation. Transient energy equation is solved by the full implicit control-volume method under the external radiative-convective boundary conditions. The influences of two reflecting modes including both specular reflection and diffuse reflection on transient temperature fields and steady heat flux are examined. According to numerical results obtained in this paper, it is found that there exits great difference in thermal behavior between slabs with diffuse interfaces and that with specular interfaces for slabs with big refractive index

  10. Anisotropic Interactions between Cold Rydberg Atoms

    Science.gov (United States)

    2015-09-28

    AFRL-AFOSR-CL-TR-2015-0002 Anisotropic interactions between cold Rydberg atoms Luis Marcassa INSTITUTO DE FISICA DE SAO CARLOS Final Report 09/28...problem with the report +551633739806 Organization / Institution name Instituto de Fisica de Sao Carlos Grant/Contract Title The full title of the

  11. Adaptive slices for acquisition of anisotropic BRDF

    Czech Academy of Sciences Publication Activity Database

    Vávra, Radomír; Filip, Jiří

    (2018) ISSN 2096-0433 R&D Projects: GA ČR GA17-18407S Institutional support: RVO:67985556 Keywords : anisotropic BRDF * slice * sampling Subject RIV: BD - Theory of Information http://library.utia.cas.cz/separaty/2018/RO/vavra-0486116.pdf

  12. Anisotropic Hanle line shape via magnetothermoelectric phenomena

    NARCIS (Netherlands)

    Das, Kumar; Dejene, Fasil; van Wees, Bart; Vera Marun, Ivan

    2016-01-01

    We observe anisotropic Hanle line shape with unequal in-plane and out-of-plane nonlocal signals for spin precession measurements carried out on lateral metallic spin valves with transparent interfaces. The conventional interpretation for this anisotropy corresponds to unequal spin relaxation times

  13. Jets in a strongly coupled anisotropic plasma

    Energy Technology Data Exchange (ETDEWEB)

    Fadafan, Kazem Bitaghsir [Shahrood University of Technology, Faculty of Physics, Shahrood (Iran, Islamic Republic of); University of Southampton, STAG Research Centre Physics and Astronomy, Southampton (United Kingdom); Morad, Razieh [University of Cape Town, Department of Physics, Rondebosch (South Africa)

    2018-01-15

    In this paper, we study the dynamics of the light quark jet moving through the static, strongly coupled N = 4, anisotropic plasma with and without charge. The light quark is presented by a 2-parameters point-like initial condition falling string in the context of the AdS/CFT. We calculate the stopping distance of the light quark in the anisotropic medium and compare it with its isotropic value. We study the dependency of the stopping distance to the both string initial conditions and background parameters such as anisotropy parameter or chemical potential. Although the typical behavior of the string in the anisotropic medium is similar to the one in the isotropic AdS-Sch background, the string falls faster to the horizon depending on the direction of moving. Particularly, the enhancement of quenching is larger in the beam direction. We find that the suppression of stopping distance is more prominent when the anisotropic plasma have the same temperature as the isotropic plasma. (orig.)

  14. Effective medium theory for anisotropic metamaterials

    KAUST Repository

    Zhang, Xiujuan; Wu, Ying

    2015-01-01

    -dimensional metamaterial composed of a rectangular array of elliptic cylinders and derive an effective medium theory for such a metamaterial. We find that it is possible to obtain a closed-form analytical solution for the anisotropic effective medium parameters, provided

  15. Algebraic solution of an anisotropic nonquadratic potential

    International Nuclear Information System (INIS)

    Boschi Filho, H.; Vaidya, A.N.

    1990-06-01

    We show that an anisotropic nonquadratic potential, for which a path integral treatment had been recently discussed in the literature, possesses the (SO(2,1)xSO(2,1))ΛSO(2,1) dynamical symmetry and constructs its Green function algebraically. A particular case which generates new eigenvalues and eigenfunctions is also discussed. (author). 11 refs

  16. Nonlinear anisotropic parabolic equations in Lm

    Directory of Open Access Journals (Sweden)

    Fares Mokhtari

    2014-01-01

    Full Text Available In this paper, we give a result of regularity of weak solutions for a class of nonlinear anisotropic parabolic equations with lower-order term when the right-hand side is an Lm function, with m being ”small”. This work generalizes some results given in [2] and [3].

  17. Casimir interactions for anisotropic magnetodielectric metamaterials

    Energy Technology Data Exchange (ETDEWEB)

    Da Rosa, Felipe S [Los Alamos National Laboratory; Dalvit, Diego A [Los Alamos National Laboratory; Milonni, Peter W [Los Alamos National Laboratory

    2008-01-01

    We extend our previous work on the generalization of the Casimir-Lifshitz theory to treat anisotropic magnetodielectric media, focusing on the forces between metals and magnetodielectric metamaterials and on the possibility of inferring magnetic effects by measurements of these forces.

  18. Hydraulic fracturing in anisotropic and heterogeneous rocks

    NARCIS (Netherlands)

    Valliappan, V.; Remmers, J.J.C.; Barnhoorn, A.; Smeulders, D.M.J.

    2017-01-01

    In this paper, we present a two dimensional model for modelling the hydraulic fracture process in anisotropic and heterogeneous rocks. The model is formulated using extended finite elements (XFEM) in combination with Newton-Raphson method for spatial and Euler's implicit scheme for time. The

  19. Spin Wave Theory of Strongly Anisotropic Magnets

    DEFF Research Database (Denmark)

    Lindgård, Per-Anker

    1977-01-01

    A strong anisotropy gives rise to a non-spherical precession of the spins with different amplitudes in the x and y directions. The highly anharmonic exchange interaction thereby becomes effectively anisotropic. The possibility of detecting a genuine two-ion anisotropy is discussed, and comments...

  20. On characterization of anisotropic plant protein structures

    NARCIS (Netherlands)

    Krintiras, G.A.; Göbel, J.; Bouwman, W.G.; Goot, van der A.J.; Stefanidis, G.D.

    2014-01-01

    In this paper, a set of complementary techniques was used to characterize surface and bulk structures of an anisotropic Soy Protein Isolate (SPI)–vital wheat gluten blend after it was subjected to heat and simple shear flow in a Couette Cell. The structured biopolymer blend can form a basis for a

  1. Data-driven imaging in anisotropic media

    Energy Technology Data Exchange (ETDEWEB)

    Volker, Arno; Hunter, Alan [TNO Stieltjes weg 1, 2600 AD, Delft (Netherlands)

    2012-05-17

    Anisotropic materials are being used increasingly in high performance industrial applications, particularly in the aeronautical and nuclear industries. Some important examples of these materials are composites, single-crystal and heavy-grained metals. Ultrasonic array imaging in these materials requires exact knowledge of the anisotropic material properties. Without this information, the images can be adversely affected, causing a reduction in defect detection and characterization performance. The imaging operation can be formulated in two consecutive and reciprocal focusing steps, i.e., focusing the sources and then focusing the receivers. Applying just one of these focusing steps yields an interesting intermediate domain. The resulting common focus point gather (CFP-gather) can be interpreted to determine the propagation operator. After focusing the sources, the observed travel-time in the CFP-gather describes the propagation from the focus point to the receivers. If the correct propagation operator is used, the measured travel-times should be the same as the time-reversed focusing operator due to reciprocity. This makes it possible to iteratively update the focusing operator using the data only and allows the material to be imaged without explicit knowledge of the anisotropic material parameters. Furthermore, the determined propagation operator can also be used to invert for the anisotropic medium parameters. This paper details the proposed technique and demonstrates its use on simulated array data from a specimen of Inconel single-crystal alloy commonly used in the aeronautical and nuclear industries.

  2. Acoustic anisotropic wavefields through perturbation theory

    KAUST Repository

    Alkhalifah, Tariq Ali

    2013-01-01

    these restrictions are the inability to handle media with η<0 and the presence of shear-wave artifacts in the solution. Both limitations do not exist in the solution of the elliptical anisotropic acoustic wave equation. Using perturbation theory in developing

  3. Gravastars and black holes of anisotropic dark energy

    International Nuclear Information System (INIS)

    Chan, Roberto; Silva, Maria de Fatima Alves da; Rocha, Pedro Senna

    2011-01-01

    Full text: Dynamical models of prototype gravastars made of anisotropic dark energy are constructed, in which an infinitely thin spherical shell of a perfect fluid with the equation of state p = (1 - γ)σ divides the whole spacetime into two regions, the internal region filled with a dark energy fluid, and the external Schwarzschild region. The models represent 'bounded excursion' stable gravastars, where the thin shell is oscillating between two finite radii, while in other cases they collapse until the formation of black holes. Here we show, for the first time in the literature, a model of gravastar and formation of black hole with both interior and thin shell constituted exclusively of dark energy. Besides, the sign of the parameter of anisotropy (Pt - Pr ) seems to be relevant to the gravastar formation. The formation is favored when the tangential pressure is greater than the radial pressure, at least in the neighborhood of the isotropic case (ω = -1). (author)

  4. Gravastars and black holes of anisotropic dark energy

    Energy Technology Data Exchange (ETDEWEB)

    Chan, Roberto [Observatorio Nacional (ON), Rio de Janeiro, RJ (Brazil); Silva, Maria de Fatima Alves da; Rocha, Pedro Senna [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil)

    2011-07-01

    Full text: Dynamical models of prototype gravastars made of anisotropic dark energy are constructed, in which an infinitely thin spherical shell of a perfect fluid with the equation of state p = (1 - {gamma}){sigma} divides the whole spacetime into two regions, the internal region filled with a dark energy fluid, and the external Schwarzschild region. The models represent 'bounded excursion' stable gravastars, where the thin shell is oscillating between two finite radii, while in other cases they collapse until the formation of black holes. Here we show, for the first time in the literature, a model of gravastar and formation of black hole with both interior and thin shell constituted exclusively of dark energy. Besides, the sign of the parameter of anisotropy (Pt - Pr ) seems to be relevant to the gravastar formation. The formation is favored when the tangential pressure is greater than the radial pressure, at least in the neighborhood of the isotropic case ({omega} = -1). (author)

  5. Uranium nitride: a cubic antiferromagnet with anisotropic critical behavior

    International Nuclear Information System (INIS)

    Buyers, W.J.L.; Holden, T.M.; Svensson, E.C.; Lander, G.H.

    1977-11-01

    Highly anisotropic critical scattering associated with the transition at T/sub N/ = 49.5 K to the type-I antiferromagnetic structure has been observed in uranium nitride. The transverse susceptibility is found to be unobservably small. The longitudinal susceptibility diverges at T/sub N/ and its anisotropy shows that the spins within the (001) ferromagnetic sheets of the [001] domain are much more highly correlated than they are with the spins lying in adjacent (001) sheets. The correlation range within the sheets is much greater than that expected for a Heisenberg system with the same T/sub N/. The rod-like scattering extended along the spin and domain direction is reminiscent of two-dimensional behavior. The results are inconsistent with a simple localized model and may reflect the itinerant nature of the 5f electrons

  6. A novel image inpainting technique based on median diffusion

    Indian Academy of Sciences (India)

    numerical methods such as anisotropic diffusion and multiresolution schemes. Some steps ... Roth & Black (2005) have developed a framework for learning a generic and expressive image priors that ..... This paper presents a new approach for image inpainting by propagating median information .... J. Graphics Tools 9(1):.

  7. A parametric finite element method for solid-state dewetting problems with anisotropic surface energies

    Science.gov (United States)

    Bao, Weizhu; Jiang, Wei; Wang, Yan; Zhao, Quan

    2017-02-01

    We propose an efficient and accurate parametric finite element method (PFEM) for solving sharp-interface continuum models for solid-state dewetting of thin films with anisotropic surface energies. The governing equations of the sharp-interface models belong to a new type of high-order (4th- or 6th-order) geometric evolution partial differential equations about open curve/surface interface tracking problems which include anisotropic surface diffusion flow and contact line migration. Compared to the traditional methods (e.g., marker-particle methods), the proposed PFEM not only has very good accuracy, but also poses very mild restrictions on the numerical stability, and thus it has significant advantages for solving this type of open curve evolution problems with applications in the simulation of solid-state dewetting. Extensive numerical results are reported to demonstrate the accuracy and high efficiency of the proposed PFEM.

  8. Wetting and Diffusion of Water on Pristine and Strained Phosphorene

    OpenAIRE

    Zhang, Wei; Ye, Chao; Bi, Lin; Yang, Zaixing; Zhou, Ruhong

    2015-01-01

    Phosphorene, a newly fabricated two-dimensional (2D) nanomaterial, have exhibited promising application prospect in biology. Nonetheless, the wetting and diffusive properties of bio-fluids on phosphorene are still elusive. In this study, using molecular dynamics (MD) simulations, we investigated the structural and dynamic properties of water on pristine and strained phosphorene. The MD simulations illustrated that the diffusion of water molecules on the phosphorene surface is anisotropic, whi...

  9. Cortical fibers orientation mapping using in-vivo whole brain 7 T diffusion MRI

    NARCIS (Netherlands)

    Gulban, Omer F; De Martino, Federico; Vu, An T; Yacoub, Essa; Uğurbil, Kamil; Lenglet, Christophe

    Diffusion MRI of the cortical gray matter is challenging because the micro-environment probed by water molecules is much more complex than within the white matter. High spatial and angular resolutions are therefore necessary to uncover anisotropic diffusion patterns and laminar structures, which

  10. Ionic diffusion in the double layer at model electrode/molten salt interfaces

    International Nuclear Information System (INIS)

    Tankeshwar, K.; Tosi, M.P.

    1991-08-01

    The anisotropic ionic diffusion coefficients in model electrochemical cells in the molten-salt regime for the electrolyte are evaluated from the ionic density profiles reported in simulation work of Grout and coworkers. A local description of the diffusion processes for counterions and coions in the electrical double layer is obtained from the data. (author). 10 refs, 1 fig., 1 tab

  11. Conservative diffusions

    International Nuclear Information System (INIS)

    Carlen, E.A.

    1984-01-01

    In Nelson's stochastic mechanics, quantum phenomena are described in terms of diffusions instead of wave functions. These diffusions are formally given by stochastic differential equations with extremely singular coefficients. Using PDE methods, we prove the existence of solutions. This reult provides a rigorous basis for stochastic mechanics. (orig.)

  12. Image denoising using non linear diffusion tensors

    International Nuclear Information System (INIS)

    Benzarti, F.; Amiri, H.

    2011-01-01

    Image denoising is an important pre-processing step for many image analysis and computer vision system. It refers to the task of recovering a good estimate of the true image from a degraded observation without altering and changing useful structure in the image such as discontinuities and edges. In this paper, we propose a new approach for image denoising based on the combination of two non linear diffusion tensors. One allows diffusion along the orientation of greatest coherences, while the other allows diffusion along orthogonal directions. The idea is to track perfectly the local geometry of the degraded image and applying anisotropic diffusion mainly along the preferred structure direction. To illustrate the effective performance of our model, we present some experimental results on a test and real photographic color images.

  13. Views on the Anisotropic Nature of Ilva Valley Region

    Directory of Open Access Journals (Sweden)

    GABRIELA-ALINA MUREŞAN

    2012-01-01

    Full Text Available There are two concepts important for the authors of this article: anisotropic region and anisotropic space. Anisotropic region is defined by A. Dauphiné, the geographer (-mathematician, as a territorial unit whose structure results from the organisation of space along one or more axes. From the point of view of a territorial system, this type of region has some characteristics which differentiate it both from the homogeneous region and from the polarised one. These specificities have been analysed for Ilva Valley. The region of Ilva Valley is formed along the morphological axis represented by the Ilva River. The aim is to identify these specificities or their absence within this region. In this way we can determine whether this region is an anisotropic one or just an anisotropic space, namely whether it can be considered as evolving towards an anisotropic region, not yet complying with all characteristics of anisotropic regions.

  14. The dynamics of nucleation and growth of a particle in the ternary alloy melt with anisotropic surface tension.

    Science.gov (United States)

    Chen, Ming-Wen; Li, Lin-Yan; Guo, Hui-Min

    2017-08-28

    The dynamics of nucleation and growth of a particle affected by anisotropic surface tension in the ternary alloy melt is studied. The uniformly valid asymptotic solution for temperature field, concentration field, and interface evolution of nucleation and particle growth is obtained by means of the multiple variable expansion method. The asymptotic solution reveals the critical radius of nucleation in the ternary alloy melt and an inward melting mechanism of the particle induced by the anisotropic effect of surface tension. The critical radius of nucleation is dependent on isotropic surface tension, temperature undercooling, and constitutional undercooling in the ternary alloy melt, and the solute diffusion melt decreases the critical radius of nucleation. Immediately after a nucleus forms in the initial stage of solidification, the anisotropic effect of surface tension makes some parts of its interface grow inward while some parts grow outward. Until the inward melting attains a certain distance (which is defined as "the melting depth"), these parts of interface start to grow outward with other parts. The interface of the particle evolves into an ear-like deformation, whose inner diameter may be less than two times the critical radius of nucleation within a short time in the initial stage of solidification. The solute diffusion in the ternary alloy melt decreases the effect of anisotropic surface tension on the interface deformation.

  15. MHD diffuser model test program

    Energy Technology Data Exchange (ETDEWEB)

    Idzorek, J J

    1976-07-01

    Experimental results of the aerodynamic performance of seven candidate diffusers are presented to assist in determining their suitability for joining an MHD channel to a steam generator at minimum spacing. The three dimensional diffusers varied in area ratio from 2 to 3.8 and wall half angle from 2 to 5 degrees. The program consisted of five phases: (1) tailoring a diffuser inlet nozzle to a 15 percent blockage; (2) comparison of isolated diffusers at enthalpy ratios 0.5 to 1.0 with respect to separation characteristics and pressure recovery coefficients; (3) recording the optimum diffuser exit flow distribution; (4) recording the internal flow distribution within the steam generator when attached to the diffuser; and (5) observing isolated diffuser exhaust dynamic characteristics. The 2 and 2-1/3 degree half angle rectangular diffusers showed recovery coefficients equal to 0.48 with no evidence of flow separation or instability. Diffusion at angles greater than these produced flow instabilities and with angles greater than 3 degrees random flow separation and reattachment.

  16. MHD diffuser model test program

    International Nuclear Information System (INIS)

    Idzorek, J.J.

    1976-07-01

    Experimental results of the aerodynamic performance of seven candidate diffusers are presented to assist in determining their suitability for joining an MHD channel to a steam generator at minimum spacing. The three dimensional diffusers varied in area ratio from 2 to 3.8 and wall half angle from 2 to 5 degrees. The program consisted of five phases: (1) tailoring a diffuser inlet nozzle to a 15 percent blockage; (2) comparison of isolated diffusers at enthalpy ratios 0.5 to 1.0 with respect to separation characteristics and pressure recovery coefficients; (3) recording the optimum diffuser exit flow distribution; (4) recording the internal flow distribution within the steam generator when attached to the diffuser; and (5) observing isolated diffuser exhaust dynamic characteristics. The 2 and 2-1/3 degree half angle rectangular diffusers showed recovery coefficients equal to 0.48 with no evidence of flow separation or instability. Diffusion at angles greater than these produced flow instabilities and with angles greater than 3 degrees random flow separation and reattachment

  17. Anisotropic membranes for gas separation

    Science.gov (United States)

    Gollan, Arye Z.

    1987-01-01

    A gas separation membrane has a dense separating layer about 10,000 Angstroms or less thick and a porous support layer 10 to 400 microns thick that is an integral unit with gradually and continuously decreasing pore size from the base of the support layer to the surface of the thin separating layer and is made from a casting solution comprising ethyl cellulose and ethyl cellulose-based blends, typically greater than 47.5 ethoxyl content ethyl cellulose blended with compatible second polymers, such as nitrocellulose. The polymer content of the casting solution is from about 10% to about 35% by weight of the total solution with up to about 50% of this polymer weight a compatible second polymer to the ethyl cellulose in a volatile solvent such as isopropanol, methylacetate, methanol, ethanol, and acetone. Typical nonsolvents for the casting solutions include water and formamide. The casting solution is cast in air from about zero to 10 seconds to allow the volatile solvent to evaporate and then quenched in a coagulation bath, typically water, at a temperature of 7.degree.-25.degree. C. and then air dried at ambient temperature, typically 10.degree.-30.degree. C.

  18. Investigation of anisotropic thermal transport in cross-linked polymers

    Science.gov (United States)

    Simavilla, David Nieto

    Thermal transport in lightly cross-linked polyisoprene and polybutadine subjected to uniaxial elongation is investigated experimentally. We employ two experimental techniques to assess the effect that deformation has on this class of materials. The first technique, which is based on Forced Rayleigh Scattering (FRS), allows us to measure the two independent components of the thermal diffusivity tensor as a function of deformation. These measurements along with independent measurements of the tensile stress and birefringence are used to evaluate the stress-thermal and stress-optic rules. The stress-thermal rule is found to be valid for the entire range of elongations applied. In contrast, the stress-optic rule fails for moderate to large stretch ratios. This suggests that the degree of anisotropy in thermal conductivity depends on both orientation and tension in polymer chain segments. The second technique, which is based on infrared thermography (IRT), allows us to measure anisotropy in thermal conductivity and strain induced changes in heat capacity. We validate this method measurements of anisotropic thermal conductivity by comparing them with those obtained using FRS. We find excellent agreement between the two techniques. Uncertainty in the infrared thermography method measurements is estimated to be about 2-5 %. The accuracy of the method and its potential application to non-transparent materials makes it a good alternative to extend current research on anisotropic thermal transport in polymeric materials. A second IRT application allows us to investigate the dependence of heat capacity on deformation. We find that heat capacity increases with stretch ratio in polyisoprene specimens under uniaxial extension. The deviation from the equilibrium value of heat capacity is consistent with an independent set of experiments comparing anisotropy in thermal diffusivity and conductivity employing FRS and IRT techniques. We identify finite extensibility and strain

  19. Wireless energy transfer between anisotropic metamaterials shells

    Energy Technology Data Exchange (ETDEWEB)

    Díaz-Rubio, Ana; Carbonell, Jorge; Sánchez-Dehesa, José, E-mail: jsdehesa@upv.es

    2014-06-15

    The behavior of strongly coupled Radial Photonic Crystals shells is investigated as a potential alternative to transfer electromagnetic energy wirelessly. These sub-wavelength resonant microstructures, which are based on anisotropic metamaterials, can produce efficient coupling phenomena due to their high quality factor. A configuration of selected constitutive parameters (permittivity and permeability) is analyzed in terms of its resonant characteristics. The coupling to loss ratio between two coupled resonators is calculated as a function of distance, the maximum (in excess of 300) is obtained when the shells are separated by three times their radius. Under practical conditions an 83% of maximum power transfer has been also estimated. -- Highlights: •Anisotropic metamaterial shells exhibit high quality factors and sub-wavelength size. •Exchange of electromagnetic energy between shells with high efficiency is analyzed. •Strong coupling is supported with high wireless transfer efficiency. •End-to-end energy transfer efficiencies higher than 83% can be predicted.

  20. Wireless energy transfer between anisotropic metamaterials shells

    International Nuclear Information System (INIS)

    Díaz-Rubio, Ana; Carbonell, Jorge; Sánchez-Dehesa, José

    2014-01-01

    The behavior of strongly coupled Radial Photonic Crystals shells is investigated as a potential alternative to transfer electromagnetic energy wirelessly. These sub-wavelength resonant microstructures, which are based on anisotropic metamaterials, can produce efficient coupling phenomena due to their high quality factor. A configuration of selected constitutive parameters (permittivity and permeability) is analyzed in terms of its resonant characteristics. The coupling to loss ratio between two coupled resonators is calculated as a function of distance, the maximum (in excess of 300) is obtained when the shells are separated by three times their radius. Under practical conditions an 83% of maximum power transfer has been also estimated. -- Highlights: •Anisotropic metamaterial shells exhibit high quality factors and sub-wavelength size. •Exchange of electromagnetic energy between shells with high efficiency is analyzed. •Strong coupling is supported with high wireless transfer efficiency. •End-to-end energy transfer efficiencies higher than 83% can be predicted

  1. Selective optical transmission in anisotropic multilayers structure

    International Nuclear Information System (INIS)

    Ouchani, N.; Bria, D.; Nougaoui, A.; Merad, A.E.

    2007-08-01

    We developed a Green's function method to study theoretically a single-defect photonic crystal composed of anisotropic dielectric materials. This structure can trap light of a given frequency range and filter only a certain frequency light with a very high quality. It is shown that the defect modes appear as peaks in the transmission spectrum. Their intensities and frequency positions depend on the incidence angle and the orientation of the principal axes of layers consisting of the superlattice and the layer defect. Our structure offers a great variety of possibilities for creating and controlling the number and transmitted intensities of defect modes. It can be a good candidate for realizing a selective electromagnetic filter. In addition to this filtration process, the defective anisotropic photonic crystal can be used to switch the modes when appropriate geometry is selected. (author)

  2. Cosmological signatures of anisotropic spatial curvature

    International Nuclear Information System (INIS)

    Pereira, Thiago S.; Marugán, Guillermo A. Mena; Carneiro, Saulo

    2015-01-01

    If one is willing to give up the cherished hypothesis of spatial isotropy, many interesting cosmological models can be developed beyond the simple anisotropically expanding scenarios. One interesting possibility is presented by shear-free models in which the anisotropy emerges at the level of the curvature of the homogeneous spatial sections, whereas the expansion is dictated by a single scale factor. We show that such models represent viable alternatives to describe the large-scale structure of the inflationary universe, leading to a kinematically equivalent Sachs-Wolfe effect. Through the definition of a complete set of spatial eigenfunctions we compute the two-point correlation function of scalar perturbations in these models. In addition, we show how such scenarios would modify the spectrum of the CMB assuming that the observations take place in a small patch of a universe with anisotropic curvature

  3. Cosmological signatures of anisotropic spatial curvature

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Thiago S. [Departamento de Física, Universidade Estadual de Londrina, 86057-970, Londrina – PR (Brazil); Marugán, Guillermo A. Mena [Instituto de Estructura de la Materia, IEM-CSIC, Serrano 121, 28006, Madrid (Spain); Carneiro, Saulo, E-mail: tspereira@uel.br, E-mail: mena@iem.cfmac.csic.es, E-mail: saulo.carneiro@pq.cnpq.br [Instituto de Física, Universidade Federal da Bahia, 40210-340, Salvador – BA (Brazil)

    2015-07-01

    If one is willing to give up the cherished hypothesis of spatial isotropy, many interesting cosmological models can be developed beyond the simple anisotropically expanding scenarios. One interesting possibility is presented by shear-free models in which the anisotropy emerges at the level of the curvature of the homogeneous spatial sections, whereas the expansion is dictated by a single scale factor. We show that such models represent viable alternatives to describe the large-scale structure of the inflationary universe, leading to a kinematically equivalent Sachs-Wolfe effect. Through the definition of a complete set of spatial eigenfunctions we compute the two-point correlation function of scalar perturbations in these models. In addition, we show how such scenarios would modify the spectrum of the CMB assuming that the observations take place in a small patch of a universe with anisotropic curvature.

  4. [Autoerotic fatalities in Greater Dusseldorf].

    Science.gov (United States)

    Hartung, Benno; Hellen, Florence; Borchard, Nora; Huckenbeck, Wolfgang

    2011-01-01

    Autoerotic fatalities in the Greater Dusseldorf area correspond to the relevant medicolegal literature. Our results included exclusively young to middle-aged, usually single men who were found dead in their city apartments. Clothing and devices used showed a great variety. Women's or fetish clothing and complex shackling or hanging devices were disproportionately frequent. In most cases, death occurred due to hanging or ligature strangulation. There was no increased incidence of underlying psychiatric disorders. In most of the deceased no or at least no remarkable alcohol intoxication was found. Occasionally, it may be difficult to reliably differentiate autoerotic accidents, accidents occurring in connection with practices of bondage & discipline, dominance & submission (BDSM) from natural death, suicide or homicide.

  5. Planning for greater confinement disposal

    International Nuclear Information System (INIS)

    Gilbert, T.L.; Luner, C.; Meshkov, N.K.; Trevorrow, L.E.; Yu, C.

    1985-01-01

    A report that provides guidance for planning for greater-confinement disposal (GCD) of low-level radioactive waste is being prepared. The report addresses procedures for selecting a GCD technology and provides information for implementing these procedures. The focus is on GCD; planning aspects common to GCD and shallow-land burial are covered by reference. Planning procedure topics covered include regulatory requirements, waste characterization, benefit-cost-risk assessment and pathway analysis methodologies, determination of need, waste-acceptance criteria, performance objectives, and comparative assessment of attributes that support these objectives. The major technologies covered include augered shafts, deep trenches, engineered structures, hydrofracture, improved waste forms, and high-integrity containers. Descriptive information is provided, and attributes that are relevant for risk assessment and operational requirements are given. 10 refs., 3 figs., 2 tabs

  6. Anisotropic conducting films for electromagnetic radiation applications

    Science.gov (United States)

    Cavallo, Francesca; Lagally, Max G.; Rojas-Delgado, Richard

    2015-06-16

    Electronic devices for the generation of electromagnetic radiation are provided. Also provided are methods for using the devices to generate electromagnetic radiation. The radiation sources include an anisotropic electrically conducting thin film that is characterized by a periodically varying charge carrier mobility in the plane of the film. The periodic variation in carrier mobility gives rise to a spatially varying electric field, which produces electromagnetic radiation as charged particles pass through the film.

  7. Anisotropic cosmological solutions in massive vector theories

    Energy Technology Data Exchange (ETDEWEB)

    Heisenberg, Lavinia [Institute for Theoretical Studies, ETH Zurich, Clausiusstrasse 47, 8092 Zurich (Switzerland); Kase, Ryotaro; Tsujikawa, Shinji, E-mail: Lavinia.heisenberg@googlemail.com, E-mail: r.kase@rs.tus.ac.jp, E-mail: shinji@rs.kagu.tus.ac.jp [Department of Physics, Faculty of Science, Tokyo University of Science, 1-3, Kagurazaka, Shinjuku-ku, Tokyo 162-8601 (Japan)

    2016-11-01

    In beyond-generalized Proca theories including the extension to theories higher than second order, we study the role of a spatial component v of a massive vector field on the anisotropic cosmological background. We show that, as in the case of the isotropic cosmological background, there is no additional ghostly degrees of freedom associated with the Ostrogradski instability. In second-order generalized Proca theories we find the existence of anisotropic solutions on which the ratio between the anisotropic expansion rate Σ and the isotropic expansion rate H remains nearly constant in the radiation-dominated epoch. In the regime where Σ/ H is constant, the spatial vector component v works as a dark radiation with the equation of state close to 1/3. During the matter era, the ratio Σ/ H decreases with the decrease of v . As long as the conditions |Σ| || H and v {sup 2} || φ{sup 2} are satisfied around the onset of late-time cosmic acceleration, where φ is the temporal vector component, we find that the solutions approach the isotropic de Sitter fixed point (Σ = 0 = v ) in accordance with the cosmic no-hair conjecture. In the presence of v and Σ the early evolution of the dark energy equation of state w {sub DE} in the radiation era is different from that in the isotropic case, but the approach to the isotropic value w {sub DE}{sup (iso)} typically occurs at redshifts z much larger than 1. Thus, apart from the existence of dark radiation, the anisotropic cosmological dynamics at low redshifts is similar to that in isotropic generalized Proca theories. In beyond-generalized Proca theories the only consistent solution to avoid the divergence of a determinant of the dynamical system corresponds to v = 0, so Σ always decreases in time.

  8. Acoustic anisotropic wavefields through perturbation theory

    KAUST Repository

    Alkhalifah, Tariq Ali

    2013-09-01

    Solving the anisotropic acoustic wave equation numerically using finite-difference methods introduces many problems and media restriction requirements, and it rarely contributes to the ability to resolve the anisotropy parameters. Among these restrictions are the inability to handle media with η<0 and the presence of shear-wave artifacts in the solution. Both limitations do not exist in the solution of the elliptical anisotropic acoustic wave equation. Using perturbation theory in developing the solution of the anisotropic acoustic wave equation allows direct access to the desired limitation-free solutions, that is, solutions perturbed from the elliptical anisotropic background medium. It also provides a platform for parameter estimation because of the ability to isolate the wavefield dependency on the perturbed anisotropy parameters. As a result, I derive partial differential equations that relate changes in the wavefield to perturbations in the anisotropy parameters. The solutions of the perturbation equations represented the coefficients of a Taylor-series-type expansion of the wavefield as a function of the perturbed parameter, which is in this case η or the tilt of the symmetry axis. The expansion with respect to the symmetry axis allows use of an acoustic transversely isotropic media with a vertical symmetry axis (VTI) kernel to estimate the background wavefield and the corresponding perturbation coefficients. The VTI extrapolation kernel is about one-fourth the cost of the transversely isotropic model with a tilt in the symmetry axis kernel. Thus, for a small symmetry axis tilt, the cost of migration using a first-order expansion can be reduced. The effectiveness of the approach was demonstrated on the Marmousi model.

  9. Entanglement of periodic anisotropic XY chains

    International Nuclear Information System (INIS)

    Zhang Lifa; Tong Peiqing

    2005-01-01

    By using the concept of concurrence, the entanglement of periodic anisotropic XY chains in a transverse field is studied numerically. It is found that the derivatives ∂ λ C(1) of nearest-neighbour concurrence diverge at quantum critical points. By proper scaling, we found that all the derivatives ∂ λ C(1) for periodic XY chains in the vicinity of quantum critical points have the same behaviours as that of a uniform chain

  10. Surface instabilities during straining of anisotropic materials

    DEFF Research Database (Denmark)

    Legarth, Brian Nyvang; Richelsen, Ann Bettina

    2006-01-01

    The development of instabilities in traction-free surfaces is investigated numerically using a unit cell model. Full finite strain analyses are conducted using isotropic as well as anisotropic yield criteria and both plane strain tension and compression are considered. In the load range of tensio...... of principal overall strain. For other orientations surface instabilities are seen when non-associated plastic flow is taken into account. Compared to tension, smaller compressive deformations are needed in order to initiate a surface instability....

  11. Symmetry analysis for anisotropic field theories

    International Nuclear Information System (INIS)

    Parra, Lorena; Vergara, J. David

    2012-01-01

    The purpose of this paper is to study with the help of Noether's theorem the symmetries of anisotropic actions for arbitrary fields which generally depend on higher order spatial derivatives, and to find the corresponding current densities and the Noether charges. We study in particular scale invariance and consider the cases of higher derivative extensions of the scalar field, electrodynamics and Chern-Simons theory.

  12. Electromagnetic effects on cracking of anisotropic polytropes

    Energy Technology Data Exchange (ETDEWEB)

    Sharif, Muhammad; Sadiq, Sobia [University of the Punjab, Department of Mathematics, Lahore (Pakistan)

    2016-10-15

    In this paper, we study the electromagnetic effects on the stability of a spherically symmetric anisotropic fluid distribution satisfying two polytropic equations of state and construct the corresponding generalized Tolman-Oppenheimer-Volkoff equations. We apply perturbations on matter variables via the polytropic constant as well as the polytropic index and formulate the force distribution function. It is found that the compact object is stable for a feasible choice of perturbed polytropic index in the presence of charge. (orig.)

  13. Anisotropic cosmological solutions in massive vector theories

    International Nuclear Information System (INIS)

    Heisenberg, Lavinia; Kase, Ryotaro; Tsujikawa, Shinji

    2016-01-01

    In beyond-generalized Proca theories including the extension to theories higher than second order, we study the role of a spatial component v of a massive vector field on the anisotropic cosmological background. We show that, as in the case of the isotropic cosmological background, there is no additional ghostly degrees of freedom associated with the Ostrogradski instability. In second-order generalized Proca theories we find the existence of anisotropic solutions on which the ratio between the anisotropic expansion rate Σ and the isotropic expansion rate H remains nearly constant in the radiation-dominated epoch. In the regime where Σ/ H is constant, the spatial vector component v works as a dark radiation with the equation of state close to 1/3. During the matter era, the ratio Σ/ H decreases with the decrease of v . As long as the conditions |Σ| || H and v 2 || φ 2 are satisfied around the onset of late-time cosmic acceleration, where φ is the temporal vector component, we find that the solutions approach the isotropic de Sitter fixed point (Σ = 0 = v ) in accordance with the cosmic no-hair conjecture. In the presence of v and Σ the early evolution of the dark energy equation of state w DE in the radiation era is different from that in the isotropic case, but the approach to the isotropic value w DE (iso) typically occurs at redshifts z much larger than 1. Thus, apart from the existence of dark radiation, the anisotropic cosmological dynamics at low redshifts is similar to that in isotropic generalized Proca theories. In beyond-generalized Proca theories the only consistent solution to avoid the divergence of a determinant of the dynamical system corresponds to v = 0, so Σ always decreases in time.

  14. Quantum transport of atomic matter waves in anisotropic two-dimensional and three-dimensional disorder

    International Nuclear Information System (INIS)

    Piraud, M; Pezzé, L; Sanchez-Palencia, L

    2013-01-01

    The macroscopic transport properties in a disordered potential, namely diffusion and weak/strong localization, closely depend on the microscopic and statistical properties of the disorder itself. This dependence is rich in counter-intuitive consequences. It can be particularly exploited in matter wave experiments, where the disordered potential can be tailored and controlled, and anisotropies are naturally present. In this work, we apply a perturbative microscopic transport theory and the self-consistent theory of Anderson localization to study the transport properties of ultracold atoms in anisotropic two-dimensional (2D) and three-dimensional (3D) speckle potentials. In particular, we discuss the anisotropy of single-scattering, diffusion and localization. We also calculate disorder-induced shift of the energy states and propose a method to include it, which amounts to renormalizing energies in the standard on-shell approximation. We show that the renormalization of energies strongly affects the prediction for the 3D localization threshold (mobility edge). We illustrate the theoretical findings with examples which are relevant for current matter wave experiments, where the disorder is created with laser speckle. This paper provides a guideline for future experiments aiming at the precise location of the 3D mobility edge and study of anisotropic diffusion and localization effects in 2D and 3D. (paper)

  15. Longitudinal fluctuations and decorrelation of anisotropic flow

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Long-Gang [Frankfurt Institute for Advanced Studies, Ruth-Moufang-Strasse 1, 60438 Frankfurt am Main (Germany); Petersen, Hannah [Frankfurt Institute for Advanced Studies, Ruth-Moufang-Strasse 1, 60438 Frankfurt am Main (Germany); Institute for Theoretical Physics, Goethe University, Max-von-Laue-Strasse 1, 60438 Frankfurt am Main (Germany); GSI Helmholtzzentrum für Schwerionenforschung, Planckstr. 1, 64291 Darmstadt (Germany); Qin, Guang-You [Key Laboratory of Quark & Lepton Physics (MOE) and Institute of Particle Physics, Central China Normal University, Wuhan 430079 (China); Roy, Victor [Institute for Theoretical Physics, Goethe University, Max-von-Laue-Strasse 1, 60438 Frankfurt am Main (Germany); Wang, Xin-Nian [Key Laboratory of Quark & Lepton Physics (MOE) and Institute of Particle Physics, Central China Normal University, Wuhan 430079 (China); Nuclear Science Division MS70R0319, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)

    2016-12-15

    We investigate the decorrelation of 2nd and 3rd order anisotropic flow for charged particles in two different pseudo rapidity (η) windows by varying the pseudo rapidity gap, in an event-by-event (3+1)D ideal hydrodynamic model, with fluctuating initial conditions from A Multi-Phase Transport (AMPT) model. We visualize the parton distribution at initial state for Pb+Pb collisions at LHC and Au+Au collisions at RHIC, and demonstrate the longitudinal fluctuations originating from the asymmetry between forward and backward going participants, the fluctuations of the string length and the fluctuations due to finite number of partons at different beam energies. The decorrelation of anisotropic flow of final hadrons with large η gaps is found to originate from the spatial decorrelation along the longitudinal direction in the AMPT initial conditions through hydrodynamic evolution. The agreement between our results and recent CMS data in most centralities suggests that the string-like mechanism of initial parton production in AMPT model captures the initial longitudinal fluctuation that is responsible for the measured decorrelation of anisotropic flow in Pb+Pb collisions at LHC. Our predictions for Au+Au collisions at the highest RHIC energy show stronger longitudinal decorrelation than at LHC, indicating larger longitudinal fluctuations at lower beam energies.

  16. Anisotropic hydrodynamics for conformal Gubser flow

    Energy Technology Data Exchange (ETDEWEB)

    Strickland, Michael; Nopoush, Mohammad [Kent State University, Kent OH 44242 (United States); Ryblewski, Radoslaw [The H. Niewodniczański Institute of Nuclear Physics, Polish Academy of Sciences, PL-31342 Kraków (Poland)

    2016-12-15

    In this proceedings contribution, we review the exact solution of the anisotropic hydrodynamics equations for a system subject to Gubser flow. For this purpose, we use the leading-order anisotropic hydrodynamics equations which assume that the distribution function is ellipsoidally symmetric in local-rest-frame momentum. We then prove that the SO(3){sub q} symmetry in de Sitter space constrains the anisotropy tensor to be of spheroidal form with only one independent anisotropy parameter remaining. As a consequence, the exact solution reduces to the problem of solving two coupled non-linear differential equations. We show that, in the limit that the relaxation time goes to zero, one obtains Gubser's ideal hydrodynamic solution and, in the limit that the relaxation time goes to infinity, one obtains the exact free streaming solution obtained originally by Denicol et al. For finite relaxation time, we solve the equations numerically and compare to the exact solution of the relaxation-time-approximation Boltzmann equation subject to Gubser flow. Using this as our standard, we find that anisotropic hydrodynamics describes the spatio-temporal evolution of the system better than all currently known dissipative hydrodynamics approaches.

  17. Bryan's effect and anisotropic nonlinear damping

    Science.gov (United States)

    Joubert, Stephan V.; Shatalov, Michael Y.; Fay, Temple H.; Manzhirov, Alexander V.

    2018-03-01

    In 1890, G. H. Bryan discovered the following: "The vibration pattern of a revolving cylinder or bell revolves at a rate proportional to the inertial rotation rate of the cylinder or bell." We call this phenomenon Bryan's law or Bryan's effect. It is well known that any imperfections in a vibratory gyroscope (VG) affect Bryan's law and this affects the accuracy of the VG. Consequently, in this paper, we assume that all such imperfections are either minimised or eliminated by some known control method and that only damping is present within the VG. If the damping is isotropic (linear or nonlinear), then it has been recently demonstrated in this journal, using symbolic analysis, that Bryan's law remains invariant. However, it is known that linear anisotropic damping does affect Bryan's law. In this paper, we generalise Rayleigh's dissipation function so that anisotropic nonlinear damping may be introduced into the equations of motion. Using a mixture of numeric and symbolic analysis on the ODEs of motion of the VG, for anisotropic light nonlinear damping, we demonstrate (up to an approximate average), that Bryan's law is affected by any form of such damping, causing pattern drift, compromising the accuracy of the VG.

  18. Veselago focusing of anisotropic massless Dirac fermions

    Science.gov (United States)

    Zhang, Shu-Hui; Yang, Wen; Peeters, F. M.

    2018-05-01

    Massless Dirac fermions (MDFs) emerge as quasiparticles in various novel materials such as graphene and topological insulators, and they exhibit several intriguing properties, of which Veselago focusing is an outstanding example with a lot of possible applications. However, up to now Veselago focusing merely occurred in p-n junction devices based on the isotropic MDF, which lacks the tunability needed for realistic applications. Here, motivated by the emergence of novel Dirac materials, we investigate the propagation behaviors of anisotropic MDFs in such a p-n junction structure. By projecting the Hamiltonian of the anisotropic MDF to that of the isotropic MDF and deriving an exact analytical expression for the propagator, precise Veselago focusing is demonstrated without the need for mirror symmetry of the electron source and its focusing image. We show a tunable focusing position that can be used in a device to probe masked atom-scale defects. This study provides an innovative concept to realize Veselago focusing relevant for potential applications, and it paves the way for the design of novel electron optics devices by exploiting the anisotropic MDF.

  19. ANALYSIS OF DEFORMABILITY OF ANISOTROPIC AGRILLITE CLAYSTONES

    Directory of Open Access Journals (Sweden)

    Ponomaryov Andrey Budimirovicn

    2017-08-01

    Full Text Available In the paper, the results of deformability study of agrillite claystones are used for determination of the Jointed rock model parameters. The number of stamp, pressuremeter and compressive tests allowed to research anisotropic deformability of argillite claystone in vertical and horizontal direction. The following problems were solved during the study: 1 the in-place and laboratory experiments to calculate the anisotropy coefficient were done for anisotropic agrillite claystones with both natural moisture and total water saturation; 2 the deformation parameters were determined and the numerical simulation of the stress-strain state of claystone in field tests was carried out with the use of Plaxis 2D software application; 3 the comparative analysis was done for calculated claystone deformation and the values obtained during the in-place tests. The authors proved that agrillite claystones shows two times less deformation under loading in the horizontal direction than vertically. The ratio is obtained to determine the parameters for numerical simulation of the Jointed Rock model used as a practical tool for analysis of stress-strain behavior of anisotropic soils. The authors provided a recommended practice for consideration of specific properties of argillite claystones when carrying out foundation works.

  20. Anisotropic hydrodynamics for conformal Gubser flow

    International Nuclear Information System (INIS)

    Strickland, Michael; Nopoush, Mohammad; Ryblewski, Radoslaw

    2016-01-01

    In this proceedings contribution, we review the exact solution of the anisotropic hydrodynamics equations for a system subject to Gubser flow. For this purpose, we use the leading-order anisotropic hydrodynamics equations which assume that the distribution function is ellipsoidally symmetric in local-rest-frame momentum. We then prove that the SO(3)_q symmetry in de Sitter space constrains the anisotropy tensor to be of spheroidal form with only one independent anisotropy parameter remaining. As a consequence, the exact solution reduces to the problem of solving two coupled non-linear differential equations. We show that, in the limit that the relaxation time goes to zero, one obtains Gubser's ideal hydrodynamic solution and, in the limit that the relaxation time goes to infinity, one obtains the exact free streaming solution obtained originally by Denicol et al. For finite relaxation time, we solve the equations numerically and compare to the exact solution of the relaxation-time-approximation Boltzmann equation subject to Gubser flow. Using this as our standard, we find that anisotropic hydrodynamics describes the spatio-temporal evolution of the system better than all currently known dissipative hydrodynamics approaches.

  1. Anisotropic and Hierarchical Porosity in Multifunctional Ceramics

    Science.gov (United States)

    Lichtner, Aaron Zev

    The performance of multifunctional porous ceramics is often hindered by the seemingly contradictory effects of porosity on both mechanical and non-structural properties and yet a sufficient body of knowledge linking microstructure to these properties does not exist. Using a combination of tailored anisotropic and hierarchical materials, these disparate effects may be reconciled. In this project, a systematic investigation of the processing, characterization and properties of anisotropic and isotropic hierarchically porous ceramics was conducted. The system chosen was a composite ceramic intended as the cathode for a solid oxide fuel cell (SOFC). Comprehensive processing investigations led to the development of approaches to make hierarchical, anisotropic porous microstructures using directional freeze-casting of well dispersed slurries. The effect of all the important processing parameters was investigated. This resulted in an ability to tailor and control the important microstructural features including the scale of the microstructure, the macropore size and total porosity. Comparable isotropic porous ceramics were also processed using fugitive pore formers. A suite of characterization techniques including x-ray tomography and 3-D sectional scanning electron micrographs (FIB-SEM) was used to characterize and quantify the green and partially sintered microstructures. The effect of sintering temperature on the microstructure was quantified and discrete element simulations (DEM) were used to explain the experimental observations. Finally, the comprehensive mechanical properties, at room temperature, were investigated, experimentally and using DEM, for the different microstructures.

  2. Quantitative Phase-Field Approach for Simulating Grain Growth in Anisotropic Systems with Arbitrary Inclination and Misorientation Dependence

    International Nuclear Information System (INIS)

    Moelans, N.; Blanpain, B.; Wollants, P.

    2008-01-01

    A phase-field approach for quantitative simulations of grain growth in anisotropic systems is introduced, together with a new methodology to derive appropriate model parameters that reproduce given misorientation and inclination dependent grain boundary energy and mobility in the simulations. The proposed model formulation and parameter choice guarantee a constant diffuse interface width and consequently give high controllability of the accuracy in grain growth simulations

  3. Anisotropic surface hole-transport property of triphenylamine-derivative single crystal prepared by solution method

    Energy Technology Data Exchange (ETDEWEB)

    Umeda, Minoru, E-mail: mumeda@vos.nagaokaut.ac.jp [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Katagiri, Mitsuhiko; Shironita, Sayoko [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Nagayama, Norio [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Ricoh Company, Ltd., Nishisawada, Numazu, Shizuoka 410-0007 (Japan)

    2016-12-01

    Highlights: • A hole transport molecule was investigated based on its electrochemical redox characteristics. • The solubility and supersolubility curves of the molecule were measured in order to prepare a large crystal. • The polarization micrograph and XRD results revealed that a single crystal was obtained. • An anisotropic surface conduction, in which the long-axis direction exceeds that of the amorphous layer, was observed. • The anisotropic surface conduction was well explained by the molecular stacked structure. - Abstract: This paper reports the anisotropic hole transport at the triphenylamine-derivative single crystal surface prepared by a solution method. Triphenylamine derivatives are commonly used in a hole-transport material for organic photoconductors of laser-beam printers, in which the materials are used as an amorphous form. For developing organic photovoltaics using the photoconductor’s technology, preparation of a single crystal seems to be a specific way by realizing the high mobility of an organic semiconductor. In this study, a single crystal of 4-(2,2-diphenylethenyl)-N,N-bis(4-methylphenyl)-benzenamine (TPA) was prepared and its anisotropic hole-transport property measured. First, the hole-transport property of the TPA was investigated based on its chemical structure and electrochemical redox characteristics. Next, a large-scale single crystal formation at a high rate was developed by employing a solution method based on its solubility and supersolubility curves. The grown TPA was found to be a single crystal based on the polarization micrograph observation and crystallographic analysis. For the TPA single crystal, an anisotropic surface conduction was found, which was well explained by its molecular stack structure. The measured current in the long-axis direction is one order of magnitude greater than that of amorphous TPA.

  4. Diffusion-weighted MR imaging of intracranial tumors

    International Nuclear Information System (INIS)

    Bydder, G.M.; Baudouin, C.J.; Steiner, R.E.; Hajnal, J.V.; Young, I.R.

    1991-01-01

    This paper assesses the effect of anisotropic diffusion weighting on the appearances of cerebral tumors as well as vasogenic and interstitial edema. Diffusion weighting produced a reduction in signal intensity in all or part of the tumors in the majority of cases. However, a relative increase in signal intensity was apparent in four cases. The decrease in signal intensity in vasogenic edema depended on the site and direction of gradient sensitization. Marked increase in conspicuity between tumor and edema was apparent in three cases. Changes in interstitial edema depended in detail in fiber direction. Differentiation between tumor and edema can be improved with diffusion-weighted imaging. Anisotropic change is seen in both vasogenic and interstitial edema

  5. Urban acid deposition in Greater Manchester

    Energy Technology Data Exchange (ETDEWEB)

    Lee, D.S.; Longhurst, J.W.S.; Gee, D.R.; Hare, S.E. (Manchester Polytechnic, Manchester (UK). Acid Rain Information Centre)

    1989-08-01

    Data are presented from a monitoring network of 18 bulk precipitation collectors and one wet-only collector in the urban area of Greater Manchester, in the north west of England. Weekly samples were analysed for all the major ions in precipitation along with gaseous nitrogen dioxide concentrations from diffusion tubes. Statistical analysis of the data shows significant spatial variation of non marine sulphate, nitrate, ammonium, acidity and calcium concentrations, and nitrogen dioxide concentrations. Calcium is thought to be responsible for the buffering of acidity and is of local origin. Wet deposition is the likely removal process for calcium in the atmosphere and probably by below cloud scavenging. Nitrate and ammonium concentrations and depositions show close spatial, temporal and statistical association. Examination of high simultaneous episodes of nitrate and ammonium deposition shows that these depositions cannot be explained in terms of trajectories and it is suggested that UK emissions of ammonia may be important. Statistical analysis of the relationships between nitrate and ammonium depositions, concentrations and precipitation amount suggest that ammonia from mesoscale sources reacts reversibly with nitric acid aerosol and is removed by below cloud scavenging. High episodes of the deposition of non marine sulphate are difficult to explain by trajectory analysis alone, perhaps suggesting local sources. In a comparison between wet deposition and bulk deposition, it was shown that only 15.2% of the non marine sulphur was dry deposited to the bulk precipitation collector. 63 refs., 86 figs., 31 tabs.

  6. Waste management in Greater Vancouver

    Energy Technology Data Exchange (ETDEWEB)

    Carrusca, K. [Greater Vancouver Regional District, Burnaby, BC (Canada); Richter, R. [Montenay Inc., Vancouver, BC (Canada)]|[Veolia Environmental Services, Vancouver, BC (Canada)

    2006-07-01

    An outline of the Greater Vancouver Regional District (GVRD) waste-to-energy program was presented. The GVRD has an annual budget for solid waste management of $90 million. Energy recovery revenues from solid waste currently exceed $10 million. Over 1,660,00 tonnes of GVRD waste is recycled, and another 280,000 tonnes is converted from waste to energy. The GVRD waste-to-energy facility combines state-of-the-art combustion and air pollution control, and has processed over 5 million tonnes of municipal solid waste since it opened in 1988. Its central location minimizes haul distance, and it was originally sited to utilize steam through sales to a recycle paper mill. The facility has won several awards, including the Solid Waste Association of North America award for best facility in 1990. The facility focuses on continual improvement, and has installed a carbon injection system; an ammonia injection system; a flyash stabilization system; and heat capacity upgrades in addition to conducting continuous waste composition studies. Continuous air emissions monitoring is also conducted at the plant, which produces a very small percentage of the total air emissions in metropolitan Vancouver. The GVRD is now seeking options for the management of a further 500,000 tonnes per year of solid waste, and has received 23 submissions from a range of waste energy technologies which are now being evaluated. It was concluded that waste-to-energy plants can be located in densely populated metropolitan areas and provide a local disposal solution as well as a source of renewable energy. Other GVRD waste reduction policies were also reviewed. refs., tabs., figs.

  7. Lead diffusion in monazite

    International Nuclear Information System (INIS)

    Gardes, E.

    2006-06-01

    Proper knowledge of the diffusion rates of lead in monazite is necessary to understand the U-Th-Pb age anomalies of this mineral, which is one of the most used in geochronology after zircon. Diffusion experiments were performed in NdPO 4 monocrystals and in Nd 0.66 Ca 0.17 Th 0.17 PO 4 polycrystals from Nd 0.66 Pb 0.17 Th 0.17 PO 4 thin films to investigate Pb 2+ + Th 4+ ↔ 2 Nd 3+ and Pb 2+ ↔ Ca 2+ exchanges. Diffusion annealings were run between 1200 and 1500 Celsius degrees, at room pressure, for durations ranging from one hour to one month. The diffusion profiles were analysed using TEM (transmission electronic microscopy) and RBS (Rutherford backscattering spectroscopy). The diffusivities extracted for Pb 2+ + Th 4+ ↔ 2 Nd 3+ exchange follow an Arrhenius law with parameters E equals 509 ± 24 kJ mol -1 and log(D 0 (m 2 s -1 )) equals -3.41 ± 0.77. Preliminary data for Pb 2+ ↔ Ca 2+ exchange are in agreement with this result. The extrapolation of our data to crustal temperatures yields very slow diffusivities. For instance, the time necessary for a 50 μm grain to lose all of its lead at 800 Celsius degrees is greater than the age of the Earth. From these results and other evidence from the literature, we conclude that most of the perturbations in U-Th-Pb ages of monazite cannot be attributed to lead diffusion, but rather to interactions with fluids. (author)

  8. Analysis of electromagnetic scattering by uniaxial anisotropic bispheres.

    Science.gov (United States)

    Li, Zheng-Jun; Wu, Zhen-Sen; Li, Hai-Ying

    2011-02-01

    Based on the generalized multiparticle Mie theory and the Fourier transformation approach, electromagnetic (EM) scattering of two interacting homogeneous uniaxial anisotropic spheres with parallel primary optical axes is investigated. By introducing the Fourier transformation, the EM fields in the uniaxial anisotropic spheres are expanded in terms of the spherical vector wave functions. The interactive scattering coefficients and the expansion coefficients of the internal fields are derived through the continuous boundary conditions on which the interaction of the bispheres is considered. Some selected calculations on the effects of the size parameter, the uniaxial anisotropic absorbing dielectric, and the sphere separation distance are described. The backward radar cross section of two uniaxial anisotropic spheres with a complex permittivity tensor changing with the sphere separation distance is numerically studied. The authors are hopeful that the work in this paper will help provide an effective calibration for further research on the scattering characteristic of an aggregate of anisotropic spheres or other shaped anisotropic particles.

  9. Sound attenuation and absorption by anisotropic fibrous materials: Theoretical and experimental study

    Science.gov (United States)

    Bravo, Teresa; Maury, Cédric

    2018-03-01

    This paper describes analytical and experimental studies carried out to examine the attenuation and absorption properties of rigidly-backed fibrous anisotropic materials in contact with a uniform mean flow. The aim is to provide insights for the development of non-locally reacting wall-treatments able to dissipate the noise induced by acoustic excitations over in-duct or external lining systems. A model of sound propagation in anisotropic bulk-reacting liners is presented that fully accounts for anisotropic losses due to heat conduction, viscous dissipation and diffusion processes along and across the material fibres as well as for the convective effect of an external flow. The propagation constant for the least attenuated mode of the coupled system is obtained using a simulated annealing search method. The predicted acoustical performance is validated in the no-flow case for a wide range of fibre diameters. They are assessed against impedance tube and free-field pressure-velocity measurements of the normal incidence absorption coefficient and surface impedance. Parametric studies are then conducted to determine the key constitutive parameters such as the fibres orientation or the amount of anisotropy that mostly influence the axial attenuation or the normal absorption. They are supported by a low-frequency approximation to the axial attenuation under a low-speed flow.

  10. Modeling the characteristic etch morphologies along specific crystallographic orientations by anisotropic chemical etching

    Science.gov (United States)

    Li, Kun-Dar; Miao, Jin-Ru

    2018-02-01

    To improve the advanced manufacturing technology for functional materials, a sophisticated control of chemical etching process is highly demanded, especially in the fields of environment and energy related applications. In this study, a phase-field-based model is utilized to investigate the etch morphologies influenced by the crystallographic characters during anisotropic chemical etching. Three types of etching modes are inspected theoretically, including the isotropic, and preferred oriented etchings. Owing to the specific etching behavior along the crystallographic directions, different characteristic surface structures are presented in the simulations, such as the pimple-like, pyramidal hillock and ridge-like morphologies. In addition, the processing parameters affecting the surface morphological formation and evolution are also examined systematically. According to the numerical results, the growth mechanism of surface morphology in a chemical etching is revealed distinctly. While the etching dynamics plays a dominant role on the surface formation, the characteristic surface morphologies corresponding to the preferred etching direction become more apparent. As the atomic diffusion turned into a determinative factor, a smoothened surface would appear, even under the anisotropic etching conditions. These simulation results provide fundamental information to enhance the development and application of anisotropic chemical etching techniques.

  11. Modeling the characteristic etch morphologies along specific crystallographic orientations by anisotropic chemical etching

    Directory of Open Access Journals (Sweden)

    Kun-Dar Li

    2018-02-01

    Full Text Available To improve the advanced manufacturing technology for functional materials, a sophisticated control of chemical etching process is highly demanded, especially in the fields of environment and energy related applications. In this study, a phase-field-based model is utilized to investigate the etch morphologies influenced by the crystallographic characters during anisotropic chemical etching. Three types of etching modes are inspected theoretically, including the isotropic, and preferred oriented etchings. Owing to the specific etching behavior along the crystallographic directions, different characteristic surface structures are presented in the simulations, such as the pimple-like, pyramidal hillock and ridge-like morphologies. In addition, the processing parameters affecting the surface morphological formation and evolution are also examined systematically. According to the numerical results, the growth mechanism of surface morphology in a chemical etching is revealed distinctly. While the etching dynamics plays a dominant role on the surface formation, the characteristic surface morphologies corresponding to the preferred etching direction become more apparent. As the atomic diffusion turned into a determinative factor, a smoothened surface would appear, even under the anisotropic etching conditions. These simulation results provide fundamental information to enhance the development and application of anisotropic chemical etching techniques.

  12. Turbulence-driven anisotropic electron tail generation during magnetic reconnection

    Science.gov (United States)

    DuBois, A. M.; Scherer, A.; Almagri, A. F.; Anderson, J. K.; Pandya, M. D.; Sarff, J. S.

    2018-05-01

    Magnetic reconnection (MR) plays an important role in particle transport, energization, and acceleration in space, astrophysical, and laboratory plasmas. In the Madison Symmetric Torus reversed field pinch, discrete MR events release large amounts of energy from the equilibrium magnetic field, a fraction of which is transferred to electrons and ions. Previous experiments revealed an anisotropic electron tail that favors the perpendicular direction and is symmetric in the parallel. New profile measurements of x-ray emission show that the tail distribution is localized near the magnetic axis, consistent modeling of the bremsstrahlung emission. The tail appears first near the magnetic axis and then spreads radially, and the dynamics in the anisotropy and diffusion are discussed. The data presented imply that the electron tail formation likely results from a turbulent wave-particle interaction and provides evidence that high energy electrons are escaping the core-localized region through pitch angle scattering into the parallel direction, followed by stochastic parallel transport to the plasma edge. New measurements also show a strong correlation between high energy x-ray measurements and tearing mode dynamics, suggesting that the coupling between core and edge tearing modes is essential for energetic electron tail formation.

  13. Giant anisotropic magnetoresistance in a quantum anomalous Hall insulator

    Science.gov (United States)

    Kandala, Abhinav; Richardella, Anthony; Kempinger, Susan; Liu, Chao-Xing; Samarth, Nitin

    2015-01-01

    When a three-dimensional ferromagnetic topological insulator thin film is magnetized out-of-plane, conduction ideally occurs through dissipationless, one-dimensional (1D) chiral states that are characterized by a quantized, zero-field Hall conductance. The recent realization of this phenomenon, the quantum anomalous Hall effect, provides a conceptually new platform for studies of 1D transport, distinct from the traditionally studied quantum Hall effects that arise from Landau level formation. An important question arises in this context: how do these 1D edge states evolve as the magnetization is changed from out-of-plane to in-plane? We examine this question by studying the field-tilt-driven crossover from predominantly edge-state transport to diffusive transport in Crx(Bi,Sb)2−xTe3 thin films. This crossover manifests itself in a giant, electrically tunable anisotropic magnetoresistance that we explain by employing a Landauer–Büttiker formalism. Our methodology provides a powerful means of quantifying dissipative effects in temperature and chemical potential regimes far from perfect quantization. PMID:26151318

  14. Orthonormal bases for anisotropic α-modulation spaces

    DEFF Research Database (Denmark)

    Rasmussen, Kenneth Niemann

    2012-01-01

    In this article we construct orthonormal bases for bi-variate anisotropic α-modulation spaces. The construction is based on generating a nice anisotropic α-covering and using carefully selected tensor products of univariate brushlet functions with regards to this covering. As an application, we...... show that n-term nonlinear approximation with the orthonormal bases in certain anisotropic α-modulation spaces can be completely characterized....

  15. Orthonormal bases for anisotropic α-modulation spaces

    DEFF Research Database (Denmark)

    Rasmussen, Kenneth Niemann

    In this article we construct orthonormal bases for bi-variate anisotropic α-modulation spaces. The construction is based on generating a nice anisotropic α-covering and using carefully selected tensor products of univariate brushlet functions with regards to this covering. As an application, we...... show that n-term nonlinear approximation with the orthonormal bases in certain anisotropic α-modulation spaces can be completely characterized....

  16. Stability conditions for the Bianchi type II anisotropically inflating universes

    International Nuclear Information System (INIS)

    Kao, W.F.; Lin, Ing-Chen

    2009-01-01

    Stability conditions for a class of anisotropically inflating solutions in the Bianchi type II background space are shown explicitly in this paper. These inflating solutions were known to break the cosmic no-hair theorem such that they do not approach the de Sitter universe at large times. It can be shown that unstable modes of the anisotropic perturbations always exist for this class of expanding solutions. As a result, we show that these set of anisotropically expanding solutions are unstable against anisotropic perturbations in the Bianchi type II space

  17. Diffusion tensor and diffusion weighted imaging. Pictorial mathematics

    Energy Technology Data Exchange (ETDEWEB)

    Nakada, Tsutomu [California Univ., Davis, CA (United States)

    1995-06-01

    A new imaging algorithm for the treatment of a second order apparent diffusion tensor, D{sub app}{sup {xi}} is described. The method calls for only mathematics of images (pictorial mathematics) without necessity of eigenvalues/eigenvectors estimation. Nevertheless, it is capable of extracting properties of D{sub app}{sup {xi}} invariant to observation axes. While trace image is an example of images weighted by invariance of the tensor matrix, three dimensional anisotropy (3DAC) contrast represents the imaging method making use to anisotropic direction of tensor ellipsoid producing color coded contrast of exceptionally high anatomic resolution. Contrary to intuition, the processes require only a simple algorithm directly applicable to clinical magnetic resonance imaging (MRI). As a contrast method which precisely represents physical characteristics of a target tissue, invariant D{sub app}{sup {xi}} images produced by pictorial mathematics possess significant potential for a number of biological and clinical applications. (author).

  18. Silicon as an anisotropic mechanical material

    DEFF Research Database (Denmark)

    Thomsen, Erik Vilain; Reck, Kasper; Skands, Gustav Erik

    2014-01-01

    While silicon is an anisotropic material it is often in literature treated as an isotropic material when it comes to plate calculations. This leads to considerable errors in the calculated deflection. To overcome this problem, we present an in-depth analysis of the bending behavior of thin crysta...... analytical models involving crystalline plates, such as those often found in the field of micro electro mechanical systems. The effect of elastic boundary conditions is taken into account by using an effective radius of the plate....

  19. Anisotropic perturbations due to dark energy

    International Nuclear Information System (INIS)

    Battye, Richard A.; Moss, Adam

    2006-01-01

    A variety of observational tests seem to suggest that the Universe is anisotropic. This is incompatible with the standard dogma based on adiabatic, rotationally invariant perturbations. We point out that this is a consequence of the standard decomposition of the stress-energy tensor for the cosmological fluids, and that rotational invariance need not be assumed, if there is elastic rigidity in the dark energy. The dark energy required to achieve this might be provided by point symmetric domain wall network with P/ρ=-2/3, although the concept is more general. We illustrate this with reference to a model with cubic symmetry and discuss various aspects of the model

  20. An approach to anisotropic cosmologies. 6

    International Nuclear Information System (INIS)

    Raychaudhuri, A.K.

    1989-01-01

    In this paper the motivation for the study of anisotropic cosmological models is set out. Then the mathematical basis for the study of such models as well as the description of some of the exact solutions of this genre are given. Killing vectors that spell out spacetime symmetries, are defined and the Bianchi classification of spacetimes based on the structure of the Killing vectors described. After a consideration of the kinematics of matter flow some of the known solutions are presented and their properties described. (author)

  1. The quantum cosmology of an anisotropic universe

    International Nuclear Information System (INIS)

    Duncan, M.J.; Jensen, L.G.

    1989-01-01

    Surveys of the microwave background indicate that the universe is isotropic to more than one part in 10 5 . Due to the arbitrariness of the initial conditions of the universe at the big bang singularity one cannot predict this; it is usually put in by hand. We therefore construct the quantum cosmology of an anisotropic universe according to the 'no-boundary' prescription of Hartle and Hawking. Such a model has a well-defined behavior at the classical singularity. We then show it also implies that a large universe, such as ours, is isotropic. (orig.)

  2. Quantum cosmology of an anisotropic universe

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, M.J.; Jensen, L.G.

    1989-01-23

    Surveys of the microwave background indicate that the universe is isotropic to more than one part in 10/sup 5/. Due to the arbitrariness of the initial conditions of the universe at the big bang singularity one cannot predict this; it is usually put in by hand. We therefore construct the quantum cosmology of an anisotropic universe according to the 'no-boundary' prescription of Hartle and Hawking. Such a model has a well-defined behavior at the classical singularity. We then show it also implies that a large universe, such as ours, is isotropic.

  3. Critical state of anisotropic hard superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Romero-Salazar, C; Perez-RodrIguez, F [Instituto de FIsica, Universidad Autonoma de Puebla, Apdo Post J-48, Puebla, Pue 72570 (Mexico)

    2003-11-01

    The magnetic response of anisotropic irreversible type-II superconductors is investigated theoretically. Using an elliptic vertical law for the electric field E as a function of the current density J, we have reproduced available experimental magnetization curves of YBCO samples with the c axis lying in the sample plane. Specifically, we could reproduce quantitatively and interpret correctly the appearance of additional extrema and segments with relatively small slopes of the virgin magnetization curves when the direction of the applied magnetic field differs from the principal axes. The notable deformation of magnetization curves in a tilted magnetic field is connected to the strong coupling between the components of the magnetic induction.

  4. Generalised model for anisotropic compact stars

    Energy Technology Data Exchange (ETDEWEB)

    Maurya, S.K. [University of Nizwa, Department of Mathematical and Physical Sciences College of Arts and Science, Nizwa (Oman); Gupta, Y.K. [Raj Kumar Goel Institute of Technology, Department of Mathematics, Ghaziabad, Uttar Pradesh (India); Ray, Saibal [Government College of Engineering and Ceramic Technology, Department of Physics, Kolkata, West Bengal (India); Deb, Debabrata [Indian Institute of Engineering Science and Technology, Shibpur, Department of Physics, Howrah, West Bengal (India)

    2016-12-15

    In the present investigation an exact generalised model for anisotropic compact stars of embedding class 1 is sought with a general relativistic background. The generic solutions are verified by exploring different physical aspects, viz. energy conditions, mass-radius relation, stability of the models, in connection to their validity. It is observed that the model presented here for compact stars is compatible with all these physical tests and thus physically acceptable as far as the compact star candidates RXJ 1856-37, SAX J 1808.4-3658 (SS1) and SAX J 1808.4-3658 (SS2) are concerned. (orig.)

  5. Many-dimensional anisotropic anharmonic oscillator

    International Nuclear Information System (INIS)

    Turbiner, A.V.

    1987-01-01

    Precision calculation of energies of several first states at d=2 and first 17 states at d=3 has been performed within the framework of a unique method based on ''nonlinearization'' method for d-dimension anisotropic an harmonic oscillator. Spectrum behaviour within the limit d → ∞ has been investigated and problems of the given approach accuracy have been studied. For the first time properties of nodal surfaces of the given task have been investigated. Routine perturbation theory in degrees of a perturbation parameter has been constructed for several first states

  6. Theory of Random Anisotropic Magnetic Alloys

    DEFF Research Database (Denmark)

    Lindgård, Per-Anker

    1976-01-01

    A mean-field-crystal-field theory is developed for random, multicomponent, anisotropic magnetic alloys. It is specially applicable to rare-earth alloys. A discussion is given of multicritical points and phase transitions between various states characterized by order parameters with different...... spatial directions or different ordering wave vectors. Theoretical predictions based on known parameters for the phase diagrams and magnetic moments for the binary rare-earth alloys of Tb, Dy, Ho, and Er, Tb-Tm, Nd-Pr, and pure double-hcp Nd agree qualitatively with the experimental observations...... fluctuation corrections in the mean-field results is also discussed....

  7. Effective Medium Theory for Anisotropic Metamaterials

    KAUST Repository

    Zhang, Xiujuan

    2017-11-12

    This dissertation includes the study of effective medium theories (EMTs) and their applications in describing wave propagation in anisotropic metamaterials, which can guide the design of metamaterials. An EMT based on field averaging is proposed to describe a peculiar anisotropic dispersion relation that is linear along the symmetry line but quadratic in the perpendicular direction. This dispersion relation is associated with the topological transition of the iso-frequency contours (IFCs), suggesting interesting wave propagation behaviors from beam shaping to beam splitting. In the framework of coherent potential approximation, an analytical EMT is further developed, with the ability to build a direct connection between the microscopic structure and the macroscopic material properties, which overcomes the requirement of prior knowledge of the field distributions. The derived EMT is valid beyond the long-wavelength limit. Using the EMT, an anisotropic zero-index metamaterial is designed. Moreover, the derived EMT imposes a condition that no scattered wave is generated in the ambient medium, which suggests the input signal cannot detect any object that might exist, making it invisible. Such correspondence between the EMT and the invisibilityinspires us to explore the wave cloaking in the same framework of coherent potential approximation. To further broaden the application realm of EMT, an EMT using the parameter retrieval method is studied in the regimes where the previously-developed EMTs are no longer accurate. Based on this study, in conjunction with the EMT mentioned above, a general scheme to realize coherent perfect absorption (CPA) in anisotropic metamaterials is proposed. As an exciting area in metamaterials, the field of metasurfaces has drawn great attention recently. As an easily attainable device, a grating may be the simplest version of metasurfaces. Here, an analytical EMT for gratings made of cylinders is developed by using the multiple scattering

  8. Local thermodynamics of a magnetized, anisotropic plasma

    International Nuclear Information System (INIS)

    Hazeltine, R. D.; Mahajan, S. M.; Morrison, P. J.

    2013-01-01

    An expression for the internal energy of a fluid element in a weakly coupled, magnetized, anisotropic plasma is derived from first principles. The result is a function of entropy, particle density and magnetic field, and as such plays the role of a thermodynamic potential: it determines in principle all thermodynamic properties of the fluid element. In particular it provides equations of state for the magnetized plasma. The derivation uses familiar fluid equations, a few elements of kinetic theory, the MHD version of Faraday's law, and certain familiar stability and regularity conditions.

  9. RELATIVISTIC CYCLOTRON INSTABILITY IN ANISOTROPIC PLASMAS

    Energy Technology Data Exchange (ETDEWEB)

    López, Rodrigo A.; Moya, Pablo S.; Muñoz, Víctor; Valdivia, J. Alejandro [Departamento de Física, Facultad de Ciencias, Universidad de Chile, Casilla 653, Santiago (Chile); Navarro, Roberto E.; Araneda, Jaime A. [Departamento de Física, Facultad de Ciencias Físicas y Matemáticas, Universidad de Concepción, Casilla 160-C, Concepción (Chile); Viñas, Adolfo F., E-mail: rlopez186@gmail.com [NASA Goddard Space Flight Center, Heliophysics Science Division, Geospace Physics Laboratory, Mail Code 673, Greenbelt, MD 20771 (United States)

    2016-11-20

    A sufficiently large temperature anisotropy can sometimes drive various types of electromagnetic plasma micro-instabilities, which can play an important role in the dynamics of relativistic pair plasmas in space, astrophysics, and laboratory environments. Here, we provide a detailed description of the cyclotron instability of parallel propagating electromagnetic waves in relativistic pair plasmas on the basis of a relativistic anisotropic distribution function. Using plasma kinetic theory and particle-in-cell simulations, we study the influence of the relativistic temperature and the temperature anisotropy on the collective and noncollective modes of these plasmas. Growth rates and dispersion curves from the linear theory show a good agreement with simulations results.

  10. Analysis of anisotropic shells containing flowing fluid

    International Nuclear Information System (INIS)

    Lakis, A.A.

    1983-01-01

    A general theory for the dynamic analysis of anisotropic thin cylindrical shells containing flowing fluid is presented. The shell may be uniform or non-uniform, provided it is geometrically axially symmetric. This is a finite- element theory, using cylindrical finite elements, but the displacement functions are determined by using classical shell theory. A new solution of the wave equation of the liquid finite element leads to an expression of the fluid pressure, p, as a function of the nodal displacements of the element and three operative forces (inertia, centrifugal and Coriolis) of the moving fluid. (Author) [pt

  11. Apparent exchange rate imaging in anisotropic systems

    DEFF Research Database (Denmark)

    Sønderby, Casper Kaae; Lundell, Henrik M; Søgaard, Lise V

    2014-01-01

    Double-wave diffusion experiments offer the possibility of probing correlation between molecular diffusion at multiple time points. It has recently been shown that this technique is capable of measuring the exchange of water across cellular membranes. The aim of this study was to investigate...... the effect of macroscopic tissue anisotropy on the measurement of the apparent exchange rate (AXR) in multicompartment systems....

  12. Fractal behavior of single-particle trajectories and isosets in isotropic and anisotropic fluids

    International Nuclear Information System (INIS)

    Kalia, R.K.; Vashishta, P.; de Leeuw, S.W.

    1985-08-01

    Molecular dynamics simulations for a variety of systems in 2 spatial dimensions reveal fractual behavior associated with trajectories and isosets of single particle motion. The fractual dimensions of trajectories and isosets are 2 and 0.5, respectively, irrespective of the nature of the interparticle interaction or thermodynamic state of the system. Recently, we have investigated the fractual behavior of diffusing Ag ions in the superionic phase of Ag 2 S. MD calculations have shown that the Ag ions diffuse anisotropically along certain directions in the lattice of S particles. Fractual dimensions D and anti D for Ag ions are again 2 and 0.5, respectively. These results confirm the universal nature of fractual dimensions of trails and isosets

  13. Anisotropic pressure and hyperons in neutron stars

    International Nuclear Information System (INIS)

    Sulaksono, A.

    2015-01-01

    We study the effects of anisotropic pressure (AI-P) on properties of the neutron stars (NSs) with hyperons inside its core within the framework of extended relativistic mean field. It is found that the main effects of AI-P on NS matter is to increase the stiffness of the equation of state EOS, which compensates for the softening of the EOS due to the hyperons. The maximum mass and redshift predictions of anisotropic neutron star with hyperonic core are quite compatible with the result of recent observational constraints if we use the parameter of AI-P model h ≤ 0.8 [L. Herrera and W. Barreto, Phys. Rev. D 88 (2013) 084022.] and Λ ≤ -1.15 [D. D. Doneva and S. S. Yazadjiev, Phys. Rev. D 85 (2012) 124023.]. The radius of the corresponding NS at M = 1.4 M ⊙ is more than 13 km, while the effect of AI-P on the minimum mass of NS is insignificant. Furthermore, due to the AI-P in the NS, the maximum mass limit of higher than 2.1 M ⊙ cannot rule out the presence of hyperons in the NS core. (author)

  14. Gravitomagnetic Instabilities in Anisotropically Expanding Fluids

    Science.gov (United States)

    Kleidis, Kostas; Kuiroukidis, Apostolos; Papadopoulos, Demetrios B.; Vlahos, Loukas

    Gravitational instabilities in a magnetized Friedman-Robertson-Walker (FRW) universe, in which the magnetic field was assumed to be too weak to destroy the isotropy of the model, are known and have been studied in the past. Accordingly, it became evident that the external magnetic field disfavors the perturbations' growth, suppressing the corresponding rate by an amount proportional to its strength. However, the spatial isotropy of the FRW universe is not compatible with the presence of large-scale magnetic fields. Therefore, in this paper we use the general-relativistic version of the (linearized) perturbed magnetohydrodynamic equations with and without resistivity, to discuss a generalized Jeans criterion and the potential formation of density condensations within a class of homogeneous and anisotropically expanding, self-gravitating, magnetized fluids in curved space-time. We find that, for a wide variety of anisotropic cosmological models, gravitomagnetic instabilities can lead to subhorizontal, magnetized condensations. In the nonresistive case, the power spectrum of the unstable cosmological perturbations suggests that most of the power is concentrated on large scales (small k), very close to the horizon. On the other hand, in a resistive medium, the critical wave-numbers so obtained, exhibit a delicate dependence on resistivity, resulting in the reduction of the corresponding Jeans lengths to smaller scales (well bellow the horizon) than the nonresistive ones, while increasing the range of cosmological models which admit such an instability.

  15. The Effective Coherence Length in Anisotropic Superconductors

    International Nuclear Information System (INIS)

    Polturak, E.; Koren, G.; Nesher, O

    1999-01-01

    If electrons are transmitted from a normal conductor(N) into a superconductor(S), common wisdom has it that the electrons are converted into Cooper pairs within a coherence length from the interface. This is true in conventional superconductors with an isotropic order parameter. We have established experimentally that the situation is rather different in high Tc superconductors having an anisotropic order parameter. We used epitaxial thin film S/N bilayers having different interface orientations in order to inject carriers from S into N along different directions. The distance to which these carriers penetrate were determined through their effect on the Tc of the bilayers. We found that the effective coherence length is 20A only along the a or b directions, while in other directions we find a length of 250dr20A out of plane, and an even larger value for in-plane, off high symmetry directions. These observations can be explained using the Blonder-Tinkham-Klapwijk model adapted to anisotropic superconductivity. Several implications of our results on outstanding problems with high Tc junctions will be discussed

  16. Lyotropic Liquid Crystal Phases from Anisotropic Nanomaterials

    Directory of Open Access Journals (Sweden)

    Ingo Dierking

    2017-10-01

    Full Text Available Liquid crystals are an integral part of a mature display technology, also establishing themselves in other applications, such as spatial light modulators, telecommunication technology, photonics, or sensors, just to name a few of the non-display applications. In recent years, there has been an increasing trend to add various nanomaterials to liquid crystals, which is motivated by several aspects of materials development. (i addition of nanomaterials can change and thus tune the properties of the liquid crystal; (ii novel functionalities can be added to the liquid crystal; and (iii the self-organization of the liquid crystalline state can be exploited to template ordered structures or to transfer order onto dispersed nanomaterials. Much of the research effort has been concentrated on thermotropic systems, which change order as a function of temperature. Here we review the other side of the medal, the formation and properties of ordered, anisotropic fluid phases, liquid crystals, by addition of shape-anisotropic nanomaterials to isotropic liquids. Several classes of materials will be discussed, inorganic and mineral liquid crystals, viruses, nanotubes and nanorods, as well as graphene oxide.

  17. Scaling Argument of Anisotropic Random Walk

    International Nuclear Information System (INIS)

    Xu Bingzhen; Jin Guojun; Wang Feifeng

    2005-01-01

    In this paper, we analytically discuss the scaling properties of the average square end-to-end distance (R 2 ) for anisotropic random walk in D-dimensional space (D≥2), and the returning probability P n (r 0 ) for the walker into a certain neighborhood of the origin. We will not only give the calculating formula for (R 2 ) and P n (r 0 ), but also point out that if there is a symmetric axis for the distribution of the probability density of a single step displacement, we always obtain (R p erpendicular n 2 )∼n, where perpendicular refers to the projections of the displacement perpendicular to each symmetric axes of the walk; in D-dimensional space with D symmetric axes perpendicular to each other, we always have (R n 2 )∼n and the random walk will be like a purely random motion; if the number of inter-perpendicular symmetric axis is smaller than the dimensions of the space, we must have (R n 2 )∼n 2 for very large n and the walk will be like a ballistic motion. It is worth while to point out that unlike the isotropic random walk in one and two dimensions, which is certain to return into the neighborhood of the origin, generally there is only a nonzero probability for the anisotropic random walker in two dimensions to return to the neighborhood.

  18. Anisotropic hydrodynamics with a scalar collisional kernel

    Science.gov (United States)

    Almaalol, Dekrayat; Strickland, Michael

    2018-04-01

    Prior studies of nonequilibrium dynamics using anisotropic hydrodynamics have used the relativistic Anderson-Witting scattering kernel or some variant thereof. In this paper, we make the first study of the impact of using a more realistic scattering kernel. For this purpose, we consider a conformal system undergoing transversally homogenous and boost-invariant Bjorken expansion and take the collisional kernel to be given by the leading order 2 ↔2 scattering kernel in scalar λ ϕ4 . We consider both classical and quantum statistics to assess the impact of Bose enhancement on the dynamics. We also determine the anisotropic nonequilibrium attractor of a system subject to this collisional kernel. We find that, when the near-equilibrium relaxation-times in the Anderson-Witting and scalar collisional kernels are matched, the scalar kernel results in a higher degree of momentum-space anisotropy during the system's evolution, given the same initial conditions. Additionally, we find that taking into account Bose enhancement further increases the dynamically generated momentum-space anisotropy.

  19. Transient electromagnetic scattering on anisotropic media

    International Nuclear Information System (INIS)

    Stewart, R.D.

    1990-01-01

    This dissertation treats the problem of transient scattering of obliquely incident electromagnetic plane waves on a stratified anisotropic dielectric slab. Scattering operators are derived for the reflective response of the medium. The internal fields are calculated. Wave splitting and invariant imbedding techniques are used. These techniques are first presented for fields normally incident on a stratified, isotropic dielectric medium. The techniques of wave splitting and invariant imbedding are applied to normally incident plane waves on an anisotropic medium. An integro-differential equation is derived for the reflective response and the direct and inverse scattering problems are discussed. These techniques are applied to the case of obliquely incident plane waves. The reflective response is derived and the direct and inverse problems discussed and compared to those for the normal incidence case. The internal fields are investigated for the oblique incidence via a Green's function approach. A numerical scheme is presented to calculate the Green's function. Finally, symmetry relations of the reflective response are discussed

  20. Making of Magnet Barium Ferit Anisotropic

    International Nuclear Information System (INIS)

    Idayati, Novrita; Dedi

    2003-01-01

    Barium Hexa ferrite (BaFe 12 O 19 ) is ceramic and materials which usually used for making of permanent magnet. In this research Barium Hexa ferrite were made Anisotropic, and applied for loudspeaker, electro motors, dynamo, KWh metre, etc. this Magnet is commonly used due to its high Induction of Remanen (Br) and coercivity (high Hc). Besides it applies a more simple and easier process technology, cheaper raw material, and easy to find it, hence the magnetic component is much cheaper. Powder Metallurgy was used for the process technology, by reacting all materials in the powder (oxide), with a certain size distribution and a tight preparation step. The next step was mixing ferrite and Barium Carbonate (in the form of oxide), calcination, compaction, cantering and characterisation. The Anisotropic particle effects a high Induce Remanen (Br) and of koersifitas (high Hc). All the process steps will is determine physical and chemical characteristics of the magnet. The best Magnet characteristic of the magnet produced in this research is Induction of Remanen (Br) = 4,27 kg, Coercivity (Hc) = 1,745 kOe, Energy Product max (BHmaks) = 2,31 MGOe

  1. Relativistic model for anisotropic strange stars

    Science.gov (United States)

    Deb, Debabrata; Chowdhury, Sourav Roy; Ray, Saibal; Rahaman, Farook; Guha, B. K.

    2017-12-01

    In this article, we attempt to find a singularity free solution of Einstein's field equations for compact stellar objects, precisely strange (quark) stars, considering Schwarzschild metric as the exterior spacetime. To this end, we consider that the stellar object is spherically symmetric, static and anisotropic in nature and follows the density profile given by Mak and Harko (2002) , which satisfies all the physical conditions. To investigate different properties of the ultra-dense strange stars we have employed the MIT bag model for the quark matter. Our investigation displays an interesting feature that the anisotropy of compact stars increases with the radial coordinate and attains its maximum value at the surface which seems an inherent property for the singularity free anisotropic compact stellar objects. In this connection we also perform several tests for physical features of the proposed model and show that these are reasonably acceptable within certain range. Further, we find that the model is consistent with the energy conditions and the compact stellar structure is stable with the validity of the TOV equation and Herrera cracking concept. For the masses below the maximum mass point in mass vs radius curve the typical behavior achieved within the framework of general relativity. We have calculated the maximum mass and radius of the strange stars for the three finite values of bag constant Bg.

  2. Building an Anisotropic Meniscus with Zonal Variations

    Science.gov (United States)

    Higashioka, Michael M.; Chen, Justin A.; Hu, Jerry C.

    2014-01-01

    Toward addressing the difficult problems of knee meniscus regeneration, a self-assembling process has been used to re-create the native morphology and matrix properties. A significant problem in such attempts is the recapitulation of the distinct zones of the meniscus, the inner, more cartilaginous and the outer, more fibrocartilaginous zones. In this study, an anisotropic and zonally variant meniscus was produced by self-assembly of the inner meniscus (100% chondrocytes) followed by cell seeding the outer meniscus (coculture of chondrocytes and meniscus cells). After 4 weeks in culture, the engineered, inner meniscus exhibited a 42% increase in both instantaneous and relaxation moduli and a 62% increase in GAG/DW, as compared to the outer meniscus. In contrast, the circumferential tensile modulus and collagen/DW of the outer zone was 101% and 129% higher, respectively, than the values measured for the inner zone. Furthermore, there was no difference in the radial tensile modulus between the control and zonal engineered menisci, suggesting that the inner and outer zones of the engineered zonal menisci successfully integrated. These data demonstrate that not only can biomechanical and biochemical properties be engineered to differ by the zone, but they can also recapitulate the anisotropic behavior of the knee meniscus. PMID:23931258

  3. Diffusion in building wakes

    International Nuclear Information System (INIS)

    Ramsdell, J.V.

    1988-03-01

    Straight-line Gaussian models adequately describe atmospheric diffusion for many applications. They have been modified for use in estimating diffusion in building wakes by adding terms that include projected building area and by redefining the diffusion coefficients so that the coefficients have minimum values that are related to building dimensions. In a recent study, Ramsdell reviewed the building-wake dispersion models used by the Nuclear Regulatory Commission (NRC) in its control room habitability assessments. The review included comparison of model estimates of centerline concentrations with concentrations observed in experiments at seven nuclear reactors. In general, the models are conservative in that they tend to predict concentrations that are greater than those actually observed. However, the models show little skill in accounting for variations in the observed concentrations. Subsequently, the experimental data and multiples linear regression techniques have been used to develop a new building wake diffusion model. This paper describes the new building wake model and compares it with other models. 8 refs., 2 figs

  4. Pulse splitting in nonlinear media with anisotropic dispersion properties

    DEFF Research Database (Denmark)

    Bergé, L.; Juul Rasmussen, J.; Schmidt, M.R.

    1998-01-01

    The nonlinear self-focusing of beams in media with anisotropic (mix-signed) dispersion is investigated. Theoretical predictions employing virial-type arguments and self-similar techniques suggest that a pulse propagating in a nonlinear medium with anisotropic dispersion will not collapse...

  5. Anisotropic microporous supports impregnated with polymeric ion-exchange materials

    Science.gov (United States)

    Friesen, Dwayne; Babcock, Walter C.; Tuttle, Mark

    1985-05-07

    Novel ion-exchange media are disclosed, the media comprising polymeric anisotropic microporous supports containing polymeric ion-exchange or ion-complexing materials. The supports are anisotropic, having small exterior pores and larger interior pores, and are preferably in the form of beads, fibers and sheets.

  6. Anisotropic Flow Measurements in ALICE at the Large Hadron Collider

    NARCIS (Netherlands)

    Bilandzic, A.

    2012-01-01

    Anisotropic flow is one of the observables which is sensitive to the properties of the created hot and dense system in heavy-ion collisions. In noncentral heavy-ion collisions the initial volume of the interacting system is anisotropic in coordinate space. Due to multiple interactions this anisotropy

  7. Remarks on the relativistic magnetohydrodynamics of an anisotropic fluid

    International Nuclear Information System (INIS)

    Ignat, M.

    1980-01-01

    Considering a pressure tensor of a general form, a relativistic rarefied, anisotropic, infinite electrically conducting and nondissipative plasma is studied. For this purpose, the method of the orthonormal frame of reference is used. The choice of the frame of reference is made adequately to the problem. Some thermodynamical properties of such a relativistic, anisotropic plasma are also given. (author)

  8. Diffusion tensor analysis with nuclear magnetic resonance in human central nervous system

    International Nuclear Information System (INIS)

    Nakayama, Naoki

    1998-01-01

    Nuclear magnetic resonance has been used to measure the diffusivity of water molecules. In central nervous system, anisotropic diffusion, which is characterized by apparent diffusion tensor D app ξ , is thought to be related to neuronal fiber tract orientation. For precise observation of anisotropic diffusion, it is needed to determine the diagonal and off-diagonal elements of D app ξ . Once D app ξ is estimated from a series of diffusion weighted images, a tissue's orthotropic principal axes and diffusivity of each direction are determined from eigenvalues and eigenvectors of D app ξ . There are several methods to represent anisotropic diffusion with D app ξ . Examples are diffusion ellipsoids constructed in each voxel depicting both these principal axes and the mean diffusion length in these directions, trace invariant values and its mapping image, largest eigenvalue, and ratio of largest eigenvalue to the other eigenvalue. In this study, the author investigated practical procedure to analyze diffusion tensor D app ξ using both of spin-echo end echo-planer diffusion weighted imagings with 3-tesla magnetic resonance machine in human brain. The ellipsoid representation provided particularly useful information about microanatomy including neuronal fiber tract orientation and molecular mobility reflective of microstructure. Furthermore, in the lesion of Wallerian degeneration, the loss of anisotropy of local apparent diffusion was observed. It is suggested that the function of axons can be observed via degree of anisotropy of apparent diffusion. Consequently, diffusion tensor analysis is expected to be a powerful, noninvasive method capable of quantitative and functional evaluation of the central nervous system. (author)

  9. Anisotropic conductivity imaging with MREIT using equipotential projection algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Degirmenci, Evren [Department of Electrical and Electronics Engineering, Mersin University, Mersin (Turkey); Eyueboglu, B Murat [Department of Electrical and Electronics Engineering, Middle East Technical University, 06531, Ankara (Turkey)

    2007-12-21

    Magnetic resonance electrical impedance tomography (MREIT) combines magnetic flux or current density measurements obtained by magnetic resonance imaging (MRI) and surface potential measurements to reconstruct images of true conductivity with high spatial resolution. Most of the biological tissues have anisotropic conductivity; therefore, anisotropy should be taken into account in conductivity image reconstruction. Almost all of the MREIT reconstruction algorithms proposed to date assume isotropic conductivity distribution. In this study, a novel MREIT image reconstruction algorithm is proposed to image anisotropic conductivity. Relative anisotropic conductivity values are reconstructed iteratively, using only current density measurements without any potential measurement. In order to obtain true conductivity values, only either one potential or conductivity measurement is sufficient to determine a scaling factor. The proposed technique is evaluated on simulated data for isotropic and anisotropic conductivity distributions, with and without measurement noise. Simulation results show that the images of both anisotropic and isotropic conductivity distributions can be reconstructed successfully.

  10. Characterization of Anisotropic Behavior for High Grade Pipes

    Science.gov (United States)

    Yang, Kun; Huo, Chunyong; Ji, Lingkang; Li, Yang; Zhang, Jiming; Ma, Qiurong

    With the developing requirement of nature gas, the property needs of steel for pipe line are higher and higher, especially in strength and toughness. It is necessary to improve the steel grade in order to ensure economic demand and safety. However, with the rise of steel grade, the differences on properties in different orientations (anisotropic behaviors) become more and more obvious after the process of hot rolling, which may affect the prediction of fracture for the pipes seriously (Thinking of isotropic mechanical properties for material in traditional predict way). In order to get the reason for anisotropic mechanics, a series of tests are carried out for high grade steel pipes, including not only mechanical properties but also microstructures. Result indicates that there are obviously anisotropic behaviors for high grade steel pipes in two orientations (rolling orientation and transverse orientation). Strength is better in T orientation because Rm is higher and Rt 0.5 rises more in T orientation, and toughness is better in L orientation because of the higher Akv and SA in L orientation under a same temperature. Banded structures are formed in T orientation, and the spatial distribution of inclusion and precipitated phases are different in T, L and S orientation. The anisotropic arrangement for the matrix in space (banded structures), which is formed after the process of hot rolling, may affect the mechanical properties in different orientation. Moreover, the elasticity modulus of particles is different from the elasticity modulus of matrix, deformation between particles and matrix may cause stress concentration, and damage forms in this place. Because of the different distribution of particles in space, the level of damage is anisotropic in different orientations, and the anisotropic mechanical properties occur finally. Therefore, the anisotropic mechanical properties are determined by the anisotropic microstructures, both the anisotropic of matrix and the

  11. Diffusion bonding

    International Nuclear Information System (INIS)

    Anderson, R.C.

    1976-01-01

    A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

  12. Mechanical, Anisotropic, and Electronic Properties of XN (X = C, Si, Ge): Theoretical Investigations.

    Science.gov (United States)

    Ma, Zhenyang; Liu, Xuhong; Yu, Xinhai; Shi, Chunlei; Wang, Dayun

    2017-08-08

    The structural, mechanical, elastic anisotropic, and electronic properties of Pbca -XN (X = C, Si, Ge) are investigated in this work using the Perdew-Burke-Ernzerhof (PBE) functional, Perdew-Burke-Ernzerhof for solids (PBEsol) functional, and Ceperly and Alder, parameterized by Perdew and Zunger (CA-PZ) functional in the framework of density functional theory. The achieved results for the lattice parameters and band gap of Pbca -CN with the PBE functional in this research are in good accordance with other theoretical results. The band structures of Pbca -XN (X = C, Si, Ge) show that Pbca -SiN and Pbca -GeN are both direct band gap semiconductor materials with a band gap of 3.39 eV and 2.22 eV, respectively. Pbca -XN (X = C, Si, Ge) exhibits varying degrees of mechanical anisotropic properties with respect to the Poisson's ratio, bulk modulus, shear modulus, Young's modulus, and universal anisotropic index. The (001) plane and (010) plane of Pbca -CN/SiN/GeN both exhibit greater elastic anisotropy in the bulk modulus and Young's modulus than the (100) plane.

  13. Mechanical, Anisotropic, and Electronic Properties of XN (X = C, Si, Ge): Theoretical Investigations

    Science.gov (United States)

    Ma, Zhenyang; Liu, Xuhong; Yu, Xinhai; Shi, Chunlei; Wang, Dayun

    2017-01-01

    The structural, mechanical, elastic anisotropic, and electronic properties of Pbca-XN (X = C, Si, Ge) are investigated in this work using the Perdew–Burke–Ernzerhof (PBE) functional, Perdew–Burke–Ernzerhof for solids (PBEsol) functional, and Ceperly and Alder, parameterized by Perdew and Zunger (CA–PZ) functional in the framework of density functional theory. The achieved results for the lattice parameters and band gap of Pbca-CN with the PBE functional in this research are in good accordance with other theoretical results. The band structures of Pbca-XN (X = C, Si, Ge) show that Pbca-SiN and Pbca-GeN are both direct band gap semiconductor materials with a band gap of 3.39 eV and 2.22 eV, respectively. Pbca-XN (X = C, Si, Ge) exhibits varying degrees of mechanical anisotropic properties with respect to the Poisson’s ratio, bulk modulus, shear modulus, Young’s modulus, and universal anisotropic index. The (001) plane and (010) plane of Pbca-CN/SiN/GeN both exhibit greater elastic anisotropy in the bulk modulus and Young’s modulus than the (100) plane. PMID:28786960

  14. Multipassage diffuser

    International Nuclear Information System (INIS)

    Lalis, A.; Rouviere, R.; Simon, G.

    1976-01-01

    A multipassage diffuser having 2p passages comprises a leak-tight cylindrical enclosure closed by a top cover and a bottom end-wall, parallel porous tubes which are rigidly assembled in sectors between tube plates and through which the gas mixture flows, the tube sectors being disposed at uniform intervals on the periphery of the enclosure. The top tube plates are rigidly fixed to an annular header having the shape of a half-torus and adapted to communicate with the tubes of the corresponding sector. Each passage is constituted by a plurality of juxtaposed sectors in which the mixture circulates in the same direction, the header being divided into p portions limited by radial partition-walls and each constituting two adjacent passages. The diffuser is provided beneath the bottom end-wall with p-1 leak-tight chambers each adapted to open into two different portions of the header, and with two collector-chambers each fitted with a nozzle for introducing the gas mixture and discharging the fraction of the undiffused mixture. By means of a central orifice formed in the bottom end-wall the enclosure communicates with a shaft for discharging the diffused fraction of the gas mixture

  15. Anisotropic phenomena in gauge/gravity duality

    International Nuclear Information System (INIS)

    Zeller, Hansjoerg

    2014-01-01

    In this thesis we use gauge/gravity duality to model anisotropic effects realised in nature. Firstly we analyse transport properties in holographic systems with a broken rotational invariance. Secondly we discuss geometries dual to IR fixed points with anisotropic scaling behaviour, which are related to quantum critical points in condensed matter systems. Gauge/gravity duality relates a gravity theory in Anti-de Sitter space to a lower dimensional strongly coupled quantum field theory in Minkowski space. Over the past decade this duality provided many insights into systems at strong coupling, e.g. quark-gluon plasma and condensed matter close to quantum critical points. One very important result computed in this framework is the value of the shear viscosity divided by the entropy density in strongly coupled theories. The quantitative result agrees very well with measurements of the ratio in quark-gluon plasma. However, for isotropic two derivative Einstein gravity it is temperature independent. We show that by breaking the rotational symmetry of a system we obtain a temperature dependent shear viscosity over entropy density. This is important to make contact with real world systems, since substances in nature display such dependence. In addition, we derive various transport properties in strongly coupled anisotropic systems using the gauge/gravity dictionary. The most notable results include an electrical conductivity with Drude behaviour in the low frequency region. This resembles conductors with broken translational invariance. However, we did not implement the breaking explicitly. Furthermore, our analysis shows that this setup models effects, resembling the piezoelectric and exoelectric effects, known from liquid crystals. In a second project we discuss a geometry with non-trivial scaling behaviour in order to model an IR fixed point of condensed matter theories. We construct the UV completion of this geometry and analyse its properties by computing the

  16. Anisotropic phenomena in gauge/gravity duality

    Energy Technology Data Exchange (ETDEWEB)

    Zeller, Hansjoerg

    2014-05-26

    In this thesis we use gauge/gravity duality to model anisotropic effects realised in nature. Firstly we analyse transport properties in holographic systems with a broken rotational invariance. Secondly we discuss geometries dual to IR fixed points with anisotropic scaling behaviour, which are related to quantum critical points in condensed matter systems. Gauge/gravity duality relates a gravity theory in Anti-de Sitter space to a lower dimensional strongly coupled quantum field theory in Minkowski space. Over the past decade this duality provided many insights into systems at strong coupling, e.g. quark-gluon plasma and condensed matter close to quantum critical points. One very important result computed in this framework is the value of the shear viscosity divided by the entropy density in strongly coupled theories. The quantitative result agrees very well with measurements of the ratio in quark-gluon plasma. However, for isotropic two derivative Einstein gravity it is temperature independent. We show that by breaking the rotational symmetry of a system we obtain a temperature dependent shear viscosity over entropy density. This is important to make contact with real world systems, since substances in nature display such dependence. In addition, we derive various transport properties in strongly coupled anisotropic systems using the gauge/gravity dictionary. The most notable results include an electrical conductivity with Drude behaviour in the low frequency region. This resembles conductors with broken translational invariance. However, we did not implement the breaking explicitly. Furthermore, our analysis shows that this setup models effects, resembling the piezoelectric and exoelectric effects, known from liquid crystals. In a second project we discuss a geometry with non-trivial scaling behaviour in order to model an IR fixed point of condensed matter theories. We construct the UV completion of this geometry and analyse its properties by computing the

  17. Modelling anisotropic water transport in polymer composite ...

    Indian Academy of Sciences (India)

    Parameters for Fickian diffusion and polymer relaxation models were determined by .... Water transport process of resin and polymer composite specimens at ..... simulation. ... Kwon Y W and Bang H 1997 Finite element method using matlab.

  18. Anisotropic bias dependent transport property of defective phosphorene layer

    Science.gov (United States)

    Umar Farooq, M.; Hashmi, Arqum; Hong, Jisang

    2015-01-01

    Phosphorene is receiving great research interests because of its peculiar physical properties. Nonetheless, no systematic studies on the transport properties modified due to defects have been performed. Here, we present the electronic band structure, defect formation energy and bias dependent transport property of various defective systems. We found that the defect formation energy is much less than that in graphene. The defect configuration strongly affects the electronic structure. The band gap vanishes in single vacancy layers, but the band gap reappears in divacancy layers. Interestingly, a single vacancy defect behaves like a p-type impurity for transport property. Unlike the common belief, we observe that the vacancy defect can contribute to greatly increasing the current. Along the zigzag direction, the current in the most stable single vacancy structure was significantly increased as compared with that found in the pristine layer. In addition, the current along the armchair direction was always greater than along the zigzag direction and we observed a strong anisotropic current ratio of armchair to zigzag direction. PMID:26198318

  19. Ultra-wideband reflective polarization converter based on anisotropic metasurface

    Science.gov (United States)

    Wu, Jia-Liang; Lin, Bao-Qin; Da, Xin-Yu

    2016-08-01

    In this paper, we propose an ultra-wideband reflective linear cross-polarization converter based on anisotropic metasurface. Its unit cell is composed of a square-shaped resonator with intersectant diagonal and metallic ground sheet separated by dielectric substrate. Simulated results show that the converter can generate resonances at four frequencies under normal incident electromagnetic (EM) wave, leading to the bandwidth expansion of cross-polarization reflection. For verification, the designed polarization converter is fabricated and measured. The measured and simulated results agree well with each other, showing that the fabricated converter can convert x- or y-polarized incident wave into its cross polarized wave in a frequency range from 7.57 GHz to 20.46 GHz with a relative bandwidth of 91.2%, and the polarization conversion efficiency is greater than 90%. The proposed polarization converter has a simple geometry but an ultra wideband compared with the published designs, and hence possesses potential applications in novel polarization-control devices. Project supported by the National Natural Science Foundation of China (Grant Nos. 61471387, 61271250, and 61571460).

  20. Ultra-wideband reflective polarization converter based on anisotropic metasurface

    International Nuclear Information System (INIS)

    Wu Jia-Liang; Lin Bao-Qin; Da Xin-Yu

    2016-01-01

    In this paper, we propose an ultra-wideband reflective linear cross-polarization converter based on anisotropic metasurface. Its unit cell is composed of a square-shaped resonator with intersectant diagonal and metallic ground sheet separated by dielectric substrate. Simulated results show that the converter can generate resonances at four frequencies under normal incident electromagnetic (EM) wave, leading to the bandwidth expansion of cross-polarization reflection. For verification, the designed polarization converter is fabricated and measured. The measured and simulated results agree well with each other, showing that the fabricated converter can convert x - or y -polarized incident wave into its cross polarized wave in a frequency range from 7.57 GHz to 20.46 GHz with a relative bandwidth of 91.2%, and the polarization conversion efficiency is greater than 90%. The proposed polarization converter has a simple geometry but an ultra wideband compared with the published designs, and hence possesses potential applications in novel polarization-control devices. (paper)

  1. Experimental evidence for anisotropic double exchange interaction driven anisotropic transport in manganite heterostructures

    NARCIS (Netherlands)

    Liao, Zhaoliang; Koster, Gertjan; Huijben, Mark; Rijnders, A.J.H.M.

    2017-01-01

    An anisotropic double exchange interaction driven giant transport anisotropy is demonstrated in a canonic double exchange system of La2/3Sr1/3MnO3 ultrathin films epitaxially grown on NdGaO3 (110) substrates. The oxygen octahedral coupling at the La2/3Sr1/3MnO3/NdGaO3 interface induces a planar

  2. Turbulent Output-Based Anisotropic Adaptation

    Science.gov (United States)

    Park, Michael A.; Carlson, Jan-Renee

    2010-01-01

    Controlling discretization error is a remaining challenge for computational fluid dynamics simulation. Grid adaptation is applied to reduce estimated discretization error in drag or pressure integral output functions. To enable application to high O(10(exp 7)) Reynolds number turbulent flows, a hybrid approach is utilized that freezes the near-wall boundary layer grids and adapts the grid away from the no slip boundaries. The hybrid approach is not applicable to problems with under resolved initial boundary layer grids, but is a powerful technique for problems with important off-body anisotropic features. Supersonic nozzle plume, turbulent flat plate, and shock-boundary layer interaction examples are presented with comparisons to experimental measurements of pressure and velocity. Adapted grids are produced that resolve off-body features in locations that are not known a priori.

  3. Long-range interaction of anisotropic systems

    KAUST Repository

    Zhang, Junyi

    2015-02-01

    The first-order electrostatic interaction energy between two far-apart anisotropic atoms depends not only on the distance between them but also on their relative orientation, according to Rayleigh-Schrödinger perturbation theory. Using the first-order interaction energy and the continuum model, we study the long-range interaction between a pair of parallel pristine graphene sheets at zero temperature. The asymptotic form of the obtained potential density, &epsi:(D) &prop: ?D ?3 ?O(D?4), is consistent with the random phase approximation and Lifshitz theory. Accordingly, neglectance of the anisotropy, especially the nonzero first-order interaction energy, is the reason why the widely used Lennard-Jones potential approach and dispersion corrections in density functional theory give a wrong asymptotic form ε(D) &prop: ?D?4. © EPLA, 2015.

  4. Spectral functions from anisotropic lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Aarts, G.; Allton, C. [Department of Physics, Swansea University, Swansea SA2 8PP, Wales (United Kingdom); Amato, A. [Helsinki Institute of Physics and University of Helsinki, Helsinki (Finland); Evans, W. [Albert Einstein Center for Fundamental Physics, Institute for Theoretical Physics Universitat Bern, Sidlerstrasse 5, CH-3012 Bern (Switzerland); Giudice, P. [Institut für Theoretische Physik, Universität Münster, D–48149 Münster (Germany); Harris, T. [School of Mathematics, Trinity College, Dublin 2 (Ireland); Kelly, A. [Department of Mathematical Physics, Maynooth University, Maynooth, Co Kildare (Ireland); Kim, S.Y. [Department of Physics, Sejong University, Seoul 143-747 (Korea, Republic of); Lombardo, M.P. [INFN–Laboratori Nazionali di Frascati, I–00044 Frascati (RM) (Italy); Praki, K. [Department of Physics, Swansea University, Swansea SA2 8PP, Wales (United Kingdom); Ryan, S.M. [School of Mathematics, Trinity College, Dublin 2 (Ireland); Skullerud, J.-I. [Department of Mathematical Physics, Maynooth University, Maynooth, Co Kildare (Ireland)

    2016-12-15

    The FASTSUM collaboration has been carrying out lattice simulations of QCD for temperatures ranging from one third to twice the crossover temperature, investigating the transition region, as well as the properties of the Quark Gluon Plasma. In this contribution we concentrate on quarkonium correlators and spectral functions. We work in a fixed scale scheme and use anisotropic lattices which help achieving the desirable fine resolution in the temporal direction, thus facilitating the (ill posed) integral transform from imaginary time to frequency space. We contrast and compare results for the correlators obtained with different methods, and different temporal spacings. We observe robust features of the results, confirming the sequential dissociation scenario, but also quantitative differences indicating that the methods' systematic errors are not yet under full control. We briefly outline future steps towards accurate results for the spectral functions and their associated statistical and systematic errors.

  5. Long-range interaction of anisotropic systems

    KAUST Repository

    Zhang, Junyi; Schwingenschlö gl, Udo

    2015-01-01

    The first-order electrostatic interaction energy between two far-apart anisotropic atoms depends not only on the distance between them but also on their relative orientation, according to Rayleigh-Schrödinger perturbation theory. Using the first-order interaction energy and the continuum model, we study the long-range interaction between a pair of parallel pristine graphene sheets at zero temperature. The asymptotic form of the obtained potential density, &epsi:(D) &prop: ?D ?3 ?O(D?4), is consistent with the random phase approximation and Lifshitz theory. Accordingly, neglectance of the anisotropy, especially the nonzero first-order interaction energy, is the reason why the widely used Lennard-Jones potential approach and dispersion corrections in density functional theory give a wrong asymptotic form ε(D) &prop: ?D?4. © EPLA, 2015.

  6. Inverse anisotropic conductivity from internal current densities

    International Nuclear Information System (INIS)

    Bal, Guillaume; Guo, Chenxi; Monard, François

    2014-01-01

    This paper concerns the reconstruction of a fully anisotropic conductivity tensor γ from internal current densities of the form J = γ∇u, where u solves a second-order elliptic equation ∇ · (γ∇u) = 0 on a bounded domain X with prescribed boundary conditions. A minimum number of n + 2 such functionals known on Y⊂X, where n is the spatial dimension, is sufficient to guarantee a unique and explicit reconstruction of γ locally on Y. Moreover, we show that γ is reconstructed with a loss of one derivative compared to errors in the measurement of J in the general case and no loss of derivatives in the special case where γ is scalar. We also describe linear combinations of mixed partial derivatives of γ that exhibit better stability properties and hence can be reconstructed with better resolution in practice. (paper)

  7. Stability of anisotropic beams with space charge

    International Nuclear Information System (INIS)

    Hofmann, I.

    1997-07-01

    We calculate coherent frequencies and stability properties of anisotropic or ''non-equipartitioned'' beams with different focusing constants and emittances in the two transverse directions. Based on the self-consistent Vlasov-Poisson equations the dispersion relations of transverse multipole oscillations with quadrupolar, sextupolar and octupolar symmetry are solved numerically. The eigenfrequencies give the coherent space charge tune shift for linear or nonlinear resonances in circular accelerators. We find that for sufficiently large energy anisotropy some of the eigenmodes become unstable in the space-charge-dominated regime. The properties of these anisotropy instabilities are used to show that ''non-equipartitioned'' beams can be tolerated in high-current linear accelerators. It is only in beams with strongly space-charge-depressed betatron tunes where harmful instabilities leading to emittance exchange should be expected. (orig.)

  8. Anisotropic thermal expansion in flexible materials

    Science.gov (United States)

    Romao, Carl P.

    2017-10-01

    A definition of the Grüneisen parameters for anisotropic materials is derived based on the response of phonon frequencies to uniaxial stress perturbations. This Grüneisen model relates the thermal expansion in a given direction (αi i) to one element of the elastic compliance tensor, which corresponds to the Young's modulus in that direction (Yi i). The model is tested through ab initio prediction of thermal expansion in zinc, graphite, and calcite using density functional perturbation theory, indicating that it could lead to increased accuracy for structurally complex systems. The direct dependence of αi i on Yi i suggests that materials which are flexible along their principal axes but rigid in other directions will generally display both positive and negative thermal expansion.

  9. Effective stress law for anisotropic elastic deformation

    International Nuclear Information System (INIS)

    Carroll, M.M.

    1979-01-01

    An effective stress law is derived analytically to describe the effect of pore fluid pressure on the linearly elastic response of saturated porous rocks which exhibit anisotropy. For general anisotropy the difference between the effective stress and the applied stress is not hydrostatic. The effective stress law involves two constants for transversely isotropic response and three constants for orthotropic response; these constants can be expressed in terms of the moduli of the porous material and of the solid material. These expressions simplify considerably when the anisotropy is structural rather than intrinsic, i.e., in the case of an isotropic solid material with an anisotropic pore structure. In this case the effective stress law involves the solid or grain bulk modulus and two or three moduli of the porous material, for transverse isotropy and orthotropy, respectively. The law reduces, in the case of isotropic response, to that suggested by Geertsma (1957) and by Skempton (1961) and derived analytically by Nur and Byerlee

  10. Analytical study of anisotropic compact star models

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, B.V. [Bulgarian Academy of Science, Institute for Nuclear Research and Nuclear Energy, Sofia (Bulgaria)

    2017-11-15

    A simple classification is given of the anisotropic relativistic star models, resembling the one of charged isotropic solutions. On the ground of this database, and taking into account the conditions for physically realistic star models, a method is proposed for generating all such solutions. It is based on the energy density and the radial pressure as seeding functions. Numerous relations between the realistic conditions are found and the need for a graphic proof is reduced just to one pair of inequalities. This general formalism is illustrated with an example of a class of solutions with linear equation of state and simple energy density. It is found that the solutions depend on three free constants and concrete examples are given. Some other popular models are studied with the same method. (orig.)

  11. Derivation of the optical constants of anisotropic

    Science.gov (United States)

    Aronson, J. R.; Emslie, A. G.; Smith, E. M.; Strong, P. F.

    1985-07-01

    This report concerns the development of methods for obtaining the optical constants of anisotropic crystals of the triclinic and monoclinic systems. The principal method used, classical dispersion theory, is adapted to these crystal systems by extending the Lorentz line parameters to include the angles characterizing the individual resonances, and by replacing the dielectric constant by a dielectric tensor. The sample crystals are gypsium, orthoclase and chalcanthite. The derived optical constants are shown to be suitable for modeling the optical properties of particulate media in the infrared spectral region. For those materials where suitable size single crystals are not available, an extension of a previously used method is applied to alabaster, a polycrystalline material of the monoclinic crystal system.

  12. Anisotropic dynamic mass density for fluidsolid composites

    KAUST Repository

    Wu, Ying

    2012-10-01

    By taking the low frequency limit of multiple-scattering theory, we obtain the dynamic effective mass density of fluidsolid composites with a two-dimensional rectangular lattice structure. The anisotropic mass density can be described by an angle-dependent dipole solution, to the leading-order of solid concentration. The angular dependence vanishes for the square lattice, but at high solid concentrations there is a structure-dependent factor that contributes to the leading-order solution. In all cases, Woods formula is found to be accurately valid for the effective bulk modulus, independent of the structures. Numerical evaluations from the solutions are shown to be in excellent agreement with finite-element simulations. © 2012 Elsevier B.V.

  13. An Anisotropic Hardening Model for Springback Prediction

    Science.gov (United States)

    Zeng, Danielle; Xia, Z. Cedric

    2005-08-01

    As more Advanced High-Strength Steels (AHSS) are heavily used for automotive body structures and closures panels, accurate springback prediction for these components becomes more challenging because of their rapid hardening characteristics and ability to sustain even higher stresses. In this paper, a modified Mroz hardening model is proposed to capture realistic Bauschinger effect at reverse loading, such as when material passes through die radii or drawbead during sheet metal forming process. This model accounts for material anisotropic yield surface and nonlinear isotropic/kinematic hardening behavior. Material tension/compression test data are used to accurately represent Bauschinger effect. The effectiveness of the model is demonstrated by comparison of numerical and experimental springback results for a DP600 straight U-channel test.

  14. An Anisotropic Hardening Model for Springback Prediction

    International Nuclear Information System (INIS)

    Zeng, Danielle; Xia, Z. Cedric

    2005-01-01

    As more Advanced High-Strength Steels (AHSS) are heavily used for automotive body structures and closures panels, accurate springback prediction for these components becomes more challenging because of their rapid hardening characteristics and ability to sustain even higher stresses. In this paper, a modified Mroz hardening model is proposed to capture realistic Bauschinger effect at reverse loading, such as when material passes through die radii or drawbead during sheet metal forming process. This model accounts for material anisotropic yield surface and nonlinear isotropic/kinematic hardening behavior. Material tension/compression test data are used to accurately represent Bauschinger effect. The effectiveness of the model is demonstrated by comparison of numerical and experimental springback results for a DP600 straight U-channel test

  15. Anisotropic magnetism in field-structured composites

    International Nuclear Information System (INIS)

    Martin, James E.; Venturini, Eugene; Odinek, Judy; Anderson, Robert A.

    2000-01-01

    Magnetic field-structured composites (FSCs) are made by structuring magnetic particle suspensions in uniaxial or biaxial (e.g., rotating) magnetic fields, while polymerizing the suspending resin. A uniaxial field produces chainlike particle structures, and a biaxial field produces sheetlike particle structures. In either case, these anisotropic structures affect the measured magnetic hysteresis loops, with the magnetic remanence and susceptibility increased significantly along the axis of the structuring field, and decreased slightly orthogonal to the structuring field, relative to the unstructured particle composite. The coercivity is essentially unaffected by structuring. We present data for FSCs of magnetically soft particles, and demonstrate that the altered magnetism can be accounted for by considering the large local fields that occur in FSCs. FSCs of magnetically hard particles show unexpectedly large anisotropies in the remanence, and this is due to the local field effects in combination with the large crystalline anisotropy of this material. (c) 2000 The American Physical Society

  16. Isotropic and anisotropic surface wave cloaking techniques

    International Nuclear Information System (INIS)

    McManus, T M; Spada, L La; Hao, Y

    2016-01-01

    In this paper we compare two different approaches for surface waves cloaking. The first technique is a unique application of Fermat’s principle and requires isotropic material properties, but owing to its derivation is limited in its applicability. The second technique utilises a geometrical optics approximation for dealing with rays bound to a two dimensional surface and requires anisotropic material properties, though it can be used to cloak any smooth surface. We analytically derive the surface wave scattering behaviour for both cloak techniques when applied to a rotationally symmetric surface deformation. Furthermore, we simulate both using a commercially available full-wave electromagnetic solver and demonstrate a good level of agreement with their analytically derived solutions. Our analytical solutions and simulations provide a complete and concise overview of two different surface wave cloaking techniques. (paper)

  17. Isotropic and anisotropic surface wave cloaking techniques

    Science.gov (United States)

    McManus, T. M.; La Spada, L.; Hao, Y.

    2016-04-01

    In this paper we compare two different approaches for surface waves cloaking. The first technique is a unique application of Fermat’s principle and requires isotropic material properties, but owing to its derivation is limited in its applicability. The second technique utilises a geometrical optics approximation for dealing with rays bound to a two dimensional surface and requires anisotropic material properties, though it can be used to cloak any smooth surface. We analytically derive the surface wave scattering behaviour for both cloak techniques when applied to a rotationally symmetric surface deformation. Furthermore, we simulate both using a commercially available full-wave electromagnetic solver and demonstrate a good level of agreement with their analytically derived solutions. Our analytical solutions and simulations provide a complete and concise overview of two different surface wave cloaking techniques.

  18. Recent developments in anisotropic heterogeneous shell theory

    CERN Document Server

    Grigorenko, Alexander Ya; Grigorenko, Yaroslav M; Vlaikov, Georgii G

    2016-01-01

    This volume focuses on the relevant general theory and presents some first applications, namely those based on classical shell theory. After a brief introduction, during which the history and state-of-the-art are discussed, the first chapter presents the mechanics of anisotropic heterogeneous shells, covering all relevant assumptions and the basic relations of 3D elasticity, classical and refined shell models. The second chapter examines the numerical techniques that are used, namely discrete orthogonalization, spline-collocation and Fourier series, while the third highlights applications based on classical theory, in particular, the stress-strain state of shallow shells, non-circular shells, shells of revolution, and free vibrations of conical shells. The book concludes with a summary and an outlook bridging the gap to the second volume.

  19. Efficient analysis of macromolecular rotational diffusion from heteronuclear relaxation data

    International Nuclear Information System (INIS)

    Dosset, Patrice; Hus, Jean-Christophe; Blackledge, Martin; Marion, Dominique

    2000-01-01

    A novel program has been developed for the interpretation of 15 N relaxation rates in terms of macromolecular anisotropic rotational diffusion. The program is based on a highly efficient simulated annealing/minimization algorithm, designed specifically to search the parametric space described by the isotropic, axially symmetric and fully anisotropic rotational diffusion tensor models. The high efficiency of this algorithm allows extensive noise-based Monte Carlo error analysis. Relevant statistical tests are systematically applied to provide confidence limits for the proposed tensorial models. The program is illustrated here using the example of the cytochrome c' from Rhodobacter capsulatus, a four-helix bundle heme protein, for which data at three different field strengths were independently analysed and compared

  20. Effective orthorhombic anisotropic models for wavefield extrapolation

    KAUST Repository

    Ibanez-Jacome, W.

    2014-07-18

    Wavefield extrapolation in orthorhombic anisotropic media incorporates complicated but realistic models to reproduce wave propagation phenomena in the Earth\\'s subsurface. Compared with the representations used for simpler symmetries, such as transversely isotropic or isotropic, orthorhombic models require an extended and more elaborated formulation that also involves more expensive computational processes. The acoustic assumption yields more efficient description of the orthorhombic wave equation that also provides a simplified representation for the orthorhombic dispersion relation. However, such representation is hampered by the sixth-order nature of the acoustic wave equation, as it also encompasses the contribution of shear waves. To reduce the computational cost of wavefield extrapolation in such media, we generate effective isotropic inhomogeneous models that are capable of reproducing the firstarrival kinematic aspects of the orthorhombic wavefield. First, in order to compute traveltimes in vertical orthorhombic media, we develop a stable, efficient and accurate algorithm based on the fast marching method. The derived orthorhombic acoustic dispersion relation, unlike the isotropic or transversely isotropic ones, is represented by a sixth order polynomial equation with the fastest solution corresponding to outgoing P waves in acoustic media. The effective velocity models are then computed by evaluating the traveltime gradients of the orthorhombic traveltime solution, and using them to explicitly evaluate the corresponding inhomogeneous isotropic velocity field. The inverted effective velocity fields are source dependent and produce equivalent first-arrival kinematic descriptions of wave propagation in orthorhombic media. We extrapolate wavefields in these isotropic effective velocity models using the more efficient isotropic operator, and the results compare well, especially kinematically, with those obtained from the more expensive anisotropic extrapolator.

  1. Radial stability of anisotropic strange quark stars

    Energy Technology Data Exchange (ETDEWEB)

    Arbañil, José D.V.; Malheiro, M., E-mail: jose.arbanil@upn.pe, E-mail: malheiro@ita.br [ITA—Instituto Tecnológico de Aeronáutica—Departamento de Física, 12228-900, São José dos Campos, São Paulo (Brazil)

    2016-11-01

    The influence of the anisotropy in the equilibrium and stability of strange stars is investigated through the numerical solution of the hydrostatic equilibrium equation and the radial oscillation equation, both modified from their original version to include this effect. The strange matter inside the quark stars is described by the MIT bag model equation of state. For the anisotropy two different kinds of local anisotropic σ = p {sub t} − p {sub r} are considered, where p {sub t} and p {sub r} are respectively the tangential and the radial pressure: one that is null at the star's surface defined by p {sub r} ( R ) = 0, and one that is nonnull at the surface, namely, σ {sub s} = 0 and σ {sub s} {sub ≠} {sub 0}. In the case σ {sub s} = 0, the maximum mass value and the zero frequency of oscillation are found at the same central energy density, indicating that the maximum mass marks the onset of the instability. For the case σ {sub s} {sub ≠} {sub 0}, we show that the maximum mass point and the zero frequency of oscillation coincide in the same central energy density value only in a sequence of equilibrium configurations with the same value of σ {sub s} . Thus, the stability star regions are determined always by the condition dM / d ρ {sub c} {sub >} {sub 0} only when the tangential pressure is maintained fixed at the star surface's p {sub t} ( R ). These results are also quite important to analyze the stability of other anisotropic compact objects such as neutron stars, boson stars and gravastars.

  2. Effective orthorhombic anisotropic models for wavefield extrapolation

    KAUST Repository

    Ibanez-Jacome, W.; Alkhalifah, Tariq Ali; Waheed, Umair bin

    2014-01-01

    Wavefield extrapolation in orthorhombic anisotropic media incorporates complicated but realistic models to reproduce wave propagation phenomena in the Earth's subsurface. Compared with the representations used for simpler symmetries, such as transversely isotropic or isotropic, orthorhombic models require an extended and more elaborated formulation that also involves more expensive computational processes. The acoustic assumption yields more efficient description of the orthorhombic wave equation that also provides a simplified representation for the orthorhombic dispersion relation. However, such representation is hampered by the sixth-order nature of the acoustic wave equation, as it also encompasses the contribution of shear waves. To reduce the computational cost of wavefield extrapolation in such media, we generate effective isotropic inhomogeneous models that are capable of reproducing the firstarrival kinematic aspects of the orthorhombic wavefield. First, in order to compute traveltimes in vertical orthorhombic media, we develop a stable, efficient and accurate algorithm based on the fast marching method. The derived orthorhombic acoustic dispersion relation, unlike the isotropic or transversely isotropic ones, is represented by a sixth order polynomial equation with the fastest solution corresponding to outgoing P waves in acoustic media. The effective velocity models are then computed by evaluating the traveltime gradients of the orthorhombic traveltime solution, and using them to explicitly evaluate the corresponding inhomogeneous isotropic velocity field. The inverted effective velocity fields are source dependent and produce equivalent first-arrival kinematic descriptions of wave propagation in orthorhombic media. We extrapolate wavefields in these isotropic effective velocity models using the more efficient isotropic operator, and the results compare well, especially kinematically, with those obtained from the more expensive anisotropic extrapolator.

  3. Study on diffusion anisotropy of cerebral ischemia using diffusion weighted echo-planar MRI

    International Nuclear Information System (INIS)

    Kajima, Toshio

    1997-01-01

    Focal cerebral ischemia was produced by occlusion of the intracranial main cerebral artery with a silicone cylinder in Wistar rats. Diffusion-weighted echo-planar images (DW-EPls) using the motion-probing gradient (MPG) method were acquired at 1-3 hours and 24-48 hours after occlusion. Apparent diffusion coefficients (ADCs) were calculated from these images in ischemic lesions and in normal unoccluded regions. Results were as follows. Ischemic lesions could be detected on the DW-EPIs at 1 hour after occlusion. The ADC of water in the brain tissue was smaller than that of free water as a result of restricted diffusion. Anisotropic diffusion that probably can be attributed to the myelin sheath was observed in the normal white matter. In the ischemic lesions, the ADC decreased rapidly within 1-3 hours after occlusion and then decreased gradually after 24-48 hours. In the ischemic white matter, diffusion anisotropy disappeared at 24-48 hours after occlusion. Diffusion-weighted imaging may have applications in the examination of pathophysiological mechanisms in cerebral ischemia by means of evaluation of ADC and diffusion anisotropy. (author)

  4. The accuracy of the diffusion theory component of removal-diffusion theory

    International Nuclear Information System (INIS)

    Donnelly, I.J.

    1976-03-01

    The neutron fluxes in five neutron shields consisting of water, concrete, graphite, iron and an iron-water lattice respectively, have been calculated using P 1 theory, diffusion theory with the usual transport correction for anisotropic scattering (DT), and diffusion theory with a diagonal transport correction (DDT). The calculations have been repeated using transport theory for the flux above 0.5 MeV and the diffusion theories for lower energies. Comparisons with transport theory calculations reveal the accuracy of each diffusion theory when it is used for flux evaluation at all energies, and also its accuracy when used for flux evaluation below 0.5 MeV given the correct flux above 0.5 MeV. It is concluded that the diffusion component of removal-diffusion theory has adequate accuracy unless the high energy diffusion entering the shield is significantly larger than the removal flux. In general, P 1 and DT are more accurate than DDT and give similar fluxes except for shields having a large hydrogen content, in which case DT is better. Therefore it is recommended that DT be used in preference to P 1 theory or DDT. (author)

  5. Tunneling anisotropic magnetoresistance driven by magnetic phase transition.

    Science.gov (United States)

    Chen, X Z; Feng, J F; Wang, Z C; Zhang, J; Zhong, X Y; Song, C; Jin, L; Zhang, B; Li, F; Jiang, M; Tan, Y Z; Zhou, X J; Shi, G Y; Zhou, X F; Han, X D; Mao, S C; Chen, Y H; Han, X F; Pan, F

    2017-09-06

    The independent control of two magnetic electrodes and spin-coherent transport in magnetic tunnel junctions are strictly required for tunneling magnetoresistance, while junctions with only one ferromagnetic electrode exhibit tunneling anisotropic magnetoresistance dependent on the anisotropic density of states with no room temperature performance so far. Here, we report an alternative approach to obtaining tunneling anisotropic magnetoresistance in α'-FeRh-based junctions driven by the magnetic phase transition of α'-FeRh and resultantly large variation of the density of states in the vicinity of MgO tunneling barrier, referred to as phase transition tunneling anisotropic magnetoresistance. The junctions with only one α'-FeRh magnetic electrode show a magnetoresistance ratio up to 20% at room temperature. Both the polarity and magnitude of the phase transition tunneling anisotropic magnetoresistance can be modulated by interfacial engineering at the α'-FeRh/MgO interface. Besides the fundamental significance, our finding might add a different dimension to magnetic random access memory and antiferromagnet spintronics.Tunneling anisotropic magnetoresistance is promising for next generation memory devices but limited by the low efficiency and functioning temperature. Here the authors achieved 20% tunneling anisotropic magnetoresistance at room temperature in magnetic tunnel junctions with one α'-FeRh magnetic electrode.

  6. Quantum diffusion

    International Nuclear Information System (INIS)

    Habib, S.

    1994-01-01

    We consider a simple quantum system subjected to a classical random force. Under certain conditions it is shown that the noise-averaged Wigner function of the system follows an integro-differential stochastic Liouville equation. In the simple case of polynomial noise-couplings this equation reduces to a generalized Fokker-Planck form. With nonlinear noise injection new ''quantum diffusion'' terms rise that have no counterpart in the classical case. Two special examples that are not of a Fokker-Planck form are discussed: the first with a localized noise source and the other with a spatially modulated noise source

  7. Hereditary Diffuse Gastric Cancer

    Science.gov (United States)

    ... Hereditary Diffuse Gastric Cancer Request Permissions Hereditary Diffuse Gastric Cancer Approved by the Cancer.Net Editorial Board , 10/2017 What is hereditary diffuse gastric cancer? Hereditary diffuse gastric cancer (HDGC) is a rare ...

  8. Development of laser ablation plasma by anisotropic self-radiation

    Directory of Open Access Journals (Sweden)

    Ohnishi Naofumi

    2013-11-01

    Full Text Available We have proposed a method for reproducing an accurate solution of low-density ablation plasma by properly treating anisotropic radiation. Monte-Carlo method is employed for estimating Eddington tensor with limited number of photon samples in each fluid time step. Radiation field from ablation plasma is significantly affected by the anisotropic Eddington tensor. Electron temperature around the ablation surface changes with the radiation field and is responsible for the observed emission. An accurate prediction of the light emission from the laser ablation plasma requires a careful estimation of the anisotropic radiation field.

  9. On Pokrovskii's anisotropic gap equations in superconductivity theory

    Science.gov (United States)

    Yang, Yisong

    2003-11-01

    An existence and uniqueness theorem for Pokrovskii's zero-temperature anisotropic gap equation is proved. Furthermore, it is shown that Pokrovskii's finite-temperature equation is inconsistent with the Bardeen-Cooper-Schrieffer (BCS) theory. A reformulation of the anisotropic gap equation is presented along the line of Pokrovskii and it is shown that the new equation is consistent with the BCS theory for the whole temperature range. As an application, the Markowitz-Kadanoff model for anisotropic superconductivity is considered and a rigorous proof of the half-integer-exponent isotope effect is obtained. Furthermore, a sharp estimate of the gap solution near the transition temperature is established.

  10. A Numerical Model of Anisotropic Mass Transport Through Grain Boundary Networks

    Science.gov (United States)

    Wang, Yibo

    Tin (Sn) thin films are commonly used in electronic circuit applications as coatings on contacts and solders for joining components. It is widely observed, for some such system, that whiskers---long, thin crystalline structures---emerge and grow from the film. The Sn whisker phenomenon has become a highly active research area since Sn whiskers have caused a large amount of damage and loss in manufacturing, military, medical and power industries. Though lead (Pb) addition to Sn has been used to solve this problem for over five decades, the adverse environmental and health effects of Pb have motivated legislation to severely constrain Pb use in society. People are researching and seeking the reasons which cause whiskers and corresponding methods to solve the problem. The contributing factors to cause a Sn whisker are potentially many and much still remains unknown. Better understanding of fundamental driving forces should point toward strategies to improve (a) the accuracy with which we can predict whisker formation, and (b) our ability to mitigate the phenomenon. This thesis summarizes recent important research achievements in understanding Sn whisker formation and growth, both experimentally and theoretically. Focus is then placed on examining the role that anisotropy in grain boundary diffusivity plays in determining whisker characteristics (specifically, whether they form and, if so, where on a surface). To study this aspect of the problem and to enable future studies on stress driven grain boundary diffusion, this thesis presents a numerical anisotropic mass transport model. In addition to presenting details of the model and implementation, model predictions for a set of increasingly complex grain boundary networks are discussed. Preliminary results from the model provide evidence that anisotropic grain boundary diffusion may be a primary driving mechanism in whisker formation.

  11. A theory for the anisotropic interaction between two substitutional magnetic impurities and the magnetic anisotropic effect in dilute magnetic alloys

    International Nuclear Information System (INIS)

    Satter, M.A.

    1990-08-01

    In this paper, a formalism for studying the anisotropic interaction between two substitutional magnetic impurities and the magnetic anisotropic effect in a dilute noble metal- transition metal magnetic alloy has been developed from relativistic scattering theory. The theoretical development and the computational techniques of this formalism are based on relativistic spin-polarized scattering theory and relativistic band structure frameworks. For studying the magnetic anisotropic effect a convenient ''working'' frame of reference with its axes oriented along the fcc crystal axes is set up. This formalism is applied to study the situation for two Fe impurities in paramagnetic Au hosts. For AuFe dilute alloy, the two impurity site interaction as a function of separation is not oscillatory and the anisotropic effect is found to be less than the two site interaction itself only by an order of magnitude. Apart from the anisotropic coupling of the two impurity spins to the separation vector, for the first time, another weak anisotropic coupling to the crystal axes is also contained in the two site interaction. These anisotropic effects are the results of the relativistic spin-orbit interaction which are incorporated into the formalism. (author). 22 refs, 5 figs

  12. Quantifying brain microstructure with diffusion MRI

    DEFF Research Database (Denmark)

    Novikov, Dmitry S.; Jespersen, Sune N.; Kiselev, Valerij G.

    2016-01-01

    the potential to quantify the relevant length scales for neuronal tissue, such as the packing correlation length for neuronal fibers, the degree of neuronal beading, and compartment sizes. The second avenue corresponds to the long-time limit, when the observed signal can be approximated as a sum of multiple non......-exchanging anisotropic Gaussian components. Here the challenge lies in parameter estimation and in resolving its hidden degeneracies. The third avenue employs multiple diffusion encoding techniques, able to access information not contained in the conventional diffusion propagator. We conclude with our outlook...... on the future research directions which can open exciting possibilities for developing markers of pathology and development based on methods of studying mesoscopic transport in disordered systems....

  13. Anisotropic nature of radially strained metal tubes

    Science.gov (United States)

    Strickland, Julie N.

    Metal pipes are sometimes swaged by a metal cone to enlarge them, which increases the strain in the material. The amount of strain is important because it affects the burst and collapse strength. Burst strength is the amount of internal pressure that a pipe can withstand before failure, while collapse strength is the amount of external pressure that a pipe can withstand before failure. If the burst or collapse strengths are exceeded, the pipe may fracture, causing critical failure. Such an event could cost the owners and their customers millions of dollars in clean up, repair, and lost time, in addition to the potential environmental damage. Therefore, a reliable way of estimating the burst and collapse strength of strained pipe is desired and valuable. The sponsor currently rates strained pipes using the properties of raw steel, because those properties are easily measured (for example, yield strength). In the past, the engineers assumed that the metal would be work-hardened when swaged, so that yield strength would increase. However, swaging introduces anisotropic strain, which may decrease the yield strength. This study measured the yield strength of strained material in the transverse and axial direction and compared them to raw material, to determine the amount of anisotropy. This information will be used to more accurately determine burst and collapse ratings for strained pipes. More accurate ratings mean safer products, which will minimize risk for the sponsor's customers. Since the strained metal has a higher yield strength than the raw material, using the raw yield strength to calculate burst and collapse ratings is a conservative method. The metal has even higher yield strength after strain aging, which indicates that the stresses are relieved. Even with the 12% anisotropy in the strained and 9% anisotropy in the strain aged specimens, the raw yield strengths are lower and therefore more conservative. I recommend that the sponsor continue using the raw

  14. Timescales of isotropic and anisotropic cluster collapse

    Science.gov (United States)

    Bartelmann, M.; Ehlers, J.; Schneider, P.

    1993-12-01

    From a simple estimate for the formation time of galaxy clusters, Richstone et al. have recently concluded that the evidence for non-virialized structures in a large fraction of observed clusters points towards a high value for the cosmological density parameter Omega0. This conclusion was based on a study of the spherical collapse of density perturbations, assumed to follow a Gaussian probability distribution. In this paper, we extend their treatment in several respects: first, we argue that the collapse does not start from a comoving motion of the perturbation, but that the continuity equation requires an initial velocity perturbation directly related to the density perturbation. This requirement modifies the initial condition for the evolution equation and has the effect that the collapse proceeds faster than in the case where the initial velocity perturbation is set to zero; the timescale is reduced by a factor of up to approximately equal 0.5. Our results thus strengthens the conclusion of Richstone et al. for a high Omega0. In addition, we study the collapse of density fluctuations in the frame of the Zel'dovich approximation, using as starting condition the analytically known probability distribution of the eigenvalues of the deformation tensor, which depends only on the (Gaussian) width of the perturbation spectrum. Finally, we consider the anisotropic collapse of density perturbations dynamically, again with initial conditions drawn from the probability distribution of the deformation tensor. We find that in both cases of anisotropic collapse, in the Zel'dovich approximation and in the dynamical calculations, the resulting distribution of collapse times agrees remarkably well with the results from spherical collapse. We discuss this agreement and conclude that it is mainly due to the properties of the probability distribution for the eigenvalues of the Zel'dovich deformation tensor. Hence, the conclusions of Richstone et al. on the value of Omega0 can be

  15. Chiral magnetic effect in the anisotropic quark-gluon plasma

    International Nuclear Information System (INIS)

    Ali-Akbari, Mohammad; Taghavi, Seyed Farid

    2015-01-01

    An anisotropic thermal plasma phase of a strongly coupled gauge theory can be holographically modelled by an anisotropic AdS black hole. The temperature and anisotropy parameter of the AdS black hole background of interest http://dx.doi.org/10.1007/JHEP07(2011)054 is specified by the location of the horizon and the value of the Dilaton field at the horizon. Interestingly, for the first time, we obtain two functions for the values of the horizon and Dilaton field in terms of the temperature and anisotropy parameter. Then by introducing a number of spinning probe D7-branes in the anisotropic background, we compute the value of the chiral magnetic effect (CME). We observe that in the isotropic and anisotropic plasma the value of the CME is equal for the massless quarks. However, at fixed temperature, raising the anisotropy in the system will increase the value of the CME for the massive quarks.

  16. Waves and discontinuities in relativistic and anisotropic magnetohydrodynamics

    International Nuclear Information System (INIS)

    Cissoko, Mahdy

    1975-01-01

    This work is devoted to the relativistic study of a non-dissipative anisotropic fluid diagram of infinite conductivity. Such a fluid diagram is constructed in part one. Starting from a macroscopic viewpoint a hydrothermodynamic study of the fluid diagram considered is carried out and the fundamental differential system of anisotropic magnetohydrodynamics is deduced. Part two concerns the study of characteristic varieties and propagation of waves for a polytropic anisotropic fluid diagram. Three types of characteristic varieties are revealed: entropy waves (or material waves), magnetosonic waves and Alfven waves. The propagation rates of Alfven and magnetosonic waves are situated with respect to each other. The study of wave cones showed up on the one hand certain special features of wave propagation in anisotropic magnetohydrodynamics and on the other hand the hyperbolic nature of differential operators associated with the various waves [fr

  17. Angle-domain common-image gathers from anisotropic Gaussian ...

    Indian Academy of Sciences (India)

    3State Key Laboratory of Oil and Gas Reservoir Geology and Exploitation, Chengdu University of Technology,. Chengdu ... studied the extraction scheme of ADCIGs by using. Kirchhoff ..... The effect of shale properties on anisotropic brittleness.

  18. Propagation of waves in a gravitating and rotating anisotropic heat ...

    African Journals Online (AJOL)

    Bheema

    astrophysical plasmas. These plasmas are usually self-gravitating, rotating and embedded in a .... gravitational potential, and P denotes the anisotropic pressure tensor defined as. ൌ ୄ ൅ ሺ צǦ ..... Nonlinear Processes Geophysics, 11 :731.

  19. Hydrodynamic cavitation in Stokes flow of anisotropic fluids

    Science.gov (United States)

    Stieger, Tillmann; Agha, Hakam; Schoen, Martin; Mazza, Marco G.; Sengupta, Anupam

    2017-05-01

    Cavitation, the nucleation of vapour in liquids, is ubiquitous in fluid dynamics, and is often implicated in a myriad of industrial and biomedical applications. Although extensively studied in isotropic liquids, corresponding investigations in anisotropic liquids are largely lacking. Here, by combining liquid crystal microfluidic experiments, nonequilibrium molecular dynamics simulations and theoretical arguments, we report flow-induced cavitation in an anisotropic fluid. The cavitation domain nucleates due to sudden pressure drop upon flow past a cylindrical obstacle within a microchannel. For an anisotropic fluid, the inception and growth of the cavitation domain ensued in the Stokes regime, while no cavitation was observed in isotropic liquids flowing under similar hydrodynamic parameters. Using simulations we identify a critical value of the Reynolds number for cavitation inception that scales inversely with the order parameter of the fluid. Strikingly, the critical Reynolds number for anisotropic fluids can be 50% lower than that of isotropic fluids.

  20. Acoustic frequency filter based on anisotropic topological phononic crystals

    KAUST Repository

    Chen, Zeguo

    2017-11-02

    We present a design of acoustic frequency filter based on a two-dimensional anisotropic phononic crystal. The anisotropic band structure exhibits either a directional or a combined (global + directional) bandgap at certain frequency regions, depending on the geometry. When the time-reversal symmetry is broken, it may introduce a topologically nontrivial bandgap. The induced nontrivial bandgap and the original directional bandgap result in various interesting wave propagation behaviors, such as frequency filter. We develop a tight-binding model to characterize the effective Hamiltonian of the system, from which the contribution of anisotropy is explicitly shown. Different from the isotropic cases, the Zeeman-type splitting is not linear and the anisotropic bandgap makes it possible to achieve anisotropic propagation characteristics along different directions and at different frequencies.

  1. Anisotropic Third-Order Regularization for Sparse Digital Elevation Models

    KAUST Repository

    Lellmann, Jan; Morel, Jean-Michel; Schö nlieb, Carola-Bibiane

    2013-01-01

    features of the contours while ensuring smoothness across level lines. We propose an anisotropic third-order model and an efficient method to adaptively estimate both the surface and the anisotropy. Our experiments show that the approach outperforms AMLE

  2. Efficient anisotropic wavefield extrapolation using effective isotropic models

    KAUST Repository

    Alkhalifah, Tariq Ali; Ma, X.; Waheed, Umair bin; Zuberi, Mohammad

    2013-01-01

    Isotropic wavefield extrapolation is more efficient than anisotropic extrapolation, and this is especially true when the anisotropy of the medium is tilted (from the vertical). We use the kinematics of the wavefield, appropriately represented

  3. On plasma stability under anisotropic random electric field influence

    International Nuclear Information System (INIS)

    Rabich, L.N.; Sosenko, P.P.

    1987-01-01

    The influence of anisotropic random field on plasma stability is studied. The thresholds and instability increments are obtained. The stabilizing influence of frequency missmatch and external magnetic field is pointed out

  4. 3-D waveform tomography sensitivity kernels for anisotropic media

    KAUST Repository

    Djebbi, Ramzi; Alkhalifah, Tariq Ali

    2014-01-01

    The complications in anisotropic multi-parameter inversion lie in the trade-off between the different anisotropy parameters. We compute the tomographic waveform sensitivity kernels for a VTI acoustic medium perturbation as a tool to investigate

  5. Modelling of anisotropic compact stars of embedding class one

    Energy Technology Data Exchange (ETDEWEB)

    Bhar, Piyali [Government General Degree College, Department of Mathematics, Singur, Hooghly, West Bengal (India); Maurya, S.K. [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman); Gupta, Y.K. [Raj Kumar Goel Institute of Technology, Department of Mathematics, Ghaziabad, U.P. (India); Manna, Tuhina [St. Xavier' s College, Department of Commerce (Evening), Kolkata, West Bengal (India)

    2016-10-15

    In the present article, we have constructed static anisotropic compact star models of Einstein field equations for the spherical symmetric metric of embedding class one. By assuming the particular form of the metric function ν, we have solved the Einstein field equations for anisotropic matter distribution. The anisotropic models represent the realistic compact objects such as SAX J 1808.4-3658 (SS1), Her X-1, Vela X-12, PSR J1614-2230 and Cen X-3. We have reported our results in details for the compact star Her X-1 on the ground of physical properties such as pressure, density, velocity of sound, energy conditions, TOV equation and red-shift etc. Along with these, we have also discussed about the stability of the compact star models. Finally we made a comparison between our anisotropic stars with the realistic objects on the key aspects as central density, central pressure, compactness and surface red-shift. (orig.)

  6. Jet quenching in a strongly coupled anisotropic plasma

    Science.gov (United States)

    Chernicoff, Mariano; Fernández, Daniel; Mateos, David; Trancanelli, Diego

    2012-08-01

    The jet quenching parameter of an anisotropic plasma depends on the relative orientation between the anisotropic direction, the direction of motion of the parton, and the direction along which the momentum broadening is measured. We calculate the jet quenching parameter of an anisotropic, strongly coupled {N} = 4 plasma by means of its gravity dual. We present the results for arbitrary orientations and arbitrary values of the anisotropy. The anisotropic value can be larger or smaller than the isotropic one, and this depends on whether the comparison is made at equal temperatures or at equal entropy densities. We compare our results to analogous calculations for the real-world quark-gluon plasma and find agreement in some cases and disagreement in others.

  7. Acoustic frequency filter based on anisotropic topological phononic crystals

    KAUST Repository

    Chen, Zeguo; Zhao, Jiajun; Mei, Jun; Wu, Ying

    2017-01-01

    We present a design of acoustic frequency filter based on a two-dimensional anisotropic phononic crystal. The anisotropic band structure exhibits either a directional or a combined (global + directional) bandgap at certain frequency regions, depending on the geometry. When the time-reversal symmetry is broken, it may introduce a topologically nontrivial bandgap. The induced nontrivial bandgap and the original directional bandgap result in various interesting wave propagation behaviors, such as frequency filter. We develop a tight-binding model to characterize the effective Hamiltonian of the system, from which the contribution of anisotropy is explicitly shown. Different from the isotropic cases, the Zeeman-type splitting is not linear and the anisotropic bandgap makes it possible to achieve anisotropic propagation characteristics along different directions and at different frequencies.

  8. Anisotropic plasma with flows in tokamak: Steady state and stability

    International Nuclear Information System (INIS)

    Ilgisonis, V.I.

    1996-01-01

    An adequate description of equilibrium and stability of anisotropic plasma with macroscopic flows in tokamaks is presented. The Chew-Goldberger-Low (CGL) approximation is consistently used to analyze anisotropic plasma dynamics. The admissible structure of a stationary flow is found to be the same as in the ideal magnetohydrodynamics with isotropic pressure (MHD), which means an allowance for the same relabeling symmetry as in ideal MHD systems with toroidally nested magnetic surfaces. A generalization of the Grad-Shafranov equation for the case of anisotropic plasma with flows confined in the axisymmetric magnetic field is derived. A variational principle was obtained, which allows for a stability analysis of anisotropic pressure plasma with flows, and takes into account the conservation laws resulting from the relabeling symmetry. This principle covers the previous stability criteria for static CGL plasma and for ideal MHD flows in isotropic plasma as well. copyright 1996 American Institute of Physics

  9. Finite-difference modelling of anisotropic wave scattering in discrete ...

    Indian Academy of Sciences (India)

    A M Ekanem

    2018-04-05

    Apr 5, 2018 ... scattering characteristics in fractured media and thus, validate the practical utility of using anisotropic .... to fluid flow. ... account the porosity of the host rock and assumes .... The free surface boundary conditions generally.

  10. Anisotropic wave-equation traveltime and waveform inversion

    KAUST Repository

    Feng, Shihang

    2016-09-06

    The wave-equation traveltime and waveform inversion (WTW) methodology is developed to invert for anisotropic parameters in a vertical transverse isotropic (VTI) meidum. The simultaneous inversion of anisotropic parameters v0, ε and δ is initially performed using the wave-equation traveltime inversion (WT) method. The WT tomograms are then used as starting background models for VTI full waveform inversion. Preliminary numerical tests on synthetic data demonstrate the feasibility of this method for multi-parameter inversion.

  11. Hydrodynamic cavitation in Stokes flow of anisotropic fluids

    OpenAIRE

    Stieger, Tillmann; Agha, Hakam; Schoen, Martin; Mazza, Marco G.; Sengupta, Anupam

    2017-01-01

    Cavitation, the nucleation of vapour in liquids, is ubiquitous in fluid dynamics, and is often implicated in a myriad of industrial and biomedical applications. Although extensively studied in isotropic liquids, corresponding investigations in anisotropic liquids are largely lacking. Here, by combining liquid crystal microfluidic experiments, nonequilibrium molecular dynamics simulations and theoretical arguments, we report flow-induced cavitation in an anisotropic fluid. The cavitation domai...

  12. Hybrid anisotropic materials for wind power turbine blades

    CERN Document Server

    Golfman, Yosif

    2012-01-01

    Based on rapid technological developments in wind power, governments and energy corporations are aggressively investing in this natural resource. Illustrating some of the crucial new breakthroughs in structural design and application of wind energy generation machinery, Hybrid Anisotropic Materials for Wind Power Turbine Blades explores new automated, repeatable production techniques that expand the use of robotics and process controls. These practices are intended to ensure cheaper fabrication of less-defective anisotropic material composites used to manufacture power turbine blades. This boo

  13. Anisotropic modelling of the electrical conductivity of fractured bedrock

    International Nuclear Information System (INIS)

    Flykt, M.J.; Sihvola, A.H.; Eloranta, E.H.

    1995-01-01

    The electromagnetic characterization of fractured bedrock is of importance when studying the final disposal of nuclear waste. The different types of discontinuities at all scales in rocks can be viewed as an inhomogeneity. In some cases there are reasons to assume the influence of the discontinuities on electrical conductivity is anisotropic in character. The effort has been made to use electromagnetic mixing rules in the definition of an equivalent homogeneous anisotropic conductivity tensor for such fractured rock mass. (author) (16 refs., 6 figs.)

  14. Algebraic collapsing acceleration of the characteristics method with anisotropic scattering

    International Nuclear Information System (INIS)

    Le Tellier, R.; Hebert, A.; Roy, R.

    2004-01-01

    In this paper, the characteristics solvers implemented in the lattice code Dragon are extended to allow a complete anisotropic treatment of the collision operator. An efficient synthetic acceleration method, called Algebraic Collapsing Acceleration (ACA), is presented. Tests show that this method can substantially speed up the convergence of scattering source iterations. The effect of boundary conditions, either specular or white reflections, on anisotropic scattering lattice-cell problems is also considered. (author)

  15. Hybrid localized waves supported by resonant anisotropic metasurfaces

    DEFF Research Database (Denmark)

    Bogdanov, A. A.; Yermakov, O. Y.; Ovcharenko, A. I.

    2016-01-01

    We study both theoretically and experimentally a new class of surface electromagnetic waves supported by resonant anisotropic metasurface. At certain frequency this type of metasurface demonstrates the topological transition from elliptical to hyperbolic regime.......We study both theoretically and experimentally a new class of surface electromagnetic waves supported by resonant anisotropic metasurface. At certain frequency this type of metasurface demonstrates the topological transition from elliptical to hyperbolic regime....

  16. Thermal fluctuations and critical behavior in a magnetized, anisotropic plasma

    International Nuclear Information System (INIS)

    Hazeltine, R. D.; Mahajan, S. M.

    2013-01-01

    Thermal fluctuations in a magnetized, anisotropic plasma are studied by applying standard methods, based on the Einstein rule, to the known thermodynamic potential of the system. It is found in particular that magnetic fluctuations become critical when the anisotropy p ∥ −p ⊥ changes sign. By examining the critical region, additional insight on the equations of state for near-critical anisotropic plasma is obtained

  17. Diffusive heat transport across magnetic islands and stochastic layers in tokamaks

    International Nuclear Information System (INIS)

    Hoelzl, Matthias

    2010-01-01

    Heat transport in tokamak plasmas with magnetic islands and ergodic field lines was simulated at realistic plasma parameters in realistic tokamak geometries. This requires the treatment of anisotropic heat diffusion, which is more efficient along magnetic field lines by up to ten orders of magnitude than perpendicular to them. Comparisons with analytical predictions and experimental measurements allow to determine the stability properties of neoclassical tearing modes as well as the experimental heat diffusion anisotropy.

  18. Data of NODDI diffusion metrics in the brain and computer simulation of hybrid diffusion imaging (HYDI acquisition scheme

    Directory of Open Access Journals (Sweden)

    Chandana Kodiweera

    2016-06-01

    Full Text Available This article provides NODDI diffusion metrics in the brains of 52 healthy participants and computer simulation data to support compatibility of hybrid diffusion imaging (HYDI, “Hybrid diffusion imaging” [1] acquisition scheme in fitting neurite orientation dispersion and density imaging (NODDI model, “NODDI: practical in vivo neurite orientation dispersion and density imaging of the human brain” [2]. HYDI is an extremely versatile diffusion magnetic resonance imaging (dMRI technique that enables various analyzes methods using a single diffusion dataset. One of the diffusion data analysis methods is the NODDI computation, which models the brain tissue with three compartments: fast isotropic diffusion (e.g., cerebrospinal fluid, anisotropic hindered diffusion (e.g., extracellular space, and anisotropic restricted diffusion (e.g., intracellular space. The NODDI model produces microstructural metrics in the developing brain, aging brain or human brain with neurologic disorders. The first dataset provided here are the means and standard deviations of NODDI metrics in 48 white matter region-of-interest (ROI averaging across 52 healthy participants. The second dataset provided here is the computer simulation with initial conditions guided by the first dataset as inputs and gold standard for model fitting. The computer simulation data provide a direct comparison of NODDI indices computed from the HYDI acquisition [1] to the NODDI indices computed from the originally proposed acquisition [2]. These data are related to the accompanying research article “Age Effects and Sex Differences in Human Brain White Matter of Young to Middle-Aged Adults: A DTI, NODDI, and q-Space Study” [3].

  19. A unified theoretical and experimental study of anisotropic hardening

    International Nuclear Information System (INIS)

    Boehler, J.P.; Raclin, J.

    1981-01-01

    The purpose of this work is to develop a consistent formulation of the constitutive relations regarding anisotropic hardening materials. Attention is focused on the appearance and the evolution of mechanical anisotropies during irreversible processes, such as plastic forming and inelastic deformation of structures. The representation theorems for anisotropic tensor functions constitute a theoretical basis, allowing to reduce arbitrariness and to obtain a unified formulation of anisotropic hardening. In this approach, a general three-dimensional constitutive law is developed for prestrained initially orthotropic materials. Introduction of the plastic behavior results in the general forms of both the flow-law and the yield criterion. The developed theory is then specialized for the case of plane stress and different modes of anisotropic hardening are analyzed. A new generalization of the Von Mises criterion is proposed, in considering a homogeneous form of order two in stress and employing the simplest combinations of the basic invariants entering the general form of the yield condition. The proposed criterion involves specific terms accounting for the initial anisotropy, the deformation induced anisotropy and correlative terms between initial and induced anisotropy. The effects of prestrainings result in both isotropic and anisotropic hardening. An adequate experimental program, consisting of uniaxial tensile tests on oriented specimens of prestrained sheet-metal, was performed, in order to determine the specific form and the evolution of the anisotropic failure criterion for soft-steel subjected to different irreversible prestrainings. (orig.)

  20. Schroedinger covariance states in anisotropic waveguides

    International Nuclear Information System (INIS)

    Angelow, A.; Trifonov, D.

    1995-03-01

    In this paper Squeezed and Covariance States based on Schroedinger inequality and their connection with other nonclassical states are considered for particular case of anisotropic waveguide in LiNiO 3 . Here, the problem of photon creation and generation of squeezed and Schroedinger covariance states in optical waveguides is solved in two steps: 1. Quantization of electromagnetic field is provided in the presence of dielectric waveguide using normal-mode expansion. The photon creation and annihilation operators are introduced, expanding the solution A-vector(r-vector,t) in a series in terms of the Sturm - Liouville mode-functions. 2. In terms of these operators the Hamiltonian of the field in a nonlinear waveguide is derived. For such Hamiltonian we construct the covariance states as stable (with nonzero covariance), which minimize the Schroedinger uncertainty relation. The evolutions of the three second momenta of q-circumflex j and p-circumflex j are calculated. For this Hamiltonian all three momenta are expressed in terms of one real parameters s only. It is found out how covariance, via this parameter s, depends on the waveguide profile n(x,y), on the mode-distributions u-vector j (x,y), and on the waveguide phase mismatching Δβ. (author). 37 refs

  1. Polarization dynamics in nonlinear anisotropic fibers

    International Nuclear Information System (INIS)

    Komarov, Andrey; Komarov, Konstantin; Meshcheriakov, Dmitry; Amrani, Foued; Sanchez, Francois

    2010-01-01

    We give an extensive study of polarization dynamics in anisotropic fibers exhibiting a third-order index nonlinearity. The study is performed in the framework of the Stokes parameters with the help of the Poincare sphere. Stationary states are determined, and their stability is investigated. The number of fixed points and their stability depend on the respective magnitude of the linear and nonlinear birefringence. A conservation relation analogous to the energy conservation in mechanics allows evidencing a close analogy between the movement of the polarization in the Poincare sphere and the motion of a particle in a potential well. Two distinct potentials are found, leading to the existence of two families of solutions, according to the sign of the total energy of the equivalent mechanical system. The mechanical analogy allows us to fully characterize the solutions and also to determine analytically the associated beat lengths. General analytical solutions are given for the two families in terms of Jacobi's functions. The intensity-dependent transmission of a fiber placed between two crossed polarizers is calculated. Optimal conditions for efficient nonlinear switching compatible with mode-locking applications are determined. The general case of a nonlinear fiber ring with an intracavity polarizer placed between two polarization controllers is also considered.

  2. Cartesian anisotropic mesh adaptation for compressible flow

    International Nuclear Information System (INIS)

    Keats, W.A.; Lien, F.-S.

    2004-01-01

    Simulating transient compressible flows involving shock waves presents challenges to the CFD practitioner in terms of the mesh quality required to resolve discontinuities and prevent smearing. This paper discusses a novel two-dimensional Cartesian anisotropic mesh adaptation technique implemented for compressible flow. This technique, developed for laminar flow by Ham, Lien and Strong, is efficient because it refines and coarsens cells using criteria that consider the solution in each of the cardinal directions separately. In this paper the method will be applied to compressible flow. The procedure shows promise in its ability to deliver good quality solutions while achieving computational savings. The convection scheme used is the Advective Upstream Splitting Method (Plus), and the refinement/ coarsening criteria are based on work done by Ham et al. Transient shock wave diffraction over a backward step and shock reflection over a forward step are considered as test cases because they demonstrate that the quality of the solution can be maintained as the mesh is refined and coarsened in time. The data structure is explained in relation to the computational mesh, and the object-oriented design and implementation of the code is presented. Refinement and coarsening algorithms are outlined. Computational savings over uniform and isotropic mesh approaches are shown to be significant. (author)

  3. Gauge unification in highly anisotropic string compactifications

    International Nuclear Information System (INIS)

    Hebecker, A.; Trapletti, M.

    2005-01-01

    It is well known that heterotic string compactifications have, in spite of their conceptual simplicity and aesthetic appeal, a serious problem with precision gauge coupling unification in the perturbative regime of string theory. Using both a duality-based and a field-theoretic definition of the boundary of the perturbative regime, we reevaluate the situation in a quantitative manner. We conclude that the simplest and most promising situations are those where some of the compactification radii are exceptionally large, corresponding to highly anisotropic orbifold models. Thus, one is led to consider constructions which are known to the effective field-theorist as higher-dimensional or orbifold grand unified theories (orbifold GUTs). In particular, if the discrete symmetry used to break the GUT group acts freely, a non-local breaking in the larger compact dimensions can be realized, leading to a precise gauge coupling unification as expected on the basis of the MSSM particle spectrum. Furthermore, a somewhat more model dependent but nevertheless very promising scenario arises if the GUT breaking is restricted to certain singular points within the manifold spanned by the larger compactification radii

  4. Birkeland currents in an anisotropic, magnetostatic plasma

    International Nuclear Information System (INIS)

    Birmingham, T.J.

    1992-01-01

    An expression for the parallel current density is derived for a plasma characterized by negligible bulk flow (magnetostatic) velocity and a two-component (anisotropic) pressure tensor by expanding the equilibrium Vlasov equation for each species in the adiabatic parameter until such point as a nonvanishing moment j parallel = ∫ d 3 vv parallel is identified. The result is a nonlocal one: it relates j parallel at one point s along a field line to j parallel at another (reference) point s 0 plus an integral function of the pressure and magnetic field between them. It is a generalization and elaboration of results obtained by Bostrom (1975), Heinemann (1990), and Heinemann and Pontius (1991). The expression could have been obtained by integrating the current continuity equation with -∇ x j perpendicular as a source term and j perpendicular given by perpendicular momentum balance. The authors explicitly show the equivalency. The widely used Vasyliunas (1970) equation follows when P perpendicular is set equal to P parallel and s and s 0 are taken to be at the ionosphere and the equator. An extended discussion of the relationship of results derived here to others in the literature is carried out in an effort to bring unity and perspective to this problem area

  5. Investigate the effect of anisotropic order parameter on the specific heat of anisotropic two-band superconductors

    International Nuclear Information System (INIS)

    Udomsamuthirun, P.; Peamsuwan, R.; Kumvongsa, C.

    2009-01-01

    The effect of anisotropic order parameter on the specific heat of anisotropic two-band superconductors in BCS weak-coupling limit is investigated. An analytical specific heat jump and the numerical specific heat are shown by using anisotropic order parameters, and the electron-phonon interaction and non-electron-phonon interaction. The two models of anisotropic order parameters are used for numerical calculation that we find little effect on the numerical results. The specific heat jump of MgB 2 , Lu 2 Fe 3 Si 5 and Nb 3 Sn superconductors can fit well with both of them. By comparing the experimental data with overall range of temperature, the best fit is Nb 3 Sn, MgB 2 , and Lu 2 Fe 3 Si 5 superconductors.

  6. VARIANT: VARIational anisotropic nodal transport for multidimensional Cartesian and hexadgonal geometry calculation

    International Nuclear Information System (INIS)

    Palmiotti, G.; Carrico, C.B.; Lewis, E.E.

    1995-10-01

    The theoretical basis, implementation information and numerical results are presented for VARIANT (VARIational Anisotropic Neutron Transport), a FORTRAN module of the DIF3D code system at Argonne National Laboratory. VARIANT employs the variational nodal method to solve multigroup steady-state neutron diffusion and transport problems. The variational nodal method is a hybrid finite element method that guarantees nodal balance and permits spatial refinement through the use of hierarchical complete polynomial trial functions. Angular variables are expanded with complete or simplified P 1 , P 3 or P 5 5 spherical harmonics approximations with full anisotropic scattering capability. Nodal response matrices are obtained, and the within-group equations are solved by red-black or four-color iteration, accelerated by a partitioned matrix algorithm. Fission source and upscatter iterations strategies follow those of DIF3D. Two- and three-dimensional Cartesian and hexagonal geometries are implemented. Forward and adjoint eigenvalue, fixed source, gamma heating, and criticality (concentration) search problems may be performed

  7. Analytical modeling of pressure transient behavior for coalbed methane transport in anisotropic media

    International Nuclear Information System (INIS)

    Wang, Lei; Wang, Xiaodong

    2014-01-01

    Resulting from the nature of anisotropy of coal media, it is a meaningful work to evaluate pressure transient behavior and flow characteristics within coals. In this article, a complete analytical model called the elliptical flow model is established by combining the theory of elliptical flow in anisotropic media and Fick's laws about the diffusion of coalbed methane. To investigate pressure transient behavior, analytical solutions were first obtained through introducing a series of special functions (Mathieu functions), which are extremely complex and are hard to calculate. Thus, a computer program was developed to establish type curves, on which the effects of the parameters, including anisotropy coefficient, storage coefficient, transfer coefficient and rate constant, were analyzed in detail. Calculative results show that the existence of anisotropy would cause great pressure depletion. To validate new analytical solutions, previous results were used to compare with the new results. It is found that a better agreement between the solutions obtained in this work and the literature was achieved. Finally, a case study is used to explain the effects of the parameters, including rock total compressibility coefficient, coal medium porosity and anisotropic permeability, sorption time constant, Langmuir volume and fluid viscosity, on bottom-hole pressure behavior. It is necessary to coordinate these parameters so as to reduce the pressure depletion. (paper)

  8. Determination of oxygen effective diffusivity in porous gas diffusion layer using a three-dimensional pore network model

    International Nuclear Information System (INIS)

    Wu Rui; Zhu Xun; Liao Qiang; Wang Hong; Ding Yudong; Li Jun; Ye Dingding

    2010-01-01

    In proton exchange membrane fuel cell (PEMFC) models, oxygen effective diffusivity is the most important parameter to characterize the oxygen transport in the gas diffusion layer (GDL). However, its determination is a challenge due to its complex dependency on GDL structure. In the present study, a three-dimensional network consisting of spherical pores and cylindrical throats is developed and used to investigate the effects of GDL structural parameters on oxygen effective diffusivity under the condition with/without water invasion process. Oxygen transport in the throat is described by Fick's law and water invasion process in the network is simulated using the invasion percolation with trapping algorithm. The simulation results reveal that oxygen effective diffusivity is slightly affected by network size but increases with decreasing the network heterogeneity and with increasing the pore connectivity. Impacts of network anisotropy on oxygen transport are also investigated in this paper. The anisotropic network is constructed by constricting the throats in the through-plane direction with a constriction factor. It is found that water invasion has a more severe negative influence on oxygen transport in an anisotropic network. Finally, two new correlations are introduced to determine the oxygen effective diffusivity for the Toray carbon paper GDLs.

  9. Diffusion tensor imaging for nerve fiber bundles in the brain stem and spinocerebellar degeneration

    International Nuclear Information System (INIS)

    Honma, Tsuguo

    2009-01-01

    Diffusion tensor imaging (DTI) can create an image of the anisotropic nature of diffusion and express it quantitatively. Nerve fibers have a large anisotropic diffusion, and it is possible to obtain images of the nerve fiber bundle. The purpose of this study is to observe the nerve fiber bundles in the brain stem using DTI and study its potential for diagnosing the type of spinocerebellar degeneration (SCD). Fractional anisotropy (FA) maps and 3D-tractography images were obtained for 41 subjects with no brain stem abnormalities. We created an apparent diffusion coefficient (ADC) map and an FA map using DTI for 16 subjects in the disease group (11 with hereditary SCD and 5 with non-hereditary SCD) and 25 in the control group. The diffusion value of the pons and middle cerebellar peduncle was measured using ADC, and the degree of anisotropic diffusion was measured using FA. The pyramidal tract, superior cerebellar peduncle, and inferior cerebellar peduncle were clearly demonstrated for all cases. ADC for the middle cerebellar peduncle in spinocerebellar ataxin (SCA)1 was significantly higher, similar to that for the pons in dentatorubro-pallidoluysian atrophy (DRPLA). In MSA-C, ADC for both the pons and middle cerebellar peduncle was significantly elevated and FA was significantly decreased. There were no significant changes in SCA3. We could observe the nerve fiber bundles in the brain stem using DTI. FA and ADC measurements with DTI can aid in diagnosing the type of SCD. (author)

  10. Diffusion and mixing in gravity-driven dense granular flows.

    Science.gov (United States)

    Choi, Jaehyuk; Kudrolli, Arshad; Rosales, Rodolfo R; Bazant, Martin Z

    2004-04-30

    We study the transport properties of particles draining from a silo using imaging and direct particle tracking. The particle displacements show a universal transition from superdiffusion to normal diffusion, as a function of the distance fallen, independent of the flow speed. In the superdiffusive (but sub-ballistic) regime, which occurs before a particle falls through its diameter, the displacements have fat-tailed and anisotropic distributions. In the diffusive regime, we observe very slow cage breaking and Péclet numbers of order 100, contrary to the only previous microscopic model (based on diffusing voids). Overall, our experiments show that diffusion and mixing are dominated by geometry, consistent with long-lasting contacts but not thermal collisions, as in normal fluids.

  11. Effective diffusion in time-periodic linear planar flow

    International Nuclear Information System (INIS)

    Indeikina, A.; Chang, H.

    1993-01-01

    It is shown that when a point source of solute is inserted into a time-periodic, unbounded linear planar flow, the large-time, time-average transport of the solute can be described by classical anisotropic diffusion with constant effective diffusion tensors. For a given vorticity and forcing period, elongational flow is shown to be the most dispersive followed by simple shear and rotational flow. Large-time diffusivity along the major axis of the time-average concentration ellipse, whose alignment is predicted from the theory, is shown to increase with vorticity for all flows and decrease with increasing forcing frequency for elongational flow and simple shear. For the interesting case of rotational flow, there exist discrete resonant frequencies where the time-average major diffusivity reaches local maxima equal to the time-average steady flow case with zero forcing frequency

  12. Greater trochanteric pain syndrome diagnosis and treatment.

    Science.gov (United States)

    Mallow, Michael; Nazarian, Levon N

    2014-05-01

    Lateral hip pain, or greater trochanteric pain syndrome, is a commonly seen condition; in this article, the relevant anatomy, epidemiology, and evaluation strategies of greater trochanteric pain syndrome are reviewed. Specific attention is focused on imaging of this syndrome and treatment techniques, including ultrasound-guided interventions. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Multiscale simulations of anisotropic particles combining molecular dynamics and Green's function reaction dynamics

    Science.gov (United States)

    Vijaykumar, Adithya; Ouldridge, Thomas E.; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2017-03-01

    The modeling of complex reaction-diffusion processes in, for instance, cellular biochemical networks or self-assembling soft matter can be tremendously sped up by employing a multiscale algorithm which combines the mesoscopic Green's Function Reaction Dynamics (GFRD) method with explicit stochastic Brownian, Langevin, or deterministic molecular dynamics to treat reactants at the microscopic scale [A. Vijaykumar, P. G. Bolhuis, and P. R. ten Wolde, J. Chem. Phys. 143, 214102 (2015)]. Here we extend this multiscale MD-GFRD approach to include the orientational dynamics that is crucial to describe the anisotropic interactions often prevalent in biomolecular systems. We present the novel algorithm focusing on Brownian dynamics only, although the methodology is generic. We illustrate the novel algorithm using a simple patchy particle model. After validation of the algorithm, we discuss its performance. The rotational Brownian dynamics MD-GFRD multiscale method will open up the possibility for large scale simulations of protein signalling networks.

  14. Dynamics of wave packets in two-dimensional random systems with anisotropic disorder.

    Science.gov (United States)

    Samelsohn, Gregory; Gruzdev, Eugene

    2008-09-01

    A theoretical model is proposed to describe narrowband pulse dynamics in two-dimensional systems with arbitrary correlated disorder. In anisotropic systems with elongated cigarlike inhomogeneities, fast propagation is predicted in the direction across the structure where the wave is exponentially localized and tunneling of evanescent modes plays a dominant role in typical realizations. Along the structure, where the wave is channeled as in a waveguide, the motion of the wave energy is relatively slow. Numerical simulations performed for ultra-wide-band pulses show that even at the initial stage of wave evolution, the radiation diffuses predominantly in the direction along the major axis of the correlation ellipse. Spectral analysis of the results relates the long tail of the wave observed in the transverse direction to a number of frequency domain "lucky shots" associated with the long-living resonant modes localized inside the sample.

  15. Diffusion archeology for diffusion progression history reconstruction.

    Science.gov (United States)

    Sefer, Emre; Kingsford, Carl

    2016-11-01

    Diffusion through graphs can be used to model many real-world processes, such as the spread of diseases, social network memes, computer viruses, or water contaminants. Often, a real-world diffusion cannot be directly observed while it is occurring - perhaps it is not noticed until some time has passed, continuous monitoring is too costly, or privacy concerns limit data access. This leads to the need to reconstruct how the present state of the diffusion came to be from partial diffusion data. Here, we tackle the problem of reconstructing a diffusion history from one or more snapshots of the diffusion state. This ability can be invaluable to learn when certain computer nodes are infected or which people are the initial disease spreaders to control future diffusions. We formulate this problem over discrete-time SEIRS-type diffusion models in terms of maximum likelihood. We design methods that are based on submodularity and a novel prize-collecting dominating-set vertex cover (PCDSVC) relaxation that can identify likely diffusion steps with some provable performance guarantees. Our methods are the first to be able to reconstruct complete diffusion histories accurately in real and simulated situations. As a special case, they can also identify the initial spreaders better than the existing methods for that problem. Our results for both meme and contaminant diffusion show that the partial diffusion data problem can be overcome with proper modeling and methods, and that hidden temporal characteristics of diffusion can be predicted from limited data.

  16. Effects of anisotropies in turbulent magnetic diffusion in mean-field solar dynamo models

    Energy Technology Data Exchange (ETDEWEB)

    Pipin, V. V. [Institute of Solar-Terrestrial Physics, Russian Academy of Sciences, Irkutsk 664033 (Russian Federation); Kosovichev, A. G. [Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305 (United States)

    2014-04-10

    We study how anisotropies of turbulent diffusion affect the evolution of large-scale magnetic fields and the dynamo process on the Sun. The effect of anisotropy is calculated in a mean-field magnetohydrodynamics framework assuming that triple correlations provide relaxation to the turbulent electromotive force (so-called the 'minimal τ-approximation'). We examine two types of mean-field dynamo models: the well-known benchmark flux-transport model and a distributed-dynamo model with a subsurface rotational shear layer. For both models, we investigate effects of the double- and triple-cell meridional circulation, recently suggested by helioseismology and numerical simulations. To characterize the anisotropy effects, we introduce a parameter of anisotropy as a ratio of the radial and horizontal intensities of turbulent mixing. It is found that the anisotropy affects the distribution of magnetic fields inside the convection zone. The concentration of the magnetic flux near the bottom and top boundaries of the convection zone is greater when the anisotropy is stronger. It is shown that the critical dynamo number and the dynamo period approach to constant values for large values of the anisotropy parameter. The anisotropy reduces the overlap of toroidal magnetic fields generated in subsequent dynamo cycles, in the time-latitude 'butterfly' diagram. If we assume that sunspots are formed in the vicinity of the subsurface shear layer, then the distributed dynamo model with the anisotropic diffusivity satisfies the observational constraints from helioseismology and is consistent with the value of effective turbulent diffusion estimated from the dynamics of surface magnetic fields.

  17. Joint eigenvector estimation from mutually anisotropic tensors improves susceptibility tensor imaging of the brain, kidney, and heart.

    Science.gov (United States)

    Dibb, Russell; Liu, Chunlei

    2017-06-01

    To develop a susceptibility-based MRI technique for probing microstructure and fiber architecture of magnetically anisotropic tissues-such as central nervous system white matter, renal tubules, and myocardial fibers-in three dimensions using susceptibility tensor imaging (STI) tools. STI can probe tissue microstructure, but is limited by reconstruction artifacts because of absent phase information outside the tissue and noise. STI accuracy may be improved by estimating a joint eigenvector from mutually anisotropic susceptibility and relaxation tensors. Gradient-recalled echo image data were simulated using a numerical phantom and acquired from the ex vivo mouse brain, kidney, and heart. Susceptibility tensor data were reconstructed using STI, regularized STI, and the proposed algorithm of mutually anisotropic and joint eigenvector STI (MAJESTI). Fiber map and tractography results from each technique were compared with diffusion tensor data. MAJESTI reduced the estimated susceptibility tensor orientation error by 30% in the phantom, 36% in brain white matter, 40% in the inner medulla of the kidney, and 45% in myocardium. This improved the continuity and consistency of susceptibility-based fiber tractography in each tissue. MAJESTI estimation of the susceptibility tensors yields lower orientation errors for susceptibility-based fiber mapping and tractography in the intact brain, kidney, and heart. Magn Reson Med 77:2331-2346, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  18. Scalar particle creation in an anisotropic universe

    International Nuclear Information System (INIS)

    Berger, B.K.

    1975-01-01

    The problem of quantized scalar field creation in an anisotropic spatially homogeneous background universe is reexamined from a Schroedinger-picture point of view. For each mode a complete set of orthonormal wave functions, psi/subN/, is obtained using the method of Salusti and Zirilli. These wave functions are valid at all times even if there is an initial cosmological singularity and depend only on the solution of the classical equation of motion. The wave functions are fixed completely by requiring the classical solution to have positive-frequency WKB form when the universe reaches the stage of adiabatic expansion. These wave functions are eigenfunctions of a conserved number operator which has the usual particle interpretation in the adiabatic regime. An intitial state near the singularity is chosen as a superposition of the wave functions, psi/subN/, and the particle number in the adiabatic regime is calculated. For plane-wave initial states, which follow the classical behavior near the singularity, the final particle number depends only on the parameters of the initial wave packet. For an initial state which instantaneously diagonalizes the Hamiltonian, an (arbitrary) initial time must be chosen. If the mode in question is in the adiabatic regime at that time almost no particle creation occurs. If it is not adiabatic, creation occurs and becomes infinite if the initial time is taken to be that of the singularity. This creation is a consequence of the failure of particle number to be well defined in this regime. Comparisons with other particle-creation studies are made

  19. Theory of Langmuir probes in anisotropic plasmas

    International Nuclear Information System (INIS)

    Sudit, I.D.; Woods, R.C.

    1994-01-01

    A theory has been developed for electron retardation by Langmuir probes of several geometries in a general anisotropic plasma with arbitrary probe orientation and valid for any sheath thickness. Electron densities and electron velocity distribution functions (EVDFs) are obtained from the second derivative of probe I-V curves, as in Druyvesteyn's original method, which was developed for isotropic plasmas. Fedorov had extended the latter method in the context of a thin sheath approximation, to axisymmetric plasmas, in which the EVDF is expanded in a series of Legendary polynomials. In the present work an expansion in a series of spherical harmonics is employed, and the coordinate transformations are handled using the irreducible representation of the three dimensional rotation group. It is shown that the Volterra integral equations that must be solved to obtain the expansion coefficients of the EVDF from the second derivative data are no more complicated in the general case that hose for the axisymmetric plasma. Furthermore in the latter case the results can be shown to be equivalent to Fedrov's thin sheath expression. For the case of planar probes a formulation based on first derivatives of the I-V curves has been obtained. If data is obtained at enough different probe orientation of a one sided planar disc probe, any number of spherical harmonic coefficient functions may be obtained by inverting a set of linear equations and the complete EVDF deduced. For a cylindrical probe or a two-sided planar disc probe the integration of the second derivative of the probe current gives the exact electron density with any arbitrary probe orientation and any degree of plasma anisotropy

  20. Synthetic acceleration methods for linear transport problems with highly anisotropic scattering

    International Nuclear Information System (INIS)

    Khattab, K.M.

    1989-01-01

    One of the iterative methods which is used to solve the discretized transport equation is called the Source Iteration Method (SI). The SI method converges very slowly for problems with optically thick regions and scattering ratios (σ s /σ t ) near unity. The Diffusion-Synthetic Acceleration method (DSA) is one of the methods which has been devised to improve the convergence rate of the SI method. The DSA method is a good tool to accelerate the SI method, if the particle which is being dealt with is a neutron. This is because the scattering process for neutrons is not severely anisotropic. However, if the particle is a charged particle (electron), DSA becomes ineffective as an acceleration device because here the scattering process is severely anisotropic. To improve the DSA algorithm for electron transport, the author approaches the problem in two different ways in this thesis. He develops the first approach by accelerating more angular moments (φ 0 , φ 1 , φ 2 , φ 3 ,...) than is done in DSA; he calls this approach the Modified P N Synthetic Acceleration (MPSA) method. In the second approach he modifies the definition of the transport sweep, using the physics of the scattering; he calls this approach the Modified Diffusion Synthetic Acceleration (MDSA) method. In general, he has developed, analyzed, and implemented the MPSA and MDSA methods in this thesis and has shown that for a high order quadrature set and mesh widths about 1.0 cm, they are each about 34 times faster (clock time) than the DSA method. Also, he has found that the MDSA spectral radius decreases as the mesh size increases. This makes the MDSA method a better choice for large spatial meshes

  1. Multigrid treatment of implicit continuum diffusion

    Science.gov (United States)

    Francisquez, Manaure; Zhu, Ben; Rogers, Barrett

    2017-10-01

    Implicit treatment of diffusive terms of various differential orders common in continuum mechanics modeling, such as computational fluid dynamics, is investigated with spectral and multigrid algorithms in non-periodic 2D domains. In doubly periodic time dependent problems these terms can be efficiently and implicitly handled by spectral methods, but in non-periodic systems solved with distributed memory parallel computing and 2D domain decomposition, this efficiency is lost for large numbers of processors. We built and present here a multigrid algorithm for these types of problems which outperforms a spectral solution that employs the highly optimized FFTW library. This multigrid algorithm is not only suitable for high performance computing but may also be able to efficiently treat implicit diffusion of arbitrary order by introducing auxiliary equations of lower order. We test these solvers for fourth and sixth order diffusion with idealized harmonic test functions as well as a turbulent 2D magnetohydrodynamic simulation. It is also shown that an anisotropic operator without cross-terms can improve model accuracy and speed, and we examine the impact that the various diffusion operators have on the energy, the enstrophy, and the qualitative aspect of a simulation. This work was supported by DOE-SC-0010508. This research used resources of the National Energy Research Scientific Computing Center (NERSC).

  2. Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

    International Nuclear Information System (INIS)

    Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

    1976-01-01

    Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

  3. Investigating the Eddy Diffusivity Concept in the Coastal Ocean

    Science.gov (United States)

    Rypina, I.; Kirincich, A.; Lentz, S. J.; Sundermeyer, M. A.

    2016-12-01

    We test the validity, utility, and limitations of the lateral eddy diffusivity concept in a coastal environment through analyzing data from coupled drifter and dye releases within the footprint of a high-resolution (800 m) high-frequency radar south of Martha's Vineyard, Massachusetts. Specifically, we investigate how well a combination of radar-based velocities and drifter-derived diffusivities can reproduce observed dye spreading over an 8-h time interval. A drifter-based estimate of an anisotropic diffusivity tensor is used to parameterize small-scale motions that are unresolved and under-resolved by the radar system. This leads to a significant improvement in the ability of the radar to reproduce the observed dye spreading. Our drifter-derived diffusivity estimates are O(10 m2/s), are consistent with the diffusivity inferred from aerial images of the dye taken using the quadcopter-mounted digital camera during the dye release, and are roughly an order of magnitude larger than diffusivity estimates of Okubo (O(1 m2/s)) for similar spatial scales ( 1 km). Despite the fact that the drifter-based diffusivity approach was successful in improving the ability of the radar to reproduce the observed dye spreading, the dispersion of drifters was, for the most part, not consistent with the diffusive spreading regime.

  4. Growth and anisotropic transport properties of self-assembled InAs nanostructures in InP

    International Nuclear Information System (INIS)

    Bierwagen, O.

    2007-01-01

    Self-assembled InAs nanostructures in InP, comprising quantum wells, quantum wires, and quantum dots, are studied in terms of their formation and properties. In particular, the structural, optical, and anisotropic transport properties of the nanostructures are investigated. The focus is a comprehending exploration of the anisotropic in-plane transport in large ensembles of laterally coupled InAs nanostructures. The self-assembled Stranski-Krastanov growth of InAs nanostructures is studied by gas-source molecular beam epitaxy on both nominally oriented and vicinal InP(001). Optical polarization of the interband transitions arising from the nanostructure type is demonstrated by photoluminescence and transmission spectroscopy. The experimentally convenient four-contact van der Pauw Hall measurement of rectangularly shaped semiconductors, usually applied to isotropic systems, is extended to yield the anisotropic transport properties. Temperature dependent transport measurements are performed in large ensembles of laterally closely spaced nanostructures. The transport of quantum wire-, quantum dash- and quantum dot containing samples is highly anisotropic with the principal axes of conductivity aligned to the directions. The direction of higher mobility is [ anti 110], which is parallel to the direction of the quantum wires. In extreme cases, the anisotropies exceed 30 for electrons, and 100 for holes. The extreme anisotropy for holes is due to diffusive transport through extended states in the [ anti 110], and hopping transport through laterally localized states in the [110] direction, within the same sample. A novel 5-terminal electronic switching device based on gate-controlled transport anisotropy is proposed. The gate-control of the transport anisotropy in modulation-doped, self-organized InAs quantum wires embedded in InP is demonstrated. (orig.)

  5. Growth and anisotropic transport properties of self-assembled InAs nanostructures in InP

    Energy Technology Data Exchange (ETDEWEB)

    Bierwagen, O.

    2007-12-20

    Self-assembled InAs nanostructures in InP, comprising quantum wells, quantum wires, and quantum dots, are studied in terms of their formation and properties. In particular, the structural, optical, and anisotropic transport properties of the nanostructures are investigated. The focus is a comprehending exploration of the anisotropic in-plane transport in large ensembles of laterally coupled InAs nanostructures. The self-assembled Stranski-Krastanov growth of InAs nanostructures is studied by gas-source molecular beam epitaxy on both nominally oriented and vicinal InP(001). Optical polarization of the interband transitions arising from the nanostructure type is demonstrated by photoluminescence and transmission spectroscopy. The experimentally convenient four-contact van der Pauw Hall measurement of rectangularly shaped semiconductors, usually applied to isotropic systems, is extended to yield the anisotropic transport properties. Temperature dependent transport measurements are performed in large ensembles of laterally closely spaced nanostructures. The transport of quantum wire-, quantum dash- and quantum dot containing samples is highly anisotropic with the principal axes of conductivity aligned to the <110> directions. The direction of higher mobility is [ anti 110], which is parallel to the direction of the quantum wires. In extreme cases, the anisotropies exceed 30 for electrons, and 100 for holes. The extreme anisotropy for holes is due to diffusive transport through extended states in the [ anti 110], and hopping transport through laterally localized states in the [110] direction, within the same sample. A novel 5-terminal electronic switching device based on gate-controlled transport anisotropy is proposed. The gate-control of the transport anisotropy in modulation-doped, self-organized InAs quantum wires embedded in InP is demonstrated. (orig.)

  6. Excess Entropy and Diffusivity

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Excess Entropy and Diffusivity. Excess entropy scaling of diffusivity (Rosenfeld,1977). Analogous relationships also exist for viscosity and thermal conductivity.

  7. Lead diffusion in monazite; Diffusion du plomb dans la monazite

    Energy Technology Data Exchange (ETDEWEB)

    Gardes, E

    2006-06-15

    Proper knowledge of the diffusion rates of lead in monazite is necessary to understand the U-Th-Pb age anomalies of this mineral, which is one of the most used in geochronology after zircon. Diffusion experiments were performed in NdPO{sub 4} monocrystals and in Nd{sub 0.66}Ca{sub 0.17}Th{sub 0.17}PO{sub 4} polycrystals from Nd{sub 0.66}Pb{sub 0.17}Th{sub 0.17}PO{sub 4} thin films to investigate Pb{sup 2+} + Th{sup 4+} {r_reversible} 2 Nd{sup 3+} and Pb{sup 2+} {r_reversible} Ca{sup 2+} exchanges. Diffusion annealings were run between 1200 and 1500 Celsius degrees, at room pressure, for durations ranging from one hour to one month. The diffusion profiles were analysed using TEM (transmission electronic microscopy) and RBS (Rutherford backscattering spectroscopy). The diffusivities extracted for Pb{sup 2+} + Th{sup 4+} {r_reversible} 2 Nd{sup 3+} exchange follow an Arrhenius law with parameters E equals 509 {+-} 24 kJ mol{sup -1} and log(D{sub 0} (m{sup 2}s{sup -1})) equals -3.41 {+-} 0.77. Preliminary data for Pb{sup 2+} {r_reversible} Ca{sup 2+} exchange are in agreement with this result. The extrapolation of our data to crustal temperatures yields very slow diffusivities. For instance, the time necessary for a 50 {mu}m grain to lose all of its lead at 800 Celsius degrees is greater than the age of the Earth. From these results and other evidence from the literature, we conclude that most of the perturbations in U-Th-Pb ages of monazite cannot be attributed to lead diffusion, but rather to interactions with fluids. (author)

  8. Two-point paraxial traveltime formula for inhomogeneous isotropic and anisotropic media: Tests of accuracy

    KAUST Repository

    Waheed, Umair bin; Psencik, Ivan; Cerveny, Vlastislav; Iversen, Einar; Alkhalifah, Tariq Ali

    2013-01-01

    On several simple models of isotropic and anisotropic media, we have studied the accuracy of the two-point paraxial traveltime formula designed for the approximate calculation of the traveltime between points S' and R' located in the vicinity of points S and R on a reference ray. The reference ray may be situated in a 3D inhomogeneous isotropic or anisotropic medium with or without smooth curved interfaces. The twopoint paraxial traveltime formula has the form of the Taylor expansion of the two-point traveltime with respect to spatial Cartesian coordinates up to quadratic terms at points S and R on the reference ray. The constant term and the coefficients of the linear and quadratic terms are determined from quantities obtained from ray tracing and linear dynamic ray tracing along the reference ray. The use of linear dynamic ray tracing allows the evaluation of the quadratic terms in arbitrarily inhomogeneous media and, as shown by examples, it extends the region of accurate results around the reference ray between S and R (and even outside this interval) obtained with the linear terms only. Although the formula may be used for very general 3D models, we concentrated on simple 2D models of smoothly inhomogeneous isotropic and anisotropic (~8% and ~20% anisotropy) media only. On tests, in which we estimated twopoint traveltimes between a shifted source and a system of shifted receivers, we found that the formula may yield more accurate results than the numerical solution of an eikonal-based differential equation. The tests also indicated that the accuracy of the formula depends primarily on the length and the curvature of the reference ray and only weakly depends on anisotropy. The greater is the curvature of the reference ray, the narrower its vicinity, in which the formula yields accurate results.

  9. Nonlinear and anisotropic tensile properties of graft materials used in soft tissue applications.

    Science.gov (United States)

    Yoder, Jonathon H; Elliott, Dawn M

    2010-05-01

    The mechanical properties of extracellular matrix grafts that are intended to augment or replace soft tissues should be comparable to the native tissue. Such grafts are often used in fiber-reinforced tissue applications that undergo multi-axial loading and therefore knowledge of the anisotropic and nonlinear properties are needed, including the moduli and Poisson's ratio in two orthogonal directions within the plane of the graft. The objective of this study was to measure the tensile mechanical properties of several marketed grafts: Alloderm, Restore, CuffPatch, and OrthADAPT. The degree of anisotropy and non-linearity within each graft was evaluated from uniaxial tensile tests and compared to their native tissue. The Alloderm graft was anisotropic in both the toe- and linear-region of the stress-strain response, was highly nonlinear, and generally had low properties. The Restore and CuffPatch grafts had similar stress-strain responses, were largely isotropic, had a linear-region modulus of 18MPa, and were nonlinear. OrthADAPT was anisotropic in the linear-region (131 MPA vs 47MPa in the toe-region) and was highly nonlinear. The Poisson ratio for all grafts was between 0.4 and 0.7, except for the parallel orientation of Restore which was greater than 1.0. Having an informed understanding of how the available grafts perform mechanically will allow for better assessment by the physician for which graft to apply depending upon its application. Copyright 2010 Elsevier Ltd. All rights reserved.

  10. Two-point paraxial traveltime formula for inhomogeneous isotropic and anisotropic media: Tests of accuracy

    KAUST Repository

    Waheed, Umair bin

    2013-09-01

    On several simple models of isotropic and anisotropic media, we have studied the accuracy of the two-point paraxial traveltime formula designed for the approximate calculation of the traveltime between points S\\' and R\\' located in the vicinity of points S and R on a reference ray. The reference ray may be situated in a 3D inhomogeneous isotropic or anisotropic medium with or without smooth curved interfaces. The twopoint paraxial traveltime formula has the form of the Taylor expansion of the two-point traveltime with respect to spatial Cartesian coordinates up to quadratic terms at points S and R on the reference ray. The constant term and the coefficients of the linear and quadratic terms are determined from quantities obtained from ray tracing and linear dynamic ray tracing along the reference ray. The use of linear dynamic ray tracing allows the evaluation of the quadratic terms in arbitrarily inhomogeneous media and, as shown by examples, it extends the region of accurate results around the reference ray between S and R (and even outside this interval) obtained with the linear terms only. Although the formula may be used for very general 3D models, we concentrated on simple 2D models of smoothly inhomogeneous isotropic and anisotropic (~8% and ~20% anisotropy) media only. On tests, in which we estimated twopoint traveltimes between a shifted source and a system of shifted receivers, we found that the formula may yield more accurate results than the numerical solution of an eikonal-based differential equation. The tests also indicated that the accuracy of the formula depends primarily on the length and the curvature of the reference ray and only weakly depends on anisotropy. The greater is the curvature of the reference ray, the narrower its vicinity, in which the formula yields accurate results.

  11. Jigsaw puzzle metasurface for multiple functions: polarization conversion, anomalous reflection and diffusion.

    Science.gov (United States)

    Zhao, Yi; Cao, Xiangyu; Gao, Jun; Liu, Xiao; Li, Sijia

    2016-05-16

    We demonstrate a simple reconfigurable metasurface with multiple functions. Anisotropic tiles are investigated and manufactured as fundamental elements. Then, the tiles are combined in a certain sequence to construct a metasurface. Each of the tiles can be adjusted independently which is like a jigsaw puzzle and the whole metasurface can achieve diverse functions by different layouts. For demonstration purposes, we realize polarization conversion, anomalous reflection and diffusion by a jigsaw puzzle metasurface with 6 × 6 pieces of anisotropic tile. Simulated and measured results prove that our method offers a simple and effective strategy for metasurface design.

  12. An Adaptive Spectrally Weighted Structure Tensor Applied to Tensor Anisotropic Nonlinear Diffusion for Hyperspectral Images

    Science.gov (United States)

    Marin Quintero, Maider J.

    2013-01-01

    The structure tensor for vector valued images is most often defined as the average of the scalar structure tensors in each band. The problem with this definition is the assumption that all bands provide the same amount of edge information giving them the same weights. As a result non-edge pixels can be reinforced and edges can be weakened…

  13. Anisotropic corner diffusion as origin for dendritic growth on hexagonal substrates

    DEFF Research Database (Denmark)

    Brune, H.; Röder, H.; Bromann, K.

    1996-01-01

    Ag aggregation on Ag(111), Pt(111), and 1 ML Ag pseudomorphically grown on Pt(111), has been studied with variable temperature STM. These systems all have in common that dendritic patterns with trigonal symmetry rather than randomly ramified aggregates, which would be expected for a simple hit an...... theory show that this relaxation is highly asymmetric with respect to the two different kinds of close-packed steps. It leads to dendritic growth as verified by kinetic Monte-Carlo simulations which agree well with experiment....

  14. Enhancing Perceived Quality of Compressed Images and Video with Anisotropic Diffusion and Fuzzy Filtering

    DEFF Research Database (Denmark)

    Nadernejad, Ehsan; Korhonen, Jari; Forchhammer, Søren

    2013-01-01

    and subjective results on JPEG compressed images, as well as MJPEG and H.264/AVC compressed video, indicate that the proposed algorithms employing directional and spatial fuzzy filters achieve better artifact reduction than other methods. In particular, robust improvements with H.264/AVC video have been gained...

  15. Mechanism of anisotropic surface self-diffusivity at the prismatic ice-vapor interface

    Czech Academy of Sciences Publication Activity Database

    Gladich, I.; Oswald, A.; Bowens, N.; Naatz, S.; Rowe, P.; Roeselová, Martina; Neshyba, S.

    2015-01-01

    Roč. 17, č. 35 (2015), s. 22947-22958 ISSN 1463-9076 R&D Projects: GA ČR GA13-06181S Institutional support: RVO:61388963 Keywords : molecular dynamics simulations * water models * melting point Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.449, year: 2015

  16. The Cn method applied to problems with an anisotropic diffusion law

    International Nuclear Information System (INIS)

    Grandjean, P.M.

    A 2-dimensional Cn calculation has been applied to homogeneous media subjected to the Rayleigh impact law. Results obtained with collision probabilities and Chandrasekhar calculations are compared to those from Cn method. Introducing in the expression of the transport equation, an expansion truncated on a polynomial basis for the outgoing angular flux (or possibly entrance flux) gives two Cn systems of algebraic linear equations for the expansion coefficients. The matrix elements of these equations are the moments of the Green function in infinite medium. The search for the Green function is effected through the Fourier transformation of the integrodifferential equation and its moments are derived from their Fourier transforms through a numerical integration in the complex plane. The method has been used for calculating the albedo in semi-infinite media, the extrapolation length of the Milne problem, and the albedo and transmission factor of a slab (a concise study of convergence is presented). A system of integro-differential equations bearing on the moments of the angular flux inside the medium has been derived, for the collision probability method. It is numerically solved with approximately the bulk flux by step functions. The albedo in semi-infinite medium has also been computed through the semi-analytical Chandrasekhar method. In the latter, the outgoing flux is expressed as a function of the entrance flux by means of a integral whose kernel is numerically derived [fr

  17. 3-D waveform tomography sensitivity kernels for anisotropic media

    KAUST Repository

    Djebbi, Ramzi

    2014-01-01

    The complications in anisotropic multi-parameter inversion lie in the trade-off between the different anisotropy parameters. We compute the tomographic waveform sensitivity kernels for a VTI acoustic medium perturbation as a tool to investigate this ambiguity between the different parameters. We use dynamic ray tracing to efficiently handle the expensive computational cost for 3-D anisotropic models. Ray tracing provides also the ray direction information necessary for conditioning the sensitivity kernels to handle anisotropy. The NMO velocity and η parameter kernels showed a maximum sensitivity for diving waves which results in a relevant choice of those parameters in wave equation tomography. The δ parameter kernel showed zero sensitivity; therefore it can serve as a secondary parameter to fit the amplitude in the acoustic anisotropic inversion. Considering the limited penetration depth of diving waves, migration velocity analysis based kernels are introduced to fix the depth ambiguity with reflections and compute sensitivity maps in the deeper parts of the model.

  18. Debonding analyses in anisotropic materials with strain- gradient effects

    DEFF Research Database (Denmark)

    Legarth, Brian Nyvang

    2012-01-01

    A unit cell approach is adopted to numerically analyze the effect of plastic anisotropy on damage evolution in a micro-reinforced composite. The matrix material exhibit size effects and a visco-plastic anisotropic strain gradient plasticity model accounting for such size effects is adopted....... A conventional cohesive law is extended such that both the average as well as the jump in plastic strain across the fiber-matrix interface are accounted for. Results are shown for both conventional isotropic and anisotropic materials as well as for higher order isotropic and anisotropic materials...... with and without debonding. Generally, the strain gradient enhanced material exhibits higher load carry capacity compared to the corresponding conventional material. A sudden stress drop occurs in the macroscopic stress-strain response curve due to fiber-matrix debonding and the results show that a change in yield...

  19. Modeling of charged anisotropic compact stars in general relativity

    Energy Technology Data Exchange (ETDEWEB)

    Dayanandan, Baiju; Maurya, S.K.; T, Smitha T. [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman)

    2017-06-15

    A charged compact star model has been determined for anisotropic fluid distribution. We have solved the Einstein-Maxwell field equations to construct the charged compact star model by using the radial pressure, the metric function e{sup λ} and the electric charge function. The generic charged anisotropic solution is verified by exploring different physical conditions like causality condition, mass-radius relation and stability of the solution (via the adiabatic index, TOV equations and the Herrera cracking concept). It is observed that the present charged anisotropic compact star model is compatible with the star PSR 1937+21. Moreover, we also presented the EOS ρ = f(p) for the present charged compact star model. (orig.)

  20. Anisotropic light scattering of individual sickle red blood cells.

    Science.gov (United States)

    Kim, Youngchan; Higgins, John M; Dasari, Ramachandra R; Suresh, Subra; Park, YongKeun

    2012-04-01

    We present the anisotropic light scattering of individual red blood cells (RBCs) from a patient with sickle cell disease (SCD). To measure light scattering spectra along two independent axes of elongated-shaped sickle RBCs with arbitrary orientation, we introduce the anisotropic Fourier transform light scattering (aFTLS) technique and measured both the static and dynamic anisotropic light scattering. We observed strong anisotropy in light scattering patterns of elongated-shaped sickle RBCs along its major axes using static aFTLS. Dynamic aFTLS analysis reveals the significantly altered biophysical properties in individual sickle RBCs. These results provide evidence that effective viscosity and elasticity of sickle RBCs are significantly different from those of the healthy RBCs.

  1. Anisotropic temperature relaxation of plasmas in an external magnetic field

    International Nuclear Information System (INIS)

    Hassan, M.H.A.

    1977-01-01

    The magnetized kinetic equation derived in an earlier paper (Hassan and Watson, 1977) is used to study the problem of relaxation of anisotropic electron and ion temperatures in a magnetized plasma. In the case of anisotropic electron temperature relaxation, it is shown that for small anisotropies the exchange of energy within the electrons between the components parallel and perpendicular to the magnetic field direction determine the relaxation rate. For anisotropic ion temperature relaxation it is shown that the essential mechanism for relaxation is provided by energy transfer between ions and electrons, and that the expression for the relaxation rate perpendicular to the magnetic field contains a significant term proportional to ln eta 0 ln (msub(e)/msub(i)) (where eta 0 = Ωsub(e)/ksub(D)Vsub(e perpendicular to)), in addition to the term proportional to the Coulomb logarithm. (author)

  2. Nonlinear, anisotropic, and giant photoconductivity in intrinsic and doped graphene

    Science.gov (United States)

    Singh, Ashutosh; Ghosh, Saikat; Agarwal, Amit

    2018-01-01

    We present a framework to calculate the anisotropic and nonlinear photoconductivity for two band systems with application to graphene. In contrast to the usual perturbative (second order in the optical field strength) techniques, we calculate photoconductivity to all orders in the optical field strength. In particular, for graphene, we find the photoresponse to be giant (at large optical field strengths) and anisotropic. The anisotropic photoresponse in graphene is correlated with polarization of the incident field, with the response being similar to that of a half-wave plate. We predict that the anisotropy in the simultaneous measurement of longitudinal (σx x) and transverse (σy x) photoconductivity, with four probes, offers a unique experimental signature of the photovoltaic response, distinguishing it from the thermal-Seebeck and bolometric effects in photoresponse.

  3. Anomalously large anisotropic magnetoresistance in a perovskite manganite

    Science.gov (United States)

    Li, Run-Wei; Wang, Huabing; Wang, Xuewen; Yu, X. Z.; Matsui, Y.; Cheng, Zhao-Hua; Shen, Bao-Gen; Plummer, E. Ward; Zhang, Jiandi

    2009-01-01

    The signature of correlated electron materials (CEMs) is the coupling between spin, charge, orbital and lattice resulting in exotic functionality. This complexity is directly responsible for their tunability. We demonstrate here that the broken symmetry, through cubic to orthorhombic distortion in the lattice structure in a prototype manganite single crystal, La0.69Ca0.31MnO3, leads to an anisotropic magneto-elastic response to an external field, and consequently to remarkable magneto-transport behavior. An anomalous anisotropic magnetoresistance (AMR) effect occurs close to the metal-insulator transition (MIT) in the system, showing a direct correlation with the anisotropic field-tuned MIT in the system and can be understood by means of a simple phenomenological model. A small crystalline anisotropy stimulates a “colossal” AMR near the MIT phase boundary of the system, thus revealing the intimate interplay between magneto- and electronic-crystalline couplings. PMID:19706504

  4. Self-force on dislocation segments in anisotropic crystals

    International Nuclear Information System (INIS)

    Fitzgerald, S P; Aubry, S

    2010-01-01

    A dislocation segment in a crystal experiences a 'self-force', by virtue of the orientation dependence of its elastic energy. If the crystal is elastically isotropic, this force is manifested as a couple acting to rotate the segment toward the lower energy of the pure screw orientation (i.e. acting to align the dislocation line with its Burgers vector). If the crystal is anisotropic, there are additional contributions to the couple, arising from the more complex energy landscape of the lattice itself. These effects can strongly influence the dynamic evolution of dislocation networks, and via their governing role in dislocation multiplication phenomena, control plastic flow in metals. In this paper we develop a model for dislocation self-forces in a general anisotropic crystal, and briefly consider the technologically important example of α-iron, which becomes increasingly anisotropic as the temperature approaches that of the α-γ phase transition at 912 0 C.

  5. Analysis and correction of gradient nonlinearity bias in apparent diffusion coefficient measurements.

    Science.gov (United States)

    Malyarenko, Dariya I; Ross, Brian D; Chenevert, Thomas L

    2014-03-01

    Gradient nonlinearity of MRI systems leads to spatially dependent b-values and consequently high non-uniformity errors (10-20%) in apparent diffusion coefficient (ADC) measurements over clinically relevant field-of-views. This work seeks practical correction procedure that effectively reduces observed ADC bias for media of arbitrary anisotropy in the fewest measurements. All-inclusive bias analysis considers spatial and time-domain cross-terms for diffusion and imaging gradients. The proposed correction is based on rotation of the gradient nonlinearity tensor into the diffusion gradient frame where spatial bias of b-matrix can be approximated by its Euclidean norm. Correction efficiency of the proposed procedure is numerically evaluated for a range of model diffusion tensor anisotropies and orientations. Spatial dependence of nonlinearity correction terms accounts for the bulk (75-95%) of ADC bias for FA = 0.3-0.9. Residual ADC non-uniformity errors are amplified for anisotropic diffusion. This approximation obviates need for full diffusion tensor measurement and diagonalization to derive a corrected ADC. Practical scenarios are outlined for implementation of the correction on clinical MRI systems. The proposed simplified correction algorithm appears sufficient to control ADC non-uniformity errors in clinical studies using three orthogonal diffusion measurements. The most efficient reduction of ADC bias for anisotropic medium is achieved with non-lab-based diffusion gradients. Copyright © 2013 Wiley Periodicals, Inc.

  6. On the nature of the NAA diffusion attenuated MR signal in the central nervous system.

    Science.gov (United States)

    Kroenke, Christopher D; Ackerman, Joseph J H; Yablonskiy, Dmitriy A

    2004-11-01

    In the brain, on a macroscopic scale, diffusion of the intraneuronal constituent N-acetyl-L-aspartate (NAA) appears to be isotropic. In contrast, on a microscopic scale, NAA diffusion is likely highly anisotropic, with displacements perpendicular to neuronal fibers being markedly hindered, and parallel displacements less so. In this report we first substantiate that local anisotropy influences NAA diffusion in vivo by observing differing diffusivities parallel and perpendicular to human corpus callosum axonal fibers. We then extend our measurements to large voxels within rat brains. As expected, the macroscopic apparent diffusion coefficient (ADC) of NAA is practically isotropic due to averaging of the numerous and diverse fiber orientations. We demonstrate that the substantially non-monoexponential diffusion-mediated MR signal decay vs. b value can be quantitatively explained by a theoretical model of NAA confined to an ensemble of differently oriented neuronal fibers. On the microscopic scale, NAA diffusion is found to be strongly anisotropic, with displacements occurring almost exclusively parallel to the local fiber axis. This parallel diffusivity, ADCparallel, is 0.36 +/- 0.01 microm2/ms, and ADCperpendicular is essentially zero. From ADCparallel the apparent viscosity of the neuron cytoplasm is estimated to be twice as large as that of a temperature-matched dilute aqueous solution. (c) 2004 Wiley-Liss, Inc.

  7. Simultaneous bilateral isolated greater trochanter fracture

    Directory of Open Access Journals (Sweden)

    Maruti Kambali

    2013-01-01

    Full Text Available A 48-year-old woman sustained simultaneous isolated bilateral greater trochanteric fracture, following a road traffic accident. The patient presented to us 1 month after the injury. She presented with complaints of pain in the left hip and inability to walk. Roentgenograms revealed displaced comminuted bilateral greater trochanter fractures. The fracture of the left greater trochanter was reduced and fixed internally using the tension band wiring technique. The greater trochanter fracture on the right side was asymptomatic and was managed conservatively. The patient regained full range of motion and use of her hips after a postoperative follow-up of 6 months. Isolated fractures of the greater trochanter are unusual injuries. Because of their relative rarity and the unsettled controversy regarding their etiology and pathogenesis, several methods of treatment have been advocated. Furthermore, the reports of this particular type of injury are not plentiful and the average textbook coverage afforded to this entity is limited. In our study we discuss the mechanism of injury and the various treatment options available.

  8. Longitudinal disordering of vortex lattices in anisotropic superconductors

    International Nuclear Information System (INIS)

    Harshman, D.R.; Brandt, E.H.; Fiory, A.T.; Inui, M.; Mitzi, D.B.; Schneemeyer, L.F.; Waszczak, J.V.

    1993-01-01

    Vortex disordering in superconducting crystals is shown to be markedly sensitive to penetration-depth anisotropy. At low temperature and high magnetic field, the muon-spin-rotation spectra for the highly anisotropic Bi 2 Sr 2 CaCu 2 O 8+δ material are found to be anomalously narrow and symmetric about the applied field, in a manner consistent with a layered vortex sublattice structure with pinning-induced misalignment between layers. In contrast, spectra for the less-anisotropic YBa 2 Cu 3 O 7-δ compounds taken at comparable fields are broader and asymmetric, showing that the vortex lattices are aligned parallel to the applied-field direction

  9. Synthesis of borophenes: Anisotropic, two-dimensional boron polymorphs

    Energy Technology Data Exchange (ETDEWEB)

    Mannix, A. J.; Zhou, X. -F.; Kiraly, B.; Wood, J. D.; Alducin, D.; Myers, B. D.; Liu, X.; Fisher, B. L.; Santiago, U.; Guest, J. R.; Yacaman, M. J.; Ponce, A.; Oganov, A. R.; Hersam, M. C.; Guisinger, N. P.

    2015-12-17

    At the atomic-cluster scale, pure boron is markedly similar to carbon, forming simple planar molecules and cage-like fullerenes. Theoretical studies predict that two-dimensional (2D) boron sheets will adopt an atomic configuration similar to that of boron atomic clusters. We synthesized atomically thin, crystalline 2D boron sheets (i.e., borophene) on silver surfaces under ultrahigh-vacuum conditions. Atomic-scale characterization, supported by theoretical calculations, revealed structures reminiscent of fused boron clusters with multiple scales of anisotropic, out-of-plane buckling. Unlike bulk boron allotropes, borophene shows metallic characteristics that are consistent with predictions of a highly anisotropic, 2D metal.

  10. The traces of anisotropic dark energy in light of Planck

    Energy Technology Data Exchange (ETDEWEB)

    Cardona, Wilmar; Kunz, Martin [Département de Physique Théorique and Center for Astroparticle Physics, Université de Genève, 24 Quai Ernest Ansermet, 1211 Genève 4 (Switzerland); Hollenstein, Lukas, E-mail: wilmar.cardona@unige.ch, E-mail: lukas.hollenstein@zhaw.ch, E-mail: martin.kunz@unige.ch [IAS Institute of Applied Simulation, ZHAW Zurich University of Applied Sciences, Grüental, PO Box, 8820 Wädenswil (Switzerland)

    2014-07-01

    We study a dark energy model with non-zero anisotropic stress, either linked to the dark energy density or to the dark matter density. We compute approximate solutions that allow to characterise the behaviour of the dark energy model and to assess the stability of the perturbations. We also determine the current limits on such an anisotropic stress from the cosmic microwave background data by the Planck satellite, and derive the corresponding constraints on the modified growth parameters like the growth index, the effective Newton's constant and the gravitational slip.

  11. Study of anisotropic mechanical properties for aeronautical PMMA

    Directory of Open Access Journals (Sweden)

    Wei Shang

    Full Text Available For the properties of polymer are relative to its structure, the main purpose of the present work is to investigate the mechanical properties of the aeronautical PMMA which has been treated by the directional tensile technology. Isodyne images reveal the stress state in directional PMMA. And then, an anisotropic mechanical model is established. Furthermore, all mechanical parameters are measured by the digital image correlation method. Finally, based on the anisotropic mechanical model and mechanical parameters, the FEM numerical simulation and experimental methods are applied to analyze the fracture mechanical properties along different directions.

  12. All spherically symmetric charged anisotropic solutions for compact stars

    Energy Technology Data Exchange (ETDEWEB)

    Maurya, S.K. [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman); Gupta, Y.K. [Raj Kumar Goel Institute of Technology, Department of Mathematics, Ghaziabad, UP (India); Ray, Saibal [Government College of Engineering and Ceramic Technology, Department of Physics, Kolkata, West Bengal (India)

    2017-06-15

    In the present paper we develop an algorithm for all spherically symmetric anisotropic charged fluid distributions. Considering a new source function ν(r) we find a set of solutions which is physically well behaved and represents compact stellar models. A detailed study specifically shows that the models actually correspond to strange stars in terms of their mass and radius. In this connection we investigate several physical properties like energy conditions, stability, mass-radius ratio, electric charge content, anisotropic nature and surface redshift through graphical plots and mathematical calculations. All the features from these studies are in excellent agreement with the already available evidence in theory as well as observations. (orig.)

  13. Lower critical field of an anisotropic type-II superconductor

    International Nuclear Information System (INIS)

    Klemm, R.A.; Clem, J.R.

    1980-01-01

    We consider the Ginzburg-Landau free energy of the anisotropic mass form in the presence of a magnetic field of arbitrary fixed direction. It is shown that the free energy may be transformed into the isotropic Ginsburg-Landau form with a kappa that depends upon the direction of the magnetic induction B relative to the crystal lattice. The lower critical field H/sub c/1 is then found for arbitrary direction of B. For highly anisotropic crystals the angular dependence of H/sub c/1 can exhibit a discontinuity or a cusp. The special case of a crystal with uniaxial symmetry is considered in detail

  14. Tunable waveguide bends with graphene-based anisotropic metamaterials

    KAUST Repository

    Chen, Zhao-xian; Chen, Ze-guo; Ming, Yang; Wu, Ying; Lu, Yan-qing

    2016-01-01

    We design tunable waveguide bends filled with graphene-based anisotropic metamaterials to achieve a nearly perfect bending effect. The anisotropic properties of the metamaterials can be described by the effective medium theory. The nearly perfect bending effect is demonstrated by finite element simulations of various structures with different bending curvatures and shapes. This effect is attributed to zero effective permittivity along the direction of propagation and matched effective impedance at the interfaces between the bending part and the dielectric waveguides. We envisage that the design will be applicable in the far-infrared and terahertz frequency ranges owing to the tunable dielectric responses of graphene.

  15. Understanding nanoparticle-mediated nucleation pathways of anisotropic nanoparticles

    Science.gov (United States)

    Laramy, Christine R.; Fong, Lam-Kiu; Jones, Matthew R.; O'Brien, Matthew N.; Schatz, George C.; Mirkin, Chad A.

    2017-09-01

    Several seed-mediated syntheses of low symmetry anisotropic nanoparticles yield broad product distributions with multiple defect structures. This observation challenges the role of the nanoparticle precursor as a seed for certain syntheses and suggests the possibility of alternate nucleation pathways. Herein, we report a method to probe the role of the nanoparticle precursor in anisotropic nanoparticle nucleation with compositional and structural 'labels' to track their fate. We use the synthesis of gold triangular nanoprisms (Au TPs) as a model system. We propose a mechanism in which, rather than acting as a template, the nanoparticle precursor catalyzes homogenous nucleation of Au TPs.

  16. MHz gravitational waves from short-term anisotropic inflation

    International Nuclear Information System (INIS)

    Ito, Asuka; Soda, Jiro

    2016-01-01

    We reveal the universality of short-term anisotropic inflation. As a demonstration, we study inflation with an exponential type gauge kinetic function which is ubiquitous in models obtained by dimensional reduction from higher dimensional fundamental theory. It turns out that an anisotropic inflation universally takes place in the later stage of conventional inflation. Remarkably, we find that primordial gravitational waves with a peak amplitude around 10 −26 ∼10 −27 are copiously produced in high-frequency bands 10 MHz∼100 MHz. If we could detect such gravitational waves in future, we would be able to probe higher dimensional fundamental theory.

  17. Tunable waveguide bends with graphene-based anisotropic metamaterials

    KAUST Repository

    Chen, Zhao-xian

    2016-01-15

    We design tunable waveguide bends filled with graphene-based anisotropic metamaterials to achieve a nearly perfect bending effect. The anisotropic properties of the metamaterials can be described by the effective medium theory. The nearly perfect bending effect is demonstrated by finite element simulations of various structures with different bending curvatures and shapes. This effect is attributed to zero effective permittivity along the direction of propagation and matched effective impedance at the interfaces between the bending part and the dielectric waveguides. We envisage that the design will be applicable in the far-infrared and terahertz frequency ranges owing to the tunable dielectric responses of graphene.

  18. Fourier Multipliers on Anisotropic Mixed-Norm Spaces of Distributions

    DEFF Research Database (Denmark)

    Cleanthous, Galatia; Georgiadis, Athanasios; Nielsen, Morten

    2018-01-01

    A new general Hormander type condition involving anisotropies and mixed norms is introduced, and boundedness results for Fourier multi- pliers on anisotropic Besov and Triebel-Lizorkin spaces of distributions with mixed Lebesgue norms are obtained. As an application, the continuity of such operat......A new general Hormander type condition involving anisotropies and mixed norms is introduced, and boundedness results for Fourier multi- pliers on anisotropic Besov and Triebel-Lizorkin spaces of distributions with mixed Lebesgue norms are obtained. As an application, the continuity...

  19. Anisotropic behavior of quantum transport in graphene superlattices

    DEFF Research Database (Denmark)

    Pedersen, Jesper Goor; Cummings, Aron W.; Roche, Stephan

    2014-01-01

    We report on the possibility to generate highly anisotropic quantum conductivity in disordered graphene-based superlattices. Our quantum simulations, based on an efficient real-space implementation of the Kubo-Greenwood formula, show that in disordered graphene superlattices the strength of multi......We report on the possibility to generate highly anisotropic quantum conductivity in disordered graphene-based superlattices. Our quantum simulations, based on an efficient real-space implementation of the Kubo-Greenwood formula, show that in disordered graphene superlattices the strength...

  20. Integral superposition of paraxial Gaussian beams in inhomogeneous anisotropic layered structures in Cartesian coordinates

    Czech Academy of Sciences Publication Activity Database

    Červený, V.; Pšenčík, Ivan

    2015-01-01

    Roč. 25, - (2015), s. 109-155 ISSN 2336-3827 Institutional support: RVO:67985530 Keywords : integral superposition of paraxial Gaussian beams * inhomogeneous anisotropic media * S waves in weakly anisotropic media Subject RIV: DC - Siesmology, Volcanology, Earth Structure

  1. Spontaneous, generalized lipidosis in captive greater horseshoe bats (Rhinolophus ferrumequinum).

    Science.gov (United States)

    Gozalo, Alfonso S; Schwiebert, Rebecca S; Metzner, Walter; Lawson, Gregory W

    2005-11-01

    During a routine 6-month quarantine period, 3 of 34 greater horseshoe bats (Rhinolophus ferrumequinum) captured in mainland China and transported to the United States for use in echolocation studies were found dead with no prior history of illness. All animals were in good body condition at the time of death. At necropsy, a large amount of white fat was found within the subcutis, especially in the sacrolumbar region. The liver, kidneys, and heart were diffusely tan in color. Microscopic examination revealed that hepatocytes throughout the liver were filled with lipid, and in some areas, lipid granulomas were present. renal lesions included moderate amounts of lipid in the cortical tubular epithelium and large amounts of protein and lipid within Bowman's capsules in the glomeruli. In addition, one bat had large lipid vacuoles diffusely distributed throughout the myocardium. The exact pathologic mechanism inducing the hepatic, renal, and cardiac lipidosis is unknown. The horseshoe bats were captured during hibernation and immediately transported to the United States. It is possible that the large amount of fat stored coupled with changes in photoperiod, lack of exercise, and/or the stress of captivity might have contributed to altering the normal metabolic processes, leading to anorexia and consequently lipidosis in these animals.

  2. Diffusing diffusivity: Rotational diffusion in two and three dimensions

    Science.gov (United States)

    Jain, Rohit; Sebastian, K. L.

    2017-06-01

    We consider the problem of calculating the probability distribution function (pdf) of angular displacement for rotational diffusion in a crowded, rearranging medium. We use the diffusing diffusivity model and following our previous work on translational diffusion [R. Jain and K. L. Sebastian, J. Phys. Chem. B 120, 3988 (2016)], we show that the problem can be reduced to that of calculating the survival probability of a particle undergoing Brownian motion, in the presence of a sink. We use the approach to calculate the pdf for the rotational motion in two and three dimensions. We also propose new dimensionless, time dependent parameters, αr o t ,2 D and αr o t ,3 D, which can be used to analyze the experimental/simulation data to find the extent of deviation from the normal behavior, i.e., constant diffusivity, and obtain explicit analytical expressions for them, within our model.

  3. Diffusion in solids

    International Nuclear Information System (INIS)

    Tiwari, G.P.; Kale, G.B.; Patil, R.V.

    1999-01-01

    The article presents a brief survey of process of diffusion in solids. It is emphasised that the essence of diffusion is the mass transfer through the atomic jumps. To begin with formal equations for diffusion coefficient are presented. This is followed by discussions on mechanisms of diffusion. Except for solutes which form interstitial solid solution, diffusion in majority of cases is mediated through exchange of sites between an atom and its neighbouring vacancy. Various vacancy parameters such as activation volume, correlation factor, mass effect etc are discussed and their role in establishing the mode of diffusion is delineated. The contribution of dislocations and grain boundaries in diffusion process is brought out. The experimental determination of different types of diffusion coefficients are described. Finally, the pervasive nature of diffusion process in number of commercial processes is outlined to show the importance of diffusion studies in materials science and technology. (author)

  4. Tunable plasmon resonances in anisotropic metal nanostructures

    Science.gov (United States)

    Penninkhof, J. J.

    2006-09-01

    Coherent oscillations of free electrons in a metal, localized in a small volume or at an interface between a metal and a dielectric medium, have attracted a lot of attention in the past decades. These so-called surface plasmons have special optical properties that can be used in many applications ranging from optoelectronics to sensing of small quantities of molecules. One of the key issues is that electromagnetic energy can be confined to a relatively small volume close to the metal surface. This field enhancement and the resonance frequency strongly depend on the shape and size of the metal structures. In this thesis, several fabrication methods to create these metal structures on the nanometer to micrometer scale are presented. The optical properties are studied with a special emphasis on the effect of shape anisotropy. Self-assembled 2D colloidal crystals are used as mask to fabricate arrays of metal triangles on a substrate. One of the limitations of this nanosphere lithography technique is that the size of the holes in the colloidal mask (through which the metal is evaporated) is determined by the size of the colloids in the mask. The masks, however, can be modified by use of MeV ion beams and/or wet-chemical growth of a thin layer of silica, resulting in a reduced hole size. Arbitrary symmetry and spacing can be obtained by use of optical tweezers and angle-resolved metal deposition. In contrast to pure metals, amorphous materials like silica are known to show anisotropic plastic deformation at constant volume when subject to MeV ion irradiation. Gold cores embedded in a silica matrix, however, show an elongation along the direction of the ion beam, whereas silver cores rather disintegrate. Silver nanocrystals in an ion-exchanged soda-lime glass redistribute themselves in arrays along the ion beam direction. The optical extinction becomes polarization-dependent, with red- and blue-shifts of the plasmon resonances for polarizations longitudinal and transverse

  5. A Morphing framework to couple non-local and local anisotropic continua

    KAUST Repository

    Azdoud, Yan

    2013-05-01

    In this article, we develop a method to couple anisotropic local continua with anisotropic non-local continua with central long-range forces. First, we describe anisotropic non-local models based on spherical harmonic descriptions. We then derive compatible classic continuum models. Finally, we apply the morphing method to these anisotropic non-local models and present three-dimensional numerical examples to validate the efficiency of the technique. © 2013 Elsevier Ltd. All rights reserved.

  6. Anisotropic mechanical properties and Stone-Wales defects in graphene monolayer: A theoretical study

    International Nuclear Information System (INIS)

    Fan, B.B.; Yang, X.B.; Zhang, R.

    2010-01-01

    We investigate the mechanical properties of graphene monolayer via the density functional theoretical (DFT) method. We find that the strain energies are anisotropic for the graphene under large strain. We attribute the anisotropic feature to the anisotropic sp 2 hybridization in the hexagonal lattice. We further identify that the formation energies of Stone-Wales (SW) defects in the graphene monolayer are determined by the defect concentration and also the direction of applied tensile strain, correlating with the anisotropic feature.

  7. Correlation and prediction of gaseous diffusion coefficients.

    Science.gov (United States)

    Marrero, T. R.; Mason, E. A.

    1973-01-01

    A new correlation method for binary gaseous diffusion coefficients from very low temperatures to 10,000 K is proposed based on an extended principle of corresponding states, and having greater range and accuracy than previous correlations. There are two correlation parameters that are related to other physical quantities and that are predictable in the absence of diffusion measurements. Quantum effects and composition dependence are included, but high-pressure effects are not. The results are directly applicable to multicomponent mixtures.

  8. Diffusion in energy materials: Governing dynamics from atomistic modelling

    Science.gov (United States)

    Parfitt, D.; Kordatos, A.; Filippatos, P. P.; Chroneos, A.

    2017-09-01

    Understanding diffusion in energy materials is critical to optimising the performance of solid oxide fuel cells (SOFCs) and batteries both of which are of great technological interest as they offer high efficiency for cleaner energy conversion and storage. In the present review, we highlight the insights offered by atomistic modelling of the ionic diffusion mechanisms in SOFCs and batteries and how the growing predictive capability of high-throughput modelling, together with our new ability to control compositions and microstructures, will produce advanced materials that are designed rather than chosen for a given application. The first part of the review focuses on the oxygen diffusion mechanisms in cathode and electrolyte materials for SOFCs and in particular, doped ceria and perovskite-related phases with anisotropic structures. The second part focuses on disordered oxides and two-dimensional materials as these are very promising systems for battery applications.

  9. Spin diffusion from an inhomogeneous quench in an integrable system.

    Science.gov (United States)

    Ljubotina, Marko; Žnidarič, Marko; Prosen, Tomaž

    2017-07-13

    Generalized hydrodynamics predicts universal ballistic transport in integrable lattice systems when prepared in generic inhomogeneous initial states. However, the ballistic contribution to transport can vanish in systems with additional discrete symmetries. Here we perform large scale numerical simulations of spin dynamics in the anisotropic Heisenberg XXZ spin 1/2 chain starting from an inhomogeneous mixed initial state which is symmetric with respect to a combination of spin reversal and spatial reflection. In the isotropic and easy-axis regimes we find non-ballistic spin transport which we analyse in detail in terms of scaling exponents of the transported magnetization and scaling profiles of the spin density. While in the easy-axis regime we find accurate evidence of normal diffusion, the spin transport in the isotropic case is clearly super-diffusive, with the scaling exponent very close to 2/3, but with universal scaling dynamics which obeys the diffusion equation in nonlinearly scaled time.

  10. Greater trochanteric fracture with occult intertrochanteric extension.

    Science.gov (United States)

    Reiter, Michael; O'Brien, Seth D; Bui-Mansfield, Liem T; Alderete, Joseph

    2013-10-01

    Proximal femoral fractures are frequently encountered in the emergency department (ED). Prompt diagnosis is paramount as delay will exacerbate the already poor outcomes associated with these injuries. In cases where radiography is negative but clinical suspicion remains high, magnetic resonance imaging (MRI) is the study of choice as it has the capability to depict fractures which are occult on other imaging modalities. Awareness of a particular subset of proximal femoral fractures, namely greater trochanteric fractures, is vital for both radiologists and clinicians since it has been well documented that they invariably have an intertrochanteric component which may require surgical management. The detection of intertrochanteric or cervical extension of greater trochanteric fractures has been described utilizing MRI but is underestimated with both computed tomography (CT) and bone scan. Therefore, if MRI is unavailable or contraindicated, the diagnosis of an isolated greater trochanteric fracture should be met with caution. The importance of avoiding this potential pitfall is demonstrated in the following case of an elderly woman with hip pain and CT demonstrating an isolated greater trochanteric fracture who subsequently returned to the ED with a displaced intertrochanteric fracture.

  11. Butterfly valves: greater use in power plants

    International Nuclear Information System (INIS)

    McCoy, M.

    1975-01-01

    Improvements in butterfly valves, particularly in the areas of automatic control and leak tightness are described. The use of butterfly valves in nuclear power plants is discussed. These uses include service in component cooling, containment cooling, and containment isolation. The outlook for further improvements and greater uses is examined. (U.S.)

  12. Greater Somalia, the never-ending dream?

    DEFF Research Database (Denmark)

    Zoppi, Marco

    2015-01-01

    This paper provides an historical analysis of the concept of Greater Somalia, the nationalist project that advocates the political union of all Somali-speaking people, including those inhabiting areas in current Djibouti, Ethiopia and Kenya. The Somali territorial unification project of “lost...

  13. Diffusion archeology for diffusion progression history reconstruction

    OpenAIRE

    Sefer, Emre; Kingsford, Carl

    2015-01-01

    Diffusion through graphs can be used to model many real-world processes, such as the spread of diseases, social network memes, computer viruses, or water contaminants. Often, a real-world diffusion cannot be directly observed while it is occurring — perhaps it is not noticed until some time has passed, continuous monitoring is too costly, or privacy concerns limit data access. This leads to the need to reconstruct how the present state of the diffusion came to be from partial d...

  14. Pseudo-spectral method using rotated staggered grid for elastic wave propagation in 3D arbitrary anisotropic media

    KAUST Repository

    Zou, Peng

    2017-05-10

    Staggering grid is a very effective way to reduce the Nyquist errors and to suppress the non-causal ringing artefacts in the pseudo-spectral solution of first-order elastic wave equations. However, the straightforward use of a staggered-grid pseudo-spectral method is problematic for simulating wave propagation when the anisotropy level is greater than orthorhombic or when the anisotropic symmetries are not aligned with the computational grids. Inspired by the idea of rotated staggered-grid finite-difference method, we propose a modified pseudo-spectral method for wave propagation in arbitrary anisotropic media. Compared with an existing remedy of staggered-grid pseudo-spectral method based on stiffness matrix decomposition and a possible alternative using the Lebedev grids, the rotated staggered-grid-based pseudo-spectral method possesses the best balance between the mitigation of artefacts and efficiency. A 2D example on a transversely isotropic model with tilted symmetry axis verifies its effectiveness to suppress the ringing artefacts. Two 3D examples of increasing anisotropy levels demonstrate that the rotated staggered-grid-based pseudo-spectral method can successfully simulate complex wavefields in such anisotropic formations.

  15. Plasma diffusion due to magnetic field fluctuations

    International Nuclear Information System (INIS)

    Okuda, H.; Lee, W.W.; Lin, A.T.

    1979-01-01

    Plasma diffusion due to magnetic field fluctuations has been studied in two dimensions for a plasma near thermal equilibrium and when the fluctuations are suprathermal. It is found that near thermal equilibrium electron diffusion varies as B -2 when the collisionless skin depth is greater than the thermal electron gyroradius and is generally smaller than the diffusion due to collisions or electrostatic fluctuations for a low-β plasma. When the suprathermal magnetic fluctuation exists because of macroscopic plasma currents, electron diffusion is enhanced due to the coalescence of current filaments and magnetic islands. Magnetic field energy is found to condense to the longest wavelength available in the system and stays there longer than the electron diffusion time scale

  16. Litrani: a general purpose Monte-Carlo program simulating light propagation in isotropic or anisotropic media

    International Nuclear Information System (INIS)

    Gentit, F.-X.

    2002-01-01

    Litrani is a general purpose Monte-Carlo program simulating light propagation in any type of setup describable by the shapes provided by ROOT. Each shape may be made of a different material. Dielectric constant, absorption length and diffusion length of materials may depend upon wavelength. Dielectric constant and absorption length may be anisotropic. Each face of a volume is either partially or totally in contact with a face of another volume, or covered with some wrapping having defined characteristics of absorption, reflection and diffusion. When in contact with another face of another volume, the possibility exists to have a thin slice of width d and index n between the two faces. The program has various sources of light: spontaneous photons, photons coming from an optical fibre, photons generated by the crossing of particles or photons generated by an electromagnetic shower. The time and wavelength spectra of emitted photons may reproduce any scintillation spectrum. As detectors, phototubes, APD, or any general type of surface or volume detectors may be specified. The aim is to follow each photon until it is absorbed or detected. Quantities to be delivered by the program are the proportion of photons detected, and the time distribution for the arrival of these, or the various ways photons may be lost

  17. Interactive Volume Rendering of Diffusion Tensor Data

    Energy Technology Data Exchange (ETDEWEB)

    Hlawitschka, Mario; Weber, Gunther; Anwander, Alfred; Carmichael, Owen; Hamann, Bernd; Scheuermann, Gerik

    2007-03-30

    As 3D volumetric images of the human body become an increasingly crucial source of information for the diagnosis and treatment of a broad variety of medical conditions, advanced techniques that allow clinicians to efficiently and clearly visualize volumetric images become increasingly important. Interaction has proven to be a key concept in analysis of medical images because static images of 3D data are prone to artifacts and misunderstanding of depth. Furthermore, fading out clinically irrelevant aspects of the image while preserving contextual anatomical landmarks helps medical doctors to focus on important parts of the images without becoming disoriented. Our goal was to develop a tool that unifies interactive manipulation and context preserving visualization of medical images with a special focus on diffusion tensor imaging (DTI) data. At each image voxel, DTI provides a 3 x 3 tensor whose entries represent the 3D statistical properties of water diffusion locally. Water motion that is preferential to specific spatial directions suggests structural organization of the underlying biological tissue; in particular, in the human brain, the naturally occuring diffusion of water in the axon portion of neurons is predominantly anisotropic along the longitudinal direction of the elongated, fiber-like axons [MMM+02]. This property has made DTI an emerging source of information about the structural integrity of axons and axonal connectivity between brain regions, both of which are thought to be disrupted in a broad range of medical disorders including multiple sclerosis, cerebrovascular disease, and autism [Mos02, FCI+01, JLH+99, BGKM+04, BJB+03].

  18. Viscoelastic materials with anisotropic rigid particles: stress-deformation behavior

    NARCIS (Netherlands)

    Sagis, L.M.C.; Linden, van der E.

    2001-01-01

    In this paper we have derived constitutive equations for the stress tensor of a viscoelastic material with anisotropic rigid particles. We have assumed that the material has fading memory. The expressions are valid for slow and small deformations from equilibrium, and for systems that are nearly

  19. Field theoretic approach to structure formation in an anisotropic medium

    International Nuclear Information System (INIS)

    Joy, Minu; Kuriakose, V.C.

    2003-01-01

    Considering a real scalar field distribution which is assumed to be locally anisotropic and coupled to a Bianchi type-I background spacetime, the energy density and pressure associated with the anisotropic matter field distribution are evaluated. The vanishing of the expectation values of the nondiagonal components of T μν allows us to treat the scalar field in complete analogy with the distribution of fluid. The primeval density perturbations produced by the vacuum fluctuations of the scalar field are considered and the Jeans criterion for structure formation is obtained. The metric and matter field perturbations are considered and it is found that for the present anisotropic case the perturbations of the pressure in the radial and tangential directions are different. The Jeans instability is discussed and the Jeans wave number for the present case is evaluated. It is found that for the anisotropic case the Jeans length depends on the velocity of the fluctuations in the radial and transverse directions and thus on the direction of propagation of the perturbations

  20. On the origins of the anisotropic mechanical behaviour of extruded ...

    Indian Academy of Sciences (India)

    This paper presents some experimental investigations about the origins of the anisotropic behaviour in cyclic loadings of AA2017 aluminium alloy. In the first step, fatigue damage evolutions were quantified for controlled proportional cyclic loadings in axial and shear directions. In this stage, the aim was to confirm the ...

  1. Anisotropic cosmological models and generalized scalar tensor theory

    Indian Academy of Sciences (India)

    Abstract. In this paper generalized scalar tensor theory has been considered in the background of anisotropic cosmological models, namely, axially symmetric Bianchi-I, Bianchi-III and Kortowski–. Sachs space-time. For bulk viscous fluid, both exponential and power-law solutions have been stud- ied and some assumptions ...

  2. Anisotropic cosmological models and generalized scalar tensor theory

    Indian Academy of Sciences (India)

    In this paper generalized scalar tensor theory has been considered in the background of anisotropic cosmological models, namely, axially symmetric Bianchi-I, Bianchi-III and Kortowski–Sachs space-time. For bulk viscous fluid, both exponential and power-law solutions have been studied and some assumptions among the ...

  3. Three anisotropic benchmark problems for adaptive finite element methods

    Czech Academy of Sciences Publication Activity Database

    Šolín, Pavel; Čertík, O.; Korous, L.

    2013-01-01

    Roč. 219, č. 13 (2013), s. 7286-7295 ISSN 0096-3003 R&D Projects: GA AV ČR IAA100760702 Institutional support: RVO:61388998 Keywords : benchmark problem * anisotropic solution * boundary layer Subject RIV: BA - General Mathematics Impact factor: 1.600, year: 2013

  4. Fluid-like elasticity induced by anisotropic effective mass density

    DEFF Research Database (Denmark)

    Ma, Guancong; Fu, Caixing; Wang, Guanghao

    We present a three-dimensional anisotropic elastic metamaterial, which can generate dipolar resonances. Repeating these subwavelength units can lead to one-dimensional arrays, which are essentially elastic rods that can withstand both longitudinal, and flexural vibrations. Band structure analysis...

  5. Anisotropic Bianchi-I universe with phantom field and cosmological ...

    Indian Academy of Sciences (India)

    India. *Corresponding author. E-mail: bcpaul@iucaa.ernet.in. MS received 23 May ... We study an anisotropic Bianchi-I universe in the presence of a phantom ... The phantom cosmology has been analysed adopting phase space analysis ... the second part we study the critical points corresponding to the set of autonomous.

  6. Neutron transport in two dissimilar media anisotropic scattering

    International Nuclear Information System (INIS)

    Burkart, A.R.; Ishiguro, Y.; Siewert, C.E.

    1976-01-01

    The elementary solution of the one-speed neutron-transport equation with linearly anisotropic scattering are used in conjunction with Chandrasekhar's invariance principles to solve in a concise manner the Milne problem for two adjoining half-spaces and the critical reactor problem for a reflected slab

  7. Anisotropic plastic deformation by viscous flow in ion tracks

    NARCIS (Netherlands)

    van Dillen, T; Polman, A; Onck, PR; van der Giessen, E

    2005-01-01

    A model describing the origin of ion beam-induced anisotropic plastic deformation is derived and discussed. It is based on a viscoelastic thermal spike model for viscous flow in single ion tracks derived by Trinkaus and Ryazanov. Deviatoric (shear) stresses, brought about by the rapid thermal

  8. Investigation of Tooling for Anisotropic Optical Functional Surfaces

    DEFF Research Database (Denmark)

    Li, Dongya; Regi, Francesco; Zhang, Yang

    This paper studied steel inserts with anisotropic surfaces for injection moulding. The inserts surfaces were machined by a five-axis micro-milling machine and the surface structures will be replicated by injection moulding. The aim of the surface structuring is to maximize visible contrast betwee...

  9. Wave propagation in a general anisotropic poroelastic medium ...

    Indian Academy of Sciences (India)

    equations (Auriault et al 1985) in terms of solid displacement and fluid pressure, whereas Biot's equations were in terms of displacements of both the solid and fluid phases. Homogenisation has proven that .... (8) to (10) imply that, in homogenisation approach, the anisotropic inertial coupling is hiding in the tensor {ˆρij}.

  10. Plasma resonance in anisotropic layered high-Tc superconductors

    DEFF Research Database (Denmark)

    Sakai, Shigeki; Pedersen, Niels Falsig

    1999-01-01

    The plasma resonance is described theoretically by the inductive coupling model for a large stacked Josephson-junction system such as the intrinsic Josephson-junction array in anisotropic high- T-c superconductors. Eigenmodes of the plasma oscillation are analytically described and a numerical...

  11. Anisotropic properties of aligned SWNT modified poly (methyl ...

    Indian Academy of Sciences (India)

    The electrical and mechanical properties of PMMA/SWNT composite were studied as a function of SWNT orientation and concentration. The aligned SWNT modified PMMA/SWNT composite presented highly anisotropic properties. The experimental results showed that the electrical conductivity and mechanical properties of ...

  12. Crystal structure of vanadite: Refinement of anisotropic displacement parameters

    Czech Academy of Sciences Publication Activity Database

    Laufek, F.; Skála, Roman; Haloda, J.; Císařová, I.

    2006-01-01

    Roč. 51, 3-4 (2006), s. 271-275 ISSN 1210-8197 Institutional research plan: CEZ:AV0Z30130516 Keywords : anisotropic displacement parameter * crystal structure * single-crystal X-ray refinement * vanadinite Subject RIV: DB - Geology ; Mineralogy

  13. Comparison of two anisotropic layer models applied to induction motors

    NARCIS (Netherlands)

    Sprangers, R.L.J.; Paulides, J.J.H.; Boynov, K.O.; Waarma, J.; Lomonova, E.

    2013-01-01

    A general description of the Anisotropic Layer Theory, derived in the polar coordinate system, and applied to the analysis of squirrel-cage induction motors (IMs), is presented. The theory considers non-conductive layers, layer with predefined current density and layers with induced current density.

  14. Fourth-order discrete anisotropic boundary-value problems

    Directory of Open Access Journals (Sweden)

    Maciej Leszczynski

    2015-09-01

    Full Text Available In this article we consider the fourth-order discrete anisotropic boundary value problem with both advance and retardation. We apply the direct method of the calculus of variations and the mountain pass technique to prove the existence of at least one and at least two solutions. Non-existence of non-trivial solutions is also undertaken.

  15. Remarks on the percolation problem in anisotropic systems

    International Nuclear Information System (INIS)

    Chaves, C.M.G.F.; Oliveira, P.M.C. de; Queiroz, S.L.A. de; Riera, R.

    1979-07-01

    The bond percolation problem is discused in an anisotropic square lattice using the position space renormalization group. It is shown that, due to symmetry, this treatment reproduces known exact results for this problem. The phase diagram and the flow lines in parameter space are also shown. Results are in agreement with universality.(Author) [pt

  16. Anisotropic colloids: bulk phase behavior and equilibrium sedimentation

    NARCIS (Netherlands)

    Marechal, M.A.T.

    2009-01-01

    This thesis focuses on the phase behavior of anisotropically shaped (i.e. non-spherical) colloids using computer simulations. Only hard-core interactions between the colloids are taken into account to investigate the effects of shape alone. The bulk phase behavior of three different shapes of

  17. Theory of Spin Waves in Strongly Anisotropic Magnets

    DEFF Research Database (Denmark)

    Lindgård, Per-Anker; Cooke, J. F.

    1976-01-01

    A new infinite-order perturbation approach to the theory of spin waves in strongly anisotropic magnets is introduced. The system is transformed into one with effective two-ion anisotropy and considerably reduced ground-state corrections. A general expression for the spin-wave energy, valid to any...

  18. Anisotropic Born-Mayer potential in lattice dynamics of Vanadium

    International Nuclear Information System (INIS)

    Onwuagba, B.N.

    1988-01-01

    A microscopic theory of the lattice dynamics of the transition metal vanadium is developed based on the Animalu's transition metal model potential (TMMP). The Born-Mayer potential associated with the distribution of the transition metal d-electrons is treated as anisotropic. Good agreement with experimental phonon dispersion curves longitudinal branches in the [111] direction

  19. Anisotropic ordering in a two-temperature lattice gas

    DEFF Research Database (Denmark)

    Szolnoki, Attila; Szabó, György; Mouritsen, Ole G.

    1997-01-01

    We consider a two-dimensional lattice gas model with repulsive nearest- and next-nearest-neighbor interactions that evolves in time according to anisotropic Kawasaki dynamics. The hopping of particles along the principal directions is governed by two heat baths at different temperatures T-x and T...

  20. Characterization of highly anisotropic three-dimensionally nanostructured surfaces

    International Nuclear Information System (INIS)

    Schmidt, Daniel

    2014-01-01

    Generalized ellipsometry, a non-destructive optical characterization technique, is employed to determine geometrical structure parameters and anisotropic dielectric properties of highly spatially coherent three-dimensionally nanostructured thin films grown by glancing angle deposition. The (piecewise) homogeneous biaxial layer model approach is discussed, which can be universally applied to model the optical response of sculptured thin films with different geometries and from diverse materials, and structural parameters as well as effective optical properties of the nanostructured thin films are obtained. Alternative model approaches for slanted columnar thin films, anisotropic effective medium approximations based on the Bruggeman formalism, are presented, which deliver results comparable to the homogeneous biaxial layer approach and in addition provide film constituent volume fraction parameters as well as depolarization or shape factors. Advantages of these ellipsometry models are discussed on the example of metal slanted columnar thin films, which have been conformally coated with a thin passivating oxide layer by atomic layer deposition. Furthermore, the application of an effective medium approximation approach to in-situ growth monitoring of this anisotropic thin film functionalization process is presented. It was found that structural parameters determined with the presented optical model equivalents for slanted columnar thin films agree very well with scanning electron microscope image estimates. - Highlights: • Summary of optical model strategies for sculptured thin films with arbitrary geometries • Application of the rigorous anisotropic Bruggeman effective medium applications • In-situ growth monitoring of atomic layer deposition on biaxial metal slanted columnar thin film