Multimodel analysis of anisotropic diffusive tracer-gas transport in a deep arid unsaturated zone

Science.gov (United States)

Green, Christopher T.; Walvoord, Michelle Ann; Andraski, Brian J.; Striegl, Robert G.; Stonestrom, David A.

2015-01-01

Gas transport in the unsaturated zone affects contaminant flux and remediation, interpretation of groundwater travel times from atmospheric tracers, and mass budgets of environmentally important gases. Although unsaturated zone transport of gases is commonly treated as dominated by diffusion, the characteristics of transport in deep layered sediments remain uncertain. In this study, we use a multimodel approach to analyze results of a gas-tracer (SF6) test to clarify characteristics of gas transport in deep unsaturated alluvium. Thirty-five separate models with distinct diffusivity structures were calibrated to the tracer-test data and were compared on the basis of Akaike Information Criteria estimates of posterior model probability. Models included analytical and numerical solutions. Analytical models provided estimates of bulk-scale apparent diffusivities at the scale of tens of meters. Numerical models provided information on local-scale diffusivities and feasible lithological features producing the observed tracer breakthrough curves. The combined approaches indicate significant anisotropy of bulk-scale diffusivity, likely associated with high-diffusivity layers. Both approaches indicated that diffusivities in some intervals were greater than expected from standard models relating porosity to diffusivity. High apparent diffusivities and anisotropic diffusivity structures were consistent with previous observations at the study site of rapid lateral transport and limited vertical spreading of gas-phase contaminants. Additional processes such as advective oscillations may be involved. These results indicate that gases in deep, layered unsaturated zone sediments can spread laterally more quickly, and produce higher peak concentrations, than predicted by homogeneous, isotropic diffusion models.

Analysis of the Numerical Diffusion in Anisotropic Mediums: Benchmarks for Magnetic Field Aligned Meshes in Space Propulsion Simulations

Directory of Open Access Journals (Sweden)

Daniel Pérez-Grande

2016-11-01

Full Text Available This manuscript explores numerical errors in highly anisotropic diffusion problems. First, the paper addresses the use of regular structured meshes in numerical solutions versus meshes aligned with the preferential directions of the problem. Numerical diffusion in structured meshes is quantified by solving the classical anisotropic diffusion problem; the analysis is exemplified with the application to a numerical model of conducting fluids under magnetic confinement, where rates of transport in directions parallel and perpendicular to a magnetic field are quite different. Numerical diffusion errors in this problem promote the use of magnetic field aligned meshes (MFAM. The generation of this type of meshes presents some challenges; several meshing strategies are implemented and analyzed in order to provide insight into achieving acceptable mesh regularity. Second, Gradient Reconstruction methods for magnetically aligned meshes are addressed and numerical errors are compared for the structured and magnetically aligned meshes. It is concluded that using the latter provides a more correct and straightforward approach to solving problems where anisotropicity is present, especially, if the anisotropicity level is high or difficult to quantify. The conclusions of the study may be extrapolated to the study of anisotropic flows different from conducting fluids.

Survey on visualization and analysis techniques based on diffusion MRI for in-vivo anisotropic diffusion structures

International Nuclear Information System (INIS)

Masutani, Yoshitaka; Sato, Tetsuo; Urayama, Shin-ichi; Bihan, D.L.

2008-01-01

In association with development of diffusion MR imaging technologies for anisotropic diffusion measurement in living body, related research is explosively increasing including research fields of applied mathematics and visualization in addition to MR imaging, biomedical image technology, and medical science. One of the reasons is that the diffusion MRI data set is a set of high dimensional image information beyond conventional scalar or vector images, and is attractive for the researchers in the related fields. This survey paper is mainly aimed at introducing state-of-the-art of post processing techniques reported in the literature for diffusion MRI data, such as analysis and visualization. (author)

Development and application of an exchange model for anisotropic water diffusion in the microporous MOF aluminum fumarate

Science.gov (United States)

Splith, Tobias; Fröhlich, Dominik; Henninger, Stefan K.; Stallmach, Frank

2018-06-01

Diffusion of water in aluminum fumarate was studied by means of pulsed field gradient (PFG) nuclear magnetic resonance (NMR). Due to water molecules exchanging between the intracrystalline anisotropic pore space and the isotropic intercrystalline void space the model of intracrystalline anisotropic diffusion fails to describe the experimental PFG NMR data at high observation times. Therefore, the two-site exchange model developed by Kärger is extended to the case of exchange between an anisotropic and an isotropic site. This extended exchange model is solved by numerical integration. It describes the experimental data very well and yields values for the intracrystalline diffusion coefficient and the mean residence times of the respective sites. Further PFG NMR studies were performed with coatings consisting of small aluminum fumarate crystals, which are used in adsorptive heat transformation applications. The diffusion coefficients of water in the small crystal coating are compared to the values expected from the extended two-site exchange model and from the model of long-range diffusion.

Artifact reduction of compressed images and video combining adaptive fuzzy filtering and directional anisotropic diffusion

DEFF Research Database (Denmark)

Nadernejad, Ehsan; Forchhammer, Søren; Korhonen, Jari

2011-01-01

and ringing artifacts, we have applied directional anisotropic diffusion. Besides that, the selection of the adaptive threshold parameter for the diffusion coefficient has also improved the performance of the algorithm. Experimental results on JPEG compressed images as well as MJPEG and H.264 compressed......Fuzzy filtering is one of the recently developed methods for reducing distortion in compressed images and video. In this paper, we combine the powerful anisotropic diffusion equations with fuzzy filtering in order to reduce the impact of artifacts. Based on the directional nature of the blocking...... videos show improvement in artifact reduction of the proposed algorithm over other directional and spatial fuzzy filters....

Multiresolution, Multi-Scale Target Identification and Tracking using the Anisotropic Diffusion Pyramid

National Research Council Canada - National Science Library

Acton, Scott

1998-01-01

...: the anisotropic diffusion pyramid and the morphological pyramid. Coarse-to-fine target searches are implemented within the image pyramids, providing a lOOX improvement in computational expense over standard correlation-based approaches...

Speckle reduction in echocardiography by temporal compounding and anisotropic diffusion filtering

Science.gov (United States)

Giraldo-Guzmán, Jader; Porto-Solano, Oscar; Cadena-Bonfanti, Alberto; Contreras-Ortiz, Sonia H.

2015-01-01

Echocardiography is a medical imaging technique based on ultrasound signals that is used to evaluate heart anatomy and physiology. Echocardiographic images are affected by speckle, a type of multiplicative noise that obscures details of the structures, and reduces the overall image quality. This paper shows an approach to enhance echocardiography using two processing techniques: temporal compounding and anisotropic diffusion filtering. We used twenty echocardiographic videos that include one or three cardiac cycles to test the algorithms. Two images from each cycle were aligned in space and averaged to obtain the compound images. These images were then processed using anisotropic diffusion filters to further improve their quality. Resultant images were evaluated using quality metrics and visual assessment by two medical doctors. The average total improvement on signal-to-noise ratio was up to 100.29% for videos with three cycles, and up to 32.57% for videos with one cycle.

An Efficient FPGA Implementation of Optimized Anisotropic Diffusion Filtering of Images

Directory of Open Access Journals (Sweden)

Chandrajit Pal

2016-01-01

Full Text Available Digital image processing is an exciting area of research with a variety of applications including medical, surveillance security systems, defence, and space applications. Noise removal as a preprocessing step helps to improve the performance of the signal processing algorithms, thereby enhancing image quality. Anisotropic diffusion filtering proposed by Perona and Malik can be used as an edge-preserving smoother, removing high-frequency components of images without blurring their edges. In this paper, we present the FPGA implementation of an edge-preserving anisotropic diffusion filter for digital images. The designed architecture completely replaced the convolution operation and implemented the same using simple arithmetic subtraction of the neighboring intensities within a kernel, preceded by multiple operations in parallel within the kernel. To improve the image reconstruction quality, the diffusion coefficient parameter, responsible for controlling the filtering process, has been properly analyzed. Its signal behavior has been studied by subsequently scaling and differentiating the signal. The hardware implementation of the proposed design shows better performance in terms of reconstruction quality and accelerated performance with respect to its software implementation. It also reduces computation, power consumption, and resource utilization with respect to other related works.

Patch-based anisotropic diffusion scheme for fluorescence diffuse optical tomography—part 1: technical principles

International Nuclear Information System (INIS)

Correia, Teresa; Arridge, Simon

2016-01-01

Fluorescence diffuse optical tomography (fDOT) provides 3D images of fluorescence distributions in biological tissue, which represent molecular and cellular processes. The image reconstruction problem is highly ill-posed and requires regularisation techniques to stabilise and find meaningful solutions. Quadratic regularisation tends to either oversmooth or generate very noisy reconstructions, depending on the regularisation strength. Edge preserving methods, such as anisotropic diffusion regularisation (AD), can preserve important features in the fluorescence image and smooth out noise. However, AD has limited ability to distinguish an edge from noise. In this two-part paper, we propose a patch-based anisotropic diffusion regularisation (PAD), where regularisation strength is determined by a weighted average according to the similarity between patches around voxels within a search window, instead of a simple local neighbourhood strategy. However, this method has higher computational complexity and, hence, we wavelet compress the patches (PAD-WT) to speed it up, while simultaneously taking advantage of the denoising properties of wavelet thresholding. The proposed method combines the nonlocal means (NLM), AD and wavelet shrinkage methods, which are image processing methods. Therefore, in this first paper, we used a denoising test problem to analyse the performance of the new method. Our results show that the proposed PAD-WT method provides better results than the AD or NLM methods alone. The efficacy of the method for fDOT image reconstruction problem is evaluated in part 2. (paper)

Imaging of postthalamic visual fiber tracts by anisotropic diffusion weighted MRI and diffusion tensor imaging: principles and applications

International Nuclear Information System (INIS)

Reinges, Marcus H.T.; Schoth, Felix; Coenen, Volker A.; Krings, Timo

2004-01-01

Diffusion weighted MRI offers the possibility to study the course of the cerebral white matter tracts. In the present manuscript, the basics, the technique and the limitations of diffusion tensor imaging and anisotropic diffusion weighted MRI are presented and their applications in various neurological and neurosurgical diseases are discussed with special emphasis on the visual system. A special focus is laid on the combination of fiber tract imaging, anatomical imaging and functional MRI for presurgical planning and intraoperative neuronavigation of lesions near the visual system

Edge Probability and Pixel Relativity-Based Speckle Reducing Anisotropic Diffusion.

Science.gov (United States)

Mishra, Deepak; Chaudhury, Santanu; Sarkar, Mukul; Soin, Arvinder Singh; Sharma, Vivek

2018-02-01

Anisotropic diffusion filters are one of the best choices for speckle reduction in the ultrasound images. These filters control the diffusion flux flow using local image statistics and provide the desired speckle suppression. However, inefficient use of edge characteristics results in either oversmooth image or an image containing misinterpreted spurious edges. As a result, the diagnostic quality of the images becomes a concern. To alleviate such problems, a novel anisotropic diffusion-based speckle reducing filter is proposed in this paper. A probability density function of the edges along with pixel relativity information is used to control the diffusion flux flow. The probability density function helps in removing the spurious edges and the pixel relativity reduces the oversmoothing effects. Furthermore, the filtering is performed in superpixel domain to reduce the execution time, wherein a minimum of 15% of the total number of image pixels can be used. For performance evaluation, 31 frames of three synthetic images and 40 real ultrasound images are used. In most of the experiments, the proposed filter shows a better performance as compared to the state-of-the-art filters in terms of the speckle region's signal-to-noise ratio and mean square error. It also shows a comparative performance for figure of merit and structural similarity measure index. Furthermore, in the subjective evaluation, performed by the expert radiologists, the proposed filter's outputs are preferred for the improved contrast and sharpness of the object boundaries. Hence, the proposed filtering framework is suitable to reduce the unwanted speckle and improve the quality of the ultrasound images.

3-D anisotropic neutron diffusion in optically thick media with optically thin channels

International Nuclear Information System (INIS)

Trahan, Travis J.; Larsen, Edward W.

2011-01-01

Standard neutron diffusion theory accurately approximates the neutron transport process for optically thick, scattering-dominated systems in which the angular neutron flux is a weak (nearly linear) function of angle. Therefore, standard diffusion theory is not directly applicable for Very High Temperature Reactor (VHTR) cores, which contain numerous narrow, axially-oriented, nearly-voided coolant channels. However, we have derived a new, accurate diffusion equation for such problems, which contains nonstandard anisotropic diffusion coefficients near and within the channels, but which reduces to the standard diffusion approximation away from the channels. The new diffusion approximation significantly improves the accuracy of VHTR diffusion simulations, while having lower computational cost than higher-order transport methods. (author)

Understanding the anisotropic strain effects on lithium diffusion in graphite anodes: A first-principles study

Science.gov (United States)

Ji, Xiang; Wang, Yang; Zhang, Junqian

2018-06-01

The lithium diffusion in graphite anode, which is the most widely used commercial electrode material today, affects the charge/discharge performance of lithium-ion batteries. In this study, the anisotropic strain effects on lithium diffusion in graphite anodes are systematically investigated using first-principles calculations based on density functional theory (DFT) with van der Waals corrections. It is found that the effects of external applied strains along various directions of LixC6 (i.e., perpendicular or parallel to the basal planes of the graphite host) on lithium diffusivity are different. Along the direction perpendicular to the graphite planes, the tensile strain facilitates in-plane Li diffusion by reducing the energy barrier, and the compressive strain hinders in-plane Li diffusion by raising the energy barrier. In contrast, the in-plane biaxial tensile strain (parallel to the graphite planes) hinders in-plane Li diffusion, and the in-plane biaxial compressive strain facilitates in-plane Li diffusion. Furthermore, both in-plane and transverse shear strains slightly influence Li diffusion in graphite anodes. A discussion is presented to explain the anisotropic strain dependence of lithium diffusion. This research provides data for the continuum modelling of the electrodes in the lithium-ion batteries.

Patch-based anisotropic diffusion scheme for fluorescence diffuse optical tomography--part 2: image reconstruction.

Science.gov (United States)

Correia, Teresa; Koch, Maximilian; Ale, Angelique; Ntziachristos, Vasilis; Arridge, Simon

2016-02-21

Fluorescence diffuse optical tomography (fDOT) provides 3D images of fluorescence distributions in biological tissue, which represent molecular and cellular processes. The image reconstruction problem is highly ill-posed and requires regularisation techniques to stabilise and find meaningful solutions. Quadratic regularisation tends to either oversmooth or generate very noisy reconstructions, depending on the regularisation strength. Edge preserving methods, such as anisotropic diffusion regularisation (AD), can preserve important features in the fluorescence image and smooth out noise. However, AD has limited ability to distinguish an edge from noise. We propose a patch-based anisotropic diffusion regularisation (PAD), where regularisation strength is determined by a weighted average according to the similarity between patches around voxels within a search window, instead of a simple local neighbourhood strategy. However, this method has higher computational complexity and, hence, we wavelet compress the patches (PAD-WT) to speed it up, while simultaneously taking advantage of the denoising properties of wavelet thresholding. Furthermore, structural information can be incorporated into the image reconstruction with PAD-WT to improve image quality and resolution. In this case, the weights used to average voxels in the image are calculated using the structural image, instead of the fluorescence image. The regularisation strength depends on both structural and fluorescence images, which guarantees that the method can preserve fluorescence information even when it is not structurally visible in the anatomical images. In part 1, we tested the method using a denoising problem. Here, we use simulated and in vivo mouse fDOT data to assess the algorithm performance. Our results show that the proposed PAD-WT method provides high quality and noise free images, superior to those obtained using AD.

Numerical analysis of anisotropic diffusion effect on ICF hydrodynamic instabilities

Directory of Open Access Journals (Sweden)

Olazabal-Loumé M.

2013-11-01

Full Text Available The effect of anisotropic diffusion on hydrodynamic instabilities in the context of Inertial Confinement Fusion (ICF flows is numerically assessed. This anisotropy occurs in indirect-drive when laminated ablators are used to modify the lateral transport [1,2]. In direct-drive, non-local transport mechanisms and magnetic fields may modify the lateral conduction [3]. In this work, numerical simulations obtained with the code PERLE [4], dedicated to linear stability analysis, are compared with previous theoretical results [5]. In these approaches, the diffusion anisotropy can be controlled by a characteristic coefficient which enables a comprehensive study. This work provides new results on the ablative Rayleigh-Taylor (RT, ablative Richtmyer-Meshkov (RM and Darrieus-Landau (DL instabilities.

Inverse anisotropic diffusion from power density measurements in two dimensions

International Nuclear Information System (INIS)

Monard, François; Bal, Guillaume

2012-01-01

This paper concerns the reconstruction of an anisotropic diffusion tensor γ = (γ ij ) 1⩽i,j⩽2 from knowledge of internal functionals of the form γ∇u i · ∇u j with u i for 1 ⩽ i ⩽ I solutions of the elliptic equation ∇ · γ∇u i = 0 on a two-dimensional bounded domain with appropriate boundary conditions. We show that for I = 4 and appropriately chosen boundary conditions, γ may uniquely and stably be reconstructed from such internal functionals, which appear in coupled-physics inverse problems involving the ultrasound modulation of electrical or optical coefficients. Explicit reconstruction procedures for the diffusion tensor are presented and implemented numerically. (paper)

Speckle Reduction and Structure Enhancement by Multichannel Median Boosted Anisotropic Diffusion

Directory of Open Access Journals (Sweden)

Yang Zhi

2004-01-01

Full Text Available We propose a new approach to reduce speckle noise and enhance structures in speckle-corrupted images. It utilizes a median-anisotropic diffusion compound scheme. The median-filter-based reaction term acts as a guided energy source to boost the structures in the image being processed. In addition, it regularizes the diffusion equation to ensure the existence and uniqueness of a solution. We also introduce a decimation and back reconstruction scheme to further enhance the processing result. Before the iteration of the diffusion process, the image is decimated and a subpixel shifted image set is formed. This allows a multichannel parallel diffusion iteration, and more importantly, the speckle noise is broken into impulsive or salt-pepper noise, which is easy to remove by median filtering. The advantage of the proposed technique is clear when it is compared to other diffusion algorithms and the well-known adaptive weighted median filtering (AWMF scheme in both simulation and real medical ultrasound images.

A review of anisotropic conductivity models of brain white matter based on diffusion tensor imaging.

Science.gov (United States)

Wu, Zhanxiong; Liu, Yang; Hong, Ming; Yu, Xiaohui

2018-06-01

The conductivity of brain tissues is not only essential for electromagnetic source estimation (ESI), but also a key reflector of the brain functional changes. Different from the other brain tissues, the conductivity of whiter matter (WM) is highly anisotropic and a tensor is needed to describe it. The traditional electrical property imaging methods, such as electrical impedance tomography (EIT) and magnetic resonance electrical impedance tomography (MREIT), usually fail to image the anisotropic conductivity tensor of WM with high spatial resolution. The diffusion tensor imaging (DTI) is a newly developed technique that can fulfill this purpose. This paper reviews the existing anisotropic conductivity models of WM based on the DTI and discusses their advantages and disadvantages, as well as identifies opportunities for future research on this subject. It is crucial to obtain the linear conversion coefficient between the eigenvalues of anisotropic conductivity tensor and diffusion tensor, since they share the same eigenvectors. We conclude that the electrochemical model is suitable for ESI analysis because the conversion coefficient can be directly obtained from the concentration of ions in extracellular liquid and that the volume fraction model is appropriate to study the influence of WM structural changes on electrical conductivity. Graphical abstract ᅟ.

Anisotropic Thermal Diffusivities of Plasma-Sprayed Thermal Barrier Coatings

Science.gov (United States)

Akoshima, Megumi; Takahashi, Satoru

2017-09-01

Thermal barrier coatings (TBCs) are used to shield the blades of gas turbines from heat and wear. There is a pressing need to evaluate the thermal conductivity of TBCs in the thermal design of advanced gas turbines with high energy efficiency. These TBCs consist of a ceramic-based top coat and a bond coat on a superalloy substrate. Usually, the focus is on the thermal conductivity in the thickness direction of the TBC because heat tends to diffuse from the surface of the top coat to the substrate. However, the in-plane thermal conductivity is also important in the thermal design of gas turbines because the temperature distribution within the turbine cannot be ignored. Accordingly, a method is developed in this study for measuring the in-plane thermal diffusivity of the top coat. Yttria-stabilized zirconia top coats are prepared by thermal spraying under different conditions. The in-plane and cross-plane thermal diffusivities of the top coats are measured by the flash method to investigate the anisotropy of thermal conduction in a TBC. It is found that the in-plane thermal diffusivity is higher than the cross-plane one for each top coat and that the top coats have significantly anisotropic thermal diffusivity. The cross-sectional and in-plane microstructures of the top coats are observed, from which their porosities are evaluated. The thermal diffusivity and its anisotropy are discussed in detail in relation to microstructure and porosity.

Effects of anisotropic turbulent thermal diffusion on spherical magnetoconvection in the Earth's core

Science.gov (United States)

Ivers, D. J.; Phillips, C. G.

2018-03-01

We re-consider the plate-like model of turbulence in the Earth's core, proposed by Braginsky and Meytlis (1990), and show that it is plausible for core parameters not only in polar regions but extends to mid- and low-latitudes where rotation and gravity are not parallel, except in a very thin equatorial layer. In this model the turbulence is highly anisotropic with preferred directions imposed by the Earth's rotation and the magnetic field. Current geodynamo computations effectively model sub-grid scale turbulence by using isotropic viscous and thermal diffusion values significantly greater than the molecular values of the Earth's core. We consider a local turbulent dynamo model for the Earth's core in which the mean magnetic field, velocity and temperature satisfy the Boussinesq induction, momentum and heat equations with an isotropic turbulent Ekman number and Roberts number. The anisotropy is modelled only in the thermal diffusion tensor with the Earth's rotation and magnetic field as preferred directions. Nonlocal organising effects of gravity and rotation (but not aspect ratio in the Earth's core) such as an inverse cascade and nonlocal transport are assumed to occur at longer length scales, which computations may accurately capture with sufficient resolution. To investigate the implications of this anisotropy for the proposed turbulent dynamo model we investigate the linear instability of turbulent magnetoconvection on length scales longer than the background turbulence in a rotating sphere with electrically insulating exterior for no-slip and isothermal boundary conditions. The equations are linearised about an axisymmetric basic state with a conductive temperature, azimuthal magnetic field and differential rotation. The basic state temperature is a function of the anisotropy and the spherical radius. Elsasser numbers in the range 1-20 and turbulent Roberts numbers 0.01-1 are considered for both equatorial symmetries of the magnetic basic state. It is found

Estimating anisotropic diffusion of neutrons near the boundary of a pebble bed random system

Energy Technology Data Exchange (ETDEWEB)

Vasques, R. [Department of Mathematics, Center for Computational Engineering Science, RWTH Aachen University, Schinkel Strasse 2, D-52062 Aachen (Germany)

2013-07-01

Due to the arrangement of the pebbles in a Pebble Bed Reactor (PBR) core, if a neutron is located close to a boundary wall, its path length probability distribution function in directions of flight parallel to the wall is significantly different than in other directions. Hence, anisotropic diffusion of neutrons near the boundaries arises. We describe an analysis of neutron transport in a simplified 3-D pebble bed random system, in which we investigate the anisotropic diffusion of neutrons born near one of the system's boundary walls. While this simplified system does not model the actual physical process that takes place near the boundaries of a PBR core, the present work paves the road to a formulation that may enable more accurate diffusion simulations of such problems to be performed in the future. Monte Carlo codes have been developed for (i) deriving realizations of the 3-D random system, and (ii) performing 3-D neutron transport inside the heterogeneous model; numerical results are presented for three different choices of parameters. These numerical results are used to assess the accuracy of estimates for the mean-squared displacement of neutrons obtained with the diffusion approximations of the Atomic Mix Model and of the recently introduced [1] Non-Classical Theory with angular-dependent path length distribution. The Non-Classical Theory makes use of a Generalized Linear Boltzmann Equation in which the locations of the scattering centers in the system are correlated and the distance to collision is not exponentially distributed. We show that the results predicted using the Non-Classical Theory successfully model the anisotropic behavior of the neutrons in the random system, and more closely agree with experiment than the results predicted by the Atomic Mix Model. (authors)

Estimating anisotropic diffusion of neutrons near the boundary of a pebble bed random system

International Nuclear Information System (INIS)

Vasques, R.

2013-01-01

Due to the arrangement of the pebbles in a Pebble Bed Reactor (PBR) core, if a neutron is located close to a boundary wall, its path length probability distribution function in directions of flight parallel to the wall is significantly different than in other directions. Hence, anisotropic diffusion of neutrons near the boundaries arises. We describe an analysis of neutron transport in a simplified 3-D pebble bed random system, in which we investigate the anisotropic diffusion of neutrons born near one of the system's boundary walls. While this simplified system does not model the actual physical process that takes place near the boundaries of a PBR core, the present work paves the road to a formulation that may enable more accurate diffusion simulations of such problems to be performed in the future. Monte Carlo codes have been developed for (i) deriving realizations of the 3-D random system, and (ii) performing 3-D neutron transport inside the heterogeneous model; numerical results are presented for three different choices of parameters. These numerical results are used to assess the accuracy of estimates for the mean-squared displacement of neutrons obtained with the diffusion approximations of the Atomic Mix Model and of the recently introduced [1] Non-Classical Theory with angular-dependent path length distribution. The Non-Classical Theory makes use of a Generalized Linear Boltzmann Equation in which the locations of the scattering centers in the system are correlated and the distance to collision is not exponentially distributed. We show that the results predicted using the Non-Classical Theory successfully model the anisotropic behavior of the neutrons in the random system, and more closely agree with experiment than the results predicted by the Atomic Mix Model. (authors)

Evidence for equivalence of diffusion processes of passive scalar and magnetic fields in anisotropic Navier-Stokes turbulence.

Science.gov (United States)

Jurčišinová, E; Jurčišin, M

2017-05-01

The influence of the uniaxial small-scale anisotropy on the kinematic magnetohydrodynamic turbulence is investigated by using the field theoretic renormalization group technique in the one-loop approximation of a perturbation theory. The infrared stable fixed point of the renormalization group equations, which drives the scaling properties of the model in the inertial range, is investigated as the function of the anisotropy parameters and it is shown that, at least at the one-loop level of approximation, the diffusion processes of the weak passive magnetic field in the anisotropically driven kinematic magnetohydrodynamic turbulence are completely equivalent to the corresponding diffusion processes of passively advected scalar fields in the anisotropic Navier-Stokes turbulent environments.

An efficient explicit numerical scheme for diffusion-type equations with a highly inhomogeneous and highly anisotropic diffusion tensor

International Nuclear Information System (INIS)

Larroche, O.

2007-01-01

A locally split-step explicit (LSSE) algorithm was developed for efficiently solving a multi-dimensional advection-diffusion type equation involving a highly inhomogeneous and highly anisotropic diffusion tensor, which makes the problem very ill-conditioned for standard implicit methods involving the iterative solution of large linear systems. The need for such an optimized algorithm arises, in particular, in the frame of thermonuclear fusion applications, for the purpose of simulating fast charged-particle slowing-down with an ion Fokker-Planck code. The LSSE algorithm is presented in this paper along with the results of a model slowing-down problem to which it has been applied

A GENERALIZED DIFFUSION TENSOR FOR FULLY ANISOTROPIC DIFFUSION OF ENERGETIC PARTICLES IN THE HELIOSPHERIC MAGNETIC FIELD

International Nuclear Information System (INIS)

Effenberger, F.; Fichtner, H.; Scherer, K.; Barra, S.; Kleimann, J.; Strauss, R. D.

2012-01-01

The spatial diffusion of cosmic rays in turbulent magnetic fields can, in the most general case, be fully anisotropic, i.e., one has to distinguish three diffusion axes in a local, field-aligned frame. We reexamine the transformation for the diffusion tensor from this local to a global frame, in which the Parker transport equation for energetic particles is usually formulated and solved. Particularly, we generalize the transformation formulae to allow for an explicit choice of two principal local perpendicular diffusion axes. This generalization includes the 'traditional' diffusion tensor in the special case of isotropic perpendicular diffusion. For the local frame, we describe the motivation for the choice of the Frenet-Serret trihedron, which is related to the intrinsic magnetic field geometry. We directly compare the old and the new tensor elements for two heliospheric magnetic field configurations, namely the hybrid Fisk and Parker fields. Subsequently, we examine the significance of the different formulations for the diffusion tensor in a standard three-dimensional model for the modulation of galactic protons. For this, we utilize a numerical code to evaluate a system of stochastic differential equations equivalent to the Parker transport equation and present the resulting modulated spectra. The computed differential fluxes based on the new tensor formulation deviate from those obtained with the 'traditional' one (only valid for isotropic perpendicular diffusion) by up to 60% for energies below a few hundred MeV depending on heliocentric distance.

Anisotropic Diffusion In Layered Argillaceous Rocks: A Case Study With Opalinus Clay

International Nuclear Information System (INIS)

Van Loon, L.R.; Soler, J.; Mueller, W.; Bradbury, M.H.

2003-01-01

Anisotropic diffusion was studied in Opalinus Clay, a potential host rock for the disposal of spent fuel, vitrified high-level waste and intermediate-level waste. Diffusion parallel to the bedding was measured using a radial through-diffusion technique, while diffusion perpendicular to the bedding was measured using the classical (planar) through-diffusion method. The materials used were samples from Mont Terri (MT) and Benken (BE), respectively. Diffusion of Tritiated Water (HTO), parallel and perpendicular to the bedding, was studied under confining pressures of 7 MPa (MT) and 14 MPa (BE), respectively. The effective diffusion coefficient for diffusion parallel to the bedding, D e , was found to be 3.20(±0.26)x10 11 m 2 s -1 and for the Benken 5.39(±0.43)x10 -11 m 2 s-1 for the Mont Terri samples. The diffusion accessible porosity was ∼ 0.15(±0.02) in both cases. For diffusion perpendicular to the bedding, the effective diffusion coefficient was 5.44(±0.35)x10 -12 m 2 s-1 and 1.37(±0.08)x10 -11 m 2 s -1 for the Benken and Mont Terri samples, respectively. The diffusion accessible porosity was also ∼0.15(±0.02) in both cases. These first results indicate that diffusion parallel to bedding is larger than that perpendicular to the bedding by a factor of 4 to 6. This might be explained in terms of smaller path lengths (tortuosity) for species diffusing parallel to the fabric. (author)

Anisotropic Diffusion In Layered Argillaceous Rocks: A Case Study With Opalinus Clay

Energy Technology Data Exchange (ETDEWEB)

Van Loon, L.R.; Soler, J.; Mueller, W.; Bradbury, M.H

2003-03-01

Anisotropic diffusion was studied in Opalinus Clay, a potential host rock for the disposal of spent fuel, vitrified high-level waste and intermediate-level waste. Diffusion parallel to the bedding was measured using a radial through-diffusion technique, while diffusion perpendicular to the bedding was measured using the classical (planar) through-diffusion method. The materials used were samples from Mont Terri (MT) and Benken (BE), respectively. Diffusion of Tritiated Water (HTO), parallel and perpendicular to the bedding, was studied under confining pressures of 7 MPa (MT) and 14 MPa (BE), respectively. The effective diffusion coefficient for diffusion parallel to the bedding, D{sub e}, was found to be 3.20({+-}0.26)x10{sup 11} m{sup 2}s{sup -1} and for the Benken 5.39({+-}0.43)x10{sup -11} m{sup 2}s-1 for the Mont Terri samples. The diffusion accessible porosity was {approx} 0.15({+-}0.02) in both cases. For diffusion perpendicular to the bedding, the effective diffusion coefficient was 5.44({+-}0.35)x10{sup -12} m{sup 2}s-1 and 1.37({+-}0.08)x10{sup -11} m{sup 2}s{sup -1} for the Benken and Mont Terri samples, respectively. The diffusion accessible porosity was also {approx}0.15({+-}0.02) in both cases. These first results indicate that diffusion parallel to bedding is larger than that perpendicular to the bedding by a factor of 4 to 6. This might be explained in terms of smaller path lengths (tortuosity) for species diffusing parallel to the fabric. (author)

Anisotropic Rotational Diffusion Studied by Nuclear Spin Relaxation and Molecular Dynamics Simulation: An Undergraduate Physical Chemistry Laboratory

Science.gov (United States)

Fuson, Michael M.

2017-01-01

Laboratories studying the anisotropic rotational diffusion of bromobenzene using nuclear spin relaxation and molecular dynamics simulations are described. For many undergraduates, visualizing molecular motion is challenging. Undergraduates rarely encounter laboratories that directly assess molecular motion, and so the concept remains an…

Drag and diffusion of heavy quarks in a hot and anisotropic QCD medium

International Nuclear Information System (INIS)

Srivastava, P.K.; Patra, Binoy Krishna

2017-01-01

The propagation of heavy quarks (HQs) in a medium was quite often modeled by the Fokker-Planck (FP) equation. Since the transport coefficients, related to drag and diffusion processes, are the main ingredients in the FP equation, the evolution of HQs is thus effectively controlled by them. At the initial stage of the relativistic heavy-ion collisions, asymptotic weak-coupling causes the free-streaming motions of partons in the beam direction and the expansions in transverse directions are almost frozen, hence an anisotropy in the momentum space sets in. Since HQs are too produced in the same time, the study of the effect of momentum anisotropy on the drag and diffusion coefficients becomes highly desirable. In this article we have thus studied the drag and diffusion of HQs in the anisotropic medium and found that the presence of the anisotropy reduces both drag and diffusion coefficients. In addition, the anisotropy introduces an angular dependence to both the drag and diffusion coefficients, as a result both coefficients get more inflated when the partons are moving transversely to the direction of anisotropy than when moving parallel to the direction of anisotropy. (orig.)

Drag and diffusion of heavy quarks in a hot and anisotropic QCD medium

Energy Technology Data Exchange (ETDEWEB)

Srivastava, P.K.; Patra, Binoy Krishna [Indian Institute of Technology Roorkee, Department of Physics, Roorkee (India)

2017-06-15

The propagation of heavy quarks (HQs) in a medium was quite often modeled by the Fokker-Planck (FP) equation. Since the transport coefficients, related to drag and diffusion processes, are the main ingredients in the FP equation, the evolution of HQs is thus effectively controlled by them. At the initial stage of the relativistic heavy-ion collisions, asymptotic weak-coupling causes the free-streaming motions of partons in the beam direction and the expansions in transverse directions are almost frozen, hence an anisotropy in the momentum space sets in. Since HQs are too produced in the same time, the study of the effect of momentum anisotropy on the drag and diffusion coefficients becomes highly desirable. In this article we have thus studied the drag and diffusion of HQs in the anisotropic medium and found that the presence of the anisotropy reduces both drag and diffusion coefficients. In addition, the anisotropy introduces an angular dependence to both the drag and diffusion coefficients, as a result both coefficients get more inflated when the partons are moving transversely to the direction of anisotropy than when moving parallel to the direction of anisotropy. (orig.)

Experimental evaluation of electrical conductivity imaging of anisotropic brain tissues using a combination of diffusion tensor imaging and magnetic resonance electrical impedance tomography

Energy Technology Data Exchange (ETDEWEB)

Sajib, Saurav Z. K.; Jeong, Woo Chul; Oh, Tong In; Kim, Hyung Joong, E-mail: bmekim@khu.ac.kr, E-mail: ejwoo@khu.ac.kr; Woo, Eung Je, E-mail: bmekim@khu.ac.kr, E-mail: ejwoo@khu.ac.kr [Department of Biomedical Engineering, Kyung Hee University, Seoul 02447 (Korea, Republic of); Kyung, Eun Jung [Department of Pharmacology, Chung-Ang University, Seoul 06974 (Korea, Republic of); Kim, Hyun Bum [Department of East-West Medical Science, Kyung Hee University, Yongin 17104 (Korea, Republic of); Kwon, Oh In [Department of Mathematics, Konkuk University, Seoul 05029 (Korea, Republic of)

2016-06-15

Anisotropy of biological tissues is a low-frequency phenomenon that is associated with the function and structure of cell membranes. Imaging of anisotropic conductivity has potential for the analysis of interactions between electromagnetic fields and biological systems, such as the prediction of current pathways in electrical stimulation therapy. To improve application to the clinical environment, precise approaches are required to understand the exact responses inside the human body subjected to the stimulated currents. In this study, we experimentally evaluate the anisotropic conductivity tensor distribution of canine brain tissues, using a recently developed diffusion tensor-magnetic resonance electrical impedance tomography method. At low frequency, electrical conductivity of the biological tissues can be expressed as a product of the mobility and concentration of ions in the extracellular space. From diffusion tensor images of the brain, we can obtain directional information on diffusive movements of water molecules, which correspond to the mobility of ions. The position dependent scale factor, which provides information on ion concentration, was successfully calculated from the magnetic flux density, to obtain the equivalent conductivity tensor. By combining the information from both techniques, we can finally reconstruct the anisotropic conductivity tensor images of brain tissues. The reconstructed conductivity images better demonstrate the enhanced signal intensity in strongly anisotropic brain regions, compared with those resulting from previous methods using a global scale factor.

Anisotropic diffusion of meteor trails due to the geomagnetic field over King Sejong Station (62.2°S, 58.8°W), Antarctica

Science.gov (United States)

Choi, Jong-Min; Kwak, Young-Sil; Kim, Yong Ha; Lee, Changsup; Kim, Jeong-Han; Jee, Geonhwa; Yang, Tae-Yong

2018-06-01

We analyzed meteor decay times measured by a VHF meteor radar at King Sejong Station, Antarctica (62.22°S, 58.78°W) to study diffusion processes of the meteor trails above the altitude of ˜93 km. Above this altitude, where the atmospheric density is so dilute that collisions between trail ions and ambient molecules become rare, diffusion of a meteor trail can be greatly affected by the geomagnetic field, resulting in anisotropic distribution of measured decay times over the azimuthal and elevation angles. Our preliminary analysis confirm the anisotropic nature of meteor decay times due to geomagnetic field.

Determination of 13C CSA Tensors: Extension of the Model-independent Approach to an RNA Kissing Complex Undergoing Anisotropic Rotational Diffusion in Solution

International Nuclear Information System (INIS)

Ravindranathan, Sapna; Kim, Chul-Hyun; Bodenhausen, Geoffrey

2005-01-01

Chemical shift anisotropy (CSA) tensor parameters have been determined for the protonated carbons of the purine bases in an RNA kissing complex in solution by extending the model-independent approach [Fushman, D., Cowburn, D. (1998) J. Am. Chem. Soc. 120, 7109-7110]. A strategy for determining CSA tensor parameters of heteronuclei in isolated X-H two-spin systems (X = 13 C or 15 N) in molecules undergoing anisotropic rotational diffusion is presented. The original method relies on the fact that the ratio κ 2 =R 2 auto /R 2 cross of the transverse auto- and cross-correlated relaxation rates involving the X CSA and the X-H dipolar interaction is independent of parameters related to molecular motion, provided rotational diffusion is isotropic. However, if the overall motion is anisotropic κ 2 depends on the anisotropy D parallel /D -perpendicular of rotational diffusion. In this paper, the field dependence of both κ 2 and its longitudinal counterpart κ 1 =R 1 auto /R 1 cross are determined. For anisotropic rotational diffusion, our calculations show that the average κ av = 1/2 (κ 1 +κ 2 ), of the ratios is largely independent of the anisotropy parameter D parallel /D -perpendicular . The field dependence of the average ratio κ av may thus be utilized to determine CSA tensor parameters by a generalized model-independent approach in the case of molecules with an overall motion described by an axially symmetric rotational diffusion tensor

Effects of MR parameter changes on the quantification of diffusion anisotropy and apparent diffusion coefficient in diffusion tensor imaging: Evaluation using a diffusional anisotropic phantom

Energy Technology Data Exchange (ETDEWEB)

Kim, Sang Joon; Choi, Choong Gon; Kim, Jeong Kon [Dept. of Radiology, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Yun, Sung Cheol [Dept. of Biostatistics, University of Ulsan College of Medicine, Seoul (Korea, Republic of); Jeong, Ha Kyu [Dept. of Radiology, East-West Neomedical Center, Kyung Hee University College of Medicine, Seoul (Korea, Republic of); Kim, Eun Ju [Clinical Scientist, MR, Philips Healthcare, Seoul (Korea, Republic of)

2015-04-15

To validate the usefulness of a diffusional anisotropic capillary array phantom and to investigate the effects of diffusion tensor imaging (DTI) parameter changes on diffusion fractional anisotropy (FA) and apparent diffusion coefficient (ADC) using the phantom. Diffusion tensor imaging of a capillary array phantom was performed with imaging parameter changes, including voxel size, number of sensitivity encoding (SENSE) factor, echo time (TE), number of signal acquisitions, b-value, and number of diffusion gradient directions (NDGD), one-at-a-time in a stepwise-incremental fashion. We repeated the entire series of DTI scans thrice. The coefficients of variation (CoV) were evaluated for FA and ADC, and the correlation between each MR imaging parameter and the corresponding FA and ADC was evaluated using Spearman's correlation analysis. The capillary array phantom CoVs of FA and ADC were 7.1% and 2.4%, respectively. There were significant correlations between FA and SENSE factor, TE, b-value, and NDGD, as well as significant correlations between ADC and SENSE factor, TE, and b-value. A capillary array phantom enables repeated measurements of FA and ADC. Both FA and ADC can vary when certain parameters are changed during diffusion experiments. We suggest that the capillary array phantom can be used for quality control in longitudinal or multicenter clinical studies.

Deuterium diffusion along the three principal directions in anisotropic Zr–2.5Nb

Energy Technology Data Exchange (ETDEWEB)

Khatamian, D., E-mail: khatamiand@aecl.ca

2013-12-15

Highlights: •Diffusivity of deuterium in a Zr–2.5Nb plate was measured. •The plate had similar microstructure to that of a CANDU pressure tube. •Diffusion coefficients in the radial direction were 24% less than in the longitudinal direction. •These findings are in close agreement with the theoretical estimates made in the literature. -- Abstract: Pressure tubes of cold-worked Zr–2.5Nb material are used in the CANDU (CANada Deuterium Uranium is a registered trademark of Atomic Energy of Canada Ltd.) reactors to contain the fuel bundles and the heavy water coolant. The pressure tube microstructure consists of α-Zr platelets, with an aspect ratio of 1:5:50 in the radial, transverse and longitudinal directions, surrounded by a thin layer of β-Zr. The diffusivity of hydrogen in β-Zr is higher than in α-Zr. As a result, the diffusivity of hydrogen in the pressure tube material is enhanced compared to unalloyed α-Zr. Due to the anisotropic microstructure of the pressure tube with respect to the β-Zr network, the diffusivity of hydrogen is thought to be different in the three principal pressure tube directions. Measurements made using specimens machined from an 8 mm thick Zr–2.5Nb plate, with a microstructure similar to that of a CANDU pressure tube, suggest the difference between the diffusion constants for deuterium in different directions of an as-installed pressure tube may be as high as 25%.

Dynamics of interface in three-dimensional anisotropic bistable reaction-diffusion system

International Nuclear Information System (INIS)

He Zhizhu; Liu, Jing

2010-01-01

This paper presents a theoretical investigation of dynamics of interface (wave front) in three-dimensional (3D) reaction-diffusion (RD) system for bistable media with anisotropy constructed by means of anisotropic surface tension. An equation of motion for the wave front is derived to carry out stability analysis of transverse perturbations, which discloses mechanism of pattern formation such as labyrinthine in 3D bistable media. Particularly, the effects of anisotropy on wave propagation are studied. It was found that, sufficiently strong anisotropy can induce dynamical instabilities and lead to breakup of the wave front. With the fast-inhibitor limit, the bistable system can further be described by a variational dynamics so that the boundary integral method is adopted to study the dynamics of wave fronts.

Simultaneous characterization of rotational and translational diffusion of optically anisotropic particles by optical microscopy

International Nuclear Information System (INIS)

Giavazzi, Fabio; Cerbino, Roberto; Haro-Pérez, Catalina

2016-01-01

We probe the roto-translational Brownian motion of optically anisotropic particles suspended in water with a simple and straightforward optical microscopy experiment that does not require positional or rotational particle tracking. We acquire a movie of the suspension placed between two polarizing elements and we extract the translational diffusion coefficient D T and the rotational diffusion coefficient D R from the analysis of the temporal correlation properties of the spatial Fourier modes of the intensity fluctuations in the movie. Our method is successfully tested with a dilute suspension of birefringent spherical colloidal particles obtained by polymerizing an emulsion of droplets of liquid crystal in a nematic phase, whose roto-translational dynamics is found to be well described by theory. The simplicity of our approach makes our method a viable alternative to particle tracking and depolarized dynamic light scattering. (paper)

Fractional Diffusion Equations and Anomalous Diffusion

Science.gov (United States)

Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

2018-01-01

Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

Thermal diffusivity and butterfly velocity in anisotropic Q-lattice models

Science.gov (United States)

Jeong, Hyun-Sik; Ahn, Yongjun; Ahn, Dujin; Niu, Chao; Li, Wei-Jia; Kim, Keun-Young

2018-01-01

We study a relation between the thermal diffusivity ( D T ) and two quantum chaotic properties, Lyapunov time (τ L ) and butterfly velocity ( v B ) in strongly correlated systems by using a holographic method. Recently, it was shown that E_i:={D}_{T,i}/({v}{^{B,i}}^2{τ}_L)(i=x,y) is universal in the sense that it is determined only by some scaling exponents of the IR metric in the low temperature limit regardless of the matter fields and ultraviolet data. Inspired by this observation, by analyzing the anisotropic IR scaling geometry carefully, we find the concrete expressions for E_i in terms of the critical dynamical exponents z i in each direction, E_i={z}_i/2({z}_i-1) . Furthermore, we find the lower bound of E_i is always 1 /2, which is not affected by anisotropy, contrary to the η/s case. However, there may be an upper bound determined by given fixed anisotropy.

Measurement of Three-Dimensional Anisotropic Thermal Diffusivities for Carbon Fiber-Reinforced Plastics Using Lock-In Thermography

Science.gov (United States)

Ishizaki, Takuya; Nagano, Hosei

2015-11-01

A new measurement technique to measure the in-plane thermal diffusivity, the distribution of in-plane anisotropy, and the out-of-plane thermal diffusivity has been developed to evaluate the thermal conductivity of anisotropic materials such as carbon fiber-reinforced plastics (CFRPs). The measurements were conducted by using a laser-spot-periodic-heating method. The temperature of the sample is detected by using lock-in thermography. Thermography can analyze the phase difference between the periodic heat input and the temperature response of the sample. Two kinds of samples, unidirectional (UD) and cross-ply (CP) pitch-based CFRPs, were fabricated and tested in an atmospheric condition. All carbon fibers of the UD sample run in one direction [90°]. The carbon fibers of the CP sample run in two directions [0°/90°]. It is found that, by using lock-in thermography, it is able to visualize the thermal anisotropy and calculate the angular dependence of the in-plane thermal diffusivity of the CFRPs. The out-of-plane thermal diffusivity of CFRPs was also measured by analyzing the frequency dependence of the phase difference.

Scalable explicit implementation of anisotropic diffusion with Runge-Kutta-Legendre super-time stepping

Science.gov (United States)

Vaidya, Bhargav; Prasad, Deovrat; Mignone, Andrea; Sharma, Prateek; Rickler, Luca

2017-12-01

An important ingredient in numerical modelling of high temperature magnetized astrophysical plasmas is the anisotropic transport of heat along magnetic field lines from higher to lower temperatures. Magnetohydrodynamics typically involves solving the hyperbolic set of conservation equations along with the induction equation. Incorporating anisotropic thermal conduction requires to also treat parabolic terms arising from the diffusion operator. An explicit treatment of parabolic terms will considerably reduce the simulation time step due to its dependence on the square of the grid resolution (Δx) for stability. Although an implicit scheme relaxes the constraint on stability, it is difficult to distribute efficiently on a parallel architecture. Treating parabolic terms with accelerated super-time-stepping (STS) methods has been discussed in literature, but these methods suffer from poor accuracy (first order in time) and also have difficult-to-choose tuneable stability parameters. In this work, we highlight a second-order (in time) Runge-Kutta-Legendre (RKL) scheme (first described by Meyer, Balsara & Aslam 2012) that is robust, fast and accurate in treating parabolic terms alongside the hyperbolic conversation laws. We demonstrate its superiority over the first-order STS schemes with standard tests and astrophysical applications. We also show that explicit conduction is particularly robust in handling saturated thermal conduction. Parallel scaling of explicit conduction using RKL scheme is demonstrated up to more than 104 processors.

Modelling anisotropic water transport in polymer composite

Indian Academy of Sciences (India)

This work reports anisotropic water transport in a polymer composite consisting of an epoxy matrix reinforced with aligned triangular bars made of vinyl ester. By gravimetric experiments, water diffusion in resin and polymer composites were characterized. Parameters for Fickian diffusion and polymer relaxation models were ...

Antiproton cross-field diffusion in antihydrogen production experiments due to anisotropic binary interactions

International Nuclear Information System (INIS)

Ordonez, C.A.; Correa, J.R.

2007-01-01

Collisional processes in electrostatic ion storage rings and reflecting-beam-type electrostatic ion traps can be associated with anisotropic binary interactions, because shielding of the Coulomb interactions may not take place in one or more dimensions. Collisional scattering theory has recently been developed for describing the velocity-space scattering processes in such systems [J.R. Correa, Y. Chang, C.A. Ordonez, Phys. Plasmas 12 (2005) 084505]. The theory is extended to enable the effect of a magnetic field to be included. The theory is intended to be applicable, for example, to antiproton scattering within nested Penning traps that are used to produce antihydrogen [M. Amoretti et al., Nature 419 (2002) 456; G. Gabrielse et al., Phys. Rev. Lett. 89 (2002) 213401]. The theory is applied for considering the cross-magnetic-field diffusion of the antiprotons

Perona Malik anisotropic diffusion model using Peaceman Rachford scheme on digital radiographic image

International Nuclear Information System (INIS)

Halim, Suhaila Abd; Razak, Rohayu Abd; Ibrahim, Arsmah; Manurung, Yupiter HP

2014-01-01

In image processing, it is important to remove noise without affecting the image structure as well as preserving all the edges. Perona Malik Anisotropic Diffusion (PMAD) is a PDE-based model which is suitable for image denoising and edge detection problems. In this paper, the Peaceman Rachford scheme is applied on PMAD to remove unwanted noise as the scheme is efficient and unconditionally stable. The capability of the scheme to remove noise is evaluated on several digital radiography weld defect images computed using MATLAB R2009a. Experimental results obtained show that the Peaceman Rachford scheme improves the image quality substantially well based on the Peak Signal to Noise Ratio (PSNR). The Peaceman Rachford scheme used in solving the PMAD model successfully removes unwanted noise in digital radiographic image

Perona Malik anisotropic diffusion model using Peaceman Rachford scheme on digital radiographic image

Energy Technology Data Exchange (ETDEWEB)

Halim, Suhaila Abd; Razak, Rohayu Abd; Ibrahim, Arsmah [Center of Mathematics Studies, Faculty of Computer and Mathematical Sciences, Universiti Teknologi MARA, 40450 Shah Alam. Selangor DE (Malaysia); Manurung, Yupiter HP [Advanced Manufacturing Technology Excellence Center (AMTEx), Faculty of Mechanical Engineering, Universiti Teknologi MARA, 40450 Shah Alam. Selangor DE (Malaysia)

2014-06-19

In image processing, it is important to remove noise without affecting the image structure as well as preserving all the edges. Perona Malik Anisotropic Diffusion (PMAD) is a PDE-based model which is suitable for image denoising and edge detection problems. In this paper, the Peaceman Rachford scheme is applied on PMAD to remove unwanted noise as the scheme is efficient and unconditionally stable. The capability of the scheme to remove noise is evaluated on several digital radiography weld defect images computed using MATLAB R2009a. Experimental results obtained show that the Peaceman Rachford scheme improves the image quality substantially well based on the Peak Signal to Noise Ratio (PSNR). The Peaceman Rachford scheme used in solving the PMAD model successfully removes unwanted noise in digital radiographic image.

Stefan-Maxwell Relations and Heat Flux with Anisotropic Transport Coefficients for Ionized Gases in a Magnetic Field with Application to the Problem of Ambipolar Diffusion

Science.gov (United States)

Kolesnichenko, A. V.; Marov, M. Ya.

2018-01-01

The defining relations for the thermodynamic diffusion and heat fluxes in a multicomponent, partially ionized gas mixture in an external electromagnetic field have been obtained by the methods of the kinetic theory. Generalized Stefan-Maxwell relations and algebraic equations for anisotropic transport coefficients (the multicomponent diffusion, thermal diffusion, electric and thermoelectric conductivity coefficients as well as the thermal diffusion ratios) associated with diffusion-thermal processes have been derived. The defining second-order equations are derived by the Chapman-Enskog procedure using Sonine polynomial expansions. The modified Stefan-Maxwell relations are used for the description of ambipolar diffusion in the Earth's ionospheric plasma (in the F region) composed of electrons, ions of many species, and neutral particles in a strong electromagnetic field.

Anisotropic Weyl invariance

Energy Technology Data Exchange (ETDEWEB)

Perez-Nadal, Guillem [Universidad de Buenos Aires, Buenos Aires (Argentina)

2017-07-15

We consider a non-relativistic free scalar field theory with a type of anisotropic scale invariance in which the number of coordinates ''scaling like time'' is generically greater than one. We propose the Cartesian product of two curved spaces, the metric of each space being parameterized by the other space, as a notion of curved background to which the theory can be extended. We study this type of geometries, and find a family of extensions of the theory to curved backgrounds in which the anisotropic scale invariance is promoted to a local, Weyl-type symmetry. (orig.)

Diffusion tensor optical coherence tomography

Science.gov (United States)

Marks, Daniel L.; Blackmon, Richard L.; Oldenburg, Amy L.

2018-01-01

In situ measurements of diffusive particle transport provide insight into tissue architecture, drug delivery, and cellular function. Analogous to diffusion-tensor magnetic resonance imaging (DT-MRI), where the anisotropic diffusion of water molecules is mapped on the millimeter scale to elucidate the fibrous structure of tissue, here we propose diffusion-tensor optical coherence tomography (DT-OCT) for measuring directional diffusivity and flow of optically scattering particles within tissue. Because DT-OCT is sensitive to the sub-resolution motion of Brownian particles as they are constrained by tissue macromolecules, it has the potential to quantify nanoporous anisotropic tissue structure at micrometer resolution as relevant to extracellular matrices, neurons, and capillaries. Here we derive the principles of DT-OCT, relating the detected optical signal from a minimum of six probe beams with the six unique diffusion tensor and three flow vector components. The optimal geometry of the probe beams is determined given a finite numerical aperture, and a high-speed hardware implementation is proposed. Finally, Monte Carlo simulations are employed to assess the ability of the proposed DT-OCT system to quantify anisotropic diffusion of nanoparticles in a collagen matrix, an extracellular constituent that is known to become highly aligned during tumor development.

Analysis of an aggregation-based algebraic two-grid method for a rotated anisotropic diffusion problem

KAUST Repository

Chen, Meng-Huo; Greenbaum, Anne

2015-01-01

Summary: A two-grid convergence analysis based on the paper [Algebraic analysis of aggregation-based multigrid, by A. Napov and Y. Notay, Numer. Lin. Alg. Appl. 18 (2011), pp. 539-564] is derived for various aggregation schemes applied to a finite element discretization of a rotated anisotropic diffusion equation. As expected, it is shown that the best aggregation scheme is one in which aggregates are aligned with the anisotropy. In practice, however, this is not what automatic aggregation procedures do. We suggest approaches for determining appropriate aggregates based on eigenvectors associated with small eigenvalues of a block splitting matrix or based on minimizing a quantity related to the spectral radius of the iteration matrix. © 2015 John Wiley & Sons, Ltd.

Analysis of an aggregation-based algebraic two-grid method for a rotated anisotropic diffusion problem

KAUST Repository

Chen, Meng-Huo

2015-03-18

Summary: A two-grid convergence analysis based on the paper [Algebraic analysis of aggregation-based multigrid, by A. Napov and Y. Notay, Numer. Lin. Alg. Appl. 18 (2011), pp. 539-564] is derived for various aggregation schemes applied to a finite element discretization of a rotated anisotropic diffusion equation. As expected, it is shown that the best aggregation scheme is one in which aggregates are aligned with the anisotropy. In practice, however, this is not what automatic aggregation procedures do. We suggest approaches for determining appropriate aggregates based on eigenvectors associated with small eigenvalues of a block splitting matrix or based on minimizing a quantity related to the spectral radius of the iteration matrix. © 2015 John Wiley & Sons, Ltd.

Enhancing Rotational Diffusion Using Oscillatory Shear

KAUST Repository

Leahy, Brian D.

2013-05-29

Taylor dispersion - shear-induced enhancement of translational diffusion - is an important phenomenon with applications ranging from pharmacology to geology. Through experiments and simulations, we show that rotational diffusion is also enhanced for anisotropic particles in oscillatory shear. This enhancement arises from variations in the particle\\'s rotation (Jeffery orbit) and depends on the strain amplitude, rate, and particle aspect ratio in a manner that is distinct from the translational diffusion. This separate tunability of translational and rotational diffusion opens the door to new techniques for controlling positions and orientations of suspended anisotropic colloids. © 2013 American Physical Society.

Diffusion properties of NAA in human corpus callosum as studied with diffusion tensor spectroscopy.

Science.gov (United States)

Upadhyay, Jaymin; Hallock, Kevin; Erb, Kelley; Kim, Dae-Shik; Ronen, Itamar

2007-11-01

In diffusion tensor imaging (DTI) the anisotropic movement of water is exploited to characterize microstructure. One confounding issue of DTI is the presence of intra- and extracellular components contributing to the measured diffusivity. This causes an ambiguity in determining the underlying cause of diffusion properties, particularly the fractional anisotropy (FA). In this study an intracellular constituent, N-acetyl aspartate (NAA), was used to probe intracellular diffusion, while water molecules were used to probe the combined intra- and extracellular diffusion. NAA and water diffusion measurements were made in anterior and medial corpus callosum (CC) regions, which are referred to as R1 and R2, respectively. FA(NAA) was found to be greater than FA(Water) in both CC regions, thus indicating a higher degree of anisotropy within the intracellular space in comparison to the combined intra- and extracellular spaces. A decreasing trend in the FA of NAA and water was observed between R1 and R2, while the radial diffusivity (RD) for both molecules increased. The increase in RD(NAA) is particularly significant, thus explaining the more significant decrease in FA(NAA) between the two regions. It is suggested that diffusion tensor spectroscopy of NAA can potentially be used to further characterize microscopic anatomic organization in white matter. Copyright 2007 Wiley-Liss, Inc.

On some applications of diffusion processes for image processing

International Nuclear Information System (INIS)

Morfu, S.

2009-01-01

We propose a new algorithm inspired by the properties of diffusion processes for image filtering. We show that purely nonlinear diffusion processes ruled by Fisher equation allows contrast enhancement and noise filtering, but involves a blurry image. By contrast, anisotropic diffusion, described by Perona and Malik algorithm, allows noise filtering and preserves the edges. We show that combining the properties of anisotropic diffusion with those of nonlinear diffusion provides a better processing tool which enables noise filtering, contrast enhancement and edge preserving.

Simulation of anisotropic diffusion by means of a diffusion velocity method

CERN Document Server

Beaudoin, A; Rivoalen, E

2003-01-01

An alternative method to the Particle Strength Exchange method for solving the advection-diffusion equation in the general case of a non-isotropic and non-uniform diffusion is proposed. This method is an extension of the diffusion velocity method. It is shown that this extension is quite straightforward due to the explicit use of the diffusion flux in the expression of the diffusion velocity. This approach is used to simulate pollutant transport in groundwater and the results are compared to those of the PSE method presented in an earlier study by Zimmermann et al.

Continuum mechanics of anisotropic materials

CERN Document Server

Cowin, Stephen C

2013-01-01

Continuum Mechanics of Anisotropic Materials(CMAM) presents an entirely new and unique development of material anisotropy in the context of an appropriate selection and organization of continuum mechanics topics. These features will distinguish this continuum mechanics book from other books on this subject. Textbooks on continuum mechanics are widely employed in engineering education, however, none of them deal specifically with anisotropy in materials. For the audience of Biomedical, Chemical and Civil Engineering students, these materials will be dealt with more frequently and greater accuracy in their analysis will be desired. Continuum Mechanics of Anisotropic Materials' author has been a leader in the field of developing new approaches for the understanding of anisotropic materials.

Anisotropic diffusion within human white matter

International Nuclear Information System (INIS)

Chenevert, T.L.; Brunberg, J.A.; Pipe, J.G.

1990-01-01

This paper reports on measurements performed to assess the impact of fiber orientation on the apparent diffusion coefficient of human white matter in vivo. Orthogonal section selection pulses and strong motion sensitization gradient pulses were used for localized diffusion measurement along an anteroposteriorly oriented 1 x 1 cm tissue column in the left cerebral hemisphere. This region was selected since white matter fiber orientations are reasonably well defined. Independent acquisitions with motion sensitivity along anteroposterior and right-left directions allowed study of diffusion anisotropy. Motion artifacts were minimized by magnitude summation after one-dimensional Fourier transform of frequency-encoded echoes; consequently, cardiac gating was not required. Five normal volunteers were studied on a 1.5-T clinical MR system

Synthetic acceleration methods for linear transport problems with highly anisotropic scattering

International Nuclear Information System (INIS)

Khattab, K.M.; Larsen, E.W.

1992-01-01

The diffusion synthetic acceleration (DSA) algorithm effectively accelerates the iterative solution of transport problems with isotropic or mildly anisotropic scattering. However, DSA loses its effectiveness for transport problems that have strongly anisotropic scattering. Two generalizations of DSA are proposed, which, for highly anisotropic scattering problems, converge at least an order of magnitude (clock time) faster than the DSA method. These two methods are developed, the results of Fourier analysis that theoretically predict their efficiency are described, and numerical results that verify the theoretical predictions are presented. (author). 10 refs., 7 figs., 5 tabs

Synthetic acceleration methods for linear transport problems with highly anisotropic scattering

International Nuclear Information System (INIS)

Khattab, K.M.; Larsen, E.W.

1991-01-01

This paper reports on the diffusion synthetic acceleration (DSA) algorithm that effectively accelerates the iterative solution of transport problems with isotropic or mildly anisotropic scattering. However, DSA loses its effectiveness for transport problems that have strongly anisotropic scattering. Two generalizations of DSA are proposed, which, for highly anisotropic scattering problems, converge at least an order of magnitude (clock time) faster than the DSA method. These two methods are developed, the results of Fourier analyses that theoretically predict their efficiency are described, and numerical results that verify the theoretical predictions are presented

A signature of anisotropic cosmic-ray transport in the gamma-ray sky

Energy Technology Data Exchange (ETDEWEB)

Cerri, Silvio Sergio; Grasso, Dario [Dipartimento di Fisica ' ' E. Fermi' ' , Università di Pisa, Largo B. Pontecorvo 3, I-56127 Pisa (Italy); Gaggero, Daniele [GRAPPA, University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Vittino, Andrea [Physik-Department T30d, Technische Universität München, James Franck-Str. 1, D-85748, Garching (Germany); Evoli, Carmelo, E-mail: silvio.cerri@df.unipi.it, E-mail: d.gaggero@uva.nl, E-mail: andrea.vittino@tum.de, E-mail: carmelo.evoli@gssi.it, E-mail: dario.grasso@pi.infn.it [Gran Sasso Science Institute, Viale Francesco Crispi 7, 67100 L' Aquila (Italy)

2017-10-01

A crucial process in Galactic cosmic-ray (CR) transport is the spatial diffusion due to the interaction with the interstellar turbulent magnetic field. Usually, CR diffusion is assumed to be uniform and isotropic all across the Galaxy. However, this picture is clearly inaccurate: several data-driven and theoretical arguments, as well as dedicated numerical simulations, show that diffusion exhibits highly anisotropic properties with respect to the direction of a background (ordered) magnetic field (i.e., parallel or perpendicular to it). In this paper we focus on a recently discovered anomaly in the hadronic CR spectrum inferred by the Fermi-LAT gamma-ray data at different positions in the Galaxy, i.e. the progressive hardening of the proton slope at low Galactocentric radii. We propose the idea that this feature can be interpreted as a signature of anisotropic diffusion in the complex Galactic magnetic field: in particular, the harder slope in the inner Galaxy is due, in our scenario, to the parallel diffusive escape along the poloidal component of the large-scale, regular, magnetic field. We implement this idea in a numerical framework, based on the DRAGON code, and perform detailed numerical tests on the accuracy of our setup. We discuss how the effect proposed depends on the relevant free parameters involved. Based on low-energy extrapolation of the few focused numerical simulations aimed at determining the scalings of the anisotropic diffusion coefficients, we finally present a set of plausible models that reproduce the behavior of the CR proton slopes inferred by gamma-ray data.

Numerical study of the thermal degradation of isotropic and anisotropic polymeric materials

Energy Technology Data Exchange (ETDEWEB)

Soler, E. [Departamento de Lenguajes y Ciencias de la Computacion, ETSI Informatica, Universidad de Malaga, 29071 Malaga (Spain); Ramos, J.I. [Room I-320-D, ETS Ingenieros Industriales, Universidad de Malaga, Plaza El Ejido, s/n, 29013 Malaga (Spain)

2005-08-01

The thermal degradation of two-dimensional isotropic, orthotropic and anisotropic polymeric materials is studied numerically by means of a second-order accurate (in both space and time) linearly implicit finite difference formulation which results in linear algebraic equations at each time step. It is shown that, for both isotropic and orthotropic composites, the monomer mass diffusion tensor plays a role in initiating the polymerization kinetics, the formation of a polymerization kernel and the initial front propagation, whereas the later stages of the polymerization are nearly independent of the monomer mass diffusion tensor. In anisotropic polymeric composites, it has been found that the monomer mass diffusion tensor plays a paramount role in determining the initial stages of the polymerization and the subsequent propagation of the polymerization front, the direction and speed of propagation of which are found to be related to the principal directions of both the monomer mass and the heat diffusion tensors. It is also shown that the polymerization time and temperatures depend strongly on the anisotropy of the mass and heat diffusion tensors. (authors)

Anisotropic swim stress in active matter with nematic order

Science.gov (United States)

Yan, Wen; Brady, John F.

2018-05-01

Active Brownian particles (ABPs) transmit a swim pressure {{{\\Pi }}}{{swim}}=n\\zeta {D}{{swim}} to the container boundaries, where ζ is the drag coefficient, D swim is the swim diffusivity and n is the uniform bulk number density far from the container walls. In this work we extend the notion of the isotropic swim pressure to the anisotropic tensorial swim stress {{\\boldsymbol{σ }}}{{swim}}=-n\\zeta {{\\boldsymbol{D}}}{{swim}}, which is related to the anisotropic swim diffusivity {{\\boldsymbol{D}}}{{swim}}. We demonstrate this relationship with ABPs that achieve nematic orientational order via a bulk external field. The anisotropic swim stress is obtained analytically for dilute ABPs in both 2D and 3D systems. The anisotropy, defined as the ratio of the maximum to the minimum of the three principal stresses, is shown to grow exponentially with the strength of the external field. We verify that the normal component of the anisotropic swim stress applies a pressure {{{\\Pi }}}{{swim}}=-({{\\boldsymbol{σ }}}{{swim}}\\cdot {\\boldsymbol{n}})\\cdot {\\boldsymbol{n}} on a wall with normal vector {\\boldsymbol{n}}, and, through Brownian dynamics simulations, this pressure is shown to be the force per unit area transmitted by the active particles. Since ABPs have no friction with a wall, the difference between the normal and tangential stress components—the normal stress difference—generates a net flow of ABPs along the wall, which is a generic property of active matter systems.

Measuring anisotropic muscle stiffness properties using elastography.

Science.gov (United States)

Green, M A; Geng, G; Qin, E; Sinkus, R; Gandevia, S C; Bilston, L E

2013-11-01

Physiological and pathological changes to the anisotropic mechanical properties of skeletal muscle are still largely unknown, with only a few studies quantifying changes in vivo. This study used the noninvasive MR elastography (MRE) technique, in combination with diffusion tensor imaging (DTI), to measure shear modulus anisotropy in the human skeletal muscle in the lower leg. Shear modulus measurements parallel and perpendicular to the fibre direction were made in 10 healthy subjects in the medial gastrocnemius, soleus and tibialis anterior muscles. The results showed significant differences in the medial gastrocnemius (μ‖ = 0.86 ± 0.15 kPa; μ⊥ = 0.66 ± 0.19 kPa, P < 0.001), soleus (μ‖ = 0.83 ± 0.22 kPa; μ⊥ = 0.65 ± 0.13 kPa, P < 0.001) and the tibialis anterior (μ‖ = 0.78 ± 0.24 kPa; μ⊥ = 0.66 ± 0.16 kPa, P = 0.03) muscles, where the shear modulus measured in the direction parallel is greater than that measured in the direction perpendicular to the muscle fibres. No significant differences were measured across muscle groups. This study provides the first direct estimates of the anisotropic shear modulus in the triceps surae muscle group, and shows that the technique may be useful for the probing of mechanical anisotropy changes caused by disease, aging and injury. Copyright © 2013 John Wiley & Sons, Ltd.

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Band gaps in periodically magnetized homogeneous anisotropic media

Science.gov (United States)

Merzlikin, A. M.; Levy, M.; Vinogradov, A. P.; Wu, Z.; Jalali, A. A.

2010-11-01

In [A. M. Merzlikin, A. P. Vinogradov, A. V. Dorofeenko, M. Inoue, M. Levy, A. B. Granovsky, Physica B 394 (2007) 277] it is shown that in anisotropic magnetophotonic crystal made of anisotropic dielectric layers and isotropic magneto-optical layers the magnetization leads to formation of additional band gaps (BG) inside the Brillouin zones. Due to the weakness of the magneto-optical effects the width of these BG is much smaller than that of usual BG forming on the boundaries of Brillouin zones. In the present communication we show that though the anisotropy suppresses magneto-optical effects. An anisotropic magnetophotonic crystal made of anisotropic dielectric layers and anisotropic magneto-optical; the width of additional BG may be much greater than the width of the usual Brillouin BG. Anisotropy tends to suppress Brillouin zone boundary band gap formation because the anisotropy suppresses magneto-optical properties, while degenerate band gap formation occurs around points of effective isotropy and is not suppressed.

Effect of reflecting modes on combined heat transfer within an anisotropic scattering slab

International Nuclear Information System (INIS)

Yi Hongliang; Tan Heping; Lu Yiping

2005-01-01

Under various interface reflecting modes, different transient thermal responses will occur in the media. Combined radiative-conductive heat transfer is investigated within a participating, anisotropic scattering gray planar slab. The two interfaces of the slab are considered to be diffuse and semitransparent. Using the ray tracing method, an anisotropic scattering radiative transfer model for diffuse reflection at boundaries is set up, and with the help of direct radiative transfer coefficients, corresponding radiative transfer coefficients (RTCs) are deduced. RTCs are used to calculate the radiative source term in energy equation. Transient energy equation is solved by the full implicit control-volume method under the external radiative-convective boundary conditions. The influences of two reflecting modes including both specular reflection and diffuse reflection on transient temperature fields and steady heat flux are examined. According to numerical results obtained in this paper, it is found that there exits great difference in thermal behavior between slabs with diffuse interfaces and that with specular interfaces for slabs with big refractive index

Correlation of Local Structure and Diffusion Pathways in the Modulated Anisotropic Oxide Ion Conductor CeNbO4.25

KAUST Repository

Pramana, Stevin S.

2016-01-15

CeNbO is reported to exhibit fast oxygen ion diffusion at moderate temperatures, making this the prototype of a new class of ion conductor with applications in a range of energy generation and storage devices. To date, the mechanism by which this ion transport is achieved has remained obscure, in part due to the long-range commensurately modulated structural motif. Here we show that CeNbO forms with a unit cell 12 times larger than the stoichiometric tetragonal parent phase of CeNbO as a result of the helical ordering of Ce and Ce ions along z. Interstitial oxygen ion incorporation leads to a cooperative displacement of the surrounding oxygen species, creating interlayer NbO connectivity by extending the oxygen coordination number to 7 and 8. Molecular dynamic simulations suggest that fast ion migration occurs predominantly within the xz plane. It is concluded that the oxide ion diffuses anisotropically, with the major migration mechanism being intralayer; however, when obstructed, oxygen can readily move to an adjacent layer along y via alternate lower energy barrier pathways.

Correlation of Local Structure and Diffusion Pathways in the Modulated Anisotropic Oxide Ion Conductor CeNbO4.25

KAUST Repository

Pramana, Stevin S.; Baikie, Tom; An, Tao; Tucker, Matthew G.; Wu, Ji; Schreyer, Martin K.; Wei, Fengxia; Bayliss, Ryan D.; Kloc, Christian L.; White, Timothy J.; Horsfield, Andrew P.; Skinner, Stephen J.

2016-01-01

CeNbO is reported to exhibit fast oxygen ion diffusion at moderate temperatures, making this the prototype of a new class of ion conductor with applications in a range of energy generation and storage devices. To date, the mechanism by which this ion transport is achieved has remained obscure, in part due to the long-range commensurately modulated structural motif. Here we show that CeNbO forms with a unit cell 12 times larger than the stoichiometric tetragonal parent phase of CeNbO as a result of the helical ordering of Ce and Ce ions along z. Interstitial oxygen ion incorporation leads to a cooperative displacement of the surrounding oxygen species, creating interlayer NbO connectivity by extending the oxygen coordination number to 7 and 8. Molecular dynamic simulations suggest that fast ion migration occurs predominantly within the xz plane. It is concluded that the oxide ion diffuses anisotropically, with the major migration mechanism being intralayer; however, when obstructed, oxygen can readily move to an adjacent layer along y via alternate lower energy barrier pathways.

Diffusion-weighted MR imaging of intracranial tumors

International Nuclear Information System (INIS)

Bydder, G.M.; Baudouin, C.J.; Steiner, R.E.; Hajnal, J.V.; Young, I.R.

1991-01-01

This paper assesses the effect of anisotropic diffusion weighting on the appearances of cerebral tumors as well as vasogenic and interstitial edema. Diffusion weighting produced a reduction in signal intensity in all or part of the tumors in the majority of cases. However, a relative increase in signal intensity was apparent in four cases. The decrease in signal intensity in vasogenic edema depended on the site and direction of gradient sensitization. Marked increase in conspicuity between tumor and edema was apparent in three cases. Changes in interstitial edema depended in detail in fiber direction. Differentiation between tumor and edema can be improved with diffusion-weighted imaging. Anisotropic change is seen in both vasogenic and interstitial edema

Diffusion Based Photon Mapping

DEFF Research Database (Denmark)

Schjøth, Lars; Fogh Olsen, Ole; Sporring, Jon

2007-01-01

. To address this problem we introduce a novel photon mapping algorithm based on nonlinear anisotropic diffusion. Our algorithm adapts according to the structure of the photon map such that smoothing occurs along edges and structures and not across. In this way we preserve the important illumination features......, while eliminating noise. We call our method diffusion based photon mapping....

Diffusion Based Photon Mapping

DEFF Research Database (Denmark)

Schjøth, Lars; Olsen, Ole Fogh; Sporring, Jon

2006-01-01

. To address this problem we introduce a novel photon mapping algorithm based on nonlinear anisotropic diffusion. Our algorithm adapts according to the structure of the photon map such that smoothing occurs along edges and structures and not across. In this way we preserve the important illumination features......, while eliminating noise. We call our method diffusion based photon mapping....

Quark–gluon plasma phenomenology from anisotropic lattice QCD

Energy Technology Data Exchange (ETDEWEB)

Skullerud, Jon-Ivar; Kelly, Aoife [Department of Mathematical Physics, Maynooth University, Maynooth, Co Kildare (Ireland); Aarts, Gert; Allton, Chris; Amato, Alessandro; Evans, P. Wynne M.; Hands, Simon [Department of Physics, Swansea University, Swansea SA2 8PP, Wales (United Kingdom); Burnier, Yannis [Institut de Théorie des Phénomènes Physiques, Ecole Polytechnique Fédérale de Lausanne, CH–1015 Lausanne (Switzerland); Giudice, Pietro [Institut für Theoretische Physik, Universität Münster, D–48149 Münster (Germany); Harris, Tim; Ryan, Sinéad M. [School of Mathematics, Trinity College, Dublin 2 (Ireland); Kim, Seyong [Department of Physics, Sejong University, Seoul 143-747 (Korea, Republic of); Lombardo, Maria Paola [INFN–Laboratori Nazionali di Frascati, I–00044 Frascati (RM) (Italy); Oktay, Mehmet B. [Department of Physics and Astronomy, University of Iowa, Iowa City, Iowa 52242 (United States); Rothkopf, Alexander [Institut für Theoretische Physik, Universität Heidelberg, Philosophenweg 16, D–69120 Heidelberg (Germany)

2016-01-22

The FASTSUM collaboration has been carrying out simulations of N{sub f} = 2 + 1 QCD at nonzero temperature in the fixed-scale approach using anisotropic lattices. Here we present the status of these studies, including recent results for electrical conductivity and charge diffusion, and heavy quarkonium (charm and beauty) physics.

A locally conservative non-negative finite element formulation for anisotropic advective-diffusive-reactive systems

Science.gov (United States)

Mudunuru, M. K.; Shabouei, M.; Nakshatrala, K.

2015-12-01

Advection-diffusion-reaction (ADR) equations appear in various areas of life sciences, hydrogeological systems, and contaminant transport. Obtaining stable and accurate numerical solutions can be challenging as the underlying equations are coupled, nonlinear, and non-self-adjoint. Currently, there is neither a robust computational framework available nor a reliable commercial package known that can handle various complex situations. Herein, the objective of this poster presentation is to present a novel locally conservative non-negative finite element formulation that preserves the underlying physical and mathematical properties of a general linear transient anisotropic ADR equation. In continuous setting, governing equations for ADR systems possess various important properties. In general, all these properties are not inherited during finite difference, finite volume, and finite element discretizations. The objective of this poster presentation is two fold: First, we analyze whether the existing numerical formulations (such as SUPG and GLS) and commercial packages provide physically meaningful values for the concentration of the chemical species for various realistic benchmark problems. Furthermore, we also quantify the errors incurred in satisfying the local and global species balance for two popular chemical kinetics schemes: CDIMA (chlorine dioxide-iodine-malonic acid) and BZ (Belousov--Zhabotinsky). Based on these numerical simulations, we show that SUPG and GLS produce unphysical values for concentration of chemical species due to the violation of the non-negative constraint, contain spurious node-to-node oscillations, and have large errors in local and global species balance. Second, we proposed a novel finite element formulation to overcome the above difficulties. The proposed locally conservative non-negative computational framework based on low-order least-squares finite elements is able to preserve these underlying physical and mathematical properties

An anisotropic elastoplasticity model implemented in FLAG

Energy Technology Data Exchange (ETDEWEB)

Buechler, Miles Allen [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Canfield, Thomas R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-10-12

Many metals, including Tantalum and Zirconium, exhibit anisotropic elastoplastic behavior at the single crystal level, and if components are manufactured from these metals through forming processes the polycrystal (component) may also exhibit anisotropic elastoplastic behavior. This is because the forming can induce a preferential orientation of the crystals in the polycrystal. One example is a rolled plate of Uranium where the sti /strong orientation of the crystal (c-axis) tends to align itself perpendicular to the rolling direction. If loads are applied to this plate in di erent orientations the sti ness as well as the ow strength of the material will be greater in the through thickness direction than in other directions. To better accommodate simulations of such materials, an anisotropic elastoplasticity model has been implemented in FLAG. The model includes an anisotropic elastic stress model as well as an anisotropic plasticity model. The model could represent single crystals of any symmetry, though it should not be confused with a high- delity crystal plasticity model with multiple slip planes and evolutions. The model is most appropriate for homogenized polycrystalline materials. Elastic rotation of the material due to deformation is captured, so the anisotropic models are appropriate for arbitrary large rotations, but currently they do not account for signi cant change in material texture beyond the elastic rotation of the entire polycrystal.

Anisotropic diffusion of 51Cr in Zr-α monocrystals

International Nuclear Information System (INIS)

Varela, N.; Balart, S.; Tendler, R.

1983-01-01

The volume diffusion coefficients of the fast-diffusing solute 51 Cr were obtained in oriented α-Zr single-crystals, in the directions parallel and perpendicular to the c axis. The dependence of those diffusion coefficients with temperature was also measured between 750 0 C and 848 0 C. Single-crystals were grown by thermal cycling through the transformation α β (863 0 C). Diffusion coefficients were measured using the 'thin film' method. In some experiments non-gaussian penetration profiles were obtained and this behaviour is analyzed in the Appendix. The diffusion of 51 Cr is faster in the c axis direction, with Q sub(//) (1.59 eV) [pt

An introduction to visualization of diffusion tensor imaging and its applications

NARCIS (Netherlands)

Vilanova, A.; Zhang, S.; Kindlmann, G.; Laidlaw, D.H.; Weickert, J.; Hagen, H.

2005-01-01

Summary. Water diffusion is anisotropic in organized tissues such as white matter and muscle. Diffusion tensor imaging (DTI), a non-invasive MR technique, measures water self-diffusion rates and thus gives an indication of the underlying tissue microstructure. The diffusion rate is often expressed

A resistor interpretation of general anisotropic cardiac tissue.

Science.gov (United States)

Shao, Hai; Sampson, Kevin J; Pormann, John B; Rose, Donald J; Henriquez, Craig S

2004-02-01

This paper describes a spatial discretization scheme for partial differential equation systems that contain anisotropic diffusion. The discretization method uses unstructured finite volumes, or the boxes, that are formed as a secondary geometric structure from an underlying triangular mesh. We show how the discretization can be interpreted as a resistive circuit network, where each resistor is assigned at each edge of the triangular element. The resistor is computed as an anisotropy dependent geometric quantity of the local mesh structure. Finally, we show that under certain conditions, the discretization gives rise to negative resistors that can produce non-physical hyperpolarizations near depolarizing stimuli. We discuss how the proper choice of triangulation (anisotropic Delaunay triangulation) can ensure monotonicity (i.e. all resistors are positive).

Diffusion tensor analysis with nuclear magnetic resonance in human central nervous system

International Nuclear Information System (INIS)

Nakayama, Naoki

1998-01-01

Nuclear magnetic resonance has been used to measure the diffusivity of water molecules. In central nervous system, anisotropic diffusion, which is characterized by apparent diffusion tensor D app ξ , is thought to be related to neuronal fiber tract orientation. For precise observation of anisotropic diffusion, it is needed to determine the diagonal and off-diagonal elements of D app ξ . Once D app ξ is estimated from a series of diffusion weighted images, a tissue's orthotropic principal axes and diffusivity of each direction are determined from eigenvalues and eigenvectors of D app ξ . There are several methods to represent anisotropic diffusion with D app ξ . Examples are diffusion ellipsoids constructed in each voxel depicting both these principal axes and the mean diffusion length in these directions, trace invariant values and its mapping image, largest eigenvalue, and ratio of largest eigenvalue to the other eigenvalue. In this study, the author investigated practical procedure to analyze diffusion tensor D app ξ using both of spin-echo end echo-planer diffusion weighted imagings with 3-tesla magnetic resonance machine in human brain. The ellipsoid representation provided particularly useful information about microanatomy including neuronal fiber tract orientation and molecular mobility reflective of microstructure. Furthermore, in the lesion of Wallerian degeneration, the loss of anisotropy of local apparent diffusion was observed. It is suggested that the function of axons can be observed via degree of anisotropy of apparent diffusion. Consequently, diffusion tensor analysis is expected to be a powerful, noninvasive method capable of quantitative and functional evaluation of the central nervous system. (author)

An integrated simulator of structure and anisotropic flow in gas diffusion layers with hydrophobic additives

Science.gov (United States)

Burganos, Vasilis N.; Skouras, Eugene D.; Kalarakis, Alexandros N.

2017-10-01

The lattice-Boltzmann (LB) method is used in this work to reproduce the controlled addition of binder and hydrophobicity-promoting agents, like polytetrafluoroethylene (PTFE), into gas diffusion layers (GDLs) and to predict flow permeabilities in the through- and in-plane directions. The present simulator manages to reproduce spreading of binder and hydrophobic additives, sequentially, into the neat fibrous layer using a two-phase flow model. Gas flow simulation is achieved by the same code, sidestepping the need for a post-processing flow code and avoiding the usual input/output and data interface problems that arise in other techniques. Compression effects on flow anisotropy of the impregnated GDL are also studied. The permeability predictions for different compression levels and for different binder or PTFE loadings are found to compare well with experimental data for commercial GDL products and with computational fluid dynamics (CFD) predictions. Alternatively, the PTFE-impregnated structure is reproduced from Scanning Electron Microscopy (SEM) images using an independent, purely geometrical approach. A comparison of the two approaches is made regarding their adequacy to reproduce correctly the main structural features of the GDL and to predict anisotropic flow permeabilities at different volume fractions of binder and hydrophobic additives.

A first approximation for modeling the liquid diffusion pathway at the greater confinement disposal facilities

International Nuclear Information System (INIS)

Olague, N.E.; Price, L.L.

1991-01-01

The greater confinement disposal (GCD) project is an ongoing project examining the disposal of orphan wastes in Area 5 of the Nevada Test Site. One of the major tasks for the project is performance assessment. With regard to performance assessment, a preliminary conceptual model for ground-water flow and radionuclide transport to the accessible environment at the GCD facilities has been developed. One of the transport pathways that has been postulated is diffusion of radionuclides in the liquid phase upward to the land surface. This pathway is not usually considered in a performance assessment, but is included in the GCD conceptual model because of relatively low recharge estimates at the GCD site and the proximity of the waste to the land surface. These low recharge estimates indicate that convective flow downward to the water table may be negligible; thus, diffusion upward to the land surface may then become important. As part of a preliminary performance assessment which considered a basecase scenario and a climate-change scenario, a first approximation for modeling the liquid-diffusion pathway was formulated. The model includes an analytical solution that incorporates both diffusion and radioactivity decay. Overall, these results indicate that, despite the configuration of the GCD facilities that establishes the need for considering the liquid-diffusion pathway, the GCD disposal concept appears to be a technically feasible method for disposing of orphan wastes. Future analyses will consist of investigating the underlying assumptions of the liquid-diffusion model, refining the model is necessary, and reducing uncertainty in the input parameters. 11 refs., 6 figs

Analytical and numerical investigation of double diffusion in thermally anisotropy multilayer porous medium

Energy Technology Data Exchange (ETDEWEB)

Bennacer, R. [Neuville sur Oise, LEEVAM 5 mail Gay Lussac, Cergy-Pontoise Cedex (France); Mohamad, A.A. [CEERE University of Calgary, Department of Mechanical and Manufacturing Engineering, Calgary, Alberta (Canada); Ganaoui, M.El [Faculte des Sciences et Techniques de Limoges, Limoges (France)

2005-02-01

Double-diffusive natural convection within a multilayer anisotropic porous medium is studied numerically and analytically. The domain composed of two horizontal porous layers is subjected to a uniform horizontal heat flux and a vertical mass flux, where only the lower one is thermally anisotropic. Darcy model with classical Boussinesq approximation is used in formulating the mathematical model. The effect of thermal anisotropy and the relative width of the two layers on the flow and transfers is illustrated with characterising the transitions from the diffusive to the convective solution. Results were well compared with respect to a developed analytical approach, based on a parallel flow approximation for thermally anisotropic multilayer media. (orig.)

Anisotropic Conductivity Tensor Imaging of In Vivo Canine Brain Using DT-MREIT.

Science.gov (United States)

Jeong, Woo Chul; Sajib, Saurav Z K; Katoch, Nitish; Kim, Hyung Joong; Kwon, Oh In; Woo, Eung Je

2017-01-01

We present in vivo images of anisotropic electrical conductivity tensor distributions inside canine brains using diffusion tensor magnetic resonance electrical impedance tomography (DT-MREIT). The conductivity tensor is represented as a product of an ion mobility tensor and a scale factor of ion concentrations. Incorporating directional mobility information from water diffusion tensors, we developed a stable process to reconstruct anisotropic conductivity tensor images from measured magnetic flux density data using an MRI scanner. Devising a new image reconstruction algorithm, we reconstructed anisotropic conductivity tensor images of two canine brains with a pixel size of 1.25 mm. Though the reconstructed conductivity values matched well in general with those measured by using invasive probing methods, there were some discrepancies as well. The degree of white matter anisotropy was 2 to 4.5, which is smaller than previous findings of 5 to 10. The reconstructed conductivity value of the cerebrospinal fluid was about 1.3 S/m, which is smaller than previous measurements of about 1.8 S/m. Future studies of in vivo imaging experiments with disease models should follow this initial trial to validate clinical significance of DT-MREIT as a new diagnostic imaging modality. Applications in modeling and simulation studies of bioelectromagnetic phenomena including source imaging and electrical stimulation are also promising.

Determination of oxygen effective diffusivity in porous gas diffusion layer using a three-dimensional pore network model

International Nuclear Information System (INIS)

Wu Rui; Zhu Xun; Liao Qiang; Wang Hong; Ding Yudong; Li Jun; Ye Dingding

2010-01-01

In proton exchange membrane fuel cell (PEMFC) models, oxygen effective diffusivity is the most important parameter to characterize the oxygen transport in the gas diffusion layer (GDL). However, its determination is a challenge due to its complex dependency on GDL structure. In the present study, a three-dimensional network consisting of spherical pores and cylindrical throats is developed and used to investigate the effects of GDL structural parameters on oxygen effective diffusivity under the condition with/without water invasion process. Oxygen transport in the throat is described by Fick's law and water invasion process in the network is simulated using the invasion percolation with trapping algorithm. The simulation results reveal that oxygen effective diffusivity is slightly affected by network size but increases with decreasing the network heterogeneity and with increasing the pore connectivity. Impacts of network anisotropy on oxygen transport are also investigated in this paper. The anisotropic network is constructed by constricting the throats in the through-plane direction with a constriction factor. It is found that water invasion has a more severe negative influence on oxygen transport in an anisotropic network. Finally, two new correlations are introduced to determine the oxygen effective diffusivity for the Toray carbon paper GDLs.

Radiative Transfer Equation for Anisotropic Spherical Medium with Specular Reflective Index

International Nuclear Information System (INIS)

Elghazaly, A.

2009-01-01

Radiative transfer problem for anisotropic scattering in a spherical homogeneous, turbid medium with diffuse and angular dependent (specular) reflecting boundaries is solved using the Pomraning-Eddington approximation method. The angular dependent specular reflectivity of the boundary is considered as Fresnel's reflection probability function. The partial heat flux is calculated with anisotropic scattering through a homogeneous solid sphere. The calculations are carried out for spherical media of radii 0.1, 1.0, and 10 mfp and for different scattering albedo. Two different weight functions are used to verify the boundary conditions. Our results are compared with the available data and give an excellent agreement for thick and highly scattering media

Computational Study of Subdural Cortical Stimulation: Effects of Simulating Anisotropic Conductivity on Activation of Cortical Neurons.

Directory of Open Access Journals (Sweden)

Hyeon Seo

Full Text Available Subdural cortical stimulation (SuCS is an appealing method in the treatment of neurological disorders, and computational modeling studies of SuCS have been applied to determine the optimal design for electrotherapy. To achieve a better understanding of computational modeling on the stimulation effects of SuCS, the influence of anisotropic white matter conductivity on the activation of cortical neurons was investigated in a realistic head model. In this paper, we constructed pyramidal neuronal models (layers 3 and 5 that showed primary excitation of the corticospinal tract, and an anatomically realistic head model reflecting complex brain geometry. The anisotropic information was acquired from diffusion tensor magnetic resonance imaging (DT-MRI and then applied to the white matter at various ratios of anisotropic conductivity. First, we compared the isotropic and anisotropic models; compared to the isotropic model, the anisotropic model showed that neurons were activated in the deeper bank during cathodal stimulation and in the wider crown during anodal stimulation. Second, several popular anisotropic principles were adapted to investigate the effects of variations in anisotropic information. We observed that excitation thresholds varied with anisotropic principles, especially with anodal stimulation. Overall, incorporating anisotropic conductivity into the anatomically realistic head model is critical for accurate estimation of neuronal responses; however, caution should be used in the selection of anisotropic information.

Diffusion Based Photon Mapping

DEFF Research Database (Denmark)

Schjøth, Lars; Sporring, Jon; Fogh Olsen, Ole

2008-01-01

. To address this problem, we introduce a photon mapping algorithm based on nonlinear anisotropic diffusion. Our algorithm adapts according to the structure of the photon map such that smoothing occurs along edges and structures and not across. In this way, we preserve important illumination features, while...

Anisotropic ray trace

Science.gov (United States)

Lam, Wai Sze Tiffany

Optical components made of anisotropic materials, such as crystal polarizers and crystal waveplates, are widely used in many complex optical system, such as display systems, microlithography, biomedical imaging and many other optical systems, and induce more complex aberrations than optical components made of isotropic materials. The goal of this dissertation is to accurately simulate the performance of optical systems with anisotropic materials using polarization ray trace. This work extends the polarization ray tracing calculus to incorporate ray tracing through anisotropic materials, including uniaxial, biaxial and optically active materials. The 3D polarization ray tracing calculus is an invaluable tool for analyzing polarization properties of an optical system. The 3x3 polarization ray tracing P matrix developed for anisotropic ray trace assists tracking the 3D polarization transformations along a ray path with series of surfaces in an optical system. To better represent the anisotropic light-matter interactions, the definition of the P matrix is generalized to incorporate not only the polarization change at a refraction/reflection interface, but also the induced optical phase accumulation as light propagates through the anisotropic medium. This enables realistic modeling of crystalline polarization elements, such as crystal waveplates and crystal polarizers. The wavefront and polarization aberrations of these anisotropic components are more complex than those of isotropic optical components and can be evaluated from the resultant P matrix for each eigen-wavefront as well as for the overall image. One incident ray refracting or reflecting into an anisotropic medium produces two eigenpolarizations or eigenmodes propagating in different directions. The associated ray parameters of these modes necessary for the anisotropic ray trace are described in Chapter 2. The algorithms to calculate the P matrix from these ray parameters are described in Chapter 3 for

Data of NODDI diffusion metrics in the brain and computer simulation of hybrid diffusion imaging (HYDI acquisition scheme

Directory of Open Access Journals (Sweden)

Chandana Kodiweera

2016-06-01

Full Text Available This article provides NODDI diffusion metrics in the brains of 52 healthy participants and computer simulation data to support compatibility of hybrid diffusion imaging (HYDI, “Hybrid diffusion imaging” [1] acquisition scheme in fitting neurite orientation dispersion and density imaging (NODDI model, “NODDI: practical in vivo neurite orientation dispersion and density imaging of the human brain” [2]. HYDI is an extremely versatile diffusion magnetic resonance imaging (dMRI technique that enables various analyzes methods using a single diffusion dataset. One of the diffusion data analysis methods is the NODDI computation, which models the brain tissue with three compartments: fast isotropic diffusion (e.g., cerebrospinal fluid, anisotropic hindered diffusion (e.g., extracellular space, and anisotropic restricted diffusion (e.g., intracellular space. The NODDI model produces microstructural metrics in the developing brain, aging brain or human brain with neurologic disorders. The first dataset provided here are the means and standard deviations of NODDI metrics in 48 white matter region-of-interest (ROI averaging across 52 healthy participants. The second dataset provided here is the computer simulation with initial conditions guided by the first dataset as inputs and gold standard for model fitting. The computer simulation data provide a direct comparison of NODDI indices computed from the HYDI acquisition [1] to the NODDI indices computed from the originally proposed acquisition [2]. These data are related to the accompanying research article “Age Effects and Sex Differences in Human Brain White Matter of Young to Middle-Aged Adults: A DTI, NODDI, and q-Space Study” [3].

An optimization-based framework for anisotropic simplex mesh adaptation

Science.gov (United States)

Yano, Masayuki; Darmofal, David L.

2012-09-01

We present a general framework for anisotropic h-adaptation of simplex meshes. Given a discretization and any element-wise, localizable error estimate, our adaptive method iterates toward a mesh that minimizes error for a given degrees of freedom. Utilizing mesh-metric duality, we consider a continuous optimization problem of the Riemannian metric tensor field that provides an anisotropic description of element sizes. First, our method performs a series of local solves to survey the behavior of the local error function. This information is then synthesized using an affine-invariant tensor manipulation framework to reconstruct an approximate gradient of the error function with respect to the metric tensor field. Finally, we perform gradient descent in the metric space to drive the mesh toward optimality. The method is first demonstrated to produce optimal anisotropic meshes minimizing the L2 projection error for a pair of canonical problems containing a singularity and a singular perturbation. The effectiveness of the framework is then demonstrated in the context of output-based adaptation for the advection-diffusion equation using a high-order discontinuous Galerkin discretization and the dual-weighted residual (DWR) error estimate. The method presented provides a unified framework for optimizing both the element size and anisotropy distribution using an a posteriori error estimate and enables efficient adaptation of anisotropic simplex meshes for high-order discretizations.

The generalized PN synthetic acceleration method for linear transport problems with highly anisotropic scattering

International Nuclear Information System (INIS)

Khattab, K.M.

1997-01-01

The diffusion synthetic acceleration (DSA) method has been known to be an effective tool for accelerating the iterative solution of transport equations with isotropic or mildly anisotropic scattering. However, the DSA method is not effective for transport equations that have strongly anisotropic scattering. A generalization of the modified DSA (MDSA) method is proposed that converges (clock time) faster than the MDSA method. This method is developed, the results of a Fourier analysis that theoretically predicts its efficiency are described, and numerical results that verify the theoretical prediction are presented

2.5D inversion of CSEM data in a vertically anisotropic earth

International Nuclear Information System (INIS)

Ramananjaona, Christophe; MacGregor, Lucy

2010-01-01

The marine Controlled-Source Electromagnetic (CSEM) method is a low frequency (diffusive) electromagnetic subsurface imaging technique aimed at mapping the electric resistivity of the earth by measuring the response to a source dipole emitting an electromagnetic field in a marine environment. Although assuming isotropy for the inversion is the most straightforward approach, in many situations horizontal layering of the earth strata and grain alignment within earth materials creates electric anisotropy. Ignoring this during interpretation may create artifacts in the inversion results. Accounting for this effect therefore requires adequate forward modelling and inversion procedures. We present here an inversion algorithm for vertically anisotropic media based on finite element modelling, the use of Frechet derivatives, and different types of regularisation. Comparisons between isotropic and anisotropic inversion results are given for the characterisation of an anisotropic earth from data measured in line with the source dipole for both synthetic and real data examples.

High-energy phosphate transfer in human muscle: diffusion of phosphocreatine.

Science.gov (United States)

Gabr, Refaat E; El-Sharkawy, Abdel-Monem M; Schär, Michael; Weiss, Robert G; Bottomley, Paul A

2011-07-01

The creatine kinase (CK) reaction is central to muscle energetics, buffering ATP levels during periods of intense activity via consumption of phosphocreatine (PCr). PCr is believed to serve as a spatial shuttle of high-energy phosphate between sites of energy production in the mitochondria and sites of energy utilization in the myofibrils via diffusion. Knowledge of the diffusion coefficient of PCr (D(PCr)) is thus critical for modeling and understanding energy transport in the myocyte, but D(PCr) has not been measured in humans. Using localized phosphorus magnetic resonance spectroscopy, we measured D(PCr) in the calf muscle of 11 adults as a function of direction and diffusion time. The results show that the diffusion of PCr is anisotropic, with significantly higher diffusion along the muscle fibers, and that the diffusion of PCr is restricted to a ∼28-μm pathlength assuming a cylindrical model, with an unbounded diffusion coefficient of ∼0.69 × 10(-3) mm(2)/s. This distance is comparable in size to the myofiber radius. On the basis of prior measures of CK reaction kinetics in human muscle, the expected diffusion distance of PCr during its half-life in the CK reaction is ∼66 μm. This distance is much greater than the average distances between mitochondria and myofibrils. Thus these first measurements of PCr diffusion in human muscle in vivo support the view that PCr diffusion is not a factor limiting high-energy phosphate transport between the mitochondria and the myofibrils in healthy resting myocytes.

Dynamic problem of generalized thermoelastic diffusive medium

Energy Technology Data Exchange (ETDEWEB)

Kumar, Rajneesh; Kansal, Tarun [Kurukshetra University, Kurukshetra (India)

2010-01-15

The equations of generalized thermoelastic diffusion, based on the theory of Lord and Shulman with one relaxation time, are derived for anisotropic media with rotation. The variational principle and reciprocity theorem for the governing equations are derived. The propagation of leaky Rayleigh waves in a viscous fluid layer overlying a homogeneous isotropic, generalized thermoelastic diffusive half space with rotating frame of reference is studied

High-coercivity ultrafine-grained anisotropic Nd–Fe–B magnets processed by hot deformation and the Nd–Cu grain boundary diffusion process

International Nuclear Information System (INIS)

Sepehri-Amin, H.; Ohkubo, T.; Nagashima, S.; Yano, M.; Shoji, T.; Kato, A.; Schrefl, T.; Hono, K.

2013-01-01

The grain boundary diffusion process using an Nd 70 Cu 30 eutectic alloy has been applied to hot-deformed anisotropic Nd–Fe–B magnets, resulting in a substantial enhancement of coercivity, from 1.5 T to 2.3 T, at the expense of remanence. Scanning electron microscopy showed that the areal fraction of an Nd-rich intergranular phase increased from 10% to 37%. The intergranular phase of the hot-deformed magnet initially contained ∼55 at.% ferromagnetic element, while it diminished to an undetectable level after the process. Microscale eutectic solidification of Nd/NdCu as well as a fine lamellae structure of Nd 70 (Co,Cu) 30 /Nd were observed in the intergranular phase. Micromagnetic simulations indicated that the reduction of the magnetization in the intergranular phases leads to the enhancement of coercivity in agreement with the experimental observation

Interactions, strings and isotopies in higher order anisotropic superspaces

CERN Document Server

Vacaru, Sergiu Ion

2001-01-01

The monograph summarizes the author's results on the geometry of anholonomic and locally anisotropic interactions, published in J. Math. Phys., Nucl. Phys. B, Ann. Phys. (NY), JHEP, Rep. Math. Phys., Int. J. Theor. Phys. and in some former Soviet Union and Romanian scientific journals. The main subjects are in the theory of field interactions, strings and diffusion processes on spaces, superspaces and isospaces with higher order anisotropy and inhomogeneity. The approach proceeds by developing the concept of higher order anisotropic (super)space which unifies the logical and manthematical aspects of modern Kaluza--Klein theories and generalized Lagrange and Finsler geometry and leads to modeling of physical processes on higher order fiber (super)bundles provided with nonlinear and distinguished connections and metric structures. This book can be also considered as a pedagogical survey on the mentioned subjects.

Magnetic resonance temporal diffusion tensor spectroscopy of disordered anisotropic tissue

DEFF Research Database (Denmark)

Nielsen, Jonathan Scharff; Dyrby, Tim B; Lundell, Henrik

2018-01-01

Molecular diffusion measured with diffusion weighted MRI (DWI) offers a probe for tissue microstructure. However, inferring microstructural properties from conventional DWI data is a complex inverse problem and has to account for heterogeneity in sizes, shapes and orientations of the tissue...

A study on the effective hydraulic conductivity of an anisotropic porous medium

International Nuclear Information System (INIS)

Seong, Kwan Jae

2002-01-01

Effective hydraulic conductivity of a statistically anisotropic heterogeneous medium is obtained for steady two-dimensional flows employing stochastic analysis. Flow equations are solved up to second order and the effective conductivity is obtained in a semi-analytic form depending only on the spatial correlation function and the anisotropy ratio of the hydraulic conductivity field, hence becoming a true intrinsic property independent of the flow field. Results are obtained using a statistically anisotropic Gaussian correlation function where the anisotropic is defined as the ratio of integral scales normal and parallel to the mean flow direction. Second order results indicate that the effective conductivity of an anisotropic medium is greater than that of an isotropic one when the anisotropy ratio is less than one and vice versa. It is also found that the effective conductivity has upper and lower bounds of the arithmetic and the harmonic mean conductivities

The generalized PN synthetic acceleration method for linear transport problems with highly anisotropic scattering

International Nuclear Information System (INIS)

Khattab, K.M.

1998-01-01

The diffusion synthetic acceleration (DSA) method has been known to be an effective tool for accelerating the iterative solution of transport equations with isotopic or mildly anisotropic scattering. However, the DSA method is not effective for transport equations that have strongly anisotropic scattering. A generalization of the modified DSA (MDSA) methods is proposed. This method converges (Clock time) faster than the MDSA method. It is developed, the results of a Fourier analysis that theoretically predicts its efficiency are described, and numerical results that verify the theoretical prediction are presented. (author). 9 refs., 2 tabs., 5 figs

Magnetic resonance temporal diffusion tensor spectroscopy of disordered anisotropic tissue

DEFF Research Database (Denmark)

Nielsen, Jonathan Scharff; Dyrby, Tim Bjørn; Lundell, Henrik

2018-01-01

of the oscillating gradient spin echo (OGSE) experiment, giving a basic contrast mechanism closely linked to both the temporal diffusion spectrum and the compartment anisotropy. We demonstrate our new method on post mortem brain tissue and show that we retrieve the correct temporal diffusion tensor spectrum...

Efficient analysis of macromolecular rotational diffusion from heteronuclear relaxation data

International Nuclear Information System (INIS)

Dosset, Patrice; Hus, Jean-Christophe; Blackledge, Martin; Marion, Dominique

2000-01-01

A novel program has been developed for the interpretation of 15 N relaxation rates in terms of macromolecular anisotropic rotational diffusion. The program is based on a highly efficient simulated annealing/minimization algorithm, designed specifically to search the parametric space described by the isotropic, axially symmetric and fully anisotropic rotational diffusion tensor models. The high efficiency of this algorithm allows extensive noise-based Monte Carlo error analysis. Relevant statistical tests are systematically applied to provide confidence limits for the proposed tensorial models. The program is illustrated here using the example of the cytochrome c' from Rhodobacter capsulatus, a four-helix bundle heme protein, for which data at three different field strengths were independently analysed and compared

Introducing Anisotropic Minkowski Functionals and Quantitative Anisotropy Measures for Local Structure Analysis in Biomedical Imaging

Science.gov (United States)

Wismüller, Axel; De, Titas; Lochmüller, Eva; Eckstein, Felix; Nagarajan, Mahesh B.

2017-01-01

The ability of Minkowski Functionals to characterize local structure in different biological tissue types has been demonstrated in a variety of medical image processing tasks. We introduce anisotropic Minkowski Functionals (AMFs) as a novel variant that captures the inherent anisotropy of the underlying gray-level structures. To quantify the anisotropy characterized by our approach, we further introduce a method to compute a quantitative measure motivated by a technique utilized in MR diffusion tensor imaging, namely fractional anisotropy. We showcase the applicability of our method in the research context of characterizing the local structure properties of trabecular bone micro-architecture in the proximal femur as visualized on multi-detector CT. To this end, AMFs were computed locally for each pixel of ROIs extracted from the head, neck and trochanter regions. Fractional anisotropy was then used to quantify the local anisotropy of the trabecular structures found in these ROIs and to compare its distribution in different anatomical regions. Our results suggest a significantly greater concentration of anisotropic trabecular structures in the head and neck regions when compared to the trochanter region (p < 10−4). We also evaluated the ability of such AMFs to predict bone strength in the femoral head of proximal femur specimens obtained from 50 donors. Our results suggest that such AMFs, when used in conjunction with multi-regression models, can outperform more conventional features such as BMD in predicting failure load. We conclude that such anisotropic Minkowski Functionals can capture valuable information regarding directional attributes of local structure, which may be useful in a wide scope of biomedical imaging applications. PMID:29170580

Anisotropic transport of microalgae Chlorella vulgaris in microfluidic channel

International Nuclear Information System (INIS)

Ishak, Nur Izzati; Muniandy, S V; Periasamy, Vengadesh; Ng, Fong-Lee; Phang, Siew-Moi

2017-01-01

In this work, we study the regional dependence of transport behavior of microalgae Chlorella vulgaris inside microfluidic channel on applied fluid flow rate. The microalgae are treated as spherical naturally buoyant particles. Deviation from the normal diffusion or Brownian transport is characterized based on the scaling behavior of the mean square displacement (MSD) of the particle trajectories by resolving the displacements in the streamwise (flow) and perpendicular directions. The channel is divided into three different flow regions, namely center region of the channel and two near-wall boundaries and the particle motions are analyzed at different flow rates. We use the scaled Brownian motion to model the transitional characteristics in the scaling behavior of the MSDs. We find that there exist anisotropic anomalous transports in all the three flow regions with mixed sub-diffusive, normal and super-diffusive behavior in both longitudinal and transverse directions. (paper)

The accuracy of the diffusion theory component of removal-diffusion theory

International Nuclear Information System (INIS)

Donnelly, I.J.

1976-03-01

The neutron fluxes in five neutron shields consisting of water, concrete, graphite, iron and an iron-water lattice respectively, have been calculated using P 1 theory, diffusion theory with the usual transport correction for anisotropic scattering (DT), and diffusion theory with a diagonal transport correction (DDT). The calculations have been repeated using transport theory for the flux above 0.5 MeV and the diffusion theories for lower energies. Comparisons with transport theory calculations reveal the accuracy of each diffusion theory when it is used for flux evaluation at all energies, and also its accuracy when used for flux evaluation below 0.5 MeV given the correct flux above 0.5 MeV. It is concluded that the diffusion component of removal-diffusion theory has adequate accuracy unless the high energy diffusion entering the shield is significantly larger than the removal flux. In general, P 1 and DT are more accurate than DDT and give similar fluxes except for shields having a large hydrogen content, in which case DT is better. Therefore it is recommended that DT be used in preference to P 1 theory or DDT. (author)

Noise-induced drift in two-dimensional anisotropic systems

Science.gov (United States)

Farago, Oded

2017-10-01

We study the isothermal Brownian dynamics of a particle in a system with spatially varying diffusivity. Due to the heterogeneity of the system, the particle's mean displacement does not vanish even if it does not experience any physical force. This phenomenon has been termed "noise-induced drift," and has been extensively studied for one-dimensional systems. Here, we examine the noise-induced drift in a two-dimensional anisotropic system, characterized by a symmetric diffusion tensor with unequal diagonal elements. A general expression for the mean displacement vector is derived and presented as a sum of two vectors, depicting two distinct drifting effects. The first vector describes the tendency of the particle to drift toward the high diffusivity side in each orthogonal principal diffusion direction. This is a generalization of the well-known expression for the noise-induced drift in one-dimensional systems. The second vector represents a novel drifting effect, not found in one-dimensional systems, originating from the spatial rotation in the directions of the principal axes. The validity of the derived expressions is verified by using Langevin dynamics simulations. As a specific example, we consider the relative diffusion of two transmembrane proteins, and demonstrate that the average distance between them increases at a surprisingly fast rate of several tens of micrometers per second.

Study on diffusion anisotropy of cerebral ischemia using diffusion weighted echo-planar MRI

International Nuclear Information System (INIS)

Kajima, Toshio

1997-01-01

Focal cerebral ischemia was produced by occlusion of the intracranial main cerebral artery with a silicone cylinder in Wistar rats. Diffusion-weighted echo-planar images (DW-EPls) using the motion-probing gradient (MPG) method were acquired at 1-3 hours and 24-48 hours after occlusion. Apparent diffusion coefficients (ADCs) were calculated from these images in ischemic lesions and in normal unoccluded regions. Results were as follows. Ischemic lesions could be detected on the DW-EPIs at 1 hour after occlusion. The ADC of water in the brain tissue was smaller than that of free water as a result of restricted diffusion. Anisotropic diffusion that probably can be attributed to the myelin sheath was observed in the normal white matter. In the ischemic lesions, the ADC decreased rapidly within 1-3 hours after occlusion and then decreased gradually after 24-48 hours. In the ischemic white matter, diffusion anisotropy disappeared at 24-48 hours after occlusion. Diffusion-weighted imaging may have applications in the examination of pathophysiological mechanisms in cerebral ischemia by means of evaluation of ADC and diffusion anisotropy. (author)

Diffusion Influenced Adsorption Kinetics.

Science.gov (United States)

Miura, Toshiaki; Seki, Kazuhiko

2015-08-27

When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

The dynamics of nucleation and growth of a particle in the ternary alloy melt with anisotropic surface tension.

Science.gov (United States)

Chen, Ming-Wen; Li, Lin-Yan; Guo, Hui-Min

2017-08-28

The dynamics of nucleation and growth of a particle affected by anisotropic surface tension in the ternary alloy melt is studied. The uniformly valid asymptotic solution for temperature field, concentration field, and interface evolution of nucleation and particle growth is obtained by means of the multiple variable expansion method. The asymptotic solution reveals the critical radius of nucleation in the ternary alloy melt and an inward melting mechanism of the particle induced by the anisotropic effect of surface tension. The critical radius of nucleation is dependent on isotropic surface tension, temperature undercooling, and constitutional undercooling in the ternary alloy melt, and the solute diffusion melt decreases the critical radius of nucleation. Immediately after a nucleus forms in the initial stage of solidification, the anisotropic effect of surface tension makes some parts of its interface grow inward while some parts grow outward. Until the inward melting attains a certain distance (which is defined as "the melting depth"), these parts of interface start to grow outward with other parts. The interface of the particle evolves into an ear-like deformation, whose inner diameter may be less than two times the critical radius of nucleation within a short time in the initial stage of solidification. The solute diffusion in the ternary alloy melt decreases the effect of anisotropic surface tension on the interface deformation.

Diffusion tensor imaging for nerve fiber bundles in the brain stem and spinocerebellar degeneration

International Nuclear Information System (INIS)

Honma, Tsuguo

2009-01-01

Diffusion tensor imaging (DTI) can create an image of the anisotropic nature of diffusion and express it quantitatively. Nerve fibers have a large anisotropic diffusion, and it is possible to obtain images of the nerve fiber bundle. The purpose of this study is to observe the nerve fiber bundles in the brain stem using DTI and study its potential for diagnosing the type of spinocerebellar degeneration (SCD). Fractional anisotropy (FA) maps and 3D-tractography images were obtained for 41 subjects with no brain stem abnormalities. We created an apparent diffusion coefficient (ADC) map and an FA map using DTI for 16 subjects in the disease group (11 with hereditary SCD and 5 with non-hereditary SCD) and 25 in the control group. The diffusion value of the pons and middle cerebellar peduncle was measured using ADC, and the degree of anisotropic diffusion was measured using FA. The pyramidal tract, superior cerebellar peduncle, and inferior cerebellar peduncle were clearly demonstrated for all cases. ADC for the middle cerebellar peduncle in spinocerebellar ataxin (SCA)1 was significantly higher, similar to that for the pons in dentatorubro-pallidoluysian atrophy (DRPLA). In MSA-C, ADC for both the pons and middle cerebellar peduncle was significantly elevated and FA was significantly decreased. There were no significant changes in SCA3. We could observe the nerve fiber bundles in the brain stem using DTI. FA and ADC measurements with DTI can aid in diagnosing the type of SCD. (author)

Anisotropic gravitational instability

International Nuclear Information System (INIS)

Polyachenko, V.L.; Fridman, A.M.

1988-01-01

Exact solutions of stability problems are obtained for two anisotropic gravitational systems of different geometries - a layer of finite thickness at rest and a rotating cylinder of finite radius. It is shown that the anisotropic gravitational instability which develops in both cases is of Jeans type. However, in contrast to the classical aperiodic Jeans instability, this instability is oscillatory. The physics of the anisotropic gravitational instability is investigated. It is shown that in a gravitating layer this instability is due, in particular, to excitation of previously unknown interchange-Jeans modes. In the cylinder, the oscillatory Jeans instability is associated with excitation of a rotational branch, this also being responsible for the beam gravitational instability. This is the reason why this instability and the anisotropic gravitational instability have so much in common

Quantum transport of atomic matter waves in anisotropic two-dimensional and three-dimensional disorder

International Nuclear Information System (INIS)

Piraud, M; Pezzé, L; Sanchez-Palencia, L

2013-01-01

The macroscopic transport properties in a disordered potential, namely diffusion and weak/strong localization, closely depend on the microscopic and statistical properties of the disorder itself. This dependence is rich in counter-intuitive consequences. It can be particularly exploited in matter wave experiments, where the disordered potential can be tailored and controlled, and anisotropies are naturally present. In this work, we apply a perturbative microscopic transport theory and the self-consistent theory of Anderson localization to study the transport properties of ultracold atoms in anisotropic two-dimensional (2D) and three-dimensional (3D) speckle potentials. In particular, we discuss the anisotropy of single-scattering, diffusion and localization. We also calculate disorder-induced shift of the energy states and propose a method to include it, which amounts to renormalizing energies in the standard on-shell approximation. We show that the renormalization of energies strongly affects the prediction for the 3D localization threshold (mobility edge). We illustrate the theoretical findings with examples which are relevant for current matter wave experiments, where the disorder is created with laser speckle. This paper provides a guideline for future experiments aiming at the precise location of the 3D mobility edge and study of anisotropic diffusion and localization effects in 2D and 3D. (paper)

Spatial Mapping of Translational Diffusion Coefficients Using Diffusion Tensor Imaging: A Mathematical Description.

Science.gov (United States)

Shetty, Anil N; Chiang, Sharon; Maletic-Savatic, Mirjana; Kasprian, Gregor; Vannucci, Marina; Lee, Wesley

2014-01-01

In this article, we discuss the theoretical background for diffusion weighted imaging and diffusion tensor imaging. Molecular diffusion is a random process involving thermal Brownian motion. In biological tissues, the underlying microstructures restrict the diffusion of water molecules, making diffusion directionally dependent. Water diffusion in tissue is mathematically characterized by the diffusion tensor, the elements of which contain information about the magnitude and direction of diffusion and is a function of the coordinate system. Thus, it is possible to generate contrast in tissue based primarily on diffusion effects. Expressing diffusion in terms of the measured diffusion coefficient (eigenvalue) in any one direction can lead to errors. Nowhere is this more evident than in white matter, due to the preferential orientation of myelin fibers. The directional dependency is removed by diagonalization of the diffusion tensor, which then yields a set of three eigenvalues and eigenvectors, representing the magnitude and direction of the three orthogonal axes of the diffusion ellipsoid, respectively. For example, the eigenvalue corresponding to the eigenvector along the long axis of the fiber corresponds qualitatively to diffusion with least restriction. Determination of the principal values of the diffusion tensor and various anisotropic indices provides structural information. We review the use of diffusion measurements using the modified Stejskal-Tanner diffusion equation. The anisotropy is analyzed by decomposing the diffusion tensor based on symmetrical properties describing the geometry of diffusion tensor. We further describe diffusion tensor properties in visualizing fiber tract organization of the human brain.

Anisotropic constant-roll inflation

Energy Technology Data Exchange (ETDEWEB)

Ito, Asuka; Soda, Jiro [Kobe University, Department of Physics, Kobe (Japan)

2018-01-15

We study constant-roll inflation in the presence of a gauge field coupled to an inflaton. By imposing the constant anisotropy condition, we find new exact anisotropic constant-roll inflationary solutions which include anisotropic power-law inflation as a special case. We also numerically show that the new anisotropic solutions are attractors in the phase space. (orig.)

Modeling Diffusion and Buoyancy-Driven Convection with Application to Geological CO2 Storage

KAUST Repository

Allen, Rebecca

2015-04-01

ABSTRACT Modeling Diffusion and Buoyancy-Driven Convection with Application to Geological CO2 Storage Rebecca Allen Geological CO2 storage is an engineering feat that has been undertaken around the world for more than two decades, thus accurate modeling of flow and transport behavior is of practical importance. Diffusive and convective transport are relevant processes for buoyancy-driven convection of CO2 into underlying fluid, a scenario that has received the attention of numerous modeling studies. While most studies focus on Darcy-scale modeling of this scenario, relatively little work exists at the pore-scale. In this work, properties evaluated at the pore-scale are used to investigate the transport behavior modeled at the Darcy-scale. We compute permeability and two different forms of tortuosity, namely hydraulic and diffusive. By generating various pore ge- ometries, we find hydraulic and diffusive tortuosity can be quantitatively different in the same pore geometry by up to a factor of ten. As such, we emphasize that these tortuosities should not be used interchangeably. We find pore geometries that are characterized by anisotropic permeability can also exhibit anisotropic diffusive tortuosity. This finding has important implications for buoyancy-driven convection modeling; when representing the geological formation with an anisotropic permeabil- ity, it is more realistic to also account for an anisotropic diffusivity. By implementing a non-dimensional model that includes both a vertically and horizontally orientated 5 Rayleigh number, we interpret our findings according to the combined effect of the anisotropy from permeability and diffusive tortuosity. In particular, we observe the Rayleigh ratio may either dampen or enhance the diffusing front, and our simulation data is used to express the time of convective onset as a function of the Rayleigh ratio. Also, we implement a lattice Boltzmann model for thermal convective flows, which we treat as an analog for

Cortical fibers orientation mapping using in-vivo whole brain 7 T diffusion MRI

NARCIS (Netherlands)

Gulban, Omer F; De Martino, Federico; Vu, An T; Yacoub, Essa; Uğurbil, Kamil; Lenglet, Christophe

Diffusion MRI of the cortical gray matter is challenging because the micro-environment probed by water molecules is much more complex than within the white matter. High spatial and angular resolutions are therefore necessary to uncover anisotropic diffusion patterns and laminar structures, which

Analysis and correction of gradient nonlinearity bias in apparent diffusion coefficient measurements.

Science.gov (United States)

Malyarenko, Dariya I; Ross, Brian D; Chenevert, Thomas L

2014-03-01

Gradient nonlinearity of MRI systems leads to spatially dependent b-values and consequently high non-uniformity errors (10-20%) in apparent diffusion coefficient (ADC) measurements over clinically relevant field-of-views. This work seeks practical correction procedure that effectively reduces observed ADC bias for media of arbitrary anisotropy in the fewest measurements. All-inclusive bias analysis considers spatial and time-domain cross-terms for diffusion and imaging gradients. The proposed correction is based on rotation of the gradient nonlinearity tensor into the diffusion gradient frame where spatial bias of b-matrix can be approximated by its Euclidean norm. Correction efficiency of the proposed procedure is numerically evaluated for a range of model diffusion tensor anisotropies and orientations. Spatial dependence of nonlinearity correction terms accounts for the bulk (75-95%) of ADC bias for FA = 0.3-0.9. Residual ADC non-uniformity errors are amplified for anisotropic diffusion. This approximation obviates need for full diffusion tensor measurement and diagonalization to derive a corrected ADC. Practical scenarios are outlined for implementation of the correction on clinical MRI systems. The proposed simplified correction algorithm appears sufficient to control ADC non-uniformity errors in clinical studies using three orthogonal diffusion measurements. The most efficient reduction of ADC bias for anisotropic medium is achieved with non-lab-based diffusion gradients. Copyright © 2013 Wiley Periodicals, Inc.

MULTISCALE TENSOR ANISOTROPIC FILTERING OF FLUORESCENCE MICROSCOPY FOR DENOISING MICROVASCULATURE.

Science.gov (United States)

Prasath, V B S; Pelapur, R; Glinskii, O V; Glinsky, V V; Huxley, V H; Palaniappan, K

2015-04-01

Fluorescence microscopy images are contaminated by noise and improving image quality without blurring vascular structures by filtering is an important step in automatic image analysis. The application of interest here is to automatically extract the structural components of the microvascular system with accuracy from images acquired by fluorescence microscopy. A robust denoising process is necessary in order to extract accurate vascular morphology information. For this purpose, we propose a multiscale tensor with anisotropic diffusion model which progressively and adaptively updates the amount of smoothing while preserving vessel boundaries accurately. Based on a coherency enhancing flow with planar confidence measure and fused 3D structure information, our method integrates multiple scales for microvasculature preservation and noise removal membrane structures. Experimental results on simulated synthetic images and epifluorescence images show the advantage of our improvement over other related diffusion filters. We further show that the proposed multiscale integration approach improves denoising accuracy of different tensor diffusion methods to obtain better microvasculature segmentation.

NON-AXISYMMETRIC PERPENDICULAR DIFFUSION OF CHARGED PARTICLES AND THEIR TRANSPORT ACROSS TANGENTIAL MAGNETIC DISCONTINUITIES

Energy Technology Data Exchange (ETDEWEB)

Strauss, R. D.; Engelbrecht, N. E.; Dunzlaff, P. [Center for Space Research, North-West University, Potchefstroom, 2522 (South Africa); Roux, J. A. le [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 3585 (United States); Ruffolo, D., E-mail: dutoit.strauss@nwu.ac.za [Department of Physics, Faculty of Science, Mahidol University, Bangkok 10400 (Thailand)

2016-07-01

We investigate the transport of charged particles across magnetic discontinuities, focusing specifically on stream interfaces associated with co-rotating interaction regions in the solar wind. We argue that the magnetic field fluctuations perpendicular to the magnetic discontinuity, and usually also perpendicular to the mean magnetic field, are strongly damped in the vicinity of such a magnetic structure, leading to anisotropic perpendicular diffusion. Assuming that perpendicular diffusion arises from drifts in a turbulent magnetic field, we adopt a simplified approach to derive the relevant perpendicular diffusion coefficient. This approach, which we believe gives the correct principal dependences as expected from more elaborate calculations, allows us to investigate transport in different turbulent geometries, such as longitudinal compressional turbulence that may be present near the heliopause. Although highly dependent on the (possibly anisotropic) perpendicular length scales and turbulence levels, we generally find perpendicular diffusion to be strongly damped at magnetic discontinuities, which may in turn provide an explanation for the large particle gradients associated with these structures.

Wetting and Diffusion of Water on Pristine and Strained Phosphorene

OpenAIRE

Zhang, Wei; Ye, Chao; Bi, Lin; Yang, Zaixing; Zhou, Ruhong

2015-01-01

Phosphorene, a newly fabricated two-dimensional (2D) nanomaterial, have exhibited promising application prospect in biology. Nonetheless, the wetting and diffusive properties of bio-fluids on phosphorene are still elusive. In this study, using molecular dynamics (MD) simulations, we investigated the structural and dynamic properties of water on pristine and strained phosphorene. The MD simulations illustrated that the diffusion of water molecules on the phosphorene surface is anisotropic, whi...

Anisotropic contrast optical microscope.

Science.gov (United States)

Peev, D; Hofmann, T; Kananizadeh, N; Beeram, S; Rodriguez, E; Wimer, S; Rodenhausen, K B; Herzinger, C M; Kasputis, T; Pfaunmiller, E; Nguyen, A; Korlacki, R; Pannier, A; Li, Y; Schubert, E; Hage, D; Schubert, M

2016-11-01

An optical microscope is described that reveals contrast in the Mueller matrix images of a thin, transparent, or semi-transparent specimen located within an anisotropic object plane (anisotropic filter). The specimen changes the anisotropy of the filter and thereby produces contrast within the Mueller matrix images. Here we use an anisotropic filter composed of a semi-transparent, nanostructured thin film with sub-wavelength thickness placed within the object plane. The sample is illuminated as in common optical microscopy but the light is modulated in its polarization using combinations of linear polarizers and phase plate (compensator) to control and analyze the state of polarization. Direct generalized ellipsometry data analysis approaches permit extraction of fundamental Mueller matrix object plane images dispensing with the need of Fourier expansion methods. Generalized ellipsometry model approaches are used for quantitative image analyses. These images are obtained from sets of multiple images obtained under various polarizer, analyzer, and compensator settings. Up to 16 independent Mueller matrix images can be obtained, while our current setup is limited to 11 images normalized by the unpolarized intensity. We demonstrate the anisotropic contrast optical microscope by measuring lithographically defined micro-patterned anisotropic filters, and we quantify the adsorption of an organic self-assembled monolayer film onto the anisotropic filter. Comparison with an isotropic glass slide demonstrates the image enhancement obtained by our method over microscopy without the use of an anisotropic filter. In our current instrument, we estimate the limit of detection for organic volumetric mass within the object plane of ≈49 fg within ≈7 × 7 μm 2 object surface area. Compared to a quartz crystal microbalance with dissipation instrumentation, where contemporary limits require a total load of ≈500 pg for detection, the instrumentation demonstrated here improves

A novel image inpainting technique based on median diffusion

Indian Academy of Sciences (India)

numerical methods such as anisotropic diffusion and multiresolution schemes. Some steps ... Roth & Black (2005) have developed a framework for learning a generic and expressive image priors that ..... This paper presents a new approach for image inpainting by propagating median information .... J. Graphics Tools 9(1):.

Simple types of anisotropic inflation

International Nuclear Information System (INIS)

Barrow, John D.; Hervik, Sigbjoern

2010-01-01

We display some simple cosmological solutions of gravity theories with quadratic Ricci curvature terms added to the Einstein-Hilbert Lagrangian which exhibit anisotropic inflation. The Hubble expansion rates are constant and unequal in three orthogonal directions. We describe the evolution of the simplest of these homogeneous and anisotropic cosmological models from its natural initial state and evaluate the deviations they will create from statistical isotropy in the fluctuations produced during a period of anisotropic inflation. The anisotropic inflation is not a late-time attractor in these models but the rate of approach to a final isotropic de Sitter state is slow and is conducive to the creation of observable anisotropic statistical effects in the microwave background. The statistical anisotropy would not be scale invariant and the level of statistical anisotropy will grow with scale.

On the nature of the NAA diffusion attenuated MR signal in the central nervous system.

Science.gov (United States)

Kroenke, Christopher D; Ackerman, Joseph J H; Yablonskiy, Dmitriy A

2004-11-01

In the brain, on a macroscopic scale, diffusion of the intraneuronal constituent N-acetyl-L-aspartate (NAA) appears to be isotropic. In contrast, on a microscopic scale, NAA diffusion is likely highly anisotropic, with displacements perpendicular to neuronal fibers being markedly hindered, and parallel displacements less so. In this report we first substantiate that local anisotropy influences NAA diffusion in vivo by observing differing diffusivities parallel and perpendicular to human corpus callosum axonal fibers. We then extend our measurements to large voxels within rat brains. As expected, the macroscopic apparent diffusion coefficient (ADC) of NAA is practically isotropic due to averaging of the numerous and diverse fiber orientations. We demonstrate that the substantially non-monoexponential diffusion-mediated MR signal decay vs. b value can be quantitatively explained by a theoretical model of NAA confined to an ensemble of differently oriented neuronal fibers. On the microscopic scale, NAA diffusion is found to be strongly anisotropic, with displacements occurring almost exclusively parallel to the local fiber axis. This parallel diffusivity, ADCparallel, is 0.36 +/- 0.01 microm2/ms, and ADCperpendicular is essentially zero. From ADCparallel the apparent viscosity of the neuron cytoplasm is estimated to be twice as large as that of a temperature-matched dilute aqueous solution. (c) 2004 Wiley-Liss, Inc.

Anisotropic biodegradable lipid coated particles for spatially dynamic protein presentation.

Science.gov (United States)

Meyer, Randall A; Mathew, Mohit P; Ben-Akiva, Elana; Sunshine, Joel C; Shmueli, Ron B; Ren, Qiuyin; Yarema, Kevin J; Green, Jordan J

2018-05-01

There has been growing interest in the use of particles coated with lipids for applications ranging from drug delivery, gene delivery, and diagnostic imaging to immunoengineering. To date, almost all particles with lipid coatings have been spherical despite emerging evidence that non-spherical shapes can provide important advantages including reduced non-specific elimination and increased target-specific binding. We combine control of core particle geometry with control of particle surface functionality by developing anisotropic, biodegradable ellipsoidal particles with lipid coatings. We demonstrate that these lipid coated ellipsoidal particles maintain advantageous properties of lipid polymer hybrid particles, such as the ability for modular protein conjugation to the particle surface using versatile bioorthogonal ligation reactions. In addition, they exhibit biomimetic membrane fluidity and demonstrate lateral diffusive properties characteristic of natural membrane proteins. These ellipsoidal particles simultaneously provide benefits of non-spherical particles in terms of stability and resistance to non-specific phagocytosis by macrophages as well as enhanced targeted binding. These biomaterials provide a novel and flexible platform for numerous biomedical applications. The research reported here documents the ability of non-spherical polymeric particles to be coated with lipids to form anisotropic biomimetic particles. In addition, we demonstrate that these lipid-coated biodegradable polymeric particles can be conjugated to a wide variety of biological molecules in a "click-like" fashion. This is of interest due to the multiple types of cellular mimicry enabled by this biomaterial based technology. These features include mimicry of the highly anisotropic shape exhibited by cells, surface presentation of membrane bound protein mimetics, and lateral diffusivity of membrane bound substrates comparable to that of a plasma membrane. This platform is demonstrated to

Image denoising using non linear diffusion tensors

International Nuclear Information System (INIS)

Benzarti, F.; Amiri, H.

2011-01-01

Image denoising is an important pre-processing step for many image analysis and computer vision system. It refers to the task of recovering a good estimate of the true image from a degraded observation without altering and changing useful structure in the image such as discontinuities and edges. In this paper, we propose a new approach for image denoising based on the combination of two non linear diffusion tensors. One allows diffusion along the orientation of greatest coherences, while the other allows diffusion along orthogonal directions. The idea is to track perfectly the local geometry of the degraded image and applying anisotropic diffusion mainly along the preferred structure direction. To illustrate the effective performance of our model, we present some experimental results on a test and real photographic color images.

Ionic diffusion in the double layer at model electrode/molten salt interfaces

International Nuclear Information System (INIS)

Tankeshwar, K.; Tosi, M.P.

1991-08-01

The anisotropic ionic diffusion coefficients in model electrochemical cells in the molten-salt regime for the electrolyte are evaluated from the ionic density profiles reported in simulation work of Grout and coworkers. A local description of the diffusion processes for counterions and coions in the electrical double layer is obtained from the data. (author). 10 refs, 1 fig., 1 tab

Diffusion and mixing in gravity-driven dense granular flows.

Science.gov (United States)

Choi, Jaehyuk; Kudrolli, Arshad; Rosales, Rodolfo R; Bazant, Martin Z

2004-04-30

We study the transport properties of particles draining from a silo using imaging and direct particle tracking. The particle displacements show a universal transition from superdiffusion to normal diffusion, as a function of the distance fallen, independent of the flow speed. In the superdiffusive (but sub-ballistic) regime, which occurs before a particle falls through its diameter, the displacements have fat-tailed and anisotropic distributions. In the diffusive regime, we observe very slow cage breaking and Péclet numbers of order 100, contrary to the only previous microscopic model (based on diffusing voids). Overall, our experiments show that diffusion and mixing are dominated by geometry, consistent with long-lasting contacts but not thermal collisions, as in normal fluids.

Calculation of anisotropic few-group constants in asymptotic cells: the code ANICELL

International Nuclear Information System (INIS)

Devenyi, A.

1985-10-01

The theoretical background of the ANICELL computer program together with a user's manual is presented. ANICELL is a nuclear reactor neutron transport code which solves the traditional asymptotic and the so-called tilted flux transport problems in one-dimensional cylindrical geometry using linearly anisotropic scattering. The method of solution used is the first flight collision probability technique. Few-group constants including radial and axial diffusion coefficients for the cell are also prepared by the program. (author)

3D controlled-source electromagnetic modeling in anisotropic medium using edge-based finite element method

DEFF Research Database (Denmark)

Cai, Hongzhu; Xiong, Bin; Han, Muran

2014-01-01

This paper presents a linear edge-based finite element method for numerical modeling of 3D controlled-source electromagnetic data in an anisotropic conductive medium. We use a nonuniform rectangular mesh in order to capture the rapid change of diffusive electromagnetic field within the regions of...... are in a good agreement with the solutions obtained by the integral equation method....

Modeling the characteristic etch morphologies along specific crystallographic orientations by anisotropic chemical etching

Directory of Open Access Journals (Sweden)

Kun-Dar Li

2018-02-01

Full Text Available To improve the advanced manufacturing technology for functional materials, a sophisticated control of chemical etching process is highly demanded, especially in the fields of environment and energy related applications. In this study, a phase-field-based model is utilized to investigate the etch morphologies influenced by the crystallographic characters during anisotropic chemical etching. Three types of etching modes are inspected theoretically, including the isotropic, and preferred oriented etchings. Owing to the specific etching behavior along the crystallographic directions, different characteristic surface structures are presented in the simulations, such as the pimple-like, pyramidal hillock and ridge-like morphologies. In addition, the processing parameters affecting the surface morphological formation and evolution are also examined systematically. According to the numerical results, the growth mechanism of surface morphology in a chemical etching is revealed distinctly. While the etching dynamics plays a dominant role on the surface formation, the characteristic surface morphologies corresponding to the preferred etching direction become more apparent. As the atomic diffusion turned into a determinative factor, a smoothened surface would appear, even under the anisotropic etching conditions. These simulation results provide fundamental information to enhance the development and application of anisotropic chemical etching techniques.

Modeling the characteristic etch morphologies along specific crystallographic orientations by anisotropic chemical etching

Science.gov (United States)

Li, Kun-Dar; Miao, Jin-Ru

2018-02-01

To improve the advanced manufacturing technology for functional materials, a sophisticated control of chemical etching process is highly demanded, especially in the fields of environment and energy related applications. In this study, a phase-field-based model is utilized to investigate the etch morphologies influenced by the crystallographic characters during anisotropic chemical etching. Three types of etching modes are inspected theoretically, including the isotropic, and preferred oriented etchings. Owing to the specific etching behavior along the crystallographic directions, different characteristic surface structures are presented in the simulations, such as the pimple-like, pyramidal hillock and ridge-like morphologies. In addition, the processing parameters affecting the surface morphological formation and evolution are also examined systematically. According to the numerical results, the growth mechanism of surface morphology in a chemical etching is revealed distinctly. While the etching dynamics plays a dominant role on the surface formation, the characteristic surface morphologies corresponding to the preferred etching direction become more apparent. As the atomic diffusion turned into a determinative factor, a smoothened surface would appear, even under the anisotropic etching conditions. These simulation results provide fundamental information to enhance the development and application of anisotropic chemical etching techniques.

Fractal behavior of single-particle trajectories and isosets in isotropic and anisotropic fluids

International Nuclear Information System (INIS)

Kalia, R.K.; Vashishta, P.; de Leeuw, S.W.

1985-08-01

Molecular dynamics simulations for a variety of systems in 2 spatial dimensions reveal fractual behavior associated with trajectories and isosets of single particle motion. The fractual dimensions of trajectories and isosets are 2 and 0.5, respectively, irrespective of the nature of the interparticle interaction or thermodynamic state of the system. Recently, we have investigated the fractual behavior of diffusing Ag ions in the superionic phase of Ag 2 S. MD calculations have shown that the Ag ions diffuse anisotropically along certain directions in the lattice of S particles. Fractual dimensions D and anti D for Ag ions are again 2 and 0.5, respectively. These results confirm the universal nature of fractual dimensions of trails and isosets

In situ gaseous tracer diffusion experiments and predictive modeling at the Greater Confinement Disposal Test

International Nuclear Information System (INIS)

Olson, M.C.

1985-07-01

The Greater Confinement Disposal Test (GCDT) at the Nevada Test Site is a research project investigating the feasibility of augered shaft disposal of low-level radioactive waste considered unsuitable for shallow land burial. The GCDT contains environmentally mobile and high-specific-activity sources. Research is focused on providing a set of analytically derived hydrogeologic parameters and an empirical database for application in a multiphase, two-dimensional, transient, predictive performance model. Potential contaminant transport processes at the GCDT are identified and their level of significance is detailed. Nonisothermal gaseous diffusion through alluvial sediments is considered the primary waste migration process. Volatile organic tracers are released in the subsurface and their migration is monitored in situ to determine media effective diffusion coefficients, tortuosity, and sorption-corrected porosity terms. The theoretical basis for volatile tracer experiments is presented. Treatment of thermal and liquid flow components is discussed, as is the basis for eliminating several negligible transport processes. Interpretive techniques include correlation, power spectra, and least squares analysis, a graphical analytical solution, and inverse numerical modeling. Model design and application to the GCDT are discussed. GCDT structural, analytical, and computer facilities are detailed. The status of the current research program is reviewed, and temperature and soil moisture profiles are presented along with results of operational tests on the analytical system. 72 refs., 39 figs., 2 tabs

Sound attenuation and absorption by anisotropic fibrous materials: Theoretical and experimental study

Science.gov (United States)

Bravo, Teresa; Maury, Cédric

2018-03-01

This paper describes analytical and experimental studies carried out to examine the attenuation and absorption properties of rigidly-backed fibrous anisotropic materials in contact with a uniform mean flow. The aim is to provide insights for the development of non-locally reacting wall-treatments able to dissipate the noise induced by acoustic excitations over in-duct or external lining systems. A model of sound propagation in anisotropic bulk-reacting liners is presented that fully accounts for anisotropic losses due to heat conduction, viscous dissipation and diffusion processes along and across the material fibres as well as for the convective effect of an external flow. The propagation constant for the least attenuated mode of the coupled system is obtained using a simulated annealing search method. The predicted acoustical performance is validated in the no-flow case for a wide range of fibre diameters. They are assessed against impedance tube and free-field pressure-velocity measurements of the normal incidence absorption coefficient and surface impedance. Parametric studies are then conducted to determine the key constitutive parameters such as the fibres orientation or the amount of anisotropy that mostly influence the axial attenuation or the normal absorption. They are supported by a low-frequency approximation to the axial attenuation under a low-speed flow.

A Numerical Model of Anisotropic Mass Transport Through Grain Boundary Networks

Science.gov (United States)

Wang, Yibo

Tin (Sn) thin films are commonly used in electronic circuit applications as coatings on contacts and solders for joining components. It is widely observed, for some such system, that whiskers---long, thin crystalline structures---emerge and grow from the film. The Sn whisker phenomenon has become a highly active research area since Sn whiskers have caused a large amount of damage and loss in manufacturing, military, medical and power industries. Though lead (Pb) addition to Sn has been used to solve this problem for over five decades, the adverse environmental and health effects of Pb have motivated legislation to severely constrain Pb use in society. People are researching and seeking the reasons which cause whiskers and corresponding methods to solve the problem. The contributing factors to cause a Sn whisker are potentially many and much still remains unknown. Better understanding of fundamental driving forces should point toward strategies to improve (a) the accuracy with which we can predict whisker formation, and (b) our ability to mitigate the phenomenon. This thesis summarizes recent important research achievements in understanding Sn whisker formation and growth, both experimentally and theoretically. Focus is then placed on examining the role that anisotropy in grain boundary diffusivity plays in determining whisker characteristics (specifically, whether they form and, if so, where on a surface). To study this aspect of the problem and to enable future studies on stress driven grain boundary diffusion, this thesis presents a numerical anisotropic mass transport model. In addition to presenting details of the model and implementation, model predictions for a set of increasingly complex grain boundary networks are discussed. Preliminary results from the model provide evidence that anisotropic grain boundary diffusion may be a primary driving mechanism in whisker formation.

Diffusive heat transport across magnetic islands and stochastic layers in tokamaks

International Nuclear Information System (INIS)

Hoelzl, Matthias

2010-01-01

Heat transport in tokamak plasmas with magnetic islands and ergodic field lines was simulated at realistic plasma parameters in realistic tokamak geometries. This requires the treatment of anisotropic heat diffusion, which is more efficient along magnetic field lines by up to ten orders of magnitude than perpendicular to them. Comparisons with analytical predictions and experimental measurements allow to determine the stability properties of neoclassical tearing modes as well as the experimental heat diffusion anisotropy.

VARIANT: VARIational anisotropic nodal transport for multidimensional Cartesian and hexadgonal geometry calculation

International Nuclear Information System (INIS)

Palmiotti, G.; Carrico, C.B.; Lewis, E.E.

1995-10-01

The theoretical basis, implementation information and numerical results are presented for VARIANT (VARIational Anisotropic Neutron Transport), a FORTRAN module of the DIF3D code system at Argonne National Laboratory. VARIANT employs the variational nodal method to solve multigroup steady-state neutron diffusion and transport problems. The variational nodal method is a hybrid finite element method that guarantees nodal balance and permits spatial refinement through the use of hierarchical complete polynomial trial functions. Angular variables are expanded with complete or simplified P 1 , P 3 or P 5 5 spherical harmonics approximations with full anisotropic scattering capability. Nodal response matrices are obtained, and the within-group equations are solved by red-black or four-color iteration, accelerated by a partitioned matrix algorithm. Fission source and upscatter iterations strategies follow those of DIF3D. Two- and three-dimensional Cartesian and hexagonal geometries are implemented. Forward and adjoint eigenvalue, fixed source, gamma heating, and criticality (concentration) search problems may be performed

Antisites and anisotropic diffusion in GaAs and GaSb

KAUST Repository

Tahini, H. A.; Bracht, H.; Chroneos, Alexander; Grimes, R. W.; Murphy, S. T.; Schwingenschlö gl, Udo

2013-01-01

The significant diffusion of Ga under Ga-rich conditions in GaAs and GaSb is counter intuitive as the concentration of Ga vacancies should be depressed although Ga vacancies are necessary to interpret the experimental evidence for Ga transport

A parametric finite element method for solid-state dewetting problems with anisotropic surface energies

Science.gov (United States)

Bao, Weizhu; Jiang, Wei; Wang, Yan; Zhao, Quan

2017-02-01

We propose an efficient and accurate parametric finite element method (PFEM) for solving sharp-interface continuum models for solid-state dewetting of thin films with anisotropic surface energies. The governing equations of the sharp-interface models belong to a new type of high-order (4th- or 6th-order) geometric evolution partial differential equations about open curve/surface interface tracking problems which include anisotropic surface diffusion flow and contact line migration. Compared to the traditional methods (e.g., marker-particle methods), the proposed PFEM not only has very good accuracy, but also poses very mild restrictions on the numerical stability, and thus it has significant advantages for solving this type of open curve evolution problems with applications in the simulation of solid-state dewetting. Extensive numerical results are reported to demonstrate the accuracy and high efficiency of the proposed PFEM.

THEMIS Observations of the Magnetopause Electron Diffusion Region: Large Amplitude Waves and Heated Electrons

Science.gov (United States)

Tang, Xiangwei; Cattell, Cynthia; Dombeck, John; Dai, Lei; Wilson, Lynn B. III; Breneman, Aaron; Hupack, Adam

2013-01-01

We present the first observations of large amplitude waves in a well-defined electron diffusion region based on the criteria described by Scudder et al at the subsolar magnetopause using data from one Time History of Events and Macroscale Interactions during Substorms (THEMIS) satellite. These waves identified as whistler mode waves, electrostatic solitary waves, lower hybrid waves, and electrostatic electron cyclotron waves, are observed in the same 12 s waveform capture and in association with signatures of active magnetic reconnection. The large amplitude waves in the electron diffusion region are coincident with abrupt increases in electron parallel temperature suggesting strong wave heating. The whistler mode waves, which are at the electron scale and which enable us to probe electron dynamics in the diffusion region were analyzed in detail. The energetic electrons (approx. 30 keV) within the electron diffusion region have anisotropic distributions with T(sub e(right angle))/T(sub e(parallel)) > 1 that may provide the free energy for the whistler mode waves. The energetic anisotropic electrons may be produced during the reconnection process. The whistler mode waves propagate away from the center of the "X-line" along magnetic field lines, suggesting that the electron diffusion region is a possible source region of the whistler mode waves.

Convergence Analysis of a FV-FE Scheme for Partially Miscible Two-Phase Flow in Anisotropic Porous Media

KAUST Repository

Saad, Bilal Mohammed; Saad, Mazen

2014-01-01

We study the convergence of a combined finite volume nonconforming finite element scheme on general meshes for a partially miscible two-phase flow model in anisotropic porous media. This model includes capillary effects and exchange between the phase. The diffusion term,which can be anisotropic and heterogeneous, is discretized by piecewise linear nonconforming triangular finite elements. The other terms are discretized by means of a cell-centered finite volume scheme on a dual mesh. The relative permeability of each phase is decentred according the sign of the velocity at the dual interface. The convergence of the scheme is proved thanks to an estimate on the two pressures which allows to show estimates on the discrete time and compactness results in the case of degenerate relative permeabilities. A key point in the scheme is to use particular averaging formula for the dissolution function arising in the diffusion term. We show also a simulation of CO2 injection in a water saturated reservoir and nuclear waste management. Numerical results are obtained by in-house numerical code. © Springer International Publishing Switzerland 2014.

Quantifying brain microstructure with diffusion MRI

DEFF Research Database (Denmark)

Novikov, Dmitry S.; Jespersen, Sune N.; Kiselev, Valerij G.

2016-01-01

the potential to quantify the relevant length scales for neuronal tissue, such as the packing correlation length for neuronal fibers, the degree of neuronal beading, and compartment sizes. The second avenue corresponds to the long-time limit, when the observed signal can be approximated as a sum of multiple non......-exchanging anisotropic Gaussian components. Here the challenge lies in parameter estimation and in resolving its hidden degeneracies. The third avenue employs multiple diffusion encoding techniques, able to access information not contained in the conventional diffusion propagator. We conclude with our outlook...... on the future research directions which can open exciting possibilities for developing markers of pathology and development based on methods of studying mesoscopic transport in disordered systems....

An axisymmetric diffusion experiment for the determination of diffusion and sorption coefficients of rock samples.

Science.gov (United States)

Takeda, M; Hiratsuka, T; Ito, K; Finsterle, S

2011-04-25

Diffusion anisotropy is a critical property in predicting migration of substances in sedimentary formations with very low permeability. The diffusion anisotropy of sedimentary rocks has been evaluated mainly from laboratory diffusion experiments, in which the directional diffusivities are separately estimated by through-diffusion experiments using different rock samples, or concurrently by in-diffusion experiments in which only the tracer profile in a rock block is measured. To estimate the diffusion anisotropy from a single rock sample, this study proposes an axisymmetric diffusion test, in which tracer diffuses between a cylindrical rock sample and a surrounding solution reservoir. The tracer diffusion between the sample and reservoir can be monitored from the reservoir tracer concentrations, and the tracer profile could also be obtained after dismantling the sample. Semi-analytical solutions are derived for tracer concentrations in both the reservoir and sample, accounting for an anisotropic diffusion tensor of rank two as well as the dilution effects from sampling and replacement of reservoir solution. The transient and steady-state analyses were examined experimentally and numerically for different experimental configurations, but without the need for tracer profiling. These experimental configurations are tested for in- and out-diffusion experiments using Koetoi and Wakkanai mudstones and Shirahama sandstone, and are scrutinized by a numerical approach to identify favorable conditions for parameter estimation. The analysis reveals the difficulty in estimating diffusion anisotropy; test configurations are proposed for enhanced identifiability of diffusion anisotropy. Moreover, it is demonstrated that the axisymmetric diffusion test is efficient in obtaining the sorption parameter from both steady-state and transient data, and in determining the effective diffusion coefficient if isotropic diffusion is assumed. Moreover, measuring reservoir concentrations in an

An asixymmetric diffusion experiment for the determination of diffusion and sorption coefficients of rock samples

Energy Technology Data Exchange (ETDEWEB)

Takeda, M.; Hiratsuka, T.; Ito, K.; Finsterle, S.

2011-02-01

Diffusion anisotropy is a critical property in predicting migration of substances in sedimentary formations with very low permeability. The diffusion anisotropy of sedimentary rocks has been evaluated mainly from laboratory diffusion experiments, in which the directional diffusivities are separately estimated by through-diffusion experiments using different rock samples, or concurrently by in-diffusion experiments in which only the tracer profile in a rock block is measured. To estimate the diffusion anisotropy from a single rock sample, this study proposes an axisymmetric diffusion test, in which tracer diffuses between a cylindrical rock sample and a surrounding solution reservoir. The tracer diffusion between the sample and reservoir can be monitored from the reservoir tracer concentrations, and the tracer profile could also be obtained after dismantling the sample. Semi-analytical solutions are derived for tracer concentrations in both the reservoir and sample, accounting for an anisotropic diffusion tensor of rank two as well as the dilution effects from sampling and replacement of reservoir solution. The transient and steady-state analyses were examined experimentally and numerically for different experimental configurations, but without the need for tracer profiling. These experimental configurations are tested for in- and out-diffusion experiments using Koetoi and Wakkanai mudstones and Shirahama sandstone, and are scrutinized by a numerical approach to identify favorable conditions for parameter estimation. The analysis reveals the difficulty in estimating diffusion anisotropy; test configurations are proposed for enhanced identifiability of diffusion anisotropy. Moreover, it is demonstrated that the axisymmetric diffusion test is efficient in obtaining the sorption parameter from both steady-state and transient data, and in determining the effective diffusion coefficient if isotropic diffusion is assumed. Moreover, measuring reservoir concentrations in an

Effective diffusion in time-periodic linear planar flow

International Nuclear Information System (INIS)

Indeikina, A.; Chang, H.

1993-01-01

It is shown that when a point source of solute is inserted into a time-periodic, unbounded linear planar flow, the large-time, time-average transport of the solute can be described by classical anisotropic diffusion with constant effective diffusion tensors. For a given vorticity and forcing period, elongational flow is shown to be the most dispersive followed by simple shear and rotational flow. Large-time diffusivity along the major axis of the time-average concentration ellipse, whose alignment is predicted from the theory, is shown to increase with vorticity for all flows and decrease with increasing forcing frequency for elongational flow and simple shear. For the interesting case of rotational flow, there exist discrete resonant frequencies where the time-average major diffusivity reaches local maxima equal to the time-average steady flow case with zero forcing frequency

Efficient Wavefield Extrapolation In Anisotropic Media

KAUST Repository

Alkhalifah, Tariq; Ma, Xuxin; Waheed, Umair bin; Zuberi, Mohammad Akbar Hosain

2014-01-01

Various examples are provided for wavefield extrapolation in anisotropic media. In one example, among others, a method includes determining an effective isotropic velocity model and extrapolating an equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. The effective isotropic velocity model can be based upon a kinematic geometrical representation of an anisotropic, poroelastic or viscoelastic wavefield. Extrapolating the equivalent propagation can use isotopic, acoustic or elastic operators based upon the determined effective isotropic velocity model. In another example, non-transitory computer readable medium stores an application that, when executed by processing circuitry, causes the processing circuitry to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. In another example, a system includes processing circuitry and an application configured to cause the system to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield.

Efficient Wavefield Extrapolation In Anisotropic Media

KAUST Repository

Alkhalifah, Tariq

2014-07-03

Various examples are provided for wavefield extrapolation in anisotropic media. In one example, among others, a method includes determining an effective isotropic velocity model and extrapolating an equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. The effective isotropic velocity model can be based upon a kinematic geometrical representation of an anisotropic, poroelastic or viscoelastic wavefield. Extrapolating the equivalent propagation can use isotopic, acoustic or elastic operators based upon the determined effective isotropic velocity model. In another example, non-transitory computer readable medium stores an application that, when executed by processing circuitry, causes the processing circuitry to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield. In another example, a system includes processing circuitry and an application configured to cause the system to determine the effective isotropic velocity model and extrapolate the equivalent propagation of an anisotropic, poroelastic or viscoelastic wavefield.

Investigate the effect of anisotropic order parameter on the specific heat of anisotropic two-band superconductors

International Nuclear Information System (INIS)

Udomsamuthirun, P.; Peamsuwan, R.; Kumvongsa, C.

2009-01-01

The effect of anisotropic order parameter on the specific heat of anisotropic two-band superconductors in BCS weak-coupling limit is investigated. An analytical specific heat jump and the numerical specific heat are shown by using anisotropic order parameters, and the electron-phonon interaction and non-electron-phonon interaction. The two models of anisotropic order parameters are used for numerical calculation that we find little effect on the numerical results. The specific heat jump of MgB 2 , Lu 2 Fe 3 Si 5 and Nb 3 Sn superconductors can fit well with both of them. By comparing the experimental data with overall range of temperature, the best fit is Nb 3 Sn, MgB 2 , and Lu 2 Fe 3 Si 5 superconductors.

Anisotropic gradients in the upper mantle

International Nuclear Information System (INIS)

Garmany, J.

1981-01-01

Pn amplitudes in some widely spaced sets of orthogonal marine refraction lines on young oceanic crust are greater in the fast direction than in the slow direction. This is inconsistent with the predicted amplitude behavior for simple head waves, but can be explained by an increase in anisotropy with depth. It appears that these gradients are due to increasing olivine crystal orientation, although changes in the relative abundance of two anisotropic minerals without variable tectonization could also account for the observations. Depth variation of tectonization most probably indicates very high temperature gradients at the Moho. This would imply a substantial amount of convective heat transport in the whole oceanic crust near mid-ocean rises

Anisotropic elastic plates

CERN Document Server

Hwu, Chyanbin

2010-01-01

As structural elements, anisotropic elastic plates find wide applications in modern technology. The plates here are considered to be subjected to not only in plane load but also transverse load. In other words, both plane and plate bending problems as well as the stretching-bending coupling problems are all explained in this book. In addition to the introduction of the theory of anisotropic elasticity, several important subjects have are discussed in this book such as interfaces, cracks, holes, inclusions, contact problems, piezoelectric materials, thermoelastic problems and boundary element a

Nano-sized Adsorbate Structure Formation in Anisotropic Multilayer System

Science.gov (United States)

Kharchenko, Vasyl O.; Kharchenko, Dmitrii O.; Yanovsky, Vladimir V.

2017-05-01

In this article, we study dynamics of adsorbate island formation in a model plasma-condensate system numerically. We derive the generalized reaction-diffusion model for adsorptive multilayer system by taking into account anisotropy in transfer of adatoms between neighbor layers induced by electric field. It will be found that with an increase in the electric field strength, a structural transformation from nano-holes inside adsorbate matrix toward separated nano-sized adsorbate islands on a substrate is realized. Dynamics of adsorbate island sizes and corresponding distributions are analyzed in detail. This study provides an insight into details of self-organization of adatoms into nano-sized adsorbate islands in anisotropic multilayer plasma-condensate systems.

Complex Anisotropic Structure of the Mantle Wedge Beneath Kamchatka Volcanoes

Science.gov (United States)

Levin, V.; Park, J.; Gordeev, E.; Droznin, D.

2002-12-01

the slab. To explain the vertical stratification of anisotropy implied from receiver functions, and the strong lateral dependence of shear-wave splitting observations, we cannot rely on simple models of mantle wedge behaviour e.g., olivine-crystal alignment through subduction-driven corner flow. Diverse mechanisms can contribute to the observed pattern of anisotropic properties, with volatiles likely being a key influence. For instance, we find evidence in favor of a slow-symmetry-axis anisotropy within the uppermost 10-20 km of the mantle wedge, implying either excessive hydration of the mantle or else a presence of systematically aligned volatile-filled cracks or lenses. Also, shear-wave splitting is weak beneath the Avachinsky-Koryaksky volcanic center, suggesting either vertical flow or the influence of volatiles and/or thermally-enhanced diffusion creep.

Variational Multiscale error estimator for anisotropic adaptive fluid mechanic simulations: application to convection-diffusion problems

OpenAIRE

Bazile , Alban; Hachem , Elie; Larroya-Huguet , Juan-Carlos; Mesri , Youssef

2018-01-01

International audience; In this work, we present a new a posteriori error estimator based on the Variational Multiscale method for anisotropic adaptive fluid mechanics problems. The general idea is to combine the large scale error based on the solved part of the solution with the sub-mesh scale error based on the unresolved part of the solution. We compute the latter with two different methods: one using the stabilizing parameters and the other using bubble functions. We propose two different...

Mechanical, Anisotropic, and Electronic Properties of XN (X = C, Si, Ge): Theoretical Investigations.

Science.gov (United States)

Ma, Zhenyang; Liu, Xuhong; Yu, Xinhai; Shi, Chunlei; Wang, Dayun

2017-08-08

The structural, mechanical, elastic anisotropic, and electronic properties of Pbca -XN (X = C, Si, Ge) are investigated in this work using the Perdew-Burke-Ernzerhof (PBE) functional, Perdew-Burke-Ernzerhof for solids (PBEsol) functional, and Ceperly and Alder, parameterized by Perdew and Zunger (CA-PZ) functional in the framework of density functional theory. The achieved results for the lattice parameters and band gap of Pbca -CN with the PBE functional in this research are in good accordance with other theoretical results. The band structures of Pbca -XN (X = C, Si, Ge) show that Pbca -SiN and Pbca -GeN are both direct band gap semiconductor materials with a band gap of 3.39 eV and 2.22 eV, respectively. Pbca -XN (X = C, Si, Ge) exhibits varying degrees of mechanical anisotropic properties with respect to the Poisson's ratio, bulk modulus, shear modulus, Young's modulus, and universal anisotropic index. The (001) plane and (010) plane of Pbca -CN/SiN/GeN both exhibit greater elastic anisotropy in the bulk modulus and Young's modulus than the (100) plane.

Anisotropic O vacancy formation and diffusion in LaMnO3

KAUST Repository

Gan, Liyong; Salawu, Omotayo Akande; Schwingenschlö gl, Udo

2014-01-01

Anisotropy effects in solid oxide fuel cells are typically not considered because of high operating temperatures. Focusing on the prototypical perovskite LaMnO3, we apply first-principles calculations to demonstrate that this approximation is no longer valid when the operating temperature is reduced and discuss the consequences for the material properties. In addition, we show that strain and Sr doping can be used to further increase the anisotropy. Tensile strain promotes both the O vacancy formation and diffusion in pristine and Sr doped LaMnO3, while Sr doping enhances the O vacancy formation. Both in LaMnO3 and La0.75Sr0.25MnO3 the O diffusion is found to be favorable in the [011] and [011] directions.

Jigsaw puzzle metasurface for multiple functions: polarization conversion, anomalous reflection and diffusion.

Science.gov (United States)

Zhao, Yi; Cao, Xiangyu; Gao, Jun; Liu, Xiao; Li, Sijia

2016-05-16

We demonstrate a simple reconfigurable metasurface with multiple functions. Anisotropic tiles are investigated and manufactured as fundamental elements. Then, the tiles are combined in a certain sequence to construct a metasurface. Each of the tiles can be adjusted independently which is like a jigsaw puzzle and the whole metasurface can achieve diverse functions by different layouts. For demonstration purposes, we realize polarization conversion, anomalous reflection and diffusion by a jigsaw puzzle metasurface with 6 × 6 pieces of anisotropic tile. Simulated and measured results prove that our method offers a simple and effective strategy for metasurface design.

Anisotropic evaluation of synthetic surgical meshes.

Science.gov (United States)

Saberski, E R; Orenstein, S B; Novitsky, Y W

2011-02-01

The material properties of meshes used in hernia repair contribute to the overall mechanical behavior of the repair. The anisotropic potential of synthetic meshes, representing a difference in material properties (e.g., elasticity) in different material axes, is not well defined to date. Haphazard orientation of anisotropic mesh material can contribute to inconsistent surgical outcomes. We aimed to characterize and compare anisotropic properties of commonly used synthetic meshes. Six different polypropylene (Trelex(®), ProLite™, Ultrapro™), polyester (Parietex™), and PTFE-based (Dualmesh(®), Infinit) synthetic meshes were selected. Longitudinal and transverse axes were defined for each mesh, and samples were cut in each axis orientation. Samples underwent uniaxial tensile testing, from which the elastic modulus (E) in each axis was determined. The degree of anisotropy (λ) was calculated as a logarithmic expression of the ratio between the elastic modulus in each axis. Five of six meshes displayed significant anisotropic behavior. Ultrapro™ and Infinit exhibited approximately 12- and 20-fold differences between perpendicular axes, respectively. Trelex(®), ProLite™, and Parietex™ were 2.3-2.4 times. Dualmesh(®) was the least anisotropic mesh, without marked difference between the axes. Anisotropy of synthetic meshes has been underappreciated. In this study, we found striking differences between elastic properties of perpendicular axes for most commonly used synthetic meshes. Indiscriminate orientation of anisotropic mesh may adversely affect hernia repairs. Proper labeling of all implants by manufacturers should be mandatory. Understanding the specific anisotropic behavior of synthetic meshes should allow surgeons to employ rational implant orientation to maximize outcomes of hernia repair.

Cracking on anisotropic neutron stars

Science.gov (United States)

Setiawan, A. M.; Sulaksono, A.

2017-07-01

We study the effect of cracking of a local anisotropic neutron star (NS) due to small density fluctuations. It is assumed that the neutron star core consists of leptons, nucleons and hyperons. The relativistic mean field model is used to describe the core of equation of state (EOS). For the crust, we use the EOS introduced by Miyatsu et al. [1]. Furthermore, two models are used to describe pressure anisotropic in neutron star matter. One is proposed by Doneva-Yazadjiev (DY) [2] and the other is proposed by Herrera-Barreto (HB) [3]. The anisotropic parameter of DY and HB models are adjusted in order the predicted maximum mass compatible to the mass of PSR J1614-2230 [4] and PSR J0348+0432 [5]. We have found that cracking can potentially present in the region close to the neutron star surface. The instability due cracking is quite sensitive to the NS mass and anisotropic parameter used.

Creating an anisotropic plasma resistivity with waves

International Nuclear Information System (INIS)

Fisch, N.J.; Boozer, A.H.

1980-05-01

An anisotropic plasma resistivity may be created by preferential heating of electrons traveling in one direction. This can result in a steady-state toroidal current in a tokamak even in the absence of net wave momentum. In fact, at high wave phase velocities, the current associated with the change in resistivity is greater than that associated with net momentum input. An immediate implication is that other waves, such as electron cyclotron waves, may be competitive with lower-hybrid waves as a means for generating current. An analytical expression is derived for the current generated per power dissipated which agrees remarkably well with numerical calculations

Quantitative Phase-Field Approach for Simulating Grain Growth in Anisotropic Systems with Arbitrary Inclination and Misorientation Dependence

International Nuclear Information System (INIS)

Moelans, N.; Blanpain, B.; Wollants, P.

2008-01-01

A phase-field approach for quantitative simulations of grain growth in anisotropic systems is introduced, together with a new methodology to derive appropriate model parameters that reproduce given misorientation and inclination dependent grain boundary energy and mobility in the simulations. The proposed model formulation and parameter choice guarantee a constant diffuse interface width and consequently give high controllability of the accuracy in grain growth simulations

A theory for the anisotropic interaction between two substitutional magnetic impurities and the magnetic anisotropic effect in dilute magnetic alloys

International Nuclear Information System (INIS)

Satter, M.A.

1990-08-01

In this paper, a formalism for studying the anisotropic interaction between two substitutional magnetic impurities and the magnetic anisotropic effect in a dilute noble metal- transition metal magnetic alloy has been developed from relativistic scattering theory. The theoretical development and the computational techniques of this formalism are based on relativistic spin-polarized scattering theory and relativistic band structure frameworks. For studying the magnetic anisotropic effect a convenient ''working'' frame of reference with its axes oriented along the fcc crystal axes is set up. This formalism is applied to study the situation for two Fe impurities in paramagnetic Au hosts. For AuFe dilute alloy, the two impurity site interaction as a function of separation is not oscillatory and the anisotropic effect is found to be less than the two site interaction itself only by an order of magnitude. Apart from the anisotropic coupling of the two impurity spins to the separation vector, for the first time, another weak anisotropic coupling to the crystal axes is also contained in the two site interaction. These anisotropic effects are the results of the relativistic spin-orbit interaction which are incorporated into the formalism. (author). 22 refs, 5 figs

Dissipative particle dynamics of diffusion-NMR requires high Schmidt-numbers

Energy Technology Data Exchange (ETDEWEB)

Azhar, Mueed; Greiner, Andreas [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Korvink, Jan G., E-mail: jan.korvink@kit.edu, E-mail: david.kauzlaric@imtek.uni-freiburg.de [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Department of Microstructure Technology, Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, Eggenstein-Leopoldshafen (Germany); Kauzlarić, David, E-mail: jan.korvink@kit.edu, E-mail: david.kauzlaric@imtek.uni-freiburg.de [Laboratory for Simulation, Department of Microsystems Engineering (IMTEK), University of Freiburg, Georges-Köhler-Allee 103, 79110 Freiburg (Germany); Freiburg Institute for Advanced Studies, University of Freiburg, Albertstr. 19, 79104 Freiburg (Germany)

2016-06-28

We present an efficient mesoscale model to simulate the diffusion measurement with nuclear magnetic resonance (NMR). On the level of mesoscopic thermal motion of fluid particles, we couple the Bloch equations with dissipative particle dynamics (DPD). Thereby we establish a physically consistent scaling relation between the diffusion constant measured for DPD-particles and the diffusion constant of a real fluid. The latter is based on a splitting into a centre-of-mass contribution represented by DPD, and an internal contribution which is not resolved in the DPD-level of description. As a consequence, simulating the centre-of-mass contribution with DPD requires high Schmidt numbers. After a verification for fundamental pulse sequences, we apply the NMR-DPD method to NMR diffusion measurements of anisotropic fluids, and of fluids restricted by walls of microfluidic channels. For the latter, the free diffusion and the localisation regime are considered.

Dynamics of anisotropic tissue growth

Energy Technology Data Exchange (ETDEWEB)

Bittig, Thomas; Juelicher, Frank [Max Planck Institute for the Physics of Complex Systems, Noethnitzer Strasse 38, 01187 Dresden (Germany); Wartlick, Ortrud; Kicheva, Anna; Gonzalez-Gaitan, Marcos [Department of Biochemistry and Department of Molecular Biology, Geneva University, Sciences II, Quai Ernest-Ansermet 30, 1211 Geneva 4 (Switzerland)], E-mail: Marcos.Gonzalez@biochem.unige.ch, E-mail: julicher@pks.mpg.de

2008-06-15

We study the mechanics of tissue growth via cell division and cell death (apoptosis). The rearrangements of cells can on large scales and times be captured by a continuum theory which describes the tissue as an effective viscous material with active stresses generated by cell division. We study the effects of anisotropies of cell division on cell rearrangements and show that average cellular trajectories exhibit anisotropic scaling behaviors. If cell division and apoptosis balance, there is no net growth, but for anisotropic cell division the tissue undergoes spontaneous shear deformations. Our description is relevant for the study of developing tissues such as the imaginal disks of the fruit fly Drosophila melanogaster, which grow anisotropically.

Nonlinear constitutive relations for anisotropic elastic materials

Science.gov (United States)

Sokolova, Marina; Khristich, Dmitrii

2018-03-01

A general approach to constructing of nonlinear variants of connection between stresses and strains in anisotropic materials with different types of symmetry of properties is considered. This approach is based on the concept of elastic proper subspaces of anisotropic materials introduced in the mechanics of solids by J. Rychlewski and on the particular postulate of isotropy proposed by A. A. Il’yushin. The generalization of the particular postulate on the case of nonlinear anisotropic materials is formulated. Systems of invariants of deformations as lengths of projections of the strain vector into proper subspaces are developed. Some variants of nonlinear constitutive relations for anisotropic materials are offered. The analysis of these relations from the point of view of their satisfaction to general and limit forms of generalization of partial isotropy postulate on anisotropic materials is performed. The relations for particular cases of anisotropy are written.

Characterization of Anisotropic Behavior for High Grade Pipes

Science.gov (United States)

Yang, Kun; Huo, Chunyong; Ji, Lingkang; Li, Yang; Zhang, Jiming; Ma, Qiurong

With the developing requirement of nature gas, the property needs of steel for pipe line are higher and higher, especially in strength and toughness. It is necessary to improve the steel grade in order to ensure economic demand and safety. However, with the rise of steel grade, the differences on properties in different orientations (anisotropic behaviors) become more and more obvious after the process of hot rolling, which may affect the prediction of fracture for the pipes seriously (Thinking of isotropic mechanical properties for material in traditional predict way). In order to get the reason for anisotropic mechanics, a series of tests are carried out for high grade steel pipes, including not only mechanical properties but also microstructures. Result indicates that there are obviously anisotropic behaviors for high grade steel pipes in two orientations (rolling orientation and transverse orientation). Strength is better in T orientation because Rm is higher and Rt 0.5 rises more in T orientation, and toughness is better in L orientation because of the higher Akv and SA in L orientation under a same temperature. Banded structures are formed in T orientation, and the spatial distribution of inclusion and precipitated phases are different in T, L and S orientation. The anisotropic arrangement for the matrix in space (banded structures), which is formed after the process of hot rolling, may affect the mechanical properties in different orientation. Moreover, the elasticity modulus of particles is different from the elasticity modulus of matrix, deformation between particles and matrix may cause stress concentration, and damage forms in this place. Because of the different distribution of particles in space, the level of damage is anisotropic in different orientations, and the anisotropic mechanical properties occur finally. Therefore, the anisotropic mechanical properties are determined by the anisotropic microstructures, both the anisotropic of matrix and the

Orthonormal bases for anisotropic α-modulation spaces

DEFF Research Database (Denmark)

Rasmussen, Kenneth Niemann

2012-01-01

In this article we construct orthonormal bases for bi-variate anisotropic α-modulation spaces. The construction is based on generating a nice anisotropic α-covering and using carefully selected tensor products of univariate brushlet functions with regards to this covering. As an application, we...... show that n-term nonlinear approximation with the orthonormal bases in certain anisotropic α-modulation spaces can be completely characterized....

Orthonormal bases for anisotropic α-modulation spaces

DEFF Research Database (Denmark)

Rasmussen, Kenneth Niemann

In this article we construct orthonormal bases for bi-variate anisotropic α-modulation spaces. The construction is based on generating a nice anisotropic α-covering and using carefully selected tensor products of univariate brushlet functions with regards to this covering. As an application, we...... show that n-term nonlinear approximation with the orthonormal bases in certain anisotropic α-modulation spaces can be completely characterized....

An exploration into diffusion tensor imaging in the bovine ocular lens

Directory of Open Access Journals (Sweden)

Ehsan eVaghefi

2013-03-01

Full Text Available We describe our development of the diffusion tensor imaging modality for the bovine ocular lens. Diffusion gradients were added to a spin-echo pulse sequence and the relevant parameters of the sequence were refined to achieve good diffusion weighting in the lens tissue, which demonstrated heterogeneous regions of diffusive signal attenuation. Decay curves for b-value (loosely summarizes the strength of diffusion weighting and TE (determines the amount of MRI-obtained signal were used to estimate apparent diffusion coefficients (ADC and T2 in different lens regions. The ADCs varied by over an order of magnitude and revealed diffusive anisotropy in the lens. Up to 30 diffusion gradient directions, and 8 signal acquisition averages, were applied to lenses in culture in order to improve maps of diffusion tensor eigenvalues, equivalent to ADC, across the lens. From these maps, fractional anisotropy maps were calculated and compared to known spatial distributions of anisotropic molecular fluxes in the lens. This comparison suggested new hypotheses and experiments to quantitatively assess models of circulation in the avascular lens.

Analysis of electromagnetic scattering by uniaxial anisotropic bispheres.

Science.gov (United States)

Li, Zheng-Jun; Wu, Zhen-Sen; Li, Hai-Ying

2011-02-01

Based on the generalized multiparticle Mie theory and the Fourier transformation approach, electromagnetic (EM) scattering of two interacting homogeneous uniaxial anisotropic spheres with parallel primary optical axes is investigated. By introducing the Fourier transformation, the EM fields in the uniaxial anisotropic spheres are expanded in terms of the spherical vector wave functions. The interactive scattering coefficients and the expansion coefficients of the internal fields are derived through the continuous boundary conditions on which the interaction of the bispheres is considered. Some selected calculations on the effects of the size parameter, the uniaxial anisotropic absorbing dielectric, and the sphere separation distance are described. The backward radar cross section of two uniaxial anisotropic spheres with a complex permittivity tensor changing with the sphere separation distance is numerically studied. The authors are hopeful that the work in this paper will help provide an effective calibration for further research on the scattering characteristic of an aggregate of anisotropic spheres or other shaped anisotropic particles.

Mechanical, Anisotropic, and Electronic Properties of XN (X = C, Si, Ge): Theoretical Investigations

Science.gov (United States)

Ma, Zhenyang; Liu, Xuhong; Yu, Xinhai; Shi, Chunlei; Wang, Dayun

2017-01-01

The structural, mechanical, elastic anisotropic, and electronic properties of Pbca-XN (X = C, Si, Ge) are investigated in this work using the Perdew–Burke–Ernzerhof (PBE) functional, Perdew–Burke–Ernzerhof for solids (PBEsol) functional, and Ceperly and Alder, parameterized by Perdew and Zunger (CA–PZ) functional in the framework of density functional theory. The achieved results for the lattice parameters and band gap of Pbca-CN with the PBE functional in this research are in good accordance with other theoretical results. The band structures of Pbca-XN (X = C, Si, Ge) show that Pbca-SiN and Pbca-GeN are both direct band gap semiconductor materials with a band gap of 3.39 eV and 2.22 eV, respectively. Pbca-XN (X = C, Si, Ge) exhibits varying degrees of mechanical anisotropic properties with respect to the Poisson’s ratio, bulk modulus, shear modulus, Young’s modulus, and universal anisotropic index. The (001) plane and (010) plane of Pbca-CN/SiN/GeN both exhibit greater elastic anisotropy in the bulk modulus and Young’s modulus than the (100) plane. PMID:28786960

Anisotropic elliptic optical fibers

Science.gov (United States)

Kang, Soon Ahm

1991-05-01

The exact characteristic equation for an anisotropic elliptic optical fiber is obtained for odd and even hybrid modes in terms of infinite determinants utilizing Mathieu and modified Mathieu functions. A simplified characteristic equation is obtained by applying the weakly guiding approximation such that the difference in the refractive indices of the core and the cladding is small. The simplified characteristic equation is used to compute the normalized guide wavelength for an elliptical fiber. When the anisotropic parameter is equal to unity, the results are compared with the previous research and they are in close agreement. For a fixed value normalized cross-section area or major axis, the normalized guide wavelength lambda/lambda(sub 0) for an anisotropic elliptic fiber is small for the larger value of anisotropy. This condition indicates that more energy is carried inside of the fiber. However, the geometry and anisotropy of the fiber have a smaller effect when the normalized cross-section area is very small or very large.

Transient anisotropic magnetic field calculation

International Nuclear Information System (INIS)

Jesenik, Marko; Gorican, Viktor; Trlep, Mladen; Hamler, Anton; Stumberger, Bojan

2006-01-01

For anisotropic magnetic material, nonlinear magnetic characteristics of the material are described with magnetization curves for different magnetization directions. The paper presents transient finite element calculation of the magnetic field in the anisotropic magnetic material based on the measured magnetization curves for different magnetization directions. For the verification of the calculation method some results of the calculation are compared with the measurement

A novel method for calculating the energy barriers for carbon diffusion in ferrite under heterogeneous stress

Science.gov (United States)

Tchitchekova, Deyana S.; Morthomas, Julien; Ribeiro, Fabienne; Ducher, Roland; Perez, Michel

2014-07-01

A novel method for accurate and efficient evaluation of the change in energy barriers for carbon diffusion in ferrite under heterogeneous stress is introduced. This method, called Linear Combination of Stress States, is based on the knowledge of the effects of simple stresses (uniaxial or shear) on these diffusion barriers. Then, it is assumed that the change in energy barriers under a complex stress can be expressed as a linear combination of these already known simple stress effects. The modifications of energy barriers by either uniaxial traction/compression and shear stress are determined by means of atomistic simulations with the Climbing Image-Nudge Elastic Band method and are stored as a set of functions. The results of this method are compared to the predictions of anisotropic elasticity theory. It is shown that, linear anisotropic elasticity fails to predict the correct energy barrier variation with stress (especially with shear stress) whereas the proposed method provides correct energy barrier variation for stresses up to ˜3 GPa. This study provides a basis for the development of multiscale models of diffusion under non-uniform stress.

A novel method for calculating the energy barriers for carbon diffusion in ferrite under heterogeneous stress

International Nuclear Information System (INIS)

Tchitchekova, Deyana S.; Morthomas, Julien; Perez, Michel; Ribeiro, Fabienne; Ducher, Roland

2014-01-01

A novel method for accurate and efficient evaluation of the change in energy barriers for carbon diffusion in ferrite under heterogeneous stress is introduced. This method, called Linear Combination of Stress States, is based on the knowledge of the effects of simple stresses (uniaxial or shear) on these diffusion barriers. Then, it is assumed that the change in energy barriers under a complex stress can be expressed as a linear combination of these already known simple stress effects. The modifications of energy barriers by either uniaxial traction/compression and shear stress are determined by means of atomistic simulations with the Climbing Image-Nudge Elastic Band method and are stored as a set of functions. The results of this method are compared to the predictions of anisotropic elasticity theory. It is shown that, linear anisotropic elasticity fails to predict the correct energy barrier variation with stress (especially with shear stress) whereas the proposed method provides correct energy barrier variation for stresses up to ∼3 GPa. This study provides a basis for the development of multiscale models of diffusion under non-uniform stress

A novel method for calculating the energy barriers for carbon diffusion in ferrite under heterogeneous stress

Energy Technology Data Exchange (ETDEWEB)

Tchitchekova, Deyana S. [IRSN, PSN, SEMIA, LPTM, Saint-Paul-Lez-Durance (France); Univ. Lyon, INSA Lyon, MATEIS, UMR CNRS 5510, Villeurbanne (France); Morthomas, Julien; Perez, Michel [Univ. Lyon, INSA Lyon, MATEIS, UMR CNRS 5510, Villeurbanne (France); Ribeiro, Fabienne [IRSN, PSN, SEMIA, LPTM, Saint-Paul-Lez-Durance (France); Ducher, Roland [IRSN, PSN, SAG, LETR, Saint-Paul-Lez-Durance (France)

2014-07-21

A novel method for accurate and efficient evaluation of the change in energy barriers for carbon diffusion in ferrite under heterogeneous stress is introduced. This method, called Linear Combination of Stress States, is based on the knowledge of the effects of simple stresses (uniaxial or shear) on these diffusion barriers. Then, it is assumed that the change in energy barriers under a complex stress can be expressed as a linear combination of these already known simple stress effects. The modifications of energy barriers by either uniaxial traction/compression and shear stress are determined by means of atomistic simulations with the Climbing Image-Nudge Elastic Band method and are stored as a set of functions. The results of this method are compared to the predictions of anisotropic elasticity theory. It is shown that, linear anisotropic elasticity fails to predict the correct energy barrier variation with stress (especially with shear stress) whereas the proposed method provides correct energy barrier variation for stresses up to ∼3 GPa. This study provides a basis for the development of multiscale models of diffusion under non-uniform stress.

Growth and anisotropic transport properties of self-assembled InAs nanostructures in InP

International Nuclear Information System (INIS)

Bierwagen, O.

2007-01-01

Self-assembled InAs nanostructures in InP, comprising quantum wells, quantum wires, and quantum dots, are studied in terms of their formation and properties. In particular, the structural, optical, and anisotropic transport properties of the nanostructures are investigated. The focus is a comprehending exploration of the anisotropic in-plane transport in large ensembles of laterally coupled InAs nanostructures. The self-assembled Stranski-Krastanov growth of InAs nanostructures is studied by gas-source molecular beam epitaxy on both nominally oriented and vicinal InP(001). Optical polarization of the interband transitions arising from the nanostructure type is demonstrated by photoluminescence and transmission spectroscopy. The experimentally convenient four-contact van der Pauw Hall measurement of rectangularly shaped semiconductors, usually applied to isotropic systems, is extended to yield the anisotropic transport properties. Temperature dependent transport measurements are performed in large ensembles of laterally closely spaced nanostructures. The transport of quantum wire-, quantum dash- and quantum dot containing samples is highly anisotropic with the principal axes of conductivity aligned to the directions. The direction of higher mobility is [ anti 110], which is parallel to the direction of the quantum wires. In extreme cases, the anisotropies exceed 30 for electrons, and 100 for holes. The extreme anisotropy for holes is due to diffusive transport through extended states in the [ anti 110], and hopping transport through laterally localized states in the [110] direction, within the same sample. A novel 5-terminal electronic switching device based on gate-controlled transport anisotropy is proposed. The gate-control of the transport anisotropy in modulation-doped, self-organized InAs quantum wires embedded in InP is demonstrated. (orig.)

Growth and anisotropic transport properties of self-assembled InAs nanostructures in InP

Energy Technology Data Exchange (ETDEWEB)

Bierwagen, O.

2007-12-20

Self-assembled InAs nanostructures in InP, comprising quantum wells, quantum wires, and quantum dots, are studied in terms of their formation and properties. In particular, the structural, optical, and anisotropic transport properties of the nanostructures are investigated. The focus is a comprehending exploration of the anisotropic in-plane transport in large ensembles of laterally coupled InAs nanostructures. The self-assembled Stranski-Krastanov growth of InAs nanostructures is studied by gas-source molecular beam epitaxy on both nominally oriented and vicinal InP(001). Optical polarization of the interband transitions arising from the nanostructure type is demonstrated by photoluminescence and transmission spectroscopy. The experimentally convenient four-contact van der Pauw Hall measurement of rectangularly shaped semiconductors, usually applied to isotropic systems, is extended to yield the anisotropic transport properties. Temperature dependent transport measurements are performed in large ensembles of laterally closely spaced nanostructures. The transport of quantum wire-, quantum dash- and quantum dot containing samples is highly anisotropic with the principal axes of conductivity aligned to the <110> directions. The direction of higher mobility is [ anti 110], which is parallel to the direction of the quantum wires. In extreme cases, the anisotropies exceed 30 for electrons, and 100 for holes. The extreme anisotropy for holes is due to diffusive transport through extended states in the [ anti 110], and hopping transport through laterally localized states in the [110] direction, within the same sample. A novel 5-terminal electronic switching device based on gate-controlled transport anisotropy is proposed. The gate-control of the transport anisotropy in modulation-doped, self-organized InAs quantum wires embedded in InP is demonstrated. (orig.)

Electrically Anisotropic Layered Perovskite Single Crystal

KAUST Repository

Li, Ting-You

2016-04-01

Organic-inorganic hybrid perovskites (OIHPs), which are promising materials for electronic and optoelectronic applications (1-10), have made into layered organic-inorganic hybrid perovskites (LOIHPs). These LOIHPs have been applied to thin-film transistors, solar cells and tunable wavelength phosphors (11-18). It is known that devices fabricated with single crystal exhibit the superior performance, which makes the growth of large-sized single crystals critical for future device applications (19-23). However, the difficulty in growing large-sized LOIHPs single crystal with superior electrical properties limits their practical applications. Here, we report a method to grow the centimeter-scaled LOIHP single crystal of [(HOC2H4NH3)2PbI4], demonstrating the potentials in mass production. After that, we reveal anisotropic electrical and optoelectronic properties which proved the carrier propagating along inorganic framework. The carrier mobility of in-inorganic-plane (in-plane) devices shows the average value of 45 cm2 V–1 s–1 which is about 100 times greater than the record of LOIHP devices (15), showing the importance of single crystal in device application. Moreover, the LOIHP single crystals show its ultra-short carrier lifetime of 42.7 ps and photoluminescence quantum efficiency (PLQE) of 25.4 %. We expect this report to be a start of LOIHPs for advanced applications in which the anisotropic properties are needed (24-25), and meets the demand of high-speed applications and fast-response applications.

Views on the Anisotropic Nature of Ilva Valley Region

Directory of Open Access Journals (Sweden)

GABRIELA-ALINA MUREŞAN

2012-01-01

Full Text Available There are two concepts important for the authors of this article: anisotropic region and anisotropic space. Anisotropic region is defined by A. Dauphiné, the geographer (-mathematician, as a territorial unit whose structure results from the organisation of space along one or more axes. From the point of view of a territorial system, this type of region has some characteristics which differentiate it both from the homogeneous region and from the polarised one. These specificities have been analysed for Ilva Valley. The region of Ilva Valley is formed along the morphological axis represented by the Ilva River. The aim is to identify these specificities or their absence within this region. In this way we can determine whether this region is an anisotropic one or just an anisotropic space, namely whether it can be considered as evolving towards an anisotropic region, not yet complying with all characteristics of anisotropic regions.

Effective medium theory for anisotropic metamaterials

KAUST Repository

Zhang, Xiujuan

2015-01-20

Materials with anisotropic material parameters can be utilized to fabricate many fascinating devices, such as hyperlenses, metasolids, and one-way waveguides. In this study, we analyze the effects of geometric anisotropy on a two-dimensional metamaterial composed of a rectangular array of elliptic cylinders and derive an effective medium theory for such a metamaterial. We find that it is possible to obtain a closed-form analytical solution for the anisotropic effective medium parameters, provided the aspect ratio of the lattice and the eccentricity of the elliptic cylinder satisfy certain conditions. The derived effective medium theory not only recovers the well-known Maxwell-Garnett results in the quasi-static regime, but is also valid beyond the long-wavelength limit, where the wavelength in the host medium is comparable to the size of the lattice so that previous anisotropic effective medium theories fail. Such an advance greatly broadens the applicable realm of the effective medium theory and introduces many possibilities in the design of structures with desired anisotropic material characteristics. A real sample of a recently theoretically proposed anisotropic medium, with a near-zero index to control the flux, is achieved using the derived effective medium theory, and control of the electromagnetic waves in the sample is clearly demonstrated.

Tunneling anisotropic magnetoresistance driven by magnetic phase transition.

Science.gov (United States)

Chen, X Z; Feng, J F; Wang, Z C; Zhang, J; Zhong, X Y; Song, C; Jin, L; Zhang, B; Li, F; Jiang, M; Tan, Y Z; Zhou, X J; Shi, G Y; Zhou, X F; Han, X D; Mao, S C; Chen, Y H; Han, X F; Pan, F

2017-09-06

The independent control of two magnetic electrodes and spin-coherent transport in magnetic tunnel junctions are strictly required for tunneling magnetoresistance, while junctions with only one ferromagnetic electrode exhibit tunneling anisotropic magnetoresistance dependent on the anisotropic density of states with no room temperature performance so far. Here, we report an alternative approach to obtaining tunneling anisotropic magnetoresistance in α'-FeRh-based junctions driven by the magnetic phase transition of α'-FeRh and resultantly large variation of the density of states in the vicinity of MgO tunneling barrier, referred to as phase transition tunneling anisotropic magnetoresistance. The junctions with only one α'-FeRh magnetic electrode show a magnetoresistance ratio up to 20% at room temperature. Both the polarity and magnitude of the phase transition tunneling anisotropic magnetoresistance can be modulated by interfacial engineering at the α'-FeRh/MgO interface. Besides the fundamental significance, our finding might add a different dimension to magnetic random access memory and antiferromagnet spintronics.Tunneling anisotropic magnetoresistance is promising for next generation memory devices but limited by the low efficiency and functioning temperature. Here the authors achieved 20% tunneling anisotropic magnetoresistance at room temperature in magnetic tunnel junctions with one α'-FeRh magnetic electrode.

A Variational Approach to Perturbed Discrete Anisotropic Equations

Directory of Open Access Journals (Sweden)

Amjad Salari

2016-01-01

Full Text Available We continue the study of discrete anisotropic equations and we will provide new multiplicity results of the solutions for a discrete anisotropic equation. We investigate the existence of infinitely many solutions for a perturbed discrete anisotropic boundary value problem. The approach is based on variational methods and critical point theory.

Diffusion of graphite. The effect of cylindrical canals; Longueur de diffusion du graphite effet des canaux cylindriques

Energy Technology Data Exchange (ETDEWEB)

Carle, R; Clouet d' Orval, C; Martelly, J; Mazancourt, T de; Sagot, M; Lattes, R; Teste du Bailler, A [Commissariat a l' Energie Atomique, Dir. Industrielle, Saclay (France). Centre d' Etudes Nucleaires; Robert, C [Ecole Normale Superieure, 75 - Paris (France)

1957-07-01

Experiments on thermal neutron diffusion in the graphite used as moderator in the pile G1 have been carried out. The object of these experiments is to determine: - the intrinsic quality of this graphite, characterised by its diffusion length L or its Laplacian 1/L{sup 2} - the effect of the canals, which modifies anisotropically the macroscopic diffusion equation and is characterized by two principal diffusion regions (or two principal Laplacian), valid respectively for the diffusion in the direction of the canals and in a perpendicular direction. In order to determine them two experiments are necessary, in which the second derivatives of the flux in relation to the space coordinates are very different. These experiments form the object of the first two parts. Part 1: Diffusion along the axis of a flux coming from the pile source, and limited radially by a quasi cylindrical screen of cadmium bars. This screen, or Faraday cage is designed to give to the thermal flux produced the same radius of extrapolation to zero as that of the pile source. The determination of L (with the graphite full) has been made under the same conditions. The measurements have been interpreted in two ways. The influence of the brackets holding the detectors is discussed. Part 2: Radial diffusion in the graphite surrounding the 'long' cylindrical pile. This is well described by a sum of Bessel functions. Part 3: Results (valid for d = 1.61 t = 17 deg. C). For the graphite without cavity L = 52.7 {+-} 0.4 cm. The effect of the canals on the diffusion area and its anisotropy are in excellent agreement with the theory of Behrens: L(parallel) = 64.6 cm and L(perpendicular) 62.2 cm. Appendix: Theory of the Faraday cage. (author) [French] Des experiences de diffusion des neutrons thermiques dans le graphite constituant le moderateur de la pile G1 ont ete effectuees. Elles ont pour objet de determiner: - la qualite intrinseque de ce graphite, caracterisee par sa longueur de diffusion L ou son

MHD diffuser model test program

Energy Technology Data Exchange (ETDEWEB)

Idzorek, J J

1976-07-01

Experimental results of the aerodynamic performance of seven candidate diffusers are presented to assist in determining their suitability for joining an MHD channel to a steam generator at minimum spacing. The three dimensional diffusers varied in area ratio from 2 to 3.8 and wall half angle from 2 to 5 degrees. The program consisted of five phases: (1) tailoring a diffuser inlet nozzle to a 15 percent blockage; (2) comparison of isolated diffusers at enthalpy ratios 0.5 to 1.0 with respect to separation characteristics and pressure recovery coefficients; (3) recording the optimum diffuser exit flow distribution; (4) recording the internal flow distribution within the steam generator when attached to the diffuser; and (5) observing isolated diffuser exhaust dynamic characteristics. The 2 and 2-1/3 degree half angle rectangular diffusers showed recovery coefficients equal to 0.48 with no evidence of flow separation or instability. Diffusion at angles greater than these produced flow instabilities and with angles greater than 3 degrees random flow separation and reattachment.

MHD diffuser model test program

International Nuclear Information System (INIS)

Idzorek, J.J.

1976-07-01

Experimental results of the aerodynamic performance of seven candidate diffusers are presented to assist in determining their suitability for joining an MHD channel to a steam generator at minimum spacing. The three dimensional diffusers varied in area ratio from 2 to 3.8 and wall half angle from 2 to 5 degrees. The program consisted of five phases: (1) tailoring a diffuser inlet nozzle to a 15 percent blockage; (2) comparison of isolated diffusers at enthalpy ratios 0.5 to 1.0 with respect to separation characteristics and pressure recovery coefficients; (3) recording the optimum diffuser exit flow distribution; (4) recording the internal flow distribution within the steam generator when attached to the diffuser; and (5) observing isolated diffuser exhaust dynamic characteristics. The 2 and 2-1/3 degree half angle rectangular diffusers showed recovery coefficients equal to 0.48 with no evidence of flow separation or instability. Diffusion at angles greater than these produced flow instabilities and with angles greater than 3 degrees random flow separation and reattachment

Numerical simulation of anisotropic preheating ablative Rayleigh-Taylor instability

International Nuclear Information System (INIS)

Wang Lifeng; Ye Wenhua; Li Yingjun

2010-01-01

The linear growth rate of the anisotropic preheating ablative Rayleigh-Taylor instability (ARTI) is studied by numerical simulations. The preheating model κ(T)=κ SH [1+f(T)] is applied, where f(T) is the preheating function interpreting the preheating tongue effect in the cold plasma ahead of the ablative front. An arbitrary coefficient D is introduced in the energy equation to study the influence of transverse thermal conductivity on the growth of the ARTI. We find that enhancing diffusion in a plane transverse to the mean longitudinal flow can strongly reduce the growth of the instability. Numerical simulations exhibit a significant stabilization of the ablation front by improving the transverse thermal conduction. Our results are in general agreement with the theory analysis and numerical simulations by Masse. (authors)

Synthetic acceleration methods for linear transport problems with highly anisotropic scattering

International Nuclear Information System (INIS)

Khattab, K.M.

1989-01-01

One of the iterative methods which is used to solve the discretized transport equation is called the Source Iteration Method (SI). The SI method converges very slowly for problems with optically thick regions and scattering ratios (σ s /σ t ) near unity. The Diffusion-Synthetic Acceleration method (DSA) is one of the methods which has been devised to improve the convergence rate of the SI method. The DSA method is a good tool to accelerate the SI method, if the particle which is being dealt with is a neutron. This is because the scattering process for neutrons is not severely anisotropic. However, if the particle is a charged particle (electron), DSA becomes ineffective as an acceleration device because here the scattering process is severely anisotropic. To improve the DSA algorithm for electron transport, the author approaches the problem in two different ways in this thesis. He develops the first approach by accelerating more angular moments (φ 0 , φ 1 , φ 2 , φ 3 ,...) than is done in DSA; he calls this approach the Modified P N Synthetic Acceleration (MPSA) method. In the second approach he modifies the definition of the transport sweep, using the physics of the scattering; he calls this approach the Modified Diffusion Synthetic Acceleration (MDSA) method. In general, he has developed, analyzed, and implemented the MPSA and MDSA methods in this thesis and has shown that for a high order quadrature set and mesh widths about 1.0 cm, they are each about 34 times faster (clock time) than the DSA method. Also, he has found that the MDSA spectral radius decreases as the mesh size increases. This makes the MDSA method a better choice for large spatial meshes

Anisotropic Oxygen Ion Diffusion in Layered PrBaCo 2 O 5+δ

KAUST Repository

Burriel, Mónica

2012-02-14

Oxygen diffusion and surface exchange coefficients have been measured on polycrystalline samples of the double perovskite oxide PrBaCo 2O 5+δ by the isotope exchange depth profile method, using a time-of-flight SIMS instrument. The measured diffusion coefficients show an activation energy of 1.02 eV, as compared to 0.89 eV for the surface exchange coefficients in the temperature range from 300 to 670 °C. Inhomogeneity was observed in the distribution of the oxygen-18 isotopic fraction from grain to grain in the ceramic samples, which was attributed to anisotropy in the diffusion and exchange of oxygen. By the use of a novel combination of electron back scattered diffraction measurements, time-of-flight, and focused ion beam SIMS, this anisotropy was confirmed by in-depth analysis of single grains of known orientation in a ceramic sample exchanged at 300 °C. Diffusion was shown to be faster in a grain oriented with the surface normal close to 100 and 010 (ab-plane oriented) than a grain with a surface normal close to 001 (c-axis oriented). The magnitude of this anisotropy is estimated to be close to a factor of 4, but this is only a lower bound due to experimental limitations. These findings are consistent with recent molecular dynamic simulations of this material where anisotropy in the oxygen transport was predicted. © 2012 American Chemical Society.

Anisotropic Oxygen Ion Diffusion in Layered PrBaCo 2 O 5+δ

KAUST Repository

Burriel, Mó nica; Peñ a-Martí nez, Juan; Chater, Richard J.; Fearn, Sarah; Berenov, Andrey V.; Skinner, Stephen J.; Kilner, John A.

2012-01-01

Oxygen diffusion and surface exchange coefficients have been measured on polycrystalline samples of the double perovskite oxide PrBaCo 2O 5+δ by the isotope exchange depth profile method, using a time-of-flight SIMS instrument. The measured diffusion coefficients show an activation energy of 1.02 eV, as compared to 0.89 eV for the surface exchange coefficients in the temperature range from 300 to 670 °C. Inhomogeneity was observed in the distribution of the oxygen-18 isotopic fraction from grain to grain in the ceramic samples, which was attributed to anisotropy in the diffusion and exchange of oxygen. By the use of a novel combination of electron back scattered diffraction measurements, time-of-flight, and focused ion beam SIMS, this anisotropy was confirmed by in-depth analysis of single grains of known orientation in a ceramic sample exchanged at 300 °C. Diffusion was shown to be faster in a grain oriented with the surface normal close to 100 and 010 (ab-plane oriented) than a grain with a surface normal close to 001 (c-axis oriented). The magnitude of this anisotropy is estimated to be close to a factor of 4, but this is only a lower bound due to experimental limitations. These findings are consistent with recent molecular dynamic simulations of this material where anisotropy in the oxygen transport was predicted. © 2012 American Chemical Society.

Theoretical and numerical study of highly anisotropic turbulent flows

NARCIS (Netherlands)

Biferale, L.; Daumont, I.; Lanotte, A.; Toschi, F.

2004-01-01

We present a detailed numerical study of anisotropic statistical fluctuations in stationary, homogeneous turbulent flows. We address both problems of intermittency in anisotropic sectors, and the relative importance of isotropic and anisotropic fluctuations at different scales on a direct numerical

Numerical simulation of anisotropic polymeric foams

Directory of Open Access Journals (Sweden)

Volnei Tita

Full Text Available This paper shows in detail the modelling of anisotropic polymeric foam under compression and tension loadings, including discussions on isotropic material models and the entire procedure to calibrate the parameters involved. First, specimens of poly(vinyl chloride (PVC foam were investigated through experimental analyses in order to understand the mechanical behavior of this anisotropic material. Then, isotropic material models available in the commercial software AbaqusTM were investigated in order to verify their ability to model anisotropic foams and how the parameters involved can influence the results. Due to anisotropy, it is possible to obtain different values for the same parameter in the calibration process. The obtained set of parameters are used to calibrate the model according to the application of the structure. The models investigated showed minor and major limitations to simulate the mechanical behavior of anisotropic PVC foams under compression, tension and multi-axial loadings. Results show that the calibration process and the choice of the material model applied to the polymeric foam can provide good quantitative results and save project time. Results also indicate what kind and order of error one will get if certain choices are made throughout the modelling process. Finally, even though the developed calibration procedure is applied to specific PVC foam, it still outlines a very broad drill to analyze other anisotropic cellular materials.

Electrical conductivity and charge diffusion in thermal QCD from the lattice

Energy Technology Data Exchange (ETDEWEB)

Aarts, Gert; Allton, Chris [Department of Physics, College of Science, Swansea University Swansea SA2 8PP (United Kingdom); Amato, Alessandro [Department of Physics, College of Science, Swansea University Swansea SA2 8PP (United Kingdom); Department of Physics and Helsinki Institute of Physics P.O. Box 64, FI-00014 University of Helsinki (Finland); Giudice, Pietro [Universität Münster, Institut für Theoretische Physik Wilhelm-Klemm-Str. 9, D-48149 Münster (Germany); Hands, Simon [Department of Physics, College of Science, Swansea University Swansea SA2 8PP (United Kingdom); Skullerud, Jon-Ivar [Department of Mathematical Physics, National University of Ireland Maynooth Maynooth, Co Kildare (Ireland)

2015-02-27

We present a lattice QCD calculation of the charge diffusion coefficient, the electrical conductivity and various susceptibilities of conserved charges, for a range of temperatures below and above the deconfinement crossover. The calculations include the contributions from up, down and strange quarks. We find that the diffusion coefficient is of the order of 1/(2πT) and has a dip around the crossover temperature. Our results are obtained with lattice simulations containing 2+1 dynamical flavours on anisotropic lattices. The Maximum Entropy Method is used to construct spectral functions from correlators of the conserved vector current.

Investigating the Eddy Diffusivity Concept in the Coastal Ocean

Science.gov (United States)

Rypina, I.; Kirincich, A.; Lentz, S. J.; Sundermeyer, M. A.

2016-12-01

We test the validity, utility, and limitations of the lateral eddy diffusivity concept in a coastal environment through analyzing data from coupled drifter and dye releases within the footprint of a high-resolution (800 m) high-frequency radar south of Martha's Vineyard, Massachusetts. Specifically, we investigate how well a combination of radar-based velocities and drifter-derived diffusivities can reproduce observed dye spreading over an 8-h time interval. A drifter-based estimate of an anisotropic diffusivity tensor is used to parameterize small-scale motions that are unresolved and under-resolved by the radar system. This leads to a significant improvement in the ability of the radar to reproduce the observed dye spreading. Our drifter-derived diffusivity estimates are O(10 m2/s), are consistent with the diffusivity inferred from aerial images of the dye taken using the quadcopter-mounted digital camera during the dye release, and are roughly an order of magnitude larger than diffusivity estimates of Okubo (O(1 m2/s)) for similar spatial scales ( 1 km). Despite the fact that the drifter-based diffusivity approach was successful in improving the ability of the radar to reproduce the observed dye spreading, the dispersion of drifters was, for the most part, not consistent with the diffusive spreading regime.

Modelling of ultrasonic nondestructive testing in anisotropic materials - Rectangular crack

International Nuclear Information System (INIS)

Bostroem, A.

2001-12-01

Nondestructive testing with ultrasound is a standard procedure in the nuclear power industry when searching for defects, in particular cracks. To develop and qualify testing procedures extensive experimental work on test blocks is usually required. This can take a lot of time and therefore be quite costly. A good mathematical model of the testing situation is therefore of great value as it can reduce the experimental work to a great extent. A good model can be very useful for parametric studies and as a pedagogical tool. A further use of a model is as a tool in the qualification of personnel. In anisotropic materials, e.g. austenitic welds, the propagation of ultrasound becomes much more complicated as compared to isotropic materials. Therefore, modelling is even more useful for anisotropic materials, and it in particular has a greater pedagogical value. The present project has been concerned with a further development of the anisotropic capabilities of the computer program UTDefect, which has so far only contained a strip-like crack as the single defect type for anisotropic materials. To be more specific, the scattering by a rectangular crack in an anisotropic component has been studied and the result is adapted to include transmitting and receiving ultrasonic probes. The component under study is assumed to be anisotropic with arbitrary anisotropy. On the other hand, it is assumed to be homogeneous, and this in particular excludes most welds, where it is seldom an adequate approximation to assume homogeneity. The anisotropy may be arbitrarily oriented and the same is true of the rectangular crack. The crack may also be located near a backside of the component. To solve the scattering problem for the crack an integral equation method is used. The probe model has been developed in an earlier project and to compute the signal response in the receiving probe an electromechanical reciprocity argument is employed. As a rectangle is a truly 3D scatterer the sizes of the

Ion and impurity transport in turbulent, anisotropic magnetic fields

International Nuclear Information System (INIS)

Negrea, M; Petrisor, I; Isliker, H; Vogiannou, A; Vlahos, L; Weyssow, B

2011-01-01

We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

Ion and impurity transport in turbulent, anisotropic magnetic fields

Energy Technology Data Exchange (ETDEWEB)

Negrea, M; Petrisor, I [Department of Physics, Association Euratom-MEdC, Romania, University of Craiova, A.I. Cuza str. 13, Craiova (Romania); Isliker, H; Vogiannou, A; Vlahos, L [Section of Astrophysics, Astronomy and Mechanics, Department of Physics, University of Thessaloniki, Association Euratom-Hellenic Republic, 541 24 Thessaloniki (Greece); Weyssow, B [Physique Statistique-Plasmas, Association Euratom-Etat Belge, Universite Libre de Bruxelles, Campus Plaine, Bd. du Triomphe, 1050 Bruxelles (Belgium)

2011-08-15

We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

Ion and impurity transport in turbulent, anisotropic magnetic fields

Science.gov (United States)

Negrea, M.; Petrisor, I.; Isliker, H.; Vogiannou, A.; Vlahos, L.; Weyssow, B.

2011-08-01

We investigate ion and impurity transport in turbulent, possibly anisotropic, magnetic fields. The turbulent magnetic field is modeled as a correlated stochastic field, with Gaussian distribution function and prescribed spatial auto-correlation function, superimposed onto a strong background field. The (running) diffusion coefficients of ions are determined in the three-dimensional environment, using two alternative methods, the semi-analytical decorrelation trajectory (DCT) method, and test-particle simulations. In a first step, the results of the test-particle simulations are compared with and used to validate the results obtained from the DCT method. For this purpose, a drift approximation was made in slab geometry, and relatively good qualitative agreement between the DCT method and the test-particle simulations was found. In a second step, the ion species He, Be, Ne and W, all assumed to be fully ionized, are considered under ITER-like conditions, and the scaling of their diffusivities is determined with respect to varying levels of turbulence (varying Kubo number), varying degrees of anisotropy of the turbulent structures and atomic number. In a third step, the test-particle simulations are repeated without drift approximation, directly using the Lorentz force, first in slab geometry, in order to assess the finite Larmor radius effects, and second in toroidal geometry, to account for the geometric effects. It is found that both effects are important, most prominently the effects due to toroidal geometry and the diffusivities are overestimated in slab geometry by an order of magnitude.

Anisotropic wave-equation traveltime and waveform inversion

KAUST Repository

Feng, Shihang; Schuster, Gerard T.

2016-01-01

The wave-equation traveltime and waveform inversion (WTW) methodology is developed to invert for anisotropic parameters in a vertical transverse isotropic (VTI) meidum. The simultaneous inversion of anisotropic parameters v0, ε and δ is initially

Anisotropic Lithium Insertion Behavior in Silicon Nanowires: Binding Energy, Diffusion Barrier, and Strain Effect

KAUST Repository

Zhang, Qianfan; Cui, Yi; Wang, Enge

2011-01-01

Silicon nanowires (SiNWs) have recently been shown to be promising as high capacity lithium battery anodes. SiNWs can be grown with their long axis along several different crystallographic directions. Due to distinct atomic configuration and electronic structure of SiNWs with different axial orientations, their lithium insertion behavior could be different. This paper focuses on the characteristics of single Li defects, including binding energy, diffusion barriers, and dependence on uniaxial strain in [110], [100], [111], and [112] SiNWs. Our systematic ab initio study suggests that the Si-Li interaction is weaker when the Si-Li bond direction is aligned close to the SiNW long axis. This results in the [110] and [111] SiNWs having the highest and lowest Li binding energy, respectively, and it makes the diffusion barrier along the SiNW axis lower than other pathways. Under external strain, it was found that [110] and [001] SiNWs are the most and least sensitive, respectively. For diffusion along the axial direction, the barrier increases (decreases) under tension (compression). This feature results in a considerable difference in the magnitude of the energy barrier along different diffusion pathways. © 2011 American Chemical Society.

Anisotropic Lithium Insertion Behavior in Silicon Nanowires: Binding Energy, Diffusion Barrier, and Strain Effect

KAUST Repository

Zhang, Qianfan

2011-05-19

Silicon nanowires (SiNWs) have recently been shown to be promising as high capacity lithium battery anodes. SiNWs can be grown with their long axis along several different crystallographic directions. Due to distinct atomic configuration and electronic structure of SiNWs with different axial orientations, their lithium insertion behavior could be different. This paper focuses on the characteristics of single Li defects, including binding energy, diffusion barriers, and dependence on uniaxial strain in [110], [100], [111], and [112] SiNWs. Our systematic ab initio study suggests that the Si-Li interaction is weaker when the Si-Li bond direction is aligned close to the SiNW long axis. This results in the [110] and [111] SiNWs having the highest and lowest Li binding energy, respectively, and it makes the diffusion barrier along the SiNW axis lower than other pathways. Under external strain, it was found that [110] and [001] SiNWs are the most and least sensitive, respectively. For diffusion along the axial direction, the barrier increases (decreases) under tension (compression). This feature results in a considerable difference in the magnitude of the energy barrier along different diffusion pathways. © 2011 American Chemical Society.

Obtuse triangle suppression in anisotropic meshes

KAUST Repository

Sun, Feng; Choi, Yi King; Wang, Wen Ping; Yan, Dongming; Liu, Yang; Lé vy, Bruno L.

2011-01-01

Anisotropic triangle meshes are used for efficient approximation of surfaces and flow data in finite element analysis, and in these applications it is desirable to have as few obtuse triangles as possible to reduce the discretization error. We present a variational approach to suppressing obtuse triangles in anisotropic meshes. Specifically, we introduce a hexagonal Minkowski metric, which is sensitive to triangle orientation, to give a new formulation of the centroidal Voronoi tessellation (CVT) method. Furthermore, we prove several relevant properties of the CVT method with the newly introduced metric. Experiments show that our algorithm produces anisotropic meshes with much fewer obtuse triangles than using existing methods while maintaining mesh anisotropy. © 2011 Elsevier B.V. All rights reserved.

Obtuse triangle suppression in anisotropic meshes

KAUST Repository

Sun, Feng

2011-12-01

Anisotropic triangle meshes are used for efficient approximation of surfaces and flow data in finite element analysis, and in these applications it is desirable to have as few obtuse triangles as possible to reduce the discretization error. We present a variational approach to suppressing obtuse triangles in anisotropic meshes. Specifically, we introduce a hexagonal Minkowski metric, which is sensitive to triangle orientation, to give a new formulation of the centroidal Voronoi tessellation (CVT) method. Furthermore, we prove several relevant properties of the CVT method with the newly introduced metric. Experiments show that our algorithm produces anisotropic meshes with much fewer obtuse triangles than using existing methods while maintaining mesh anisotropy. © 2011 Elsevier B.V. All rights reserved.

Diffusion is capable of translating anisotropic apoptosis initiation into a homogeneous execution of cell death.

LENUS (Irish Health Repository)

Huber, Heinrich J

2010-01-01

ABSTRACT: BACKGROUND: Apoptosis is an essential cell death process throughout the entire life span of all metazoans and its deregulation in humans has been implicated in many proliferative and degenerative diseases. Mitochondrial outer membrane permeabilisation (MOMP) and activation of effector caspases are key processes during apoptosis signalling. MOMP can be subject to spatial coordination in human cancer cells, resulting in intracellular waves of cytochrome-c release. To investigate the consequences of these spatial anisotropies in mitochondrial permeabilisation on subsequent effector caspase activation, we devised a mathematical reaction-diffusion model building on a set of partial differential equations. RESULTS: Reaction-diffusion modelling suggested that even if strong spatial anisotropies existed during mitochondrial cytochrome c release, these would be eliminated by free diffusion of the cytosolic proteins that instantiate the apoptosis execution network. Experimentally, rapid sampling of mitochondrial permeabilisation and effector caspase activity in individual HeLa cervical cancer cells confirmed predictions of the reaction-diffusion model and demonstrated that the signalling network of apoptosis execution could efficiently translate spatial anisotropies in mitochondrial permeabilisation into a homogeneous effector caspase response throughout the cytosol. Further systems modelling suggested that a more than 10,000-fold impaired diffusivity would be required to maintain spatial anisotropies as observed during mitochondrial permeabilisation until the time effector caspases become activated. CONCLUSIONS: Multi-protein diffusion efficiently contributes to eliminating spatial asynchronies which are present during the initiation of apoptosis execution and thereby ensures homogeneous apoptosis execution throughout the entire cell body. For previously reported biological scenarios in which effector caspase activity was shown to be targeted selectively to

Anisotropic surface hole-transport property of triphenylamine-derivative single crystal prepared by solution method

Energy Technology Data Exchange (ETDEWEB)

Umeda, Minoru, E-mail: mumeda@vos.nagaokaut.ac.jp [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Katagiri, Mitsuhiko; Shironita, Sayoko [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Nagayama, Norio [Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Ricoh Company, Ltd., Nishisawada, Numazu, Shizuoka 410-0007 (Japan)

2016-12-01

Highlights: • A hole transport molecule was investigated based on its electrochemical redox characteristics. • The solubility and supersolubility curves of the molecule were measured in order to prepare a large crystal. • The polarization micrograph and XRD results revealed that a single crystal was obtained. • An anisotropic surface conduction, in which the long-axis direction exceeds that of the amorphous layer, was observed. • The anisotropic surface conduction was well explained by the molecular stacked structure. - Abstract: This paper reports the anisotropic hole transport at the triphenylamine-derivative single crystal surface prepared by a solution method. Triphenylamine derivatives are commonly used in a hole-transport material for organic photoconductors of laser-beam printers, in which the materials are used as an amorphous form. For developing organic photovoltaics using the photoconductor’s technology, preparation of a single crystal seems to be a specific way by realizing the high mobility of an organic semiconductor. In this study, a single crystal of 4-(2,2-diphenylethenyl)-N,N-bis(4-methylphenyl)-benzenamine (TPA) was prepared and its anisotropic hole-transport property measured. First, the hole-transport property of the TPA was investigated based on its chemical structure and electrochemical redox characteristics. Next, a large-scale single crystal formation at a high rate was developed by employing a solution method based on its solubility and supersolubility curves. The grown TPA was found to be a single crystal based on the polarization micrograph observation and crystallographic analysis. For the TPA single crystal, an anisotropic surface conduction was found, which was well explained by its molecular stack structure. The measured current in the long-axis direction is one order of magnitude greater than that of amorphous TPA.

Magnetostatics of anisotropic superconducting ellipsoid

International Nuclear Information System (INIS)

Saif, A.G.

1987-09-01

The magnetization and the magnetic field distribution inside (outside) an anisotropic type II superconducting ellipsoid, with filamentary structure, is formulated. We have shown that the magnetic field in this case is different from that of the general anisotropic one. The nucleations of the flux lines for specimens with large demagnetization factors are theoretically studied. We have shown that the nucleations of the flux lines, for specimens with large demagnetization factor, appears at a field larger than that of ellipsoidal shape. (author). 15 refs

Multigrid treatment of implicit continuum diffusion

Science.gov (United States)

Francisquez, Manaure; Zhu, Ben; Rogers, Barrett

2017-10-01

Implicit treatment of diffusive terms of various differential orders common in continuum mechanics modeling, such as computational fluid dynamics, is investigated with spectral and multigrid algorithms in non-periodic 2D domains. In doubly periodic time dependent problems these terms can be efficiently and implicitly handled by spectral methods, but in non-periodic systems solved with distributed memory parallel computing and 2D domain decomposition, this efficiency is lost for large numbers of processors. We built and present here a multigrid algorithm for these types of problems which outperforms a spectral solution that employs the highly optimized FFTW library. This multigrid algorithm is not only suitable for high performance computing but may also be able to efficiently treat implicit diffusion of arbitrary order by introducing auxiliary equations of lower order. We test these solvers for fourth and sixth order diffusion with idealized harmonic test functions as well as a turbulent 2D magnetohydrodynamic simulation. It is also shown that an anisotropic operator without cross-terms can improve model accuracy and speed, and we examine the impact that the various diffusion operators have on the energy, the enstrophy, and the qualitative aspect of a simulation. This work was supported by DOE-SC-0010508. This research used resources of the National Energy Research Scientific Computing Center (NERSC).

Numerical Simulation of Anisotropic Preheating Ablative Rayleigh–Taylor Instability

International Nuclear Information System (INIS)

Li-Feng, Wang; Wen-Hua, Ye; Ying-Jun, Li

2010-01-01

The linear growth rate of the anisotropic preheating ablative Rayleigh–Taylor instability (ARTI) is studied by numerical simulations. The preheating model κ(T) = κ SH [1 + f(T)] is applied, where f(T) is the preheating function interpreting the preheating tongue effect in the cold plasma ahead of the ablative front. An arbitrary coefficient D is introduced in the energy equation to study the influence of transverse thermal conductivity on the growth of the ARTI. We find that enhancing diffusion in a plane transverse to the mean longitudinal flow can strongly reduce the growth of the instability. Numerical simulations exhibit a significant stabilization of the ablation front by improving the transverse thermal conduction. Our results are in general agreement with the theory analysis and numerical simulations by Masse [Phys. Rev. Lett. 98 (2007) 245001]. (physics of gases, plasmas, and electric discharges)

Diffusion in energy materials: Governing dynamics from atomistic modelling

Science.gov (United States)

Parfitt, D.; Kordatos, A.; Filippatos, P. P.; Chroneos, A.

2017-09-01

Understanding diffusion in energy materials is critical to optimising the performance of solid oxide fuel cells (SOFCs) and batteries both of which are of great technological interest as they offer high efficiency for cleaner energy conversion and storage. In the present review, we highlight the insights offered by atomistic modelling of the ionic diffusion mechanisms in SOFCs and batteries and how the growing predictive capability of high-throughput modelling, together with our new ability to control compositions and microstructures, will produce advanced materials that are designed rather than chosen for a given application. The first part of the review focuses on the oxygen diffusion mechanisms in cathode and electrolyte materials for SOFCs and in particular, doped ceria and perovskite-related phases with anisotropic structures. The second part focuses on disordered oxides and two-dimensional materials as these are very promising systems for battery applications.

Jet quenching in a strongly coupled anisotropic plasma

Science.gov (United States)

Chernicoff, Mariano; Fernández, Daniel; Mateos, David; Trancanelli, Diego

2012-08-01

The jet quenching parameter of an anisotropic plasma depends on the relative orientation between the anisotropic direction, the direction of motion of the parton, and the direction along which the momentum broadening is measured. We calculate the jet quenching parameter of an anisotropic, strongly coupled {N} = 4 plasma by means of its gravity dual. We present the results for arbitrary orientations and arbitrary values of the anisotropy. The anisotropic value can be larger or smaller than the isotropic one, and this depends on whether the comparison is made at equal temperatures or at equal entropy densities. We compare our results to analogous calculations for the real-world quark-gluon plasma and find agreement in some cases and disagreement in others.

Diffusion tensor and diffusion weighted imaging. Pictorial mathematics

Energy Technology Data Exchange (ETDEWEB)

Nakada, Tsutomu [California Univ., Davis, CA (United States)

1995-06-01

A new imaging algorithm for the treatment of a second order apparent diffusion tensor, D{sub app}{sup {xi}} is described. The method calls for only mathematics of images (pictorial mathematics) without necessity of eigenvalues/eigenvectors estimation. Nevertheless, it is capable of extracting properties of D{sub app}{sup {xi}} invariant to observation axes. While trace image is an example of images weighted by invariance of the tensor matrix, three dimensional anisotropy (3DAC) contrast represents the imaging method making use to anisotropic direction of tensor ellipsoid producing color coded contrast of exceptionally high anatomic resolution. Contrary to intuition, the processes require only a simple algorithm directly applicable to clinical magnetic resonance imaging (MRI). As a contrast method which precisely represents physical characteristics of a target tissue, invariant D{sub app}{sup {xi}} images produced by pictorial mathematics possess significant potential for a number of biological and clinical applications. (author).

Anisotropic solutions by gravitational decoupling

Science.gov (United States)

Ovalle, J.; Casadio, R.; da Rocha, R.; Sotomayor, A.

2018-02-01

We investigate the extension of isotropic interior solutions for static self-gravitating systems to include the effects of anisotropic spherically symmetric gravitational sources by means of the gravitational decoupling realised via the minimal geometric deformation approach. In particular, the matching conditions at the surface of the star with the outer Schwarzschild space-time are studied in great detail, and we describe how to generate, from a single physically acceptable isotropic solution, new families of anisotropic solutions whose physical acceptability is also inherited from their isotropic parent.

Anisotropic solutions by gravitational decoupling

Energy Technology Data Exchange (ETDEWEB)

Ovalle, J. [Silesian University in Opava, Institute of Physics and Research Centre of Theoretical Physics and Astrophysics, Faculty of Philosophy and Science, Opava (Czech Republic); Universidad Simon Bolivar, Departamento de Fisica, Caracas (Venezuela, Bolivarian Republic of); Casadio, R. [Alma Mater Universita di Bologna, Dipartimento di Fisica e Astronomia, Bologna (Italy); Istituto Nazionale di Fisica Nucleare, Bologna (Italy); Rocha, R. da [Universidade Federal do ABC (UFABC), Centro de Matematica, Computacao e Cognicao, Santo Andre, SP (Brazil); Sotomayor, A. [Universidad de Antofagasta, Departamento de Matematicas, Antofagasta (Chile)

2018-02-15

We investigate the extension of isotropic interior solutions for static self-gravitating systems to include the effects of anisotropic spherically symmetric gravitational sources by means of the gravitational decoupling realised via the minimal geometric deformation approach. In particular, the matching conditions at the surface of the star with the outer Schwarzschild space-time are studied in great detail, and we describe how to generate, from a single physically acceptable isotropic solution, new families of anisotropic solutions whose physical acceptability is also inherited from their isotropic parent. (orig.)

Jets in a strongly coupled anisotropic plasma

Energy Technology Data Exchange (ETDEWEB)

Fadafan, Kazem Bitaghsir [Shahrood University of Technology, Faculty of Physics, Shahrood (Iran, Islamic Republic of); University of Southampton, STAG Research Centre Physics and Astronomy, Southampton (United Kingdom); Morad, Razieh [University of Cape Town, Department of Physics, Rondebosch (South Africa)

2018-01-15

In this paper, we study the dynamics of the light quark jet moving through the static, strongly coupled N = 4, anisotropic plasma with and without charge. The light quark is presented by a 2-parameters point-like initial condition falling string in the context of the AdS/CFT. We calculate the stopping distance of the light quark in the anisotropic medium and compare it with its isotropic value. We study the dependency of the stopping distance to the both string initial conditions and background parameters such as anisotropy parameter or chemical potential. Although the typical behavior of the string in the anisotropic medium is similar to the one in the isotropic AdS-Sch background, the string falls faster to the horizon depending on the direction of moving. Particularly, the enhancement of quenching is larger in the beam direction. We find that the suppression of stopping distance is more prominent when the anisotropic plasma have the same temperature as the isotropic plasma. (orig.)

Antisites and anisotropic diffusion in GaAs and GaSb

KAUST Repository

Tahini, H. A.

2013-10-02

The significant diffusion of Ga under Ga-rich conditions in GaAs and GaSb is counter intuitive as the concentration of Ga vacancies should be depressed although Ga vacancies are necessary to interpret the experimental evidence for Ga transport. To reconcile the existence of Ga vacancies under Ga-rich conditions, transformation reactions have been proposed. Here, density functional theory is employed to calculate the formation energies of vacancies on both sublattices and the migration energy barriers to overcome the formation of the vacancy-antisite defect. Transformation reactions enhance the vacancy concentration in both materials and migration energy barriers indicate that Ga vacancies will dominate.

Quantitative multi-waves migration in elastic anisotropic media; Migration quantitative multi-ondes en milieu elastique anisotrope

Energy Technology Data Exchange (ETDEWEB)

Borgne, H.

2004-12-01

Seismic imaging is an important tool for ail exploration. From the filtered seismic traces and a subsurface velocity model, migration allows to localize the reflectors and to estimate physical properties of these interfaces. The subsurface is split up into a reference medium, corresponding to the low spatial frequencies (a smooth medium), and a perturbation medium, corresponding to the high spatial frequencies. The propagation of elastic waves in the medium of reference is modelled by the ray theory. The association of this theory with a principle of diffraction or reflection allows to take into account the high spatial frequencies: the Kirchhoff approach represents so the medium of perturbations with continuous surfaces, characterized by reflection coefficients. The target of the quantitative migration is to reconstruct this reflection coefficient, notably its behaviour according to the incidence angle. These information will open the way to seismic characterization of the reservoir domain, with. a stratigraphic inversion for instance. In order to improve the qualitative and quantitative migration results, one of the current challenges is to take into account the anisotropy of the subsurface. Taking into account rocks anisotropy in the imaging process of seismic data requires two improvements from the isotropic case. The first one roughly concerns the modelling aspect: an anisotropic propagator should be used to avoid a mis-positioning or bad focusing of the imaged reflectors. The second correction concerns the migration aspect: as anisotropy affects the reflectivity of subsurface, a specific anisotropic imaging formula should be applied in the migration kernel, in order to recover the correct A V A behavior of the subsurface reflectors, If the first correction is DOW made in most so-called anisotropic imaging algorithms, the second one is currently ignored. The first part of my work concerns theoretical aspects. 1 study first the preservation of amplitudes in the

Effects of anisotropies in turbulent magnetic diffusion in mean-field solar dynamo models

Energy Technology Data Exchange (ETDEWEB)

Pipin, V. V. [Institute of Solar-Terrestrial Physics, Russian Academy of Sciences, Irkutsk 664033 (Russian Federation); Kosovichev, A. G. [Hansen Experimental Physics Laboratory, Stanford University, Stanford, CA 94305 (United States)

2014-04-10

We study how anisotropies of turbulent diffusion affect the evolution of large-scale magnetic fields and the dynamo process on the Sun. The effect of anisotropy is calculated in a mean-field magnetohydrodynamics framework assuming that triple correlations provide relaxation to the turbulent electromotive force (so-called the 'minimal τ-approximation'). We examine two types of mean-field dynamo models: the well-known benchmark flux-transport model and a distributed-dynamo model with a subsurface rotational shear layer. For both models, we investigate effects of the double- and triple-cell meridional circulation, recently suggested by helioseismology and numerical simulations. To characterize the anisotropy effects, we introduce a parameter of anisotropy as a ratio of the radial and horizontal intensities of turbulent mixing. It is found that the anisotropy affects the distribution of magnetic fields inside the convection zone. The concentration of the magnetic flux near the bottom and top boundaries of the convection zone is greater when the anisotropy is stronger. It is shown that the critical dynamo number and the dynamo period approach to constant values for large values of the anisotropy parameter. The anisotropy reduces the overlap of toroidal magnetic fields generated in subsequent dynamo cycles, in the time-latitude 'butterfly' diagram. If we assume that sunspots are formed in the vicinity of the subsurface shear layer, then the distributed dynamo model with the anisotropic diffusivity satisfies the observational constraints from helioseismology and is consistent with the value of effective turbulent diffusion estimated from the dynamics of surface magnetic fields.

Generalized Fractional Derivative Anisotropic Viscoelastic Characterization

Directory of Open Access Journals (Sweden)

Harry H. Hilton

2012-01-01

Full Text Available Isotropic linear and nonlinear fractional derivative constitutive relations are formulated and examined in terms of many parameter generalized Kelvin models and are analytically extended to cover general anisotropic homogeneous or non-homogeneous as well as functionally graded viscoelastic material behavior. Equivalent integral constitutive relations, which are computationally more powerful, are derived from fractional differential ones and the associated anisotropic temperature-moisture-degree-of-cure shift functions and reduced times are established. Approximate Fourier transform inversions for fractional derivative relations are formulated and their accuracy is evaluated. The efficacy of integer and fractional derivative constitutive relations is compared and the preferential use of either characterization in analyzing isotropic and anisotropic real materials must be examined on a case-by-case basis. Approximate protocols for curve fitting analytical fractional derivative results to experimental data are formulated and evaluated.

Waves and discontinuities in relativistic and anisotropic magnetohydrodynamics

International Nuclear Information System (INIS)

Cissoko, Mahdy

1975-01-01

This work is devoted to the relativistic study of a non-dissipative anisotropic fluid diagram of infinite conductivity. Such a fluid diagram is constructed in part one. Starting from a macroscopic viewpoint a hydrothermodynamic study of the fluid diagram considered is carried out and the fundamental differential system of anisotropic magnetohydrodynamics is deduced. Part two concerns the study of characteristic varieties and propagation of waves for a polytropic anisotropic fluid diagram. Three types of characteristic varieties are revealed: entropy waves (or material waves), magnetosonic waves and Alfven waves. The propagation rates of Alfven and magnetosonic waves are situated with respect to each other. The study of wave cones showed up on the one hand certain special features of wave propagation in anisotropic magnetohydrodynamics and on the other hand the hyperbolic nature of differential operators associated with the various waves [fr

Anisotropic interpolation theorems of Musielak-Orlicz type

Directory of Open Access Journals (Sweden)

Jinxia Li

2016-10-01

Full Text Available Abstract Anisotropy is a common attribute of Nature, which shows different characterizations in different directions of all or part of the physical or chemical properties of an object. The anisotropic property, in mathematics, can be expressed by a fairly general discrete group of dilations { A k : k ∈ Z } $\\{A^{k}: k\\in\\mathbb{Z}\\}$ , where A is a real n × n $n\\times n$ matrix with all its eigenvalues λ satisfy | λ | > 1 $|\\lambda|>1$ . Let φ : R n × [ 0 , ∞ → [ 0 , ∞ $\\varphi: \\mathbb{R}^{n}\\times[0, \\infty\\to[0,\\infty$ be an anisotropic Musielak-Orlicz function such that φ ( x , ⋅ $\\varphi(x,\\cdot$ is an Orlicz function and φ ( ⋅ , t $\\varphi(\\cdot,t$ is a Muckenhoupt A ∞ ( A $\\mathbb {A}_{\\infty}(A$ weight. The aim of this article is to obtain two anisotropic interpolation theorems of Musielak-Orlicz type, which are weighted anisotropic extension of Marcinkiewicz interpolation theorems. The above results are new even for the isotropic weighted settings.

Self-diffusion in dense granular shear flows.

Science.gov (United States)

Utter, Brian; Behringer, R P

2004-03-01

Diffusivity is a key quantity in describing velocity fluctuations in granular materials. These fluctuations are the basis of many thermodynamic and hydrodynamic models which aim to provide a statistical description of granular systems. We present experimental results on diffusivity in dense, granular shear flows in a two-dimensional Couette geometry. We find that self-diffusivities D are proportional to the local shear rate gamma; with diffusivities along the direction of the mean flow approximately twice as large as those in the perpendicular direction. The magnitude of the diffusivity is D approximately gamma;a(2), where a is the particle radius. However, the gradient in shear rate, coupling to the mean flow, and strong drag at the moving boundary lead to particle displacements that can appear subdiffusive or superdiffusive. In particular, diffusion appears to be superdiffusive along the mean flow direction due to Taylor dispersion effects and subdiffusive along the perpendicular direction due to the gradient in shear rate. The anisotropic force network leads to an additional anisotropy in the diffusivity that is a property of dense systems and has no obvious analog in rapid flows. Specifically, the diffusivity is suppressed along the direction of the strong force network. A simple random walk simulation reproduces the key features of the data, such as the apparent superdiffusive and subdiffusive behavior arising from the mean velocity field, confirming the underlying diffusive motion. The additional anisotropy is not observed in the simulation since the strong force network is not included. Examples of correlated motion, such as transient vortices, and Lévy flights are also observed. Although correlated motion creates velocity fields which are qualitatively different from collisional Brownian motion and can introduce nondiffusive effects, on average the system appears simply diffusive.

Anisotropic conductivity imaging with MREIT using equipotential projection algorithm

Energy Technology Data Exchange (ETDEWEB)

Degirmenci, Evren [Department of Electrical and Electronics Engineering, Mersin University, Mersin (Turkey); Eyueboglu, B Murat [Department of Electrical and Electronics Engineering, Middle East Technical University, 06531, Ankara (Turkey)

2007-12-21

Magnetic resonance electrical impedance tomography (MREIT) combines magnetic flux or current density measurements obtained by magnetic resonance imaging (MRI) and surface potential measurements to reconstruct images of true conductivity with high spatial resolution. Most of the biological tissues have anisotropic conductivity; therefore, anisotropy should be taken into account in conductivity image reconstruction. Almost all of the MREIT reconstruction algorithms proposed to date assume isotropic conductivity distribution. In this study, a novel MREIT image reconstruction algorithm is proposed to image anisotropic conductivity. Relative anisotropic conductivity values are reconstructed iteratively, using only current density measurements without any potential measurement. In order to obtain true conductivity values, only either one potential or conductivity measurement is sufficient to determine a scaling factor. The proposed technique is evaluated on simulated data for isotropic and anisotropic conductivity distributions, with and without measurement noise. Simulation results show that the images of both anisotropic and isotropic conductivity distributions can be reconstructed successfully.

Enhanced diffusion of solute metals forming complexes with radiation defects in silica

International Nuclear Information System (INIS)

Pivin, J.C.; Garrido, E.; Rizza, G.; Thome, L.

1998-01-01

The mixing kinetics of Cu, Ag, W, Pt, and Au single layers embedded in silica when irradiated with heavy ions at temperatures (T) of 110 and 300 K was investigated by means of in situ RBS analyses in alternation with irradiations. The spreading of peaks related to the metallic species is generally anisotropic and obeys either a quadratic or a linear dependence on the ion dose according to the increasing T. The quadratic law is attributed to a control of the diffusion by the coupling of the large impurity atoms M with matrix defects, and a classical regime of radiation enhanced diffusion is observed when this coupling is made easier (higher T or mass of M). Other factors such as internal stresses affect the rates of M dissolution and diffusion. (orig.)

Joint eigenvector estimation from mutually anisotropic tensors improves susceptibility tensor imaging of the brain, kidney, and heart.

Science.gov (United States)

Dibb, Russell; Liu, Chunlei

2017-06-01

To develop a susceptibility-based MRI technique for probing microstructure and fiber architecture of magnetically anisotropic tissues-such as central nervous system white matter, renal tubules, and myocardial fibers-in three dimensions using susceptibility tensor imaging (STI) tools. STI can probe tissue microstructure, but is limited by reconstruction artifacts because of absent phase information outside the tissue and noise. STI accuracy may be improved by estimating a joint eigenvector from mutually anisotropic susceptibility and relaxation tensors. Gradient-recalled echo image data were simulated using a numerical phantom and acquired from the ex vivo mouse brain, kidney, and heart. Susceptibility tensor data were reconstructed using STI, regularized STI, and the proposed algorithm of mutually anisotropic and joint eigenvector STI (MAJESTI). Fiber map and tractography results from each technique were compared with diffusion tensor data. MAJESTI reduced the estimated susceptibility tensor orientation error by 30% in the phantom, 36% in brain white matter, 40% in the inner medulla of the kidney, and 45% in myocardium. This improved the continuity and consistency of susceptibility-based fiber tractography in each tissue. MAJESTI estimation of the susceptibility tensors yields lower orientation errors for susceptibility-based fiber mapping and tractography in the intact brain, kidney, and heart. Magn Reson Med 77:2331-2346, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

Stability conditions for the Bianchi type II anisotropically inflating universes

International Nuclear Information System (INIS)

Kao, W.F.; Lin, Ing-Chen

2009-01-01

Stability conditions for a class of anisotropically inflating solutions in the Bianchi type II background space are shown explicitly in this paper. These inflating solutions were known to break the cosmic no-hair theorem such that they do not approach the de Sitter universe at large times. It can be shown that unstable modes of the anisotropic perturbations always exist for this class of expanding solutions. As a result, we show that these set of anisotropically expanding solutions are unstable against anisotropic perturbations in the Bianchi type II space

Anisotropic hydrodynamics: Motivation and methodology

Energy Technology Data Exchange (ETDEWEB)

Strickland, Michael

2014-06-15

In this proceedings contribution I review recent progress in our understanding of the bulk dynamics of relativistic systems that possess potentially large local rest frame momentum-space anisotropies. In order to deal with these momentum-space anisotropies, a reorganization of relativistic viscous hydrodynamics can be made around an anisotropic background, and the resulting dynamical framework has been dubbed “anisotropic hydrodynamics”. I also discuss expectations for the degree of momentum-space anisotropy of the quark–gluon plasma generated in relativistic heavy ion collisions at RHIC and LHC from second-order viscous hydrodynamics, strong-coupling approaches, and weak-coupling approaches.

Effect of self-interstitial diffusion anisotropy in electron-irradiated zirconium: A cluster dynamics modeling

International Nuclear Information System (INIS)

Christien, F.; Barbu, A.

2005-01-01

A model based on the cluster dynamics approach was proposed in [A. Hardouin Duparc, C. Moingeon, N. Smetniansky-de-Grande, A. Barbu, J. Nucl. Mater. 302 (2002) 143] to describe point defect agglomeration in metals under irradiation. This model is restricted to materials where point defect diffusion is isotropic and is thus not applicable to anisotropic metals such as zirconium. Following the approach proposed by Woo [C.H. Woo, J. Nucl. Mater. 159 (1988) 237], we extended in this work the model to the case where self-interstitial atoms (SIA) diffusion is anisotropic. The model was then applied to the loop microstructure evolution of a zirconium thin foil irradiated with electrons in a high-voltage microscope. First, the inputs were validated by comparing the numerical results with Hellio et al. experimental results [C. Hellio, C.H. de Novion, L. Boulanger, J. Nucl. Mater. 159 (1988) 368]. Further calculations were made to evidence the effect of the thin foil orientation on the dislocation loop microstructure under irradiation. The result is that it is possible to reproduce for certain orientations the 'unexpected' vacancy loop growth experimentally observed in electron-irradiated zirconium [M. Griffiths, M.H. Loretto, R.E. Sallmann, J. Nucl. Mater. 115 (1983) 313; J. Nucl. Mater. 115 (1983) 323; Philos. Mag. A 49 (1984) 613]. This effect is directly linked to SIA diffusion anisotropy

Surface diffusion of sorbed radionuclides

International Nuclear Information System (INIS)

Berry, J.A.; Bond, K.A.

1991-01-01

Surface diffusion has in the past been invoked to explain rates of radionuclide migration which were greater than those predicted. Results were generally open to interpretation but the possible existence of surface diffusion, whereby sorbed radionuclides could potentially migrate at much enhanced rates, necessitated investigation. In this work through-diffusion experiments have shown that although surface diffusion does exist for some nuclides, the magnitude of the phenomenon is not sufficient to affect repository safety assessment modelling. (author)

Hydrodynamic cavitation in Stokes flow of anisotropic fluids

Science.gov (United States)

Stieger, Tillmann; Agha, Hakam; Schoen, Martin; Mazza, Marco G.; Sengupta, Anupam

2017-05-01

Cavitation, the nucleation of vapour in liquids, is ubiquitous in fluid dynamics, and is often implicated in a myriad of industrial and biomedical applications. Although extensively studied in isotropic liquids, corresponding investigations in anisotropic liquids are largely lacking. Here, by combining liquid crystal microfluidic experiments, nonequilibrium molecular dynamics simulations and theoretical arguments, we report flow-induced cavitation in an anisotropic fluid. The cavitation domain nucleates due to sudden pressure drop upon flow past a cylindrical obstacle within a microchannel. For an anisotropic fluid, the inception and growth of the cavitation domain ensued in the Stokes regime, while no cavitation was observed in isotropic liquids flowing under similar hydrodynamic parameters. Using simulations we identify a critical value of the Reynolds number for cavitation inception that scales inversely with the order parameter of the fluid. Strikingly, the critical Reynolds number for anisotropic fluids can be 50% lower than that of isotropic fluids.

A Morphing framework to couple non-local and local anisotropic continua

KAUST Repository

Azdoud, Yan

2013-05-01

In this article, we develop a method to couple anisotropic local continua with anisotropic non-local continua with central long-range forces. First, we describe anisotropic non-local models based on spherical harmonic descriptions. We then derive compatible classic continuum models. Finally, we apply the morphing method to these anisotropic non-local models and present three-dimensional numerical examples to validate the efficiency of the technique. © 2013 Elsevier Ltd. All rights reserved.

Elastic properties of spherically anisotropic piezoelectric composites

International Nuclear Information System (INIS)

En-Bo, Wei; Guo-Qing, Gu; Ying-Ming, Poon

2010-01-01

Effective elastic properties of spherically anisotropic piezoelectric composites, whose spherically anisotropic piezoelectric inclusions are embedded in an infinite non-piezoelectric matrix, are theoretically investigated. Analytical solutions for the elastic displacements and the electric potentials under a uniform external strain are derived exactly. Taking into account of the coupling effects of elasticity, permittivity and piezoelectricity, the formula is derived for estimating the effective elastic properties based on the average field theory in the dilute limit. An elastic response mechanism is revealed, in which the effective elastic properties increase as inclusion piezoelectric properties increase and inclusion dielectric properties decrease. Moreover, a piezoelectric response mechanism, of which the effective piezoelectric response vanishes due to the symmetry of spherically anisotropic composite, is also disclosed. (condensed matter: structure, thermal and mechanical properties)

Acoustic frequency filter based on anisotropic topological phononic crystals

KAUST Repository

Chen, Zeguo

2017-11-02

We present a design of acoustic frequency filter based on a two-dimensional anisotropic phononic crystal. The anisotropic band structure exhibits either a directional or a combined (global + directional) bandgap at certain frequency regions, depending on the geometry. When the time-reversal symmetry is broken, it may introduce a topologically nontrivial bandgap. The induced nontrivial bandgap and the original directional bandgap result in various interesting wave propagation behaviors, such as frequency filter. We develop a tight-binding model to characterize the effective Hamiltonian of the system, from which the contribution of anisotropy is explicitly shown. Different from the isotropic cases, the Zeeman-type splitting is not linear and the anisotropic bandgap makes it possible to achieve anisotropic propagation characteristics along different directions and at different frequencies.

Acoustic frequency filter based on anisotropic topological phononic crystals

KAUST Repository

Chen, Zeguo; Zhao, Jiajun; Mei, Jun; Wu, Ying

2017-01-01

We present a design of acoustic frequency filter based on a two-dimensional anisotropic phononic crystal. The anisotropic band structure exhibits either a directional or a combined (global + directional) bandgap at certain frequency regions, depending on the geometry. When the time-reversal symmetry is broken, it may introduce a topologically nontrivial bandgap. The induced nontrivial bandgap and the original directional bandgap result in various interesting wave propagation behaviors, such as frequency filter. We develop a tight-binding model to characterize the effective Hamiltonian of the system, from which the contribution of anisotropy is explicitly shown. Different from the isotropic cases, the Zeeman-type splitting is not linear and the anisotropic bandgap makes it possible to achieve anisotropic propagation characteristics along different directions and at different frequencies.

Density functional theory study of the mechanism of Li diffusion in rutile RuO2

International Nuclear Information System (INIS)

Jung, Jongboo; Cho, Maenghyo; Zhou, Min

2014-01-01

First-principle calculations are carried out to study the diffusion of Li ions in rutile structure RuO 2 , a material for positive electrodes in rechargeable Li ion batteries. The calculations focus on migration pathways and energy barriers for diffusion in Li-poor and Li-rich phases using the Nudged Elastic Band Method. Diffusion coefficients estimated based on calculated energy barriers are in good agreement with experimental values reported in the literature. The results confirm the anisotropic nature of diffusion of Li ions in one-dimensional c channels along the [001] crystalline direction of rutile RuO 2 and show that Li diffusion in the Li-poor phase is faster than in the Li-rich phase. The findings of fast Li diffusion and feasible Li insertion at low temperatures in the host rutile RuO 2 suggest this material is a good ionic conductor for Li transport. The finding also suggests possible means for enhancing the performance of RuO 2 -based electrode materials

Anisotropic nanomaterials preparation, properties, and applications

CERN Document Server

Li, Quan

2015-01-01

In this book anisotropic one-dimensional and two-dimensional nanoscale building blocks and their assembly into fascinating and qualitatively new functional structures embracing both hard and soft components are explained. Contributions from leading experts regarding important aspects like synthesis, assembly, properties and applications of the above materials are compiled into a reference book. The anisotropy, i.e. the direction-dependent physical properties, of materials is fascinating and elegant and has sparked the quest for anisotropic materials with useful properties. With such a curiosi

Plane-wave diffraction by periodic structures with artificial anisotropic dielectrics

International Nuclear Information System (INIS)

Kazerooni, Azadeh Semsar; Shahabadi, Mahmoud

2010-01-01

Periodic structures with artificial anisotropic dielectrics are studied. The artificial anisotropic dielectric material in this work is made of two alternating isotropic dielectric layers. By a proper choice of the dielectric constant of the layers, we can realize a uniaxial anisotropic medium with controllable anisotropy. The artificial anisotropic dielectric is then used in periodic structures. For these structures, the optical axis of the artificial dielectric is assumed to be parallel or perpendicular to the period of the structure. Diffraction of plane waves by these structures is analyzed by a fully vectorial rigorous matrix method based on a generalized transmission line (TL) formulation. The propagation constants and field distributions are computed and diffraction properties of such structures are studied to show that, by a proper choice of structural parameters, these periodic structures with artificial anisotropic dielectrics can be used as polarizers or polarizing mirrors

Determination of the Pt spin diffusion length by spin-pumping and spin Hall effect

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wei; Pearson, John E.; Hoffmann, Axel [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Vlaminck, Vincent [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Colegio de Ciencias e Ingenería, Universidad San Fransciso de Quito, Quito (Ecuador); Divan, Ralu [Center for Nanoscale Materials, Argonne National Laboratory, Illinois 60439 (United States); Bader, Samuel D. [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Center for Nanoscale Materials, Argonne National Laboratory, Illinois 60439 (United States)

2013-12-09

The spin diffusion length of Pt at room temperature and at 8 K is experimentally determined via spin pumping and spin Hall effect in permalloy/Pt bilayers. Voltages generated during excitation of ferromagnetic resonance from the inverse spin Hall effect and anisotropic magnetoresistance effect were investigated with a broadband approach. Varying the Pt layer thickness gives rise to an evolution of the voltage line shape due to the superposition of the above two effects. By studying the ratio of the two voltage components with the Pt layer thickness, the spin diffusion length of Pt can be directly extracted. We obtain a spin diffusion length of ∼1.2 nm at room temperature and ∼1.6 nm at 8 K.

Pseudo-spectral method using rotated staggered grid for elastic wave propagation in 3D arbitrary anisotropic media

KAUST Repository

Zou, Peng

2017-05-10

Staggering grid is a very effective way to reduce the Nyquist errors and to suppress the non-causal ringing artefacts in the pseudo-spectral solution of first-order elastic wave equations. However, the straightforward use of a staggered-grid pseudo-spectral method is problematic for simulating wave propagation when the anisotropy level is greater than orthorhombic or when the anisotropic symmetries are not aligned with the computational grids. Inspired by the idea of rotated staggered-grid finite-difference method, we propose a modified pseudo-spectral method for wave propagation in arbitrary anisotropic media. Compared with an existing remedy of staggered-grid pseudo-spectral method based on stiffness matrix decomposition and a possible alternative using the Lebedev grids, the rotated staggered-grid-based pseudo-spectral method possesses the best balance between the mitigation of artefacts and efficiency. A 2D example on a transversely isotropic model with tilted symmetry axis verifies its effectiveness to suppress the ringing artefacts. Two 3D examples of increasing anisotropy levels demonstrate that the rotated staggered-grid-based pseudo-spectral method can successfully simulate complex wavefields in such anisotropic formations.

Nonlinear and anisotropic tensile properties of graft materials used in soft tissue applications.

Science.gov (United States)

Yoder, Jonathon H; Elliott, Dawn M

2010-05-01

The mechanical properties of extracellular matrix grafts that are intended to augment or replace soft tissues should be comparable to the native tissue. Such grafts are often used in fiber-reinforced tissue applications that undergo multi-axial loading and therefore knowledge of the anisotropic and nonlinear properties are needed, including the moduli and Poisson's ratio in two orthogonal directions within the plane of the graft. The objective of this study was to measure the tensile mechanical properties of several marketed grafts: Alloderm, Restore, CuffPatch, and OrthADAPT. The degree of anisotropy and non-linearity within each graft was evaluated from uniaxial tensile tests and compared to their native tissue. The Alloderm graft was anisotropic in both the toe- and linear-region of the stress-strain response, was highly nonlinear, and generally had low properties. The Restore and CuffPatch grafts had similar stress-strain responses, were largely isotropic, had a linear-region modulus of 18MPa, and were nonlinear. OrthADAPT was anisotropic in the linear-region (131 MPA vs 47MPa in the toe-region) and was highly nonlinear. The Poisson ratio for all grafts was between 0.4 and 0.7, except for the parallel orientation of Restore which was greater than 1.0. Having an informed understanding of how the available grafts perform mechanically will allow for better assessment by the physician for which graft to apply depending upon its application. Copyright 2010 Elsevier Ltd. All rights reserved.

Anisotropic Intervalley Plasmon Excitations in Graphene

International Nuclear Information System (INIS)

Chen Jian; Xu Huai-Zhe

2015-01-01

We investigate theoretically the intervalley plasmon excitations (IPEs) in graphene monolayer within the random-phase approximation. We derive an analytical expression of the real part of the dielectric function. We find a low-energy plasmon mode with a linear anisotropic dispersion which depends on the Fermi energy and the dielectric constant of substrate. The IPEs show strongly anisotropic behavior, which becomes significant around the zigzag crystallographic direction. More interestingly, the group velocity of IPE varies from negative to positive, and vanishes at special energy. (paper)

Modelling of CMUTs with Anisotropic Plates

DEFF Research Database (Denmark)

la Cour, Mette Funding; Christiansen, Thomas Lehrmann; Jensen, Jørgen Arendt

2012-01-01

Traditionally, CMUTs are modelled using the isotropic plate equation and this leads to deviations between analytical calculations and FEM simulations. In this paper, the deflection profile and material parameters are calculated using the anisotropic plate equation. It is shown that the anisotropic...... calculations match perfectly with FEM while an isotropic approach causes up to 10% deviations in deflection profile. Furthermore, we show how commonly used analytic modelling methods such as static calculations of the pull-in voltage and dynamic modelling through an equivalent circuit representation can...

Spin diffusion from an inhomogeneous quench in an integrable system.

Science.gov (United States)

Ljubotina, Marko; Žnidarič, Marko; Prosen, Tomaž

2017-07-13

Generalized hydrodynamics predicts universal ballistic transport in integrable lattice systems when prepared in generic inhomogeneous initial states. However, the ballistic contribution to transport can vanish in systems with additional discrete symmetries. Here we perform large scale numerical simulations of spin dynamics in the anisotropic Heisenberg XXZ spin 1/2 chain starting from an inhomogeneous mixed initial state which is symmetric with respect to a combination of spin reversal and spatial reflection. In the isotropic and easy-axis regimes we find non-ballistic spin transport which we analyse in detail in terms of scaling exponents of the transported magnetization and scaling profiles of the spin density. While in the easy-axis regime we find accurate evidence of normal diffusion, the spin transport in the isotropic case is clearly super-diffusive, with the scaling exponent very close to 2/3, but with universal scaling dynamics which obeys the diffusion equation in nonlinearly scaled time.

On Pokrovskii's anisotropic gap equations in superconductivity theory

Science.gov (United States)

Yang, Yisong

2003-11-01

An existence and uniqueness theorem for Pokrovskii's zero-temperature anisotropic gap equation is proved. Furthermore, it is shown that Pokrovskii's finite-temperature equation is inconsistent with the Bardeen-Cooper-Schrieffer (BCS) theory. A reformulation of the anisotropic gap equation is presented along the line of Pokrovskii and it is shown that the new equation is consistent with the BCS theory for the whole temperature range. As an application, the Markowitz-Kadanoff model for anisotropic superconductivity is considered and a rigorous proof of the half-integer-exponent isotope effect is obtained. Furthermore, a sharp estimate of the gap solution near the transition temperature is established.

Data-driven imaging in anisotropic media

Energy Technology Data Exchange (ETDEWEB)

Volker, Arno; Hunter, Alan [TNO Stieltjes weg 1, 2600 AD, Delft (Netherlands)

2012-05-17

Anisotropic materials are being used increasingly in high performance industrial applications, particularly in the aeronautical and nuclear industries. Some important examples of these materials are composites, single-crystal and heavy-grained metals. Ultrasonic array imaging in these materials requires exact knowledge of the anisotropic material properties. Without this information, the images can be adversely affected, causing a reduction in defect detection and characterization performance. The imaging operation can be formulated in two consecutive and reciprocal focusing steps, i.e., focusing the sources and then focusing the receivers. Applying just one of these focusing steps yields an interesting intermediate domain. The resulting common focus point gather (CFP-gather) can be interpreted to determine the propagation operator. After focusing the sources, the observed travel-time in the CFP-gather describes the propagation from the focus point to the receivers. If the correct propagation operator is used, the measured travel-times should be the same as the time-reversed focusing operator due to reciprocity. This makes it possible to iteratively update the focusing operator using the data only and allows the material to be imaged without explicit knowledge of the anisotropic material parameters. Furthermore, the determined propagation operator can also be used to invert for the anisotropic medium parameters. This paper details the proposed technique and demonstrates its use on simulated array data from a specimen of Inconel single-crystal alloy commonly used in the aeronautical and nuclear industries.

Anisotropic characterization of magnetorheological materials

Energy Technology Data Exchange (ETDEWEB)

Dohmen, E., E-mail: eike.dohmen@tu-dresden.de; Modler, N.; Gude, M.

2017-06-01

For the development of energy efficient lightweight parts novel function integrating materials are needed. Concerning this field of application magnetorheological (MR) fluids, MR elastomers and MR composites are promising materials allowing the adjustment of mechanical properties by an external magnetic field. A key issue for operating such structures in praxis is the magneto-mechanical description. Most rheological properties are gathered at laboratory conditions for high magnetic flux densities and a single field direction, which does not correspond to real praxis conditions. Although anisotropic formation of superstructures can be observed in MR suspensions (Fig. 1) or experimenters intentionally polymerize MR elastomers with anisotropic superstructures these MR materials are usually described in an external magnetic field as uniform, isotropic materials. This is due to missing possibilities for experimentally measuring field angle dependent properties and ways of distinguishing between material properties and frictional effects. Just a few scientific works experimentally investigated the influence of different field angles (Ambacher et al., 1992; Grants et al., 1990; Kuzhir et al., 2003) or the influence of surface roughness on the shear behaviour of magnetic fluids (Tang and Conrad, 1996) . The aim of this work is the introduction of a novel field angle cell allowing the determination of anisotropic mechanical properties for various MR materials depending on the applied magnetic field angle. - Highlights: • Novel magnetic field angle testing device (MFATD) presented. • Determination of magnetic field dependent anisotropic mechanical properties. • Experimental data for different field directions shown for a commercial MR fluid. • Material description of MR fluids as transversal-isotropic solids. • Magnetic field angle dependent variations in shear stresses experimentally measured. • Determination of frictional coefficients between the MR fluid and

A unified theoretical and experimental study of anisotropic hardening

International Nuclear Information System (INIS)

Boehler, J.P.; Raclin, J.

1981-01-01

The purpose of this work is to develop a consistent formulation of the constitutive relations regarding anisotropic hardening materials. Attention is focused on the appearance and the evolution of mechanical anisotropies during irreversible processes, such as plastic forming and inelastic deformation of structures. The representation theorems for anisotropic tensor functions constitute a theoretical basis, allowing to reduce arbitrariness and to obtain a unified formulation of anisotropic hardening. In this approach, a general three-dimensional constitutive law is developed for prestrained initially orthotropic materials. Introduction of the plastic behavior results in the general forms of both the flow-law and the yield criterion. The developed theory is then specialized for the case of plane stress and different modes of anisotropic hardening are analyzed. A new generalization of the Von Mises criterion is proposed, in considering a homogeneous form of order two in stress and employing the simplest combinations of the basic invariants entering the general form of the yield condition. The proposed criterion involves specific terms accounting for the initial anisotropy, the deformation induced anisotropy and correlative terms between initial and induced anisotropy. The effects of prestrainings result in both isotropic and anisotropic hardening. An adequate experimental program, consisting of uniaxial tensile tests on oriented specimens of prestrained sheet-metal, was performed, in order to determine the specific form and the evolution of the anisotropic failure criterion for soft-steel subjected to different irreversible prestrainings. (orig.)

Visualization of transverse diffusion paths across fiber cells of the ocular lens by small animal MRI

International Nuclear Information System (INIS)

Vaghefi, Ehsan; Hunter, Peter J; Jacobs, Marc D; Pontre, Beau; Donaldson, Paul J

2009-01-01

The sense of vision requires that light penetrate through the ocular lens. Experiments, performed and published by many research groups, have suggested that the lens, which has no blood vessels, relies on internally directed ion and water fluxes for its circulation, survival and transparency. We investigated the internal diffusive pathways of the lens in order to better understand the constraints that may be operating on directional lens fluxes. Small animal magnetic resonance imaging, including T2-weighted and diffusion tensor imaging, was used to measure tissue properties and diffusivity throughout cultured bovine lenses. A range of concentric regions of signal intensity was distinguished inside the lens, by both T2-weighted signal and mean diffusivity. Diffusivity mapping of the lens revealed novel anisotropic polar and equatorial zones of pronounced diffusivity directed transverse to the fiber cells. In contrast, an inner zone including the lens nucleus showed isotropic and weak diffusivity. Our results lend support to models of internally directed lens micro-circulation, by placing non-structural diffusive constraints on global patterns of fluid circulation

Anisotropic magnetoresistance and piezoelectric effect in GaAs Hall samples

Science.gov (United States)

Ciftja, Orion

2017-02-01

Application of a strong magnetic field perpendicular to a two-dimensional electron system leads to a variety of quantum phases ranging from incompressible quantum Hall liquid to Wigner solid, charge density wave, and exotic non-Abelian states. A few quantum phases seen in past experiments on GaAs Hall samples of electrons show pronounced anisotropic magnetoresistance values at certain weak magnetic fields. We argue that this might be due to the piezoelectric effect that is inherent in a semiconductor host such as GaAs. Such an effect has the potential to create a sufficient in-plane internal strain that will be felt by electrons and will determine the direction of high and low resistance. When Wigner solid, charge density wave, and isotropic liquid phases are very close in energy, the overall stability of the system is very sensitive to local order and, thus, can be strongly influenced even by a weak perturbation such as the piezoelectric-induced effective electron-electron interaction, which is anisotropic. In this work, we argue that an anisotropic interaction potential may stabilize anisotropic liquid phases of electrons even in a strong magnetic field regime where normally one expects to see only isotropic quantum Hall or isotropic Fermi liquid states. We use this approach to support a theoretical framework that envisions the possibility of an anisotropic liquid crystalline state of electrons in the lowest Landau level. In particular, we argue that an anisotropic liquid state of electrons may stabilize in the lowest Landau level close to the liquid-solid transition region at filling factor ν =1 /6 for a given anisotropic Coulomb interaction potential. Quantum Monte Carlo simulations for a liquid crystalline state with broken rotational symmetry indicate stability of liquid crystalline order consistent with the existence of an anisotropic liquid state of electrons stabilized by anisotropy at filling factor ν =1 /6 of the lowest Landau level.

Development of laser ablation plasma by anisotropic self-radiation

Directory of Open Access Journals (Sweden)

Ohnishi Naofumi

2013-11-01

Full Text Available We have proposed a method for reproducing an accurate solution of low-density ablation plasma by properly treating anisotropic radiation. Monte-Carlo method is employed for estimating Eddington tensor with limited number of photon samples in each fluid time step. Radiation field from ablation plasma is significantly affected by the anisotropic Eddington tensor. Electron temperature around the ablation surface changes with the radiation field and is responsible for the observed emission. An accurate prediction of the light emission from the laser ablation plasma requires a careful estimation of the anisotropic radiation field.

Anisotropic inflation with derivative couplings

Science.gov (United States)

Holland, Jonathan; Kanno, Sugumi; Zavala, Ivonne

2018-05-01

We study anisotropic power-law inflationary solutions when the inflaton and its derivative couple to a vector field. This type of coupling is motivated by D-brane inflationary models, in which the inflaton, and a vector field living on the D-brane, couple disformally (derivatively). We start by studying a phenomenological model where we show the existence of anisotropic solutions and demonstrate their stability via a dynamical system analysis. Compared to the case without a derivative coupling, the anisotropy is reduced and thus can be made consistent with current limits, while the value of the slow-roll parameter remains almost unchanged. We also discuss solutions for more general cases, including D-brane-like couplings.

Anisotropic charged generalized polytropic models

Science.gov (United States)

Nasim, A.; Azam, M.

2018-06-01

In this paper, we found some new anisotropic charged models admitting generalized polytropic equation of state with spherically symmetry. An analytic solution of the Einstein-Maxwell field equations is obtained through the transformation introduced by Durgapal and Banerji (Phys. Rev. D 27:328, 1983). The physical viability of solutions corresponding to polytropic index η =1/2, 2/3, 1, 2 is analyzed graphically. For this, we plot physical quantities such as radial and tangential pressure, anisotropy, speed of sound which demonstrated that these models achieve all the considerable physical conditions required for a relativistic star. Further, it is mentioned here that previous results for anisotropic charged matter with linear, quadratic and polytropic equation of state can be retrieved.

Pulse splitting in nonlinear media with anisotropic dispersion properties

DEFF Research Database (Denmark)

Bergé, L.; Juul Rasmussen, J.; Schmidt, M.R.

1998-01-01

The nonlinear self-focusing of beams in media with anisotropic (mix-signed) dispersion is investigated. Theoretical predictions employing virial-type arguments and self-similar techniques suggest that a pulse propagating in a nonlinear medium with anisotropic dispersion will not collapse...

Diffusion-weighted imaging: basic concepts and application in cerebral stroke and head trauma

International Nuclear Information System (INIS)

Huisman, Thierry A.G.M.

2003-01-01

Diffusion-weighted imaging (DWI) of the brain represents a new imaging technique that extends imaging from depiction of neuroanatomy to the level of function and physiology. DWI measures a fundamentally different physiological parameter compared with conventional MRI. Image contrast is related to differences in the diffusion rate of water molecules rather than to changes in total tissue water. DWI can reveal pathology in cases where conventional MRI remains unremarkable. DWI has proven to be highly sensitive in the early detection of acute cerebral ischemia and seems promising in the evaluation of traumatic brain injury. DWI can differentiate between lesions with decreased and increased diffusion. In addition, full-tensor DWI can evaluate the microscopic architecture of the brain, in particular white matter tracts, by measuring the degree and spatial distribution of anisotropic diffusion within the brain. This article reviews the basic concepts of DWI and its application in cerebral ischemia and traumatic brain injury. (orig.)

Diffusion-weighted imaging: basic concepts and application in cerebral stroke and head trauma

Energy Technology Data Exchange (ETDEWEB)

Huisman, Thierry A.G.M. [Department of Radiology, Neuroradiology Section and MGH-NMR Center, Massachusetts General Hospital and Harvard Medical School, MA 02129, Boston (United States); Department of Radiology, University Children' s Hospital Zurich, Steinwiesstrasse 75, 8032, Zurich (Switzerland)

2003-10-01

Diffusion-weighted imaging (DWI) of the brain represents a new imaging technique that extends imaging from depiction of neuroanatomy to the level of function and physiology. DWI measures a fundamentally different physiological parameter compared with conventional MRI. Image contrast is related to differences in the diffusion rate of water molecules rather than to changes in total tissue water. DWI can reveal pathology in cases where conventional MRI remains unremarkable. DWI has proven to be highly sensitive in the early detection of acute cerebral ischemia and seems promising in the evaluation of traumatic brain injury. DWI can differentiate between lesions with decreased and increased diffusion. In addition, full-tensor DWI can evaluate the microscopic architecture of the brain, in particular white matter tracts, by measuring the degree and spatial distribution of anisotropic diffusion within the brain. This article reviews the basic concepts of DWI and its application in cerebral ischemia and traumatic brain injury. (orig.)

Anisotropic rectangular metric for polygonal surface remeshing

KAUST Repository

Pellenard, Bertrand

2013-06-18

We propose a new method for anisotropic polygonal surface remeshing. Our algorithm takes as input a surface triangle mesh. An anisotropic rectangular metric, defined at each triangle facet of the input mesh, is derived from both a user-specified normal-based tolerance error and the requirement to favor rectangle-shaped polygons. Our algorithm uses a greedy optimization procedure that adds, deletes and relocates generators so as to match two criteria related to partitioning and conformity.

Anisotropic rectangular metric for polygonal surface remeshing

KAUST Repository

Pellenard, Bertrand; Morvan, Jean-Marie; Alliez, Pierre

2013-01-01

We propose a new method for anisotropic polygonal surface remeshing. Our algorithm takes as input a surface triangle mesh. An anisotropic rectangular metric, defined at each triangle facet of the input mesh, is derived from both a user-specified normal-based tolerance error and the requirement to favor rectangle-shaped polygons. Our algorithm uses a greedy optimization procedure that adds, deletes and relocates generators so as to match two criteria related to partitioning and conformity.

Temperature-Responsive Anisotropic Slippery Surface for Smart Control of the Droplet Motion.

Science.gov (United States)

Wang, By Lili; Heng, Liping; Jiang, Lei

2018-02-28

Development of stimulus-responsive anisotropic slippery surfaces is important because of the high demand for such materials in the field of liquid directional-driven systems. However, current studies in the field of slippery surfaces are mainly conducted to prepare isotropic slippery surfaces. Although we have developed electric-responsive anisotropic slippery surfaces that enable smart control of the droplet motion, there remain challenges for designing temperature-responsive anisotropic slippery surfaces to control the liquid droplet motion on the surface and in the tube. In this work, temperature-responsive anisotropic slippery surfaces have been prepared by using paraffin, a thermo-responsive phase-transition material, as a lubricating fluid and directional porous polystyrene (PS) films as the substrate. The smart regulation of the droplet motion of several liquids on this surface was accomplished by tuning the substrate temperature. The uniqueness of this surface lies in the use of an anisotropic structure and temperature-responsive lubricating fluids to achieve temperature-driven smart control of the anisotropic motion of the droplets. Furthermore, this surface was used to design temperature-driven anisotropic microreactors and to manipulate liquid transfer in tubes. This work advances the understanding of the principles underlying anisotropic slippery surfaces and provides a promising material for applications in the biochip and microreactor system.

Anisotropic wave-equation traveltime and waveform inversion

KAUST Repository

Feng, Shihang

2016-09-06

The wave-equation traveltime and waveform inversion (WTW) methodology is developed to invert for anisotropic parameters in a vertical transverse isotropic (VTI) meidum. The simultaneous inversion of anisotropic parameters v0, ε and δ is initially performed using the wave-equation traveltime inversion (WT) method. The WT tomograms are then used as starting background models for VTI full waveform inversion. Preliminary numerical tests on synthetic data demonstrate the feasibility of this method for multi-parameter inversion.

Anisotropic microporous supports impregnated with polymeric ion-exchange materials

Science.gov (United States)

Friesen, Dwayne; Babcock, Walter C.; Tuttle, Mark

1985-05-07

Novel ion-exchange media are disclosed, the media comprising polymeric anisotropic microporous supports containing polymeric ion-exchange or ion-complexing materials. The supports are anisotropic, having small exterior pores and larger interior pores, and are preferably in the form of beads, fibers and sheets.

Disadvantage factor for anisotropic scattering

International Nuclear Information System (INIS)

Saad, E.A.; Abdel Krim, M.S.; EL-Dimerdash, A.A.

1990-01-01

The invariant embedding method is used to solve the problem for a two region reactor with anisotropic scattering and to compute the disadvantage factor necessary for calculating some reactor parameters

First-principles investigation of diffusion and defect properties of Fe and Ni in Cr2O3

Science.gov (United States)

Rak, Zs.; Brenner, D. W.

2018-04-01

Diffusion of Fe and Ni and the energetics of Fe- and Ni-related defects in chromium oxide (α-Cr2O3) are investigated using first-principles Density Functional Theory calculations in combination with the climbing-image nudged elastic band method. The orientations of the spin magnetic moments of the migrating ions are taken into account and their effects on migration barriers are examined. Several possible diffusion pathways were explored through interstitial and vacancy mechanisms, and it was found that the principal mode of ion transport in Cr2O3 is via vacancies. Both interstitial- and vacancy-mediated diffusions are anisotropic, with diffusion being faster in the z-direction. The energetics of defect formation indicates that the Ni-related defects are less stable than the Fe-related ones. This is consistent with Ni-diffusion being faster than Fe-diffusion. The results are compared with previous theoretical and experimental data and possible implications in corrosion control are discussed.

Analytical modeling of pressure transient behavior for coalbed methane transport in anisotropic media

International Nuclear Information System (INIS)

Wang, Lei; Wang, Xiaodong

2014-01-01

Resulting from the nature of anisotropy of coal media, it is a meaningful work to evaluate pressure transient behavior and flow characteristics within coals. In this article, a complete analytical model called the elliptical flow model is established by combining the theory of elliptical flow in anisotropic media and Fick's laws about the diffusion of coalbed methane. To investigate pressure transient behavior, analytical solutions were first obtained through introducing a series of special functions (Mathieu functions), which are extremely complex and are hard to calculate. Thus, a computer program was developed to establish type curves, on which the effects of the parameters, including anisotropy coefficient, storage coefficient, transfer coefficient and rate constant, were analyzed in detail. Calculative results show that the existence of anisotropy would cause great pressure depletion. To validate new analytical solutions, previous results were used to compare with the new results. It is found that a better agreement between the solutions obtained in this work and the literature was achieved. Finally, a case study is used to explain the effects of the parameters, including rock total compressibility coefficient, coal medium porosity and anisotropic permeability, sorption time constant, Langmuir volume and fluid viscosity, on bottom-hole pressure behavior. It is necessary to coordinate these parameters so as to reduce the pressure depletion. (paper)

Casimir force in O(n) systems with a diffuse interface.

Science.gov (United States)

Dantchev, Daniel; Grüneberg, Daniel

2009-04-01

We study the behavior of the Casimir force in O(n) systems with a diffuse interface and slab geometry infinity;{d-1}xL , where 2system. We consider a system with nearest-neighbor anisotropic interaction constants J_{ parallel} parallel to the film and J_{ perpendicular} across it. We argue that in such an anisotropic system the Casimir force, the free energy, and the helicity modulus will differ from those of the corresponding isotropic system, even at the bulk critical temperature, despite that these systems both belong to the same universality class. We suggest a relation between the scaling functions pertinent to the both systems. Explicit exact analytical results for the scaling functions, as a function of the temperature T , of the free energy density, Casimir force, and the helicity modulus are derived for the n-->infinity limit of O(n) models with antiperiodic boundary conditions applied along the finite dimension L of the film. We observe that the Casimir amplitude Delta_{Casimir}(dmid R:J_{ perpendicular},J_{ parallel}) of the anisotropic d -dimensional system is related to that of the isotropic system Delta_{Casimir}(d) via Delta_{Casimir}(dmid R:J_{ perpendicular},J_{ parallel})=(J_{ perpendicular}J_{ parallel});{(d-1)2}Delta_{Casimir}(d) . For d=3 we derive the exact Casimir amplitude Delta_{Casimir}(3,mid R:J_{ perpendicular},J_{ parallel})=[Cl_{2}(pi3)3-zeta(3)(6pi)](J_{ perpendicular}J_{ parallel}) , as well as the exact scaling functions of the Casimir force and of the helicity modulus Upsilon(T,L) . We obtain that beta_{c}Upsilon(T_{c},L)=(2pi;{2})[Cl_{2}(pi3)3+7zeta(3)(30pi)](J_{ perpendicular}J_{ parallel})L;{-1} , where T_{c} is the critical temperature of the bulk system. We find that the contributions in the excess free energy due to the existence of a diffuse interface result in a repulsive Casimir force in the whole temperature region.

Uranium nitride: a cubic antiferromagnet with anisotropic critical behavior

International Nuclear Information System (INIS)

Buyers, W.J.L.; Holden, T.M.; Svensson, E.C.; Lander, G.H.

1977-11-01

Highly anisotropic critical scattering associated with the transition at T/sub N/ = 49.5 K to the type-I antiferromagnetic structure has been observed in uranium nitride. The transverse susceptibility is found to be unobservably small. The longitudinal susceptibility diverges at T/sub N/ and its anisotropy shows that the spins within the (001) ferromagnetic sheets of the [001] domain are much more highly correlated than they are with the spins lying in adjacent (001) sheets. The correlation range within the sheets is much greater than that expected for a Heisenberg system with the same T/sub N/. The rod-like scattering extended along the spin and domain direction is reminiscent of two-dimensional behavior. The results are inconsistent with a simple localized model and may reflect the itinerant nature of the 5f electrons

Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

International Nuclear Information System (INIS)

Posadillo, R.; Lopez Luque, R.

2009-01-01

The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

Predicting patterns of glioma recurrence using diffusion tensor imaging

International Nuclear Information System (INIS)

Price, Stephen J.; Pickard, John D.; Jena, Rajesh; Burnet, Neil G.; Carpenter, T.A.; Gillard, Jonathan H.

2007-01-01

Although multimodality therapy for high-grade gliomas is making some improvement in outcome, most patients will still die from their disease within a short time. We need tools that allow treatments to be tailored to an individual. In this study we used diffusion tensor imaging (DTI), a technique sensitive to subtle disruption of white-matter tracts due to tumour infiltration, to see if it can be used to predict patterns of glioma recurrence. In this study we imaged 26 patients with gliomas using DTI. Patients were imaged after 2 years or on symptomatic tumour recurrence. The diffusion tensor was split into its isotropic (p) and anisotropic (q) components, and these were plotted on T 2 -weighted images to show the pattern of DTI abnormality. This was compared to the pattern of recurrence. Three DTI patterns could be identified: (a) a diffuse pattern of abnormality where p exceeded q in all directions and was associated with diffuse increase in tumour size; (b) a localised pattern of abnormality where the tumour recurred in one particular direction; and (c) a pattern of minimal abnormality seen in some patients with or without evidence of recurrence. Diffusion tensor imaging is able to predict patterns of tumour recurrence and may allow better individualisation of tumour management and stratification for randomised controlled trials. (orig.)

Predicting patterns of glioma recurrence using diffusion tensor imaging

Energy Technology Data Exchange (ETDEWEB)

Price, Stephen J.; Pickard, John D. [University of Cambridge and Cambridge University Hospitals NHS Foundation Trust, Addenbrooke' s Hospital, Academic Neurosurgery Unit (United Kingdom); University of Cambridge and Cambridge University Hospitals NHS Foundation Trust, Addenbrooke' s Hospital, Wolfson Brain Imaging Centre, Department of Clinical Neurosciences (United Kingdom); Jena, Rajesh; Burnet, Neil G. [University of Cambridge and Cambridge University Hospitals NHS Foundation Trust, Addenbrooke' s Hospital, University Department of Oncology (United Kingdom); Carpenter, T.A. [University of Cambridge and Cambridge University Hospitals NHS Foundation Trust, Addenbrooke' s Hospital, Wolfson Brain Imaging Centre, Department of Clinical Neurosciences (United Kingdom); Gillard, Jonathan H. [University of Cambridge and Cambridge University Hospitals NHS Foundation Trust, Addenbrooke' s Hospital, University Department of Radiology (United Kingdom)

2007-07-15

Although multimodality therapy for high-grade gliomas is making some improvement in outcome, most patients will still die from their disease within a short time. We need tools that allow treatments to be tailored to an individual. In this study we used diffusion tensor imaging (DTI), a technique sensitive to subtle disruption of white-matter tracts due to tumour infiltration, to see if it can be used to predict patterns of glioma recurrence. In this study we imaged 26 patients with gliomas using DTI. Patients were imaged after 2 years or on symptomatic tumour recurrence. The diffusion tensor was split into its isotropic (p) and anisotropic (q) components, and these were plotted on T{sub 2}-weighted images to show the pattern of DTI abnormality. This was compared to the pattern of recurrence. Three DTI patterns could be identified: (a) a diffuse pattern of abnormality where p exceeded q in all directions and was associated with diffuse increase in tumour size; (b) a localised pattern of abnormality where the tumour recurred in one particular direction; and (c) a pattern of minimal abnormality seen in some patients with or without evidence of recurrence. Diffusion tensor imaging is able to predict patterns of tumour recurrence and may allow better individualisation of tumour management and stratification for randomised controlled trials. (orig.)

Chiral magnetic effect in the anisotropic quark-gluon plasma

International Nuclear Information System (INIS)

Ali-Akbari, Mohammad; Taghavi, Seyed Farid

2015-01-01

An anisotropic thermal plasma phase of a strongly coupled gauge theory can be holographically modelled by an anisotropic AdS black hole. The temperature and anisotropy parameter of the AdS black hole background of interest http://dx.doi.org/10.1007/JHEP07(2011)054 is specified by the location of the horizon and the value of the Dilaton field at the horizon. Interestingly, for the first time, we obtain two functions for the values of the horizon and Dilaton field in terms of the temperature and anisotropy parameter. Then by introducing a number of spinning probe D7-branes in the anisotropic background, we compute the value of the chiral magnetic effect (CME). We observe that in the isotropic and anisotropic plasma the value of the CME is equal for the massless quarks. However, at fixed temperature, raising the anisotropy in the system will increase the value of the CME for the massive quarks.

Modelling of anisotropic compact stars of embedding class one

Energy Technology Data Exchange (ETDEWEB)

Bhar, Piyali [Government General Degree College, Department of Mathematics, Singur, Hooghly, West Bengal (India); Maurya, S.K. [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman); Gupta, Y.K. [Raj Kumar Goel Institute of Technology, Department of Mathematics, Ghaziabad, U.P. (India); Manna, Tuhina [St. Xavier' s College, Department of Commerce (Evening), Kolkata, West Bengal (India)

2016-10-15

In the present article, we have constructed static anisotropic compact star models of Einstein field equations for the spherical symmetric metric of embedding class one. By assuming the particular form of the metric function ν, we have solved the Einstein field equations for anisotropic matter distribution. The anisotropic models represent the realistic compact objects such as SAX J 1808.4-3658 (SS1), Her X-1, Vela X-12, PSR J1614-2230 and Cen X-3. We have reported our results in details for the compact star Her X-1 on the ground of physical properties such as pressure, density, velocity of sound, energy conditions, TOV equation and red-shift etc. Along with these, we have also discussed about the stability of the compact star models. Finally we made a comparison between our anisotropic stars with the realistic objects on the key aspects as central density, central pressure, compactness and surface red-shift. (orig.)

Microseismic Full Waveform Modeling in Anisotropic Media with Moment Tensor Implementation

Science.gov (United States)

Shi, Peidong; Angus, Doug; Nowacki, Andy; Yuan, Sanyi; Wang, Yanyan

2018-03-01

Seismic anisotropy which is common in shale and fractured rocks will cause travel-time and amplitude discrepancy in different propagation directions. For microseismic monitoring which is often implemented in shale or fractured rocks, seismic anisotropy needs to be carefully accounted for in source location and mechanism determination. We have developed an efficient finite-difference full waveform modeling tool with an arbitrary moment tensor source. The modeling tool is suitable for simulating wave propagation in anisotropic media for microseismic monitoring. As both dislocation and non-double-couple source are often observed in microseismic monitoring, an arbitrary moment tensor source is implemented in our forward modeling tool. The increments of shear stress are equally distributed on the staggered grid to implement an accurate and symmetric moment tensor source. Our modeling tool provides an efficient way to obtain the Green's function in anisotropic media, which is the key of anisotropic moment tensor inversion and source mechanism characterization in microseismic monitoring. In our research, wavefields in anisotropic media have been carefully simulated and analyzed in both surface array and downhole array. The variation characteristics of travel-time and amplitude of direct P- and S-wave in vertical transverse isotropic media and horizontal transverse isotropic media are distinct, thus providing a feasible way to distinguish and identify the anisotropic type of the subsurface. Analyzing the travel-times and amplitudes of the microseismic data is a feasible way to estimate the orientation and density of the induced cracks in hydraulic fracturing. Our anisotropic modeling tool can be used to generate and analyze microseismic full wavefield with full moment tensor source in anisotropic media, which can help promote the anisotropic interpretation and inversion of field data.

Thermodynamic analysis on an anisotropically superhydrophobic surface with a hierarchical structure

Energy Technology Data Exchange (ETDEWEB)

Zhao, Jieliang [Division of Intelligent and Biomechanical Systems, State Key Laboratory of Tribology, Tsinghua University, Room 3407, Building 9003, 100084 Beijing (China); Su, Zhengliang [Division of Intelligent and Biomechanical Systems, State Key Laboratory of Tribology, Tsinghua University, Room 3407, Building 9003, 100084 Beijing (China); Department of Automotive Engineering, Tsinghua University, Beijing 100084 (China); Yan, Shaoze, E-mail: yansz@mail.tsinghua.edu.cn [Division of Intelligent and Biomechanical Systems, State Key Laboratory of Tribology, Tsinghua University, Room 3407, Building 9003, 100084 Beijing (China)

2015-12-01

Graphical abstract: - Highlights: • We model the superhydrophobic surface with anisotropic and hierarchical structure. • Anisotropic wetting only shows in noncomposite state (not in composite state). • Transition from noncomposite to composite state on dual-scale structure is hard. • Droplets tend to roll in the particular direction. • Droplets tend to stably remain in one preferred thermodynamic state. - Abstract: Superhydrophobic surfaces, which refer to the surfaces with contact angle higher than 150° and hysteresis less than 10°, have been reported in various studies. However, studies on the superhydrophobicity of anisotropic, hierarchical surfaces are limited and the corresponding thermodynamic mechanisms could not be explained thoroughly. Here we propose a simplified surface model of anisotropic patterned surface with dual scale roughness. Based on the thermodynamic method, we calculate the equilibrium contact angle (ECA) and the contact angle hysteresis (CAH) on the given surface. We show here that the hierarchical structure has much better anisotropic wetting properties than the single-scale one, and the results shed light on the potential application in controllable micro-/nano-fluidic systems. Our studies can be potentially applied for the fabrication of anisotropically superhydrophobic surfaces.

Thermodynamic analysis on an anisotropically superhydrophobic surface with a hierarchical structure

International Nuclear Information System (INIS)

Zhao, Jieliang; Su, Zhengliang; Yan, Shaoze

2015-01-01

Graphical abstract: - Highlights: • We model the superhydrophobic surface with anisotropic and hierarchical structure. • Anisotropic wetting only shows in noncomposite state (not in composite state). • Transition from noncomposite to composite state on dual-scale structure is hard. • Droplets tend to roll in the particular direction. • Droplets tend to stably remain in one preferred thermodynamic state. - Abstract: Superhydrophobic surfaces, which refer to the surfaces with contact angle higher than 150° and hysteresis less than 10°, have been reported in various studies. However, studies on the superhydrophobicity of anisotropic, hierarchical surfaces are limited and the corresponding thermodynamic mechanisms could not be explained thoroughly. Here we propose a simplified surface model of anisotropic patterned surface with dual scale roughness. Based on the thermodynamic method, we calculate the equilibrium contact angle (ECA) and the contact angle hysteresis (CAH) on the given surface. We show here that the hierarchical structure has much better anisotropic wetting properties than the single-scale one, and the results shed light on the potential application in controllable micro-/nano-fluidic systems. Our studies can be potentially applied for the fabrication of anisotropically superhydrophobic surfaces.

Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

International Nuclear Information System (INIS)

Liao Ruijin; Zhu Mengzhao; Yang Lijun; Zhou Xin; Gong Chunyan

2011-01-01

Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

Energy Technology Data Exchange (ETDEWEB)

Liao Ruijin [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Zhu Mengzhao, E-mail: xiaozhupost@163.co [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Yang Lijun; Zhou Xin; Gong Chunyan [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China)

2011-03-01

Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

Anisotropic Concrete Compressive Strength

DEFF Research Database (Denmark)

Gustenhoff Hansen, Søren; Jørgensen, Henrik Brøner; Hoang, Linh Cao

2017-01-01

When the load carrying capacity of existing concrete structures is (re-)assessed it is often based on compressive strength of cores drilled out from the structure. Existing studies show that the core compressive strength is anisotropic; i.e. it depends on whether the cores are drilled parallel...

Hydrodynamic cavitation in Stokes flow of anisotropic fluids

OpenAIRE

Stieger, Tillmann; Agha, Hakam; Schoen, Martin; Mazza, Marco G.; Sengupta, Anupam

2017-01-01

Cavitation, the nucleation of vapour in liquids, is ubiquitous in fluid dynamics, and is often implicated in a myriad of industrial and biomedical applications. Although extensively studied in isotropic liquids, corresponding investigations in anisotropic liquids are largely lacking. Here, by combining liquid crystal microfluidic experiments, nonequilibrium molecular dynamics simulations and theoretical arguments, we report flow-induced cavitation in an anisotropic fluid. The cavitation domai...

Diffusion of graphite. The effect of cylindrical canals

International Nuclear Information System (INIS)

Carle, R.; Clouet d'Orval, C.; Martelly, J.; Mazancourt, T. de; Sagot, M.; Lattes, R.; Teste du Bailler, A.

1957-01-01

Experiments on thermal neutron diffusion in the graphite used as moderator in the pile G1 have been carried out. The object of these experiments is to determine: - the intrinsic quality of this graphite, characterised by its diffusion length L or its Laplacian 1/L 2 - the effect of the canals, which modifies anisotropically the macroscopic diffusion equation and is characterized by two principal diffusion regions (or two principal Laplacian), valid respectively for the diffusion in the direction of the canals and in a perpendicular direction. In order to determine them two experiments are necessary, in which the second derivatives of the flux in relation to the space coordinates are very different. These experiments form the object of the first two parts. Part 1: Diffusion along the axis of a flux coming from the pile source, and limited radially by a quasi cylindrical screen of cadmium bars. This screen, or Faraday cage is designed to give to the thermal flux produced the same radius of extrapolation to zero as that of the pile source. The determination of L (with the graphite full) has been made under the same conditions. The measurements have been interpreted in two ways. The influence of the brackets holding the detectors is discussed. Part 2: Radial diffusion in the graphite surrounding the 'long' cylindrical pile. This is well described by a sum of Bessel functions. Part 3: Results (valid for d = 1.61 t = 17 deg. C). For the graphite without cavity L = 52.7 ± 0.4 cm. The effect of the canals on the diffusion area and its anisotropy are in excellent agreement with the theory of Behrens: L(parallel) = 64.6 cm and L(perpendicular) 62.2 cm. Appendix: Theory of the Faraday cage. (author) [fr

Effects of anisotropic diffusion and finite island sizes in homoepitaxial growth Pt on Pt(100)-hex

DEFF Research Database (Denmark)

Mortensen, Jens Jørgen; Linderoth, T.R.; Jacobsen, Karsten Wedel

1998-01-01

coverage regime. have been determined for substrate temperatures in the range T = 318-497 K and adatom deposition rates from R=4 x 10(-5) to 7 x 10(-3) site(-1) s(-1). The measurements are compared to the results of kinetic Monte Carlo (KMC) simulations and rate equation theory. The Pt(100)-hex surface...... exhibits a height modulation caused by the misfit between the topmost quasi-hexagonal layer and the quadratic substrate. resulting in a highly anisotropic large scale surface morphology with six-atom wide channels running along the [1(1) over bar0$] direction. From an autocorrelation analysis...... channels. Rate equations incorporating this effect are solved, and a scaling exponent of chi=1/3 is derived in contrast to the chi=1/4 obtained for a 1-D point-island model. (C) 1998 Elsevier Science B.V....

Anisotropic surface chemistry properties and adsorption behavior of silicate mineral crystals.

Science.gov (United States)

Xu, Longhua; Tian, Jia; Wu, Houqin; Fang, Shuai; Lu, Zhongyuan; Ma, Caifeng; Sun, Wei; Hu, Yuehua

2018-03-07

Anisotropic surface properties of minerals play an important role in a variety of fields. With a focus on the two most intensively investigated silicate minerals (i.e., phyllosilicate minerals and pegmatite aluminosilicate minerals), this review highlights the research on their anisotropic surface properties based on their crystal structures. Four surface features comprise the anisotropic surface chemistry of minerals: broken bonds, energy, wettability, and charge. Analysis of surface broken bond and energy anisotropy helps to explain the cleavage and growth properties of mineral crystals, and understanding surface wettability and charge anisotropy is critical to the analysis of minerals' solution behavior, such as their flotation performance and rheological properties. In a specific reaction, the anisotropic surface properties of minerals are reflected in the adsorption strengths of reagents on different mineral surfaces. Combined with the knowledge of mineral crushing and grinding, a thorough understanding of the anisotropic surface chemistry properties and the anisotropic adsorption behavior of minerals will lead to the development of effective relational models comprising their crystal structure, surface chemistry properties, and targeted reagent adsorption. Overall, such a comprehensive approach is expected to firmly establish the connection between selective cleavage of mineral crystals for desired surfaces and designing novel reagents selectively adsorbed on the mineral surfaces. As tools to characterize the anisotropic surface chemistry properties of minerals, DLVO theory, atomic force microscopy (AFM), and molecular dynamics (MD) simulations are also reviewed. Copyright © 2017 Elsevier B.V. All rights reserved.

Acoustic anisotropic wavefields through perturbation theory

KAUST Repository

Alkhalifah, Tariq Ali

2013-09-01

Solving the anisotropic acoustic wave equation numerically using finite-difference methods introduces many problems and media restriction requirements, and it rarely contributes to the ability to resolve the anisotropy parameters. Among these restrictions are the inability to handle media with η<0 and the presence of shear-wave artifacts in the solution. Both limitations do not exist in the solution of the elliptical anisotropic acoustic wave equation. Using perturbation theory in developing the solution of the anisotropic acoustic wave equation allows direct access to the desired limitation-free solutions, that is, solutions perturbed from the elliptical anisotropic background medium. It also provides a platform for parameter estimation because of the ability to isolate the wavefield dependency on the perturbed anisotropy parameters. As a result, I derive partial differential equations that relate changes in the wavefield to perturbations in the anisotropy parameters. The solutions of the perturbation equations represented the coefficients of a Taylor-series-type expansion of the wavefield as a function of the perturbed parameter, which is in this case η or the tilt of the symmetry axis. The expansion with respect to the symmetry axis allows use of an acoustic transversely isotropic media with a vertical symmetry axis (VTI) kernel to estimate the background wavefield and the corresponding perturbation coefficients. The VTI extrapolation kernel is about one-fourth the cost of the transversely isotropic model with a tilt in the symmetry axis kernel. Thus, for a small symmetry axis tilt, the cost of migration using a first-order expansion can be reduced. The effectiveness of the approach was demonstrated on the Marmousi model.

Bryan's effect and anisotropic nonlinear damping

Science.gov (United States)

Joubert, Stephan V.; Shatalov, Michael Y.; Fay, Temple H.; Manzhirov, Alexander V.

2018-03-01

In 1890, G. H. Bryan discovered the following: "The vibration pattern of a revolving cylinder or bell revolves at a rate proportional to the inertial rotation rate of the cylinder or bell." We call this phenomenon Bryan's law or Bryan's effect. It is well known that any imperfections in a vibratory gyroscope (VG) affect Bryan's law and this affects the accuracy of the VG. Consequently, in this paper, we assume that all such imperfections are either minimised or eliminated by some known control method and that only damping is present within the VG. If the damping is isotropic (linear or nonlinear), then it has been recently demonstrated in this journal, using symbolic analysis, that Bryan's law remains invariant. However, it is known that linear anisotropic damping does affect Bryan's law. In this paper, we generalise Rayleigh's dissipation function so that anisotropic nonlinear damping may be introduced into the equations of motion. Using a mixture of numeric and symbolic analysis on the ODEs of motion of the VG, for anisotropic light nonlinear damping, we demonstrate (up to an approximate average), that Bryan's law is affected by any form of such damping, causing pattern drift, compromising the accuracy of the VG.

Anisotropic hydrodynamics for conformal Gubser flow

Energy Technology Data Exchange (ETDEWEB)

Strickland, Michael; Nopoush, Mohammad [Kent State University, Kent OH 44242 (United States); Ryblewski, Radoslaw [The H. Niewodniczański Institute of Nuclear Physics, Polish Academy of Sciences, PL-31342 Kraków (Poland)

2016-12-15

In this proceedings contribution, we review the exact solution of the anisotropic hydrodynamics equations for a system subject to Gubser flow. For this purpose, we use the leading-order anisotropic hydrodynamics equations which assume that the distribution function is ellipsoidally symmetric in local-rest-frame momentum. We then prove that the SO(3){sub q} symmetry in de Sitter space constrains the anisotropy tensor to be of spheroidal form with only one independent anisotropy parameter remaining. As a consequence, the exact solution reduces to the problem of solving two coupled non-linear differential equations. We show that, in the limit that the relaxation time goes to zero, one obtains Gubser's ideal hydrodynamic solution and, in the limit that the relaxation time goes to infinity, one obtains the exact free streaming solution obtained originally by Denicol et al. For finite relaxation time, we solve the equations numerically and compare to the exact solution of the relaxation-time-approximation Boltzmann equation subject to Gubser flow. Using this as our standard, we find that anisotropic hydrodynamics describes the spatio-temporal evolution of the system better than all currently known dissipative hydrodynamics approaches.

Anisotropic hydrodynamics for conformal Gubser flow

International Nuclear Information System (INIS)

Strickland, Michael; Nopoush, Mohammad; Ryblewski, Radoslaw

2016-01-01

In this proceedings contribution, we review the exact solution of the anisotropic hydrodynamics equations for a system subject to Gubser flow. For this purpose, we use the leading-order anisotropic hydrodynamics equations which assume that the distribution function is ellipsoidally symmetric in local-rest-frame momentum. We then prove that the SO(3)_q symmetry in de Sitter space constrains the anisotropy tensor to be of spheroidal form with only one independent anisotropy parameter remaining. As a consequence, the exact solution reduces to the problem of solving two coupled non-linear differential equations. We show that, in the limit that the relaxation time goes to zero, one obtains Gubser's ideal hydrodynamic solution and, in the limit that the relaxation time goes to infinity, one obtains the exact free streaming solution obtained originally by Denicol et al. For finite relaxation time, we solve the equations numerically and compare to the exact solution of the relaxation-time-approximation Boltzmann equation subject to Gubser flow. Using this as our standard, we find that anisotropic hydrodynamics describes the spatio-temporal evolution of the system better than all currently known dissipative hydrodynamics approaches.

Temperature-dependent anisotropic magnetoresistance inversion behaviors in Fe{sub 3}O{sub 4} films

Energy Technology Data Exchange (ETDEWEB)

Yoon, Kap Soo [Novel Functional Materials and Devices Lab, The Research Institute for Natural Science, Department of Physics, Hanyang University, Seoul 133-791 (Korea, Republic of); Hong, Jin Pyo, E-mail: jphong@hanyang.ac.kr [Novel Functional Materials and Devices Lab, The Research Institute for Natural Science, Department of Physics, Hanyang University, Seoul 133-791 (Korea, Republic of); Division of Nano-Scale Semiconductor Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of)

2017-02-01

We address the abnormal anisotropic magnetoresistance (AMR) reversal feature of half-metallic polycrystalline Fe{sub 3}O{sub 4} films occurring at a specific temperature. Experimental results revealed a positive to negative MR transition in the Fe{sub 3}O{sub 4} films at 264 K, which reflect the influence of additional domain wall scattering. These features was described by a correlation between domain wall resistance and inversion behavior of AMR with additional domain wall scattering factors. We further describe a possible model based on systematic structural and electrical measurements that employs a temperature-dependent domain wall width and spin diffusion length of the conducting electrons. This model allows for spin-flipping scattering of spin polarized electrons inside a proper domain width.

Methods for high-resolution anisotropic finite element modeling of the human head: automatic MR white matter anisotropy-adaptive mesh generation.

Science.gov (United States)

Lee, Won Hee; Kim, Tae-Seong

2012-01-01

This study proposes an advanced finite element (FE) head modeling technique through which high-resolution FE meshes adaptive to the degree of tissue anisotropy can be generated. Our adaptive meshing scheme (called wMesh) uses MRI structural information and fractional anisotropy maps derived from diffusion tensors in the FE mesh generation process, optimally reflecting electrical properties of the human brain. We examined the characteristics of the wMeshes through various qualitative and quantitative comparisons to the conventional FE regular-sized meshes that are non-adaptive to the degree of white matter anisotropy. We investigated numerical differences in the FE forward solutions that include the electrical potential and current density generated by current sources in the brain. The quantitative difference was calculated by two statistical measures of relative difference measure (RDM) and magnification factor (MAG). The results show that the wMeshes are adaptive to the anisotropic density of the WM anisotropy, and they better reflect the density and directionality of tissue conductivity anisotropy. Our comparison results between various anisotropic regular mesh and wMesh models show that there are substantial differences in the EEG forward solutions in the brain (up to RDM=0.48 and MAG=0.63 in the electrical potential, and RDM=0.65 and MAG=0.52 in the current density). Our analysis results indicate that the wMeshes produce different forward solutions that are different from the conventional regular meshes. We present some results that the wMesh head modeling approach enhances the sensitivity and accuracy of the FE solutions at the interfaces or in the regions where the anisotropic conductivities change sharply or their directional changes are complex. The fully automatic wMesh generation technique should be useful for modeling an individual-specific and high-resolution anisotropic FE head model incorporating realistic anisotropic conductivity distributions

Textile-templated electrospun anisotropic scaffolds for regenerative cardiac tissue engineering.

Science.gov (United States)

Şenel Ayaz, H Gözde; Perets, Anat; Ayaz, Hasan; Gilroy, Kyle D; Govindaraj, Muthu; Brookstein, David; Lelkes, Peter I

2014-10-01

For patients with end-stage heart disease, the access to heart transplantation is limited due to the shortage of donor organs and to the potential for rejection of the donated organ. Therefore, current studies focus on bioengineering approaches for creating biomimetic cardiac patches that will assist in restoring cardiac function, by repairing and/or regenerating the intrinsically anisotropic myocardium. In this paper we present a simplified, straightforward approach for creating bioactive anisotropic cardiac patches, based on a combination of bioengineering and textile-manufacturing techniques in concert with nano-biotechnology based tissue-engineering stratagems. Using knitted conventional textiles, made of cotton or polyester yarns as template targets, we successfully electrospun anisotropic three-dimensional scaffolds from poly(lactic-co-glycolic) acid (PLGA), and thermoplastic polycarbonate-urethane (PCU, Bionate(®)). The surface topography and mechanical properties of textile-templated anisotropic scaffolds significantly differed from those of scaffolds electrospun from the same materials onto conventional 2-D flat-target electrospun scaffolds. Anisotropic textile-templated scaffolds electrospun from both PLGA and PCU, supported the adhesion and proliferation of H9C2 cardiac myoblasts cell line, and guided the cardiac tissue-like anisotropic organization of these cells in vitro. All cell-seeded PCU scaffolds exhibited mechanical properties comparable to those of a human heart, but only the cells on the polyester-templated scaffolds exhibited prolonged spontaneous synchronous contractility on the entire engineered construct for 10 days in vitro at a near physiologic frequency of ∼120 bpm. Taken together, the methods described here take advantage of straightforward established textile manufacturing strategies as an efficient and cost-effective approach to engineering 3D anisotropic, elastomeric PCU scaffolds that can serve as a cardiac patch. Copyright �

Dynamics of wave packets in two-dimensional random systems with anisotropic disorder.

Science.gov (United States)

Samelsohn, Gregory; Gruzdev, Eugene

2008-09-01

A theoretical model is proposed to describe narrowband pulse dynamics in two-dimensional systems with arbitrary correlated disorder. In anisotropic systems with elongated cigarlike inhomogeneities, fast propagation is predicted in the direction across the structure where the wave is exponentially localized and tunneling of evanescent modes plays a dominant role in typical realizations. Along the structure, where the wave is channeled as in a waveguide, the motion of the wave energy is relatively slow. Numerical simulations performed for ultra-wide-band pulses show that even at the initial stage of wave evolution, the radiation diffuses predominantly in the direction along the major axis of the correlation ellipse. Spectral analysis of the results relates the long tail of the wave observed in the transverse direction to a number of frequency domain "lucky shots" associated with the long-living resonant modes localized inside the sample.

Anisotropic, Mixed-Norm Lizorkin-Triebel Spaces and Diffeomorphic Maps

DEFF Research Database (Denmark)

Johnsen, Jon; Hansen, Sabrina Munch; Sickel, Winfried

2014-01-01

This paper gives general results on invariance of anisotropic Lizorkin-Triebel spaces with mixed norms under coordinate transformations on Euclidean space, open sets, and cylindrical domains.......This paper gives general results on invariance of anisotropic Lizorkin-Triebel spaces with mixed norms under coordinate transformations on Euclidean space, open sets, and cylindrical domains....

Anisotropically Swelling Gels Attained through Axis-Dependent Crosslinking of MOF Crystals.

Science.gov (United States)

Ishiwata, Takumi; Kokado, Kenta; Sada, Kazuki

2017-03-01

Anisotropically deforming objects have attracted considerable interest for use in molecular machines and artificial muscles. Herein, we focus on a new approach based on the crystal crosslinking of organic ligands in a pillared-layer metal-organic framework (PLMOF). The approach involves the transformation from crosslinked PLMOF to polymer gels through hydrolysis of the coordination bonds between the organic ligands and metal ions, giving a network polymer that exhibits anisotropic swelling. The anisotropic monomer arrangement in the PLMOF underwent axis-dependent crosslinking to yield anisotropically swelling gels. Therefore, the crystal crosslinking of MOFs should be a useful method for creating actuators with designable deformation properties. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The anisotropic Ising correlations as elliptic integrals: duality and differential equations

International Nuclear Information System (INIS)

McCoy, B M; Maillard, J-M

2016-01-01

We present the reduction of the correlation functions of the Ising model on the anisotropic square lattice to complete elliptic integrals of the first, second and third kind, the extension of Kramers–Wannier duality to anisotropic correlation functions, and the linear differential equations for these anisotropic correlations. More precisely, we show that the anisotropic correlation functions are homogeneous polynomials of the complete elliptic integrals of the first, second and third kind. We give the exact dual transformation matching the correlation functions and the dual correlation functions. We show that the linear differential operators annihilating the general two-point correlation functions are factorized in a very simple way, in operators of decreasing orders. (paper)

Hybrid localized waves supported by resonant anisotropic metasurfaces

DEFF Research Database (Denmark)

Bogdanov, A. A.; Yermakov, O. Y.; Ovcharenko, A. I.

2016-01-01

We study both theoretically and experimentally a new class of surface electromagnetic waves supported by resonant anisotropic metasurface. At certain frequency this type of metasurface demonstrates the topological transition from elliptical to hyperbolic regime.......We study both theoretically and experimentally a new class of surface electromagnetic waves supported by resonant anisotropic metasurface. At certain frequency this type of metasurface demonstrates the topological transition from elliptical to hyperbolic regime....

Theory and simulation of time-fractional fluid diffusion in porous media

International Nuclear Information System (INIS)

Carcione, José M; Sanchez-Sesma, Francisco J; Gavilán, Juan J Perez; Luzón, Francisco

2013-01-01

We simulate a fluid flow in inhomogeneous anisotropic porous media using a time-fractional diffusion equation and the staggered Fourier pseudospectral method to compute the spatial derivatives. A fractional derivative of the order of 0 < ν < 2 replaces the first-order time derivative in the classical diffusion equation. It implies a time-dependent permeability tensor having a power-law time dependence, which describes memory effects and accounts for anomalous diffusion. We provide a complete analysis of the physics based on plane waves. The concepts of phase, group and energy velocities are analyzed to describe the location of the diffusion front, and the attenuation and quality factors are obtained to quantify the amplitude decay. We also obtain the frequency-domain Green function. The time derivative is computed with the Grünwald–Letnikov summation, which is a finite-difference generalization of the standard finite-difference operator to derivatives of fractional order. The results match the analytical solution obtained from the Green function. An example of the pressure field generated by a fluid injection in a heterogeneous sandstone illustrates the performance of the algorithm for different values of ν. The calculation requires storing the whole pressure field in the computer memory since anomalous diffusion ‘recalls the past’. (paper)

Effect of uniaxial strain on adatom diffusion across {l_brace}1 1 1{r_brace}-faceted step

Energy Technology Data Exchange (ETDEWEB)

Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.cn [Department of Maths and Physics, Hunan Institute of Engineering, Donghu Street, Xiangtan 411104 (China); Hu Wangyu, E-mail: Wangyuhu2001@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Tang Jianfeng [Department of Applied Physics, Hunan Agricultural University, Changsha 410128 (China)

2011-02-01

Diffusion of Pt adatom across the strained {l_brace}1 1 1{r_brace}-faceted step is studied by embedded atom method along with nudged elastic band method. For adatom on the flat (1 1 1) surface, the anisotropic diffusion behavior is found as the uniaxial strain is imposed. For the strained {l_brace}1 1 1{r_brace}-faceted step, our results show that the maximum energy barrier for adatom crossing step edge remains approximately constant as the strain varied from -1.0% to 1.0%, and there is a rise as the larger uniaxial strain is applied. The calculated energy barrier for adatom diffusion along the step edge increases with increasing tensile strain, and the slope of the straight line is small.

Giant anisotropic magnetoresistance in a quantum anomalous Hall insulator

Science.gov (United States)

Kandala, Abhinav; Richardella, Anthony; Kempinger, Susan; Liu, Chao-Xing; Samarth, Nitin

2015-01-01

When a three-dimensional ferromagnetic topological insulator thin film is magnetized out-of-plane, conduction ideally occurs through dissipationless, one-dimensional (1D) chiral states that are characterized by a quantized, zero-field Hall conductance. The recent realization of this phenomenon, the quantum anomalous Hall effect, provides a conceptually new platform for studies of 1D transport, distinct from the traditionally studied quantum Hall effects that arise from Landau level formation. An important question arises in this context: how do these 1D edge states evolve as the magnetization is changed from out-of-plane to in-plane? We examine this question by studying the field-tilt-driven crossover from predominantly edge-state transport to diffusive transport in Crx(Bi,Sb)2−xTe3 thin films. This crossover manifests itself in a giant, electrically tunable anisotropic magnetoresistance that we explain by employing a Landauer–Büttiker formalism. Our methodology provides a powerful means of quantifying dissipative effects in temperature and chemical potential regimes far from perfect quantization. PMID:26151318

Investigation of altered microstructure in patients with drug refractory epilepsy using diffusion tensor imaging

Energy Technology Data Exchange (ETDEWEB)

Jiang, Yuwei; Yan, Xu; Fan, Mingxia [East China Normal University, Key Laboratory of Magnetic Resonance, Shanghai (China); Mao, Lingyan; Wang, Xin; Ding, Jing [Fudan University, Department of Neurology, Zhongshan Hospital, Shanghai (China); Xu, Dongrong [Columbia University and New York State Psychiatric Institute, MRI Unit/Epidemiology Division, Department of Psychiatry, New York, NY (United States)

2017-06-15

The risk of refractory epilepsy can be more dangerous than the adverse effect caused by medical treatment. In this study, we employed voxel-wise analysis (VWA) and tract-based spatial statistics (TBSS) methods to measure microstructural changes using diffusion tensor imaging (DTI) in patients of drug refractory epilepsy (DRE) who had been epileptic for more than 10 years. To examine the specific microstructural abnormalities in DRE patients and its difference from medically controlled epilepsy (MCE), we acquired DTI data of 7 DRE patients, 37 MCE patients, and 31 healthy controls (HCs) using a 3 T MRI scanner. Comparisons between epileptic patients and HCs between MCE and DRE patients were performed based on calculated diffusion anisotropic indices data using VWA and TBSS. Compared to HCs, epileptic patients (including MCE and DRE) showed significant DTI changes in the common affected regions based on VWA, whereas TBSS found that widespread DTI changes in parts of microstructures of bilateral hemispheres were more obvious in the DRE patients than that in the MCE patients when compared with HCs. In contrast, significant reduction of fractional anisotropy values of thalamo-cortical fibers, including left superior temporal gyrus, insular cortex, pre-/post-central gyri, and thalamus, were further found in DRE patients compared with MCE. The results of multiple diffusion anisotropic indices data provide complementary information to understand the dysfunction of thalamo-cortical pathway in DRE patients, which may be contributors to disorder of language and motor functions. Our current study may shed light on the pathophysiology of DRE. (orig.)

A new model for spherically symmetric anisotropic compact star

Energy Technology Data Exchange (ETDEWEB)

Maurya, S.K.; Dayanandan, Baiju [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman); Gupta, Y.K. [Raj Kumar Goel Institute of Technology, Department of Mathematics, Ghaziabad, UP (India); Ray, Saibal [Government College of Engineering and Ceramic Technology, Department of Physics, Kolkata, West Bengal (India)

2016-05-15

In this article we obtain a new anisotropic solution for Einstein's field equations of embedding class one metric. The solution represents realistic objects such as Her X-1 and RXJ 1856-37. We perform a detailed investigation of both objects by solving numerically the Einstein field equations with anisotropic pressure. The physical features of the parameters depend on the anisotropic factor i.e. if the anisotropy is zero everywhere inside the star then the density and pressures will become zero and the metric turns out to be flat. We report our results and compare with the above mentioned two compact objects as regards a number of key aspects: the central density, the surface density onset and the critical scaling behaviour, the effective mass and radius ratio, the anisotropization with isotropic initial conditions, adiabatic index and red shift. Along with this we have also made a comparison between the classical limit and theoretical model treatment of the compact objects. Finally we discuss the implications of our findings for the stability condition in a relativistic compact star. (orig.)

Prestack exploding reflector modelling and migration for anisotropic media

KAUST Repository

Alkhalifah, Tariq Ali

2014-10-09

The double-square-root equation is commonly used to image data by downward continuation using one-way depth extrapolation methods. A two-way time extrapolation of the double-square-root-derived phase operator allows for up and downgoing wavefields but suffers from an essential singularity for horizontally travelling waves. This singularity is also associated with an anisotropic version of the double-square-root extrapolator. Perturbation theory allows us to separate the isotropic contribution, as well as the singularity, from the anisotropic contribution to the operator. As a result, the anisotropic residual operator is free from such singularities and can be applied as a stand alone operator to correct for anisotropy. We can apply the residual anisotropy operator even if the original prestack wavefield was obtained using, for example, reverse-time migration. The residual correction is also useful for anisotropic parameter estimation. Applications to synthetic data demonstrate the accuracy of the new prestack modelling and migration approach. It also proves useful in approximately imaging the Vertical Transverse Isotropic Marmousi model.

Dynamical anisotropic response of black phosphorus under magnetic field

Science.gov (United States)

Liu, Xuefeng; Lu, Wei; Zhou, Xiaoying; Zhou, Yang; Zhang, Chenglong; Lai, Jiawei; Ge, Shaofeng; Sekhar, M. Chandra; Jia, Shuang; Chang, Kai; Sun, Dong

2018-04-01

Black phosphorus (BP) has emerged as a promising material candidate for next generation electronic and optoelectronic devices due to its high mobility, tunable band gap and highly anisotropic properties. In this work, polarization resolved ultrafast mid-infrared transient reflection spectroscopy measurements are performed to study the dynamical anisotropic optical properties of BP under magnetic fields up to 9 T. The relaxation dynamics of photoexcited carrier is found to be insensitive to the applied magnetic field due to the broadening of the Landau levels and large effective mass of carriers. While the anisotropic optical response of BP decreases with increasing magnetic field, its enhancement due to the excitation of hot carriers is similar to that without magnetic field. These experimental results can be well interpreted by the magneto-optical conductivity of the Landau levels of BP thin film, based on an effective k · p Hamiltonian and linear response theory. These findings suggest attractive possibilities of multi-dimensional control of anisotropic response (AR) of BP with light, electric and magnetic field, which further introduces BP to the fantastic magnetic field sensitive applications.

Soft tissue deformation modelling through neural dynamics-based reaction-diffusion mechanics.

Science.gov (United States)

Zhang, Jinao; Zhong, Yongmin; Gu, Chengfan

2018-05-30

Soft tissue deformation modelling forms the basis of development of surgical simulation, surgical planning and robotic-assisted minimally invasive surgery. This paper presents a new methodology for modelling of soft tissue deformation based on reaction-diffusion mechanics via neural dynamics. The potential energy stored in soft tissues due to a mechanical load to deform tissues away from their rest state is treated as the equivalent transmembrane potential energy, and it is distributed in the tissue masses in the manner of reaction-diffusion propagation of nonlinear electrical waves. The reaction-diffusion propagation of mechanical potential energy and nonrigid mechanics of motion are combined to model soft tissue deformation and its dynamics, both of which are further formulated as the dynamics of cellular neural networks to achieve real-time computational performance. The proposed methodology is implemented with a haptic device for interactive soft tissue deformation with force feedback. Experimental results demonstrate that the proposed methodology exhibits nonlinear force-displacement relationship for nonlinear soft tissue deformation. Homogeneous, anisotropic and heterogeneous soft tissue material properties can be modelled through the inherent physical properties of mass points. Graphical abstract Soft tissue deformation modelling with haptic feedback via neural dynamics-based reaction-diffusion mechanics.

Anisotropic light scattering of individual sickle red blood cells.

Science.gov (United States)

Kim, Youngchan; Higgins, John M; Dasari, Ramachandra R; Suresh, Subra; Park, YongKeun

2012-04-01

We present the anisotropic light scattering of individual red blood cells (RBCs) from a patient with sickle cell disease (SCD). To measure light scattering spectra along two independent axes of elongated-shaped sickle RBCs with arbitrary orientation, we introduce the anisotropic Fourier transform light scattering (aFTLS) technique and measured both the static and dynamic anisotropic light scattering. We observed strong anisotropy in light scattering patterns of elongated-shaped sickle RBCs along its major axes using static aFTLS. Dynamic aFTLS analysis reveals the significantly altered biophysical properties in individual sickle RBCs. These results provide evidence that effective viscosity and elasticity of sickle RBCs are significantly different from those of the healthy RBCs.

Modeling of charged anisotropic compact stars in general relativity

Energy Technology Data Exchange (ETDEWEB)

Dayanandan, Baiju; Maurya, S.K.; T, Smitha T. [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman)

2017-06-15

A charged compact star model has been determined for anisotropic fluid distribution. We have solved the Einstein-Maxwell field equations to construct the charged compact star model by using the radial pressure, the metric function e{sup λ} and the electric charge function. The generic charged anisotropic solution is verified by exploring different physical conditions like causality condition, mass-radius relation and stability of the solution (via the adiabatic index, TOV equations and the Herrera cracking concept). It is observed that the present charged anisotropic compact star model is compatible with the star PSR 1937+21. Moreover, we also presented the EOS ρ = f(p) for the present charged compact star model. (orig.)

Anisotropic mechanical properties and Stone-Wales defects in graphene monolayer: A theoretical study

International Nuclear Information System (INIS)

Fan, B.B.; Yang, X.B.; Zhang, R.

2010-01-01

We investigate the mechanical properties of graphene monolayer via the density functional theoretical (DFT) method. We find that the strain energies are anisotropic for the graphene under large strain. We attribute the anisotropic feature to the anisotropic sp 2 hybridization in the hexagonal lattice. We further identify that the formation energies of Stone-Wales (SW) defects in the graphene monolayer are determined by the defect concentration and also the direction of applied tensile strain, correlating with the anisotropic feature.

An anisotropic elasto-viscoplastic model for short-fiber reinforced polymers

NARCIS (Netherlands)

Amiri Rad, A.; Govaert, L.E.; van Dommelen, J.A.W.

2017-01-01

The influence of flow on the fiber orientation in injection molding of short-fiber composites leads to both anisotropy and inhomogeneity of the mechanical response. An anisotropic elasto-viscoplastic constitutive model is developed to capture the anisotropic and time-dependent behavior and

An Anisotropic Elasto-Viscoplastic Model for Short-Fiber Reinforced Polymers

NARCIS (Netherlands)

Amiri Rad, A.; Govaert, L.E.; van Dommelen, J.A.W.

2018-01-01

The influence of flow on the fiber orientation in injection molding of short-fiber composites leads to both anisotropy and inhomogeneity of the mechanical response. An anisotropic elasto-viscoplastic constitutive model is developed to capture the anisotropic and time-dependent behavior and

Bianchi-type II spacetime and anisotropic brane-world cosmology

International Nuclear Information System (INIS)

Sevinc, O.

2010-01-01

Anisotropic generalization of Randall and Sundrum brane-world model is considered. I studied a bulk with an anisotropic space of motion of the brane, depending on both time and extra coordinate. Then I discussed possibility of obtaining the fine-tuning condition of Randall and Sundrum following the method of Andrei V. Frolov (Phys. Lett. B, 514,213).

Remarks on the relativistic magnetohydrodynamics of an anisotropic fluid

International Nuclear Information System (INIS)

Ignat, M.

1980-01-01

Considering a pressure tensor of a general form, a relativistic rarefied, anisotropic, infinite electrically conducting and nondissipative plasma is studied. For this purpose, the method of the orthonormal frame of reference is used. The choice of the frame of reference is made adequately to the problem. Some thermodynamical properties of such a relativistic, anisotropic plasma are also given. (author)

Anisotropic wetting characteristics versus roughness on machined surfaces of hydrophilic and hydrophobic materials

International Nuclear Information System (INIS)

Liang, Yande; Shu, Liming; Natsu, Wataru; He, Fuben

2015-01-01

Graphical abstract: - Highlights: • The aim is to investigate the influence of roughness on anisotropic wetting on machined surfaces. • The relationship between roughness and anisotropic wetting is modeled by thermodynamical analysis. • The effect of roughness on anisotropic wetting on hydrophilic materials is stronger than that on hydrophobic materials. • The energy barrier existing in the direction perpendicular to the lay is one of the main reasons for the anisotropic wetting. • The contact angle in the parallel direction is larger than that in the perpendicular direction. - Abstract: Anisotropic wetting of machined surfaces is widely applied in industries which can be greatly affected by roughness and solid's chemical properties. However, there has not been much work on it. A free-energy thermodynamic model is presented by analyzing geometry morphology of machined surfaces (2-D model surfaces), which demonstrates the influence of roughness on anisotropic wetting. It can be concluded that the energy barrier is one of the main reasons for the anisotropic wetting existing in the direction perpendicular to the lay. In addition, experiments in investigating anisotropic wetting, which was characterized by the static contact angle and droplet's distortion, were performed on machined surfaces with different roughness on hydrophilic and hydrophobic materials. The droplet's anisotropy found on machined surfaces increased with mean slope of roughness profile Kr. It indicates that roughness on anisotropic wetting on hydrophilic materials has a stronger effect than that on hydrophobic materials. Furthermore, the contact angles predicted by the model are basically consistent with the experimentally ones

Anisotropic plasma with flows in tokamak: Steady state and stability

International Nuclear Information System (INIS)

Ilgisonis, V.I.

1996-01-01

An adequate description of equilibrium and stability of anisotropic plasma with macroscopic flows in tokamaks is presented. The Chew-Goldberger-Low (CGL) approximation is consistently used to analyze anisotropic plasma dynamics. The admissible structure of a stationary flow is found to be the same as in the ideal magnetohydrodynamics with isotropic pressure (MHD), which means an allowance for the same relabeling symmetry as in ideal MHD systems with toroidally nested magnetic surfaces. A generalization of the Grad-Shafranov equation for the case of anisotropic plasma with flows confined in the axisymmetric magnetic field is derived. A variational principle was obtained, which allows for a stability analysis of anisotropic pressure plasma with flows, and takes into account the conservation laws resulting from the relabeling symmetry. This principle covers the previous stability criteria for static CGL plasma and for ideal MHD flows in isotropic plasma as well. copyright 1996 American Institute of Physics

Anisotropic Ripple Deformation in Phosphorene.

Science.gov (United States)

Kou, Liangzhi; Ma, Yandong; Smith, Sean C; Chen, Changfeng

2015-05-07

Two-dimensional materials tend to become crumpled according to the Mermin-Wagner theorem, and the resulting ripple deformation may significantly influence electronic properties as observed in graphene and MoS2. Here, we unveil by first-principles calculations a new, highly anisotropic ripple pattern in phosphorene, a monolayer black phosphorus, where compression-induced ripple deformation occurs only along the zigzag direction in the strain range up to 10%, but not the armchair direction. This direction-selective ripple deformation mode in phosphorene stems from its puckered structure with coupled hinge-like bonding configurations and the resulting anisotropic Poisson ratio. We also construct an analytical model using classical elasticity theory for ripple deformation in phosphorene under arbitrary strain. The present results offer new insights into the mechanisms governing the structural and electronic properties of phosphorene crucial to its device applications.

On cracking of charged anisotropic polytropes

Energy Technology Data Exchange (ETDEWEB)

Azam, M. [Division of Science and Technology, University of Education, Township Campus, Lahore-54590 (Pakistan); Mardan, S.A., E-mail: azam.math@ue.edu.pk, E-mail: syedalimardanazmi@yahoo.com [Department of Mathematics, University of the Management and Technology, C-II, Johar Town, Lahore-54590 (Pakistan)

2017-01-01

Recently in [1], the role of electromagnetic field on the cracking of spherical polytropes has been investigated without perturbing charge parameter explicitly. In this study, we have examined the occurrence of cracking of anisotropic spherical polytropes through perturbing parameters like anisotropic pressure, energy density and charge. We consider two different types of polytropes in this study. We discuss the occurrence of cracking in two different ways ( i ) by perturbing polytropic constant, anisotropy and charge parameter ( ii ) by perturbing polytropic index, anisotropy and charge parameter for each case. We conclude that cracking appears for a wide range of parameters in both cases. Also, our results are reduced to [2] in the absence of charge.

Anisotropic Deformation Behavior of Al2024T351 Aluminum Alloy

Directory of Open Access Journals (Sweden)

R Khan

2013-06-01

Full Text Available The objective of this work was to investigate the effects of material anisotropy on the yielding and hardening behavior of 2024T351 aluminum alloy using isotropic and anisotropic yield criteria. Anisotropy may be induced in a material during the manufacturing through processes like rolling or forging. This induced anisotropy gives rise to the concept of orientation-dependent material properties such as yield strength, ductility, strain hardening, fracture strength, or fatigue resistance. Inclusion of the effects of anisotropy is essential in correctly predicting the deformation behavior of a material. In this study, uniaxial tensile tests were first performed in all three rolling directions, L , T  and S , for smooth bar specimens made from hot rolled plate of Al2024 alloy. The experimental results showed that the L - and T -directions yielded higher yield strengths and a greater percentage of elongation before fracture than the S -direction. Subsequently, finite element analysis of tensile specimens was performed using isotropic (von Mises and anisotropic (Hill yield criteria to predict the onset of yielding and hardening behaviors during the course of deformation. Hill's criterion perfectly fitted with the test data in the S -direction, but slightly underestimated the yield strength in L -direction. The results indicated that the Hill yield criterion is the most suitable one to predict the onset of yielding and hardening behaviors for 2024T351 aluminum alloy in all directions.

Diffusion weighted magnetic resonance imaging: ischemic and traumatic injury of the central nervous system

International Nuclear Information System (INIS)

Huisman, T.A.G.M.; Sorensen, A.G.; Hawighorst, H.; Benoit, C.H.

2001-01-01

Diffusion weighted magnetic resonance imaging (DWI) represents a recent development that extends imaging from the depiction of the neuroanatomy into the field of functional and physiologic processes. DWI measures a fundamentally different physiologic parameter than conventional MRI. Image contrast is related to differences in the microscopic motion (diffusion) of water molecules within brain tissue rather than a change in total tissue water. Consequently, DWI can reveal pathology where conventional T1- and T2-weighted MR images are negative. DWI has clinically proven its value in the assessment of acute cerebral stroke and trauma by showing cerebral injury early due to its ability to discriminate between lesions with cytotoxic edema (decreased diffusion) from lesions with vasogenic edema (increased diffusion). Full tensor DWI allows to calculate a variety of functional maps, the most widely used maps include maps of apparent diffusion coefficients and isotropic diffusion. In addition maps of anisotropic diffusion can be calculated which are believed to give information about the integrity and location of fiber tracts. This functional-anatomical information will most probably play an increasingly important role in the early detection of primary and secondary tissue injury from various reasons and could guide and validate current and future neuroprotective treatments. (orig.) [de

Black Holes with Anisotropic Fluid in Lyra Scalar-Tensor Theory

Directory of Open Access Journals (Sweden)

Melis ULU DOĞRU

2018-02-01

Full Text Available In this paper, we investigate distribution of anisotropic fluid which is a resource of black holes in regard to Lyra scalar-tensor theory. As part of the theory, we obtain field equations of spherically symmetric space-time with anisotropic fluid. By using field equations, we suggest distribution of anisotropic fluid, responsible for space-time geometries such as Schwarzschild, Reissner-Nordström, Minkowski type, de Sitter type, Anti-de Sitter type, BTZ and charged BTZ black holes. Finally, we discuss obtained pressures and density of the fluid for different values of arbitrary constants, geometrically and physically.

Veselago focusing of anisotropic massless Dirac fermions

Science.gov (United States)

Zhang, Shu-Hui; Yang, Wen; Peeters, F. M.

2018-05-01

Massless Dirac fermions (MDFs) emerge as quasiparticles in various novel materials such as graphene and topological insulators, and they exhibit several intriguing properties, of which Veselago focusing is an outstanding example with a lot of possible applications. However, up to now Veselago focusing merely occurred in p-n junction devices based on the isotropic MDF, which lacks the tunability needed for realistic applications. Here, motivated by the emergence of novel Dirac materials, we investigate the propagation behaviors of anisotropic MDFs in such a p-n junction structure. By projecting the Hamiltonian of the anisotropic MDF to that of the isotropic MDF and deriving an exact analytical expression for the propagator, precise Veselago focusing is demonstrated without the need for mirror symmetry of the electron source and its focusing image. We show a tunable focusing position that can be used in a device to probe masked atom-scale defects. This study provides an innovative concept to realize Veselago focusing relevant for potential applications, and it paves the way for the design of novel electron optics devices by exploiting the anisotropic MDF.

Anomalously large anisotropic magnetoresistance in a perovskite manganite

Science.gov (United States)

Li, Run-Wei; Wang, Huabing; Wang, Xuewen; Yu, X. Z.; Matsui, Y.; Cheng, Zhao-Hua; Shen, Bao-Gen; Plummer, E. Ward; Zhang, Jiandi

2009-01-01

The signature of correlated electron materials (CEMs) is the coupling between spin, charge, orbital and lattice resulting in exotic functionality. This complexity is directly responsible for their tunability. We demonstrate here that the broken symmetry, through cubic to orthorhombic distortion in the lattice structure in a prototype manganite single crystal, La0.69Ca0.31MnO3, leads to an anisotropic magneto-elastic response to an external field, and consequently to remarkable magneto-transport behavior. An anomalous anisotropic magnetoresistance (AMR) effect occurs close to the metal-insulator transition (MIT) in the system, showing a direct correlation with the anisotropic field-tuned MIT in the system and can be understood by means of a simple phenomenological model. A small crystalline anisotropy stimulates a “colossal” AMR near the MIT phase boundary of the system, thus revealing the intimate interplay between magneto- and electronic-crystalline couplings. PMID:19706504

Gravastars and black holes of anisotropic dark energy

International Nuclear Information System (INIS)

Chan, Roberto; Silva, Maria de Fatima Alves da; Rocha, Pedro Senna

2011-01-01

Full text: Dynamical models of prototype gravastars made of anisotropic dark energy are constructed, in which an infinitely thin spherical shell of a perfect fluid with the equation of state p = (1 - γ)σ divides the whole spacetime into two regions, the internal region filled with a dark energy fluid, and the external Schwarzschild region. The models represent 'bounded excursion' stable gravastars, where the thin shell is oscillating between two finite radii, while in other cases they collapse until the formation of black holes. Here we show, for the first time in the literature, a model of gravastar and formation of black hole with both interior and thin shell constituted exclusively of dark energy. Besides, the sign of the parameter of anisotropy (Pt - Pr ) seems to be relevant to the gravastar formation. The formation is favored when the tangential pressure is greater than the radial pressure, at least in the neighborhood of the isotropic case (ω = -1). (author)

Gravastars and black holes of anisotropic dark energy

Energy Technology Data Exchange (ETDEWEB)

Chan, Roberto [Observatorio Nacional (ON), Rio de Janeiro, RJ (Brazil); Silva, Maria de Fatima Alves da; Rocha, Pedro Senna [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil)

2011-07-01

Full text: Dynamical models of prototype gravastars made of anisotropic dark energy are constructed, in which an infinitely thin spherical shell of a perfect fluid with the equation of state p = (1 - {gamma}){sigma} divides the whole spacetime into two regions, the internal region filled with a dark energy fluid, and the external Schwarzschild region. The models represent 'bounded excursion' stable gravastars, where the thin shell is oscillating between two finite radii, while in other cases they collapse until the formation of black holes. Here we show, for the first time in the literature, a model of gravastar and formation of black hole with both interior and thin shell constituted exclusively of dark energy. Besides, the sign of the parameter of anisotropy (Pt - Pr ) seems to be relevant to the gravastar formation. The formation is favored when the tangential pressure is greater than the radial pressure, at least in the neighborhood of the isotropic case ({omega} = -1). (author)

Investigation of anisotropic thermal transport in cross-linked polymers

Science.gov (United States)

Simavilla, David Nieto

Thermal transport in lightly cross-linked polyisoprene and polybutadine subjected to uniaxial elongation is investigated experimentally. We employ two experimental techniques to assess the effect that deformation has on this class of materials. The first technique, which is based on Forced Rayleigh Scattering (FRS), allows us to measure the two independent components of the thermal diffusivity tensor as a function of deformation. These measurements along with independent measurements of the tensile stress and birefringence are used to evaluate the stress-thermal and stress-optic rules. The stress-thermal rule is found to be valid for the entire range of elongations applied. In contrast, the stress-optic rule fails for moderate to large stretch ratios. This suggests that the degree of anisotropy in thermal conductivity depends on both orientation and tension in polymer chain segments. The second technique, which is based on infrared thermography (IRT), allows us to measure anisotropy in thermal conductivity and strain induced changes in heat capacity. We validate this method measurements of anisotropic thermal conductivity by comparing them with those obtained using FRS. We find excellent agreement between the two techniques. Uncertainty in the infrared thermography method measurements is estimated to be about 2-5 %. The accuracy of the method and its potential application to non-transparent materials makes it a good alternative to extend current research on anisotropic thermal transport in polymeric materials. A second IRT application allows us to investigate the dependence of heat capacity on deformation. We find that heat capacity increases with stretch ratio in polyisoprene specimens under uniaxial extension. The deviation from the equilibrium value of heat capacity is consistent with an independent set of experiments comparing anisotropy in thermal diffusivity and conductivity employing FRS and IRT techniques. We identify finite extensibility and strain

Sign rules for anisotropic quantum spin systems

International Nuclear Information System (INIS)

Bishop, R. F.; Farnell, D. J. J.; Parkinson, J. B.

2000-01-01

We present exact ''sign rules'' for various spin-s anisotropic spin-lattice models. It is shown that, after a simple transformation which utilizes these sign rules, the ground-state wave function of the transformed Hamiltonian is positive definite. Using these results exact statements for various expectation values of off-diagonal operators are presented, and transitions in the behavior of these expectation values are observed at particular values of the anisotropy. Furthermore, the importance of such sign rules in variational calculations and quantum Monte Carlo calculations is emphasized. This is illustrated by a simple variational treatment of a one-dimensional anisotropic spin model

Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

International Nuclear Information System (INIS)

Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

1976-01-01

Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

Anisotropic Flow Measurements in ALICE at the Large Hadron Collider

NARCIS (Netherlands)

Bilandzic, A.

2012-01-01

Anisotropic flow is one of the observables which is sensitive to the properties of the created hot and dense system in heavy-ion collisions. In noncentral heavy-ion collisions the initial volume of the interacting system is anisotropic in coordinate space. Due to multiple interactions this anisotropy

Double anisotropic electrically conductive flexible Janus-typed membranes.

Science.gov (United States)

Li, Xiaobing; Ma, Qianli; Tian, Jiao; Xi, Xue; Li, Dan; Dong, Xiangting; Yu, Wensheng; Wang, Xinlu; Wang, Jinxian; Liu, Guixia

2017-12-07

Novel type III anisotropic conductive films (ACFs), namely flexible Janus-typed membranes, were proposed, designed and fabricated for the first time. Flexible Janus-typed membranes composed of ordered Janus nanobelts were constructed by electrospinning, which simultaneously possess fluorescence and double electrically conductive anisotropy. For the fabrication of the Janus-typed membrane, Janus nanobelts comprising a conductive side and an insulative-fluorescent side were primarily fabricated, and then the Janus nanobelts are arranged into parallel arrays using an aluminum rotary drum as the collector to obtain a single anisotropically conductive film. Subsequently, a secondary electrospinning process was applied to the as-prepared single anisotropically conductive films to acquire the final Janus-typed membrane. For this Janus-typed membrane, namely its left-to-right structure, anisotropic electrical conduction synchronously exists on both sides, and furthermore, the two electrically conductive directions are perpendicular. By modulating the amount of Eu(BA) 3 phen complex and conducting polyaniline (PANI), the characteristics and intensity of the fluorescence-electricity dual-function in the membrane can be tuned. The high integration of this peculiar Janus-typed membrane with simultaneous double electrically conductive anisotropy-fluorescent dual-functionality is successfully realized in this study. This design philosophy and preparative technique will provide support for the design and construction of new types of special nanostructures with multi-functionality.

Holographic models with anisotropic scaling

Science.gov (United States)

Brynjolfsson, E. J.; Danielsson, U. H.; Thorlacius, L.; Zingg, T.

2013-12-01

We consider gravity duals to d+1 dimensional quantum critical points with anisotropic scaling. The primary motivation comes from strongly correlated electron systems in condensed matter theory but the main focus of the present paper is on the gravity models in their own right. Physics at finite temperature and fixed charge density is described in terms of charged black branes. Some exact solutions are known and can be used to obtain a maximally extended spacetime geometry, which has a null curvature singularity inside a single non-degenerate horizon, but generic black brane solutions in the model can only be obtained numerically. Charged matter gives rise to black branes with hair that are dual to the superconducting phase of a holographic superconductor. Our numerical results indicate that holographic superconductors with anisotropic scaling have vanishing zero temperature entropy when the back reaction of the hair on the brane geometry is taken into account.

Anisotropic models for compact stars

Energy Technology Data Exchange (ETDEWEB)

Maurya, S.K.; Dayanandan, Baiju [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman); Gupta, Y.K. [Jaypee Institute of Information Technology University, Department of Mathematics, Noida, Uttar Pradesh (India); Ray, Saibal [Government College of Engineering and Ceramic Technology, Department of Physics, Kolkata, West Bengal (India)

2015-05-15

In the present paper we obtain an anisotropic analog of the Durgapal and Fuloria (Gen Relativ Gravit 17:671, 1985) perfect fluid solution. The methodology consists of contraction of the anisotropic factor Δ with the help of both metric potentials e{sup ν} and e{sup λ}. Here we consider e{sup λ} the same as Durgapal and Fuloria (Gen Relativ Gravit 17:671, 1985) did, whereas e{sup ν} is as given by Lake (Phys Rev D 67:104015, 2003). The field equations are solved by the change of dependent variable method. The solutions set mathematically thus obtained are compared with the physical properties of some of the compact stars, strange star as well as white dwarf. It is observed that all the expected physical features are available related to the stellar fluid distribution, which clearly indicates the validity of the model. (orig.)

Generalization of Asaoka method to linearly anisotropic scattering: benchmark data in cylindrical geometry

International Nuclear Information System (INIS)

Sanchez, Richard.

1975-11-01

The Integral Transform Method for the neutron transport equation has been developed in last years by Asaoka and others. The method uses Fourier transform techniques in solving isotropic one-dimensional transport problems in homogeneous media. The method has been extended to linearly anisotropic transport in one-dimensional homogeneous media. Series expansions were also obtained using Hembd techniques for the new anisotropic matrix elements in cylindrical geometry. Carlvik spatial-spherical harmonics method was generalized to solve the same problem. By applying a relation between the isotropic and anisotropic one-dimensional kernels, it was demonstrated that anisotropic matrix elements can be calculated by a linear combination of a few isotropic matrix elements. This means in practice that the anisotropic problem of order N with the N+2 isotropic matrix for the plane and spherical geometries, and N+1 isotropic matrix for cylindrical geometries can be solved. A method of solving linearly anisotropic one-dimensional transport problems in homogeneous media was defined by applying Mika and Stankiewicz observations: isotropic matrix elements were computed by Hembd series and anisotropic matrix elements then calculated from recursive relations. The method has been applied to albedo and critical problems in cylindrical geometries. Finally, a number of results were computed with 12-digit accuracy for use as benchmarks [fr

Zonal flows in tokamaks with anisotropic pressure

International Nuclear Information System (INIS)

Ren, Haijun

2014-01-01

Zonal flows (ZFs) in a tokamak plasma with anisotropic pressure are investigated. The dynamics of perpendicular and parallel pressures are determined by the Chew-Goldberger-Low double equations and low-β condition is adopted, where β is the ratio of plasma pressure to the magnetic field pressure. The dispersion relation is analytically derived and illustrates two branches of ZFs. The low frequency zonal flow (LFZF) branch becomes unstable when χ, the ratio of the perpendicular pressure to the parallel one, is greater than a threshold value χ c , which is about 3.8. In the stable region, its frequency increases first and then decreases with increasing χ. For χ = 1, the frequency of LFZF agrees well with the experimental observation. For the instability, the growth rate of LFZF increases with χ. The geodesic acoustic mode branch is shown to be always stable with a frequency increasing with χ. The safety factor is shown to diminish the frequencies of both branches or the growth rate of LFZF

Sound speeds, cracking and the stability of self-gravitating anisotropic compact objects

International Nuclear Information System (INIS)

Abreu, H; Hernandez, H; Nunez, L A

2007-01-01

Using the concept of cracking we explore the influence that density fluctuations and local anisotropy have on the stability of local and non-local anisotropic matter configurations in general relativity. This concept, conceived to describe the behavior of a fluid distribution just after its departure from equilibrium, provides an alternative approach to consider the stability of self-gravitating compact objects. We show that potentially unstable regions within a configuration can be identified as a function of the difference of propagations of sound along tangential and radial directions. In fact, it is found that these regions could occur when, at a particular point within the distribution, the tangential speed of sound is greater than the radial one

Hybrid anisotropic materials for wind power turbine blades

CERN Document Server

Golfman, Yosif

2012-01-01

Based on rapid technological developments in wind power, governments and energy corporations are aggressively investing in this natural resource. Illustrating some of the crucial new breakthroughs in structural design and application of wind energy generation machinery, Hybrid Anisotropic Materials for Wind Power Turbine Blades explores new automated, repeatable production techniques that expand the use of robotics and process controls. These practices are intended to ensure cheaper fabrication of less-defective anisotropic material composites used to manufacture power turbine blades. This boo

Anisotropic behavior of quantum transport in graphene superlattices

DEFF Research Database (Denmark)

Pedersen, Jesper Goor; Cummings, Aron W.; Roche, Stephan

2014-01-01

We report on the possibility to generate highly anisotropic quantum conductivity in disordered graphene-based superlattices. Our quantum simulations, based on an efficient real-space implementation of the Kubo-Greenwood formula, show that in disordered graphene superlattices the strength of multi......We report on the possibility to generate highly anisotropic quantum conductivity in disordered graphene-based superlattices. Our quantum simulations, based on an efficient real-space implementation of the Kubo-Greenwood formula, show that in disordered graphene superlattices the strength...

Fractional Brownian motion run with a multi-scaling clock mimics diffusion of spherical colloids in microstructural fluids.

Science.gov (United States)

Park, Moongyu; Cushman, John Howard; O'Malley, Dan

2014-09-30

The collective molecular reorientations within a nematic liquid crystal fluid bathing a spherical colloid cause the colloid to diffuse anomalously on a short time scale (i.e., as a non-Brownian particle). The deformations and fluctuations of long-range orientational order in the liquid crystal profoundly influence the transient diffusive regimes. Here we show that an anisotropic fractional Brownian process run with a nonlinear multiscaling clock effectively mimics this collective and transient phenomenon. This novel process has memory, Gaussian increments, and a multiscale mean square displacement that can be chosen independently from the fractal dimension of a particle trajectory. The process is capable of modeling multiscale sub-, super-, or classical diffusion. The finite-size Lyapunov exponents for this multiscaling process are defined for future analysis of related mixing processes.

Anisotropic Rabi model

OpenAIRE

Xie, Qiong-Tao; Cui, Shuai; Cao, Jun-Peng; Amico, Luigi; Fan, Heng

2014-01-01

We define the anisotropic Rabi model as the generalization of the spin-boson Rabi model: The Hamiltonian system breaks the parity symmetry; the rotating and counterrotating interactions are governed by two different coupling constants; a further parameter introduces a phase factor in the counterrotating terms. The exact energy spectrum and eigenstates of the generalized model are worked out. The solution is obtained as an elaboration of a recently proposed method for the isotropic limit of th...

Phosphatidylserine and GTPase activation control Cdc42 nanoclustering to counter dissipative diffusion.

Science.gov (United States)

Sartorel, Elodie; Ünlü, Caner; Jose, Mini; Massoni-Laporte, Aurélie; Meca, Julien; Sibarita, Jean-Baptiste; McCusker, Derek

2018-04-18

The anisotropic organization of plasma membrane constituents is indicative of mechanisms that drive the membrane away from equilibrium. However, defining these mechanisms is challenging due to the short spatio-temporal scales at which diffusion operates. Here, we use high-density single protein tracking combined with photoactivation localization microscopy (sptPALM) to monitor Cdc42 in budding yeast, a system in which Cdc42 exhibits anisotropic organization. Cdc42 exhibited reduced mobility at the cell pole, where it was organized in nanoclusters. The Cdc42 nanoclusters were larger at the cell pole than those observed elsewhere in the cell. These features were exacerbated in cells expressing Cdc42-GTP, and were dependent on the scaffold Bem1, which contributed to the range of mobility and nanocluster size exhibited by Cdc42. The lipid environment, in particular phosphatidylserine levels, also played a role in regulating Cdc42 nanoclustering. These studies reveal how the mobility of a Rho GTPase is controlled to counter the depletive effects of diffusion, thus stabilizing Cdc42 on the plasma membrane and sustaining cell polarity. Movie S1 Movie S1 sptPALM imaging of live yeast expressing Pil1-mEOS expressed at the genomic locus. Pil1-mEOS was simultaneously photo-converted with a 405 nm laser and imaged with a 561 nm laser using HiLo illumination. Images were acquired at 20 ms intervals, of which 300 frames are shown at 7 frames per second.

Effective material parameter retrieval of anisotropic elastic metamaterials with inherent nonlocality

Science.gov (United States)

Lee, Hyung Jin; Lee, Heung Son; Ma, Pyung Sik; Kim, Yoon Young

2016-09-01

In this paper, the scattering (S-) parameter retrieval method is presented specifically for anisotropic elastic metamaterials; so far, no retrieval has been accomplished when elastic metamaterials exhibit fully anisotropic behavior. Complex constitutive property and intrinsic scattering behavior of elastic metamaterials make their characterization far more complicated than that for acoustic and electromagnetic metamaterials. In particular, elastic metamaterials generally exhibit anisotropic scattering behavior due to higher scattering modes associated with shear deformation. They also exhibit nonlocal responses to some degrees, which originate from strong multiple scattering interactions even in the long wavelength limit. Accordingly, the conventional S-parameter retrieval methods cannot be directly used for elastic metamaterials, because they determine only the diagonal components in effective tensor property. Also, the conventional methods simply use the analytic inversion formulae for the material characterization so that inherent nonlocality cannot be taken into account. To establish a retrieval method applicable to anisotropic elastic metamaterials, we propose an alternative S-parameter method to deal with full anisotropy of elastic metamaterials. To retrieve the whole effective anisotropic parameter, we utilize not only normal but also oblique wave incidences. For the retrieval, we first retrieve the ratio of the effective stiffness tensor to effective density and then determine the effective density. The proposed retrieval method is validated by characterizing the effective material parameters of various types of non-resonant anisotropic metamaterials. It is found that the whole effective parameters are retrieved consistently regardless of used retrieval conditions in spite of inherent nonlocality.

Self-force on dislocation segments in anisotropic crystals

International Nuclear Information System (INIS)

Fitzgerald, S P; Aubry, S

2010-01-01

A dislocation segment in a crystal experiences a 'self-force', by virtue of the orientation dependence of its elastic energy. If the crystal is elastically isotropic, this force is manifested as a couple acting to rotate the segment toward the lower energy of the pure screw orientation (i.e. acting to align the dislocation line with its Burgers vector). If the crystal is anisotropic, there are additional contributions to the couple, arising from the more complex energy landscape of the lattice itself. These effects can strongly influence the dynamic evolution of dislocation networks, and via their governing role in dislocation multiplication phenomena, control plastic flow in metals. In this paper we develop a model for dislocation self-forces in a general anisotropic crystal, and briefly consider the technologically important example of α-iron, which becomes increasingly anisotropic as the temperature approaches that of the α-γ phase transition at 912 0 C.

Preconditioned conjugate gradient technique for the analysis of symmetric anisotropic structures

Science.gov (United States)

Noor, Ahmed K.; Peters, Jeanne M.

1987-01-01

An efficient preconditioned conjugate gradient (PCG) technique and a computational procedure are presented for the analysis of symmetric anisotropic structures. The technique is based on selecting the preconditioning matrix as the orthotropic part of the global stiffness matrix of the structure, with all the nonorthotropic terms set equal to zero. This particular choice of the preconditioning matrix results in reducing the size of the analysis model of the anisotropic structure to that of the corresponding orthotropic structure. The similarities between the proposed PCG technique and a reduction technique previously presented by the authors are identified and exploited to generate from the PCG technique direct measures for the sensitivity of the different response quantities to the nonorthotropic (anisotropic) material coefficients of the structure. The effectiveness of the PCG technique is demonstrated by means of a numerical example of an anisotropic cylindrical panel.

ANALYSIS OF DEFORMABILITY OF ANISOTROPIC AGRILLITE CLAYSTONES

Directory of Open Access Journals (Sweden)

Ponomaryov Andrey Budimirovicn

2017-08-01

Full Text Available In the paper, the results of deformability study of agrillite claystones are used for determination of the Jointed rock model parameters. The number of stamp, pressuremeter and compressive tests allowed to research anisotropic deformability of argillite claystone in vertical and horizontal direction. The following problems were solved during the study: 1 the in-place and laboratory experiments to calculate the anisotropy coefficient were done for anisotropic agrillite claystones with both natural moisture and total water saturation; 2 the deformation parameters were determined and the numerical simulation of the stress-strain state of claystone in field tests was carried out with the use of Plaxis 2D software application; 3 the comparative analysis was done for calculated claystone deformation and the values obtained during the in-place tests. The authors proved that agrillite claystones shows two times less deformation under loading in the horizontal direction than vertically. The ratio is obtained to determine the parameters for numerical simulation of the Jointed Rock model used as a practical tool for analysis of stress-strain behavior of anisotropic soils. The authors provided a recommended practice for consideration of specific properties of argillite claystones when carrying out foundation works.

3-D direct current resistivity anisotropic modelling by goal-oriented adaptive finite element methods

Science.gov (United States)

Ren, Zhengyong; Qiu, Lewen; Tang, Jingtian; Wu, Xiaoping; Xiao, Xiao; Zhou, Zilong

2018-01-01

Although accurate numerical solvers for 3-D direct current (DC) isotropic resistivity models are current available even for complicated models with topography, reliable numerical solvers for the anisotropic case are still an open question. This study aims to develop a novel and optimal numerical solver for accurately calculating the DC potentials for complicated models with arbitrary anisotropic conductivity structures in the Earth. First, a secondary potential boundary value problem is derived by considering the topography and the anisotropic conductivity. Then, two a posteriori error estimators with one using the gradient-recovery technique and one measuring the discontinuity of the normal component of current density are developed for the anisotropic cases. Combing the goal-oriented and non-goal-oriented mesh refinements and these two error estimators, four different solving strategies are developed for complicated DC anisotropic forward modelling problems. A synthetic anisotropic two-layer model with analytic solutions verified the accuracy of our algorithms. A half-space model with a buried anisotropic cube and a mountain-valley model are adopted to test the convergence rates of these four solving strategies. We found that the error estimator based on the discontinuity of current density shows better performance than the gradient-recovery based a posteriori error estimator for anisotropic models with conductivity contrasts. Both error estimators working together with goal-oriented concepts can offer optimal mesh density distributions and highly accurate solutions.

Failure in imperfect anisotropic materials

DEFF Research Database (Denmark)

Legarth, Brian Nyvang

2005-01-01

The fundamental cause of crack growth, namely nucleation and growth of voids, is investigated numerically for a two phase imperfect anisotropic material. A unit cell approach is adopted from which the overall stress strain is evaluated. Failure is observed as a sudden stress drop and depending...

Detection of hyperacute parenchymal hemorrhage of the brain using echo-planar T2{sup *}-weighted and diffusion-weighted MRI

Energy Technology Data Exchange (ETDEWEB)

Wiesmann, M. [Dept. of Radiology, Medizinische Universitaet zu Luebeck (Germany); Mayer, T.E.; Yousry, I.; Brueckmann, H. [Dept. of Neuroradiology, Klinikum Grosshadern, Ludwig-Maximilians-Universitaet, Muenchen (Germany); Hamann, G.F. [Dept. of Neurology, Klinikum Grosshadern, Ludwig-Maximilians-Universitaet, Muenchen (Germany)

2001-05-01

We investigated the usefulness of echo-planar imaging (EPI) as well as T2{sup *}-weighted and diffusion-weighted MRI (DWI) to identify hyperacute hemorrhage (within 24 h after ictus) in the brain. Seven patients were examined 3.5 to 24 h after onset of symptoms using a whole-body 1.5-T MR system. Two diffusion-weighted sequences were run to obtain isotropic and anisotropic diffusion images. Apparent diffusion coefficients (ADC) were calculated from the isotropic diffusion images. All DWI images as well as the T2*-weighted EPI images showed the hematomas as either discrete, deeply hypointense homogeneous lesions, or as lesions of mixed signal intensity containing hypointense areas. We conclude that even in the early phase after hemorrhage, sufficient amounts of paramagnetic deoxyhemoglobin are present in intracerebral hemorrhages to cause hypointensity on EPI T2{sup *}-weighted and DWI images; thus, use of ultrafast EPI allows identification of intracerebral hemorrhage. (orig.)

Field theoretic approach to structure formation in an anisotropic medium

International Nuclear Information System (INIS)

Joy, Minu; Kuriakose, V.C.

2003-01-01

Considering a real scalar field distribution which is assumed to be locally anisotropic and coupled to a Bianchi type-I background spacetime, the energy density and pressure associated with the anisotropic matter field distribution are evaluated. The vanishing of the expectation values of the nondiagonal components of T μν allows us to treat the scalar field in complete analogy with the distribution of fluid. The primeval density perturbations produced by the vacuum fluctuations of the scalar field are considered and the Jeans criterion for structure formation is obtained. The metric and matter field perturbations are considered and it is found that for the present anisotropic case the perturbations of the pressure in the radial and tangential directions are different. The Jeans instability is discussed and the Jeans wave number for the present case is evaluated. It is found that for the anisotropic case the Jeans length depends on the velocity of the fluctuations in the radial and transverse directions and thus on the direction of propagation of the perturbations

Effective Medium Theory for Anisotropic Metamaterials

KAUST Repository

Zhang, Xiujuan

2017-11-12

This dissertation includes the study of effective medium theories (EMTs) and their applications in describing wave propagation in anisotropic metamaterials, which can guide the design of metamaterials. An EMT based on field averaging is proposed to describe a peculiar anisotropic dispersion relation that is linear along the symmetry line but quadratic in the perpendicular direction. This dispersion relation is associated with the topological transition of the iso-frequency contours (IFCs), suggesting interesting wave propagation behaviors from beam shaping to beam splitting. In the framework of coherent potential approximation, an analytical EMT is further developed, with the ability to build a direct connection between the microscopic structure and the macroscopic material properties, which overcomes the requirement of prior knowledge of the field distributions. The derived EMT is valid beyond the long-wavelength limit. Using the EMT, an anisotropic zero-index metamaterial is designed. Moreover, the derived EMT imposes a condition that no scattered wave is generated in the ambient medium, which suggests the input signal cannot detect any object that might exist, making it invisible. Such correspondence between the EMT and the invisibilityinspires us to explore the wave cloaking in the same framework of coherent potential approximation. To further broaden the application realm of EMT, an EMT using the parameter retrieval method is studied in the regimes where the previously-developed EMTs are no longer accurate. Based on this study, in conjunction with the EMT mentioned above, a general scheme to realize coherent perfect absorption (CPA) in anisotropic metamaterials is proposed. As an exciting area in metamaterials, the field of metasurfaces has drawn great attention recently. As an easily attainable device, a grating may be the simplest version of metasurfaces. Here, an analytical EMT for gratings made of cylinders is developed by using the multiple scattering

An anisotropic standing wave braneworld and associated Sturm-Liouville problem

International Nuclear Information System (INIS)

Gogberashvili, Merab; Herrera-Aguilar, Alfredo; Malagón-Morejón, Dagoberto

2012-01-01

We present a consistent derivation of the recently proposed 5D anisotropic standing wave braneworld generated by gravity coupled to a phantom-like scalar field. We explicitly solve the corresponding junction conditions, a fact that enables us to give a physical interpretation to the anisotropic energy-momentum tensor components of the brane. So matter on the brane represents an oscillating fluid which emits anisotropic waves into the bulk. We also analyze the Sturm-Liouville problem associated with the correct localization condition of the transverse to the brane metric and scalar fields. It is shown that this condition restricts the physically meaningful space of solutions for the localization of the fluctuations of the model. (paper)

Experimental evidence for anisotropic double exchange interaction driven anisotropic transport in manganite heterostructures

NARCIS (Netherlands)

Liao, Zhaoliang; Koster, Gertjan; Huijben, Mark; Rijnders, A.J.H.M.

2017-01-01

An anisotropic double exchange interaction driven giant transport anisotropy is demonstrated in a canonic double exchange system of La2/3Sr1/3MnO3 ultrathin films epitaxially grown on NdGaO3 (110) substrates. The oxygen octahedral coupling at the La2/3Sr1/3MnO3/NdGaO3 interface induces a planar

Characterization of highly anisotropic three-dimensionally nanostructured surfaces

International Nuclear Information System (INIS)

Schmidt, Daniel

2014-01-01

Generalized ellipsometry, a non-destructive optical characterization technique, is employed to determine geometrical structure parameters and anisotropic dielectric properties of highly spatially coherent three-dimensionally nanostructured thin films grown by glancing angle deposition. The (piecewise) homogeneous biaxial layer model approach is discussed, which can be universally applied to model the optical response of sculptured thin films with different geometries and from diverse materials, and structural parameters as well as effective optical properties of the nanostructured thin films are obtained. Alternative model approaches for slanted columnar thin films, anisotropic effective medium approximations based on the Bruggeman formalism, are presented, which deliver results comparable to the homogeneous biaxial layer approach and in addition provide film constituent volume fraction parameters as well as depolarization or shape factors. Advantages of these ellipsometry models are discussed on the example of metal slanted columnar thin films, which have been conformally coated with a thin passivating oxide layer by atomic layer deposition. Furthermore, the application of an effective medium approximation approach to in-situ growth monitoring of this anisotropic thin film functionalization process is presented. It was found that structural parameters determined with the presented optical model equivalents for slanted columnar thin films agree very well with scanning electron microscope image estimates. - Highlights: • Summary of optical model strategies for sculptured thin films with arbitrary geometries • Application of the rigorous anisotropic Bruggeman effective medium applications • In-situ growth monitoring of atomic layer deposition on biaxial metal slanted columnar thin film

Aerobic fitness is associated with greater white matter integrity in children

Directory of Open Access Journals (Sweden)

Laura eChaddock-Heyman

2014-08-01

Full Text Available Aerobic fitness has been found to play a positive role in brain and cognitive health of children. Yet, many of the neural biomarkers related to aerobic fitness remain unknown. Here, using diffusion tensor imaging (DTI, we demonstrated that higher aerobic fitness was related to greater estimates of white matter microstructure in children. Higher fit 9- and 10-year-old children showed greater fractional anisotropy (FA in sections of the corpus callosum, corona radiata, and superior longitudinal fasciculus, compared to lower fit children. The FA effects were primarily characterized by aerobic fitness differences in radial diffusivity (RD, thereby raising the possibility that estimates of myelination may vary as a function of individual differences in fitness during childhood. White matter structure may be another potential neural mechanism of aerobic fitness that assists in efficient communication between gray matter regions as well as the integration of regions into networks.

On a hierarchical construction of the anisotropic LTSN solution from the isotropic LTSN solution

International Nuclear Information System (INIS)

Foletto, Taline; Segatto, Cynthia F.; Bodmann, Bardo E.; Vilhena, Marco T.

2015-01-01

In this work, we present a recursive scheme targeting the hierarchical construction of anisotropic LTS N solution from the isotropic LTS N solution. The main idea relies in the decomposition of the associated LTS N anisotropic matrix as a sum of two matrices in which one matrix contains the isotropic and the other anisotropic part of the problem. The matrix containing the anisotropic part is considered as the source of the isotropic problem. The solution of this problem is made by the decomposition of the angular flux as a truncated series of intermediate functions and replace in the isotropic equation. After the replacement of these into the split isotropic equation, we construct a set of isotropic recursive problems, that are readily solved by the classic LTS N isotropic method. We apply this methodology to solve problems considering homogeneous and heterogeneous anisotropic regions. Numerical results are presented and compared with the classical LTS N anisotropic solution. (author)

Brazilian Tensile Strength of Anisotropic Rocks: Review and New Insights

Directory of Open Access Journals (Sweden)

Tianshou Ma

2018-01-01

Full Text Available Strength anisotropy is one of the most distinct features of anisotropic rocks, and it also normally reveals strong anisotropy in Brazilian test Strength (“BtS”. Theoretical research on the “BtS” of anisotropic rocks is seldom performed, and in particular some significant factors, such as the anisotropic tensile strength of anisotropic rocks, the initial Brazilian disc fracture points, and the stress distribution on the Brazilian disc, are often ignored. The aim of the present paper is to review the state of the art in the experimental studies on the “BtS” of anisotropic rocks since the pioneering work was introduced in 1964, and to propose a novel theoretical method to underpin the failure mechanisms and predict the “BtS” of anisotropic rocks under Brazilian test conditions. The experimental data of Longmaxi Shale-I and Jixi Coal were utilized to verify the proposed method. The results show the predicted “BtS” results show strong agreement with experimental data, the maximum error is only ~6.55% for Longmaxi Shale-I and ~7.50% for Jixi Coal, and the simulated failure patterns of the Longmaxi Shale-I are also consistent with the test results. For the Longmaxi Shale-I, the Brazilian disc experiences tensile failure of the intact rock when 0° ≤ βw ≤ 24°, shear failure along the weakness planes when 24° ≤ βw ≤ 76°, and tensile failure along the weakness planes when 76° ≤ βw ≤ 90°. For the Jixi Coal, the Brazilian disc experiences tensile failure when 0° ≤ βw ≤ 23° or 76° ≤ βw ≤ 90°, shear failure along the butt cleats when 23° ≤ βw ≤ 32°, and shear failure along the face cleats when 32° ≤ βw ≤ 76°. The proposed method can not only be used to predict the “BtS” and underpin the failure mechanisms of anisotropic rocks containing a single group of weakness planes, but can also be generalized for fractured rocks containing multi-groups of weakness planes.

Debonding analyses in anisotropic materials with strain- gradient effects

DEFF Research Database (Denmark)

Legarth, Brian Nyvang

2012-01-01

A unit cell approach is adopted to numerically analyze the effect of plastic anisotropy on damage evolution in a micro-reinforced composite. The matrix material exhibit size effects and a visco-plastic anisotropic strain gradient plasticity model accounting for such size effects is adopted....... A conventional cohesive law is extended such that both the average as well as the jump in plastic strain across the fiber-matrix interface are accounted for. Results are shown for both conventional isotropic and anisotropic materials as well as for higher order isotropic and anisotropic materials...... with and without debonding. Generally, the strain gradient enhanced material exhibits higher load carry capacity compared to the corresponding conventional material. A sudden stress drop occurs in the macroscopic stress-strain response curve due to fiber-matrix debonding and the results show that a change in yield...

Two-relaxation-time lattice Boltzmann method for the anisotropic dispersive Henry problem

Science.gov (United States)

Servan-Camas, Borja; Tsai, Frank T.-C.

2010-02-01

This study develops a lattice Boltzmann method (LBM) with a two-relaxation-time collision operator (TRT) to cope with anisotropic heterogeneous hydraulic conductivity and anisotropic velocity-dependent hydrodynamic dispersion in the saltwater intrusion problem. The directional-speed-of-sound technique is further developed to address anisotropic hydraulic conductivity and dispersion tensors. Forcing terms are introduced in the LBM to correct numerical errors that arise during the recovery procedure and to describe the sink/source terms in the flow and transport equations. In order to facilitate the LBM implementation, the forcing terms are combined with the equilibrium distribution functions (EDFs) to create pseudo-EDFs. This study performs linear stability analysis and derives LBM stability domains to solve the anisotropic advection-dispersion equation. The stability domains are used to select the time step at which the lattice Boltzmann method provides stable solutions to the numerical examples. The LBM was implemented for the anisotropic dispersive Henry problem with high ratios of longitudinal to transverse dispersivities, and the results compared well to the solutions in the work of Abarca et al. (2007).

Fabrication of an Anisotropic Superhydrophobic Polymer Surface Using Compression Molding and Dip Coating

Directory of Open Access Journals (Sweden)

Kyong-Min Lee

2017-11-01

Full Text Available Many studies of anisotropic wetting surfaces with directional structures inspired from rice leaves, bamboo leaves, and butterfly wings have been carried out because of their unique liquid shape control and transportation. In this study, a precision mechanical cutting process, ultra-precision machining using a single crystal diamond tool, was used to fabricate a mold with microscale directional patterns of triangular cross-sectional shape for good moldability, and the patterns were duplicated on a flat thermoplastic polymer plate by compression molding for the mass production of an anisotropic wetting polymer surface. Anisotropic wetting was observed only with microscale patterns, but the sliding of water could not be achieved because of the pinning effect of the micro-structure. Therefore, an additional dip coating process with 1H, 1H, 2H, 2H-perfluorodecythricholosilanes, and TiO2 nanoparticles was applied for a small sliding angle with nanoscale patterns and a low surface energy. The anisotropic superhydrophobic surface was fabricated and the surface morphology and anisotropic wetting behaviors were investigated. The suggested fabrication method can be used to mass produce an anisotropic superhydrophobic polymer surface, demonstrating the feasibility of liquid shape control and transportation.

Anisotropic spin motive force in multi-layered Dirac fermion system, α-(BEDT-TTF)2I3

International Nuclear Information System (INIS)

Kubo, K; Morinari, T

2015-01-01

We investigate the anisotropic spin motive force in α-(BEDT-TTF) 2 I 3 , which is a multi-layered massless Dirac fermion system under pressure. Assuming the interlayer antiferromagnetic interaction and the interlayer anisotropic ferromagnetic interaction, we numerically examine the spin ordered state of the ground state using the steepest descent method. The anisotropic interaction leads to the anisotropic spin ordered state. We calculate the spin motive force produced by the anisotropic spin texture. The result quantitatively agrees with the experiment. (paper)

Turbulence-driven anisotropic electron tail generation during magnetic reconnection

Science.gov (United States)

DuBois, A. M.; Scherer, A.; Almagri, A. F.; Anderson, J. K.; Pandya, M. D.; Sarff, J. S.

2018-05-01

Magnetic reconnection (MR) plays an important role in particle transport, energization, and acceleration in space, astrophysical, and laboratory plasmas. In the Madison Symmetric Torus reversed field pinch, discrete MR events release large amounts of energy from the equilibrium magnetic field, a fraction of which is transferred to electrons and ions. Previous experiments revealed an anisotropic electron tail that favors the perpendicular direction and is symmetric in the parallel. New profile measurements of x-ray emission show that the tail distribution is localized near the magnetic axis, consistent modeling of the bremsstrahlung emission. The tail appears first near the magnetic axis and then spreads radially, and the dynamics in the anisotropy and diffusion are discussed. The data presented imply that the electron tail formation likely results from a turbulent wave-particle interaction and provides evidence that high energy electrons are escaping the core-localized region through pitch angle scattering into the parallel direction, followed by stochastic parallel transport to the plasma edge. New measurements also show a strong correlation between high energy x-ray measurements and tearing mode dynamics, suggesting that the coupling between core and edge tearing modes is essential for energetic electron tail formation.

3D anisotropic modeling and identification for airborne EM systems based on the spectral-element method

Science.gov (United States)

Huang, Xin; Yin, Chang-Chun; Cao, Xiao-Yue; Liu, Yun-He; Zhang, Bo; Cai, Jing

2017-09-01

The airborne electromagnetic (AEM) method has a high sampling rate and survey flexibility. However, traditional numerical modeling approaches must use high-resolution physical grids to guarantee modeling accuracy, especially for complex geological structures such as anisotropic earth. This can lead to huge computational costs. To solve this problem, we propose a spectral-element (SE) method for 3D AEM anisotropic modeling, which combines the advantages of spectral and finite-element methods. Thus, the SE method has accuracy as high as that of the spectral method and the ability to model complex geology inherited from the finite-element method. The SE method can improve the modeling accuracy within discrete grids and reduce the dependence of modeling results on the grids. This helps achieve high-accuracy anisotropic AEM modeling. We first introduced a rotating tensor of anisotropic conductivity to Maxwell's equations and described the electrical field via SE basis functions based on GLL interpolation polynomials. We used the Galerkin weighted residual method to establish the linear equation system for the SE method, and we took a vertical magnetic dipole as the transmission source for our AEM modeling. We then applied fourth-order SE calculations with coarse physical grids to check the accuracy of our modeling results against a 1D semi-analytical solution for an anisotropic half-space model and verified the high accuracy of the SE. Moreover, we conducted AEM modeling for different anisotropic 3D abnormal bodies using two physical grid scales and three orders of SE to obtain the convergence conditions for different anisotropic abnormal bodies. Finally, we studied the identification of anisotropy for single anisotropic abnormal bodies, anisotropic surrounding rock, and single anisotropic abnormal body embedded in an anisotropic surrounding rock. This approach will play a key role in the inversion and interpretation of AEM data collected in regions with anisotropic

Diffusion weighted magnetic resonance imaging: ischemic and traumatic injury of the central nervous system; Diffusionsgewichtete MRI: ischaemische und traumatische Verletzungen des Zentralnervensystems

Energy Technology Data Exchange (ETDEWEB)

Huisman, T.A.G.M.; Sorensen, A.G. [Massachusetts General Hospital and Harvard Medical School, Boston (United States). MGH-NMR Center; Hawighorst, H.; Benoit, C.H. [Swiss Paraplegic Center Nottwil (Switzerland). Inst. of Radiology

2001-12-01

Diffusion weighted magnetic resonance imaging (DWI) represents a recent development that extends imaging from the depiction of the neuroanatomy into the field of functional and physiologic processes. DWI measures a fundamentally different physiologic parameter than conventional MRI. Image contrast is related to differences in the microscopic motion (diffusion) of water molecules within brain tissue rather than a change in total tissue water. Consequently, DWI can reveal pathology where conventional T1- and T2-weighted MR images are negative. DWI has clinically proven its value in the assessment of acute cerebral stroke and trauma by showing cerebral injury early due to its ability to discriminate between lesions with cytotoxic edema (decreased diffusion) from lesions with vasogenic edema (increased diffusion). Full tensor DWI allows to calculate a variety of functional maps, the most widely used maps include maps of apparent diffusion coefficients and isotropic diffusion. In addition maps of anisotropic diffusion can be calculated which are believed to give information about the integrity and location of fiber tracts. This functional-anatomical information will most probably play an increasingly important role in the early detection of primary and secondary tissue injury from various reasons and could guide and validate current and future neuroprotective treatments. (orig.) [German] Die diffusionsgewichtete Magnetresonanz Tomografie (DWI) stellt ein neues Verfahren dar, welches die Bildgebung von der einfachen Darstellung der Neuroanatomie um das Feld der funktionalen und physiologischen Prozesse erweitert. Im Gegensatz zur konventionellen MRT misst die DWI einen vollkommen anderen physiologischen Parameter. Der Bildkontrast haengt von Unterschieden in der Mikrobewegung (Diffusion) der Wassermolekuele im Hirngewebe ab. Daher kann die DWI pathologische Prozesse aufzeichnen, wo konventionelle T1- und T2-gewichtete MR Bilder unauffaellig bleiben. In der klinischen

Total magnitude of diffusion tensor imaging as an effective tool for the differentiation of glioma

Energy Technology Data Exchange (ETDEWEB)

Smitha, Karavallil A., E-mail: mithamahesh@gmail.com [Department of Imaging Sciences and Interventional Radiology, Sree Chitra Tirunal Institute for Medical Sciences and Technology, Thiruvananthapuram (India); Gupta, Arun kumar, E-mail: gupta209@gmail.com [Department of Neuroimaging and Interventional Radiology, National Institute of Mental Health and Neuro Sciences, Bangalore (India); Jayasree, Ramapurath S., E-mail: jayashreemenon@gmail.com [Biophotonics and Imaging Laboratory, Biomedical Technology Wing, Sree Chitra Tirunal Institute for Medical Sciences and Technology, Thiruvananthapuram (India)

2013-05-15

Objectives: The study aims to evaluate the difference in diffusion properties between high grade glioma and low grade glioma by measuring the total magnitude of diffusion tensor (L), and its isotropic (p) and anisotropic (q) components. Methods: The diffusion tensor parameters p, q, L and FA from the tumor area, adjacent area to the tumor and corresponding contra lateral normal area of 30 high grade glioma and 49 low grade glioma were calculated. Chi square analysis was done to find the changes in age and sex. One Way ANOVA was performed to compare the mean and ROC curve analysis to confirm the discriminative sensitivity. Results: Major variation in the mean values of p, L and FA was observed in different brain areas considered. Variation in the p and L values between low grade and high grade glioma were statistically significant (p < 0.001) and their ROC curve analysis yielded 93.9% and 91.8% sensitivity and 53.3% specificity respectively. Conclusion: Measurement of the isotropic component p and the total value of diffusion tensor L can be effectively correlated with different grades of glioma and can be used to study the diffusion properties of tumor affected brain.

Analytical theory and method for longitudinal magneto-optical Kerr effect of optically anisotropic magnetic film

Energy Technology Data Exchange (ETDEWEB)

Wang, Xiao, E-mail: sps_wangx@ujn.edu.cn [School of Physics and Technology, University of Jinan, Jinan 250022 (China); School of Material Science and Engineering, University of Jinan, Jinan 250022 (China); Lian, Jie [School of Information Science and Engineering, Shandong University, Jinan 250100 (China); Li, Ping; Xu, XiJin [School of Physics and Technology, University of Jinan, Jinan 250022 (China); Li, MengMeng [School of Information Science and Engineering, Shandong University, Jinan 250100 (China)

2017-01-15

The Fresnel equations are solved to analyze the reflection and propagation properties of the ordinary and extraordinary light of the optically anisotropic magnetic film. Using the boundary and propagation matrix, the longitudinal magneto-optical Kerr rotation expression is derived. After that, simulations are performed on optically anisotropic and isotropic Co/SiO{sub 2} film. Results show that for Co material in the thin-film limit, the anisotropic Co can provide larger max rotations than the isotropic Co in the visible region. This is because that the refractive index discrepancy of optically anisotropic Co film reduces the Fresnel reflective coefficient r{sub pp,} which improves the Kerr rotation. This makes the optically anisotropic Co film more effective in magneto optical sensor design and device fabrication. - Highlights: • In this work, using the boundary matrix and media propagation matrix developed by Zak and S.D.Bader,we get the analytical solution of the magneto-optical Kerr rotation of the optical anisotropic magnetic film. • Results show that for film in the thin-film limit, the anisotropic Co can provide larger maximum rotations than the isotropic Co. • The improvement of Kerr rotation can be attributed to the refractive index discrepancy of optically anisotropic Co film which reduce the Fresnel reflective coefficient rpp.

Electrical conductivity and ion diffusion in porcine meniscus: effects of strain, anisotropy, and tissue region.

Science.gov (United States)

Kleinhans, Kelsey L; McMahan, Jeffrey B; Jackson, Alicia R

2016-09-06

The purpose of the present study was to investigate the effects of mechanical strain, anisotropy, and tissue region on electrical conductivity and ion diffusivity in meniscus fibrocartilage. A one-dimensional, 4-wire conductivity experiment was employed to measure the electrical conductivity in porcine meniscus tissues from two tissue regions (horn and central), for two tissue orientations (axial and circumferential), and for three levels of compressive strain (0%, 10%, and 20%). Conductivity values were then used to estimate the relative ion diffusivity in meniscus. The water volume fraction of tissue specimens was determined using a buoyancy method. A total of 135 meniscus samples were measured; electrical conductivity values ranged from 2.47mS/cm to 4.84mS/cm, while relative ion diffusivity was in the range of 0.235 to 0.409. Results show that electrical conductivity and ion diffusion are significantly anisotropic (pmeniscus fibrocartilage, which is essential in developing new strategies to treat and/or prevent tissue degeneration. Copyright © 2016 Elsevier Ltd. All rights reserved.

Anisotropic cosmological solutions in massive vector theories

Energy Technology Data Exchange (ETDEWEB)

Heisenberg, Lavinia [Institute for Theoretical Studies, ETH Zurich, Clausiusstrasse 47, 8092 Zurich (Switzerland); Kase, Ryotaro; Tsujikawa, Shinji, E-mail: Lavinia.heisenberg@googlemail.com, E-mail: r.kase@rs.tus.ac.jp, E-mail: shinji@rs.kagu.tus.ac.jp [Department of Physics, Faculty of Science, Tokyo University of Science, 1-3, Kagurazaka, Shinjuku-ku, Tokyo 162-8601 (Japan)

2016-11-01

In beyond-generalized Proca theories including the extension to theories higher than second order, we study the role of a spatial component v of a massive vector field on the anisotropic cosmological background. We show that, as in the case of the isotropic cosmological background, there is no additional ghostly degrees of freedom associated with the Ostrogradski instability. In second-order generalized Proca theories we find the existence of anisotropic solutions on which the ratio between the anisotropic expansion rate Σ and the isotropic expansion rate H remains nearly constant in the radiation-dominated epoch. In the regime where Σ/ H is constant, the spatial vector component v works as a dark radiation with the equation of state close to 1/3. During the matter era, the ratio Σ/ H decreases with the decrease of v . As long as the conditions |Σ| || H and v {sup 2} || φ{sup 2} are satisfied around the onset of late-time cosmic acceleration, where φ is the temporal vector component, we find that the solutions approach the isotropic de Sitter fixed point (Σ = 0 = v ) in accordance with the cosmic no-hair conjecture. In the presence of v and Σ the early evolution of the dark energy equation of state w {sub DE} in the radiation era is different from that in the isotropic case, but the approach to the isotropic value w {sub DE}{sup (iso)} typically occurs at redshifts z much larger than 1. Thus, apart from the existence of dark radiation, the anisotropic cosmological dynamics at low redshifts is similar to that in isotropic generalized Proca theories. In beyond-generalized Proca theories the only consistent solution to avoid the divergence of a determinant of the dynamical system corresponds to v = 0, so Σ always decreases in time.

Anisotropic cosmological solutions in massive vector theories

International Nuclear Information System (INIS)

Heisenberg, Lavinia; Kase, Ryotaro; Tsujikawa, Shinji

2016-01-01

In beyond-generalized Proca theories including the extension to theories higher than second order, we study the role of a spatial component v of a massive vector field on the anisotropic cosmological background. We show that, as in the case of the isotropic cosmological background, there is no additional ghostly degrees of freedom associated with the Ostrogradski instability. In second-order generalized Proca theories we find the existence of anisotropic solutions on which the ratio between the anisotropic expansion rate Σ and the isotropic expansion rate H remains nearly constant in the radiation-dominated epoch. In the regime where Σ/ H is constant, the spatial vector component v works as a dark radiation with the equation of state close to 1/3. During the matter era, the ratio Σ/ H decreases with the decrease of v . As long as the conditions |Σ| || H and v 2 || φ 2 are satisfied around the onset of late-time cosmic acceleration, where φ is the temporal vector component, we find that the solutions approach the isotropic de Sitter fixed point (Σ = 0 = v ) in accordance with the cosmic no-hair conjecture. In the presence of v and Σ the early evolution of the dark energy equation of state w DE in the radiation era is different from that in the isotropic case, but the approach to the isotropic value w DE (iso) typically occurs at redshifts z much larger than 1. Thus, apart from the existence of dark radiation, the anisotropic cosmological dynamics at low redshifts is similar to that in isotropic generalized Proca theories. In beyond-generalized Proca theories the only consistent solution to avoid the divergence of a determinant of the dynamical system corresponds to v = 0, so Σ always decreases in time.

A simple strategy to realize biomimetic surfaces with controlled anisotropic wetting

Science.gov (United States)

Wu, Dong; Chen, Qi-Dai; Yao, Jia; Guan, Yong-Chao; Wang, Jian-Nan; Niu, Li-Gang; Fang, Hong-Hua; Sun, Hong-Bo

2010-02-01

The study of anisotropic wetting has become one of the most important research areas in biomimicry. However, realization of controlled anisotropic surfaces remains challenging. Here we investigated anisotropic wetting on grooves with different linewidth, period, and height fabricated by laser interference lithography and found that the anisotropy strongly depended on the height. The anisotropy significantly increased from 9° to 48° when the height was changed from 100 nm to 1.3 μm. This was interpreted by a thermodynamic model as a consequence of the increase of free energy barriers versus the height increase. According to the relationship, controlled anisotropic surfaces were rapidly realized by adjusting the grooves' height that was simply accomplished by changing the resin thickness. Finally, the perpendicular contact angle was further enhanced to 131°±2° by surface modification, which was very close to 135°±3° of a common grass leaf.

Diffusion of Botulinum Toxins

Directory of Open Access Journals (Sweden)

Matthew A. Brodsky

2012-08-01

Full Text Available Background: It is generally agreed that diffusion of botulinum toxin occurs, but the extent of the spread and its clinical importance are disputed. Many factors have been suggested to play a role but which have the most clinical relevance is a subject of much discussion.Methods: This review discusses the variables affecting diffusion, including protein composition and molecular size as well as injection factors (e.g., volume, dose, injection method. It also discusses data on diffusion from comparative studies in animal models and human clinical trials that illustrate differences between the available botulinum toxin products (onabotulinumtoxinA, abobotulinumtoxinA, incobotulinumtoxinA, and rimabotulinumtoxinB.Results: Neither molecular weight nor the presence of complexing proteins appears to affect diffusion; however, injection volume, concentration, and dose all play roles and are modifiable. Both animal and human studies show that botulinum toxin products are not interchangeable, and that some products are associated with greater diffusion and higher rates of diffusion-related adverse events than others.Discussion: Each of the botulinum toxins is a unique pharmacologic entity. A working knowledge of the different serotypes is essential to avoid unwanted diffusion-related adverse events. In addition, clinicians should be aware that the factors influencing diffusion may range from properties intrinsic to the drug to accurate muscle selection as well as dilution, volume, and dose injected.

Pattern formation of a nonlocal, anisotropic interaction model

KAUST Repository

Burger, Martin

2017-11-24

We consider a class of interacting particle models with anisotropic, repulsive–attractive interaction forces whose orientations depend on an underlying tensor field. An example of this class of models is the so-called Kücken–Champod model describing the formation of fingerprint patterns. This class of models can be regarded as a generalization of a gradient flow of a nonlocal interaction potential which has a local repulsion and a long-range attraction structure. In contrast to isotropic interaction models the anisotropic forces in our class of models cannot be derived from a potential. The underlying tensor field introduces an anisotropy leading to complex patterns which do not occur in isotropic models. This anisotropy is characterized by one parameter in the model. We study the variation of this parameter, describing the transition between the isotropic and the anisotropic model, analytically and numerically. We analyze the equilibria of the corresponding mean-field partial differential equation and investigate pattern formation numerically in two dimensions by studying the dependence of the parameters in the model on the resulting patterns.

Pattern formation of a nonlocal, anisotropic interaction model

KAUST Repository

Burger, Martin; Dü ring, Bertram; Kreusser, Lisa Maria; Markowich, Peter A.; Schö nlieb, Carola-Bibiane

2017-01-01

We consider a class of interacting particle models with anisotropic, repulsive–attractive interaction forces whose orientations depend on an underlying tensor field. An example of this class of models is the so-called Kücken–Champod model describing the formation of fingerprint patterns. This class of models can be regarded as a generalization of a gradient flow of a nonlocal interaction potential which has a local repulsion and a long-range attraction structure. In contrast to isotropic interaction models the anisotropic forces in our class of models cannot be derived from a potential. The underlying tensor field introduces an anisotropy leading to complex patterns which do not occur in isotropic models. This anisotropy is characterized by one parameter in the model. We study the variation of this parameter, describing the transition between the isotropic and the anisotropic model, analytically and numerically. We analyze the equilibria of the corresponding mean-field partial differential equation and investigate pattern formation numerically in two dimensions by studying the dependence of the parameters in the model on the resulting patterns.

DNA-nanoparticle superlattices formed from anisotropic building blocks

Science.gov (United States)

Jones, Matthew R.; Macfarlane, Robert J.; Lee, Byeongdu; Zhang, Jian; Young, Kaylie L.; Senesi, Andrew J.; Mirkin, Chad A.

2010-11-01

Directional bonding interactions in solid-state atomic lattices dictate the unique symmetries of atomic crystals, resulting in a diverse and complex assortment of three-dimensional structures that exhibit a wide variety of material properties. Methods to create analogous nanoparticle superlattices are beginning to be realized, but the concept of anisotropy is still largely underdeveloped in most particle assembly schemes. Some examples provide interesting methods to take advantage of anisotropic effects, but most are able to make only small clusters or lattices that are limited in crystallinity and especially in lattice parameter programmability. Anisotropic nanoparticles can be used to impart directional bonding interactions on the nanoscale, both through face-selective functionalization of the particle with recognition elements to introduce the concept of valency, and through anisotropic interactions resulting from particle shape. In this work, we examine the concept of inherent shape-directed crystallization in the context of DNA-mediated nanoparticle assembly. Importantly, we show how the anisotropy of these particles can be used to synthesize one-, two- and three-dimensional structures that cannot be made through the assembly of spherical particles.

Surface Waves Propagating on Grounded Anisotropic Dielectric Slab

Directory of Open Access Journals (Sweden)

Zhuozhu Chen

2018-01-01

Full Text Available This paper investigates the characteristics of surface waves propagating on a grounded anisotropic dielectric slab. Distinct from the existing analyses that generally assume that the fields of surface wave uniformly distribute along the transverse direction of the infinitely large grounded slab, our method takes into account the field variations along the transverse direction of a finite-width slab. By solving Maxwell’s equations in closed-form, it is revealed that no pure transverse magnetic (TM or transverse electric (TE mode exists if the fields are non-uniformly distributed along the transverse direction of the grounded slab. Instead, two hybrid modes, namely quasi-TM and quasi-TE modes, are supported. In addition, the propagation characteristics of two hybrid modes supported by the grounded anisotropic slab are analyzed in terms of the slab thickness, slab width, as well as the relative permittivity tensor of the anisotropic slab. Furthermore, different methods are employed to compare the analyses, as well as to validate our derivations. The proposed method is very suitable for practical engineering applications.

Size-dependent effective properties of anisotropic piezoelectric composites with piezoelectric nano-particles

International Nuclear Information System (INIS)

Huang, Ming-Juan; Fang, Xue-Qian; Liu, Jin-Xi; Feng, Wen-Jie; Zhao, Yong-Mao

2015-01-01

Based on the electro-elastic surface/interface theory, the size-dependent effective piezoelectric and dielectric coefficients of anisotropic piezoelectric composites that consist of spherically piezoelectric inclusions under a uniform electric field are investigated, and the analytical solutions for the elastic displacement and electric potentials are derived. With consideration of the coupling effects of elasticity, permittivity and piezoelectricity, the effective field method is introduced to derive the effective dielectric and piezoelectric responses in the dilute limit. The numerical examples show that the effective dielectric constant exhibits a significant variation due to the surface/interface effect. The dielectric property of the surface/interface displays greater effect than the piezoelectric property, and the elastic property shows little effect. A comparison with the existing results validates the present approach. (paper)

Comparison of Experimental Methods for Estimating Matrix Diffusion Coefficients for Contaminant Transport Modeling

Energy Technology Data Exchange (ETDEWEB)

Telfeyan, Katherine Christina [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Ware, Stuart Douglas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Reimus, Paul William [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Birdsell, Kay Hanson [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-11-06

Diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged from 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.

Comparison of experimental methods for estimating matrix diffusion coefficients for contaminant transport modeling

Science.gov (United States)

Telfeyan, Katherine; Ware, S. Doug; Reimus, Paul W.; Birdsell, Kay H.

2018-02-01

Diffusion cell and diffusion wafer experiments were conducted to compare methods for estimating effective matrix diffusion coefficients in rock core samples from Pahute Mesa at the Nevada Nuclear Security Site (NNSS). A diffusion wafer method, in which a solute diffuses out of a rock matrix that is pre-saturated with water containing the solute, is presented as a simpler alternative to the traditional through-diffusion (diffusion cell) method. Both methods yielded estimates of effective matrix diffusion coefficients that were within the range of values previously reported for NNSS volcanic rocks. The difference between the estimates of the two methods ranged from 14 to 30%, and there was no systematic high or low bias of one method relative to the other. From a transport modeling perspective, these differences are relatively minor when one considers that other variables (e.g., fracture apertures, fracture spacings) influence matrix diffusion to a greater degree and tend to have greater uncertainty than effective matrix diffusion coefficients. For the same relative random errors in concentration measurements, the diffusion cell method yields effective matrix diffusion coefficient estimates that have less uncertainty than the wafer method. However, the wafer method is easier and less costly to implement and yields estimates more quickly, thus allowing a greater number of samples to be analyzed for the same cost and time. Given the relatively good agreement between the methods, and the lack of any apparent bias between the methods, the diffusion wafer method appears to offer advantages over the diffusion cell method if better statistical representation of a given set of rock samples is desired.

SO-FDTD analysis of anisotropic magnetized plasma

International Nuclear Information System (INIS)

Yang Hongwei; Nanjing Univ. of Science and Technology, Nanjing; Yuan Hong; Chen Rushan; Yang Yang

2007-01-01

A novel finite-difference time-domain (FDTD) method, called shift operator FDTD (SO-FDTD) method is developed for anisotropic magnetized dispersive media. The recursive relation between operators is used. In this paper, some expressions containing the dielectric constants of magnetized dispersive media are written as rational polynomial function. The SO-FDTD formulation for anisotropic magnetized plasma is derived. The high efficiency and effectiveness of the method are confirmed by computing the reflection and transmission through a magnetized plasma layer, with the direction of the propagation parallel to the direction of the biasing field. A comparison with frequency domain analytic results is included. The CPU time was several times shorter than that of the JEC method. (authors)

Newton–Hooke-type symmetry of anisotropic oscillators

International Nuclear Information System (INIS)

Zhang, P.M.; Horvathy, P.A.; Andrzejewski, K.; Gonera, J.; Kosiński, P.

2013-01-01

Rotation-less Newton–Hooke-type symmetry, found recently in the Hill problem, and instrumental for explaining the center-of-mass decomposition, is generalized to an arbitrary anisotropic oscillator in the plane. Conversely, the latter system is shown, by the orbit method, to be the most general one with such a symmetry. Full Newton–Hooke symmetry is recovered in the isotropic case. Star escape from a galaxy is studied as an application. -- Highlights: ► Rotation-less Newton–Hooke (NH) symmetry is generalized to an arbitrary anisotropic oscillator. ► The orbit method is used to find the most general case for rotation-less NH symmetry. ► The NH symmetry is decomposed into Heisenberg algebras based on chiral decomposition

Inflationary perturbations in anisotropic, shear-free universes

International Nuclear Information System (INIS)

Pereira, Thiago S.; Carneiro, Saulo; Marugan, Guillermo A. Mena

2012-01-01

In this work, the linear and gauge-invariant theory of cosmological perturbations in a class of anisotropic and shear-free spacetimes is developed. After constructing an explicit set of complete eigenfunctions in terms of which perturbations can be expanded, we identify the effective degrees of freedom during a generic slow-roll inflationary phase. These correspond to the anisotropic equivalent of the standard Mukhanov-Sasaki variables. The associated equations of motion present a remarkable resemblance to those found in perturbed Friedmann-Robertson-Walker spacetimes with curvature, apart from the spectrum of the Laplacian, which exhibits the characteristic frequencies of the underlying geometry. In particular, it is found that the perturbations cannot develop arbitrarily large super-Hubble modes

Generalized analytic solutions and response characteristics of magnetotelluric fields on anisotropic infinite faults

Science.gov (United States)

Bing, Xue; Yicai, Ji

2018-06-01

In order to understand directly and analyze accurately the detected magnetotelluric (MT) data on anisotropic infinite faults, two-dimensional partial differential equations of MT fields are used to establish a model of anisotropic infinite faults using the Fourier transform method. A multi-fault model is developed to expand the one-fault model. The transverse electric mode and transverse magnetic mode analytic solutions are derived using two-infinite-fault models. The infinite integral terms of the quasi-analytic solutions are discussed. The dual-fault model is computed using the finite element method to verify the correctness of the solutions. The MT responses of isotropic and anisotropic media are calculated to analyze the response functions by different anisotropic conductivity structures. The thickness and conductivity of the media, influencing MT responses, are discussed. The analytic principles are also given. The analysis results are significant to how MT responses are perceived and to the data interpretation of the complex anisotropic infinite faults.

A magnetic relaxation study on anisotropic reorientation in aqueous polyelectrolyte solutions

International Nuclear Information System (INIS)

Mulder, C.W.R.

1984-01-01

The present thesis proposes a study on anisotropic reorientation of aqueous polyelectrolyte solutions. In particular, it is directed to the question to what extent information may be obtained on anisotropic reorientation by nuclear magnetic relaxation experiments. The polymethacrylic acid/water system has been chosen as probe system. (Auth.)

Anisotropic magnetoresistance in a Fermi glass

International Nuclear Information System (INIS)

Ovadyahu, Z.; Physics Department, Ben-Gurion University of the Negev, Beer-Sheva, Israel 84120)

1986-01-01

Insulating thin films of indium oxide exhibit negative, anisotropic magnetoresistance. The systematics of these results imply that the magnetoresistance mechanism may give different weight to the distribution of the localization lengths than that given by the hopping conductivity

Plasma diffusion due to magnetic field fluctuations

International Nuclear Information System (INIS)

Okuda, H.; Lee, W.W.; Lin, A.T.

1979-01-01

Plasma diffusion due to magnetic field fluctuations has been studied in two dimensions for a plasma near thermal equilibrium and when the fluctuations are suprathermal. It is found that near thermal equilibrium electron diffusion varies as B -2 when the collisionless skin depth is greater than the thermal electron gyroradius and is generally smaller than the diffusion due to collisions or electrostatic fluctuations for a low-β plasma. When the suprathermal magnetic fluctuation exists because of macroscopic plasma currents, electron diffusion is enhanced due to the coalescence of current filaments and magnetic islands. Magnetic field energy is found to condense to the longest wavelength available in the system and stays there longer than the electron diffusion time scale

Cosmological signatures of anisotropic spatial curvature

International Nuclear Information System (INIS)

Pereira, Thiago S.; Marugán, Guillermo A. Mena; Carneiro, Saulo

2015-01-01

If one is willing to give up the cherished hypothesis of spatial isotropy, many interesting cosmological models can be developed beyond the simple anisotropically expanding scenarios. One interesting possibility is presented by shear-free models in which the anisotropy emerges at the level of the curvature of the homogeneous spatial sections, whereas the expansion is dictated by a single scale factor. We show that such models represent viable alternatives to describe the large-scale structure of the inflationary universe, leading to a kinematically equivalent Sachs-Wolfe effect. Through the definition of a complete set of spatial eigenfunctions we compute the two-point correlation function of scalar perturbations in these models. In addition, we show how such scenarios would modify the spectrum of the CMB assuming that the observations take place in a small patch of a universe with anisotropic curvature

Cosmological signatures of anisotropic spatial curvature

Energy Technology Data Exchange (ETDEWEB)

Pereira, Thiago S. [Departamento de Física, Universidade Estadual de Londrina, 86057-970, Londrina – PR (Brazil); Marugán, Guillermo A. Mena [Instituto de Estructura de la Materia, IEM-CSIC, Serrano 121, 28006, Madrid (Spain); Carneiro, Saulo, E-mail: tspereira@uel.br, E-mail: mena@iem.cfmac.csic.es, E-mail: saulo.carneiro@pq.cnpq.br [Instituto de Física, Universidade Federal da Bahia, 40210-340, Salvador – BA (Brazil)

2015-07-01

If one is willing to give up the cherished hypothesis of spatial isotropy, many interesting cosmological models can be developed beyond the simple anisotropically expanding scenarios. One interesting possibility is presented by shear-free models in which the anisotropy emerges at the level of the curvature of the homogeneous spatial sections, whereas the expansion is dictated by a single scale factor. We show that such models represent viable alternatives to describe the large-scale structure of the inflationary universe, leading to a kinematically equivalent Sachs-Wolfe effect. Through the definition of a complete set of spatial eigenfunctions we compute the two-point correlation function of scalar perturbations in these models. In addition, we show how such scenarios would modify the spectrum of the CMB assuming that the observations take place in a small patch of a universe with anisotropic curvature.

Inhomogeneous anisotropic cosmology

International Nuclear Information System (INIS)

Kleban, Matthew; Senatore, Leonardo

2016-01-01

In homogeneous and isotropic Friedmann-Robertson-Walker cosmology, the topology of the universe determines its ultimate fate. If the Weak Energy Condition is satisfied, open and flat universes must expand forever, while closed cosmologies can recollapse to a Big Crunch. A similar statement holds for homogeneous but anisotropic (Bianchi) universes. Here, we prove that arbitrarily inhomogeneous and anisotropic cosmologies with “flat” (including toroidal) and “open” (including compact hyperbolic) spatial topology that are initially expanding must continue to expand forever at least in some region at a rate bounded from below by a positive number, despite the presence of arbitrarily large density fluctuations and/or the formation of black holes. Because the set of 3-manifold topologies is countable, a single integer determines the ultimate fate of the universe, and, in a specific sense, most 3-manifolds are “flat” or “open”. Our result has important implications for inflation: if there is a positive cosmological constant (or suitable inflationary potential) and initial conditions for the inflaton, cosmologies with “flat” or “open” topology must expand forever in some region at least as fast as de Sitter space, and are therefore very likely to begin inflationary expansion eventually, regardless of the scale of the inflationary energy or the spectrum and amplitude of initial inhomogeneities and gravitational waves. Our result is also significant for numerical general relativity, which often makes use of periodic (toroidal) boundary conditions.

Longitudinal fluctuations and decorrelation of anisotropic flow

Energy Technology Data Exchange (ETDEWEB)

Pang, Long-Gang [Frankfurt Institute for Advanced Studies, Ruth-Moufang-Strasse 1, 60438 Frankfurt am Main (Germany); Petersen, Hannah [Frankfurt Institute for Advanced Studies, Ruth-Moufang-Strasse 1, 60438 Frankfurt am Main (Germany); Institute for Theoretical Physics, Goethe University, Max-von-Laue-Strasse 1, 60438 Frankfurt am Main (Germany); GSI Helmholtzzentrum für Schwerionenforschung, Planckstr. 1, 64291 Darmstadt (Germany); Qin, Guang-You [Key Laboratory of Quark & Lepton Physics (MOE) and Institute of Particle Physics, Central China Normal University, Wuhan 430079 (China); Roy, Victor [Institute for Theoretical Physics, Goethe University, Max-von-Laue-Strasse 1, 60438 Frankfurt am Main (Germany); Wang, Xin-Nian [Key Laboratory of Quark & Lepton Physics (MOE) and Institute of Particle Physics, Central China Normal University, Wuhan 430079 (China); Nuclear Science Division MS70R0319, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)

2016-12-15

We investigate the decorrelation of 2nd and 3rd order anisotropic flow for charged particles in two different pseudo rapidity (η) windows by varying the pseudo rapidity gap, in an event-by-event (3+1)D ideal hydrodynamic model, with fluctuating initial conditions from A Multi-Phase Transport (AMPT) model. We visualize the parton distribution at initial state for Pb+Pb collisions at LHC and Au+Au collisions at RHIC, and demonstrate the longitudinal fluctuations originating from the asymmetry between forward and backward going participants, the fluctuations of the string length and the fluctuations due to finite number of partons at different beam energies. The decorrelation of anisotropic flow of final hadrons with large η gaps is found to originate from the spatial decorrelation along the longitudinal direction in the AMPT initial conditions through hydrodynamic evolution. The agreement between our results and recent CMS data in most centralities suggests that the string-like mechanism of initial parton production in AMPT model captures the initial longitudinal fluctuation that is responsible for the measured decorrelation of anisotropic flow in Pb+Pb collisions at LHC. Our predictions for Au+Au collisions at the highest RHIC energy show stronger longitudinal decorrelation than at LHC, indicating larger longitudinal fluctuations at lower beam energies.

Ultra-wideband reflective polarization converter based on anisotropic metasurface

International Nuclear Information System (INIS)

Wu Jia-Liang; Lin Bao-Qin; Da Xin-Yu

2016-01-01

In this paper, we propose an ultra-wideband reflective linear cross-polarization converter based on anisotropic metasurface. Its unit cell is composed of a square-shaped resonator with intersectant diagonal and metallic ground sheet separated by dielectric substrate. Simulated results show that the converter can generate resonances at four frequencies under normal incident electromagnetic (EM) wave, leading to the bandwidth expansion of cross-polarization reflection. For verification, the designed polarization converter is fabricated and measured. The measured and simulated results agree well with each other, showing that the fabricated converter can convert x - or y -polarized incident wave into its cross polarized wave in a frequency range from 7.57 GHz to 20.46 GHz with a relative bandwidth of 91.2%, and the polarization conversion efficiency is greater than 90%. The proposed polarization converter has a simple geometry but an ultra wideband compared with the published designs, and hence possesses potential applications in novel polarization-control devices. (paper)

Magnetic relaxation in anisotropic magnets

DEFF Research Database (Denmark)

Lindgård, Per-Anker

1971-01-01

The line shape and the kinematic and thermodynamic slowing down of the critical and paramagnetic relaxation in axially anisotropic materials are discussed. Kinematic slowing down occurs only in the longitudinal relaxation function. The thermodynamic slowing down occurs in either the transverse...... or longitudinal relaxation function depending on the sign of the axial anisotropy....

Anisotropic stress as a signature of nonstandard propagation of gravitational waves.

Science.gov (United States)

Saltas, Ippocratis D; Sawicki, Ignacy; Amendola, Luca; Kunz, Martin

2014-11-07

We make precise the heretofore ambiguous statement that anisotropic stress is a sign of a modification of gravity. We show that in cosmological solutions of very general classes of models extending gravity-all scalar-tensor theories (Horndeski), Einstein-aether models, and bimetric massive gravity-a direct correspondence exists between perfect fluids apparently carrying anisotropic stress and a modification in the propagation of gravitational waves. Since the anisotropic stress can be measured in a model-independent manner, a comparison of the behavior of gravitational waves from cosmological sources with large-scale-structure formation could, in principle, lead to new constraints on the theory of gravity.

Anisotropic Failure Strength of Shale with Increasing Confinement: Behaviors, Factors and Mechanism.

Science.gov (United States)

Cheng, Cheng; Li, Xiao; Qian, Haitao

2017-11-15

Some studies reported that the anisotropic failure strength of shale will be weakened by increasing confinement. In this paper, it is found that there are various types of anisotropic strength behaviors. Four types of anisotropic strength ratio ( S A 1 ) behaviors and three types of anisotropic strength difference ( S A 2 ) behaviors have been classified based on laboratory experiments on nine groups of different shale samples. The cohesion c w and friction angle ϕ w of the weak planes are proven to be two dominant factors according to a series of bonded-particle discrete element modelling analyses. It is observed that shale is more prone to a slight increase of S A 1 and significant increase of S A 2 with increasing confinement for higher cohesion c w and lower to medium friction angle ϕ w . This study also investigated the mechanism of the anisotropic strength behaviors with increasing confinement. Owing to different contributions of c w and ϕ w under different confinements, different combinations of c w and ϕ w may have various types of influences on the minimum failure strength with the increasing confinement; therefore, different types of anisotropic behaviors occur for different shale specimens as the confinement increases. These findings are very important to understand the stability of wellbore and underground tunneling in the shale rock mass, and should be helpful for further studies on hydraulic fracture propagations in the shale reservoir.

Study of anisotropic mechanical properties for aeronautical PMMA

Directory of Open Access Journals (Sweden)

Wei Shang

Full Text Available For the properties of polymer are relative to its structure, the main purpose of the present work is to investigate the mechanical properties of the aeronautical PMMA which has been treated by the directional tensile technology. Isodyne images reveal the stress state in directional PMMA. And then, an anisotropic mechanical model is established. Furthermore, all mechanical parameters are measured by the digital image correlation method. Finally, based on the anisotropic mechanical model and mechanical parameters, the FEM numerical simulation and experimental methods are applied to analyze the fracture mechanical properties along different directions.

Understanding nanoparticle-mediated nucleation pathways of anisotropic nanoparticles

Science.gov (United States)

Laramy, Christine R.; Fong, Lam-Kiu; Jones, Matthew R.; O'Brien, Matthew N.; Schatz, George C.; Mirkin, Chad A.

2017-09-01

Several seed-mediated syntheses of low symmetry anisotropic nanoparticles yield broad product distributions with multiple defect structures. This observation challenges the role of the nanoparticle precursor as a seed for certain syntheses and suggests the possibility of alternate nucleation pathways. Herein, we report a method to probe the role of the nanoparticle precursor in anisotropic nanoparticle nucleation with compositional and structural 'labels' to track their fate. We use the synthesis of gold triangular nanoprisms (Au TPs) as a model system. We propose a mechanism in which, rather than acting as a template, the nanoparticle precursor catalyzes homogenous nucleation of Au TPs.

MHz gravitational waves from short-term anisotropic inflation

International Nuclear Information System (INIS)

Ito, Asuka; Soda, Jiro

2016-01-01

We reveal the universality of short-term anisotropic inflation. As a demonstration, we study inflation with an exponential type gauge kinetic function which is ubiquitous in models obtained by dimensional reduction from higher dimensional fundamental theory. It turns out that an anisotropic inflation universally takes place in the later stage of conventional inflation. Remarkably, we find that primordial gravitational waves with a peak amplitude around 10 −26 ∼10 −27 are copiously produced in high-frequency bands 10 MHz∼100 MHz. If we could detect such gravitational waves in future, we would be able to probe higher dimensional fundamental theory.

Thermal fluctuations and critical behavior in a magnetized, anisotropic plasma

International Nuclear Information System (INIS)

Hazeltine, R. D.; Mahajan, S. M.

2013-01-01

Thermal fluctuations in a magnetized, anisotropic plasma are studied by applying standard methods, based on the Einstein rule, to the known thermodynamic potential of the system. It is found in particular that magnetic fluctuations become critical when the anisotropy p ∥ −p ⊥ changes sign. By examining the critical region, additional insight on the equations of state for near-critical anisotropic plasma is obtained

Linear astrophysical dynamos in rotating spheres: Differential rotation, anisotropic turbulent magnetic diffusivity, and solar-stellar cycle magnetic parity

International Nuclear Information System (INIS)

Yoshimura, H.; Wang, Z.; Wu, F.

1984-01-01

Differential rotation dependence of the selection mechanism for magnetic parity of solar and stellar cycles is studied by assuming various differential rotation profiles inn the dynamo equation. The parity selection depends on propagation direction of oscillating magnetic fields in the form of dynamo waves which propagate along isorotation surfaces. When there is any radial gradient in the differential rotation, dynamo waves propagate either equatorward or poleward. In the former case, field systems of the two hemispheres approach each other and collide at the equator. Then, odd parity is selected. In the latter case, field systems of the two hemispheres recede from each other and do not collide at the equator, an even parity is selected. Thus the equatorial migration of wings of the butterfly iagram of the solar cycle and its odd parity are intrinsically related. In the case of purely latitudibnal differential rotation, dynamo waves propagate purely radially and growth rates of odd and even modes are nearly the same even when dynamo strength is weak when the parity selection mechanism should work most efficiently. In this case, anisotropy of turbulent diffusivity is a decisive factor to separate odd and even modes. Unlike in the case of radial-gradient-dominated differential rotation in which any difference between diffusivities for poloidal and toroidal fields enhancess the parity selection without changing the parity, the parity selection in the case of latitudinal-gradient-dominated differential rotation depends on the difference of diffusivities for poloidal and toroidal fields. When diffusivity for poloidal fields iss larger than that for toroidal fields, odd parity is selected; and when diffusivity for toroidal fields is larger, even parity is selected

Effective medium theory for anisotropic metamaterials

KAUST Repository

Zhang, Xiujuan; Wu, Ying

2015-01-01

-dimensional metamaterial composed of a rectangular array of elliptic cylinders and derive an effective medium theory for such a metamaterial. We find that it is possible to obtain a closed-form analytical solution for the anisotropic effective medium parameters, provided

Casimir interactions for anisotropic magnetodielectric metamaterials

Energy Technology Data Exchange (ETDEWEB)

Da Rosa, Felipe S [Los Alamos National Laboratory; Dalvit, Diego A [Los Alamos National Laboratory; Milonni, Peter W [Los Alamos National Laboratory

2008-01-01

We extend our previous work on the generalization of the Casimir-Lifshitz theory to treat anisotropic magnetodielectric media, focusing on the forces between metals and magnetodielectric metamaterials and on the possibility of inferring magnetic effects by measurements of these forces.

Acoustic anisotropic wavefields through perturbation theory

KAUST Repository

Alkhalifah, Tariq Ali

2013-01-01

these restrictions are the inability to handle media with η<0 and the presence of shear-wave artifacts in the solution. Both limitations do not exist in the solution of the elliptical anisotropic acoustic wave equation. Using perturbation theory in developing

Diffusion in building wakes

International Nuclear Information System (INIS)

Ramsdell, J.V.

1988-03-01

Straight-line Gaussian models adequately describe atmospheric diffusion for many applications. They have been modified for use in estimating diffusion in building wakes by adding terms that include projected building area and by redefining the diffusion coefficients so that the coefficients have minimum values that are related to building dimensions. In a recent study, Ramsdell reviewed the building-wake dispersion models used by the Nuclear Regulatory Commission (NRC) in its control room habitability assessments. The review included comparison of model estimates of centerline concentrations with concentrations observed in experiments at seven nuclear reactors. In general, the models are conservative in that they tend to predict concentrations that are greater than those actually observed. However, the models show little skill in accounting for variations in the observed concentrations. Subsequently, the experimental data and multiples linear regression techniques have been used to develop a new building wake diffusion model. This paper describes the new building wake model and compares it with other models. 8 refs., 2 figs

Anisotropic modelling of the electrical conductivity of fractured bedrock

International Nuclear Information System (INIS)

Flykt, M.J.; Sihvola, A.H.; Eloranta, E.H.

1995-01-01

The electromagnetic characterization of fractured bedrock is of importance when studying the final disposal of nuclear waste. The different types of discontinuities at all scales in rocks can be viewed as an inhomogeneity. In some cases there are reasons to assume the influence of the discontinuities on electrical conductivity is anisotropic in character. The effort has been made to use electromagnetic mixing rules in the definition of an equivalent homogeneous anisotropic conductivity tensor for such fractured rock mass. (author) (16 refs., 6 figs.)

Fourier Multipliers on Anisotropic Mixed-Norm Spaces of Distributions

DEFF Research Database (Denmark)

Cleanthous, Galatia; Georgiadis, Athanasios; Nielsen, Morten

2018-01-01

A new general Hormander type condition involving anisotropies and mixed norms is introduced, and boundedness results for Fourier multi- pliers on anisotropic Besov and Triebel-Lizorkin spaces of distributions with mixed Lebesgue norms are obtained. As an application, the continuity of such operat......A new general Hormander type condition involving anisotropies and mixed norms is introduced, and boundedness results for Fourier multi- pliers on anisotropic Besov and Triebel-Lizorkin spaces of distributions with mixed Lebesgue norms are obtained. As an application, the continuity...

Thin-source concentration dependent diffusion

International Nuclear Information System (INIS)

Eng, G.

1978-01-01

The diffusion of (Ca ++ ) in NaCl has been measured for various diffusion times and for the temperature range (575 0 to 775 0 C), using a thin-source of 45 Ca tracer, rectangular geometry, and serial sectioning. The pre-diffusion surface concentration was approximately 3 x 10 16 (Ca)-atoms/cm 2 , which, for an average penetration depth of 100 to 300 μm, produces a maximum (post-diffusion) impurity concentration comparable to or greater than the intrinsic cation vacancy concentration. The high-temperature function closely matches the D 0 (T) function obtained from low impurity concentration experiments. The lower-temperature function, combined with the sudden failure of the D(C) = D 0 (1 + [C] + 0.5[C] 2 ) function at these lower temperatures, indicates the onset of a second diffusion process, one which would operate only at extremely high impurity concentrations. This low-temperature behavior is shown to be consistent with a breakdown of the conditions assumed for vacancy equilibrium

Features of the electric-field distribution in anisotropic semiconductor wafers in a transverse magnetic field

International Nuclear Information System (INIS)

Filippov, V. V.; Bormontov, E. N.

2013-01-01

A macroscopic model of the Hall effects and magnetoresistance in anisotropic semiconductor wafers is developed. The results obtained by solving the electrodynamic boundary problem allow the potential and eddy currents in anisotropic semiconductors to be calculated at different current-contact locations, depending on the parameters of the sample material’s anisotropy. The results of this study are of great practical importance for investigating the physical properties of anisotropic semiconductors and simulating the electron-transport phenomena in devices based on anisotropic semiconductors

Features of the electric-field distribution in anisotropic semiconductor wafers in a transverse magnetic field

Energy Technology Data Exchange (ETDEWEB)

Filippov, V. V., E-mail: wwfilippow@mail.ru [Lipetsk State Pedagogical University (Russian Federation); Bormontov, E. N. [Voronezh State University (Russian Federation)

2013-07-15

A macroscopic model of the Hall effects and magnetoresistance in anisotropic semiconductor wafers is developed. The results obtained by solving the electrodynamic boundary problem allow the potential and eddy currents in anisotropic semiconductors to be calculated at different current-contact locations, depending on the parameters of the sample material's anisotropy. The results of this study are of great practical importance for investigating the physical properties of anisotropic semiconductors and simulating the electron-transport phenomena in devices based on anisotropic semiconductors.

Two-point paraxial traveltime formula for inhomogeneous isotropic and anisotropic media: Tests of accuracy

KAUST Repository

Waheed, Umair bin; Psencik, Ivan; Cerveny, Vlastislav; Iversen, Einar; Alkhalifah, Tariq Ali

2013-01-01

On several simple models of isotropic and anisotropic media, we have studied the accuracy of the two-point paraxial traveltime formula designed for the approximate calculation of the traveltime between points S' and R' located in the vicinity of points S and R on a reference ray. The reference ray may be situated in a 3D inhomogeneous isotropic or anisotropic medium with or without smooth curved interfaces. The twopoint paraxial traveltime formula has the form of the Taylor expansion of the two-point traveltime with respect to spatial Cartesian coordinates up to quadratic terms at points S and R on the reference ray. The constant term and the coefficients of the linear and quadratic terms are determined from quantities obtained from ray tracing and linear dynamic ray tracing along the reference ray. The use of linear dynamic ray tracing allows the evaluation of the quadratic terms in arbitrarily inhomogeneous media and, as shown by examples, it extends the region of accurate results around the reference ray between S and R (and even outside this interval) obtained with the linear terms only. Although the formula may be used for very general 3D models, we concentrated on simple 2D models of smoothly inhomogeneous isotropic and anisotropic (~8% and ~20% anisotropy) media only. On tests, in which we estimated twopoint traveltimes between a shifted source and a system of shifted receivers, we found that the formula may yield more accurate results than the numerical solution of an eikonal-based differential equation. The tests also indicated that the accuracy of the formula depends primarily on the length and the curvature of the reference ray and only weakly depends on anisotropy. The greater is the curvature of the reference ray, the narrower its vicinity, in which the formula yields accurate results.

Two-point paraxial traveltime formula for inhomogeneous isotropic and anisotropic media: Tests of accuracy

KAUST Repository

Waheed, Umair bin

2013-09-01

On several simple models of isotropic and anisotropic media, we have studied the accuracy of the two-point paraxial traveltime formula designed for the approximate calculation of the traveltime between points S\\' and R\\' located in the vicinity of points S and R on a reference ray. The reference ray may be situated in a 3D inhomogeneous isotropic or anisotropic medium with or without smooth curved interfaces. The twopoint paraxial traveltime formula has the form of the Taylor expansion of the two-point traveltime with respect to spatial Cartesian coordinates up to quadratic terms at points S and R on the reference ray. The constant term and the coefficients of the linear and quadratic terms are determined from quantities obtained from ray tracing and linear dynamic ray tracing along the reference ray. The use of linear dynamic ray tracing allows the evaluation of the quadratic terms in arbitrarily inhomogeneous media and, as shown by examples, it extends the region of accurate results around the reference ray between S and R (and even outside this interval) obtained with the linear terms only. Although the formula may be used for very general 3D models, we concentrated on simple 2D models of smoothly inhomogeneous isotropic and anisotropic (~8% and ~20% anisotropy) media only. On tests, in which we estimated twopoint traveltimes between a shifted source and a system of shifted receivers, we found that the formula may yield more accurate results than the numerical solution of an eikonal-based differential equation. The tests also indicated that the accuracy of the formula depends primarily on the length and the curvature of the reference ray and only weakly depends on anisotropy. The greater is the curvature of the reference ray, the narrower its vicinity, in which the formula yields accurate results.

1-D DC Resistivity Modeling and Interpretation in Anisotropic Media Using Particle Swarm Optimization

Science.gov (United States)

Pekşen, Ertan; Yas, Türker; Kıyak, Alper

2014-09-01

We examine the one-dimensional direct current method in anisotropic earth formation. We derive an analytic expression of a simple, two-layered anisotropic earth model. Further, we also consider a horizontally layered anisotropic earth response with respect to the digital filter method, which yields a quasi-analytic solution over anisotropic media. These analytic and quasi-analytic solutions are useful tests for numerical codes. A two-dimensional finite difference earth model in anisotropic media is presented in order to generate a synthetic data set for a simple one-dimensional earth. Further, we propose a particle swarm optimization method for estimating the model parameters of a layered anisotropic earth model such as horizontal and vertical resistivities, and thickness. The particle swarm optimization is a naturally inspired meta-heuristic algorithm. The proposed method finds model parameters quite successfully based on synthetic and field data. However, adding 5 % Gaussian noise to the synthetic data increases the ambiguity of the value of the model parameters. For this reason, the results should be controlled by a number of statistical tests. In this study, we use probability density function within 95 % confidence interval, parameter variation of each iteration and frequency distribution of the model parameters to reduce the ambiguity. The result is promising and the proposed method can be used for evaluating one-dimensional direct current data in anisotropic media.

Nonlinear, anisotropic, and giant photoconductivity in intrinsic and doped graphene

Science.gov (United States)

Singh, Ashutosh; Ghosh, Saikat; Agarwal, Amit

2018-01-01

We present a framework to calculate the anisotropic and nonlinear photoconductivity for two band systems with application to graphene. In contrast to the usual perturbative (second order in the optical field strength) techniques, we calculate photoconductivity to all orders in the optical field strength. In particular, for graphene, we find the photoresponse to be giant (at large optical field strengths) and anisotropic. The anisotropic photoresponse in graphene is correlated with polarization of the incident field, with the response being similar to that of a half-wave plate. We predict that the anisotropy in the simultaneous measurement of longitudinal (σx x) and transverse (σy x) photoconductivity, with four probes, offers a unique experimental signature of the photovoltaic response, distinguishing it from the thermal-Seebeck and bolometric effects in photoresponse.

3-D waveform tomography sensitivity kernels for anisotropic media

KAUST Repository

Djebbi, Ramzi

2014-01-01

The complications in anisotropic multi-parameter inversion lie in the trade-off between the different anisotropy parameters. We compute the tomographic waveform sensitivity kernels for a VTI acoustic medium perturbation as a tool to investigate this ambiguity between the different parameters. We use dynamic ray tracing to efficiently handle the expensive computational cost for 3-D anisotropic models. Ray tracing provides also the ray direction information necessary for conditioning the sensitivity kernels to handle anisotropy. The NMO velocity and η parameter kernels showed a maximum sensitivity for diving waves which results in a relevant choice of those parameters in wave equation tomography. The δ parameter kernel showed zero sensitivity; therefore it can serve as a secondary parameter to fit the amplitude in the acoustic anisotropic inversion. Considering the limited penetration depth of diving waves, migration velocity analysis based kernels are introduced to fix the depth ambiguity with reflections and compute sensitivity maps in the deeper parts of the model.

On the Diffusion Coefficient of Two-step Method for LWR analysis

International Nuclear Information System (INIS)

Lee, Deokjung; Choi, Sooyoung; Smith, Kord S.

2015-01-01

The few-group constants including diffusion coefficients are generated from the assembly calculation results. Once the assembly calculation is done, the cross sections (XSs) are spatially homogenized, and a critical spectrum calculation is performed in order to take into account the neutron leakages of the lattice. The diffusion coefficient is also generated through the critical spectrum calculation. Three different methods of the critical spectrum calculation such as B1 method, P1 method, and fundamental mode (FM) calculation method are considered in this paper. The diffusion coefficients can also be affected by transport approximations for the transport XS calculation which is used in the assembly transport lattice calculation in order to account for the anisotropic scattering effects. The outflow transport approximation and the inflow transport approximation are investigated in this paper. The accuracy of the few group data especially the diffusion coefficients has been studied to optimize the combination of the transport correction methods and the critical spectrum calculation methods using the UNIST lattice physics code STREAM. The combination of the inflow transport approximation and the FM method is shown to provide the highest accuracy in the LWR core calculations. The methodologies to calculate the diffusion coefficients have been reviewed, and the performances of them have been investigated with a LWR core problem. The combination of the inflow transport approximation and the fundamental mode critical spectrum calculation shows the smallest errors in terms of assembly power distribution

Diffusion tensor imaging for target volume definition in glioblastoma multiforme

Energy Technology Data Exchange (ETDEWEB)

Berberat, Jatta; Remonda, Luca [Cantonal Hospital, Department of Neuro-radiology, Aarau (Switzerland); McNamara, Jane; Rogers, Susanne [Cantonal Hospital, Department of Radiation Oncology, Aarau (Switzerland); Bodis, Stephan [Cantonal Hospital, Department of Radiation Oncology, Aarau (Switzerland); University Hospital, Department of Radiation Oncology, Zurich (Switzerland)

2014-10-15

Diffusion tensor imaging (DTI) is an MR-based technique that may better detect the peritumoural region than MRI. Our aim was to explore the feasibility of using DTI for target volume delineation in glioblastoma patients. MR tensor tracts and maps of the isotropic (p) and anisotropic (q) components of water diffusion were coregistered with CT in 13 glioblastoma patients. An in-house image processing program was used to analyse water diffusion in each voxel of interest in the region of the tumour. Tumour infiltration was mapped according to validated criteria and contralateral normal brain was used as an internal control. A clinical target volume (CTV) was generated based on the T{sub 1}-weighted image obtained using contrast agent (T{sub 1Gd}), tractography and the infiltration map. This was compared to a conventional T{sub 2}-weighted CTV (T{sub 2}-w CTV). Definition of a diffusion-based CTV that included the adjacent white matter tracts proved highly feasible. A statistically significant difference was detected between the DTI-CTV and T{sub 2}-w CTV volumes (p < 0.005, t = 3.480). As the DTI-CTVs were smaller than the T{sub 2}-w CTVs (tumour plus peritumoural oedema), the pq maps were not simply detecting oedema. Compared to the clinical planning target volume (PTV), the DTI-PTV showed a trend towards volume reduction. These diffusion-based volumes were smaller than conventional volumes, yet still included sites of tumour recurrence. Extending the CTV along the abnormal tensor tracts in order to preserve coverage of the likely routes of dissemination, whilst sparing uninvolved brain, is a rational approach to individualising radiotherapy planning for glioblastoma patients. (orig.) [German] Die Diffusions-Tensor-Bildgebung (DTI) ist eine MR-Technik, die dank der Erfassung des peritumoralen Bereichs eine Verbesserung bezueglich MRI bringt. Unser Ziel war die Pruefung der Machbarkeit der Verwendung der DTI fuer die Zielvolumenabgrenzung fuer Patienten mit

Anisotropic diffusion of point defects in a two-dimensional crystal of streptavidin observed by high-speed atomic force microscopy

International Nuclear Information System (INIS)

Yamamoto, Daisuke; Uchihashi, Takayuki; Kodera, Noriyuki; Ando, Toshio

2008-01-01

The diffusion of individual point defects in a two-dimensional streptavidin crystal formed on biotin-containing supported lipid bilayers was observed by high-speed atomic force microscopy. The two-dimensional diffusion of monovacancy defects exhibited anisotropy correlated with the two crystallographic axes in the orthorhombic C 222 crystal; in the 2D plane, one axis (the a-axis) is comprised of contiguous biotin-bound subunit pairs whereas the other axis (the b-axis) is comprised of contiguous biotin-unbound subunit pairs. The diffusivity along the b-axis is approximately 2.4 times larger than that along the a-axis. This anisotropy is ascribed to the difference in the association free energy between the biotin-bound subunit-subunit interaction and the biotin-unbound subunit-subunit interaction. The preferred intermolecular contact occurs between the biotin-unbound subunits. The difference in the intermolecular binding energy between the two types of subunit pair is estimated to be approximately 0.52 kcal mol -1 . Another observed dynamic behavior of point defects was fusion of two point defects into a larger defect, which occurred much more frequently than the fission of a point defect into smaller defects. The diffusivity of point defects increased with increasing defect size. The fusion and the higher diffusivity of larger defects are suggested to be involved in the mechanism for the formation of defect-free crystals

User's manual for ONEDANT: a code package for one-dimensional, diffusion-accelerated, neutral-particle transport

International Nuclear Information System (INIS)

O'Dell, R.D.; Brinkley, F.W. Jr.; Marr, D.R.

1982-02-01

ONEDANT is designed for the CDC-7600, but the program has been implemented and run on the IBM-370/190 and CRAY-I computers. ONEDANT solves the one-dimensional multigroup transport equation in plane, cylindrical, spherical, and two-angle plane geometries. Both regular and adjoint, inhomogeneous and homogeneous (k/sub eff/ and eigenvalue search) problems subject to vacuum, reflective, periodic, white, albedo, or inhomogeneous boundary flux conditions are solved. General anisotropic scattering is allowed and anisotropic inhomogeneous sources are permitted. ONEDANT numerically solves the one-dimensional, multigroup form of the neutral-particle, steady-state form of the Boltzmann transport equation. The discrete-ordinates approximation is used for treating the angular variation of the particle distribution and the diamond-difference scheme is used for phase space discretization. Negative fluxes are eliminated by a local set-to-zero-and-correct algorithm. A standard inner (within-group) iteration, outer (energy-group-dependent source) iteration technique is used. Both inner and outer iterations are accelerated using the diffusion synthetic acceleration method

Rapid diffusion of molybdenum trace contamination in silicon

International Nuclear Information System (INIS)

Tobin, S.P.; Greenwald, A.C.; Wolfson, R.G.; Meier, D.L.; Drevinsky, P.J.

1985-01-01

Molybdenum contamination has been detected in silicon epitaxial layers and substrate wafers after processing in any one of several epitaxial silicon reactors. Greatly reduced minority carrier diffusion lengths and lifetimes are consistent with Mo concentrations measured by DLTS in the 10 12 and 10 13 cm -3 ranges. Depth profiling of diffusion length and the Mo deep level show much greater penetration than expected from previous reports of Mo as a slow diffuser. The data indicate a lower limit of 10 -8 cm 2 /sec for the diffusion coefficient of Mo in silicon at 1200 0 C, consistent with high diffusivities measured for other transition metals

Low-loss single-mode hollow-core fiber with anisotropic anti-resonant elements

DEFF Research Database (Denmark)

Habib, Selim; Bang, Ole; Bache, Morten

2016-01-01

A hollow-core fiber using anisotropic anti-resonant tubes in thecladding is proposed for low loss and effectively single-mode guidance. We show that the loss performance and higher-order mode suppression is significantly improved by using symmetrically distributed anisotropic antiresonant tubes i...

Algebraic collapsing acceleration of the characteristics method with anisotropic scattering

International Nuclear Information System (INIS)

Le Tellier, R.; Hebert, A.; Roy, R.

2004-01-01

In this paper, the characteristics solvers implemented in the lattice code Dragon are extended to allow a complete anisotropic treatment of the collision operator. An efficient synthetic acceleration method, called Algebraic Collapsing Acceleration (ACA), is presented. Tests show that this method can substantially speed up the convergence of scattering source iterations. The effect of boundary conditions, either specular or white reflections, on anisotropic scattering lattice-cell problems is also considered. (author)

Analytical Method and Semianalytical Method for Analysis of Scattering by Anisotropic Sphere: A Review

Directory of Open Access Journals (Sweden)

Chao Wan

2012-01-01

Full Text Available The history of methods for the electromagnetic scattering by an anisotropic sphere has been reviewed. Two main methods, angular expansion method and T-matrix method, which are widely used for the anisotropic sphere, are expressed in Cartesian coordinate firstly. The comparison of those and the further exploration on the scattering field are illustrated afterwards. Based on the most general form concluded by variable separation method, the coupled electric field and magnetic field of radial anisotropic sphere can be derived. By simplifying the condition, simpler case of uniaxial anisotropic media is expressed with confirmed coefficients for the internal and external field. Details of significant phenomenon are presented.

Coercivity enhancements of Nd–Fe–B sintered magnets by diffusing DyHx along different axes

International Nuclear Information System (INIS)

Ma, Tianyu; Wang, Xuejiao; Liu, Xiaolian; Wu, Chen; Yan, Mi

2015-01-01

Diffusing heavy rare earth elements along the grain boundaries (GBs) for Nd 2 Fe 14 B-type sintered magnets serves as an effective method to enhance coercivity and to minimize remanence loss simultaneously. Considering the texture anisotropy of Nd-rich GB phases, the coercivity incremental difference by diffusing DyH x fine powders along or perpendicular to the  <0 0 1 >  easy axis (c-axis) has been investigated. The coercivity increases more rapidly to 20.61 kOe (5.76 kOe higher than that of the as-sintered state) when diffusing along the c-axis than that diffusing perpendicular to c-axis (18.85 kOe, 4.00 kOe higher than the as-sintered state). Microstructural investigation reveals that Dy diffuses more easily towards the magnet inner part when treating along the c-axis than that for the perpendicular case due to the anisotropic distribution of the Nd-rich phase. This is verified by a higher Dy content at equivalent diffusing depth and a much deeper final diffusion distance. The local Dy-containing fractions with a stronger anisotropy field are richer for the magnet treated along the c-axis, leading to the much rapider coercivity enhancement. This work reveals that diffusion heavy rare earth along the c-axis is more effective to enhance coercivity for aligned Nd–Fe–B sintered magnets. (paper)

Odd number of coupled antiferromagnetic anisotropic Heisenberg chains: Spin wave theory

International Nuclear Information System (INIS)

Benyoussef, A.

1996-10-01

The effect of the chain and perpendicular anisotropies on the energy gap for odd number of coupled quantum spin-1/2 antiferromagnetic anisotropic Heisenberg chains is investigated using a spin wave theory. The energy gap opens above a critical anisotropic value. The known results of the isotropic case have been obtained. (author). 11 refs, 4 figs

Van der Waals Attraction of Vortices in Anisotropic and Layered Superconductors

International Nuclear Information System (INIS)

Blatter, G.; Geshkenbein, V.

1996-01-01

We show that in anisotropic and layered superconductors the fluctuations of vortex lines produce an attractive long-range vortex-vortex interaction of the van der Waals type. This attraction follows from the anisotropic screening properties of the material and has profound consequences for the low-field phase diagram of these materials. copyright 1996 The American Physical Society

Anisotropic silk fibroin/gelatin scaffolds from unidirectional freezing

Energy Technology Data Exchange (ETDEWEB)

Asuncion, Maria Christine Tankeh, E-mail: christine.asuncion@u.nus.edu [National University of Singapore, Department of Biomedical Engineering (Singapore); Goh, James Cho-Hong [National University of Singapore, Department of Biomedical Engineering (Singapore); National University of Singapore, Department of Orthopedic Surgery (Singapore); Toh, Siew-Lok [National University of Singapore, Department of Biomedical Engineering (Singapore); National University of Singapore, Department of Mechanical Engineering (Singapore)

2016-10-01

Recent studies have underlined the importance of matching scaffold properties to the biological milieu. Tissue, and thus scaffold, anisotropy is one such property that is important yet sometimes overlooked. Methods that have been used to achieve anisotropic scaffolds present challenges such as complicated fabrication steps, harsh processing conditions and toxic chemicals involved. In this study, unidirectional freezing was employed to fabricate anisotropic silk fibroin/gelatin scaffolds in a simple and mild manner. Morphological, mechanical, chemical and cellular compatibility properties were investigated, as well as the effect of the addition of gelatin to certain properties of the scaffold. It was shown that scaffold properties were suitable for cell proliferation and that mesenchymal stem cells were able to align themselves along the directed fibers. The fabricated scaffolds present a platform that can be used for anisotropic tissue engineering applications such as cardiac patches. - Highlights: • Silk/gelatin scaffolds with unidirectional alignment were fabricated using a simple and scalable process • Presence of gelatin in silk resulted to lesser shrinkage, better water retention and improved cell proliferation. • Mesenchymal stem cells were shown to align themselves according to the fiber alignment.

Double-grooved nanofibre surfaces with enhanced anisotropic hydrophobicity.

Science.gov (United States)

Liang, Meimei; Chen, Xin; Xu, Yang; Zhu, Lei; Jin, Xiangyu; Huang, Chen

2017-11-02

This study reports a facile method for fabricating double-grooved fibrous surfaces. The primary grooves of the surface are formed by aligned fibres, while the secondary grooves are achieved by oriented nanogrooves on the fibre surface. Investigation into the formation mechanism reveals that the nanogrooves can be readily tailored through adjusting the solvent ratio and relative humidity. With this understanding, a variety of polymers have been successfully electrospun into fibres having the same nanogrooved feature. These fibres show high resemblance to natural hierarchical structures, and thereby endowing the corresponding double-grooved surface with enhanced anisotropic hydrophobicity. A water droplet at a parallel direction to the grooves exhibits a much higher contact angle and a lower roll-off angle than the droplet at a perpendicular direction. The application potential of such anisotropic hydrophobicity has been demonstrated via a fog collection experiment, in which the double-grooved surface can harvest the largest amount of water. Moreover, the fabrication method requires neither post-treatment nor sophisticated equipment, making us anticipate that the double-grooved surface would be competitive in areas where a highly ordered surface, a large surface area and an anisotropic hydrophobicity are preferred.

Isothermal anisotropic magnetoresistance in antiferromagnetic metallic IrMn.

Science.gov (United States)

Galceran, R; Fina, I; Cisneros-Fernández, J; Bozzo, B; Frontera, C; López-Mir, L; Deniz, H; Park, K-W; Park, B-G; Balcells, Ll; Martí, X; Jungwirth, T; Martínez, B

2016-10-20

Antiferromagnetic spintronics is an emerging field; antiferromagnets can improve the functionalities of ferromagnets with higher response times, and having the information shielded against external magnetic field. Moreover, a large list of aniferromagnetic semiconductors and metals with Néel temperatures above room temperature exists. In the present manuscript, we persevere in the quest for the limits of how large can anisotropic magnetoresistance be in antiferromagnetic materials with very large spin-orbit coupling. We selected IrMn as a prime example of first-class moment (Mn) and spin-orbit (Ir) combination. Isothermal magnetotransport measurements in an antiferromagnetic-metal(IrMn)/ferromagnetic-insulator thin film bilayer have been performed. The metal/insulator structure with magnetic coupling between both layers allows the measurement of the modulation of the transport properties exclusively in the antiferromagnetic layer. Anisotropic magnetoresistance as large as 0.15% has been found, which is much larger than that for a bare IrMn layer. Interestingly, it has been observed that anisotropic magnetoresistance is strongly influenced by the field cooling conditions, signaling the dependence of the found response on the formation of domains at the magnetic ordering temperature.

Effective wavefield extrapolation in anisotropic media: Accounting for resolvable anisotropy

KAUST Repository

Alkhalifah, Tariq Ali

2014-04-30

Spectral methods provide artefact-free and generally dispersion-free wavefield extrapolation in anisotropic media. Their apparent weakness is in accessing the medium-inhomogeneity information in an efficient manner. This is usually handled through a velocity-weighted summation (interpolation) of representative constant-velocity extrapolated wavefields, with the number of these extrapolations controlled by the effective rank of the original mixed-domain operator or, more specifically, by the complexity of the velocity model. Conversely, with pseudo-spectral methods, because only the space derivatives are handled in the wavenumber domain, we obtain relatively efficient access to the inhomogeneity in isotropic media, but we often resort to weak approximations to handle the anisotropy efficiently. Utilizing perturbation theory, I isolate the contribution of anisotropy to the wavefield extrapolation process. This allows us to factorize as much of the inhomogeneity in the anisotropic parameters as possible out of the spectral implementation, yielding effectively a pseudo-spectral formulation. This is particularly true if the inhomogeneity of the dimensionless anisotropic parameters are mild compared with the velocity (i.e., factorized anisotropic media). I improve on the accuracy by using the Shanks transformation to incorporate a denominator in the expansion that predicts the higher-order omitted terms; thus, we deal with fewer terms for a high level of accuracy. In fact, when we use this new separation-based implementation, the anisotropy correction to the extrapolation can be applied separately as a residual operation, which provides a tool for anisotropic parameter sensitivity analysis. The accuracy of the approximation is high, as demonstrated in a complex tilted transversely isotropic model. © 2014 European Association of Geoscientists & Engineers.

Effective wavefield extrapolation in anisotropic media: Accounting for resolvable anisotropy

KAUST Repository

Alkhalifah, Tariq Ali

2014-01-01

Spectral methods provide artefact-free and generally dispersion-free wavefield extrapolation in anisotropic media. Their apparent weakness is in accessing the medium-inhomogeneity information in an efficient manner. This is usually handled through a velocity-weighted summation (interpolation) of representative constant-velocity extrapolated wavefields, with the number of these extrapolations controlled by the effective rank of the original mixed-domain operator or, more specifically, by the complexity of the velocity model. Conversely, with pseudo-spectral methods, because only the space derivatives are handled in the wavenumber domain, we obtain relatively efficient access to the inhomogeneity in isotropic media, but we often resort to weak approximations to handle the anisotropy efficiently. Utilizing perturbation theory, I isolate the contribution of anisotropy to the wavefield extrapolation process. This allows us to factorize as much of the inhomogeneity in the anisotropic parameters as possible out of the spectral implementation, yielding effectively a pseudo-spectral formulation. This is particularly true if the inhomogeneity of the dimensionless anisotropic parameters are mild compared with the velocity (i.e., factorized anisotropic media). I improve on the accuracy by using the Shanks transformation to incorporate a denominator in the expansion that predicts the higher-order omitted terms; thus, we deal with fewer terms for a high level of accuracy. In fact, when we use this new separation-based implementation, the anisotropy correction to the extrapolation can be applied separately as a residual operation, which provides a tool for anisotropic parameter sensitivity analysis. The accuracy of the approximation is high, as demonstrated in a complex tilted transversely isotropic model. © 2014 European Association of Geoscientists & Engineers.

Anisotropic flow of charged particles in Pb-Pb collisions at $\\sqrt{s_{\\rm NN}}$ = 5.02 TeV

CERN Document Server

Adam, Jaroslav; Aggarwal, Madan Mohan; Aglieri Rinella, Gianluca; Agnello, Michelangelo; Agrawal, Neelima; Ahammed, Zubayer; Ahmad, Shakeel; Ahn, Sang Un; Aiola, Salvatore; Akindinov, Alexander; Alam, Sk Noor; Silva De Albuquerque, Danilo; Aleksandrov, Dmitry; Alessandro, Bruno; Alexandre, Didier; Alfaro Molina, Jose Ruben; Alici, Andrea; Alkin, Anton; Millan Almaraz, Jesus Roberto; Alme, Johan; Alt, Torsten; Altinpinar, Sedat; Altsybeev, Igor; Alves Garcia Prado, Caio; Andrei, Cristian; Andronic, Anton; Anguelov, Venelin; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Aphecetche, Laurent Bernard; Appelshaeuser, Harald; Arcelli, Silvia; Arnaldi, Roberta; Arnold, Oliver Werner; Arsene, Ionut Cristian; Arslandok, Mesut; Audurier, Benjamin; Augustinus, Andre; Averbeck, Ralf Peter; Azmi, Mohd Danish; Badala, Angela; Baek, Yong Wook; Bagnasco, Stefano; Bailhache, Raphaelle Marie; Bala, Renu; Balasubramanian, Supraja; Baldisseri, Alberto; Baral, Rama Chandra; Barbano, Anastasia Maria; Barbera, Roberto; Barile, Francesco; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Ramillien Barret, Valerie; Bartalini, Paolo; Barth, Klaus; Bartke, Jerzy Gustaw; Bartsch, Esther; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Bathen, Bastian; Batigne, Guillaume; Batista Camejo, Arianna; Batyunya, Boris; Batzing, Paul Christoph; Bearden, Ian Gardner; Beck, Hans; Bedda, Cristina; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bello Martinez, Hector; Bellwied, Rene; Belmont Iii, Ronald John; Belmont Moreno, Ernesto; Belyaev, Vladimir; Benacek, Pavel; Bencedi, Gyula; Beole, Stefania; Berceanu, Ionela; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Bertens, Redmer Alexander; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhat, Inayat Rasool; Bhati, Ashok Kumar; Bhattacharjee, Buddhadeb; Bhom, Jihyun; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Biro, Gabor; Biswas, Rathijit; Biswas, Saikat; Bjelogrlic, Sandro; Blair, Justin Thomas; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Borel, Herve; Borissov, Alexander; Borri, Marcello; Bossu, Francesco; Botta, Elena; Bourjau, Christian; Braun-Munzinger, Peter; Bregant, Marco; Breitner, Timo Gunther; Broker, Theo Alexander; Browning, Tyler Allen; Broz, Michal; Brucken, Erik Jens; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Buncic, Predrag; Busch, Oliver; Buthelezi, Edith Zinhle; Bashir Butt, Jamila; Buxton, Jesse Thomas; Cabala, Jan; Caffarri, Davide; Cai, Xu; Caines, Helen Louise; Calero Diaz, Liliet; Caliva, Alberto; Calvo Villar, Ernesto; Camerini, Paolo; Carena, Francesco; Carena, Wisla; Carnesecchi, Francesca; Castillo Castellanos, Javier Ernesto; Castro, Andrew John; Casula, Ester Anna Rita; Ceballos Sanchez, Cesar; Cepila, Jan; Cerello, Piergiorgio; Cerkala, Jakub; Chang, Beomsu; Chapeland, Sylvain; Chartier, Marielle; Charvet, Jean-Luc Fernand; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chauvin, Alex; Chelnokov, Volodymyr; Cherney, Michael Gerard; Cheshkov, Cvetan Valeriev; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Dobrigkeit Chinellato, David; Cho, Soyeon; Chochula, Peter; Choi, Kyungeon; Chojnacki, Marek; Choudhury, Subikash; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-Urk; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Colamaria, Fabio Filippo; Colella, Domenico; Collu, Alberto; Colocci, Manuel; Conesa Balbastre, Gustavo; Conesa Del Valle, Zaida; Connors, Megan Elizabeth; Contreras Nuno, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortes Maldonado, Ismael; Cortese, Pietro; Cosentino, Mauro Rogerio; Costa, Filippo; Crochet, Philippe; Cruz Albino, Rigoberto; Cuautle Flores, Eleazar; Cunqueiro Mendez, Leticia; Dahms, Torsten; Dainese, Andrea; Danisch, Meike Charlotte; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Supriya; Dash, Ajay Kumar; Dash, Sadhana; De, Sudipan; De Caro, Annalisa; De Cataldo, Giacinto; De Conti, Camila; De Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; De Marco, Nora; De Pasquale, Salvatore; Deisting, Alexander; Deloff, Andrzej; Denes, Ervin Sandor; Deplano, Caterina; Dhankher, Preeti; Di Bari, Domenico; Di Mauro, Antonio; Di Nezza, Pasquale; Diaz Corchero, Miguel Angel; Dietel, Thomas; Dillenseger, Pascal; Divia, Roberto; Djuvsland, Oeystein; Dobrin, Alexandru Florin; Domenicis Gimenez, Diogenes; Donigus, Benjamin; Dordic, Olja; Drozhzhova, Tatiana; Dubey, Anand Kumar; Dubla, Andrea; Ducroux, Laurent; Dupieux, Pascal; Ehlers Iii, Raymond James; Elia, Domenico; Endress, Eric; Engel, Heiko; Epple, Eliane; Erazmus, Barbara Ewa; Erdemir, Irem; Erhardt, Filip; Espagnon, Bruno; Estienne, Magali Danielle; Esumi, Shinichi; Eum, Jongsik; Evans, David; Evdokimov, Sergey; Eyyubova, Gyulnara; Fabbietti, Laura; Fabris, Daniela; Faivre, Julien; Fantoni, Alessandra; Fasel, Markus; Feldkamp, Linus; Feliciello, Alessandro; Feofilov, Grigorii; Ferencei, Jozef; Fernandez Tellez, Arturo; Gonzalez Ferreiro, Elena; Ferretti, Alessandro; Festanti, Andrea; Feuillard, Victor Jose Gaston; Figiel, Jan; Araujo Silva Figueredo, Marcel; Filchagin, Sergey; Finogeev, Dmitry; Fionda, Fiorella; Fiore, Enrichetta Maria; Fleck, Martin Gabriel; Floris, Michele; Foertsch, Siegfried Valentin; Foka, Panagiota; Fokin, Sergey; Fragiacomo, Enrico; Francescon, Andrea; Frankenfeld, Ulrich Michael; Fronze, Gabriele Gaetano; Fuchs, Ulrich; Furget, Christophe; Furs, Artur; Fusco Girard, Mario; Gaardhoeje, Jens Joergen; Gagliardi, Martino; Gago Medina, Alberto Martin; Gallio, Mauro; Gangadharan, Dhevan Raja; Ganoti, Paraskevi; Gao, Chaosong; Garabatos Cuadrado, Jose; Garcia-Solis, Edmundo Javier; Gargiulo, Corrado; Gasik, Piotr Jan; Gauger, Erin Frances; Germain, Marie; Gheata, Andrei George; Gheata, Mihaela; Ghosh, Premomoy; Ghosh, Sanjay Kumar; Gianotti, Paola; Giubellino, Paolo; Giubilato, Piero; Gladysz-Dziadus, Ewa; Glassel, Peter; Gomez Coral, Diego Mauricio; Gomez Ramirez, Andres; Sanchez Gonzalez, Andres; Gonzalez, Victor; Gonzalez Zamora, Pedro; Gorbunov, Sergey; Gorlich, Lidia Maria; Gotovac, Sven; Grabski, Varlen; Grachov, Oleg Anatolievich; Graczykowski, Lukasz Kamil; Graham, Katie Leanne; Grelli, Alessandro; Grigoras, Alina Gabriela; Grigoras, Costin; Grigoryev, Vladislav; Grigoryan, Ara; Grigoryan, Smbat; Grynyov, Borys; Grion, Nevio; Gronefeld, Julius Maximilian; Grosse-Oetringhaus, Jan Fiete; Grosso, Raffaele; Guber, Fedor; Guernane, Rachid; Guerzoni, Barbara; Gulbrandsen, Kristjan Herlache; Gunji, Taku; Gupta, Anik; Gupta, Ramni; Haake, Rudiger; Haaland, Oystein Senneset; Hadjidakis, Cynthia Marie; Haiduc, Maria; Hamagaki, Hideki; Hamar, Gergoe; Hamon, Julien Charles; Harris, John William; Harton, Austin Vincent; Hatzifotiadou, Despina; Hayashi, Shinichi; Heckel, Stefan Thomas; Hellbar, Ernst; Helstrup, Haavard; Herghelegiu, Andrei Ionut; Herrera Corral, Gerardo Antonio; Hess, Benjamin Andreas; Hetland, Kristin Fanebust; Hillemanns, Hartmut; Hippolyte, Boris; Horak, David; Hosokawa, Ritsuya; Hristov, Peter Zahariev; Humanic, Thomas; Hussain, Nur; Hussain, Tahir; Hutter, Dirk; Hwang, Dae Sung; Ilkaev, Radiy; Inaba, Motoi; Incani, Elisa; Ippolitov, Mikhail; Irfan, Muhammad; Ivanov, Marian; Ivanov, Vladimir; Izucheev, Vladimir; Jacazio, Nicolo; Jacobs, Peter Martin; Jadhav, Manoj Bhanudas; Jadlovska, Slavka; Jadlovsky, Jan; Jahnke, Cristiane; Jakubowska, Monika Joanna; Jang, Haeng Jin; Janik, Malgorzata Anna; Pahula Hewage, Sandun; Jena, Chitrasen; Jena, Satyajit; Jimenez Bustamante, Raul Tonatiuh; Jones, Peter Graham; Jusko, Anton; Kalinak, Peter; Kalweit, Alexander Philipp; Kamin, Jason Adrian; Kang, Ju Hwan; Kaplin, Vladimir; Kar, Somnath; Karasu Uysal, Ayben; Karavichev, Oleg; Karavicheva, Tatiana; Karayan, Lilit; Karpechev, Evgeny; Kebschull, Udo Wolfgang; Keidel, Ralf; Keijdener, Darius Laurens; Keil, Markus; Khan, Mohammed Mohisin; Khan, Palash; Khan, Shuaib Ahmad; Khanzadeev, Alexei; Kharlov, Yury; Kileng, Bjarte; Kim, Do Won; Kim, Dong Jo; Kim, Daehyeok; Kim, Hyeonjoong; Kim, Jinsook; Kim, Minwoo; Kim, Se Yong; Kim, Taesoo; Kirsch, Stefan; Kisel, Ivan; Kiselev, Sergey; Kisiel, Adam Ryszard; Kiss, Gabor; Klay, Jennifer Lynn; Klein, Carsten; Klein, Jochen; Klein-Boesing, Christian; Klewin, Sebastian; Kluge, Alexander; Knichel, Michael Linus; Knospe, Anders Garritt; Kobdaj, Chinorat; Kofarago, Monika; Kollegger, Thorsten; Kolozhvari, Anatoly; Kondratev, Valerii; Kondratyeva, Natalia; Kondratyuk, Evgeny; Konevskikh, Artem; Kopcik, Michal; Kostarakis, Panagiotis; Kour, Mandeep; Kouzinopoulos, Charalampos; Kovalenko, Oleksandr; Kovalenko, Vladimir; Kowalski, Marek; Koyithatta Meethaleveedu, Greeshma; Kralik, Ivan; Kravcakova, Adela; Krivda, Marian; Krizek, Filip; Kryshen, Evgeny; Krzewicki, Mikolaj; Kubera, Andrew Michael; Kucera, Vit; Kuhn, Christian Claude; Kuijer, Paulus Gerardus; Kumar, Ajay; Kumar, Jitendra; Lokesh, Kumar; Kumar, Shyam; Kurashvili, Podist; Kurepin, Alexander; Kurepin, Alexey; Kuryakin, Alexey; Kweon, Min Jung; Kwon, Youngil; La Pointe, Sarah Louise; La Rocca, Paola; Ladron De Guevara, Pedro; Lagana Fernandes, Caio; Lakomov, Igor; Langoy, Rune; Lara Martinez, Camilo Ernesto; Lardeux, Antoine Xavier; Lattuca, Alessandra; Laudi, Elisa; Lea, Ramona; Leardini, Lucia; Lee, Graham Richard; Lee, Seongjoo; Lehas, Fatiha; Lemmon, Roy Crawford; Lenti, Vito; Leogrande, Emilia; Leon Monzon, Ildefonso; Leon Vargas, Hermes; Leoncino, Marco; Levai, Peter; Li, Shuang; Li, Xiaomei; Lien, Jorgen Andre; Lietava, Roman; Lindal, Svein; Lindenstruth, Volker; Lippmann, Christian; Lisa, Michael Annan; Ljunggren, Hans Martin; Lodato, Davide Francesco; Lonne, Per-Ivar; Loginov, Vitaly; Loizides, Constantinos; Lopez, Xavier Bernard; Lopez Torres, Ernesto; Lowe, Andrew John; Luettig, Philipp Johannes; Lunardon, Marcello; Luparello, Grazia; Lutz, Tyler Harrison; Maevskaya, Alla; Mager, Magnus; Mahajan, Sanjay; Mahmood, Sohail Musa; Maire, Antonin; Majka, Richard Daniel; Malaev, Mikhail; Maldonado Cervantes, Ivonne Alicia; Malinina, Liudmila; Mal'Kevich, Dmitry; Malzacher, Peter; Mamonov, Alexander; Manko, Vladislav; Manso, Franck; Manzari, Vito; Marchisone, Massimiliano; Mares, Jiri; Margagliotti, Giacomo Vito; Margotti, Anselmo; Margutti, Jacopo; Marin, Ana Maria; Markert, Christina; Marquard, Marco; Martin, Nicole Alice; Martin Blanco, Javier; Martinengo, Paolo; Martinez Hernandez, Mario Ivan; Martinez-Garcia, Gines; Martinez Pedreira, Miguel; Mas, Alexis Jean-Michel; Masciocchi, Silvia; Masera, Massimo; Masoni, Alberto; Mastroserio, Annalisa; Matyja, Adam Tomasz; Mayer, Christoph; Mazer, Joel Anthony; Mazzoni, Alessandra Maria; Mcdonald, Daniel; Meddi, Franco; Melikyan, Yuri; Menchaca-Rocha, Arturo Alejandro; Meninno, Elisa; Mercado-Perez, Jorge; Meres, Michal; Miake, Yasuo; Mieskolainen, Matti Mikael; Mikhaylov, Konstantin; Milano, Leonardo; Milosevic, Jovan; Mischke, Andre; Mishra, Aditya Nath; Miskowiec, Dariusz Czeslaw; Mitra, Jubin; Mitu, Ciprian Mihai; Mohammadi, Naghmeh; Mohanty, Bedangadas; Molnar, Levente; Montano Zetina, Luis Manuel; Montes Prado, Esther; Moreira De Godoy, Denise Aparecida; Perez Moreno, Luis Alberto; Moretto, Sandra; Morreale, Astrid; Morsch, Andreas; Muccifora, Valeria; Mudnic, Eugen; Muhlheim, Daniel Michael; Muhuri, Sanjib; Mukherjee, Maitreyee; Mulligan, James Declan; Gameiro Munhoz, Marcelo; Munzer, Robert Helmut; Murakami, Hikari; Murray, Sean; Musa, Luciano; Musinsky, Jan; Naik, Bharati; Nair, Rahul; Nandi, Basanta Kumar; Nania, Rosario; Nappi, Eugenio; Naru, Muhammad Umair; Ferreira Natal Da Luz, Pedro Hugo; Nattrass, Christine; Rosado Navarro, Sebastian; Nayak, Kishora; Nayak, Ranjit; Nayak, Tapan Kumar; Nazarenko, Sergey; Nedosekin, Alexander; Nellen, Lukas; Ng, Fabian; Nicassio, Maria; Niculescu, Mihai; Niedziela, Jeremi; Nielsen, Borge Svane; Nikolaev, Sergey; Nikulin, Sergey; Nikulin, Vladimir; Noferini, Francesco; Nomokonov, Petr; Nooren, Gerardus; Cabanillas Noris, Juan Carlos; Norman, Jaime; Nyanin, Alexander; Nystrand, Joakim Ingemar; Oeschler, Helmut Oskar; Oh, Saehanseul; Oh, Sun Kun; Ohlson, Alice Elisabeth; Okatan, Ali; Okubo, Tsubasa; Olah, Laszlo; Oleniacz, Janusz; Oliveira Da Silva, Antonio Carlos; Oliver, Michael Henry; Onderwaater, Jacobus; Oppedisano, Chiara; Orava, Risto; Oravec, Matej; Ortiz Velasquez, Antonio; Oskarsson, Anders Nils Erik; Otwinowski, Jacek Tomasz; Oyama, Ken; Ozdemir, Mahmut; Pachmayer, Yvonne Chiara; Pagano, Davide; Pagano, Paola; Paic, Guy; Pal, Susanta Kumar; Pan, Jinjin; Pandey, Ashutosh Kumar; Papikyan, Vardanush; Pappalardo, Giuseppe; Pareek, Pooja; Park, Woojin; Parmar, Sonia; Passfeld, Annika; Paticchio, Vincenzo; Patra, Rajendra Nath; Paul, Biswarup; Pei, Hua; Peitzmann, Thomas; Pereira Da Costa, Hugo Denis Antonio; Peresunko, Dmitry Yurevich; Perez Lara, Carlos Eugenio; Perez Lezama, Edgar; Peskov, Vladimir; Pestov, Yury; Petracek, Vojtech; Petrov, Viacheslav; Petrovici, Mihai; Petta, Catia; Piano, Stefano; Pikna, Miroslav; Pillot, Philippe; Ozelin De Lima Pimentel, Lais; Pinazza, Ombretta; Pinsky, Lawrence; Piyarathna, Danthasinghe; Ploskon, Mateusz Andrzej; Planinic, Mirko; Pluta, Jan Marian; Pochybova, Sona; Podesta Lerma, Pedro Luis Manuel; Poghosyan, Martin; Polishchuk, Boris; Poljak, Nikola; Poonsawat, Wanchaloem; Pop, Amalia; Porteboeuf, Sarah Julie; Porter, R Jefferson; Pospisil, Jan; Prasad, Sidharth Kumar; Preghenella, Roberto; Prino, Francesco; Pruneau, Claude Andre; Pshenichnov, Igor; Puccio, Maximiliano; Puddu, Giovanna; Pujahari, Prabhat Ranjan; Punin, Valery; Putschke, Jorn Henning; Qvigstad, Henrik; Rachevski, Alexandre; Raha, Sibaji; Rajput, Sonia; Rak, Jan; Rakotozafindrabe, Andry Malala; Ramello, Luciano; Rami, Fouad; Raniwala, Rashmi; Raniwala, Sudhir; Rasanen, Sami Sakari; Rascanu, Bogdan Theodor; Rathee, Deepika; Read, Kenneth Francis; Redlich, Krzysztof; Reed, Rosi Jan; Rehman, Attiq Ur; Reichelt, Patrick Simon; Reidt, Felix; Ren, Xiaowen; Renfordt, Rainer Arno Ernst; Reolon, Anna Rita; Reshetin, Andrey; Reygers, Klaus Johannes; Riabov, Viktor; Ricci, Renato Angelo; Richert, Tuva Ora Herenui; Richter, Matthias Rudolph; Riedler, Petra; Riegler, Werner; Riggi, Francesco; Ristea, Catalin-Lucian; Rocco, Elena; Rodriguez Cahuantzi, Mario; Rodriguez Manso, Alis; Roeed, Ketil; Rogochaya, Elena; Rohr, David Michael; Roehrich, Dieter; Ronchetti, Federico; Ronflette, Lucile; Rosnet, Philippe; Rossi, Andrea; Roukoutakis, Filimon; Roy, Ankhi; Roy, Christelle Sophie; Roy, Pradip Kumar; Rubio Montero, Antonio Juan; Rui, Rinaldo; Russo, Riccardo; Ryabinkin, Evgeny; Ryabov, Yury; Rybicki, Andrzej; Saarinen, Sampo; Sadhu, Samrangy; Sadovskiy, Sergey; Safarik, Karel; Sahlmuller, Baldo; Sahoo, Pragati; Sahoo, Raghunath; Sahoo, Sarita; Sahu, Pradip Kumar; Saini, Jogender; Sakai, Shingo; Saleh, Mohammad Ahmad; Salzwedel, Jai Samuel Nielsen; Sambyal, Sanjeev Singh; Samsonov, Vladimir; Sandor, Ladislav; Sandoval, Andres; Sano, Masato; Sarkar, Debojit; Sarkar, Nachiketa; Sarma, Pranjal; Scapparone, Eugenio; Scarlassara, Fernando; Schiaua, Claudiu Cornel; Schicker, Rainer Martin; Schmidt, Christian Joachim; Schmidt, Hans Rudolf; Schuchmann, Simone; Schukraft, Jurgen; Schulc, Martin; Schutz, Yves Roland; Schwarz, Kilian Eberhard; Schweda, Kai Oliver; Scioli, Gilda; Scomparin, Enrico; Scott, Rebecca Michelle; Sefcik, Michal; Seger, Janet Elizabeth; Sekiguchi, Yuko; Sekihata, Daiki; Selyuzhenkov, Ilya; Senosi, Kgotlaesele; Senyukov, Serhiy; Serradilla Rodriguez, Eulogio; Sevcenco, Adrian; Shabanov, Arseniy; Shabetai, Alexandre; Shadura, Oksana; Shahoyan, Ruben; Shahzad, Muhammed Ikram; Shangaraev, Artem; Sharma, Ankita; Sharma, Mona; Sharma, Monika; Sharma, Natasha; Sheikh, Ashik Ikbal; Shigaki, Kenta; Shou, Qiye; Shtejer Diaz, Katherin; Sibiryak, Yury; Siddhanta, Sabyasachi; Sielewicz, Krzysztof Marek; Siemiarczuk, Teodor; Silvermyr, David Olle Rickard; Silvestre, Catherine Micaela; Simatovic, Goran; Simonetti, Giuseppe; Singaraju, Rama Narayana; Singh, Ranbir; Singha, Subhash; Singhal, Vikas; Sinha, Bikash; Sarkar - Sinha, Tinku; Sitar, Branislav; Sitta, Mario; Skaali, Bernhard; Slupecki, Maciej; Smirnov, Nikolai; Snellings, Raimond; Snellman, Tomas Wilhelm; Song, Jihye; Song, Myunggeun; Song, Zixuan; Soramel, Francesca; Sorensen, Soren Pontoppidan; Derradi De Souza, Rafael; Sozzi, Federica; Spacek, Michal; Spiriti, Eleuterio; Sputowska, Iwona Anna; Spyropoulou-Stassinaki, Martha; Stachel, Johanna; Stan, Ionel; Stankus, Paul; Stenlund, Evert Anders; Steyn, Gideon Francois; Stiller, Johannes Hendrik; Stocco, Diego; Strmen, Peter; Alarcon Do Passo Suaide, Alexandre; Sugitate, Toru; Suire, Christophe Pierre; Suleymanov, Mais Kazim Oglu; Suljic, Miljenko; Sultanov, Rishat; Sumbera, Michal; Sumowidagdo, Suharyo; Szabo, Alexander; Szanto De Toledo, Alejandro; Szarka, Imrich; Szczepankiewicz, Adam; Szymanski, Maciej Pawel; Tabassam, Uzma; Takahashi, Jun; Tambave, Ganesh Jagannath; Tanaka, Naoto; Tarhini, Mohamad; Tariq, Mohammad; Tarzila, Madalina-Gabriela; Tauro, Arturo; Tejeda Munoz, Guillermo; Telesca, Adriana; Terasaki, Kohei; Terrevoli, Cristina; Teyssier, Boris; Thaeder, Jochen Mathias; Thakur, Dhananjaya; Thomas, Deepa; Tieulent, Raphael Noel; Timmins, Anthony Robert; Toia, Alberica; Trogolo, Stefano; Trombetta, Giuseppe; Trubnikov, Victor; Trzaska, Wladyslaw Henryk; Tsuji, Tomoya; Tumkin, Alexandr; Turrisi, Rosario; Tveter, Trine Spedstad; Ullaland, Kjetil; Uras, Antonio; Usai, Gianluca; Utrobicic, Antonija; Vala, Martin; Valencia Palomo, Lizardo; Vallero, Sara; Van Der Maarel, Jasper; Van Hoorne, Jacobus Willem; Van Leeuwen, Marco; Vanat, Tomas; Vande Vyvre, Pierre; Varga, Dezso; Diozcora Vargas Trevino, Aurora; Vargyas, Marton; Varma, Raghava; Vasileiou, Maria; Vasiliev, Andrey; Vauthier, Astrid; Vechernin, Vladimir; Veen, Annelies Marianne; Veldhoen, Misha; Velure, Arild; Vercellin, Ermanno; Vergara Limon, Sergio; Vernet, Renaud; Verweij, Marta; Vickovic, Linda; Viesti, Giuseppe; Viinikainen, Jussi Samuli; Vilakazi, Zabulon; Villalobos Baillie, Orlando; Villatoro Tello, Abraham; Vinogradov, Alexander; Vinogradov, Leonid; Vinogradov, Yury; Virgili, Tiziano; Vislavicius, Vytautas; Viyogi, Yogendra; Vodopyanov, Alexander; Volkl, Martin Andreas; Voloshin, Kirill; Voloshin, Sergey; Volpe, Giacomo; Von Haller, Barthelemy; Vorobyev, Ivan; Vranic, Danilo; Vrlakova, Janka; Vulpescu, Bogdan; Wagner, Boris; Wagner, Jan; Wang, Hongkai; Wang, Mengliang; Watanabe, Daisuke; Watanabe, Yosuke; Weber, Michael; Weber, Steffen Georg; Weiser, Dennis Franz; Wessels, Johannes Peter; Westerhoff, Uwe; Whitehead, Andile Mothegi; Wiechula, Jens; Wikne, Jon; Wilk, Grzegorz Andrzej; Wilkinson, Jeremy John; Williams, Crispin; Windelband, Bernd Stefan; Winn, Michael Andreas; Yang, Hongyan; Yang, Ping; Yano, Satoshi; Yasin, Zafar; Yin, Zhongbao; Yokoyama, Hiroki; Yoo, In-Kwon; Yoon, Jin Hee; Yurchenko, Volodymyr; Yushmanov, Igor; Zaborowska, Anna; Zaccolo, Valentina; Zaman, Ali; Zampolli, Chiara; Correia Zanoli, Henrique Jose; Zaporozhets, Sergey; Zardoshti, Nima; Zarochentsev, Andrey; Zavada, Petr; Zavyalov, Nikolay; Zbroszczyk, Hanna Paulina; Zgura, Sorin Ion; Zhalov, Mikhail; Zhang, Haitao; Zhang, Xiaoming; Zhang, Yonghong; Chunhui, Zhang; Zhang, Zuman; Zhao, Chengxin; Zhigareva, Natalia; Zhou, Daicui; Zhou, You; Zhou, Zhuo; Zhu, Hongsheng; Zhu, Jianhui; Zichichi, Antonino; Zimmermann, Alice; Zimmermann, Markus Bernhard; Zinovjev, Gennady; Zyzak, Maksym

2016-04-01

We report the first results of elliptic ($v_2$), triangular ($v_3$) and quadrangular flow ($v_4$) of charged particles in Pb--Pb collisions at $\\sqrt{s_{_{\\rm NN}}}=$ 5.02 TeV with the ALICE detector at the CERN Large Hadron Collider. The measurements are performed in the central pseudorapidity region $|\\eta| <$ 0.8 and for the transverse momentum range 0.2 $< p_{\\rm T} < $ 5 GeV/$c$. The anisotropic flow is measured using two--particle correlations with a pseudorapidity gap greater than one unit and with the multi--particle cumulant method. Compared to results from Pb--Pb collisions at $\\sqrt{s_{_{\\rm NN}}}=$ 2.76 TeV, the anisotropic flow coefficients $v_{2}$, $v_{3}$ and $v_{4}$ are found to increase by (3.0$\\pm$0.6)\\%, (4.3$\\pm$1.4)\\% and (10.2$\\pm$3.8)\\%, respectively, over the centrality range 0-50\\%. This can be attributed mostly to an increase of the average transverse momentum between the two energies. The measurements are found to be compatible with hydrodynamic model calculations. This com...

Longitudinal disordering of vortex lattices in anisotropic superconductors

International Nuclear Information System (INIS)

Harshman, D.R.; Brandt, E.H.; Fiory, A.T.; Inui, M.; Mitzi, D.B.; Schneemeyer, L.F.; Waszczak, J.V.

1993-01-01

Vortex disordering in superconducting crystals is shown to be markedly sensitive to penetration-depth anisotropy. At low temperature and high magnetic field, the muon-spin-rotation spectra for the highly anisotropic Bi 2 Sr 2 CaCu 2 O 8+δ material are found to be anomalously narrow and symmetric about the applied field, in a manner consistent with a layered vortex sublattice structure with pinning-induced misalignment between layers. In contrast, spectra for the less-anisotropic YBa 2 Cu 3 O 7-δ compounds taken at comparable fields are broader and asymmetric, showing that the vortex lattices are aligned parallel to the applied-field direction

Tunable waveguide bends with graphene-based anisotropic metamaterials

KAUST Repository

Chen, Zhao-xian; Chen, Ze-guo; Ming, Yang; Wu, Ying; Lu, Yan-qing

2016-01-01

We design tunable waveguide bends filled with graphene-based anisotropic metamaterials to achieve a nearly perfect bending effect. The anisotropic properties of the metamaterials can be described by the effective medium theory. The nearly perfect bending effect is demonstrated by finite element simulations of various structures with different bending curvatures and shapes. This effect is attributed to zero effective permittivity along the direction of propagation and matched effective impedance at the interfaces between the bending part and the dielectric waveguides. We envisage that the design will be applicable in the far-infrared and terahertz frequency ranges owing to the tunable dielectric responses of graphene.

Synthesis of borophenes: Anisotropic, two-dimensional boron polymorphs

Energy Technology Data Exchange (ETDEWEB)

Mannix, A. J.; Zhou, X. -F.; Kiraly, B.; Wood, J. D.; Alducin, D.; Myers, B. D.; Liu, X.; Fisher, B. L.; Santiago, U.; Guest, J. R.; Yacaman, M. J.; Ponce, A.; Oganov, A. R.; Hersam, M. C.; Guisinger, N. P.

2015-12-17

At the atomic-cluster scale, pure boron is markedly similar to carbon, forming simple planar molecules and cage-like fullerenes. Theoretical studies predict that two-dimensional (2D) boron sheets will adopt an atomic configuration similar to that of boron atomic clusters. We synthesized atomically thin, crystalline 2D boron sheets (i.e., borophene) on silver surfaces under ultrahigh-vacuum conditions. Atomic-scale characterization, supported by theoretical calculations, revealed structures reminiscent of fused boron clusters with multiple scales of anisotropic, out-of-plane buckling. Unlike bulk boron allotropes, borophene shows metallic characteristics that are consistent with predictions of a highly anisotropic, 2D metal.

Tunable waveguide bends with graphene-based anisotropic metamaterials

KAUST Repository

Chen, Zhao-xian

2016-01-15

We design tunable waveguide bends filled with graphene-based anisotropic metamaterials to achieve a nearly perfect bending effect. The anisotropic properties of the metamaterials can be described by the effective medium theory. The nearly perfect bending effect is demonstrated by finite element simulations of various structures with different bending curvatures and shapes. This effect is attributed to zero effective permittivity along the direction of propagation and matched effective impedance at the interfaces between the bending part and the dielectric waveguides. We envisage that the design will be applicable in the far-infrared and terahertz frequency ranges owing to the tunable dielectric responses of graphene.

Anisotropic and Hierarchical Porosity in Multifunctional Ceramics

Science.gov (United States)

Lichtner, Aaron Zev

The performance of multifunctional porous ceramics is often hindered by the seemingly contradictory effects of porosity on both mechanical and non-structural properties and yet a sufficient body of knowledge linking microstructure to these properties does not exist. Using a combination of tailored anisotropic and hierarchical materials, these disparate effects may be reconciled. In this project, a systematic investigation of the processing, characterization and properties of anisotropic and isotropic hierarchically porous ceramics was conducted. The system chosen was a composite ceramic intended as the cathode for a solid oxide fuel cell (SOFC). Comprehensive processing investigations led to the development of approaches to make hierarchical, anisotropic porous microstructures using directional freeze-casting of well dispersed slurries. The effect of all the important processing parameters was investigated. This resulted in an ability to tailor and control the important microstructural features including the scale of the microstructure, the macropore size and total porosity. Comparable isotropic porous ceramics were also processed using fugitive pore formers. A suite of characterization techniques including x-ray tomography and 3-D sectional scanning electron micrographs (FIB-SEM) was used to characterize and quantify the green and partially sintered microstructures. The effect of sintering temperature on the microstructure was quantified and discrete element simulations (DEM) were used to explain the experimental observations. Finally, the comprehensive mechanical properties, at room temperature, were investigated, experimentally and using DEM, for the different microstructures.

Anisotropic temperature relaxation of plasmas in an external magnetic field

International Nuclear Information System (INIS)

Hassan, M.H.A.

1977-01-01

The magnetized kinetic equation derived in an earlier paper (Hassan and Watson, 1977) is used to study the problem of relaxation of anisotropic electron and ion temperatures in a magnetized plasma. In the case of anisotropic electron temperature relaxation, it is shown that for small anisotropies the exchange of energy within the electrons between the components parallel and perpendicular to the magnetic field direction determine the relaxation rate. For anisotropic ion temperature relaxation it is shown that the essential mechanism for relaxation is provided by energy transfer between ions and electrons, and that the expression for the relaxation rate perpendicular to the magnetic field contains a significant term proportional to ln eta 0 ln (msub(e)/msub(i)) (where eta 0 = Ωsub(e)/ksub(D)Vsub(e perpendicular to)), in addition to the term proportional to the Coulomb logarithm. (author)

Anisotropic magnetoelectric characteristics in five-layer magnetization-graded multiferroic composites

Directory of Open Access Journals (Sweden)

Lei Chen

2017-05-01

Full Text Available We investigate the anisotropic magnetoelectric(ME characteristics for the five-layer magnetization-graded multiferroic composites(MGMC. The magnetic anisotropy and corresponding anisotropic magnetomechanical effect, demagnetization effect and magneto-mechanical damping’s dependence on magnetic field direction result in an obvious anisotropic ME coupling effect. The experimental results show that ME voltage coefficient in H33 mode is remarkably larger than the other ones (H11, H31 and H13 over the whole Hdc range. Correspondingly, ∂VME/∂Hdc arrives about 420mV/Oe at an optimum bias magnetic field of 46Oe, which is approximately 40 times larger than that of the previous reported composite. Furthermore, it also demonstrates an obvious angular dependence on dc magnetic field. Taking advantage of these specifications, the MGMC can be used to detect weak dc magnetic field and its spatial orientation.

δ M formalism and anisotropic chaotic inflation power spectrum

Science.gov (United States)

Talebian-Ashkezari, A.; Ahmadi, N.

2018-05-01

A new analytical approach to linear perturbations in anisotropic inflation has been introduced in [A. Talebian-Ashkezari, N. Ahmadi and A.A. Abolhasani, JCAP 03 (2018) 001] under the name of δ M formalism. In this paper we apply the mentioned approach to a model of anisotropic inflation driven by a scalar field, coupled to the kinetic term of a vector field with a U(1) symmetry. The δ M formalism provides an efficient way of computing tensor-tensor, tensor-scalar as well as scalar-scalar 2-point correlations that are needed for the analysis of the observational features of an anisotropic model on the CMB. A comparison between δ M results and the tedious calculations using in-in formalism shows the aptitude of the δ M formalism in calculating accurate two point correlation functions between physical modes of the system.

Multiscale simulations of anisotropic particles combining molecular dynamics and Green's function reaction dynamics

Science.gov (United States)

Vijaykumar, Adithya; Ouldridge, Thomas E.; ten Wolde, Pieter Rein; Bolhuis, Peter G.

2017-03-01

The modeling of complex reaction-diffusion processes in, for instance, cellular biochemical networks or self-assembling soft matter can be tremendously sped up by employing a multiscale algorithm which combines the mesoscopic Green's Function Reaction Dynamics (GFRD) method with explicit stochastic Brownian, Langevin, or deterministic molecular dynamics to treat reactants at the microscopic scale [A. Vijaykumar, P. G. Bolhuis, and P. R. ten Wolde, J. Chem. Phys. 143, 214102 (2015)]. Here we extend this multiscale MD-GFRD approach to include the orientational dynamics that is crucial to describe the anisotropic interactions often prevalent in biomolecular systems. We present the novel algorithm focusing on Brownian dynamics only, although the methodology is generic. We illustrate the novel algorithm using a simple patchy particle model. After validation of the algorithm, we discuss its performance. The rotational Brownian dynamics MD-GFRD multiscale method will open up the possibility for large scale simulations of protein signalling networks.

Solution of time dependent atmospheric diffusion equation with a proposed diffusion coefficient

International Nuclear Information System (INIS)

Mayhoub, A.B.; Essa, KH.S.M.; Aly, SH.

2004-01-01

One-dimensional model for the dispersion of passive atmospheric contaminant (not included chemical reactions) in the atmospheric boundary layer is considered. On the basis of the gradient transfer theory (K-theory), the time dependent diffusion equation represents the dispersion of the pollutants is solved analytically. The solution depends on diffusion coefficient K', which is expressed in terms of the friction velocity 'u the vertical coordinate -L and the depth of the mixing layer 'h'. The solution is obtained to either the vertical coordinate 'z' is less or greater than the mixing height 'h'. The obtained solution may be applied to study the atmospheric dispersion of pollutants

Finite frequency traveltime sensitivity kernels for acoustic anisotropic media: Angle dependent bananas

KAUST Repository

Djebbi, Ramzi

2013-08-19

Anisotropy is an inherent character of the Earth subsurface. It should be considered for modeling and inversion. The acoustic VTI wave equation approximates the wave behavior in anisotropic media, and especially it\\'s kinematic characteristics. To analyze which parts of the model would affect the traveltime for anisotropic traveltime inversion methods, especially for wave equation tomography (WET), we drive the sensitivity kernels for anisotropic media using the VTI acoustic wave equation. A Born scattering approximation is first derived using the Fourier domain acoustic wave equation as a function of perturbations in three anisotropy parameters. Using the instantaneous traveltime, which unwraps the phase, we compute the kernels. These kernels resemble those for isotropic media, with the η kernel directionally dependent. They also have a maximum sensitivity along the geometrical ray, which is more realistic compared to the cross-correlation based kernels. Focusing on diving waves, which is used more often, especially recently in waveform inversion, we show sensitivity kernels in anisotropic media for this case.

Radiation of planar electromagnetic waves by a line source in anisotropic metamaterials

International Nuclear Information System (INIS)

Cheng Qiang; Jiang Weixiang; Cui Tiejun

2010-01-01

We show experimentally that a line source in an anisotropic metamaterial directly radiates planar electromagnetic waves instead of cylindrical waves, when one component of the permeability tensor approaches zero. The impedance of this material can be perfectly matched to that of free space, which can significantly reduce the reflections between the source and the superstrate, as in traditional highly directive antennas based on zero index metamaterials. Such a unique property determines the two-way propagation of electromagnetic waves excited by a line source, instead of all-way propagation. From this feature, a highly directive emission of electromagnetic waves is achieved using the anisotropic metamaterial with arbitrary shape. We have designed and fabricated the anisotropic metamaterial in the microwave region, and observed the generation of plane waves and their highly directive emission. The proposed plane-wave emission is independent of the shape variance of the anisotropic metamaterial, which can be utilized in the design of conformal antennas.

Finite frequency traveltime sensitivity kernels for acoustic anisotropic media: Angle dependent bananas

KAUST Repository

Djebbi, Ramzi; Alkhalifah, Tariq Ali

2013-01-01

Anisotropy is an inherent character of the Earth subsurface. It should be considered for modeling and inversion. The acoustic VTI wave equation approximates the wave behavior in anisotropic media, and especially it's kinematic characteristics. To analyze which parts of the model would affect the traveltime for anisotropic traveltime inversion methods, especially for wave equation tomography (WET), we drive the sensitivity kernels for anisotropic media using the VTI acoustic wave equation. A Born scattering approximation is first derived using the Fourier domain acoustic wave equation as a function of perturbations in three anisotropy parameters. Using the instantaneous traveltime, which unwraps the phase, we compute the kernels. These kernels resemble those for isotropic media, with the η kernel directionally dependent. They also have a maximum sensitivity along the geometrical ray, which is more realistic compared to the cross-correlation based kernels. Focusing on diving waves, which is used more often, especially recently in waveform inversion, we show sensitivity kernels in anisotropic media for this case.

Litrani: a general purpose Monte-Carlo program simulating light propagation in isotropic or anisotropic media

International Nuclear Information System (INIS)

Gentit, F.-X.

2002-01-01

Litrani is a general purpose Monte-Carlo program simulating light propagation in any type of setup describable by the shapes provided by ROOT. Each shape may be made of a different material. Dielectric constant, absorption length and diffusion length of materials may depend upon wavelength. Dielectric constant and absorption length may be anisotropic. Each face of a volume is either partially or totally in contact with a face of another volume, or covered with some wrapping having defined characteristics of absorption, reflection and diffusion. When in contact with another face of another volume, the possibility exists to have a thin slice of width d and index n between the two faces. The program has various sources of light: spontaneous photons, photons coming from an optical fibre, photons generated by the crossing of particles or photons generated by an electromagnetic shower. The time and wavelength spectra of emitted photons may reproduce any scintillation spectrum. As detectors, phototubes, APD, or any general type of surface or volume detectors may be specified. The aim is to follow each photon until it is absorbed or detected. Quantities to be delivered by the program are the proportion of photons detected, and the time distribution for the arrival of these, or the various ways photons may be lost

Anisotropic nanomaterials: Synthesis, optical and magnetic properties, and applications

Science.gov (United States)

Banholzer, Matthew John

As nanoscience and nanotechnology mature, anisotropic metal nanostructures are emerging in a variety of contexts as valuable class of nanostructures due to their distinctive attributes. With unique properties ranging from optical to magnetic and beyond, these structures are useful in many new applications. Chapter two discusses the nanodisk code: a linear array of metal disk pairs that serve as surface-enhanced Raman scattering substrates. These multiplexing structures employ a binary encoding scheme, perform better than previous nanowires designs (in the context of SERS) and are useful for both convert encoding and tagging of substrates (based both on spatial disk position and spectroscopic response) as well as biomolecule detection (e.g. DNA). Chapter three describes the development of improved, silver-based nanodisk code structures. Work was undertaken to generate structures with high yield and reproducibility and to reoptimize the geometry of each disk pair for maximum Raman enhancement. The improved silver structures exhibit greater enhancement than Au structures (leading to lower DNA detection limits), convey additional flexibility, and enable trinary encoding schemes where far more unique structures can be created. Chapter four considers the effect of roughness on the plasmonic properties of nanorod structures and introduces a novel method to smooth the end-surfaces of nanorods structures. The smoothing technique is based upon a two-step process relying upon diffusion control during nanowires growth and selective oxidation after each step of synthesis is complete. Empirical and theoretical work show that smoothed nanostructures have superior and controllable optical properties. Chapter five concerns silica-encapsulated gold nanoprisms. This encapsulation allows these highly sensitive prisms to remain stable and protected in solution, enabling their use as class-leading sensors. Theoretical study complements the empirical work, exploring the effect of

Anisotropic Interactions between Cold Rydberg Atoms

Science.gov (United States)

2015-09-28

AFRL-AFOSR-CL-TR-2015-0002 Anisotropic interactions between cold Rydberg atoms Luis Marcassa INSTITUTO DE FISICA DE SAO CARLOS Final Report 09/28...problem with the report +551633739806 Organization / Institution name Instituto de Fisica de Sao Carlos Grant/Contract Title The full title of the

TOPICAL REVIEW Textured silicon nitride: processing and anisotropic properties

Directory of Open Access Journals (Sweden)

Xinwen Zhu and Yoshio Sakka

2008-01-01

Full Text Available Textured silicon nitride (Si3N4 has been intensively studied over the past 15 years because of its use for achieving its superthermal and mechanical properties. In this review we present the fundamental aspects of the processing and anisotropic properties of textured Si3N4, with emphasis on the anisotropic and abnormal grain growth of β-Si3N4, texture structure and texture analysis, processing methods and anisotropic properties. On the basis of the texturing mechanisms, the processing methods described in this article have been classified into two types: hot-working (HW and templated grain growth (TGG. The HW method includes the hot-pressing, hot-forging and sinter-forging techniques, and the TGG method includes the cold-pressing, extrusion, tape-casting and strong magnetic field alignment techniques for β-Si3N4 seed crystals. Each processing technique is thoroughly discussed in terms of theoretical models and experimental data, including the texturing mechanisms and the factors affecting texture development. Also, methods of synthesizing the rodlike β-Si3N4 single crystals are presented. Various anisotropic properties of textured Si3 N4 and their origins are thoroughly described and discussed, such as hardness, elastic modulus, bending strength, fracture toughness, fracture energy, creep behavior, tribological and wear behavior, erosion behavior, contact damage behavior and thermal conductivity. Models are analyzed to determine the thermal anisotropy by considering the intrinsic thermal anisotropy, degree of orientation and various microstructure factors. Textured porous Si3N4 with a unique microstructure composed of oriented elongated β-Si3N4 and anisotropic pores is also described for the first time, with emphasis on its unique mechanical and thermal-mechanical properties. Moreover, as an important related material, textured α-Sialon is also reviewed, because the presence of elongated α-Sialon grains allows the production of textured �

Ultraviolet laser-induced voltage in anisotropic shale

Science.gov (United States)

Miao, Xinyang; Zhu, Jing; Li, Yizhang; Zhao, Kun; Zhan, Honglei; Yue, Wenzheng

2018-01-01

The anisotropy of shales plays a significant role in oil and gas exploration and engineering. Owing to various problems and limitations, anisotropic properties were seldom investigated by direct current resistivity methods. Here in this work, a 248 nm ultraviolet laser was employed to assess the anisotropic electrical response of a dielectric shale. Angular dependence of laser-induced voltages (V p) were obtained, with a data symmetry at the location of 180° and a ~62.2% V p anisotropy of the sample. The double-exponential functions have provided an explanation for the electrical field controlled carrier transportation process in horizontal and vertical directions. The results demonstrate that the combination of optics and electrical logging analysis (Opti-electrical Logging) is a promising technology for the investigation of unconventional reservoirs.

Transient electromagnetic scattering on anisotropic media

International Nuclear Information System (INIS)

Stewart, R.D.

1990-01-01

This dissertation treats the problem of transient scattering of obliquely incident electromagnetic plane waves on a stratified anisotropic dielectric slab. Scattering operators are derived for the reflective response of the medium. The internal fields are calculated. Wave splitting and invariant imbedding techniques are used. These techniques are first presented for fields normally incident on a stratified, isotropic dielectric medium. The techniques of wave splitting and invariant imbedding are applied to normally incident plane waves on an anisotropic medium. An integro-differential equation is derived for the reflective response and the direct and inverse scattering problems are discussed. These techniques are applied to the case of obliquely incident plane waves. The reflective response is derived and the direct and inverse problems discussed and compared to those for the normal incidence case. The internal fields are investigated for the oblique incidence via a Green's function approach. A numerical scheme is presented to calculate the Green's function. Finally, symmetry relations of the reflective response are discussed

Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

International Nuclear Information System (INIS)

El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

2010-01-01

The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

Practical estimate of gradient nonlinearity for implementation of apparent diffusion coefficient bias correction.

Science.gov (United States)

Malkyarenko, Dariya I; Chenevert, Thomas L

2014-12-01

To describe an efficient procedure to empirically characterize gradient nonlinearity and correct for the corresponding apparent diffusion coefficient (ADC) bias on a clinical magnetic resonance imaging (MRI) scanner. Spatial nonlinearity scalars for individual gradient coils along superior and right directions were estimated via diffusion measurements of an isotropicic e-water phantom. Digital nonlinearity model from an independent scanner, described in the literature, was rescaled by system-specific scalars to approximate 3D bias correction maps. Correction efficacy was assessed by comparison to unbiased ADC values measured at isocenter. Empirically estimated nonlinearity scalars were confirmed by geometric distortion measurements of a regular grid phantom. The applied nonlinearity correction for arbitrarily oriented diffusion gradients reduced ADC bias from 20% down to 2% at clinically relevant offsets both for isotropic and anisotropic media. Identical performance was achieved using either corrected diffusion-weighted imaging (DWI) intensities or corrected b-values for each direction in brain and ice-water. Direction-average trace image correction was adequate only for isotropic medium. Empiric scalar adjustment of an independent gradient nonlinearity model adequately described DWI bias for a clinical scanner. Observed efficiency of implemented ADC bias correction quantitatively agreed with previous theoretical predictions and numerical simulations. The described procedure provides an independent benchmark for nonlinearity bias correction of clinical MRI scanners.

Crystal structure and ion-diffusion pathway of inorganic materials through neutron diffraction

International Nuclear Information System (INIS)

Yashima, Masatomo

2012-01-01

The present brief review describes the application of neutron powder diffractometry and maximum-entropy method to the studies of crystal structure and diffusional pathways of mobile ions in ionic conducting ceramic materials. La 0.62 Li 0.16 TiO 3 and L i0.6 FePO 4 exhibit two- and one-dimensional networks of Li cation diffusional pathways, respectively. In the fluorite-structure ionic conductors such as celia solid solution Ce 0.93 Y 0.07 O 1.96 , bismuth oxide solid solution δ-Bi 1.4 Yb 0.6 O 3 and copper iodide CuI, a similar curved diffusion pathway along the directions is observed. In the cubic ABO 3 perovskite-type ionic conductor, lanthanum gallate solid solution, the mobile ions diffuse along a curved line keeping the interatomic distance between the B cation and O 2- anion. We have experimentally confirmed that the anisotropic thermal motions of the apex O2 atom and the interstitial O3 atoms are essential for the high oxygen permeability of the K 2 NiF 4 -type mixed conductor. Diffusion paths of proton are visualized along c axis in hexagonal hydroxyapatite. (author)

FDTD analysis of 3-D conducting target coated by anisotropic magnetized plasma

International Nuclear Information System (INIS)

Xu Lijun; Liu Shaobin; Mo Jinjun; Yuan Naichang

2006-01-01

The JEC finite-difference time-domain (JEC-FDTD) method is extended to three dimensional anisotropic dispersive media- the magnetized plasma. The problem which incorporates both anisotropy and frequency dispersion at the same time is solved for the electromagnetic wave propagation. The three dimensional JEC-FDTD formulations for anisotropic magnetized plasma are derived. The method is applied to the electromagnetic scattering of dihedral corner reflector and sphere-cone coated with anisotropic magnetized plasma. By simulating the interaction of electromagnetic wave with magnetized plasma, some numerical results are obtained, which indicate that an appropriate plasma coating may efficiently reduce the RCS of a metallic target. (authors)

Lead diffusion in monazite; Diffusion du plomb dans la monazite

Energy Technology Data Exchange (ETDEWEB)

Gardes, E

2006-06-15

Proper knowledge of the diffusion rates of lead in monazite is necessary to understand the U-Th-Pb age anomalies of this mineral, which is one of the most used in geochronology after zircon. Diffusion experiments were performed in NdPO{sub 4} monocrystals and in Nd{sub 0.66}Ca{sub 0.17}Th{sub 0.17}PO{sub 4} polycrystals from Nd{sub 0.66}Pb{sub 0.17}Th{sub 0.17}PO{sub 4} thin films to investigate Pb{sup 2+} + Th{sup 4+} {r_reversible} 2 Nd{sup 3+} and Pb{sup 2+} {r_reversible} Ca{sup 2+} exchanges. Diffusion annealings were run between 1200 and 1500 Celsius degrees, at room pressure, for durations ranging from one hour to one month. The diffusion profiles were analysed using TEM (transmission electronic microscopy) and RBS (Rutherford backscattering spectroscopy). The diffusivities extracted for Pb{sup 2+} + Th{sup 4+} {r_reversible} 2 Nd{sup 3+} exchange follow an Arrhenius law with parameters E equals 509 {+-} 24 kJ mol{sup -1} and log(D{sub 0} (m{sup 2}s{sup -1})) equals -3.41 {+-} 0.77. Preliminary data for Pb{sup 2+} {r_reversible} Ca{sup 2+} exchange are in agreement with this result. The extrapolation of our data to crustal temperatures yields very slow diffusivities. For instance, the time necessary for a 50 {mu}m grain to lose all of its lead at 800 Celsius degrees is greater than the age of the Earth. From these results and other evidence from the literature, we conclude that most of the perturbations in U-Th-Pb ages of monazite cannot be attributed to lead diffusion, but rather to interactions with fluids. (author)

Monte carlo simulation of anisotropic grain growth in liquid phase sintering

International Nuclear Information System (INIS)

Han, Yoon Soo; Kim, Do Kyung

2003-01-01

One of the key techniques in modern engineering ceramic system is microstructural control of anisotropic grain growth because grain orientation and shape proved to have an influence on mechanic, dielectric and electric behavior of ceramics. But until now, computer simulation for grain growth has not sufficiently addressed to this subject. The reason is that simulation algorithm was laborious because it has to contain mass transfer through liquid phase and especially anisotropic grain growth has to be considered based on interfacial properties in real system. The goal of present study is simulation of anisotropic grain growth in liquid phase by Q-states model. To give anisotropic inherency to grains, constraint on mobility to specific boundaries was applied. For comparison, we measured grain size distribution and deduced grain growth kinetics from relation ship between average grain size and time. As a result, the grain size distribution functions become broader and the peak height decreases as the anisotropy is increased. The growth exponent 0.67 and 0.47 found by linear fitting have slightly different values in comparison with work of Grest et al. but similar is trend to the decrease of exponent with anisotropy

Anisotropic fractal media by vector calculus in non-integer dimensional space

Energy Technology Data Exchange (ETDEWEB)

Tarasov, Vasily E., E-mail: tarasov@theory.sinp.msu.ru [Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University, Moscow 119991 (Russian Federation)

2014-08-15

A review of different approaches to describe anisotropic fractal media is proposed. In this paper, differentiation and integration non-integer dimensional and multi-fractional spaces are considered as tools to describe anisotropic fractal materials and media. We suggest a generalization of vector calculus for non-integer dimensional space by using a product measure method. The product of fractional and non-integer dimensional spaces allows us to take into account the anisotropy of the fractal media in the framework of continuum models. The integration over non-integer-dimensional spaces is considered. In this paper differential operators of first and second orders for fractional space and non-integer dimensional space are suggested. The differential operators are defined as inverse operations to integration in spaces with non-integer dimensions. Non-integer dimensional space that is product of spaces with different dimensions allows us to give continuum models for anisotropic type of the media. The Poisson's equation for fractal medium, the Euler-Bernoulli fractal beam, and the Timoshenko beam equations for fractal material are considered as examples of application of suggested generalization of vector calculus for anisotropic fractal materials and media.

Anisotropic fractal media by vector calculus in non-integer dimensional space

Science.gov (United States)

Tarasov, Vasily E.

2014-08-01

A review of different approaches to describe anisotropic fractal media is proposed. In this paper, differentiation and integration non-integer dimensional and multi-fractional spaces are considered as tools to describe anisotropic fractal materials and media. We suggest a generalization of vector calculus for non-integer dimensional space by using a product measure method. The product of fractional and non-integer dimensional spaces allows us to take into account the anisotropy of the fractal media in the framework of continuum models. The integration over non-integer-dimensional spaces is considered. In this paper differential operators of first and second orders for fractional space and non-integer dimensional space are suggested. The differential operators are defined as inverse operations to integration in spaces with non-integer dimensions. Non-integer dimensional space that is product of spaces with different dimensions allows us to give continuum models for anisotropic type of the media. The Poisson's equation for fractal medium, the Euler-Bernoulli fractal beam, and the Timoshenko beam equations for fractal material are considered as examples of application of suggested generalization of vector calculus for anisotropic fractal materials and media.

Anisotropic fractal media by vector calculus in non-integer dimensional space

International Nuclear Information System (INIS)

Tarasov, Vasily E.

2014-01-01

A review of different approaches to describe anisotropic fractal media is proposed. In this paper, differentiation and integration non-integer dimensional and multi-fractional spaces are considered as tools to describe anisotropic fractal materials and media. We suggest a generalization of vector calculus for non-integer dimensional space by using a product measure method. The product of fractional and non-integer dimensional spaces allows us to take into account the anisotropy of the fractal media in the framework of continuum models. The integration over non-integer-dimensional spaces is considered. In this paper differential operators of first and second orders for fractional space and non-integer dimensional space are suggested. The differential operators are defined as inverse operations to integration in spaces with non-integer dimensions. Non-integer dimensional space that is product of spaces with different dimensions allows us to give continuum models for anisotropic type of the media. The Poisson's equation for fractal medium, the Euler-Bernoulli fractal beam, and the Timoshenko beam equations for fractal material are considered as examples of application of suggested generalization of vector calculus for anisotropic fractal materials and media

Influence of copper foil polycrystalline structure on graphene anisotropic etching

Energy Technology Data Exchange (ETDEWEB)

Sharma, Kamal P. [Department of Frontier Materials, Nagoya Institute of Technology, Gokiso-cho, Showa-ku, Nagoya 466-8555 (Japan); Mahyavanshi, Rakesh D. [Department of Physical Science and Engineering, Nagoya Institute of Technology, Gokiso-cho, Showa-ku, Nagoya 466-8555 (Japan); Kalita, Golap, E-mail: kalita.golap@nitech.ac.jp [Department of Frontier Materials, Nagoya Institute of Technology, Gokiso-cho, Showa-ku, Nagoya 466-8555 (Japan); Department of Physical Science and Engineering, Nagoya Institute of Technology, Gokiso-cho, Showa-ku, Nagoya 466-8555 (Japan); Tanemura, Masaki [Department of Frontier Materials, Nagoya Institute of Technology, Gokiso-cho, Showa-ku, Nagoya 466-8555 (Japan); Department of Physical Science and Engineering, Nagoya Institute of Technology, Gokiso-cho, Showa-ku, Nagoya 466-8555 (Japan)

2017-01-30

Graphical abstract: Hexagonal hole formation with anisotropic etching independent of the stripes and wrinkles in the synthesized graphene. We also observed variation in etched pattern of the graphene depending on the base Cu grain orientations, attributing to difference in nucleation and growth process. - Highlights: • Reveal the influence of copper polycrystalline structure on anisotropic etching of graphene. • Hexagonal hole formation with etching is observed to be independent of stripes and wrinkles in graphene. • Variation in etched pattern of graphene depending on the base Cu grain is confirmed. • This finding will help to understand the nature of microscopic etched pattern in graphene. - Abstract: Anisotropic etching of graphene and other two dimensional materials is an important tool to understand the growth process as well as enabling fabrication of various well-defined structures. Here, we reveal the influence of copper foil polycrystalline structure on anisotropic etching process of as-synthesized graphene. Graphene crystals were synthesized on the polycrystalline Cu foil by a low-pressure chemical vapor deposition (LPCVD) system. Microscopic analysis shows difference in shape, size and stripes alignment of graphene crystals with dissimilar nucleation within closure vicinity of neighboring Cu grains. Post-growth etching of such graphene crystals also significantly affected by the crystallographic nature of Cu grains as observed by the field emission scanning electron microscope (FE-SEM) and electron back scattered diffraction (EBSD) analysis. Hexagonal hole formation with anisotropic etching is observed to be independent of the stripes and wrinkles in the synthesized graphene. We also observed variation in etched pattern of the graphene depending on the base Cu grain orientations, attributing to difference in nucleation and growth process. The findings can facilitate to understand the nature of microscopic etched pattern depending on metal

Influence of copper foil polycrystalline structure on graphene anisotropic etching

International Nuclear Information System (INIS)

Sharma, Kamal P.; Mahyavanshi, Rakesh D.; Kalita, Golap; Tanemura, Masaki

2017-01-01

Graphical abstract: Hexagonal hole formation with anisotropic etching independent of the stripes and wrinkles in the synthesized graphene. We also observed variation in etched pattern of the graphene depending on the base Cu grain orientations, attributing to difference in nucleation and growth process. - Highlights: • Reveal the influence of copper polycrystalline structure on anisotropic etching of graphene. • Hexagonal hole formation with etching is observed to be independent of stripes and wrinkles in graphene. • Variation in etched pattern of graphene depending on the base Cu grain is confirmed. • This finding will help to understand the nature of microscopic etched pattern in graphene. - Abstract: Anisotropic etching of graphene and other two dimensional materials is an important tool to understand the growth process as well as enabling fabrication of various well-defined structures. Here, we reveal the influence of copper foil polycrystalline structure on anisotropic etching process of as-synthesized graphene. Graphene crystals were synthesized on the polycrystalline Cu foil by a low-pressure chemical vapor deposition (LPCVD) system. Microscopic analysis shows difference in shape, size and stripes alignment of graphene crystals with dissimilar nucleation within closure vicinity of neighboring Cu grains. Post-growth etching of such graphene crystals also significantly affected by the crystallographic nature of Cu grains as observed by the field emission scanning electron microscope (FE-SEM) and electron back scattered diffraction (EBSD) analysis. Hexagonal hole formation with anisotropic etching is observed to be independent of the stripes and wrinkles in the synthesized graphene. We also observed variation in etched pattern of the graphene depending on the base Cu grain orientations, attributing to difference in nucleation and growth process. The findings can facilitate to understand the nature of microscopic etched pattern depending on metal

Timoshenko beam element with anisotropic cross-sectional properties

DEFF Research Database (Denmark)

Stäblein, Alexander; Hansen, Morten Hartvig

2016-01-01

Beam models are used for the aeroelastic time and frequency domain analysis of wind turbines due to their computational efficiency. Many current aeroelastic tools for the analysis of wind turbines rely on Timoshenko beam elements with classical crosssectional properties (EA, EI, etc.). Those cross......-sectional properties do not reflect the various couplings arising from the anisotropic behaviour of the blade material. A twonoded, three-dimensional Timoshenko beam element was therefore extended to allow for anisotropic cross-sectional properties. For an uncoupled beam, the resulting shape functions are identical...... to the original formulation. The new element was implemented into a co-rotational formulation and validated against natural frequencies and several static load cases of previous works....

Anisotropic dynamic mass density for fluidsolid composites

KAUST Repository

Wu, Ying; Mei, Jun; Sheng, Ping

2012-01-01

By taking the low frequency limit of multiple-scattering theory, we obtain the dynamic effective mass density of fluidsolid composites with a two-dimensional rectangular lattice structure. The anisotropic mass density can be described by an angle

Comparative analysis of diffused solar radiation models for optimum tilt angle determination for Indian locations

International Nuclear Information System (INIS)

Yadav, P.; Chandel, S.S.

2014-01-01

Tilt angle and orientation greatly are influenced on the performance of the solar photo voltaic panels. The tilt angle of solar photovoltaic panels is one of the important parameters for the optimum sizing of solar photovoltaic systems. This paper analyses six different isotropic and anisotropic diffused solar radiation models for optimum tilt angle determination. The predicted optimum tilt angles are compared with the experimentally measured values for summer season under outdoor conditions. The Liu and Jordan model is found to exhibit t lowest error as compared to other models for the location. (author)

Nonlinear anisotropic parabolic equations in Lm

Directory of Open Access Journals (Sweden)

Fares Mokhtari

2014-01-01

Full Text Available In this paper, we give a result of regularity of weak solutions for a class of nonlinear anisotropic parabolic equations with lower-order term when the right-hand side is an Lm function, with m being ”small”. This work generalizes some results given in [2] and [3].

Asymptotic Analysis of Upwind Discontinuous Galerkin Approximation of the Radiative Transport Equation in the Diffusive Limit

KAUST Repository

Guermond, Jean-Luc; Kanschat, Guido

2010-01-01

We revisit some results from M. L. Adams [Nu cl. Sci. Engrg., 137 (2001), pp. 298- 333]. Using functional analytic tools we prove that a necessary and sufficient condition for the standard upwind discontinuous Galerkin approximation to converge to the correct limit solution in the diffusive regime is that the approximation space contains a linear space of continuous functions, and the restrictions of the functions of this space to each mesh cell contain the linear polynomials. Furthermore, the discrete diffusion limit converges in the Sobolev space H1 to the continuous one if the boundary data is isotropic. With anisotropic boundary data, a boundary layer occurs, and convergence holds in the broken Sobolev space H with s < 1/2 only © 2010 Society for Industrial and Applied Mathematics.

Stoner–Wohlfarth model for the anisotropic case

Energy Technology Data Exchange (ETDEWEB)

Campos, Marcos F. de, E-mail: mcampos@metal.eeimvr.uff.br [Programa de Pós-graduação em Engenharia Metalúrgica-PUVR, Universidade Federal Fluminense, Av dos Trabalhadores 420,27255-125 Volta Redonda, Rio de Janeiro (Brazil); Sampaio da Silva, Fernanda A. [Programa de Pós-graduação em Engenharia Metalúrgica-PUVR, Universidade Federal Fluminense, Av dos Trabalhadores 420,27255-125 Volta Redonda, Rio de Janeiro (Brazil); Perigo, Elio A. [Laboratory for the Physics of Advanced Materials, University of Luxembourg, L1511 Luxembourg (Luxembourg); Castro, José A. de [Programa de Pós-graduação em Engenharia Metalúrgica-PUVR, Universidade Federal Fluminense, Av dos Trabalhadores 420,27255-125 Volta Redonda, Rio de Janeiro (Brazil)

2013-11-15

The Stoner–Wohlfarth (SW) model was calculated for the anisotropic case, by assuming crystallographical texture distributions as Gaussian, Lorentzian and Cos{sup n} (alpha). All these distributions were tested and both Gaussian and Cos{sup n} (alpha) give similar results for M{sub r}/M{sub s} above 0.8. However, the use of Cos{sup n} (alpha) makes it easier to find analytical expressions representing texture. The Lorentzian distribution is a suitable choice for not well aligned magnets, or magnets with a high fraction of misaligned grains. It is discussed how to obtain the alignment degree M{sub r}/M{sub s} directly from two measurements of magnetic remanence at the transverse and parallel directions to the alignment direction of the magnet. It is demonstrated that even the well aligned magnets with M{sub r}/M{sub s}=0.96 present coercive field of 60–70% of the anisotropy field, depending on the chosen distribution. The anisotropic SW model was used for discussing hysteresis squareness. Improving the crystalographical texture, the loop squareness also increases. - Highlights: • The Stoner–Wohlfarth model was calculated for the anisotropic case. • Different distribution functions for texture description were compared and discussed. • Lorentzian distribution is adequate for not well oriented magnets. • Determination of the alignment ratio M{sub r}/M{sub s} from 2 remanence measurements. • Prediction of the coercive field in Stoner–Wohlfarth aligned magnets.

Anisotropic stars obeying Chaplygin equation of state

Indian Academy of Sciences (India)

P Bhar

2017-12-14

Dec 14, 2017 ... Anisotropic effects may also originate from slow rotation of the core ... to include the effects of pressure anisotropy, electric charge, scalar field, dark energy and the cosmological constant in .... Generating solutions. In order to ...

Ballistic Anisotropic Magnetoresistance of Single-Atom Contacts.

Science.gov (United States)

Schöneberg, J; Otte, F; Néel, N; Weismann, A; Mokrousov, Y; Kröger, J; Berndt, R; Heinze, S

2016-02-10

Anisotropic magnetoresistance, that is, the sensitivity of the electrical resistance of magnetic materials on the magnetization direction, is expected to be strongly enhanced in ballistic transport through nanoscale junctions. However, unambiguous experimental evidence of this effect is difficult to achieve. We utilize single-atom junctions to measure this ballistic anisotropic magnetoresistance (AMR). Single Co and Ir atoms are deposited on domains and domain walls of ferromagnetic Fe layers on W(110) to control their magnetization directions. They are contacted with nonmagnetic tips in a low-temperature scanning tunneling microscope to measure the junction conductances. Large changes of the magnetoresistance occur from the tunneling to the ballistic regime due to the competition of localized and delocalized d-orbitals, which are differently affected by spin-orbit coupling. This work shows that engineering the AMR at the single atom level is feasible.

Selective optical transmission in anisotropic multilayers structure

International Nuclear Information System (INIS)

Ouchani, N.; Bria, D.; Nougaoui, A.; Merad, A.E.

2007-08-01

We developed a Green's function method to study theoretically a single-defect photonic crystal composed of anisotropic dielectric materials. This structure can trap light of a given frequency range and filter only a certain frequency light with a very high quality. It is shown that the defect modes appear as peaks in the transmission spectrum. Their intensities and frequency positions depend on the incidence angle and the orientation of the principal axes of layers consisting of the superlattice and the layer defect. Our structure offers a great variety of possibilities for creating and controlling the number and transmitted intensities of defect modes. It can be a good candidate for realizing a selective electromagnetic filter. In addition to this filtration process, the defective anisotropic photonic crystal can be used to switch the modes when appropriate geometry is selected. (author)

An analytical model of anisotropic low-field electron mobility in wurtzite indium nitride

International Nuclear Information System (INIS)

Wang, Shulong; Liu, Hongxia; Song, Xin; Guo, Yulong; Yang, Zhaonian

2014-01-01

This paper presents a theoretical analysis of anisotropic transport properties and develops an anisotropic low-field electron analytical mobility model for wurtzite indium nitride (InN). For the different effective masses in the Γ-A and Γ-M directions of the lowest valley, both the transient and steady state transport behaviors of wurtzite InN show different transport characteristics in the two directions. From the relationship between velocity and electric field, the difference is more obvious when the electric field is low in the two directions. To make an accurate description of the anisotropic transport properties under low field, for the first time, we present an analytical model of anisotropic low-field electron mobility in wurtzite InN. The effects of different ionized impurity scattering models on the low-field mobility calculated by Monte Carlo method (Conwell-Weisskopf and Brooks-Herring method) are also considered. (orig.)

Anisotropic Characteristics of Turbulence Dissipation in Swirling Flow: A Direct Numerical Simulation Study

Directory of Open Access Journals (Sweden)

Xingtuan Yang

2015-01-01

Full Text Available This study investigates the anisotropic characteristics of turbulent energy dissipation rate in a rotating jet flow via direct numerical simulation. The turbulent energy dissipation tensor, including its eigenvalues in the swirling flows with different rotating velocities, is analyzed to investigate the anisotropic characteristics of turbulence and dissipation. In addition, the probability density function of the eigenvalues of turbulence dissipation tensor is presented. The isotropic subrange of PDF always exists in swirling flows relevant to small-scale vortex structure. Thus, with remarkable large-scale vortex breakdown, the isotropic subrange of PDF is reduced in strongly swirling flows, and anisotropic energy dissipation is proven to exist in the core region of the vortex breakdown. More specifically, strong anisotropic turbulence dissipation occurs concentratively in the vortex breakdown region, whereas nearly isotropic turbulence dissipation occurs dispersively in the peripheral region of the strong swirling flows.

Interactive Volume Rendering of Diffusion Tensor Data

Energy Technology Data Exchange (ETDEWEB)

Hlawitschka, Mario; Weber, Gunther; Anwander, Alfred; Carmichael, Owen; Hamann, Bernd; Scheuermann, Gerik

2007-03-30

As 3D volumetric images of the human body become an increasingly crucial source of information for the diagnosis and treatment of a broad variety of medical conditions, advanced techniques that allow clinicians to efficiently and clearly visualize volumetric images become increasingly important. Interaction has proven to be a key concept in analysis of medical images because static images of 3D data are prone to artifacts and misunderstanding of depth. Furthermore, fading out clinically irrelevant aspects of the image while preserving contextual anatomical landmarks helps medical doctors to focus on important parts of the images without becoming disoriented. Our goal was to develop a tool that unifies interactive manipulation and context preserving visualization of medical images with a special focus on diffusion tensor imaging (DTI) data. At each image voxel, DTI provides a 3 x 3 tensor whose entries represent the 3D statistical properties of water diffusion locally. Water motion that is preferential to specific spatial directions suggests structural organization of the underlying biological tissue; in particular, in the human brain, the naturally occuring diffusion of water in the axon portion of neurons is predominantly anisotropic along the longitudinal direction of the elongated, fiber-like axons [MMM+02]. This property has made DTI an emerging source of information about the structural integrity of axons and axonal connectivity between brain regions, both of which are thought to be disrupted in a broad range of medical disorders including multiple sclerosis, cerebrovascular disease, and autism [Mos02, FCI+01, JLH+99, BGKM+04, BJB+03].

Measurement of Anisotropic Particle Interactions with Nonuniform ac Electric Fields.

Science.gov (United States)

Rupp, Bradley; Torres-Díaz, Isaac; Hua, Xiaoqing; Bevan, Michael A

2018-02-20

Optical microscopy measurements are reported for single anisotropic polymer particles interacting with nonuniform ac electric fields. The present study is limited to conditions where gravity confines particles with their long axis parallel to the substrate such that particles can be treated using quasi-2D analysis. Field parameters are investigated that result in particles residing at either electric field maxima or minima and with long axes oriented either parallel or perpendicular to the electric field direction. By nonintrusively observing thermally sampled positions and orientations at different field frequencies and amplitudes, a Boltzmann inversion of the time-averaged probability of states yields kT-scale energy landscapes (including dipole-field, particle-substrate, and gravitational potentials). The measured energy landscapes show agreement with theoretical potentials using particle conductivity as the sole adjustable material property. Understanding anisotropic particle-field energy landscapes vs field parameters enables quantitative control of local forces and torques on single anisotropic particles to manipulate their position and orientation within nonuniform fields.