WorldWideScience

Sample records for granada agar plate

  1. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  2. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  3. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  4. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright ¬

  5. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  6. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  7. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 ¬Ķg/g in samples taken on day 19, 16.4 ¬Ķg/g in samples taken 3 months after exposure, 13.4 ¬Ķg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 ¬Ķg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  8. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burm√łlle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  9. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  10. A simple agar plate preparation for effective transfer of Ureaplasma colonies onto nitrocellulose membranes for colony immunoblotting.

    Science.gov (United States)

    Zimmerman, Carl-Ulrich R; Stiedl, Thomas; Spergser, Joachim; Rosengarten, Renate

    2014-09-01

    A simple method for preparing agar plates is presented, which allows an efficient transfer of Ureaplasma colonies to nitrocellulose membranes for subsequent immunological detection. This simple and reproducible procedure was used to demonstrate antigenic variation in the phase-variable mba-locus of Ureaplasma parvum serovar 3. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Comparative evaluation of Strepto B ID chromogenic medium and Granada media for the detection of Group B streptococcus from vaginal samples of pregnant women.

    Science.gov (United States)

    Tazi, Asmaa; Réglier-Poupet, Hélène; Dautezac, François; Raymond, Josette; Poyart, Claire

    2008-06-01

    Two types of selective media, the chromogenic medium Strepto B ID and two non-chromogenic media Strepto B agar and the Granada medium, were tested and compared to blood agar plates (BAP) for screening of Group B streptococcus vaginal colonization in pregnant women. All tested media were comparable in terms of sensitivity however, their use in routine laboratories may markedly facilitate the rapid detection of GBS in vaginal samples.

  12. Fluconazole-containing agar Sabouraud dextrose plates are not useful when screening for susceptibility in Candida albicans.

    Science.gov (United States)

    Bordallo-Cardona, M A; Marcos-Zambrano, L J; Gómez G de la Pedrosa, E; Escribano, P; Bouza, E; Guinea, J; Cantón, R

    2017-04-01

    Fluconazole is an alternative for candidemic patients who are not critically ill. Fluconazole is mainly fungistatic and does not completely inhibit visual Candida albicans growth. We studied the usefulness of fluconazole-containing Sabouraud dextrose agar plates for detecting susceptibility to fluconazole in C. albicans. Adjusted inocula of 19 isolates were transferred directly onto fluconazole-containing Sabouraud dextrose plates (concentrations ranging from 0.125 mg/L to 128 mg/L). The fluconazole MIC in fresh isolates and after growth on the fluconazole-containing plate at 128 mg/L was recorded following the EUCAST EDef 7.2 guidelines. Then isolates were classified according to their degree of trailing production, based on microdilution procedure. All isolates were able to grow on all fluconazole-containing plates, even those isolates susceptible to fluconazole. In fact, we selected isolates with different degrees of trailing based on microdilution procedures. 50% of isolates classified as heavy trailers, 35.71% as moderate trailers, and 14.28% as slight trailers. The use of fluconazole-containing Sabouraud dextrose agar plates was not a reliable method to detect fluconazole susceptibility in C. albicans isolates; growth of the isolates was a trailing effect rather than true resistance.

  13. Agar Plates Made from Common Supermarket Substances and Bacillus subtilis Natto as an Inexpensive Approach to Microbiology Education

    Directory of Open Access Journals (Sweden)

    Franz-Josef Scharfenberg

    2015-08-01

    Full Text Available To address the possible limitations that financial restrictions may have on students’ independent experimentation at school, we developed and implemented an inexpensive approach for basic microbiology education. We describe four nutrient agars consisting only of everyday substances available from the supermarket or online that we developed to replace standard agars and specific agars. Additionally, we selected Bacillus subtilis natto as an example of a pure-culture species. Our tip first reports the four supermarket-substance agar variants; second, it suggests utilizing them to introduce basic microbiological techniques; and third, it introduces B. subtilis natto in the context of the antibacterial effects of antibiotics as well as of supermarket products which students can bring to class from home. We implemented our approach in microbiology education at school as well as in pre-service teacher education and in in-service teacher professional development courses at our university. Finally, our paper provides worksheets for all the experiments. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe laboratory techniques. For more information, read the laboratory safety section of the ASM Curriculum Recommendations: Introductory Course in Microbiology and the Guidelines for Biosafety in Teaching Laboratories, available at www.asm.org. The Editors of JMBE recommend that adopters of the protocols included in this article follow a minimum of Biosafety Level 1 practices. If the soil plates described in the activity are opened, a minimum of Biosafety Level 2 is required.

  14. Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates.

    Science.gov (United States)

    Haakensen, M; Schubert, A; Ziola, B

    2009-03-15

    Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

  15. Enumerating actinomycetes in compost bioaerosols at source‚ÄĒUse of soil compost agar to address plate 'masking'

    Science.gov (United States)

    Taha, M. P. M.; Drew, G. H.; Tamer Vestlund, A.; Aldred, D.; Longhurst, P. J.; Pollard, S. J. T.

    Actinomycetes are the dominant bacteria isolated from bioaerosols sampled at composting facilities. Here, a novel method for the isolation of actinomycetes is reported, overcoming masking of conventional agar plates, as well as reducing analysis time and costs. Repeatable and reliable actinomycetes growth was best achieved using a soil compost media at an incubation temperature of 44 ¬įC and 7 days' incubation. The results are of particular value to waste management operators and their advisors undertaking regulatory risk assessments that support environmental approvals for compost facilities.

  16. A Direct Quantitative Agar-Plate Based Assay for Analysis of Pseudomonas protegens PF-5 Degradation of Polyurethane Films (Postprint)

    Science.gov (United States)

    2014-10-02

    was dissolved in methanol ; Irogran (1 g) was dissolved in 25 mL THF; and AS-P108 was prepared by adding 0.3 g of catalyst to 10 g of resin and then... Selected results are in Supple- mental Information. 3. Results 3.1. General growth characteristics of Pf-5 on M9/citrate agar plates Dilutions of P...minimal. An IR map with the color scale corresponding to the in- tensity of the 1735 cm1 carbonyl absorbance from the urethane and ester components is

  17. A screening method for ő≤-glucan hydrolase employing Trypan Blue-coupled ő≤-glucan agar plate and ő≤-glucan zymography.

    Science.gov (United States)

    Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick

    2012-06-01

    A new screening method for ő≤-(1,3-1,6) glucan hydrolase was developed using a pure ő≤-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a ő≤-glucan hydrolase on the Trypan Blue-coupled ő≤-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-ő≤-glucan zymography. The ő≤-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the ő≤-glucan hydrolase of Paenibacillus sp. was sequenced.

  18. Screening of tannin acyl hydrolase (E.C.3.1.1.20) producing tannery effluent fungal isolates using simple agar plate and SmF process.

    Science.gov (United States)

    Murugan, K; Saravanababu, S; Arunachalam, M

    2007-03-01

    Industrially important tannase producing fungi were isolated from tannery effluent using simple agar plate method. The isolates were screened by submerged fermentation using auto-controlled bioreactor. The colony diameter on the solid surface media shows high correlation with quantitative production of tannase. The isolate Aspergillus niger shows maximum production of both extracellular and intracellular enzyme.

  19. Multicentre validation of 4-well azole agar plates as a screening method for detection of clinically relevant azole-resistant Aspergillus fumigatus

    DEFF Research Database (Denmark)

    Arendrup, Maiken Cavling; Verweij, Paul E; Mouton, Johan W

    2017-01-01

    Objectives: Azole-resistant Aspergillus fumigatus is emerging worldwide. Reference susceptibility testing methods are technically demanding and no validated commercial susceptibility tests for moulds currently exist. In this multicentre study a 4-well azole-containing screening agar method...... following E.Def 9.3. In-house and commercial 4-well plates containing agars supplemented with 4‚ÄČmg/L itraconazole, 1‚ÄČmg/L voriconazole, 0.5‚ÄČmg/L posaconazole and no antifungal, respectively, were evaluated. Growth was scored (0-3) by two independent observers in three laboratories. Inter-plate, inter...... agreement (no growth versus growth) was excellent (median 95%-100%, range 87%-100%, overall). The overall sensitivity and specificity for the 4-well plate (no growth versus growth) was 99% (range 97%-100%) and 99% (95%-100%), respectively. The sensitivity for simulated WT/mutant specimens was 94% (range 83...

  20. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  1. Comparing Diagnostic Accuracy of Kato-Katz, Koga Agar Plate, Ether-Concentration, and FLOTAC for Schistosoma mansoni and Soil-Transmitted Helminths

    Science.gov (United States)

    Glinz, Dominik; Silu√©, Kigbafori D.; Knopp, Stefanie; Lohourignon, Laurent K.; Yao, Kouassi P.; Steinmann, Peter; Rinaldi, Laura; Cringoli, Giuseppe; N'Goran, Eli√©zer K.; Utzinger, J√ľrg

    2010-01-01

    Background Infections with schistosomes and soil-transmitted helminths exert a considerable yet underappreciated economic and public health burden on afflicted populations. Accurate diagnosis is crucial for patient management, drug efficacy evaluations, and monitoring of large-scale community-based control programs. Methods/Principal Findings The diagnostic accuracy of four copromicroscopic techniques (i.e., Kato-Katz, Koga agar plate, ether-concentration, and FLOTAC) for the detection of Schistosoma mansoni and soil-transmitted helminth eggs was compared using stool samples from 112 school children in C√īte d'Ivoire. Combined results of all four methods served as a diagnostic ‚Äėgold‚Äô standard and revealed prevalences of S. mansoni, hookworm, Trichuris trichiura, Strongyloides stercoralis and Ascaris lumbricoides of 83.0%, 55.4%, 40.2%, 33.9% and 28.6%, respectively. A single FLOTAC from stool samples preserved in sodium acetate-acetic acid-formalin for 30 or 83 days showed a higher sensitivity for S. mansoni diagnosis (91.4%) than the ether-concentration method on stool samples preserved for 40 days (85.0%) or triplicate Kato-Katz using fresh stool samples (77.4%). Moreover, a single FLOTAC detected hookworm, A. lumbricoides and T. trichiura infections with a higher sensitivity than any of the other methods used, but resulted in lower egg counts. The Koga agar plate method was the most accurate diagnostic assay for S. stercoralis. Conclusion/Significance We have shown that the FLOTAC method holds promise for the diagnosis of S. mansoni. Moreover, our study confirms that FLOTAC is a sensitive technique for detection of common soil-transmitted helminths. For the diagnosis of S. stercoralis, the Koga agar plate method remains the method of choice. PMID:20651931

  2. A combined disc method with resazurin agar plate assay for early phenotypic screening of KPC, MBL and OXA-48 carbapenemases among Enterobacteriaceae.

    Science.gov (United States)

    Teethaisong, Y; Eumkeb, G; Nakouti, I; Evans, K; Hobbs, G

    2016-08-01

    To validate a combined disc method along with resazurin chromogenic agar for early screening and differentiation of Klebsiella pneumoniae carbapenemase, metallo-ő≤-lactamase and OXA-48 carbapenemase-producing Enterobacteriaceae. The combined disc test comprising of meropenem alone and with EDTA, phenylboronic acid or both EDTA and phenylboronic acid, and temocillin alone were evaluated with the resazurin chromogenic agar plate assay against a total of 86 molecularly confirmed Enterobacteriaceae clinical isolates (11 metallo-ő≤-lactamases, eight Kl.¬†pneumoniae carbapenemases, 11 OXA-48, 32 AmpC and 15 extended-spectrum-ő≤-lactamase producers and nine co-producers of extended-spectrum-ő≤-lactamase and AmpC). The inhibition zone diameters were measured and interpreted at 7¬†h for the presence of carbapenemase. All carbapenemase producers were phenotypically distinguished by this assay with 100% sensitivity and specificity. This early phenotypic method is very simple, inexpensive, and reliable in the detection and differentiation of carbapenemase-producing Enterobacteriaceae. It could be exploited in any microbiological laboratory for diagnosis of these recalcitrant bacteria. This assay poses excellent performance in discrimination of Kl.¬†pneumoniae carbapenemase, metallo-ő≤-lactamase and OXA-48 carbapenemases within 7¬†h, which is much faster than conventional disc diffusion methods. The rapid detection could help clinicians screen patients, control infection and provide epidemiological surveillance. ¬© 2016 The Society for Applied Microbiology.

  3. Identification of Brucella by MALDI-TOF mass spectrometry. Fast and reliable identification from agar plates and blood cultures.

    Directory of Open Access Journals (Sweden)

    Laura Ferreira

    Full Text Available BACKGROUND: MALDI-TOF mass spectrometry (MS is a reliable method for bacteria identification. Some databases used for this purpose lack reference profiles for Brucella species, which is still an important pathogen in wide areas around the world. We report the creation of profiles for MALDI-TOF Biotyper 2.0 database (Bruker Daltonics, Germany and their usefulness for identifying brucellae from culture plates and blood cultures. METHODOLOGY/PRINCIPAL FINDINGS: We created MALDI Biotyper 2.0 profiles for type strains belonging to B. melitensis biotypes 1, 2 and 3; B. abortus biotypes 1, 2, 5 and 9; B. suis, B. canis, B ceti and B. pinnipedialis. Then, 131 clinical isolates grown on plate cultures were used in triplicate to check identification. Identification at genus level was always correct, although in most cases the three replicates reported different identification at species level. Simulated blood cultures were performed with type strains belonging to the main human pathogenic species (B. melitensis, B. abortus, B. suis and B. canis, and studied by MALDI-TOF MS in triplicate. Identification at genus level was always correct. CONCLUSIONS/SIGNIFICANCE: MALDI-TOF MS is reliable for Brucella identification to the genus level from culture plates and directly from blood culture bottles.

  4. Scale-up and large-scale production of Tetraselmis sp. CTP4 (Chlorophyta) for CO2 mitigation: from an agar plate to 100-m3 industrial photobioreactors.

    Science.gov (United States)

    Pereira, Hugo; P√°ramo, Jaime; Silva, Joana; Marques, Ana; Barros, Ana; Maur√≠cio, Dinis; Santos, Tam√°ra; Schulze, Peter; Barros, Ra√ļl; Gouveia, Lu√≠sa; Barreira, Lu√≠sa; Varela, Jo√£o

    2018-03-23

    Industrial production of novel microalgal isolates is key to improving the current portfolio of available strains that are able to grow in large-scale production systems for different biotechnological applications, including carbon mitigation. In this context, Tetraselmis sp. CTP4 was successfully scaled up from an agar plate to 35- and 100-m 3 industrial scale tubular photobioreactors (PBR). Growth was performed semi-continuously for 60 days in the autumn-winter season (17 th October - 14 th December). Optimisation of tubular PBR operations showed that improved productivities were obtained at a culture velocity of 0.65-1.35‚ÄČm‚ÄČs -1 and a pH set-point for CO 2 injection of 8.0. Highest volumetric (0.08‚ÄȬĪ‚ÄČ0.01‚ÄČg‚ÄČL -1 d -1 ) and areal (20.3‚ÄȬĪ‚ÄČ3.2‚ÄČg‚ÄČm -2 d -1 ) biomass productivities were attained in the 100-m 3 PBR compared to those of the 35-m 3 PBR (0.05‚ÄȬĪ‚ÄČ0.02‚ÄČg‚ÄČL -1 d -1 and 13.5‚ÄȬĪ‚ÄČ4.3‚ÄČg‚ÄČm -2 d -1 , respectively). Lipid contents were similar in both PBRs (9-10% of ash free dry weight). CO 2 sequestration was followed in the 100-m 3 PBR, revealing a mean CO 2 mitigation efficiency of 65% and a biomass to carbon ratio of 1.80. Tetraselmis sp. CTP4 is thus a robust candidate for industrial-scale production with promising biomass productivities and photosynthetic efficiencies up to 3.5% of total solar irradiance.

  5. Cultivation characteristics and gene expression profiles of Aspergillus oryzae by membrane-surface liquid culture, shaking-flask culture, and agar-plate culture.

    Science.gov (United States)

    Imanaka, Hiroyuki; Tanaka, Soukichi; Feng, Bin; Imamura, Koreyoshi; Nakanishi, Kazuhiro

    2010-03-01

    We cultivated a filamentous fungus, Aspergillus oryzae IAM 2706 by three different cultivation methods, i.e., shaking-flask culture (SFC), agar-plate culture (APC), and membrane-surface liquid culture (MSLC), to elucidate the differences of its behaviors by different cultivation methods under the same media, by measuring the growth, secretion of proteases and alpha-amylase, secreted protein level, and gene transcriptional profile by the DNA microarray analysis. The protease activities detected by MSLC and APC were much higher than that by SFC, using both modified Czapek-Dox (mCD) and dextrin-peptone-yeast extract (DPY) media. The alpha-amylase activity was detected in MSLC and APC in a much larger extent than that in SFC when DPY medium was used. On the basis of SDS-PAGE analyses and N-terminal amino acid sequences, 6 proteins were identified in the supernatants of the culture broths using DPY medium, among which oryzin (alkaline protease) and alpha-amylase were detected at a much higher extent for APC and MSLC than those for SFC while only oryzin was detected in mCD medium, in accordance with the activity measurements. A microarray analysis for the fungi cultivated by SFC, APC, and MSLC using mCD medium was carried out to elucidate the differences in the gene transcriptional profile by the cultivation methods. The gene transcriptional profile obtained for the MSLC sample showed a similar tendency to the APC sample while it was quite different from that for the SFC sample. Most of the genes specifically transcribed in the MSLC sample versus those in the SFC sample with a 10-fold up-regulation or higher were unknown or predicted proteins. However, transcription of oryzin gene was only slightly up-regulated in the MSLC sample and that of alpha-amylase gene, slightly down-regulated. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  6. Comparing the mannitol-egg yolk-polymyxin agar plating method with the three-tube most-probable-number method for enumeration of Bacillus cereus spores in raw and high-temperature, short-time pasteurized milk.

    Science.gov (United States)

    Harper, Nigel M; Getty, Kelly J K; Schmidt, Karen A; Nutsch, Abbey L; Linton, Richard H

    2011-03-01

    The U.S. Food and Drug Administration's Bacteriological Analytical Manual recommends two enumeration methods for Bacillus cereus: (i) standard plate count method with mannitol-egg yolk-polymyxin (MYP) agar and (ii) a most-probable-number (MPN) method with tryptic soy broth (TSB) supplemented with 0.1% polymyxin sulfate. This study compared the effectiveness of MYP and MPN methods for detecting and enumerating B. cereus in raw and high-temperature, short-time pasteurized skim (0.5%), 2%, and whole (3.5%) bovine milk stored at 4¬įC for 96 h. Each milk sample was inoculated with B. cereus EZ-Spores and sampled at 0, 48, and 96 h after inoculation. There were no differences (P > 0.05) in B. cereus populations among sampling times for all milk types, so data were pooled to obtain overall mean values for each treatment. The overall B. cereus population mean of pooled sampling times for the MPN method (2.59 log CFU/ml) was greater (P milk samples ranged from 2.36 to 3.46 and 2.66 to 3.58 log CFU/ml for inoculated milk treatments for the MYP plate count and MPN methods, respectively, which is below the level necessary for toxin production. The MPN method recovered more B. cereus, which makes it useful for validation research. However, the MYP plate count method for enumeration of B. cereus also had advantages, including its ease of use and faster time to results (2 versus 5 days for MPN).

  7. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    H√łi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  8. Using selective chromogenic plates to optimize isolation of group B Streptococcus in pregnant women

    Directory of Open Access Journals (Sweden)

    Romano Mattei

    2014-03-01

    Full Text Available Group B Streptococcus (GBS remains the leading cause of severe bacterial infections (sepsis, meningitis, pneumonia in neonates. We compared the detection of GBS from recto-vaginal swabs on blood agar and two chromogenic media and evaluated their antibiotic susceptibility. A total of 1351 swabs were taken from pregnant women at 35-37 weeks of gestation. Following enrichment in Todd Hewitt broth + nalidixic acid and colistin, the samples were plated on Columbia CNA agar (CNA, chromID Strepto B agar (STRB and Granada Agar (GRAN, respectively. GBS were found in 22.4% of recto-vaginal swabs from pregnant women. Sensitivity, specificity, positive and negative predictive values of GBS detection were 88%, 88%, 81% and 96% for CNA, 99%, 97%, 90% and 99% for STRB and 94%, 99%, 98% e 99% for GRAN; Cohen’s k index concordances for CNA, STREB and GRAN were 0.68, 0.92 and 0.96, respectively. All isolates were susceptible to penicillin, whereas resistances of erythromycin and clindamycin were 40% and 42%, respectively. To conclude, selective broth enrichment combined with chromogenic plates is recommended for GBS screening in pregnant women.

  9. Neotectonic and seismicidad in the Granada basin

    International Nuclear Information System (INIS)

    Sanz de Galdeano, C.; Vidal, F.; Miguel, F. de

    1984-01-01

    The depression of Granada is one of the Betics interior basins whose formation begun during the Middle Miocene and reached its individualization from the Upper Miocene. The main fracture directions are: N10-30E, N120-150E, N70-100E, some of them show great vertical jumpings. This seismic area is the most active in the Cordilleras Beticas (frequently like seismic series) and some destructive earthquakes occurred in the past. The higher seismic activity is concentrated in most subsident sectors of the area: the Vega de Granada, the Padul-Valle de Lecrin and the ''corredor de las Alpujarras'' prolongation about Arenas del Rey. (author)

  10. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  11. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  12. ‚ÄúWindow Shopping, Granada, 1930s‚ÄĚ

    Directory of Open Access Journals (Sweden)

    Mae Claxton

    2010-02-01

    Full Text Available ‚ÄúWindow Shopping, Granada, 1930s,‚ÄĚ Photographs, p.¬†16, with the gracious permission of the Eudora Welty FoundationAn African American woman, dressed in her Saturday go-to-town-best, stands outside a store window, chin in hand, contemplating the contents in the window. The image is reflective and thoughtful. What is she thinking? And what lies beyond the frame of this photograph? In Mississippi in the 1930s, could she walk into this store, perhaps try on clothes or hats, and make a purchase? I...

  13. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  14. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth

  15. San Isidoro Schools in Padul, Granada, Spain

    Science.gov (United States)

    Lafuente-Bolívar, Francisco Javier; Santiago Zaragoza, Juan Manuel; Fernández-Adarve, Gabriel; María Cruz-Valdivieso, Ana

    2017-10-01

    The small and unique building of ‚ÄúLas Escuelas de San Isidoro‚ÄĚ, erected in Padul at the beginning of the 20th century, is a clear example of the new architectural type of the innovative educational model created in Granada by Father Manj√≥n. That model supposed a radical change for the methods of the Spanish teaching and it was the origin of the current educational system. Andr√©s Manj√≥n y Manj√≥n (1846-1923), priest, jurist and pedagogue, broke with traditional pedagogy and revolutionized the old-fashion model of education that was in vogue until that moment and universalized and socialized education. That pioneer model promoted an education based on aptitudes and faculties, using games and practice, addressed to all ages and social classes, in conjunction with nature. Outdoor education should be used wherever possible. In a historical context of profound social changes, this typology was the answer to the new educational needs using a ‚Äúspearing‚ÄĚ architectural language based on a constructive system that was both efficient and economic: Spanish Regionalism. It was a new style from the first third of the 20th century that recreated historical forms. It was far from the breakthrough modern movement that, at that time, it took place in central Europe. However, the model of the Manjonian School runs away from historicist models and remains in the simplicity of brick-faced walls or brick-wrapping walls and masonry drawers, with no more decorative concession that window lintels, jambs and sill jut out. The fa√ßades highlight made with simple semicircular arches and some glazed ceramics. Wooden rounded slabs supported on walls and simple wooden cover structures. The steel was barely used in metal structural slabs and brick, and even less on the roof. Architects like Francisco Jim√©nez Ar√©valo, Juan Montserrat Pons or Fernando Wilhelmi Manzano will be the architects of this type of architecture that has as a mark of identity the massive use of brick in load

  16. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  17. Experimental light scattering by small particles in Amsterdam and Granada

    Directory of Open Access Journals (Sweden)

    Volten H.

    2010-06-01

    Full Text Available We report on two light scattering instruments located in Amsterdam and Granada, respectively. These instruments enable measuring scattering matrices as functions of the scattering angle of collections of randomly orieneted irregular particles. In the past decades, the experimental setup located in Amsterdam, The Netherlands, has produced a significant amount of experimental data. Unfortunately, this setup was officially closed a couple of years ago. We also present a modernized descendant of the Dutch experimental setup recently constructed at the Instituto de Astrofísica de Andalucía (IAA in Granada, Spain. We give a brief description of the instruments, and present some representative results.

  18. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  19. Preferencias, conflictos y usos territoriales en la ciudad de Granada

    Directory of Open Access Journals (Sweden)

    Fernando Fern√°ndez

    2000-01-01

    Full Text Available Este art√≠culo se enmarca dentro de una investigaci√≥n m√°s amplia, referida a la ciudad de Granada y a su entorno metropolitano, sin embargo, y enumera aqu√≠ los principales problemas e inconvenientes urbanos de hoy d√≠a, muy especialmente para el caso de Granada, en los aspectos de inconvenientes, satisfacciones residenciales, inseguridad ciudadana, zonas preferidas y repulsivas, espacios peligrosos, y un largo etc√©tera que nos ayude a comprender el espacio de la ciudad. La metodolog√≠a utilizada ha sido la entrevista realizada a 1.938 personas de la ciudad que residen en Granada (todos ellos mayores de 18 a√Īos, que es una herramienta muy apta para diagnosticar el espacio urbano. La conclusi√≥n principal es que las preferencias (personales, vivenciales y subjetivas de los ciudadanos de la ciudad de Granada se ajustan a lo evidenciado en los estudios similares existentes en las ciudades espa√Īolas, aunque la ciudad tiene un alto grado de confortabilidad.

  20. Anuario 2008: Biblioteca de la Universidad de Granada

    OpenAIRE

    Universidad de Granada. Biblioteca

    2009-01-01

    La Biblioteca Universitaria de Granada (BUG) presenta, el anuario correspondiente a 2008, donde se expone la actividad desarrollada en sus 21 puntos de servicio, repartidos en las diferentes Escuelas y Facultades de la Universidad. En el 2008 observamos tendencias positivas en la mayor??a de los datos estad??sticos e indicadores, respecto a los procesos clave de la Biblioteca.

  1. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1őľg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  2. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micińá, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a ‚Äúgreen‚ÄĚ agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: ‚ÄĘ Rapid aggregation and sedimentation were observed in bare milled ZVI particles. ‚ÄĘ Agar agar improved the stability of milled ZVI particle suspensions. ‚ÄĘ Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. ‚ÄĘ Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  3. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micińá, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a ‚Äúgreen‚ÄĚ agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: ‚ÄĘ Rapid aggregation and sedimentation were observed in bare milled ZVI particles. ‚ÄĘ Agar agar improved the stability of milled ZVI particle suspensions. ‚ÄĘ Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. ‚ÄĘ Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  4. Menu Proposal to Use Powdered Agar

    OpenAIRE

    ŚúüŚĪč, „Ā≤„āćŚ≠ź; Ś∂čśĚĎ, ś°ÉŚ≠ź; ŚįŹśĚĺ, ś≤ôťúß

    2015-01-01

    The author was involved in the development of the menu items that might be sold at ‚ÄúTaisho Village‚ÄĚ, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  5. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  6. Direct identification and recognition of yeast species from clinical material by using albicans ID and CHROMagar Candida plates.

    OpenAIRE

    Baumgartner, C; Freydiere, A M; Gille, Y

    1996-01-01

    Two chromogenic media, Albicans ID and CHROMagar Candida agar plates, were compared with a reference medium, Sabouraud-chloramphenicol agar, and standard methods for the identification of yeast species. This study involved 951 clinical specimens. The detection rates for the two chromogenic media for polymicrobial specimens were 20% higher than that for the Sabouraud-chloramphenicol agar plates. The rates of identification of Candida albicans for Albicans ID and CHROMagar Candida agar plates w...

  7. Seasonal variability in 7Be depositional fluxes at Granada, Spain

    International Nuclear Information System (INIS)

    Gonzalez-Gomez, C.; Azahra, M.; Lopez-Penalver, J.J.; Camacho-Garcia, A.; Bardouni, T.El.; Boukhal, H.

    2006-01-01

    Measurement of 7 Be depositional fluxes at Granada, Spain (37 o 10'50''N-3 o 35'44''W, altitude 670 m) in the period 1995 through 1998 indicates substantial variations between the four seasons and also between corresponding seasons in different years, ranging from 23.6 to 242 Bq m -2 per season. A strongly positive correlation with precipitation is shown, which explains about 70% of the variations in the 7 Be depositional fluxes over the 16 seasons studied. The depositional 7 Be flux is on the average highest in the fall and lowest in the summer. The study shows that precipitation primarily controls the 7 Be depositional flux and plays a dominant role in the removal of 7 Be from the troposphere. The average annual 7 Be depositional flux at Granada amounts to 469+145 Bq m -2

  8. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  9. Phytotoponymy and Synphytotoponymy in Western Granada Province (Andalusia, Spain

    Directory of Open Access Journals (Sweden)

    Benítez Cruz, Guillermo

    2009-12-01

    Full Text Available Within the framework of a research project on the ethnobotany of the western section of the province of Granada, in southern Spain, a detailed study was made of place names derived from names related to plants (phytotoponyms and synphytotoponyms. The information ‚ÄĒgathered from the Territorial Land Registry of Granada, the Regional Government of Andalusia and field work‚ÄĒ has been included in a database written with the Microsoft Excel program. References to a total of 98 plant species were found in as many as 593 place names of the area. The authors comment on the environmental, paleophytogeographic and ethnobotanical significance of the species represented in the place names.

    En el marco de la investigaci√≥n etnobot√°nica desarrollada en el poniente granadino, se ha realizado un estudio sobre la toponimia de la comarca con atenci√≥n a los apelativos de origen vegetal (fitotop√≥nimos y sinfitotop√≥nimos. La informaci√≥n ‚ÄĒobtenida de la Gerencia Territorial del Catastro de Granada, de la Junta de Andaluc√≠a y de nuestro trabajo de campo‚ÄĒ se ha incluido en una base de datos con el programa Microsoft Excell¬ģ. Un total de 98 especies vegetales se encuentran representadas en la toponimia local, dando nombre a 593 lugares del territorio. Se aportan comentarios sobre el significado ecol√≥gico, paleofitogeogr√°fico y etnobot√°nico de las especies reflejadas en la toponimia.

  10. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  11. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  12. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants őĒH d egree, őĒS d egree and őĒG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  13. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Pe√Īalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  15. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  16. 77 FR 60981 - TGP Granada, LLC and Roosevelt Wind Ranch, LLC v. Public Service Company of New Mexico, Tortoise...

    Science.gov (United States)

    2012-10-05

    ...; EL12-43-000, EL12-43-001 TGP Granada, LLC and Roosevelt Wind Ranch, LLC v. Public Service Company of New Mexico, Tortoise Capital Resources Corp.; TGP Granada, LLC and Roosevelt Wind Ranch, LLC; Notice... over capacity on the Eastern Interconnection Project. \\1\\ TGP Granada, LLC v. Pub. Serv. Co. of New...

  17. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  18. Monopolios, aranceles y contrabando en Nueva Granada, 1821-1830

    Directory of Open Access Journals (Sweden)

    Muriel Laurent

    2011-06-01

    Full Text Available Este artículo estudia el contrabando en Nueva Granada durante la primera década postindependentista. En un contexto en el que la reglamentación aduanera y comercial continuaba siendo proteccionista y fiscalista, a pesar de la pertinencia cada vez más aceptada de los argumentos a favor del libre cambio, se examina el comportamiento del comercio ilícito. El objetivo consiste en determinar cuál fue la relación entre esta reglamentación y el contrabando y en evaluar si la tendencia que considera que a mayor prohibición o mayor gravamen mayor contrabando se verifica en Nueva Granada entre 1821 y 1830; asimismo, en caso de verificarse, establecer si el contrabando recayó más en los productos prohibidos o en los más gravados.This article studies contraband in New Granada during the first decade after Independence. Given that the regulation of customs and trade remained protectionist and fiscally oriented, despite the growing acceptance of arguments in favor of free trade, it examines what happened to this illicit trade. The article tries to determine the relationship between these regulations and contraband. It also evaluates whether the frequently-held assumption that increasing prohibition or taxes on trade leads to a rise in contraband holds true for Colombia. If it does hold true, the article also attempts to establish whether or not there was greater contraband in prohibited or highly-taxes products.

  19. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  20. Don Alonso de Granada Venegas Rengifo, cuarto se√Īor de la casa de Granada (1540-1611)

    OpenAIRE

    García Luján, José Antonio

    2014-01-01

    Limitada es la información que poseíamos hasta ahora sobre este conspicuo personaje. Sin embargo, un conjunto documental, disperso en varios archivos, ha posibilitado la realización de este artículo en el que se traza la biografía, hasta donde los documentos permiten, del que fuera titular de los mayorazgos y Casa de Granada desde 1565 hasta su fallecimiento en 1611. Sin duda, es su intervención en la rebelión morisca lo más conocido, que ahora se completa, al tiempo que se perfil...

  1. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37¬įC. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  2. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Y√ľcesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  3. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  4. Secado por atomización de zumo de granada

    OpenAIRE

    Miravet Valero, Gracia María

    2009-01-01

    Se sabe que el granado era cultivado en tiempos muy remotos porque se han encontrado indicios del consumo de esta fruta en tumbas egipcias de 2.500 a√Īos antes de la era cristiana. Se cree que los cartagineses introdujeron el granado en la regi√≥n mediterr√°nea a ra√≠z de las guerras P√ļnicas, de ah√≠ su nombre ‚ÄúPunica granatum‚ÄĚ. La granada es una fruta arbustiva oriunda de los pa√≠ses del este de Europa (Costa D√°lmata y Grecia) y Oriente (Palestina, Ir√°n, Afganist√°n, Paquist√°n). Espa√Īa es uno de lo...

  5. Sports injuries and illnesses during the Granada Winter Universiade 2015

    Science.gov (United States)

    Gallo-Vallejo, Miguel √Āngel; de la Cruz-M√°rquez, Juan Carlos; de la Cruz-Campos, Adri√°n; de la Cruz-Campos, Juan Carlos; Pesta√Īa-Melero, Francisco Luis; Carmona-Ruiz, Gin√©s; Gallo-Gal√°n, Luz Mar√≠a

    2016-01-01

    Objective To analyse the incidence of diseases and injuries suffered by athletes participating in the 27th Winter Sports Universiade held in Granada, Spain. Methods The daily occurrence of injuries and diseases was registered at the point of first aid (Borreguiles, 2665 metres above sea level (masl)) and in the clinic of Pradollano (2017 masl), both in Sierra Nevada, as well as in medical services provided by the organising committee of Granada 2015 Universiade and located in sport pavilions in which indoor competitions are held. Results A total of 1109 athletes (650 men, 58.61%; 459 women, 41.39%). Nine diseases and 68 injuries were recorded. In total, the rate of injury was 6.13% (7.07% for men and 4.79% for women). The percentage of injury was highest in alpine skiing (10.34%) followed by freestyle skiing (8.62%). In relation to the time of exposure, freestyle skiing showed the shortest time of exposure (0.31‚ÄČhours) before suffering an injury. Short track speed skating showed the longest exposure (9.80‚ÄČhours), before suffering an injury. The most common anatomical areas of injury were the head, shoulder and knee (13.23%). Only nine diseases were suffered (four women and five men) of which six were infections, one was a friction burn, one was a lipothymy and one a cluster headache due to height. Conclusion In general, 6.13% of the athletes sustained at least one injury and 0.81% a disease, which is a much lower percentage than that recorded in similar events. The incidence of injuries and diseases varied among sport specialities. PMID:28879023

  6. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  7. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  8. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  9. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  10. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a an√°lise da preval√™ncia de Listeria sp. em lingui√ßas resfriadas e a compara√ß√£o dos meios seletivos utilizados no plaqueamento do m√©todo ISO 11290-1 (√Āgar PALCAM e √Āgar Oxford, e √°gares cromog√™nicos (√Āgares Listeria Cromog√™nico CM 1080 (OCLA e CM 1084 (ISO. A frequ√™ncia de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam √† L. monocytogenes. A efic√°cia dos quatro √°gares para o isolamento de L. monocytogenes demonstrou-se satisfat√≥ria. Apesar de haver algumas diferen√ßas nas composi√ß√Ķes dos meios cromog√™nicos analisados, estas n√£o pareceram influenciar nas concord√Ęncias entre os resultados expressos. Contudo, o √°gar PALCAM mostrou-se mais eficaz na supress√£o de outros micro-organismos, aumentando, assim, a possibilidade de detec√ß√£o de esp√©cies de Listeria presentes em n√ļmero reduzido. Atrav√©s deste trabalho sugere-se a utiliza√ß√£o do √°gar PALCAM associado a um meio cromog√™nico para aumentar a chance de isolamento de cepas at

  11. La pintura mural en la Granada del XVIII.

    Directory of Open Access Journals (Sweden)

    Ana María Gómez Román

    2016-01-01

    Full Text Available El camino hacia la revalorizaci√≥n de la pintura mural a lo largo del siglo XVIII en la ciudad de Granada arranca con la figura del arzobispo Mart√≠n de Ascargorta (1693-1719. El gusto impuesto por este prelado supuso un cambio durante la primera mitad de este siglo en el desarrollo de los programas decorativos bajo las directrices de Acisclo Antonio Palomino y Jos√© Risue√Īo que tendr√≠a su prolongaci√≥n con la actividad de pintores como Mart√≠n de Pineda, Jos√© Hidalgo, Diego S√°nchez Saravia o Tom√°s Ferrer. Este gusto por la pintura mural culminar√≠a a finales de la centuria con el ciclo de las haza√Īas del Quijote del Palacio del Cuzco en V√≠znar, relacionado tambi√©n con otro arzobispo, Juan Manuel Moscoso (1789-1811 y realizado por Nicol√°s Mart√≠n Tenllado, Jos√© de Medina y Antonio Jim√©nez.

  12. Solid industrial wastes and their management in Asegra (Granada, Spain)

    International Nuclear Information System (INIS)

    Casares, M.L.; Ulierte, N.; Mataran, A.; Ramos, A.; Zamorano, M.

    2005-01-01

    ASEGRA is an industrial area in Granada (Spain) with important waste management problems. In order to properly manage and control waste production in industry, one must know the quantity, type, and composition of industrial wastes, as well as the management practices of the companies involved. In our study, questionnaires were used to collect data regarding methods of waste management used in 170 of the 230 businesses in the area of study. The majority of these companies in ASEGRA are small or medium-size, and belong to the service sector, transport, and distribution. This was naturally a conditioning factor in both the type and management of the wastes generated. It was observed that paper and cardboard, plastic, wood, and metals were the most common types of waste, mainly generated from packaging (49% of the total volume), as well as material used in containers and for wrapping products. Serious problems were observed in the management of these wastes. In most cases they were disposed of by dumping, and very rarely did businesses resort to reuse, recycling or valorization. Smaller companies encountered greater difficulties when it came to effective waste management. The most frequent solution for the disposal of wastes in the area was dumping

  13. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordo√Īez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  14. Radiological quality in drinking water from Granada city; Calidad radiologica del agua potable de la ciudad de Granada

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Penalver, J. J.; Gonzalez Gomez, C.; Ferro Garcia, M. A.; Prados Joya, G.

    2007-07-01

    The purpose of this study is to present data on gross alpha and beta activities in the drinking water from Granada city, during six years, 2000 to 2005. The samples were measured using a gas-flow proportional counter Bert hold LB 770-2/5. The results show that the gross alpha and gross beta cavity is lower than the maximum contaminant level based on the World Health Organisation, who which indicates 0.1 Bq.1-1 and 1.0 Bq.l''-1 as maximum contaminant level of gross alpha and gross beta radioactivity in potable water, respectively. Concentration ranging from 4.1.10''-3 to 3.9.10''2 Bq.l''-1 and from 4.9.10''-3 to 5.6.10''-2 Bq.l''-1 were observed from the gross alpha and beta activities, respectively. An average annual effective dose equivalent of 2.909 {mu}Sv-yr''-1 was obtained together with a range of 0.186 to 0.326 {mu}Sv.mo''-1. (Author) 10 refs.

  15. 77 FR 14514 - TGP Granada, LLC v. Public Service Company of New Mexico; Tortoise Capital Resources Corp...

    Science.gov (United States)

    2012-03-12

    ...] TGP Granada, LLC v. Public Service Company of New Mexico; Tortoise Capital Resources Corp.: Notice of...), and 385.212 (2012), TGP Granada, LLC (Complainant) filed (1) a formal complaint against the Public... waives sections 22.2 and 23.2 of the PNM tariff, to allow TGP to change the POR without losing its...

  16. Un paso decisivo en el conocimiento de la Granada romana (Municipium Florentinum Iliberritanum

    Directory of Open Access Journals (Sweden)

    Sotomayor, Manuel

    2004-12-01

    Full Text Available The finding of a large series of Roman architectural elements utilized more than once in the walls and foundations of a house in the Albaicín (Granada, together with the recovery of some ancient maps which had been lost, allow us now to confirm fully the authenticity of the remains of the forum of Roman Granada discovered in 1754, and to recognize precisely the spot where it was situated.El hallazgo de una amplia serie de elementos arquitectónicos romanos reutilizados en los muros y cimientos de una casa del Albaicín, juntamente con la recuperación de unos planos antiguos que se habían perdido, nos permiten ahora confirmar plenamente la autenticidad de los restos del foro de la Granada romana, descubiertos en 1754, y conocer con certeza el lugar donde estuvo situado.

  17. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008‚Äďwinter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between¬†...

  18. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  19. Moriscos expulsados de Granada y ‚Äúavecindados‚ÄĚ en Toledo

    Directory of Open Access Journals (Sweden)

    Rodríguez de Gracia, Hilario

    2013-06-01

    Full Text Available The expulsion and resettlement in Castile of thousands of Moriscos from Granada began in November 1570. The first expedition, consisting of 624 people, arrived in Toledo at the end of that month, and all of those from the age of ten were handed over to local citizens to work for them as a way to prevent destitution. The main objective of this part of the article is to analyze the number of each expedition, its origins, the hardships people endured on the journey and their final destination. Studying their work preferences and their location in the parish districts of Toledo is the main point dealt with in the second part of this article. Conclusions are drawn from the powers of attorney made by notary public Blas Hurtado in 1587. In them appear more than four hundred men with their names, occupations and residence. The information allows us to know what their preferred activities were and where within the city they established their residence.La expulsi√≥n y reparto por Castilla de miles de moriscos granadinos comenz√≥ en noviembre de 1570. La primera expedici√≥n, constituida por 624 personas, lleg√≥ a Toledo a finales de dicho mes, siendo entregadas, a partir de los diez a√Īos de edad, a ciudadanos para que trabajasen con ellos como una forma de impedir su desamparo. El objetivo principal de esta parte del art√≠culo consiste en analizar el n√ļmero de cada partida, su procedencia, las penalidades que soportaron en el trayecto y su destino final. El estudio de sus preferencias laborales y su ubicaci√≥n en las colaciones parroquiales toledanas es el aspecto principal que trata la otra parte de este trabajo. Para obtener conclusiones se utilizan unos poderes realizados por el escribano p√ļblico Blas Hurtado en 1587. All√≠ aparecen identificados m√°s de cuatrocientos hombres con sus nombres, apellidos, profesi√≥n y residencia. La informaci√≥n posibilita conocer cu√°les eran sus actividades preferentes y en qu√© partes del plano ciudadano

  20. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  1. Social Justice Practices on Gender, Race, and Environment within a School in Granada

    Science.gov (United States)

    Soza Vergara, Ximena; Hartlep, Nicholas Daniel

    2015-01-01

    In this article we discuss the experience of the Institute Ilíberis, a public high school in a small town in Granada, Spain, that has been engaged in innovative ways of teaching. Located in Atarfe, one of the few rural Spanish municipalities with expanding, rather than shrinking demographics, in the last 2 decades the Institute Ilíberis has…

  2. Arquitectura del Paisaje: gu??a Did??ctica (ETSA-Universidad de Granada)

    OpenAIRE

    Cabrera-Manzano, David

    2013-01-01

    Esta Gu??a contiene informaci??n sobre contenidos, objetivos, actividades, metodolog??a, criterios de evaluaci??n y otros asuntos de inter??s para los alumnos de Arquitectura, que cursan la asignatura optativa ARQUITECTURA DEL PAISAJE del Grado de Arquitectura en la Escuela T??cnica Superior de Arquitectura (ETSA) de la Universidad de Granada.

  3. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat ‚Äď obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep ‚Äď up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  4. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  5. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H.¬†musciformis (and K.¬†alvarezii) indicated őļ-carrageenan, C.¬†crenulata hydrocolloids were mainly őĻ-carrageenan, and the H.¬†dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36¬†¬įC for the őļ-carrageenan hydrocolloid samples...... comparable with őļ-carrageenan from K.¬†alvarezii, whereas the H.¬†dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21‚Äď26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  6. Cold plate

    Energy Technology Data Exchange (ETDEWEB)

    Marroquin, Christopher M.; O' Connell, Kevin M.; Schultz, Mark D.; Tian, Shurong

    2018-02-13

    A cold plate, an electronic assembly including a cold plate, and a method for forming a cold plate are provided. The cold plate includes an interface plate and an opposing plate that form a plenum. The cold plate includes a plurality of active areas arranged for alignment over respective heat generating portions of an electronic assembly, and non-active areas between the active areas. A cooling fluid flows through the plenum. The plenum, at the non-active areas, has a reduced width and/or reduced height relative to the plenum at the active areas. The reduced width and/or height of the plenum, and exterior dimensions of cold plate, at the non-active areas allow the non-active areas to flex to accommodate surface variations of the electronics assembly. The reduced width and/or height non-active areas can be specifically shaped to fit between physical features of the electronics assembly.

  7. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  8. Plating laboratory

    International Nuclear Information System (INIS)

    Seamster, A.G.; Weitkamp, W.G.

    1984-01-01

    The lead plating of the prototype resonator has been conducted entirely in the plating laboratory at SUNY Stony Brook. Because of the considerable cost and inconvenience in transporting personnel and materials to and from Stony Brook, it is clearly impractical to plate all the resonators there. Furthermore, the high-beta resonator cannot be accommodated at Stony Brook without modifying the set up there. Consequently the authors are constructing a plating lab in-house

  9. Identification of non-streptococcal organisms from human dental plaque grown on the Streptococcus-selective medium mitis-salivarius agar.

    Science.gov (United States)

    Kim, Yeon-Hee; Lee, Si Young

    2015-02-01

    Mitis-salivarius (MS) agar has been used widely in microbial epidemiological studies because oral viridans streptococci can be selectively grown on this medium. Even though the previous findings reported the limited selecting power of MS agar for streptococcus strains, the identities of non-streptococcal strains from human oral samples which can grow on this medium are not clear yet. In this study, we identified non-streptococcal organisms grown on MS agar plates by polymerase chain reaction (PCR) amplification and sequencing of the 16S ribosomal RNA (rRNA) gene. Eighty bacterial colonies on MS plates were isolated from plaque samples, and bacterial identification was achieved with the rapid ID 32 Strep system and mini API reader. The bacterial colonies identified as non-streptococci by the API system were selected for further identification. The 16S rRNA gene was amplified by PCR and verified using DNA sequencing analysis for identification. Sequences were compared with those of reference organisms in the genome database of the National Center for Biotechnology Information using the Basic Local Alignment Search Tool (BLAST). Among the 11 isolated non-streptococcal strains on MS plates, 3 strains were identified as Actinomyces naeslundii, 7 strains were identified as Actinomyces oris and 1 strain were identified as Actinomyces sp. using Blastn. In this study, we showed that some oral Actinomyces species can grow on Streptococcus-selective MS agar plates. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  12. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  13. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  14. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  15. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  16. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  17. Effects of immersion disinfection of agar-alginate combined impressions on the surface properties of stone casts.

    Science.gov (United States)

    Iwasaki, Yukiko; Hiraguchi, Hisako; Iwasaki, Eriko; Yoneyama, Takayuki

    2016-01-01

    This study investigated the effects of disinfection of agar-alginate combined impressions on the surface properties of the resulting stone casts. Two brands of cartridge-form agar impression material and one alginate impression material were used. Agar-alginate combined impressions of smooth glass plates were prepared. The impressions were immersed in 0.55% ortho-phthalaldehyde solution or 0.5% sodium hypochlorite solution for 1, 3, 5 and 10 min. A stone cast made with an impression that had not been immersed was prepared as a control. The surface roughness (Ra) of the stone casts was measured, and the cast surfaces were observed by SEM. Immersion of agar-alginate combined impressions in 0.5% sodium hypochlorite solution for up to 10 min had no serious adverse effects on the surface properties of the stone casts. In contrast, even 1 min of immersion in 0.55% ortho-phthalaldehyde solution caused deterioration of the cast surface properties.

  18. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  19. Isolation of nontuberculous mycobacteria from soil using Middlebrook 7H10 agar with increased malachite green concentration.

    Science.gov (United States)

    Hu, Yuli; Yu, Xinglong; Zhao, Dun; Li, Runcheng; Liu, Yang; Ge, Meng; Hu, Huican

    2017-12-01

    Environmental exposure is considered to be responsible for nontuberculous mycobacterial infections in humans. To facilitate the isolation of mycobacteria from soil, Middlebrook 7H10 agar was optimized as an enhanced selective medium by increasing the concentration of malachite green. A series of modified Middlebrook 7H10 agar media with malachite green concentrations ranging from 2.5 to 2500 mg/L was evaluated using 20 soil samples decontaminated with 3% sodium dodecyl sulfate plus 2% NaOH for 30 min. Among these modified Middlebrook 7H10 media, the medium with malachite green at a concentration of 250 mg/L, i.e., at the same concentration as in Löwenstein-Jensen medium, was the most effective in terms of the number of plates with mycobacterial growth. This medium was further evaluated with 116 soil samples. The results showed that 87.1% (101/116) of the samples produced mycobacterial growth, and 15 samples (12.9%) produced no mycobacterial growth. Of the plates inoculated with the soil samples, each in duplicate, 5.2% (12/232) showed late contamination. In total, 19 mycobacterial species were isolated, including seven (36.8%) rapidly growing mycobacteria and 12 (63.2%) slowly growing mycobacteria. Our results demonstrate that the modified Middlebrook 7H10 agar with 250 mg/L malachite green is useful for the primary isolation of nontuberculous mycobacteria from soil.

  20. Possible cases of tuberculosis and brucellosis in Argaric villages in Galera (Granada

    Directory of Open Access Journals (Sweden)

    √Āngel Rubio

    2017-07-01

    Full Text Available One of the main characteristics of Bronze Age Argaric populations of Granada is an agricultural and livestock economy in which animals were present within the settlements. Such presence is a factor in the increase of the risk of contagious diseases. In this study we present some cases that could be linked to animal-transmitted infectious diseases due that have been documented at the sites of Castellón Alto and Fuente Amarga, both located in Galera (province of Granada. At these sites four individuals have been identified with new bone formations in the thorax (scapulae and ribs that can indicate the presence of tuberculosis. At Fuente Amarga another individual presents a characteristic lesion in the vertebral column linked to brucellosis (vertebral epiphysitis. These features are not uncommon in populations that have close contact with animals.

  1. Impact of prescribed burning on soils in urban interface areas in Granada (south-eastern Spain

    Directory of Open Access Journals (Sweden)

    Sara Montoya S√°nchez-Camacho

    2014-03-01

    Full Text Available We report here on the effects of preventive burning on soils in peri-urban areas in Granada (Spain. The sampling area, located close to the Sacromonte Abbey on the outskirts of the city of Granada,used to be an agricultural plot devoted to olive trees and cereals but is now abandoned to scrub and the odd tree.The soils in question were entisols. Controlled burning was conductedfor six hours over an area of 13,300 m2and samples were taken at three different times: before burning, four days afterwards and a year afterwards. The parameters measured were: pH, organic matter, carbonates, soil moisture and nitrogen. The results reveal that whilst organic matter and nitrogen contents increased, pH, carbonates and soil moisture decreased after burning.

  2. Nondestructive evaluation of the preservation state of stone columns in the Hospital Real of Granada

    Science.gov (United States)

    Moreno de Jong van Coevorden, C.; Cobos Sánchez, C.; Rubio Bretones, A.; Fernández Pantoja, M.; García, Salvador G.; Gómez Martín, R.

    2012-12-01

    This paper describes the results of the employment of two nondestructive evaluation methods for the diagnostic of the preservation state of stone elements. The first method is based on ultrasonic (US) pulses while the second method uses short electromagnetic pulses. Specifically, these methods were applied to some columns, some of them previously restored. These columns are part of the architectonic heritage of the University of Granada, in particular they are located at the patio de la capilla del Hospital Real of Granada. The objective of this work was the application of systems based on US pulses (in transmission mode) and the ground-penetrating radar systems (electromagnetic tomography) in the diagnosis and detection of possible faults in the interior of columns.

  3. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37¬įC. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  4. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  5. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  6. La Virgen del Rosario del convento de Santa Cruz la Real en la Granada barroca (The Virgen del Rosario of Santa Cruz la Real convent in Granada baroque

    Directory of Open Access Journals (Sweden)

    Juan Jes√ļs L√≥pez-Guadalupe Mu√Īoz

    2016-01-01

    Full Text Available Resumen: A pesar de la escasez de fuentes documentales, se ensaya una reconstrucción de la historia devocional de la Virgen del Rosario de Granada que la convierte en un ejemplo eminente de la religiosidad popular barroca. En ella interaccionan los intereses pastorales de la orden dominica con la renovación de la imagen de la monarquía hispánica. En este proceso el auge de la devoción a la Virgen del Rosario la proyecta hasta el crucero de la iglesia y sirve de estímulo a la conclusión de las obras del templo.Abstract: Despite the scarcity of documentary sources, a reconstruction of the devotional history of the Virgen del Rosario of Granada make it an outstanding example of Baroque popular religiosity. In this case the pastoral interest of the Dominican order and the renovation of the image of the Spanish monarchy are related. In this process the growth of devotion to the Virgen del Rosario projected her to the transept of the Church and gives encouragement to the completion of its construction.

  7. Desenvolvimento floral e produ√ß√£o de pessegueiros 'granada' sob distintas condi√ß√Ķes clim√°ticas Floral development and yield of 'granada' peach tree under different weather conditions

    Directory of Open Access Journals (Sweden)

    Gilmar Ant√īnio Nava

    2011-06-01

    Full Text Available A cultivar de pessegueiro 'Granada' vem apresentando baixa frutifica√ß√£o e irregularidade de produ√ß√£o nas principais regi√Ķes produtoras de p√™ssego no Estado do Rio Grande do Sul. Este trabalho teve como objetivo comparar o desenvolvimento floral e a produ√ß√£o de pessegueiros 'Granada' em duas regi√Ķes com distintas condi√ß√Ķes clim√°ticas. Os pomares estudados, nas safras de 2004 e 2005, localizam-se nos munic√≠pios de Charqueadas e Cangu√ßu, nas regi√Ķes Depress√£o Central e Sul do RS, respectivamente. Conclui-se que o pessegueiro 'Granada' mostra-se muito inst√°vel em termos de produ√ß√£o. A baixa produ√ß√£o e a viabilidade do p√≥len, aliada ao atraso no desenvolvimento dos √≥vulos, influenciadas sobretudo pela ocorr√™ncia de altas temperaturas na pr√©-flora√ß√£o e flora√ß√£o, foram as principais causas do baixo desempenho reprodutivo e produtivo do pessegueiro 'Granada' em Charqueadas, em 2004, e em Cangu√ßu, em 2005.The peach cultivar Granada is showing low fruit set and irregularity of yield in major producing regions of peach fruit in Rio Grande do Sul State, Brazil. This work aimed to compare the floral development and yield of 'Granada' peach tree in two regions with different climatic conditions. The orchards studied, in 2004 and 2005, are located in Charqueadas, in the Central Depression, and Cangu√ßu, in the Southern State. The low yield and viability of pollen, associated to delay in the ovules development, mainly influenced by high temperatures during the pr√©-flowering and flowering, were the causes of low reproductive and productive performance of 'Granada' peach tree at Charqueadas in 2004 and at Cangu√ßu in 2005.

  8. Activity of two strobilurin fungicides against three species of decay fungi in agar plate tests

    Science.gov (United States)

    Juliet D. Tang; Tina Ciaramitaro; Maria Tomaso-Peterson; Susan V. Diehl

    2017-01-01

    The objective of this study was to examine the toxicity of strobilurin fungicides against wood decay fungi in order to assess their potential to act as a co-biocide for copper-based wood protection. Two strobilurin fungicides, Heritage (50% azoxystrobin active ingredient) and Insignia (20% pyraclostrobin active ingredients), and copper sulfate pentahydrate were tested...

  9. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  10. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  11. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  12. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  13. Growth of strontium oxalate crystals in agar‚Äďagar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar‚Äďagar gel. P V DALAL. ‚ąó and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  14. The contextualized participative mode of evaluation (CPME applied to ‚ÄúGranada-Employment‚ÄĚ project / El modelo de evaluaci√≥n participativo contextualizado (MEPAC aplicado al proyecto ‚ÄúGranada-Empleo‚ÄĚ

    Directory of Open Access Journals (Sweden)

    Margarita Pérez Sánchez

    2013-10-01

    Full Text Available This article presents the evaluation of 2009-2010 ‚ÄúGranada-Employment‚ÄĚ Project financed by the European Social Fund and coordinated by the Granada County Council. The evaluation -developed between September of 2010 and July of 2011- was designed by the Departments of Political Science and Public Administration, and Sociology from the University of Granada. This research offers a Contextualized Participative Mode of Evaluation (CPME case study, which is ad hoc designed by the external evaluation team. The summative evaluation of the Project undergoes the main objectives pursed and the measures developed by the programme, and it reveals key points for the territorial pacts future development for employment and actions addressed to improve the job seekers‚Äô labour integration.

  15. ROMERO S√ĀNCHEZ, Guadalupe. Los pueblos de indios en Nueva Granada. Granada: Atrio y Universidad Nacional de Colombia, 2010, 364 pp.

    Directory of Open Access Journals (Sweden)

    Inmaculada Rodríguez Moya

    2010-03-01

    Full Text Available Todavía hoy en día sigue abrumando a los historiadores del arte la complejidad y vastedad del territorio iberoamericano. Por ello, debemos loar el esfuerzo de aquellos que estudian, y además en profundidad, procesos tan laberínticos como el de la fundación de los llamados pueblos de indios. La obra que nos ocupa, primera de la Colección Atrio Patrimonio dirigida por Rafael López Guzmán, es fruto del laborioso trabajo de Guadalupe Romero, y resultado de sus fascinantes viajes por el territorio del antiguo Virreinato de Nueva Granada. Es consecuencia también del estudio de numerosas y variadas fuentes: contratos, relaciones de visitas, y por supuesto de un análisis certero de las mismas...

  16. Direct identification and recognition of yeast species from clinical material by using albicans ID and CHROMagar Candida plates.

    Science.gov (United States)

    Baumgartner, C; Freydiere, A M; Gille, Y

    1996-02-01

    Two chromogenic media, Albicans ID and CHROMagar Candida agar plates, were compared with a reference medium, Sabouraud-chloramphenicol agar, and standard methods for the identification of yeast species. This study involved 951 clinical specimens. The detection rates for the two chromogenic media for polymicrobial specimens were 20% higher than that for the Sabouraud-chloramphenicol agar plates. The rates of identification of Candida albicans for Albicans ID and CHROMagar Candida agar plates were, respectively, 37.0 and 6.0% after 24 h of incubation and 93.6 and 92.2% after 72 h of incubation, with specificities of 99.8 and 100%. Furthermore, CHROMagar Candida plates identified 13 of 14 Candida tropicalis and 9 of 12 Candida krusei strains after 48 h of incubation.

  17. ESTUDIO DE H√ĀBITOS DEPORTIVOS EN LA PROVINCIA DE GRANADA

    Directory of Open Access Journals (Sweden)

    M. Martí­nez

    2010-09-01

    Full Text Available

     

    RESUMEN

    Este art√≠culo es, fundamentalmente, una propuesta de estrategia a seguir para el an√°lisis de la situaci√≥n actual del fen√≥meno deportivo en nuestra sociedad. Al mismo tiempo como iniciativa subvencionada por la Diputaci√≥n Provincial de Granada en su √°rea de Deporte este estudio tiene un doble objetivo, en primer lugar conocer la realidad de Granada y su provincia en materia deportiva y en segundo lugar el poder realizar tras el an√°lisis de los datos, una pol√≠tica adecuada a las necesidades y demandas detectadas. El cuestionario se dise√Ī√≥ con 272 items, siendo aplicado a una muestra de 2.400 sujetos con un nivel de confianza de +95%. Se ha utilizado un muestreo por conglomerados poliet√°picos por edades, sexo y estratos de poblaci√≥n. Las dimensiones del estudio versan sobre imagen del deporte, h√°bitos deportivos, ocupaci√≥n del tiempo libre, deporte competici√≥n y asociacionismo, deporte escolar, oferta deportiva p√ļblica y privada e instalaciones y equipamientos deportivos. Como primeros resultados relevantes podemos destacar la imagen positiva que existe del deporte para todos en la provincia de Granada, el mayor porcentaje de pr√°ctica deportiva en el hombre respecto a la mujer granadina, la importancia que otorgan los padres a la educaci√≥n f√≠sica y deportiva de sus hijos, el aumento de pr√°ctica fisico-deportiva en espacios al aire libre y el inter√©s de realizaci√≥n de actividad f√≠sica entorno a la salud y la diversi√≥n.
    PALABRAS CLAVE: H√°bitos deportivos, demanda deportiva, cuestionario.

     

    ABSTRACT

    This article is, a proposition of strategie to follow to analice de actual situation of sporting phenomenon in our society.
    At the same time this study, that it appears like a grant iniciative from Granada County Council in her Sport Area, has a

  18. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. La medicina en el Nuevo Reino de Granada en la segunda mitad del siglo XVIII

    Directory of Open Access Journals (Sweden)

    Andres Soriano Lleras

    1964-11-01

    Full Text Available En 1783 Mutis decía en carta al Virrey Flórez que en materia de quinas la materia médica debe ser la corteza de las ramas jóvenes, pues la de las viejas ya es muy pobre. El capitán Antonio de Latorre Miranda encontró la quina anaranjada en Fusagasugá y reclamó para sí el descubrimiento de las quinas en el Nuevo Reino de Granada.

  20. Sierra Nevada serpentinites. An important element in the architectonic heritage of Granada (Spain).

    Science.gov (United States)

    Navarro, Rafael; Pereira, Dolores; Rodríguez-Navarro, Carlos; Sebastián-Pardo, Eduardo

    2013-04-01

    Serpentinites are widely used in historic buildings in the whole world, from Ancient Greek or Egypt to more recent colonial buildings in the USA. Serpentinites from Sierra Nevada (S of Spain) have been traditionally used as ornamental elements in historic buildings of Granada city, both indoors and outdoors. The Cathedral, Carlos V Palace, Royal Chancery and some others are good examples of their use. Some other important cases can be found outside Granada, like El Escorial monastery, Las Salesas Reales convent, etc… all of them part of Madrid architectonic heritage. There are two quarries located in Sierra Nevada that supplied all the material to make the different elements in the cited buildings. In this work, a thorough characterization of the main serpentinites from Sierra Nevada, their uses, and their state of conservation in selected buildings from Granada has been performed. Samples from the main original quarry and from one historical building (Real Chancillería) have been analysed, determining the mineralogical and geochemical composition, texture, water parameters (absorption, porosity, density) and possible alteration by salt formation. It has been observed that the mineralogical and geochemical compositions are similar in both sets of samples, although the ones coming from the historical building show a highly advanced state of alteration. Regarding physical and mechanical parameters, samples from the quarry have very low water absorption values, while the porosity of serpentinites sampled from the Real Chancillería is comparatively much higher. We explain this difference as due to the weathering of the emplaced serpentinites by salt crystallization processes (mainly gypsum or epsomite), that generate strong internal pressures causing the disintegration of the whole natural stone. In addition, the increase of the porosity can be caused by dissolution processes related to the presence of acid solutions related to oxidation and hydrolysis of iron

  1. Study of 99mTc in the discharge of public hospitals in Granada

    International Nuclear Information System (INIS)

    Pinero Garcia, F.; Krawczyk, E.; Ferro Garcia, M. A.

    2011-01-01

    The main objective is to determine the activity levels of 99m Tc in the discharge of two public hospitals in Granada, Nuclear Medicine Service at the point of controlling them. The reasons for this study are due to higher doses may be administered until 10 to 20 mCi, to produce images with better definition due to the relative safety of this radionuclide. Which will be reflected later in the highest values ??of activity found for this isotope of technetium in these effluents.

  2. Ilustración y reacción en la Nueva Granada

    Directory of Open Access Journals (Sweden)

    Javier Lavi√Īa

    1989-01-01

    Full Text Available Las Reformas Borbónicas y la influencia del pensamiento ilustrado francés, incidieron decididamente en la liberalización de la Nueva Granada. Cuando las autoridades se percataron de los aires independentistas, expresados en hechos como la "Revolución de los Pasquines", optaron por elaborar un proyecto que devolviera la seguridad al Reino. Aquí se analizan algunos de los informes oficiales sobre la situación de la Colonia y las soluciones expuestas para contrarrestar el ambiente político que se percibía.

  3. Inteligencia Emocional en los docentes de la Universidad Militar Nueva Granada

    OpenAIRE

    López Pacheco, Jenny Carolina; Pedraza Ortíz, Alexandra Patricia

    2016-01-01

    La presente investigación tuvo como objetivo principal describir el estado actual de la inteligencia emocional en los docentes de la Universidad Militar Nueva Granada. Se utilizaron los siguientes instrumentos: escala Trait Meta Mood Scale 24 (TMMS-24) y una encuesta de variables sociodemográficas. También se describió la percepción que tienen los docentes con relación al concepto de Inteligencia Emocional. La investigación fue de tipo observacional descriptiva, se realizó un muestreo por con...

  4. Estado del vireinato de santafé, nuevo reino de granada

    OpenAIRE

    Antonio Moreno, Francisco

    2010-01-01

    Estado del vireinato de Santaf√© y relaci√≥n de su gobierno y mando del Excelent√≠simo se√Īor Bailio frai Pedro Mesia de la Cerda. Informe enviado en el a√Īo de 1772, al final del Gobierno del Virrey. Expone las condiciones de la Nueva Granada luego de la renuncia del Virrey. Contiene una descrici√≥n geogr√°fica del virreinato; las condiciones en que se establecen las audiencias y causas; la relaci√≥n de habitantes y los tipos de poblaci√≥n del virreinato; el listado de los gobiernos militares y pol√≠t...

  5. La formación de la conciencia moral en la Universidad Militar Nueva Granada

    Directory of Open Access Journals (Sweden)

    Jorge Eduardo Vargas Vargas

    2008-01-01

    Full Text Available Este art√≠culo presenta los hallazgos obtenidos en la investigaci√≥n titulada "Formaci√≥n de la conciencia moral en la Universidad Militar Nueva Granada", partiendo de las teor√≠as del desarrollo moral propuestas por Piaget y Kohlberg. El diagn√≥stico nos enfrenta a la responsabilidad que tienen las instituciones de Educaci√≥n Superior frente a la formaci√≥n de sujetos con una moral de principios, de justicia social y de reconocimiento de los otros y a la b√ļsqueda de procesos pedag√≥gicos que posibiliten estos desarrollos.

  6. La Vega de Granada: De un espacio agrario en crisis a un complejo paisaje cultural

    OpenAIRE

    Ra√ļl Puente Asuero

    2013-01-01

    RESUMEN: La Vega de Granada es un paisaje agrario multifuncional con una potente dimensi√≥n cultural y colectiva. Este art√≠culo tiene como objetivo se√Īalar c√≥mo, en las √ļltimas d√©cadas, este √°mbito agrario de anta√Īo notable unidad paisaj√≠stica, ha devenido en una compleja aglomeraci√≥n caracterizada por una gran discontinuidad y fraccionamiento del territorio. Para ello, se caracterizan los principales valores patrimoniales de la Vega (r√≠os, acequias, caminos, secaderos‚Ķ) y c√≥mo las manifestac...

  7. Mechanical touch responses of Arabidopsis TCH1-3 mutant roots on inclined hard-agar surface

    Science.gov (United States)

    Zha, Guodong; Wang, Bochu; Liu, Junyu; Yan, Jie; Zhu, Liqing; Yang, Xingyan

    2016-01-01

    The gravity-induced mechanical touch stimulus can affect plant root architecture. Mechanical touch responses of plant roots are an important aspect of plant root growth and development. Previous studies have reported that Arabidopsis TCH1-3 genes are involved in mechano-related events, how-ever, the physiological functions of TCH1-3 genes in Arabidopsis root mechanoresponses remain unclear. In the present study, we applied an inclined hard agar plate method to produce mechanical touch stimulus, and provided evidence that altered mechanical environment could influence root growth. Furthermore, tch1-3 Arabidopsis mutants were investigated on inclined agar surfaces to explore the functions of TCH1-3 genes on Arabidopsis root mechanoresponses. The results showed that two tch2 mutants, cml24-2 and cml24-4, exhibited significantly reduced root length, biased skewing, and decreased density of lateral root. In addition, primary root length and density of lateral root of tch3 (cml12-2) was significantly decreased on inclined agar surfaces. This study indicates that the tch2 and tch3 mutants are hypersensitive to mechanical touch stimulus, and TCH2 (CML24-2 and CML24-4) and TCH3 (CML12-2) genes may participate in the mechanical touch response of Arabidopsis roots.

  8. Implications of student mobility at the University of Granada: culture shock, education shock and ‚Äúhosting shock‚ÄĚ

    Directory of Open Access Journals (Sweden)

    Inmaculada Soriano García

    2008-05-01

    Full Text Available The University of Granada heads the latest statistics in absolute figures in students’ mobility in Spain. Taking this assertion as a starting point, this paper shows the implications of culture shock for student mobility as well as the impact of student mobility for the different education levels and for host institutions. Furthermore, this paper presents the results obtained from the Temcu project (Teacher Training for the MulticulturalClassroom at the University, a European project based on the implications of the multicultural classroom at the University of Granada.

  9. El modelo de articulación entre la universidad militar Nueva Granada y la educación media

    OpenAIRE

    Cantor, Carlos Fernando

    2016-01-01

    Con el fin de responder a necesidades sociales de los municipios de la Sabana-Centro en Cundinamarca, la Universidad Militar Nueva Granada ‚Äď UMNG, ha formulado y viene desarrollando el ‚ÄúModelo de articulaci√≥n entre la Universidad Militar Nueva Granada y la educaci√≥n media‚ÄĚ. Es una estrategia pedag√≥gica que brinda oportunidades a estudiantes de d√©cimo y und√©cimo, para el mejoramiento de 1) competencias cognitivas en matem√°tica, f√≠sica, qu√≠mica y lecto-escritura, y/o 2) competencias laborales e...

  10. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  11. Fauna de mamiferos del pleistoceno superior del yacimiento de las Majolicas (Granada

    Directory of Open Access Journals (Sweden)

    Alberdi, M√ā¬™ T.

    2004-12-01

    Full Text Available In this paper we describe the fossils of macromarnmals provided by Las Majolicas site (Granada, Spain. This site was excavated in the 50's by E. Aguirre. The high frecuency of cervids with 469 fossils identified out of 558 is remarkable. We have compared Cervus elaphus from Las Majolicas with others that belong to the Cantabrian Range and we can conclude that they have smaller sizes, a fact which can be related to the more meridional situation of the site. According to the fauna that appears in Las Majolicas this site might be located in the Upper Pleistocene.En este trabajo se describen los f√≥siles de macromam√≠feros del yacimiento de Las Majolicas (Granada, Espa√Īa, excavado en la d√©cada de los cincuenta por E. Aguirre. En √©l predominan los c√©rvidos, con 469 restos identificados de un total de 558. Los restos de Cervus elaphus al compararlos con otros ejemplares del Pleistoceno superior de la Cordillera Cant√°brica presentan un menor tama√Īo, lo cual podr√≠a indicar una reducci√≥n de la talla en relaci√≥n al nivel m√°s meridional de esta localidad. La fauna presente en Las Majolicas indica su posible asignaci√≥n al Pleistoceno Superior

  12. Administración económica, fiscal y de hacienda en la nueva Granada

    Directory of Open Access Journals (Sweden)

    Jacqueline Blanco Blanco

    2008-01-01

    Full Text Available Al examinar la administraci√≥n econ√≥mica del Estado durante la Nueva Granada, especialmente durante el gobierno del General Francisco de Paula Santander, se encuentra un importante esfuerzo por vincular el desarrollo econ√≥mico del pa√≠s a una propuesta de orden liberal orientada hacia la ampliaci√≥n de la producci√≥n y el fortalecimiento del comercio, fundamentalmente el de exportaci√≥n. El proyecto contrasta con el estado de pobreza en que se encontraba la econom√≠a rural basada principalmente en la explotaci√≥n de la mano de obra esclava, con la languidez del comercio de productos como caf√©, cacao, algod√≥n y a√Īil, y con el escaso desarrollo de la manufactura artesanal en el pa√≠s. En consecuencia la vinculaci√≥n al mercado internacional de la Nueva Granada durante este per√≠odo result√≥ atropellada. La administraci√≥n estatal del referido proyecto econ√≥mico enfrent√≥ la corrupci√≥n p√ļblica incontrolada, que desemboc√≥ en el progresivo deterioro del fisco, lo cual imposibilit√≥ alcanzar los logros previstos en cuanto al mejoramiento de las condiciones sociales, culturales, educativas, y de bienestar material y general.

  13. Las galeras mercantiles de Florencia en el Reino de Granada en el siglo XV

    Directory of Open Access Journals (Sweden)

    Gonz√°lez Ar√©valo, Ra√ļl

    2011-06-01

    Full Text Available Florence developped a statal galleys system in the 15th century. The present article analyzes its role in the Kingdom of Granada, in the Florentine Sea Consuls’ orders as well as in the privet documentation. Thus, we study aspects as different as the insertion of the Nasrid ports in the Florentine navigation lines, freight charges envisaged and the news about the mercantile practice. What emerges is a hitherto unknown image about the role of the Tuscan galleys in the external commercial organization of the Granadan territory.

    Florencia desarrolló un sistema estatal de galeras en el siglo XV. El presente artículo analiza su papel en el Reino de Granada, tanto en las órdenes del Consulado del Mar florentino como en la documentación privada. Así, se estudian aspectos tan dispares como la inserción de los puertos nazaríes en las líneas de navegación florentinas, los fletes previstos y las noticias sobre la práctica mercantil. Emerge una imagen inédita sobre el papel de las galeras toscanas en la articulación comercial exterior del territorio granadino.

  14. An index to quantify street cleanliness: the case of Granada (Spain).

    Science.gov (United States)

    Sevilla, Aitana; Rodríguez, Miguel Luis; García-Maraver, Angela; Zamorano, Montserrat

    2013-05-01

    Urban surfaces receive waste deposits from natural and human sources, which create a negative visual impact and are identified as potentially significant contributors to water and air pollution. Local councils are usually responsible for the sweep of roads and footpaths to keep the environment clean and free of litter. Quality controls are useful in order to check whether the services are being executed according to the quantity, quality and performance standards that are provided. In this sense, several factors might affect the efficiency of the management of cleaning and waste collection services; however, only a few contributions are available in the literature on the various aspects associated with the level of street cleanliness. In this paper, the suitability of a Cleanliness Index has been checked, for the case of Granada (South of Spain), in order to contribute to the proper management of public expenditure, improving the quality and cost of an essential service for any municipality. Results have concluded that the city exhibits a good level of cleanliness, although the standard of cleaning varied from one area of the city to another. The Cleaning Index fits well to the general situation of the different districts of Granada and thus, it could be considered a useful tool for measuring the level of cleanliness of the streets of the city and for evaluating the organization of the cleaning service, such that an outsourced company would not be responsible for controlling all the cleaning services. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Analysis of an institutional domain: scientific output of the Granada University (SCI 1991-99

    Directory of Open Access Journals (Sweden)

    Moya Anegón, Félix

    2005-06-01

    Full Text Available Institutional domain analysis is a very important bibliometric method to obtain an academic institutional scientific profile. In this paper we realize a deep analysis about the scientific production of the University of Granada, form 1991 to 1999. We present a wide set of indicators: production, visibility, normalized mean impact, productivity, research potential, and others. The indicators are for the whole institution, faculties, institutes, departments.

    El análisis de dominio institucional constituye un tipo de estudio bibliométrico que permite representar, de forma muy aproximada, el perfil investigador de una determinada institución académica. En el presente trabajo se realiza un profundo análisis de la producción científica de la Universidad de Granada, para el período 1991-99. Se presentan una amplia serie de indicadores: producción, visibilidad, impacto medio normalizado, productividad, potencial investigador, entre otros. Los indicadores se presentan tanto de forma global para toda la universidad, como por facultades, escuelas, institutos y departamentos.

  16. La televisión universitaria, el ejemplo de la Universidad de Granada

    Directory of Open Access Journals (Sweden)

    Vanesa María Gámiz Sánchez

    2012-01-01

    Full Text Available En este art√≠culo mostramos, tras una peque√Īa introducci√≥n sobre las funciones sociales y posibilidades actuales de la televisi√≥n y en concreto de la televisi√≥n universitaria, la experiencia llevada a cabo en la Universidad de Granada con la puesta en marcha de una televisi√≥n Universitaria. Explicamos lo que se est√° haciendo (tipo de emisiones y c√≥mo, ya que la Universidad de Granada ha apostado por la evoluci√≥n tecnol√≥gica y est√° trabajando la televisi√≥n v√≠a Internet y explotando sus posibilidades; describimos los recursos que est√° utilizando la UGR para la producci√≥n y distribuci√≥n de material audiovisual. Finalmente valoramos la puesta en marcha de esta experiencia y se√Īalamos sus posibilidades futuras en torno a su potencial formativo adem√°s de informativo y c√≥mo √©sta puede incidir en la formaci√≥n de los receptores, modificando sus conocimientos, conducta, actitudes, etc., pero que sobre todo se ha de basar en la mejora del proceso de formaci√≥n del individuo.

  17. Characterization and conservation of the stone used in the Cathedral of Granada, Spain

    Directory of Open Access Journals (Sweden)

    Villegas, R.

    1995-12-01

    Full Text Available This paper summarizes a study carried out on the Granada Cathedral which includes studies of indicators, factors and mechanisms of deterioration. A complete chemical and physical characterization of altered and unaltered material from the quarries and the building has been made. Eight commercial treatment products have been tested on the main stone-type used in the monument, including two accelerated weathering tests (salt crystallization and SO2 chemical attack. Some conservation proposals have been made.

    Este artículo recoge un estudio llevado a cabo sobre la Catedral de Granada que incluye la determinación de los indicadores, factores y mecanismos de deterioro. Asimismo se ha realizado una completa caracterización física y química del material alterado del edificio e inalterado de cantera. Se han probado ocho productos comerciales aplicados al principal tipo de piedra existente en el monumento, incluyendo la realización de dos ensayos de alteración acelerada (cristalización de sales y ataque químico con atmósfera de SO2. Como punto final se recogen algunas recomendaciones de cara a una posible intervención.

  18. La arquitectura del pleno barroco en Granada: el hospital del Corpus Christi

    Directory of Open Access Journals (Sweden)

    Barrios Roz√ļa, Juan Manuel

    2011-03-01

    Full Text Available The Corpus Christi hospital of Granada was a victim of prejudices against the baroque on the part of influential historians. Nevertheless, the building is an interesting example of hospital architecture with a frankly original temple. Thanks to the exhaustive analysis of the institution’s very complete archive, it can be determined that some thirty artists worked there, including Alonso Cano and his disciple Juan Luis de Ortega, whose architectural works are evaluated here.

    El hospital del Corpus Christi de Granada fue víctima de los prejuicios contra el barroco de influyentes historiadores. Sin embargo, el edificio constituye un interesante ejemplo de arquitectura hospitalaria con un templo francamente original. Gracias al análisis exhaustivo de su completo archivo, puede detectarse la labor de una treintena de artífices, entre ellos Alonso Cano y su discípulo Juan Luis de Ortega, cuyas obras arquitectónicas son valoradas aquí.

  19. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  20. Procesos indentitarios en el paisaje contempor√°neo. Caso de estudio de la Vega de Granada. / Identity processes in the contemporary landscape. Case of study of the Vega de Granada.

    Directory of Open Access Journals (Sweden)

    Maria Teresa Zapiain Aizpuru

    2011-09-01

    Full Text Available ResumenConsiderando la distinción de significado establecida entre los conceptos de espacio, territorio y paisaje, y su relación indisociable con la cultura y la identidad, en su primera parte, este artículo expone una propuesta teórica de interpretación de los procesos identitarios vinculados con el territorio. En la segunda parte, se explora, por medio de un estudio empírico en la Vega de Granada, la relación entre territorio e identidad, así como la influencia de ciertas transformaciones socioeconómicas y culturales en los procesos de identificación con el lugar.Palabras clave Territorio, paisaje, cultura, identidad, Vega de Granada. AbstractConsidering the meaningful distinction drawn between the concepts of space, territory and landscape, and its inseparable relationship with culture and identity, in its first part, this paper presents a theoretical proposal for the interpretation of identity processes associated with the territory. In the second part, is explored the relation between territory and identity, as well as the influence of certain socio-economic and cultural transformations in identity processes through an empirical study of the Vega de GranadaKeywordsTerritory, landscape, culture, identity, Vega de Granada.

  1. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ¬Ī 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  2. An integrated methodology for salt damage assessment and remediation: The case of San Jerónimo Monastery (Granada, Spain)

    NARCIS (Netherlands)

    Ruiz-Agudo, E.; Lubelli, B.; Sawdy, A.; Hees, R. van; Price, C.; Rodriguez-Navarro, C.

    2011-01-01

    San Jerónimo Monastery (Granada, Spain) was selected as a case study for the investigation of the effect of indoor environmental conditions on salt weathering and for on-site testing of a remediation treatment using crystallization inhibitors on account of the extreme salt damage affecting both the

  3. An integrated methodology for salt damage assessment and remediation : The case of San Jeronimo Monastery (Granada, Spain)

    NARCIS (Netherlands)

    Ruiz-Agudo, E.; Lubelli, B.; Sawdy, A.; Van Hees, R.; Price, C.; Rodriguez-Navarro, C.

    2010-01-01

    San Jeronimo Monastery (Granada, Spain) was selected as a case study for the investigation of the effect of indoor environmental conditions on salt weathering and for on-site testing of a remediation treatment using crystallization inhibitors on account of the extreme salt damage affecting both the

  4. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  5. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; G√ľmral, Ramazan; D√∂ńüen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26¬įC on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  6. Palace of the Earl of Padul, Granada, Spain. A Milestone in a Crossroad

    Science.gov (United States)

    Lafuente-Bolívar, Francisco Javier; Santiago-Zaragoza, Juan Manuel; María Cruz-Valdivieso, Ana

    2017-10-01

    The Palace of the Counts of Padul is the most emblematic building of Padul, Province of Granada in Spain, being one of the most remarkable buildings of the region of the Valley of Lecrín. It is a building of undoubted historical value. It is classified as one of Cultural Interest, which means maximum level of protection of the Spanish legislation in historical heritage. In spite of being a historical symbol of Padul, most of the citizens ignore its importance. It was built in the first part of the XVII century. D. Antonio de Aróstegui y Zazo (knight of the Santiago order and a secretary of Felipe III) was its developer. He gave the building a noble character with an unusual design for this shire. The ground floor has an L shape. Besides, it has two floors and two squared towers, and standing out there is a third floor covered by a pitched roof. Also, it has load-bearing walls of masonry. Only the corners are built with carved stones. Deck is built with logs, and bricks, and wooden roof trusses. It looks like a solid simple house of civil architecture at the beginning of the Baroque style. Analyzing the urban morphology of Padul, the uniqueness of the plot is important related to the urban fabric. It is also remarkable its strategic position with respect to the historical roads that crossed there: The royal road that came from Granada heading to the Alpujarras, and leading to Motril and the road that starting in Malaga crossed through Alhama and arrived in Padul. It is clear the function of controlling the necessary passage towards the Lecrin Valley, the Alpujarras and the Mediterranean coast. Immediately after its declaration in 1981 as a National Monument, and despite this, it suffered an unfortunate intervention which has been maintained until today. The council of Padul would like to acquire it presenting a project for its recovery. This situation provoked the invitation of the council to the University of Granada to help with that. And this would allow the

  7. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  8. Optimisation of a direct plating method for the detection and enumeration of Alicyclobacillus acidoterrestris spores.

    Science.gov (United States)

    Henczka, Marek; Djas, MaŇāgorzata; Filipek, Katarzyna

    2013-01-01

    A direct plating method for the detection and enumeration of Alicyclobacillus acidoterrestris spores has been optimised. The results of the application of four types of growth media (BAT agar, YSG agar, K agar and SK agar) regarding the recovery and enumeration of A. acidoterrestris spores were compared. The influence of the type of applied growth medium, heat shock conditions, incubation temperature, incubation time, plating technique and the presence of apple juice in the sample on the accuracy of the detection and enumeration of A. acidoterrestris spores was investigated. Among the investigated media, YSG agar was the most sensitive medium, and its application resulted in the highest recovery of A. acidoterrestris spores, while K agar and BAT agar were the least suitable media. The effect of the heat shock time on the recovery of spores was negligible. When there was a low concentration of spores in a sample, the membrane filtration method was superior to the spread plating method. The obtained results show that heat shock carried out at 80¬įC for 10 min and plating samples in combination with membrane filtration on YSG agar, followed by incubation at 46¬įC for 3 days provided the optimal conditions for the detection and enumeration of A. acidoterrestris spores. Application of the presented method allows highly efficient, fast and sensitive identification and enumeration of A. acidoterrestris spores in food products. This methodology will be useful for the fruit juice industry for identifying products contaminated with A. acidoterrestris spores, and its practical application may prevent economic losses for manufacturers. Copyright ¬© 2012 Elsevier B.V. All rights reserved.

  9. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  10. Plate tectonics

    Digital Repository Service at National Institute of Oceanography (India)

    Chaubey, A.K.

    's continental drift theory was later disproved, it was one of the first times that the idea of crustal movement had been introduced to the scientific community; and it has laid the groundwork for the development of modern plate tectonics. In the early... of the structure of the atom was to physical sciences and the theory of evolution was to the life sciences. Tectonics is the study of the forces within the Earth that give rise to continents, ocean basins, mountain ranges, earthquake belts and other large-scale...

  11. Create Your Plate

    Medline Plus

    Full Text Available ... Plate Share Create Your Plate ! Share: Seven Simple Steps to Create Your Plate It's simple and effective ... foods within each food category. Try these seven steps to get started: Using your dinner plate, put ...

  12. Atmospheric concentrations of 7Be and 210Pb in Granada, Spain

    International Nuclear Information System (INIS)

    Azahra, M.; Gonzalez-Gomez, C.; Instituto Andaluz de Ciencias de la Tierra, Granada; Lopez-Penalver, J.J.; Camacho-Garcia, M.A.; El Bardouni, T.; Boukhal, H.

    2004-01-01

    Aerosols samples in near-surface air of Granada (Spain) were collected on a weekly basis. The seasonal 210 Pb and 7 Be concentrations were determined during the five-year period, from October 1993 to September 1997. The elements, despite their different origin and their different distribution throughout the atmosphere, present the same seasonal variation. There was a tendency for a maximum during the summer season and a minimum during fall and/or winter. Concentration of 7 Be and 210 Pb and meteorological data have been used in order to determine the periods of the potential radioactive pollution. Deposition of 7 Be occurs primarily by precipitation except during the investigation periods where precipitation was scarce and irregular. (author)

  13. The Tinea Hospital in Granada, 1679-1923: an institution with a long history.

    Science.gov (United States)

    Girón, F; Lozano, C; Serrano-Ortega, S

    2015-10-01

    The Tinea hospital in Granada, Spain, was a charitable health facility founded in the 17th century and still treating patients well into the 20th century. The hospital accepted patients from anywhere, not only those residing in the surrounding area. We describe the hospital's founding and the characteristics of the patients and caregivers. We also discuss how tinea was considered at the time, including the typology and treatment protocols applied as well as diet and hygiene measures used. It is striking that a hospital so focused on treating a single disease did not produce studies on the condition or on the application of contemporary knowledge to guide treatment. Copyright ¬© 2013 Elsevier Espa√Īa, S.L.U. and AEDV. All rights reserved.

  14. The expulsion of Jesuits from Nueva Granada in 185Oas key for understanding

    Directory of Open Access Journals (Sweden)

    José David Cortés Guerrero

    2003-01-01

    Full Text Available This article shows the confrontation between the liberal ideology of the mid nineteenth century and the conservative positions of the time as a result of the expulsion of the Society of Jesus from the Nueva Granada. The expulsion of the Jesuits encapsulates several key aspects of liberal ideology: the need to break with the colonial past; progress and civilization as attainable objectives; education as a neutral in terms of religious instruction; and the separation of the Catholic Church from the State as an important factor for reaching modernization and modernity. With the expulsion of the Jesuits one can also see the aligning of the nascent political parties, some defended the expulsión, others opposed it vehemently.

  15. Sobre la identidad del fragmento craneal atribuido a Homo sp. en Venta Mlcena (Orce Granada

    Directory of Open Access Journals (Sweden)

    Moy√°-Sol√°, S.

    1987-12-01

    Full Text Available The internal morphology of the cranial fragment attributed to Homo from Venta Micena (Granada is analysed. The presence of a coronal suture close to lambda does not permit its attribution to the genus Homo. The distace between the coronal suture and lambda (4 cm., the presence of tentorial procces and the digital impresions strongly suggesst its attribution to a juvenil specimen of Equus stenonis.Se analiza la morfología de la cara interna del fragmento craneal de Venta Micena atribuido inicialmente al género Homo. Se detecta la presencia de la sutura coronal a cuatro centímetros del punto lambda. Ello, conjuntamente a las fuertes impresiones digitales del endocraneo y la presencia de una cresta del proceso oseo tentoríal hacen imposible la adscripción de esta pieza al género Homo., atribuyendose a Equus stenonis.

  16. Metamorfosis del Albaicín (Granada. Del aislamiento de la interdependencia

    Directory of Open Access Journals (Sweden)

    Julio Cabrera Medina

    2002-01-01

    Full Text Available En este trabajo se ofrecen los resultados de un estudio relativo a la econom√≠a del Albaic√≠n, barrio hist√≥rico, n√ļcleo originario de la ciudad de Granada, que desde 1984 es Patrimonio de la Humanidad. Se responde a preguntas relativas a la actividad econ√≥mica existente en el barrio, sus relaciones con la ciudad y de qu√© viven sus habitantes. Al mismo tiempo, se plantean algunos problemas surgidos en el contexto de la investigaci√≥n, como la existencia de una imagen social desfasada de la econom√≠a del Albaic√≠n, el significado de la econom√≠a de los barrios hist√≥ricos, y la forma que √©sta adopta en sus relaciones con la ciudad.

  17. Attitudes towards Mathematics of the students who enter University of Granada

    Directory of Open Access Journals (Sweden)

    Patricia Pérez-Tyteca

    2008-05-01

    Full Text Available Affective answers play an essential role in the process of teaching-learning mathematics. Within this field, the more studied construct in the last three decades is the attitude¬†towards mathematics. This construct have been frequently related to gender differences¬†between the students population as well as the students¬ī election of mathematics courses¬†and university degrees depending on the level of mathematics that they present. For this¬†reason, we have analyzed, using an adaptation of the Fennema-Sherman Mathematics¬†Attitude Scales (1976, the attitudes towards mathematics of the students who enter the¬†University of Granada, in a global way and classifying the subjects by gender and by¬†the fields of knowledge of their degrees.

  18. Pedro de Valencia, Francisco de Gurmendi and the Plomos de Granada

    Directory of Open Access Journals (Sweden)

    Magnier, Grace

    2003-12-01

    Full Text Available The Inquisition in 1618 seized all the papers of Pedro de Valencia, renowned humanist, biblical scholar and chronicler of Philip III. The papers of other members of his circle were also confiscated. In this article I examine the two most important texts: Sobre el pergamino y l√°minas de Granada of Valencia and a Libelo Segundo of Francisco de Gurmendi, interpreter of Oriental languages for Philip III. The article is structured around Gurmendi's response to a memorial published in 1617 by Archbishop Pedro de Castro in defence of one of his translators. Gurmendi, working from his translation of the first two Lead Books, shows how these contain heretical ideas on the Trinity and how the memorialista has mistranslated many passages.

    En 1618 la Inquisici√≥n confisc√≥ todos los papeles de Pedro de Valencia, humanista insigne, exegeta b√≠blico y cronista del reino y de las Indias de Felipe III. Tambi√©n confisc√≥ los papeles de otros miembros de su c√≠rculo. En este art√≠culo examino los dos textos m√°s importantes: Sobre el pergamino y l√°minas de Granada de Valencia y un Libelo segundo de Francisco de Gurmendi, int√©rprete en lenguas orientales del rey. El art√≠culo se centra en la respuesta de Gurmendi a un memorial del Arzobispo Pedro de Castro en el que se defiende a uno de sus traductores. Partiendo de su traducci√≥n de los dos primeros libros pl√ļmbeos, Gurmendi muestra las herej√≠as trinitarias que √©stos contienen y c√≥mo el memorialista ha traducido mal muchos pasajes.

  19. [Nutritional assessment of the menus served in municipal nursery schools in Granada].

    Science.gov (United States)

    Seiquer, Isabel; Haro, Ana; Cabrera-Vique, Carmen; Mu√Īoz-Hoyos, Antonio; Gald√≥, Gabriel

    2016-10-01

    The school canteen plays today an essential role in child nutrition and for consolidating appropriate eating habits. In Spain, the guidelines for school meals have been established by the NAOS strategy and the Perseus program, and are especially aimed at school children of 6-10 years. However, there is a lack of information on menus offered in pre-school education centres, which take in children of pre-school age. The aim of this study was to evaluate the composition and the food supplied in pre-schools of the province of Granada. A study was conducted on the menus offered in public pre-schools in Granada, with a population of 420 children aged 2-6 years old. A total of 20 menus were analysed, and details were collected including direct information on the ingredients used, the proportion of these in each dish, and the form of preparation. The daily intake of energy and nutrients, as well as the frequency of weekly supply of the different food groups were studied. The average energy content of the menus was 512.5kcal, distributed into protein (17.3%), carbohydrates (48.8%), and lipids (33.9%). A suitable supply of fibre (7.8g/day) was observed, but content of calcium and zinc did not reach recommended levels. The supply of vegetables was adequate, with a daily presence of salad, as well as vegetables, meat, fish and fruit. Menus evaluated represent an adequate content of energy, and proper supply of the different groups of foods, especially vegetables, fruits and salads. A great effort is observed in the centres to adapt meals to nutritional recommendations. Copyright ¬© 2015 Asociaci√≥n Espa√Īola de Pediatr√≠a. Publicado por Elsevier Espa√Īa, S.L.U. All rights reserved.

  20. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  1. Aportaci√≥n al estudio palinol√≥gico de la flora ornamental de la ciudad de Granada (Espa√Īa)

    OpenAIRE

    Díaz de la Guardia Guerrero, Consuelo; Blanca López, Gabriel; Nieto, Rosa Mª

    1988-01-01

    Se estudian los caracteres polínicos de 23 especies pertenecientes a la flora ornamental de la ciudad de Granada, utilizando microscopía óptica y microscopía electrónica de barrido, indicando su posible incidencia alergógena. The pollen characters of 23 species, representing the flora ornamental from the city of Granada (Spain), are studied by optical and scanning electron microscopy to determine allergenic incidence.

  2. Valores de trihalometanos en agua de consumo de la provincia de Granada, Espa√Īa Trihalomethane levels in drinking water in the province of Granada (Spain

    Directory of Open Access Journals (Sweden)

    Carmen Freire

    2008-12-01

    Full Text Available Objetivos: La cloraci√≥n del agua da lugar a la formaci√≥n de subproductos potencialmente da√Īinos para la salud, entre ellos los trihalometanos, que se han hallado elevados en algunas zonas de Espa√Īa. En este estudio se investigan los valores de trihalometanos en el agua de consumo suministrada por varios sistemas de abastecimiento de la provincia de Granada, en el √°rea de actuaci√≥n de la cohorte madres-hijos de la Red INMA (Infancia y Medio Ambiente. M√©todos: Se analizaron 82 muestras de agua de consumo en dos campa√Īas de muestreo en invierno y verano de 2006. Se determin√≥ la concentraci√≥n de cloroformo, bromodiclorometano, dibromoclorometano y bromoformo, siguiendo un procedimiento optimizado basado en cromatograf√≠a de gases y espectrometr√≠a de masas. Resultados: El rango de concentraci√≥n de trihalometanos totales se situ√≥ entre 0,14 y 18,75 őľg/l en la campa√Īa de invierno y entre 0,01 y 31,87 őľg/l en la de verano. El compuesto mayoritario fue cloroformo. La concentraci√≥n media de trihalometanos en agua de origen superficial y subterr√°neo fue de 10,13 y 1,41 őľg/l, respectivamente. Conclusiones: Los valores de trihalometanos encontrados son muy inferiores a la concentraci√≥n m√°xima admisible (100 őľg/l establecida por la UniŌÉn Europea para estos compuestos. Estos valores varőĹan significativamente segŌän el origen del agua, con mayores concentraciones en őĪreas urbana y semiurbana, donde el agua es mayoritariamente de origen superficial. La presencia de trihalometanos en la zona es menor a la descrita en otras regiones espaŌĀolas.Objectives: Drinking water chlorination generates potentially harmful by-products, such as trihalomethanes. Trihalomethane levels are high in some parts of Spain. The aim of the present study was to investigate trihalomethane concentrations in drinking water from distinct water supplies in the province of Granada, within the framework of the Childhood and Environment (INMA study. Methods: Eighty

  3. Evaluation of Petrifilm‚ĄĘ Select E. coli Count Plate medium to discriminate antimicrobial resistant Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jensen Lars

    2008-09-01

    Full Text Available Abstract Background Screening and enumeration of antimicrobial resistant Escherichia coli directly from samples is needed to identify emerging resistant clones and obtain quantitative data for risk assessment. Aim of this study was to evaluate the performance of 3M‚ĄĘ Petrifilm‚ĄĘ Select E. coli Count Plate (SEC plate supplemented with antimicrobials to discriminate antimicrobial-resistant and non-resistant E. coli. Method A range of E. coli isolates were tested by agar dilution method comparing the Minimal Inhibitory Concentration (MIC for eight antimicrobials obtained by Mueller-Hinton II agar, MacConkey agar and SEC plates. Kappa statistics was used to assess the levels of agreement when classifying strains as resistant, intermediate or susceptible. Results SEC plate showed that 74% of all strains agreed within ¬Ī 1 log2 dilution when comparing MICs with Mueller-Hinton II media. High agreement levels were found for gentamicin, ampicillin, chloramphenicol and cefotaxime, resulting in a kappa value of 0.9 and 100% agreement within ¬Ī 1 log2 dilution. Significant variances were observed for oxytetracycline and sulphamethoxazole. Further tests showed that the observed discrepancy in classification of susceptibility to oxytetracycline by the two media could be overcome when a plate-dependent breakpoint of 64 mg/L was used for SEC plates. For sulphamethoxazole, SEC plates provided unacceptably high MICs. Conclusion SEC plates showed good agreement with Mueller-Hinton II agar in MIC studies and can be used to screen and discriminate resistant E. coli for ampicillin, cephalothin, streptomycin, chloramphenicol, cefotaxime and gentamicin using CLSI standardized breakpoints, but not for sulphamethoxazole. SEC plates can also be used to discriminate oxytetracycline-resistant E. coli if a plate-dependent breakpoint value of 64 mg/L is used.

  4. EVALUACI√ďN POR M√ČTODO ECOM√ČTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  5. Los estudios de bot√°nica en los planes ilustrados del virreinato de la Nueva Granada

    OpenAIRE

    Arboleda, Luis Carlos; Soto Arango, Diana

    1995-01-01

    During the kingdoms of the New Granada, the first plan of teaching wich was presented by the botanical departament was made during the Viceroy Caballero y Góngora (1787). Later, beginning in the 19th century, during the political and ideological repression in the universities, the plans of the Baron Carondelet (1800) were presented with the idea of the creation of the Botanical Department in the University of Quito, and the creole Eloy Valenzuela presented the teaching of botanical studies in...

  6. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  7. Archaeometric characterization of Terra Sigillata Hispanica from Granada workshops

    Directory of Open Access Journals (Sweden)

    Aranda, M. A. G.

    2010-04-01

    Full Text Available Terra Sigillata was a Roman pottery, which was also produced in several workshops in Hispania. Two known workshops at Granada (Cartuja and Carmen de la Muralla, or Albayzin are known to have produced both typical Terra Sigillata and low-gloss coating related pottery. Potsherds from these workshops have been thoroughly studied from an archaeological approach, but not by analytical chemistry techniques. Here, we report a full characterization of nine selected samples from these workshops and also a tenth sample, Terra Sigillata made in the Gaul, for comparison. The pastes characterization includes elemental analysis from XRF and quantitative mineralogical analysis by Rietveld analysis of XRPD data. Cluster analysis to both types of data has been carried out. SEM-EDX and GI-XRPD have been used to characterize the slips of the pottery. The elemental analysis results for the pastes suggest that terra sigillata potsherds from both workshops were likely made from the same clay, different to that used to make the low-gloss coating pottery. The firing temperatures have been estimated from the phase assemblages being about 900-950¬ļC for the Granada sigillata.

    La Terra Sigillata fue una cerámica romana, que se produjo también en varios talleres en Hispania. Los talleres ubicados en Granada (Cartuja y Carmen de la Muralla, o Albayzín produjeron Terra Sigillata y cerámicas de barniz mate. Ambos talleres han sido ampliamente estudiados desde un punto de vista arqueológico, pero no mediante técnicas analíticas. En este trabajo, se estudian nueve muestras de estas producciones, y una décima de Terra Sigillata producida en la Galia, para su comparación. La caracterización de las pastas incluye análisis elemental por XRF, y análisis mineralógico cuantitativo mediante análisis de Rietveld de los datos de XRPD. Estos dos conjuntos de datos también se han evaluados mediante análisis de

  8. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucum√°n, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ¬≤-lactamase. A total of 96.5% of ¬≤-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 ¬Ķgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 ¬Ķgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 ¬Ķgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 ¬Ķgml-1 for cefoxitin, < 0.06 ¬Ķgml-1 for cefotaxime, < 0.25 ¬Ķgml-1 for norfloxacin, < 10 ¬Ķgml-1 for cephaloridine, < 10 ¬Ķgml-1 for cephalexin, and < 50 ¬Ķgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucum√°n, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucum√°n since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  9. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  10. Effectiveness of stone treatments in enhancing the durability of bioclastic calcarenite in (Granada, Spain

    Directory of Open Access Journals (Sweden)

    Sebasti√°n, E.

    2008-12-01

    Full Text Available Santa Pudia limestone, a biocalcarenite highly sensitive to decay, is one of the most commonly used building materials in historical monuments in the city of Granada, Spain. The compatibility between a variety of stone treatments (consolidants and/or water repellents and this calcarenite was analyzed and the resulting improvement in durability assessed. To this end, a two-stage accelerated ageing process was implemented. In the first, freshly quarried, undamaged specimens were altered to resemble the weathered stone in buildings. The second was conducted after applying the various treatments to the artificially aged stone to test their effectiveness. While all the treatments studied (Tegosivin HL100, Silo 111, Estel 1100 and Tegovakon V enhanced stone resistance to decay while barely affecting chromatic parameters, the most effective was Tegowakon V, as it provided the best results in the hydric tests on the limestone.La calcarenita de Santa Pudia es uno de los materiales rocosos de construcci√≥n m√°s empleados en las edificaciones monumentales de la ciudad de Granada (Espa√Īa. Se ha evaluado la compatibilidad de diversos productos de tratamiento (de consolidaci√≥n y/o hidrofugaci√≥n con esta calcarenita y como son capaces de mejorar su durabilidad. Para ello, se han realizado dos fases de envejecimiento acelerado: la primera ten√≠a el objetivo de acercar el material de cantera sin alterar (‚Äúsano‚ÄĚ a las condiciones reales del material puesto en obra y actualmente deteriorado; la segunda, efectuada despu√©s de aplicar los tratamientos sobre la calcarenita deteriorada, con el fin de determinar su grado de eficacia. Se ha podido comprobar que aunque, en general, todos los productos de tratamiento seleccionados (Tegosivin HL100, Silo 111, Estel 1100 y Tegovakon V mejoran las propiedades del material frente al deterioro y apenas modifican sus par√°metros crom√°ticos, el m√°s eficaz es el Tegovakon V ya que es el que proporciona mejores resultados

  11. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  12. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  13. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121¬įC dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  14. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  16. Biodeterioration of the Lions Fountain at the Alhambra Palace, Granada (Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Sarro, M. Isabel; Garcia, Ana M.; Rivalta, Victor M.; Moreno, Diego A. [Universidad Politecnica de Madrid, Escuela Tecnica Superior de Ingenieros Industriales, Jose Gutierrez Abascal, Madrid (Spain). Departamento de Ingenieria y Ciencia de los Materiales; Arroyo, Irene [Instituto del Patrimonio Historico Espanol, Ministerio de Cultura, El Greco, Madrid (Spain)

    2006-12-15

    Stone works of art exposed to the environment are liable to be deteriorated by the action of biological agents such as bacteria, fungi, mosses, etc. In ornamental fountains, the microorganisms present in water can contribute to these biodeterioration processes. This paper assesses the biodeterioration experienced by the Lions Fountain at the Alhambra Palace in Granada (Spain). Analyses have been made of the biodeterioration of Lions 4, 5 and 9, the biofouling of the fountain basin, and the water supply system. Conventional and molecular biology techniques have identified microorganisms belonging to various microbial groups ({alpha}-, {beta}- and {gamma}-Protebacteria, Chlamydiae/Verrucomicrobia and Eukaryota). Additionally, on the mortar in the sculptures the presence of algae and bryophytes has been observed. X-ray diffraction allowed both the detection of neoformation mineral products that can be related with the presence of microorganisms and the corrosion products in the Lions Fountain. A number of recommendations are made regarding the prevention and control of biodeterioration in this important work of art. (author)

  17. Bot√°nica y Medicina africanas en la Nueva Granada, Siglo XVII.

    Directory of Open Access Journals (Sweden)

    Luz Adriana Maya Restrepo.

    2000-06-01

    Full Text Available La relación que los bozales (africanos que llegaban directamente de Africa que no se expresaban en lengua castellana ni conocían la fe católica y sus hijos nacidos en la Nueva Granada mantuvieron con los vegetales y los animales, en particular las aves, es otro de los legados ancestrales que la nación colombiana le debe a Africa. Los africanos le transmitieron a sus descendientes saberes y técnicas sobre el mundo vegetal y animal. Estos conocimientos, que fueron utilizados para curar los males del cuerpo y los del alma, se caracterizaban por un componente experimental cuyo éxito dependía también de la interacción con los espíritus. De ahí que el Tribunal de la Inquisición de Cartagena hubiera juzgado a los africanos y a sus hijos en calidad de "brujos(as", "hechiceros(as" y "curanderos(as".

  18. Judeo-Conversos en la audiencia del Nuevo Reino de Granada. Siglos XVI y XVII.

    Directory of Open Access Journals (Sweden)

    Maria Cristina Navarrete.

    2002-06-01

    Full Text Available A large number of Portuguese ‚ÄúNew Christians‚ÄĚ (Jewish converts to Catholicism constituted one of the most important components of the white population of the Indies during the 16th and 17th centuries. They settled in various cities within the jurisdiction of the High Court of Justice of the New Kingdom of Granada, especially in Cartagena, where they occupied themselves in the slave trade and commerce in general. They extended their trade networks to and from the Viceroyalty of Peru and other provinces to the south of the New Kingdom. The Inquisition used its power to persecute them and to confiscate their property as a way to protect the purity of the faith and to sustain the institution economically. The New Christians were accused of secretly practicing the Jewish religion and of not being true Christians. Many of them were crypto-Jews who observed the Sabbath and Queen Esther‚Äôs feast day, observed Jewish fasting and dietary practices, and attended synagogue meetings. The most respected men among them acted as rabbis and orally transmitted their prayers and the few traditions remaining extant among them. As a result of both persecution by the Inquisition and the independence of Portugal in 1640, some of them returned to that country, while others scattered throughout the Caribbean and still others blended into the traditional Christian population.

  19. Music and gardens in Granada. Debussy and Forestier’s French mark in Spanish artistic creation

    Directory of Open Access Journals (Sweden)

    Laura Sanz García

    2018-01-01

    Full Text Available This article aims to delve into the aspects that connect both Spanish and French musicians and landscapers‚Äô works around the cultural image of Spain, as well as the importance of gardens in the visual inspiration of impressionist music. For that purpose, the text presents an analysis of the thematic and stylistic parallelisms between two outstanding French artists, the composer Claude Debussy and the landscape architect Jean-Claude Nicolas Forestier, in relation to the Arab-Andalusian exotism and, more specifically, to the gardens of Granada. To their common interest in representing the authentic essence of all that is Spanish, one should add the same avant-garde intention and a series of themes that translate into artistic terms their personal interpretation of Al-Andalus. On the other hand, the infl uence exercised by Debussy and Forestier on the Spanish artists ‚Äďsuch as Falla and Javier de Winthuysen‚Äď, relates France once more to the development of modern art and music in Spain. This interdisciplinary analysis reveals a common sensibility in the axis France Spain and between two artistic disciplines apparently uneven as music and gardening. Debussy and Forestier, as well as their Spanish ‚Äúdisciples‚ÄĚ, intend to overcome the romantic images of Spain, using the Hispano-Arabic clich√© to update their respective artistic languages, in music and landscape architecture, in the transition to the 20th century.

  20. Soil Properties Database of Spanish Soils. Volume VII.- Andalucia (b): Cadiz, Malaga, Granada y Almeria

    International Nuclear Information System (INIS)

    Trueba, C.; Millan, R.; Schmid, T.; Lago, C.; Roquero, C; Magister, M.

    1999-01-01

    The soil vulnerability determines the sensitivity of the soil after an accidental radioactive contamination due to Cs-137 and Sr-90. The Departamento de Impacto Ambiental de la Energia of CIEMAT is carrying out an assessment of the radiological vulnerability of the different Spanish soils found on the Iberian Peninsula. This requires the knowledge of the soil properties for the various types of existing soils. In order to achieve this aim, a bibliographical compilation of soil profiles has been made to characterize the different soil types and create a database of their properties. Depending on the year of publication and the type of documentary source, the information compiled from the available bibliography is very heterogeneous. Therefore, an important effort has been made to normalize and process the information prior to its incorporation to the database. This volume presents the criteria applied to normalize and process the data as well as the soil properties of the various soil types belonging to the provinces of Cadiz, Malaga, Granada and Almeria of the Comunidad Autonoma de Andalucia. (Author) 78 refs

  1. Comparison of the factors of the built environment influencing the decision to walk for short trips in two Spanish cities: Valencia and Granada

    Energy Technology Data Exchange (ETDEWEB)

    Ferrer, S.; Ruiz Sanchez, T.

    2016-07-01

    In this study, we use a qualitative methodology to identify and compare factors of the built environment influencing the decision to walk for short trips in two different Spanish cities: Valencia and Granada. Three focus groups were held in Valencia and two in Granada with participants who undertook, at least once a week, one short non-shopping trip in any travel mode (were ‚Äúshort trip‚ÄĚ is defined as less than 30-45 minutes walking distance). A thematic analysis of the data using the software QSR NVivo was performed after the transcription of the video recordings. Results show that participants perceive more facilitators to walking in Granada than in Valencia, explained by the smaller size of the former city and the driving restriction policy in the city centre of Granada for private cars. The main common barriers to walking in the two cities were: insecurity from crime (absence of people, a poor street lighting or walking along a conflictive are), a high density of traffic lights and walking along large avenues. In the city of Valencia, crossing multilane avenues and large-diameter roundabouts are deterrents to walking. In Granada, very steep streets motivate the use of alternative travel modes. (Author)

  2. The effectiveness of processed grapefruit-seed extract as an antibacterial agent: I. An in vitro agar assay.

    Science.gov (United States)

    Reagor, Lee; Gusman, Jean; McCoy, Lana; Carino, Edith; Heggers, John P

    2002-06-01

    Grapefruit-seed extract (GSE) Citricidal has, in recent reports, been reported to be successful in combating a variety of common infectious agents. In our study, drops of concentrated grapefruit-seed extract were tested for antibacterial properties against a number of gram-positive and gram-negative organisms. Sixty-seven (67) distinct biotypes were tested for their susceptibilities to the GSE as well as to 5 other topical antibacterials (Silvadene, Sulfamylon, Bactroban, Nitrofurazone, and Silvadene, Nystatin). Wells were punched into Mueller-Hinton agar plates, which were then inoculated with the organism to be tested; each well was then inoculated with one of the antibacterial agents. After an overnight incubation period, the plates were checked for zones of bacterial susceptibility around the individual wells, with a measured susceptibility zone diameter of 10 mm or more considered a positive result. The GSE was consistently antibacterial against all of the biotypes tested, with susceptibility zone diameters equal to or greater than 15 mm in each case. Our preliminary data thus suggest an antibacterial characteristic to GSE that is comparable to that of proven topical antibacterials. Although the GSE appeared to have a somewhat greater inhibitory effect on gram-positive organisms than on gram-negative organisms, its comparative effectiveness against a wide range of bacterial biotypes is significant.

  3. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  4. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  5. El liderazgo femenino en los cargos directivos: un estudio longitudinal en la Universidad de Granada (1990-2005 Women leading managerial positions: a longitudinal study at Universidad de Granada (1990-2005

    Directory of Open Access Journals (Sweden)

    Manuel Lorenzo Delgado

    2007-12-01

    Full Text Available La presencia de la mujer en los cargos directivos sigue siendo hoy uno de los grandes retos para este colectivo. En este art√≠culo se pretende mostrar esa realidad, a trav√©s de un estudio descriptivo realizado en la Universidad de Granada, sobre el n√ļmero de hombres y mujeres que desempe√Īan los cargos de m√°s alta representaci√≥n institucional, como pueden ser el de Decano/a, Secretario/a o, para el caso de los departamentos, el de Director/ a y el de Secretario/a, a trav√©s de la revisi√≥n de las memorias universitarias de cada curso acad√©mico, desde 1990 hasta el 2005. El estudio abarca, por una parte, una perspectiva diacr√≥nica, entendida como la evoluci√≥n seguida en los distintos centros o facultades de la Universidad de Granada, de la presencia femenina en los cargos directivos de los √ļltimos quince a√Īos. Por otra, partiendo de una visi√≥n sincr√≥nica, trata de centrarse de un modo m√°s espec√≠fico en analizar, con una mayor profundidad y precisi√≥n, la posici√≥n de la mujer en los cargos directivos de los diversos departamentos que integran la Facultad de Ciencias de Educaci√≥n.The presence of women at managerial positions continues being one of the biggest challenges for this group. In this article we intend to show that situation, through a descriptive research made at Universidad de Granada , Spain , with a group of men and women who have high institutional positions as Deans, First Secretaries, or Directors. We did this work by reviewing each students group's memories at the University, from 1990 until 2005. This study includes, on one hand, a diachronical perspective, understood as the evolution of all departments and faculties at Universidad de Granada with female presence in managerial positions during the last fifteen years. On the other hand, from a synchronic perspective, this research intends to focus specifically on women's situation in managerial positions at the various Departments that compose the Faculty of

  6. Research about the reasons why university students practice sport. The example of Granada University INVESTIGACI√ďN SOBRE LOS MOTIVOS POR LOS QUE LOS ESTUDIANTES UNIVERSITARIOS PRACTICAN DEPORTE. EL CASO DE LA UNIVERSIDAD DE GRANADA

    Directory of Open Access Journals (Sweden)

    J. Medina

    2010-09-01

    Full Text Available

    Through this paper, the motivation of Granada University¬īs students for the physical activity in the sport program of this organization has tried to be known. With this aim, fifty-five students who are participants in these activities were selected to complete a Lickert¬īs Scale with six factors and twenty-six items. Next to statistic analysis, the best factor chosen was "Fitness - Health", taking away importance to the aspects related with "Situacional Reasons" and "Self-realization". At the same time, sexual differences related with physical activity in these activities organized by Granada University were determined, verifying that girls value more the socializators and group practice aspects than boys.
    KEY WORDS: Motivation, physical activity, youngsters, university sports.

     

     

    A través de este trabajo se pretende conocer cuál es la motivación de los estudiantes de la Universidad de Granada por la actividad física dentro de las actividades deportivas organizadas por dicho organismo. Con este fin, se seleccionó una muestra de 50 jóvenes universitarios que realizan deporte dentro de estas actividades, empleando para ello una escala de opinión tipo Lickert con 6 categorías y 26 motivos hacia los cuales los cuestionados debían mostrar su grado de conformidad. Después del análisis estadístico, se comprobó cómo la categoría mejor puntuada fue la denominada como Forma Física -Salud, restando importancia a los aspectos relacionados con las Razones Situacionales y de Autorrealización. A su vez, se determinaron las diferencias en cuanto al sexo por la práctica deportiva en estas actividades organizadas por la Universidad de Granada, comprobando que las chicas valoran más los aspectos socializadores y de práctica en grupo que los chicos.
    PALABRAS CLAVE: Motivación, actividad física, jóvenes, deporte universitario

  7. El arzobispo don Pedro de Castro Cabeza de Vaca y Qui√Īones y la influencia del Sacro Monte en el desarrollo inmaculista en Granada.

    Directory of Open Access Journals (Sweden)

    José Antonio Peinado Guzmán

    2015-12-01

    Full Text Available The figure of archbishop don Pedro de Castro was extremely important for the development of immaculist devotion in Granada in the 16th century and beginning of the 17th century. In the wake of the famous discoveries of the Sacro Monte, it will produce an evolution of this belief in land Granada at the request of this prelate, who took the issue as one of his personal priorities in his episcopate. Intelligent handling of the issue by the Archbishop, while the findings of the Sacro Monte were subsequently convicted of Rome, eventually landing in the erection of the Abbey, in the ideological use of all of this, as well as the extension of the conceptionism in Granada.

  8. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  9. [The university stage does not favor the healthy life style in women students from Granada].

    Science.gov (United States)

    Gallardo-Escudero, Alba; Mu√Īoz Alf√©rez, Mar√≠a Jos√©; Planells del Pozo, Elena Mar√≠a; L√≥pez Aliaga, Inmaculada

    2014-11-15

    The university stage involves a series of emotional, physiological and environmental changes that will determine consumer patterns that, in many cases, will be maintained and will affect their health. The aim of this study is to analyze the lifestyle (alcohol and tobacco consumption, and levels of physical activity) of female students at the University of Granada. Several authors have noted that the student population is particularly vulnerable to develop risk customs and habits, since the period of university studies is often the time when students take first responsibility for determining their own styles and customs, which in many cases will be maintained throughout its entire life. This is a cross / descriptive and analytical study in which 55 students participated in two age groups (18-24 and 25-31 years). A lifestyle-questionnaire was applied to evaluate the type and frequency of alcohol consumption, number of cigarettes smoked daily and physical activity levels (sedentary, light, moderate and severe). Alcohol consumption is higher in the older group, and preferably drinks beer and wine; however the younger group shows a pattern of consumption centered on the weekends being preferably consumed distilled beverages. A third of the population smokes with an increase in the number of cigarettes as age increases. There is a positive correlation between snuff and alcohol. A direct positive correlation between tobacco and alcohol was observed. The 88.9% of lesser age group and 52.7% of higher age group show a sedentary-low physical activity. The need to sensitize the college female population on the benefits of no-consumption of alcohol and snuff, and regular physical exercise is suggested. It would also be advisable to develop protocols of educational intervention in universities promoting healthy living habits. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  10. Pharmaceutical ethnobotany in the western part of Granada province (southern Spain): ethnopharmacological synthesis.

    Science.gov (United States)

    Benítez, G; González-Tejero, M R; Molero-Mesa, J

    2010-05-04

    The aim of this work is to catalogue, document, and make known the uses of plants for folk medicine in the western part of the province of Granada (southern Spain). An analysis was made of the species used, parts of the plant employed, preparation methods, administration means, and the ailments treated in relation to pathological groups. The work was performed in 16 municipalities within the study zone. The participants were located mainly by questionnaires distributed in public and private centres. The information, gathered through semi-structured open interviews of a total of 279 people, was included in a database for subsequent analysis. A floristic catalogue of the territory was compiled, enabling analyses of the relevance of certain botanical families in popular medicine. Great diversity was established among medicinal species in the region. A total of 229 species of plants were catalogued for use in human medicine to prevent or treat 100 different health problems covering 14 different pathological groups. The number of references reached 1963. The popular pharmacopoeia of this area relies primarily on plants to treat digestive, respiratory, and circulatory problems, using mainly the soft parts of the plant (leaves and flowers) prepared in simple ways (decoction, infusion). An analysis of the medicinal ritual uses of 34 species and the different symptoms reflected a certain acculturation in relation to ethnobotanical knowledge in the last 20 years. The traditional knowledge of plants was shown in relation to medicinal use, reflecting a striking diversity of species and uses, as well as their importance in popular plant therapy in the study zone. These traditions could pave the way for future phytochemical and pharmacological studies and thereby give rise to new medicinal resources. (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  11. Evaluation of the Sensititre MycoTB plate for susceptibility testing of the Mycobacterium tuberculosis complex against first- and second-line agents.

    Science.gov (United States)

    Hall, Leslie; Jude, Kurt P; Clark, Shirley L; Dionne, Kim; Merson, Ryan; Boyer, Ana; Parrish, Nicole M; Wengenack, Nancy L

    2012-11-01

    The Sensititre MycoTB plate (TREK Diagnostic Systems, Cleveland, OH) uses a microtiter plate MIC format for susceptibility testing of Mycobacterium tuberculosis complex isolates against first- and second-line antituberculosis agents. Categorical agreement versus the agar proportion method for 122 M. tuberculosis complex isolates was 94% to 100%.

  12. Use of benzimidazole agar plates to assess fall armyworm (Lepidoptera: Noctuidae) feeding on excised maize and sorghum leaves

    Science.gov (United States)

    The fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) is an economically significant pest of sorghum and maize. To screen sorghum and maize germplasm for resistance to fall armyworm feeding, field, greenhouse, or lab bioassays are often utilized individually or in combinatio...

  13. La cocina de los venenos. Aspectos de la criminalidad en el Nuevo Reino de Granada, siglos XVII-XVIII

    OpenAIRE

    Ariza Martínez, Juan Sebastián

    2013-01-01

    Durante los siglos XVII y XVIII se presentaron varias querellas ante el Tribunal de Justicia Criminal del Nuevo Reino de Granada, en las que se denunciaba que había personas que ejercían los oficios médicos sin tener títulos que los acreditaran como facultativos en las artes curativas. Por ese entonces, se creía que quienes utilizaban yerbas y conjuros como métodos terapéuticos, por lo general mujeres, debían ser juzgadas como yerbateras-envenenadoras, porque no pretendían curar sino matar a ...

  14. The Vega of Granada in the late Middle Ages (XIV-XVI Centuries: almunias versus alquerías

    Directory of Open Access Journals (Sweden)

    Carmen Trillo San José

    2017-10-01

    Full Text Available Peri-urban areas of cities in Al-Andalus was a very diverse rural habitat.¬†Aristocratic property was present in these environments and has received little attention. Indeed, we know very little about the elites of Al-Andalus in comparison to those of other western medieval¬†countries. In this study we have examined the hinterland of the city of Granada during the NaŠĻ£rid era (XIV-XV centuries, paying special attention to two features of the distribution of its population:¬†alquer√≠as¬†(villages, settlements of the rural community par excellence, and¬†almunias¬†or aristocatic estates.

  15. Guerra, imperio y violencia en la Audiencia de Santa Fe, Nuevo Reino de Granada, 1580-1620

    OpenAIRE

    Córdoba Ochoa, Luis Miguel

    2013-01-01

    Programa de Doctorado en Estudios sobre Europa, el Mundo Mediterr√°neo y su Difusi√≥n Atl√°ntica: √Člites y Procesos de Convergencia Cultural y Econ√≥mica, 1450-1900 En la tesis se analizan los procesos mediante los cuales los espa√Īoles adquirieron, construyeron y reinterpretaron los conocimientos sobre la poblaci√≥n ind√≠gena y sobre los recursos de los territorios bajo la jurisdicci√≥n de la Audiencia de Santa Fe -hoy Bogot√°-, en el Nuevo Reino de Granada durante el siglo XVI, con el prop√≥sito d...

  16. Catalogue of type specimens of fungi and lichens deposited in the Herbarium of the University of Granada (Spain).

    Science.gov (United States)

    Vizoso, M Teresa; Quesada, Carmen

    2015-01-01

    A catalogue of types from the Herbarium of the University of Granada has not previously been compiled. As a result, a search of these collections in order to compile digital images for preservation and publication yielded a large number of formerly unrecognized types. This dataset contains the specimen records from the catalogue of the nomenclature types of fungi and lichens in the Herbarium of the University of Granada, Spain. These herbarium specimens are included in the GDA and GDAC collections, acronyms from Index Herbariorum (Thiers 2014). At this time, the type collection of fungi and lichens contains 88 type specimens of 49 nominal taxa, most from Agaricales and the genus Cortinarius, described from the western Mediterranean, mainly Spain, by the following authors: V.Antonin, J.Ballar√†, A.Bidaud, G.F.Bills, M.Bon, C.Cano, M.Casares, G.Chevassut, M.Contu, F.Esteve-Ravent√≥s, R.Gal√°n, L.Guzm√°n-D√°valos, R.Henry, E.Horak, R.Mahiques, G.Malen√ßon, P.Mo√ęnne-Loccoz, G.Moreno, A.Ortega, F.Palaz√≥n, V.N.Su√°rez.-Santiago, A.V√™zda, J.Vila, and M.Villareal. For each specimen, the locality indication, species name, observation date, collector, type status, related information, associated sequences, other catalogue numbers related to each type, and image URL are recorded. The dataset is associated with an image collection named "Colecci√≥n de im√°genes de los tipos nomenclaturales de hongos, l√≠quenes, musgos y algas incluidos en el Herbario de la Universidad de Granada (GDA y GDAC)" (Vizoso and Quesada 2013) which is housed and accessible at the Global Biodiversity Information Facility in Spain (GBIF.ES) Hosting and Publishing Service "Biodiversity Image Portal of Spanish collections" and is also available at the Herbarium of University of Granada institutional web (Vizoso 2014a, Vizoso 2014b). That image collection contains 113 images, of which 56 correspond to the nomenclature types of 49 taxa (47 fungi, 2 lichens), the rest of the images in this collection

  17. El status actual de las ecoescuelas: el caso de la provincia de Granada (Espa√Īa)

    OpenAIRE

    Perales-Palacios, F. J.; Burgos-Peredo, O.; Gutiérrez-Pérez, J.

    2013-01-01

    La preocupaci√≥n progresiva por la sostenibilidad de las organizaciones sociales representa hoy un factor de calidad de la madurez institucional de un pa√≠s. Las ecoauditor√≠as ambientales son un ejemplo de buenas pr√°cticas ambientales en los centros educativos. En esta comunicaci√≥n se analiza la aplicaci√≥n de estas metodolog√≠as al campo de la planificaci√≥n y gesti√≥n escolar. La implantaci√≥n del Programa a 21 ecoescuelas de la Provincia de Granada se eval√ļa mediante un dise√Īo de investigaci√≥n cu...

  18. El status actual de las ecoescuelas : el caso de la provincia de Granada (Espa√Īa)

    OpenAIRE

    Perales Palacios, F. Javier

    2013-01-01

    La preocupaci√≥n progresiva por la sostenibilidad de las organizaciones sociales representa hoy un factor de calidad de la madurez institucional de un pa√≠s. Las ecoauditor√≠as ambientales son un ejemplo de buenas pr√°cticas ambientales en los centros educativos. En esta comunicaci√≥n se analiza la aplicaci√≥n de estas metodolog√≠as al campo de la planificaci√≥n y gesti√≥n escolar. La implantaci√≥n del Programa a 21 ecoescuelas de la Provincia de Granada se eval√ļa mediante un dise√Īo de investigaci√≥n cu...

  19. Entre el Rey y la comunidad: el agua del Albayzín (Granada) en la Edad Media

    OpenAIRE

    Trillo, Carmen

    2012-01-01

    En este trabajo analizamos una acequia medieval, la de Aynadamar, utilizada en época andalusí en la ciudad de Granada, desde el punto de vista histórico. Hace¬mos hincapié en un anáfisis social, estudiando sus orígenes, forma de organización, objetivos a los que atendía y mantenimiento. Para ello se ha utilizado tanto docu¬mentación editada como inédita, en árabe romanceada y en castellano, perteneciente a archivos locales y nacionales. Del estudio puede concluirse que, seguramente entre el s...

  20. Radiation shielding plate

    International Nuclear Information System (INIS)

    Kobayashi, Torakichi; Sugawara, Takeo.

    1983-01-01

    Purpose: To reduce the weight and stabilize the configuration of a radiation shielding plate which is used in close contact with an object to be irradiated with radiation rays. Constitution: The radiation shielding plate comprises a substrate made of lead glass and a metallic lead coating on the surface of the substrate by means of plating, vapor deposition or the like. Apertures for permeating radiation rays are formed to the radiation shielding plate. Since the shielding plate is based on a lead glass plate, a sufficient mechanical strength can be obtained with a thinner structure as compared with the conventional plate made of metallic lead. Accordingly, if the shielding plate is disposed on a soft object to be irradiated with radiation rays, the object and the plate itself less deform to obtain a radiation irradiation pattern with distinct edges. (Moriyama, K.)

  1. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  2. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  3. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  4. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (őĒH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (őĒH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  5. Carcass Characteristics of the Libyan Purebred Mahali Goat and their Crosses with Damascus and Morcia Granada Goats

    Directory of Open Access Journals (Sweden)

    Abdelkareem E. Ahtash

    2010-01-01

    Full Text Available This study was conducted to evaluate the carcass characteristics of Mahali (M, Damascus (D and Morcia Granada (G goats and their crosses. Live weight, carcass weight, dressing-out %, rib eye muscle area, non-carcass components and kidney fat were measured. The results showed significant superiority of Damascus goats in live weight (65.8 kg, carcass weight (34.3 kg, dressing-out %( 52.1%, rib eye muscle areas (22.7 cm¬≤ over the Mahali and Morcia Granada goats. The crossbred group (1/2 M “≥ 1/2 D was superior in live weight (50 kg, carcass weight (24.2kg, dressing-out %( 48.4%, and rib eye muscle area (21.2cm¬≤ over other crossbreds. The crossbred group (3‚ĀĄ4D “≥ 1‚ĀĄ4M was superior in live weight (61.7kg, carcass weight (31 kg and rib eye muscle area (21.3cm¬≤ over the other 3‚ĀĄ4 crossbreds. This study indicated that crossing between Mahali “≥ Damascus breed was beneficial for increasing live weight, carcass weight and meat production.

  6. Atmospheric composition and micro-climate in the Alhambra monument, Granada (Spain), in the context of preventive conservation

    International Nuclear Information System (INIS)

    Horemans, B; Schalm, O; De Wael, K; Van Grieken, R; Cardell, C

    2012-01-01

    The world famous Alhambra monument in Granada, Southern Spain, listed as UNESCO world cultural heritage since 1984, represents probably the most beautiful example of Islamic art and architecture from the Middle Ages in Europe. It is visited by ca. 2 million people annually. Granada is situated in a natural basin, surrounded by mountains with altitudes up to 3500 m. Due to this topography and the prevailing low wind speeds, pollution-derived and especially traffic-derived particulate matter often accumulates in the urban air. In order to evaluate the potential conservation risks from the surrounding air, the atmospheric composition in the Alhambra monument was evaluated. Indoor temperature and relative humidity fluctuations were evaluated for their potential degenerative effects. Furthermore, the atmospheric composition in the Alhambra was analyzed in terms of inorganic gases (NO 2 , SO 2 , O 3 , and NH 3 ) and black carbon. It was found that the open architecture protected the indoor environments from developing a potentially harmful microclimate, such as the build-up of humidity resulting from the huge number of daily tourists. On the downside, the strong ventilation made the indoor air hardly different from outdoor air, as characterized by strong diurnal temperature and relative humidity gradients and high traffic-derived pollutant levels.

  7. Atmospheric composition and micro-climate in the Alhambra monument, Granada (Spain), in the context of preventive conservation

    Science.gov (United States)

    Horemans, B.; Schalm, O.; De Wael, K.; Cardell, C.; Van Grieken, R.

    2012-07-01

    The world famous Alhambra monument in Granada, Southern Spain, listed as UNESCO world cultural heritage since 1984, represents probably the most beautiful example of Islamic art and architecture from the Middle Ages in Europe. It is visited by ca. 2 million people annually. Granada is situated in a natural basin, surrounded by mountains with altitudes up to 3500 m. Due to this topography and the prevailing low wind speeds, pollution-derived and especially traffic-derived particulate matter often accumulates in the urban air. In order to evaluate the potential conservation risks from the surrounding air, the atmospheric composition in the Alhambra monument was evaluated. Indoor temperature and relative humidity fluctuations were evaluated for their potential degenerative effects. Furthermore, the atmospheric composition in the Alhambra was analyzed in terms of inorganic gases (NO2, SO2, O3, and NH3) and black carbon. It was found that the open architecture protected the indoor environments from developing a potentially harmful microclimate, such as the build-up of humidity resulting from the huge number of daily tourists. On the downside, the strong ventilation made the indoor air hardly different from outdoor air, as characterized by strong diurnal temperature and relative humidity gradients and high traffic-derived pollutant levels.

  8. [Life style and monitoring of the dietary intake of students at the Melilla campus of the University of Granada].

    Science.gov (United States)

    Navarro-Prado, Silvia; González-Jiménez, Emilio; Montero-Alonso, Miguel A; López-Bueno, Marta; Schmidt-RioValle, Jacqueline

    2015-06-01

    University students represent a social group at risk, from the nutrionally point of view because they usually have inappropiate nutritional habits and lifestyle. Analize the students' lifestyle from the Campus of University of Granada in Melilla. Analize the evolution of the eating habits of these students during the academic year 2013-2014. A longitudinal study was carried out during the academic year 2013-2014, the lifestyle was evaluated and, in a ongoing way, the eating habits in a representative sample of 257 students, 90 men (35%) and 167 women (65%), all of them from the campus of University of Granada in Melilla. The results get worst as the academic year progresses and they are characterized by a significant reduction (p sedentary lifestyle. As the academic year progresses, the students' eating habits get worst distance from the Mediterranian Diet pattern with the consequent risk at the development of cardiovascular diseases and metabolism disorder. So, it is necesary to get into these results in order to identify the influential factors in their eating habits and take the appropiate actions. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  9. Create Your Plate

    Medline Plus

    Full Text Available ... foods you want, but changes the portion sizes so you are getting larger portions of non-starchy ... plate. Then on one side, cut it again so you will have three sections on your plate. ...

  10. Create Your Plate

    Medline Plus

    Full Text Available ... of the differences in types of vegetables. When creating your plate at home, remember that half of ... effective for both managing diabetes and losing weight. Creating your plate lets you still choose the foods ...

  11. Create Your Plate

    Medline Plus

    Full Text Available ... Index Low-Calorie Sweeteners Sugar and Desserts Fitness Exercise & Type 1 Diabetes Get Started Safely Get And ... Plate Create Your Plate is a simple and effective way to manage your blood glucose levels and ...

  12. Create Your Plate

    Medline Plus

    Full Text Available ... Meals Diabetes Meal Plans Create Your Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with ... Your Plate Meal Planning for Vegetarian Diets Gluten Free Diets Holiday Meal Planning Cook with Heart-Healthy ...

  13. Create Your Plate

    Medline Plus

    Full Text Available ... Your Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with Heart-Healthy Foods Holiday Meal ... Healthy Diet Create Your Plate Meal Planning for Vegetarian Diets Gluten Free Diets Holiday Meal Planning Cook ...

  14. Microbial monitoring in treated stone at the Royal Chapel of Granada

    Science.gov (United States)

    Jroundi, Fadwa; Pinar, Guadalupe; Gonz√°lez-Mu√Īoz, Maria Theresa; Sterflinger, Katja

    2014-05-01

    Biomineralization processes have been applied in situ to protect and consolidate decayed ornamental stone of the Royal Chapel in Granada (Spain). In few years, this conservation treatment has gained worth attention as environmentally friendly methodology for protection and consolidation of limestone because of the compatibilities shown between the new calcium carbonate cement and the original stone substrate. Moreover, the success of this approach may be related to the diversity of the microbiota inhabiting the stone and activated upon the biotreatment application and throughout the time. Gonz√°lez-Mu√Īoz et al. (2008) proposed a nutritional solution that activate among the bacteria inhabiting the stone those with carbonatogenic activity. In this study, a long-term (one, two and three years) monitoring of the microbiota present on the treated and untreated stones was done using a molecular strategy, including total DNA extraction, PCR amplification of 16S rRNA sequences, construction of clone libraries and fingerprinting by DGGE (Denaturing Gradient Gel Electrophoresis) analysis. Sequencing of the 16S rDNA revealed the dominant occurrence of members of Actinobacteria (44.20%), Gamma-proteobacteria (30.24%) and Chloroflexi (25.56%) after one year of the biotreatment. Whereas after two years, members of Cyanobacteria (22.10%) appeared and three years after, the microbiota consisted of only Actinobacteria and Cyanobacteria with approximately the same percentage in comparison with the untreated stones, dominated exclusively by Actinobacteria (100%). Fungal diversity followed the same dynamic as bacterial diversity being Ascomicota the predominant order before treatment. After one year, members of Basidiomycota and Viridiplantae appeared on the stone while two years after, the Viridiplantae dominated with a percentage of 84.77%. Finally, three years after the treatment, fungi population started to stabilize again and Ascomicota predominated next to 16.67% of

  15. ¬ŅQui√©n es mestizo? Descifrando la mezcla racial en El Nuevo Reino de Granada, siglos XVI y XVII Quem √© mesti√ßo? Decifrando a mistura racial no Novo Reino de Granada, s√©culos XVI e XVII Who is mestizo? Discussing race mixture in Nova Granada Realm, XVI and XVII centuries

    Directory of Open Access Journals (Sweden)

    Joanne Rappaport

    2009-06-01

    Full Text Available Muito da literatura sobre misturas raciais na Am√©rica Hisp√Ęnica colonial baseia-se em categorias anal√≠ticas tais como √≠ndio, negro, mesti√ßo, mulato e espanhol, que aparecem nos documentos arquiv√≠sticos. Ao utilizar v√°rios casos dos s√©culos dezesseis e dezessete do Novo Reino de Granada (hoje, Col√īmbia, este artigo explora a instabilidade destas categorias, principalmente das intermedi√°rias, e em que extens√£o elas s√£o objeto de negocia√ß√£o social.Most of the literature on racial mixing in colonial Spanish America takes at face value the categories - indio, negro, mestizo, mulato, espa√Īol - that appear in archival documents. Using a series of sixteenth- and seventeenth-century cases from the Nuevo Reino de Granada (today, Colombia, this article explores the instability of these categories, particularly of the intermediate ones, and the extent to which they are subject to social negotiation.

  16. Acerca de la contribuci√≥n militar de la Junta General de la provincia de Guip√ļzcoa a la Guerra de Granada en 1484

    Directory of Open Access Journals (Sweden)

    García Fernández, Ernesto

    2010-12-01

    Full Text Available The Guipuzcoans participated with their militias and their armed men in the war against Granada waged by the Catholic Monarchs Isabella and Ferdinand, from their ascension to the throne of the Crown of Castile to the conquest of the Muslim kingdom of Granada in 1492. In this paper we look into how several requests were made from the Province of Guipuzcoa for several ships with their respective armed crews in order to control the different points of access to the Strait of Gibraltar, on the one hand, and, on the other hand, we examine the replies given by the representatives of the Province councils after the Board Meeting at Usarraga.

    Los guipuzcoanos participaron con sus milicias y hombres armados en la Guerra de Granada auspiciada por los Reyes Cat√≥licos, Isabel y Fernando, desde su ascenso al trono de la Corona de Castilla hasta la conquista del reino nazar√≠ en 1492. En este art√≠culo se estudian por una parte las demandas a la Provincia Guip√ļzcoa de varias embarcaciones con sus respectivas tripulaciones armadas para controlar los accesos a Granada a trav√©s del Estrecho de Gibraltar y por otra las diversas respuestas dadas por los procuradores generales de los concejos de la Provincia, reunidos en la Junta General de Usarraga.

  17. Actions and Achievements of Self-Regulated Learning in Personal Environments. Research on Students Participating in the Graduate Program in Preschool Education at the University of Granada

    Science.gov (United States)

    Chaves-Barboza, Eduardo; Trujillo-Torres, Juan Manuel; L√≥pez-N√ļ√Īez, Juan Antonio; Sola-Mart√≠nez, Tom√°s

    2017-01-01

    This paper is intended to study the self-regulated learning (SRL) process in personal learning environments (PLEs) among students participating in the Graduate Program for Preschool Education at the University of Granada (Spain). The study is focused on self-regulatory actions carried out by students, and on their self-regulated learning…

  18. Desenvolvimento floral e produ√ß√£o de pessegueiros 'granada' sob distintas condi√ß√Ķes clim√°ticas

    Directory of Open Access Journals (Sweden)

    Gilmar Ant√īnio Nava

    2011-06-01

    Full Text Available A cultivar de pessegueiro 'Granada' vem apresentando baixa frutifica√ß√£o e irregularidade de produ√ß√£o nas principais regi√Ķes produtoras de p√™ssego no Estado do Rio Grande do Sul. Este trabalho teve como objetivo comparar o desenvolvimento floral e a produ√ß√£o de pessegueiros 'Granada' em duas regi√Ķes com distintas condi√ß√Ķes clim√°ticas. Os pomares estudados, nas safras de 2004 e 2005, localizam-se nos munic√≠pios de Charqueadas e Cangu√ßu, nas regi√Ķes Depress√£o Central e Sul do RS, respectivamente. Conclui-se que o pessegueiro 'Granada' mostra-se muito inst√°vel em termos de produ√ß√£o. A baixa produ√ß√£o e a viabilidade do p√≥len, aliada ao atraso no desenvolvimento dos √≥vulos, influenciadas sobretudo pela ocorr√™ncia de altas temperaturas na pr√©-flora√ß√£o e flora√ß√£o, foram as principais causas do baixo desempenho reprodutivo e produtivo do pessegueiro 'Granada' em Charqueadas, em 2004, e em Cangu√ßu, em 2005.

  19. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that¬† the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g ‚Äď 35.76 g/100 g, color intensity L*, a*, b* with őĒE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  20. Selective vs. nonselective media and direct plating vs. enrichment technique in isolation of Vibrio cholerae: recommendations for clinical laboratories.

    Science.gov (United States)

    Rennels, M B; Levine, M M; Daya, V; Angle, P; Young, C

    1980-09-01

    The occurrence of human cholera along the Gulf of Mexico and the isolation of Vibrio cholerae O1 from the Gulf and Chesapeake Bay make it imperative that microbiology laboratories along estuaries develop the capabilities to culture for these pathogens. In attempts to devise a simplified but efficient culture procedure, a selective medium, thiosulfate-citrate-bile salts-sucrose (TCBS) agar, was compared with a nonselective medium, gelatin agar (GA), and the utility of enrichment was examined. TCBS agar detected 99% of the stools found to be positive by all techniques combined, whereas GA identified only 80%. Of acute diarrheal stools, 96% were positive on direct plating, whereas only 66% of formed stools containing V. cholerae were detected by direct plating. Stools from patients with acute diarrhea can be plated directly into TCBS agar alone; stools from persons shedding low numbers of organisms (such as contacts, carriers, or patients receiving antibiotics) should be incubated first in an enrichment broth and then on TCBS agar.

  1. Dengue in Grenada El dengue en el país de Granada

    Directory of Open Access Journals (Sweden)

    André Panagos

    2005-04-01

    Full Text Available OBJECTIVES: Dengue fever is endemic in the country of Grenada and is grossly underreported as a source of morbidity. The goal of this study was to assess the status of dengue fever in a representative community in Grenada. METHODS: Surveys were conducted in the Mont Tout/Grand Anse Valley area in the parish of St. George's from March to June 1996. The objectives of the survey were to: (1 to assess the knowledge, attitudes, and practices (KAP of residents; (2 to determine the presence of larval and adult Aedes aegypti and their potential breeding sites; and (3 to identify the seroprevalence of specific immunoglobulin G (IgG dengue antibodies in the local population. RESULTS: Out of the 102 respondents to the KAP survey, 100 of them (98% reported never having had dengue fever. Of the 75 persons who agreed to have blood samples taken, 70 of them (93% (95% confidence interval = 85.1%-97.8% tested positive with the IgG enzyme-linked immunosorbent assay, indicating past exposure. In terms of water storage, 98 of 102 respondents (96% stored fresh water in containers. The vector survey found 57 of the 102 households (56% had Ae. aegypti larvae in water containers on their property, and 94 of 102 dwellings (92% had adult Ae. aegypti mosquitoes indoors. CONCLUSIONS: Although many people were familiar with dengue fever and mosquitoes, the 1996 survey found that their knowledge of the important relationships among mosquitoes, human behavior, and disease transmission was incomplete. Since 1996, continued education efforts have been made in the public school system and with national public health campaigns, yet little effort has been specifically targeted towards our study community. These data suggest Grenada has a need for continued community education that addresses dengue fever transmission and Ae. aegypti reduction.OBJETIVOS: La fiebre del dengue es end√©mica en el pa√≠s caribe√Īo de Granada y es grande su subnotificaci√≥n como fuente de morbilidad. El

  2. Analytical study of the main door of Santiago church, Guadix, Granada

    Directory of Open Access Journals (Sweden)

    Espinosa Gait√°n, Jes√ļs

    1995-06-01

    Full Text Available The analytical study described on this paper has been made due to the request formulated by the priest of Santiago church, D. José Mª Ballesteros, through the Provincial Delegation of Culture of Granada. In view of the degradation of the main door front, the Instituto Andaluz del Patrimonio Histórico has been asked for technical advice on the possible treatment to be carried out to resolve the problems of this front. As a part of the technical study we have carried out the analysis required to determine the characteristics of the stone used, the possible causes of weathering and to evaluate the most adequate treatment products, in case that it is convenient to apply any one as a part of the conservation restoration works. As a first step we have carried out a visual inspection of the door front and the inside of the church, and then samples have been taken. These samples have been analyzed by means of: chemical analysis of main components, X Ray diffraction, mineralogic petrographic study and SEM observation. From all these determinations it has been deduced the possible causes and mechanisms of alteration. As previous phase to the evaluation of treatments, due to the high quantity of stone needed to make all the tests, we have proceeded to identify and find the quarry of origin of this stone; it is located in Bácor, a little village on the municipal term of Guadix, at 40 Km from it. Once the identification has been made with certainty, enough material has been extracted to prepare the samples used. It is very interesting to study this stone because it has been employed also on the Cathedral of Guadix and it will be able to extend the results obtained on the tests to this building.

    El estudio analítico recogido en el presente artículo se realiza como respuesta a la petición formulada por el párroco de la iglesia de Santiago, D. José Mª Ballesteros, a través de la Delegación Provincial de Cultura de Granada. Ante el estado de

  3. Macroscopical morphology of deterioration of the stone used in the cathedral whole of Granada/Spain

    Directory of Open Access Journals (Sweden)

    Alcalde, M.

    1992-06-01

    Full Text Available The main factors of deterioration that affect the Cathedral Whole of Granada are one of natural thermic origin due to the low temperatures during the winters and the higher thermic oscillations and those of anthropogenical origin: fundamentally the oxidation of metallic elements and atmospheric pollution due to burnt products. For this reason, the more important deterioration mechanisms are the freezing ones due to the expansion produced in the water retained inside the pores and microcracks, fundamentally in the architectonic elements with high expositional surface and in their shady orientation; the main indicators produced are fissuring and spalling. In this way, a lot of elements of Santa Pudia stone located in the Royal Chapel crenellations have disappeared and the rest are very deteriorated. The more compact Sierra Elvira stone used on the upper zone of the cornices has also been affected by the freezing mechanism, which starts with the microcracks produced by differential dilatations due to the thermic oscillations which made the water access easy. The iron corrosion and later expansion of the oxidation products has provoked the cracking and fissuring of many ornamental elements like balls, pinnacles, etc, and this situation has obliged their dismantling on the upper zones due to the danger to the public. The mechanisms of dissolution, crystallization cycles and Chemical action have led to abundant material loosening in the form of grain disgregations overcoats on the higher humidity zones, and formation of hollows (pitting, alveolar erosion, striations in the zones more exposed to the winds. This situation is generalized in the lower zones of the monument, except on the main facade, and in the parapets and lower zones of the cornices. The grain disgregations are more important when biological crusts or unburned deposits exist, the latter being of major abundance on the surfaces near the Gran Vía and in its orientation. It is necessary

  4. Paper microzone plates.

    Science.gov (United States)

    Carrilho, Emanuel; Phillips, Scott T; Vella, Sarah J; Martinez, Andres W; Whitesides, George M

    2009-08-01

    This paper describes 96- and 384-microzone plates fabricated in paper as alternatives to conventional multiwell plates fabricated in molded polymers. Paper-based plates are functionally related to plastic well plates, but they offer new capabilities. For example, paper-microzone plates are thin (approximately 180 microm), require small volumes of sample (5 microL per zone), and can be manufactured from inexpensive materials ($0.05 per plate). The paper-based plates are fabricated by patterning sheets of paper, using photolithography, into hydrophilic zones surrounded by hydrophobic polymeric barriers. This photolithography used an inexpensive formulation photoresist that allows rapid (approximately 15 min) prototyping of paper-based plates. These plates are compatible with conventional microplate readers for quantitative absorbance and fluorescence measurements. The limit of detection per zone loaded for fluorescence was 125 fmol for fluorescein isothiocyanate-labeled bovine serum albumin, and this level corresponds to 0.02 the quantity of analyte per well used to achieve comparable signal-to-noise in a 96-well plastic plate (using a solution of 25 nM labeled protein). The limits of detection for absorbance on paper was approximately 50 pmol per zone for both Coomassie Brilliant Blue and Amaranth dyes; these values were 0.4 that required for the plastic plate. Demonstration of quantitative colorimetric correlations using a scanner or camera to image the zones and to measure the intensity of color, makes it possible to conduct assays without a microplate reader.

  5. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (őĶ'), loss factor (őĶ"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 ¬įC. The őĶ' and őĶ" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m ¬įC, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 ¬įC in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. ¬© 2015 Institute of Food Technologists¬ģ

  6. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 őľg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright ¬© 2013 Elsevier Ltd. All rights reserved.

  7. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  9. Thin-layer agar (TL7H11 for rapid isolation of Mycobacterium tuberculosis in sputum specimens

    Directory of Open Access Journals (Sweden)

    Habiba Binte Alam

    2016-08-01

    Full Text Available Background: Tuberculosis (TB remains one of the major causes of death from a single infectious agent worldwide. The early detection of new cases of pulmonary tuberculosis is an important goal in tuberculosis control program.Objective: 1n this study, thin layer agar (TLA culture was compared with Lowenstein-Jensen (LJ culture for rapid detection of pulmonary tuberculosis. Methods: It was a cross sectional study conducted in National Tuberculosis Reference Labora¬≠tory (NTRL of National Institute of Disease of Chest and Hospital (NIDCH, Dhaka, from July 2010 to June 2011. A total of 100 sputum smear positive for acid fast bacilli (AFB by Z-N staining, pulmonary tuberculosis patients were included in this study. Samples were processed by modified Petroff method and then cultured on thin layer 7H11(TL7H11 plates and L-J tubes. TL7H11 plates were observed microscopically for rnicrocolony growth once a week for 6 weeks, and L-J tubes were observed once a week for 8 weeks. Results: The recovery rates of mycobacteria on only TLA, only LJ and on both media were 90%, 97% and 88% respectively. Overall positivity was 99% in both L-J and TLA media. Mean time for detection of mycobacteria on TLA was 9.04¬Ī1.66 days compared to 21.78¬Ī6.19 days on L-J media. The rate of contamination was higher (6% in L-J media than in TLA media (4%. Conclusion: The TL7H11 media can be used as an alternative to the Lowenstein-Jensen medium for early isolation of mycobacteria in resource constrained settings.

  10. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  11. Thermal, mechanical, and physical properties of seaweed/sugar palm fibre reinforced thermoplastic sugar palm Starch/Agar hybrid composites.

    Science.gov (United States)

    Jumaidin, Ridhwan; Sapuan, Salit M; Jawaid, Mohammad; Ishak, Mohamad R; Sahari, Japar

    2017-04-01

    The aim of this research is to investigate the effect of sugar palm fibre (SPF) on the mechanical, thermal and physical properties of seaweed/thermoplastic sugar palm starch agar (TPSA) composites. Hybridized seaweed/SPF filler at weight ratio of 25:75, 50:50 and 75:25 were prepared using TPSA as a matrix. Mechanical, thermal and physical properties of hybrid composites were carried out. Obtained results indicated that hybrid composites display improved tensile and flexural properties accompanied with lower impact resistance. The highest tensile (17.74MPa) and flexural strength (31.24MPa) was obtained from hybrid composite with 50:50 ratio of seaweed/SPF. Good fibre-matrix bonding was evident in the scanning electron microscopy (SEM) micrograph of the hybrid composites' tensile fracture. Fourier transform infrared spectroscopy (FT-IR) analysis showed increase in intermolecular hydrogen bonding following the addition of SPF. Thermal stability of hybrid composites was enhanced, indicated by a higher onset degradation temperature (259¬įC) for 25:75 seaweed/SPF composites than the individual seaweed composites (253¬įC). Water absorption, thickness swelling, water solubility, and soil burial tests showed higher water and biodegradation resistance of the hybrid composites. Overall, the hybridization of SPF with seaweed/TPSA composites enhances the properties of the biocomposites for short-life application; that is, disposable tray, plate, etc. Copyright ¬© 2017 Elsevier B.V. All rights reserved.

  12. Effect of seaweed on mechanical, thermal, and biodegradation properties of thermoplastic sugar palm starch/agar composites.

    Science.gov (United States)

    Jumaidin, Ridhwan; Sapuan, Salit M; Jawaid, Mohammad; Ishak, Mohamad R; Sahari, Japar

    2017-06-01

    The aim of this paper is to investigate the characteristics of thermoplastic sugar palm starch/agar (TPSA) blend containing Eucheuma cottonii seaweed waste as biofiller. The composites were prepared by melt-mixing and hot pressing at 140¬įC for 10min. The TPSA/seaweed composites were characterized for their mechanical, thermal and biodegradation properties. Incorporation of seaweed from 0 to 40wt.% has significantly improved the tensile, flexural, and impact properties of the TPSA/seaweed composites. Scanning electron micrograph of the tensile fracture showed homogeneous surface with formation of cleavage plane. It is also evident from TGA results that thermal stability of the composites were enhanced with addition of seaweed. After soil burial for 2 and 4 weeks, the biodegradation of the composites was enhanced with addition of seaweed. Overall, the incorporation of seaweed into TPSA enhances the properties of TPSA for short-life product application such as tray, plate, etc. Copyright ¬© 2017 Elsevier B.V. All rights reserved.

  13. The use of antibiotics to improve phage detection and enumeration by the double-layer agar technique

    Directory of Open Access Journals (Sweden)

    Ferreira Eugénio C

    2009-07-01

    Full Text Available Abstract Background The Double-Layer Agar (DLA technique is extensively used in phage research to enumerate and identify phages and to isolate mutants and new phages. Many phages form large and well-defined plaques that are easily observed so that they can be enumerated when plated by the DLA technique. However, some give rise to small and turbid plaques that are very difficult to detect and count. To overcome these problems, some authors have suggested the use of dyes to improve the contrast between the plaques and the turbid host lawns. It has been reported that some antibiotics stimulate bacteria to produce phages, resulting in an increase in final titer. Thus, antibiotics might contribute to increasing plaque size in solid media. Results Antibiotics with different mechanisms of action were tested for their ability to enhance plaque morphology without suppressing phage development. Some antibiotics increased the phage plaque surface by up to 50-fold. Conclusion This work presents a modification of the DLA technique that can be used routinely in the laboratory, leading to a more accurate enumeration of phages that would be difficult or even impossible otherwise.

  14. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  15. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  16. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  17. El precio de un marido. El significado de la dote matrimonial en el nuevo Reino de Granada. (1570-1650

    Directory of Open Access Journals (Sweden)

    René Salinas Meza

    2011-10-01

    Full Text Available Bajo el sugerente título de este libro su autor, investigador del grupo de historia colonial del Instituto Colombiano de Antropología e Historia (ICANH, analiza el funcionamiento del mecanismo de la dote en una sociedad provinciana del Nuevo Reino de Granada, Pamplona, durante la primera mitad del siglo XVII. Tras situar el contexto social y económico de la región durante el período de estudio (1570-1650, caracterizado por el desarrollo de la minería del oro y el auge del sistema de la encomienda así como la crisis demográfica de las comunidades indígenas, hace una rápida evaluación y verificación de las fuentes documentales que sustentaron la investigación, fundamentalmente cartas de dote y testamentos.

  18. El tabern√°culo de la Catedral de Granada: de Diego de Siloe a Navas Parejo

    Directory of Open Access Journals (Sweden)

    José Antonio Peinado Guzmán

    2010-03-01

    Full Text Available Uno de los elementos m√°s olvidados en los estudios acerca de la Catedral de Granada, ha sido, hist√≥ricamente, el tabern√°culo de su Capilla Mayor. El ideado por Diego de Siloe en 1561, supuso la creaci√≥n de un elemento innovador dentro del ornato de su presbiterio. Este ciborio, ven√≠a a completar un programa iconogr√°fico-teol√≥gico cargado de simbolismos. El paso del tiempo hizo que tuviese que ser sustituido por otros. Tras el de Siloe, tenemos referencias de la adquisici√≥n de uno en 1648 con forma de ¬ęCarro de Ezequiel¬Ľ, otro provisional en 1804 y, finalmente, el actual, hecho por Navas Parejo entre 1924-1929.

  19. Castigo y orden social en la América Latina colonial. El Nuevo Reino de Granada. Un esbozo.

    Directory of Open Access Journals (Sweden)

    Franz Dieter Hensel.

    2002-07-01

    Full Text Available This article inquires into the relationship between punishment and social order in colonial Latin America, especially during the 17th and 18th centuries in the Nuevo Reino de Granada. For this purpose, punishment is understood not only as a means of social regulation but also as an advantageous way to study the colonial order. Thus, the proposal explores the link between sanction and society at various moments. First, the most relevant features of the administration of justice are reviewed. Next, the main crimes and punishments relating to crimes against nature are identified. In the final section, some doctrinal sermons and talks about the sacrament of penance are considered to show how punishment, the social order and the divine order must be viewed as parts of a single process, rather than as isolated units lacking reciprocal relationships.

  20. A Student Migratory Process (Pre-Migration, Migration and Post-Migration: Moroccan Youngsters in the University of Granada

    Directory of Open Access Journals (Sweden)

    Eva María González Barea

    2008-11-01

    Full Text Available In this article we analyze a partircularly migratory process and, at the same time, we include a new and not studied notion of migration. It consists of the displacement of sutdents of different regions of Morocco to continue their academic formation in a foreign university, in this case, the University of Granada. We present the study as a new research topic, due to the practical inexistence of bibliography or studies in this matter. At the same time, we present it as the analysis of a new migratory process that we necessarily have to include in the global phenomenon of actual migrations. We also include the theoretical analysis that stands for the development of this study.

  1. Photogrammetric Methodology for the Production of Geomorphologic Maps: Application to the Veleta Rock Glacier (Sierra Nevada, Granada, Spain

    Directory of Open Access Journals (Sweden)

    Jos√© Jes√ļs Guerrero

    2009-10-01

    Full Text Available In this paper we present a stereo feature-based method using SIFT (Scale-invariant feature transform descriptors. We use automatic feature extractors, matching algorithms between images and techniques of robust estimation to produce a DTM (Digital Terrain Model using convergent shots of a rock glacier.The geomorphologic structure observed in this study is the Veleta rock glacier (Sierra Nevada, Granada, Spain. This rock glacier is of high scientific interest because it is the southernmost active rock glacier in Europe and it has been analyzed every year since 2001. The research on the Veleta rock glacier is devoted to the study of its displacement and cartography through geodetic and photogrammetric techniques.

  2. La iglesia y el crédito colonial: Pamplona-Nuevo Reino de Granada, 1700-1760

    Directory of Open Access Journals (Sweden)

    Carmen Adriana Ferreira Esparza

    1996-06-01

    Full Text Available A partir del an√°lisis de los protocolos notariales del Archivo Hist√≥rico de Pamplona y de una clasificaci√≥n detallada de los censos y capellan√≠as, este art√≠culo ubica las fuentes y mecanismos crediticios que operaron durante el periodo colonial. Destaca especialmente el papel desempe√Īado por el convento de monjas de Santa Clara y la Hermandad de San Pedro, instituciones eclesi√°sticas que asumieron funcione financieras, as√≠ como algunos capitales provenientes del sector privado. Finalmente se√Īala la aplicaci√≥n de este sistema crediticio en el marco de una econom√≠a agr√≠cola, basada en la comercializaci√≥n y producci√≥n de cacao, como fue la de la provincia de Pamplona en la Nueva Granada, durante los primeros 60 a√Īos del siglo XVIII.

  3. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  4. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  5. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  6. Socio-demographic analysis of status and level of nutrition and physical activity in two schools in Granada (Spain.

    Directory of Open Access Journals (Sweden)

    María I. Tovar-Galvez

    2017-04-01

    Full Text Available Objectives: Currently, nutritional habits and the lifestyle of Spanish schoolchildren have undergone important changes. This study aimed to analyze the sociodemographic characteristics, eating habits and physical activity of schoolchildren of two different schools and determine possible differences in nutritional status and body composition, as well as nutrition and physical activity level of school children. Methods: Cross-sectional study of 114 schoolchildren between 8 and 13 years old, from Granada, Spain. An assessment of the nutritional status was performed by anthropometry and an analysis of body composition by bioelectrical impedance. Two questionnaires were used, one ad hoc about sociodemographic and nutritional data and the Krece-Plus test to assess nutritional status and physical activity. Results: There are no noteworthy significant differences in the nutritional habits of schoolchildren in both centers, most performed five daily meals. There are significant differences in the use of transport to go to school; schoolchildren of the Albayzín attend to school walking everyday, with a higher prevalence of low weight and ideal fat percentage lower than recommended. On the other hand, the schoolchildren in the center of the capital have low regular physical activity and nutritional status. There are sociodemographic differences between the two populations of students, both comply with the recommendations on the number of daily intakes. Conclusion: Students who reside in the center of Granada are more sedentary than their counterparts in the Albayzín and have a higher prevalence of overweight and obesity. Students of the Albayzín have better nutrition and physical activity level.

  7. Los estudios de Bot√°nica en los planes ilustrados del Virreinato de la Nueva Granada

    Directory of Open Access Journals (Sweden)

    Arboleda, Luis Carlos

    1995-12-01

    Full Text Available During the kingdoms of the New Granada, the first plan of teaching wich was presented by the botanical departament was made during the Viceroy Caballero y Góngora (1787. Later, beginning in the 19th century, during the political and ideological repression in the universities, the plans of the Baron Carondelet (1800 were presented with the idea of the creation of the Botanical Department in the University of Quito, and the creole Eloy Valenzuela presented the teaching of botanical studies in the course of study of Philosophy in the College-University of Mompox in 1806. He carried out a model of Botanical Expedition to realize in the Villa of Mompox. This was include in the General Laws in the College-University of Mompox. This plans no weren't aproval by controversy and administrative procedures. Only, the Plan of Valenzuela had partial aplication.

    En el virreinato de la Nueva Granada, el primer plan ilustrado de ense√Īanza que propuso la c√°tedra de Bot√°nica fue el del virrey Caballero y G√≥ngora (1787. Posteriormente, en los albores del Siglo XIX y ya en la etapa de represi√≥n pol√≠tica e ideol√≥gica en las universidades, se presentaron los planes del Bar√≥n de Carondelet (1800, que plante√≥ la c√°tedra de Bot√°nica para la Universidad quite√Īa, y el criollo Eloy Valenzuela present√≥ la ense√Īanza de la Bot√°nica dentro del plan de estudios de Filosof√≠a para el Colegio-Universidad de Mompox en 1806 y en las Constituciones del mismo Colegio desarroll√≥ un modelo de Expedici√≥n Bot√°nica para realizar en la Villa de Mompox.

  8. Create Your Plate

    Medline Plus

    Full Text Available ... Type 2 Diabetes Know Your Rights Employment Discrimination Health Care Professionals Law ... Your Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with Heart- ...

  9. Create Your Plate

    Medline Plus

    Full Text Available ... Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with Heart-Healthy Foods Holiday ... Carbohydrates Types of Carbohydrates Carbohydrate Counting Make Your Carbs ...

  10. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  11. Comparison of the Cellient(‚ĄĘ) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  12. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  14. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  15. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  16. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    S√łrensen, Jens Laurids; Mogensen, Jesper M√łlgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  17. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  18. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  19. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  20. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  1. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  2. Can serums be replaced by Mueller‚ÄĎHinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‚ÄĎHinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the¬†...

  3. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  4. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  5. Create Your Plate

    Medline Plus

    Full Text Available ... In Memory In Honor Become a Member En Espa√Īol Type 1 Type 2 About Us Online Community ... Page Text Size: A A A Listen En Espa√Īol Create Your Plate Create Your Plate is a ...

  6. Create Your Plate

    Medline Plus

    Full Text Available ... Diabetes Meal Plans Create Your Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with Heart-Healthy Foods Holiday Meal Planning ... Planning Meals Diabetes Meal Plans and a Healthy Diet Create Your Plate Meal Planning for Vegetarian Diets ...

  7. Create Your Plate

    Medline Plus

    Full Text Available ... Planning Meals Diabetes Meal Plans Create Your Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with Heart- ... Create Your Plate Meal Planning for Vegetarian Diets Gluten Free Diets Holiday Meal Planning Cook with Heart-Healthy Foods ...

  8. Create Your Plate

    Medline Plus

    Full Text Available ... ready, you can try new foods within each food category. Try these seven steps to get started: Using your dinner plate, put a line down the middle of the plate. Then on one side, cut it ... and starchy foods. See this list of grains and starchy foods . ...

  9. Towards stacked zone plates

    International Nuclear Information System (INIS)

    Werner, S; Rehbein, S; Guttman, P; Heim, S; Schneider, G

    2009-01-01

    Fresnel zone plates are the key optical elements for soft and hard x-ray microscopy. For short exposure times and minimum radiation load of the specimen the diffraction efficiency of the zone plate objectives has to be maximized. As the efficiency strongly depends on the height of the diffracting zone structures the achievable aspect ratio of the nanostructures determines these limits. To reach aspect ratios ‚Č• 20:1 for high efficient optics we propose to superimpose zone plates on top of each other. With this multiplication approach the final aspect ratio is only limited by the number of stacked zone plate layers. For the stack process several nanostructuring process steps have to be developed and/or improved. Our results show for the first time two layers of zone plates stacked on top of each other.

  10. Detection by hyperspectral imaging of shiga toxin-producing Escherichia coli serogroups O26, O45, O103, O111, O121, and O145 on rainbow agar.

    Science.gov (United States)

    Windham, William R; Yoon, Seung-Chul; Ladely, Scott R; Haley, Jennifer A; Heitschmidt, Jerry W; Lawrence, Kurt C; Park, Bosoon; Narrang, Neelam; Cray, William C

    2013-07-01

    The U.S. Department of Agriculture, Food Safety Inspection Service has determined that six non-O157 Shiga toxin-producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) are adulterants in raw beef. Isolate and phenotypic discrimination of non-O157 STEC is problematic due to the lack of suitable agar media. The lack of distinct phenotypic color variation among non-O157serogroups cultured on chromogenic agar poses a challenge in selecting colonies for confirmation. In this study, visible and near-infrared hyperspectral imaging and chemometrics were used to detect and classify non-O157 STEC serogroups grown on Rainbow agar O157. The method was first developed by building spectral libraries for each serogroup obtained from ground-truth regions of interest representing the true identity of each pixel and thus each pure culture colony in the hyperspectral agar-plate image. The spectral library for the pure-culture non-O157 STEC consisted of 2,171 colonies, with spectra derived from 124,347 of pixels. The classification models for each serogroup were developed with a k nearest-neighbor classifier. The overall classification training accuracy at the colony level was 99%. The classifier was validated with ground beef enrichments artificially inoculated with 10, 50, and 100 CFU/ml STEC. The validation ground-truth regions of interest of the STEC target colonies consisted of 606 colonies, with 3,030 pixels of spectra. The overall classification accuracy was 98%. The average specificity of the method was 98% due to the low false-positive rate of 1.2%. The sensitivity ranged from 78 to 100% due to the false-negative rates of 22, 7, and 8% for O145, O45, and O26, respectively. This study showed the potential of visible and near-infrared hyperspectral imaging for detecting and classifying colonies of the six non-O157 STEC serogroups. The technique needs to be validated with bacterial cultures directly extracted from meat products and positive

  11. Fenologia e produção de pessegueiros 'granada' com aplicação de cianamida hidrogenada e boro Phenologyand production of 'granada' peaches with application of hydrogen cyanamyd and boron

    Directory of Open Access Journals (Sweden)

    Gilmar Ant√īnio Nava

    2009-06-01

    Full Text Available O objetivo do trabalho foi avaliar o efeito de diferentes concentra√ß√Ķes e √©pocas de aplica√ß√£o de cianamida hidrogenada (CH + √≥leo mineral (OM e boro sobre a fenologia e produ√ß√£o de pessegueiros 'Granada'. O trabalho foi desenvolvido no munic√≠pio de Charqueadas, na Depress√£o Central do Rio Grande do Sul. Avaliaram-se a fenologia, a queda de gemas florais e intensidade de flora√ß√£o, a frutifica√ß√£o efetiva, o rendimento e a qualidade f√≠sico-qu√≠mica dos frutos. A aplica√ß√£o de 0,4 % CH + 1,0 % OM no est√°dio de gema dormente estimulou o florescimento e a brota√ß√£o, mas reduziu a produ√ß√£o das plantas. A pulveriza√ß√£o com 0,2% de b√≥rax (220 mg.L-1 de boro nas gemas e flores aumentou a produ√ß√£o das plantas. A aplica√ß√£o simult√Ęnea de 0,25% CH + 0,8% OM, no est√°dio de in√≠cio de inchamento das gemas, e de 0,2% de √°cido b√≥rico (340 mg.L-1 de boro, na plena flora√ß√£o, promoveu a maior produ√ß√£o de frutos. A aplica√ß√£o isolada de 0,25 % CH + 0,8 % OM, no est√°dio de in√≠cio de inchamento das gemas, reduziu o teor de s√≥lidos sol√ļveis (SS totais e, quando aplicados simultaneamente com o boro, na plena flora√ß√£o, reduziu a acidez titul√°vel dos frutos.The 'Granada' peach presents, in most years, low fruit set in the main producing regions of southern Brazil. Among the factors that can act negatively about this peach variety production detaches the lack of hibernal cold for buds dormancy liberation, as well as the occurrence of nutritional deficiencies. So, this work aimed to evaluate the effect of different concentrations and times of application of hydrogen Cyanamid (CH + mineral oil (OM and boron on the phenology and production of peach trees, cv. Granada. The experiment was carried in Charqueadas city, in the Central Depression region of Rio Grande do Sul State, Brazil. It has been evaluated the phenology, the floral bud dropping and the intensity of blooming, the fruit setting and the physic-chemistry quality of the

  12. Revisión Histórica sobre el bocio en Suramérica y la Nueva Granada.

    Directory of Open Access Journals (Sweden)

    Jos√© Felix Pati√Īo Restrepo

    2001-08-01

    Full Text Available

    Con anotaciones sobre el descubrimiento de la etiología y tratamiento del bocio endémico en Colombia, basadas en 3 memorias originales de la biblioteca del Dr. Nicolas Osorio.

    Este artículo es una revisión del Capítulo 1 del libro

    BOCIO Y CANCER DE TRIROIDES por J.F. Pati√Īo. Bogot√°, 1976.

    Resumen
    Se revisa la pol√©mica sobre si el problema del bocio fue conocido por los pueblos americanos antes de la llegada de los espa√Īoles. Fue motivo de preocupaci√≥n cient√≠fica desde la √©poca colonial, pero especialmente en los siglos XVIII y XIX.

    Se conocen citas muy antiguas sobre el origen y tratamiento de los cotos, pero fueron las observaciones hechas en el Nuevo Reino de Granada, hoy Rep√ļblica de Colombia, a comienzos del siglo XIX, las que resultaron en el descubrimiento del yodo como factor etiol√≥gico y como agente terap√©utico en el problema del bocio.

    Las primeras publicaciones colombianas sobre tiroides datan de 1794 y finales del siglo XVIII, por José Celestino Mutis y Gil de Tejada, entre otros. En 1808 y 1809 se hicieron publicaciones en el

    Semanario de la Nueva Granada, bajo la dirección de Francisco José de Caldas, en que se mencionan curaciones con la ingestión de sal llegada de ciertas regiones del país. Humboldt en 1824 registró la ocurrencia de bocios en los Andes y observó que algunos habitantes utilizaban sal traída de lugares distantes, como tratamiento del bocio.

    Se reconoce en la literatura m√©dica que fue el joven agr√≥nomo franc√©s, J.B. Boussingault, quien recomend√≥ por primera vez, en 1813, la adici√≥n de peque√Īas cantidades de yodo a la sal como medida preventiva contra el bocio. Boussingault encabez√≥ la misi√≥n cient√≠fica que viaj√≥ a la Gran Colombia por encargo del Gobierno del General Francisco de Paula Santander, y sus cuidadosas observaciones fueron presentadas a la Academia de

  13. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  15. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  16. Anisotropic elastic plates

    CERN Document Server

    Hwu, Chyanbin

    2010-01-01

    As structural elements, anisotropic elastic plates find wide applications in modern technology. The plates here are considered to be subjected to not only in plane load but also transverse load. In other words, both plane and plate bending problems as well as the stretching-bending coupling problems are all explained in this book. In addition to the introduction of the theory of anisotropic elasticity, several important subjects have are discussed in this book such as interfaces, cracks, holes, inclusions, contact problems, piezoelectric materials, thermoelastic problems and boundary element a

  17. High loading uranium plate

    International Nuclear Information System (INIS)

    Wiencek, T.C.; Domagala, R.F.; Thresh, H.R.

    1990-01-01

    Two embodiments of a high uranium fuel plate are disclosed which contain a meat comprising structured uranium compound confined between a pari of diffusion bonded ductile metal cladding plates uniformly covering the meat, the meat hiving a uniform high fuel loading comprising a content of uranium compound greater than about 45 Vol. % at a porosity not greater than about 10 Vol. %. In a first embodiment, the meat is a plurality of parallel wires of uranium compound. In a second embodiment, the meat is a dispersion compact containing uranium compound. The fuel plates are fabricated by a hot isostatic pressing process

  18. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  19. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  20. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  1. Heat insulating plates

    Energy Technology Data Exchange (ETDEWEB)

    Allan, J.A.F.

    1976-10-28

    Micro-porous insulation plates are dealt with, for example, how they are used in the insulation of heat storage devices. Since one side of such plates is exposed to a temperature of over 700/sup 0/C, a shrinkage of the glass texture of the covering can occur, which can exceed the shrinkage of the inner micro-porous material, so that cracks and splits in the high temperature side of the covering can come about. The task of the invention is to design the plate in such a way as to prevent this from happening. For this purpose the plate is provided, according to invention specifications, with flutes, waves, ribs, waffle or grid patterns and the covering is set into the recesses originating from this.

  2. Create Your Plate

    Medline Plus

    Full Text Available ... Plate is a simple and effective way to manage your blood glucose levels and lose weight. With ... been easier. It can be a challenge to manage portion control wherever you are. Now, our best- ...

  3. Create Your Plate

    Medline Plus

    Full Text Available ... Food Planning Meals Diabetes Meal Plans and a Healthy Diet Create Your Plate Meal Planning for Vegetarian Diets Gluten Free Diets Holiday Meal Planning Cook with Heart-Healthy Foods donate en -- A Future Without Diabetes - a- ...

  4. Create Your Plate

    Medline Plus

    Full Text Available ... Risk Test Lower Your Risk Healthy Eating Overweight Smoking High Blood Pressure Physical Activity High Blood Glucose ... Diabetes Meal Plans Create Your Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with Heart- ...

  5. Create Your Plate

    Medline Plus

    Full Text Available ... Risk Test Lower Your Risk Healthy Eating Overweight Smoking High Blood Pressure Physical Activity High Blood Glucose ... Planning Meals Diabetes Meal Plans and a Healthy Diet Create Your Plate Meal Planning for Vegetarian Diets ...

  6. Create Your Plate

    Medline Plus

    Full Text Available ... Children and Type 2 Diabetes Know Your Rights Employment Discrimination Health Care Professionals Law Enforcement Driver's License ... blood glucose levels and lose weight. With this method, you fill your plate with more non-starchy ...

  7. Create Your Plate

    Medline Plus

    Full Text Available ... diabetes. Other Ways to Give Become a Member Vehicle Donation Planned Giving Options Memorial Giving Brochures & Envelopes ... to manage your blood glucose levels and lose weight. With this method, you fill your plate with ...

  8. Create Your Plate

    Medline Plus

    Full Text Available ... breast cancer and AIDS combined. Your gift today will help us get closer to curing diabetes and ... on one side, cut it again so you will have three sections on your plate. Fill the ...

  9. Create Your Plate

    Medline Plus

    Full Text Available ... Recipes Association Cookbook Recipes Planning Meals Diabetes Meal Plans Create Your Plate Gluten Free Diets Meal Planning ... serving of dairy or both as your meal plan allows. Choose healthy fats in small amounts. For ...

  10. Create Your Plate

    Medline Plus

    Full Text Available ... Count Glycemic Index Low-Calorie Sweeteners Sugar and Desserts Fitness Exercise & Type 1 Diabetes Get Started Safely ... blood glucose levels and lose weight. With this method, you fill your plate with more non-starchy ...

  11. Create Your Plate

    Medline Plus

    Full Text Available ... these seven steps to get started: Using your dinner plate, put a line down the middle of ... Fitness Food Recipes Planning Meals What Can I Eat Weight Loss Fitness In My Community Calendar of ...

  12. Create Your Plate

    Medline Plus

    Full Text Available ... Food MyFoodAdvisor Recipes Association Cookbook Recipes Planning Meals Diabetes Meal Plans Create Your Plate Gluten Free Diets Meal Planning for Vegetarian Diets Cook with Heart-Healthy Foods Holiday Meal ...

  13. Create Your Plate

    Medline Plus

    Full Text Available ... for Association Events Messaging Tools Recruiting Advocates Local Market Planning Training Webinars News & Events Advocacy News Call ... Meals > Create Your Plate Share: Print Page Text Size: A A A Listen En Espa√Īol Create Your ...

  14. Create Your Plate

    Medline Plus

    Full Text Available ... Us in the Fight for a Cure Your tax-deductible gift today can fund critical diabetes research ... Close www.diabetes.org > Food and Fitness > Food > Planning Meals > Create Your Plate Share: Print Page Text ...

  15. Create Your Plate

    Medline Plus

    Full Text Available ... critical diabetes research and support vital diabetes education services that improve the lives of those with diabetes. $50 $100 $250 $500 Other Other Ways ... Meals > Create Your Plate ...

  16. Create Your Plate

    Medline Plus

    Full Text Available ... 800-342-2383) Give by Mail Close ... your plate with more non-starchy veggies and smaller portions of starchy foods and protein‚ÄĒno special tools or counting required! You can ...

  17. Humvee Armor Plate Drilling

    National Research Council Canada - National Science Library

    2004-01-01

    When drilling holes in hard steel plate used in up-armor kits for Humvee light trucks, the Anniston Army Depot, Anniston, Alabama, requested the assistance of the National Center for Defense Manufacturing and Machining (NCDMM...

  18. Create Your Plate

    Medline Plus

    Full Text Available ... Easy Advocacy Checklists for Association Events Messaging Tools Recruiting Advocates Local Market Planning Training Webinars News & Events ... blood glucose levels and lose weight. With this method, you fill your plate with more non-starchy ...

  19. Create Your Plate

    Medline Plus

    Full Text Available ... blood glucose levels and lose weight. With this method, you fill your plate with more non-starchy ... Complications Health Insurance For Parents & Kids Know Your Rights We Can Help Enroll in the Living WIth ...

  20. Create Your Plate

    Medline Plus

    Full Text Available ... blood glucose levels and lose weight. With this method, you fill your plate with more non-starchy ... today and help fund grants supporting next generation scientists. Donate Today We Can Help - we-can-help. ...

  1. BAO Plate Archive Project

    Science.gov (United States)

    Mickaelian, A. M.; Gigoyan, K. S.; Gyulzadyan, M. V.; Paronyan, G. M.; Abrahamyan, H. V.; Andreasyan, H. R.; Azatyan, N. M.; Kostandyan, G. R.; Samsonyan, A. L.; Mikayelyan, G. A.; Farmanyan, S. V.; Harutyunyan, V. L.

    2017-12-01

    We present the Byurakan Astrophysical Observatory (BAO) Plate Archive Project that is aimed at digitization, extraction and analysis of archival data and building an electronic database and interactive sky map. BAO Plate Archive consists of 37,500 photographic plates and films, obtained with 2.6m telescope, 1m and 0.5m Schmidt telescopes and other smaller ones during 1947-1991. The famous Markarian Survey (or the First Byurakan Survey, FBS) 2000 plates were digitized in 2002-2005 and the Digitized FBS (DFBS, www.aras.am/Dfbs/dfbs.html) was created. New science projects have been conducted based on this low-dispersion spectroscopic material. Several other smaller digitization projects have been carried out as well, such as part of Second Byurakan Survey (SBS) plates, photographic chain plates in Coma, where the blazar ON 231 is located and 2.6m film spectra of FBS Blue Stellar Objects. However, most of the plates and films are not digitized. In 2015, we have started a project on the whole BAO Plate Archive digitization, creation of electronic database and its scientific usage. Armenian Virtual Observatory (ArVO, www.aras.am/Arvo/arvo.htm) database will accommodate all new data. The project runs in collaboration with the Armenian Institute of Informatics and Automation Problems (IIAP) and will continues during 4 years in 2015-2018. The final result will be an Electronic Database and online Interactive Sky map to be used for further research projects. ArVO will provide all standards and tools for efficient usage of the scientific output and its integration in international databases.

  2. Neutron imaging plates

    International Nuclear Information System (INIS)

    Niimura, Nobuo

    1995-01-01

    Imaging plates have been used in the field of medical diagnosis since long ago, but their usefulness was verified as the two-dimensional detector for analyzing the X-ray crystalline structure of high bio molecules like protein, and they have contributed to the remarkable progress in this field. The great contribution is due to the excellent features, such as the detection efficiency of about 100%, the positional resolution smaller than 0.2 mm, the dynamic range of five digits, and the area of several hundreds mm square. The neutron imaging plates have not yet obtained the sufficient results. It was planned to construct the neutron diffractometer for biological matters, and to put imaging plate neutron detectors (IP-ND) to practical use as the detector. The research on the development of IP-NDs was carried out, and the IPp-NDs having the performance comparable with that for X-ray were able to be produced. Imaging plates are the integral type two-dimensional radiation detector using photostimulated luminescence matters, and their principle is explained. As to neutron imaging plates, the converter, neutron detection efficiency and the flight of secondary particles in photo-stimulated luminescence matters are described. As for the present state of development of neutron imaging plates, the IP-NDs made for trial, the dynamic range, the positional resolution, the detection efficiency and the kinds of converters, and the application of IP-NDs are reported. (K.I.)

  3. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  4. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  5. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  6. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  7. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30¬įC in 5% CO2 for 2 days prior to continuous culture in air at 30¬įC. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 őľg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  8. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Y√ľcesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  9. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  10. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  11. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  12. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  13. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ‚ĖŅ

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  14. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest¬ģ (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer‚Äôs standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest¬ģ were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest¬ģ, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC‚Äôs were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest¬ģ were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  15. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais ‚Äď UFMG, Avenida Presidente Ant√īnio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais ‚Äď UFMG, Avenida Presidente Ant√īnio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5¬į andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais ‚Äď UFMG, Avenida Presidente Ant√īnio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais ‚Äď UFMG, Avenida Presidente Ant√īnio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet‚Äďvisible spectroscopy (UV‚ÄďVis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 ¬įC for 2 h showed both an expressive porosity (‚Čą 77%) and a significant cold crushing strength (‚Čą 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 ¬įC for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: ‚ÄĘSuccessful preparation of amine-impregnated gel-cast silica foams ‚ÄĘAgar used as the gelling agent ‚ÄĘSamples with expressive porosity and cold crushing strength ‚ÄĘSintering times as long as 16 h led to the rupture of the pore network.

  16. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet‚Äďvisible spectroscopy (UV‚ÄďVis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 ¬įC for 2 h showed both an expressive porosity (‚Čą 77%) and a significant cold crushing strength (‚Čą 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 ¬įC for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: ‚ÄĘSuccessful preparation of amine-impregnated gel-cast silica foams ‚ÄĘAgar used as the gelling agent ‚ÄĘSamples with expressive porosity and cold crushing strength ‚ÄĘSintering times as long as 16 h led to the rupture of the pore network.

  17. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30¬įC for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  18. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30¬įC for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  19. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 őľCi and 0.2 őľCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  20. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  1. Propiedades psicométricas y baremos del Cuestionario de Burnout Granada en profesionales de Enfermería

    Directory of Open Access Journals (Sweden)

    Emilia I. de la Fuente

    2015-01-01

    Full Text Available Los enfermeros son uno de los colectivos profesionales que presentan mayores niveles de burnout. La definici√≥n m√°s aceptada de este trastorno fue propuesta por Maslach y Jackson, y se caracteriza por cansancio emocional, despersonalizaci√≥n y realizaci√≥n personal. Esta definici√≥n operativa fue usada en la elaboraci√≥n del Cuestionario de Burnout Granada (CBG. El objetivo de la presente investigaci√≥n fue evaluar las propiedades psicom√©tricas del CBG y elaborar un baremo para profesionales de enfermer√≠a espa√Īoles. El CBG era cumplimentado por 1.177 enfermeros. Las evidencias de validez de constructo fueron examinadas usando estrategias de validez cruzada y validez convergente, y las evidencias de validez de criterio mediante la validez concurrente. El coeficiente alfa de Cronbach se utiliz√≥ para medir la consistencia interna. Los resultados indican √≠ndices de ajuste satisfactorios en el an√°lisis factorial confirmatorio, y en las evidencias de validez convergente y concurrente. Todos los valores de alfa de Cronbach eran superiores a 0,83. Los resultados muestran que el CBG tiene buenas propiedades psicom√©tricas para ser usado en enfermeros. Se elabor√≥ un baremo en puntuaciones T y centiles que permite evaluar burnout en enfermeros espa√Īoles.

  2. Intestinal and haematic parasitism in the birds of the Almu√Īecar (Granada, Spain) ornithological garden.

    Science.gov (United States)

    Cordón, G Pérez; Prados, A Hitos; Romero, D; Moreno, M Sánchez; Pontes, A; Osuna, A; Rosales, M J

    2009-11-12

    Birds from the Almu√Īecar ornithological garden (Granada, Spain) were surveyed from June 2006 to May 2007 to establish programmes to prevent, control, and treat intestinal and haematic parasites. A total of 984 faecal samples and 41 samples of blood were collected from Psittacidae, Cacatuidae, Phasianidae, and Anatidae. One or more intestinal parasites were identified in 51.6% of the samples. Blood parasites were found in 26.8% of the birds examined. The most frequent pathogenic endoparasites were coccidians, such as Cyclospora sp. (4.5%), Eimeria sp. (4.1%) and Isospora sp. (2%) and helminths such as Capillaria sp. (10. 1%), Ascaridia sp. (4.9%) and Heterakis gallinarum (4.9%). All the parasites varied with season but the most were found year round. Multiple parasitic infections by intestinal parasites were common, with 196 of 984 faecal samples having 2-5 intestinal parasites. The most frequent cases of multiple parasitism were Blastocystis plus Entamoeba sp. and Blastocystis plus Cyclospora sp. The haematic protozoa detected were Haemoproteus sp. (17%) and Plasmodium sp. (7.3%). Multiple parasitism by Haemoproteus sp. and Plasmodium sp. was detected in 1 sample of Gallus gallus. After each sampling, some of the affected animals were treated according to our results, and the corresponding programmes of prevention and control were designed.

  3. Personal Learning Environments (PLE in the Bachelor’s Degree in Elementary Education at the University of Granada

    Directory of Open Access Journals (Sweden)

    Eduardo Chaves-Barboza

    2017-12-01

    Full Text Available This paper studies the devices that university students in teacher education incorporate into their personal learning environments (PLE. It also examines the time that students dedicate to activities related to ICT, the factors that encourage or frustrate the incorporation of tools to students‚Äô PLE, and the characteristics that this population desires for a PLE. For this, a questionnaire has been applied using Likert scales in a sample of 668 students divided into 15 groups, enrolled in the Elementary Education Bachelor‚Äôs degree program, at the University of Granada, Spain. The data were analyzed using descriptive and inferential statistics (with 95% confidence interval. Also, correlation tests (Kendall coefficient ŌĄ and analysis of variance (test of Kruskal-Wallis H were employed. The results showed that laptops and smartphones are the most accessible devices for students. The findings also showed that students spend little time to visiting university platforms, they prefer PLE tools to be productive and to allow them to connect with others, and they want PLE to be interactive, customizable and useful.

  4. Cadmium plating replacements

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, M.J.; Groshart, E.C.

    1995-03-01

    The Boeing Company has been searching for replacements to cadmium plate. Two alloy plating systems seem close to meeting the needs of a cadmium replacement. The two alloys, zinc-nickel and tin-zinc are from alloy plating baths; both baths are neutral pH. The alloys meet the requirements for salt fog corrosion resistance, and both alloys excel as a paint base. Currently, tests are being performed on standard fasteners to compare zinc-nickel and tin-zinc on threaded hardware where cadmium is heavily used. The Hydrogen embrittlement propensity of the zinc-nickel bath has been tested, and just beginning for the tin-zinc bath. Another area of interest is the electrical properties on aluminum for tin-zinc and will be discussed. The zinc-nickel alloy plating bath is in production in Boeing Commercial Airplane Group for non-critical low strength steels. The outlook is promising that these two coatings will help The Boeing Company significantly reduce its dependence on cadmium plating.

  5. Bending and stretching of plates

    CERN Document Server

    Mansfield, E H; Hemp, W S

    1964-01-01

    The Bending and Stretching of Plates deals with elastic plate theory, particularly on small- and large-deflexion theory. Small-deflexion theory concerns derivation of basic equations, rectangular plates, plates of various shapes, plates whose boundaries are amenable to conformal transformation, plates with variable rigidity, and approximate methods. Large-deflexion theory includes general equations and some exact solutions, approximate methods in large-deflexion theory, asymptotic large-deflexion theories for very thin plates. Asymptotic theories covers membrane theory, tension field theory, a

  6. Plating on Zircaloy-2

    International Nuclear Information System (INIS)

    Dini, J.W.; Johnson, H.R.; Jones, A.

    1979-03-01

    Zircaloy-2 is a difficult alloy to coat with an adherent electroplate because it easily forms a tenacious oxide film in air and aqueous solutions. Procedures reported in the literature and those developed at SLL for surmounting this problem were investigated. The best results were obtained when specimens were first etched in either an ammonium bifluoride/sulfuric acid or an ammonium bifluoride solution, plated, and then heated at 700 0 C for 1 hour in a constrained condition. Machining threads in the Zircaloy-2 for the purpose of providing sites for mechanical interlocking of the plating also proved satisfactory

  7. NICKEL PLATING PROCESS

    Science.gov (United States)

    Hoover, T.B.; Zava, T.E.

    1959-05-12

    A simplified process is presented for plating nickel by the vapor decomposition of nickel carbonyl. In a preferred form of the invention a solid surface is nickel plated by subjecting the surface to contact with a mixture containing by volume approximately 20% nickel carbonyl vapor, 2% hydrogen sulfide and .l% water vapor or 1% oxygen and the remainder carbon dioxide at room temperature until the desired thickness of nickel is obtained. The advantage of this composition over others is that the normally explosive nickel carbonyl is greatly stabilized.

  8. Hydrodynamics of a flexible plate between pitching rigid plates

    Science.gov (United States)

    Kim, Junyoung; Kim, Daegyoum

    2017-11-01

    The dynamics of a flexible plate have been studied as a model problem in swimming and flying of animals and fluid-structure interaction of plants and flags. Motivated by fish schooling and an array of sea grasses, we investigate the dynamics of a flexible plate closely placed between two pitching rigid plates. In most studies on passive deformation of the flexible plate, the plate is immersed in a uniform flow or a wavy flow. However, in this study, the flexible plate experiences periodic deformation by the oscillatory flow generated by the prescribed pitching motion of the rigid plates. In our model, the pitching axes of the rigid plates and the clamping position of the flexible plate are aligned on the same line. The flexible plate shows various responses depending on length and pitching frequency of rigid plates, thickness of a flexible plate, and free-stream velocity. To find the effect of each variable on the response of the flexible plate, amplitude of a trailing edge and modal contribution of a flapping motion are compared, and flow structure around the flexible plate is examined.

  9. Los cuidadores familiares en el Hospital Universitario de Traumatología y Rehabilitación de Granada Family caregivers in the University Hospital Traumatología and Rehabiblitación in Granada

    Directory of Open Access Journals (Sweden)

    Aurora Quero Rufi√°n

    2005-06-01

    Full Text Available Introducci√≥n: La hospitalizaci√≥n afecta a la din√°mica de las relaciones familiares y obliga a cambios en la representaci√≥n de los roles habituales. El papel de los cuidadores familiares adquiere toda su relevancia en la medida que satisfacen las necesidades del enfermo. Esta actividad en la mayor√≠a de los casos es realizada por mujeres. Objetivos: Conocer el perfil y tipo de cuidados que prestan los cuidadores familiares en las unidades de Maxilofacial, Neurolog√≠a, Neurocirug√≠a y Traumatolog√≠a del Hospital de Traumatolog√≠a de Granada. Analizar las necesidades y problemas con los que se encuentran en el hospital. Conocer la opini√≥n del personal de enfermer√≠a sobre el cuidador familiar. Dise√Īo: Cualitativo, mediante Observaci√≥n sistem√°tica, grupos focales (uno con enfermeras y otro con auxiliares, encuestas y entrevistas en profundidad. El an√°lisis de contenido ha sido realizado mediante el soporte inform√°tico Atlas/ti, 2.4. Resultados: correspondientes a la categor√≠a de h√°bitat hospitalario, en relaci√≥n con las actividades, nivel de informaci√≥n, demandas, etc, de los cuidadores familiares. Conclusiones: El √°mbito hospitalario es hostil para el cuidador familiar; es necesario establecer un nuevo marco relacional entre los profesionales y los cuidadores y reconocer su presencia y actividad dentro de la instituci√≥n sanitaria.Introduction: Generally hospitalization affects familiar relationships and it also obvies to take certain changes in families‚Äô routine. That is why family caregivers have acquired an important role, as they fulfil the needs of the patients. Most of the times, this activity is performed by women. Aims: The aims of this article are: to explain family care givers profile and the kind of care they provide in the following units: Maxilofacial, Neurology, Neurosurgery and Traumatology in the University Hospital Traumatolog√≠a y Rehabilitaci√≥n in Granada.This article will analyse different needs and problems

  10. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  11. Incubation of premise plumbing water samples on Buffered Charcoal Yeast Extract agar at elevated temperature and pH selects for Legionella pneumophila.

    Science.gov (United States)

    Veenendaal, Harm R; Brouwer-Hanzens, Anke J; van der Kooij, Dick

    2017-10-15

    Worldwide, over 90% of the notified cases of Legionnaires' disease are caused by Legionella pneumophila. However, the standard culture medium for the detection of Legionella in environmental water samples, Buffered Charcoal Yeast Extract (BCYE) agar of pH 6.9¬†¬Ī¬†0.4 with or without antimicrobial agents incubated at 36¬†¬Ī¬†1¬†¬įC, supports the growth of a large diversity of Legionella species. BCYE agar of elevated pH or/and incubation at elevated temperature gave strongly reduced recoveries of most of 26 L. non-pneumophila spp. tested, but not of L.¬†pneumophila. BCYE agar of pH 7.3¬†¬Ī¬†0.1, incubated at 40¬†¬Ī¬†0.5¬†¬įC (BCYE pH 7.3/40¬†¬įC) was tested for selective enumeration of L.¬†pneumophila. Of the L. non-pneumophila spp. tested, only L.¬†adelaidensis and L. londiniensis multiplied under these conditions. The colony counts on BCYE pH 7.3/40¬†¬įC of a L.¬†pneumophila serogroup 1 strain cultured in tap water did not differ significantly from those on BCYE pH 6.9/36¬†¬įC when directly plated and after membrane filtration and showed repeatability's of 13-14%. By using membrane filtration L.¬†pneumophila was detected in 58 (54%) of 107 Legionella-positive water samples from premise plumbing systems under one or both of these culture conditions. The L.¬†pneumophila colony counts (log-transformed) on BCYE pH 7.3/40¬†¬įC were strongly related (r 2 ¬†=¬†0.87) to those on BCYE pH 6.9/36¬†¬įC, but differed significantly (p¬†<¬†0.05) by a mean¬†of¬†-¬†0.12¬†¬Ī¬†0.30 logs. L. non-pneumophila spp. were detected only on BCYE pH 6.9/36¬†¬įC in 49 (46%) of the samples. Hence, BCYE pH 7.3/40¬†¬įC can facilitate the enumeration of L.¬†pneumophila and their isolation from premise plumbing systems with culturable L. non-pneumophila spp., some of which, e.g. L.¬†anisa, can be present in high numbers. Copyright ¬© 2017 Elsevier Ltd. All rights reserved.

  12. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3ő≤-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid —Āhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  13. Create Your Plate

    Medline Plus

    Full Text Available ... meal-planning, . In this section Food Planning Meals Diabetes Meal Plans and a Healthy Diet Create Your Plate Meal Planning for Vegetarian Diets Gluten Free Diets Holiday Meal Planning Cook with Heart-Healthy Foods donate en -- A Future Without Diabetes - a-future-without-diabetes-2.html A Future ...

  14. Create Your Plate

    Medline Plus

    Full Text Available ... tool is not to scale because of the differences in types of vegetables. When creating your plate ... function (data) { $('#survey-errors').remove(); $('.survey-form .form-group .survey-alert-wrap').remove(); if (data.submitSurveyResponse.success == ' ...

  15. Create Your Plate

    Medline Plus

    Full Text Available ... Your Plate Meal Planning for Vegetarian Diets Gluten Free Diets Holiday Meal Planning Cook with Heart-Healthy Foods donate en -- A Future Without Diabetes - a-future-without-diabetes-2.html A Future Without Diabetes Donate towards research today and your gift will be matched. Donate ...

  16. Create Your Plate

    Medline Plus

    Full Text Available ... Planning Meals > Create Your Plate Share: Print Page Text Size: A A A Listen En Espa√Īol Create ... Type 2 Education Series Hear audio clips and full recordings of past Q&A events at your ...

  17. Create Your Plate

    Medline Plus

    Full Text Available ... 1 Type 2 About Us Online Community Meal Planning Sign In Search: Search More Sites Search ‚Č° Are ... Fitness Home Food MyFoodAdvisor Recipes Association Cookbook Recipes Planning Meals Diabetes Meal Plans Create Your Plate Gluten ...

  18. Create Your Plate

    Medline Plus

    Full Text Available ... tax-deductible gift today can fund critical diabetes research and support vital diabetes education services that improve the ... effective way to manage your blood glucose levels and lose weight. With this method, you fill your plate with more non-starchy ...

  19. Microchannel plate photodetectors

    International Nuclear Information System (INIS)

    Majka, R.

    1977-01-01

    A review is given the status of development work on photodetectors using microchannel plates (MCP) as the electron gain element. Projections are made and opinions are presented on what might be available in the next few years. Several uses for these devices at ISABELLE are mentioned

  20. Parallel plate detectors

    International Nuclear Information System (INIS)

    Gardes, D.; Volkov, P.

    1981-01-01

    A 5x3cm 2 (timing only) and a 15x5cm 2 (timing and position) parallel plate avalanche counters (PPAC) are considered. The theory of operation and timing resolution is given. The measurement set-up and the curves of experimental results illustrate the possibilities of the two counters [fr

  1. Flat plate collector. Solarflachkollektor

    Energy Technology Data Exchange (ETDEWEB)

    Raab, N

    1979-03-29

    The invention refers to a flat solar collector with an absorber plate, which is arranged on a support and is covered by a transparent window, between which and the plate there is an air space. The previously known structures of this type had the disadvantage that the thermal expansion of the enclosed air caused considerable difficulties. The purpose of the invention is therefore to create a collector, which can be used on the modular system, retains its properties and is safe in spite of the great temperature variations. According to the invention this problem is solved by providing a compensating space in the collector, which is separated by a diaphragm from the airspace between the plate and the covering window. The airspace therefore remains sealed against the atmosphere, so that no dirt, corrosion of the inside and no condensation can reduce the efficiency of the collector. A rise in pressure due to an increase in temperature is immediately reduced by expansion of the diaphragm, which enters the compensation space. In order to increase the pressure in the airspace above the plate for increases in temperature, the compensation space is connected to the atmosphere. The diaphragm can be mirrored on the side towards the absorber, which makes the diaphragm into an insulating element, as it reflects radiated heat from the absorber.

  2. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ‚Ėļ The mechanism of SEM observation of agar gel using ionic liquid was investigated. ‚Ėļ Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ‚Ėļ Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ‚Ėļ We could optimize the water concentrations of sample of IL and wet material mixtures. ‚Ėļ SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 ‚ąí ‚čĮHOH‚čĮBF 4 ‚ąí by interaction with BF 4 ‚ąí of IL, and, it remained stable even under vacuum condition at 60 ¬įC, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  3. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  4. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  5. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background: ¬†¬†¬†Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods: ¬†¬†¬†¬†¬†The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results: ¬†¬†¬†The MIC value was 125 ¬Ķg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion: ¬†¬†¬†¬†We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  6. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  7. Recharge sources and hydrogeochemical evolution of groundwater in semiarid and karstic environments: A field study in the Granada Basin (Southern Spain)

    International Nuclear Information System (INIS)

    Kohfahl, Claus; Sprenger, Christoph; Herrera, Jose Benavente; Meyer, Hanno; Chacon, Franzisca Fernandez; Pekdeger, Asaf

    2008-01-01

    The objective of this study is to refine the understanding of recharge processes in watersheds representative for karstic semiarid areas by means of stable isotope analysis and hydrogeochemistry. The study focuses on the Granada aquifer system which is located in an intramontane basin bounded by high mountain ranges providing elevation differences of almost 2900 m. These altitude gradients lead to important temperature and precipitation gradients and provide excellent conditions for the application of stable isotopes of water whose composition depends mainly on temperature. Samples of rain, snow, surface water and groundwater were collected at 154 locations for stable isotope studies (őī 18 O, D) and, in the case of ground- and surface waters, also for major and minor ion analysis. Thirty-seven springs were sampled between 2 and 5 times from October 2004 to March 2005 along an altitudinal gradient from 552 masl in the Granada basin to 2156 masl in Sierra Nevada. Nine groundwater samples were taken from the discharge of operating wells in the Granada basin which are all located between 540 and 728 masl. The two main rivers were monitored every 2-3 weeks at three different altitudes. Rainfall being scarce during the sampling period, precipitation could only be sampled during four rainfall events. Calculated recharge altitudes of springs showed that source areas of mainly snowmelt recharge are generally located between 1600 and 2000 masl. The isotope compositions of spring water indicate water sources from the western Mediterranean as well as from the Atlantic without indicating a seasonal trend. The isotope pattern of the Quaternary aquifer reflects the spatial separation of different sources of recharge which occur mainly by bankfiltration of the main rivers. Isotopic signatures in the southeastern part of the aquifer indicate a considerable recharge contribution by subsurface flow discharged from the adjacent carbonate aquifer. No evaporation effects due to

  8. Recharge sources and hydrogeochemical evolution of groundwater in semiarid and karstic environments: A field study in the Granada Basin (Southern Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Kohfahl, Claus [Freie Universitaet Berlin, Institute of Geological Sciences, Malteserstr. 74-100, D-12249 Berlin (Germany)], E-mail: kohfahl@zedat.fu-berlin.de; Sprenger, Christoph [Freie Universitaet Berlin, Institute of Geological Sciences, Malteserstr. 74-100, D-12249 Berlin (Germany); Herrera, Jose Benavente [Instituto del Agua de la Universidad de Granada, Ramon y Cajal, 4, 18071 Granada (Spain); Meyer, Hanno [Isotope Laboratory of the Alfred Wegener Institute for Polar and Marine Research, Research Unit Potsdam, Telegrafenberg A 43, 14473 Potsdam (Germany); Chacon, Franzisca Fernandez [Dpto. Hidrogeologia y Aguas Subterraneas, Instituto Geologico y Minero de Espana, Oficina de Proyectos, Urb. Alcazar del Genil 4, Edificio Zulema bajo, 18006 Granada (Spain); Pekdeger, Asaf [Freie Universitaet Berlin, Institute of Geological Sciences, Malteserstr. 74-100, D-12249 Berlin (Germany)

    2008-04-15

    The objective of this study is to refine the understanding of recharge processes in watersheds representative for karstic semiarid areas by means of stable isotope analysis and hydrogeochemistry. The study focuses on the Granada aquifer system which is located in an intramontane basin bounded by high mountain ranges providing elevation differences of almost 2900 m. These altitude gradients lead to important temperature and precipitation gradients and provide excellent conditions for the application of stable isotopes of water whose composition depends mainly on temperature. Samples of rain, snow, surface water and groundwater were collected at 154 locations for stable isotope studies ({delta}{sup 18}O, D) and, in the case of ground- and surface waters, also for major and minor ion analysis. Thirty-seven springs were sampled between 2 and 5 times from October 2004 to March 2005 along an altitudinal gradient from 552 masl in the Granada basin to 2156 masl in Sierra Nevada. Nine groundwater samples were taken from the discharge of operating wells in the Granada basin which are all located between 540 and 728 masl. The two main rivers were monitored every 2-3 weeks at three different altitudes. Rainfall being scarce during the sampling period, precipitation could only be sampled during four rainfall events. Calculated recharge altitudes of springs showed that source areas of mainly snowmelt recharge are generally located between 1600 and 2000 masl. The isotope compositions of spring water indicate water sources from the western Mediterranean as well as from the Atlantic without indicating a seasonal trend. The isotope pattern of the Quaternary aquifer reflects the spatial separation of different sources of recharge which occur mainly by bankfiltration of the main rivers. Isotopic signatures in the southeastern part of the aquifer indicate a considerable recharge contribution by subsurface flow discharged from the adjacent carbonate aquifer. No evaporation effects due

  9. Comparison of plate counts, Petrifilm, dipslides, and adenosine triphosphate bioluminescence for monitoring bacteria in cooling-tower waters.

    Science.gov (United States)

    Mueller, Sherry A; Anderson, James E; Kim, Byung R; Ball, James C

    2009-04-01

    Effective bacterial control in cooling-tower systems requires accurate and timely methods to count bacteria. Plate-count methods are difficult to implement on-site, because they are time- and labor-intensive and require sterile techniques. Several field-applicable methods (dipslides, Petrifilm, and adenosine triphosphate [ATP] bioluminescence) were compared with the plate count for two sample matrices--phosphate-buffered saline solution containing a pure culture of Pseudomonas fluorescens and cooling-tower water containing an undefined mixed bacterial culture. For the pure culture, (1) counts determined on nutrient agar and plate-count agar (PCA) media and expressed as colony-forming units (CFU) per milliliter were equivalent to those on R2A medium (p = 1.0 and p = 1.0, respectively); (2) Petrifilm counts were not significantly different from R2A plate counts (p = 0.99); (3) the dipslide counts were up to 2 log units higher than R2A plate counts, but this discrepancy was not statistically significant (p = 0.06); and (4) a discernable correlation (r2 = 0.67) existed between ATP readings and plate counts. For cooling-tower water samples (n = 62), (1) bacterial counts using R2A medium were higher (but not significant; p = 0.63) than nutrient agar and significantly higher than tryptone-glucose yeast extract (TGE; p = 0.03) and PCA (p < 0.001); (2) Petrifilm counts were significantly lower than nutrient agar or R2A (p = 0.02 and p < 0.001, respectively), but not statistically different from TGE, PCA, and dipslides (p = 0.55, p = 0.69, and p = 0.91, respectively); (3) the dipslide method yielded bacteria counts 1 to 3 log units lower than nutrient agar and R2A (p < 0.001), but was not significantly different from Petrifilm (p = 0.91), PCA (p = 1.00) or TGE (p = 0.07); (4) the differences between dipslides and the other methods became greater with a 6-day incubation time; and (5) the correlation between ATP readings and plate counts varied from system to system, was poor

  10. Los asentamientos mineros en la minería aurífera de Nueva Granada durante la época colonial

    OpenAIRE

    Orche García, Enrique; Puche Riart, Octavio

    2000-01-01

    El Virreinato de Nueva Granada ocupaba el √°rea que hoy comprende, total o parcialmente, Colombia, Ecuador, Venezuela y Panam√°. Desde las primeras incursiones en este vasto territorio, los espa√Īoles constataron la enorme riqueza aur√≠fera existente tanto en los aluviales de sus r√≠os como en los innumerables filones de cuarzo aflorantes en su agreste orograf√≠a y, por ello, acometieron la explotaci√≥n sistem√°tica de los yacimientos de oro en cuanto obtuvieron todo el metal que los indios fueron ca...

  11. El incesto padre e hija a través de los juicios criminales en el Nuevo Reino de Granada (1773-1828

    Directory of Open Access Journals (Sweden)

    Jenny Yamile Malagón Pinzón

    2008-01-01

    Full Text Available En este artículo se hace una aproximación al contexto en el que se desarrollaron las relaciones incestuosas entre padre e hija, estudiadas a través de los juicios criminales procesados en el Nuevo Reino de Granada (1773-1828. El análisis revelará aspectos de la composición y la dinámica familiar, así como la percepción de las comunidades y de las autoridades civiles y eclesiásticas en torno a esta práctica sexual y amorosa.

  12. Un conjunto singular del barroco sevillano en Granada: el Apostolado de la Basílica de las Angustias, obra de Pedro Duque Cornejo

    Directory of Open Access Journals (Sweden)

    Manuel García Luque

    2010-03-01

    Full Text Available Se estudia el Apostolado escultórico que Pedro Duque Cornejo realizó entre 1713 y 1718 para la parroquia de Ntra. Sra. de las Angustias de Granada, a partir de documentación inédita que nos permite reconstruir su historia material y arrojar nueva luz sobre la presencia del artista sevillano en la ciudad. Se plantea, además, la vinculación del conjunto con la basílica romana de San Juan de Letrán.

  13. El inicio del juicio de residencia a don Alonso de Granada Venegas (Oca√Īa, Toledo, 1597) : algunas notas sobre su procedimiento

    OpenAIRE

    Gonz√°lez Peinado, Carmen

    2010-01-01

    El art√≠culo se centra en el inicio del juicio de residencia a don Alonso de Granada Venegas, noble de ascendencia nazar√≠, gobernador de la provincia de Castilla la Mancha y Ribera del Tajo perteneciente a la Orden Militar de Santiago desde 1594 a 1597, as√≠ como a los oficiales p√ļblicos y del concejo de Oca√Īa, sede de gobernaci√≥n. La residencia tiene su especificidad propia en tierras de √≥rdenes militares y refleja la problem√°tica existente en torno a este cont...

  14. El inicio del juicio de residencia a donAlonso de Granada Venegas (Oca√Īa,Toledo, 1597) : algunas notas sobresu procedimiento

    OpenAIRE

    Carmen Gonz√°lez Peinado

    2010-01-01

    El art√≠culo se centra en el inicio del juicio de residencia a don Alonso de Granada Venegas, noble de ascendencia nazar√≠, gobernador de la provincia de Castilla la Mancha y Ribera del Tajo perteneciente a la Orden Militar de Santiago desde 1594 a 1597, as√≠ como a los oficiales p√ļblicos y del concejo de Oca√Īa, sede de gobernaci√≥n. La residencia tiene su especificidad propia en tierras de √≥rdenes militares y refleja la problem√°tica existente en torno a este control, que adquiere especial releva...

  15. Estudio de viabilidad para la ejecución de un aparcamiento subterráneo entre las calles Ciudad de Granada, Bolivia y Badajoz de Barcelona

    OpenAIRE

    Domínguez Quinoya, Inmaculada

    2014-01-01

    Este trabajo, punto final a los estudios de Ciencias y Tecnolog√≠a de Edificaci√≥n, pretende aplicar todos los conocimientos adquiridos en estos cuatro a√Īos en un proyecto concreto y real. Se trata de confirmar o negar la viabilidad de la construcci√≥n de un aparcamiento subterr√°neo en un solar situado entre las calles Ciudad de Granada, Bolivia y Badajoz de Barcelona. 1.- VIABILIDAD EN EL TERRITORIO: Empezamos conociendo la zona donde se ubica el aparcamiento, estudiando si ex...

  16. Menores marroqu√≠es que emigran: la b√ļsqueda de un sue√Īo en la ciudad de Granada (Espa√Īa

    Directory of Open Access Journals (Sweden)

    Francisco Jiménez Bautista

    2007-01-01

    Full Text Available Este estudio pretende analizar el problema de la inmigraci√≥n de menores en la ciudad de Granada (Espa√Īa dando una visi√≥n de sus conflictos en un contexto de inmigraci√≥n acelerada que se produce en la sociedad espa√Īola. Adem√°s, pretendemos exponer los principales conflictos que plantea hoy los menores inmigrantes (procedencia, conflictos y educaci√≥n, con su marco legal y el papel del sistema educativo como medio para la integraci√≥n personal de estos j√≥venes.

  17. La arquitectura escolar de José María García de Paredes en Granada. Un prototipo, tres escuelas

    OpenAIRE

    Castillo Hisp√°n, S.; Valero Ramos, E.

    2016-01-01

    Jos√© Mar√≠a Garc√≠a de Paredes, construy√≥ entre 1964 y 1967 tres escuelas en Granada, una arquitectura comprometida, que sigue sorprendiendo cincuenta a√Īos despu√©s por la vigencia y rotundidad de los principios que las originaron. Estos son los √ļnicos edificios escolares que Garc√≠a de Paredes construy√≥ en su carrera, en ellos sintetizo un discurso completo sobre los nuevos espacios docentes que se demandaban por la sociedad de la √©poca. Y lo hizo en unas circunstancias especialmente compli...

  18. Evaluation of Petrifilm Lactic Acid Bacteria Plates for Counting Lactic Acid Bacteria in Food.

    Science.gov (United States)

    Kanagawa, Satomi; Ohshima, Chihiro; Takahashi, Hajime; Burenqiqige; Kikuchi, Misato; Sato, Fumina; Nakamura, Ayaka; Mohamed, Shimaa M; Kuda, Takashi; Kimura, Bon

    2018-06-01

    Although lactic acid bacteria (LAB) are used widely as starter cultures in the production of fermented foods, they are also responsible for food decay and deterioration. The undesirable growth of LAB in food causes spoilage, discoloration, and slime formation. Because of these adverse effects, food companies test for the presence of LAB in production areas and processed foods and consistently monitor the behavior of these bacteria. The 3M Petrifilm LAB Count Plates have recently been launched as a time-saving and simple-to-use plate designed for detecting and quantifying LAB. This study compares the abilities of Petrifilm LAB Count Plates and the de Man Rogosa Sharpe (MRS) agar medium to determine the LAB count in a variety of foods and swab samples collected from a food production area. Bacterial strains isolated from Petrifilm LAB Count Plates were identified by 16S rDNA sequence analysis to confirm the specificity of these plates for LAB. The results showed no significant difference in bacterial counts measured by using Petrifilm LAB Count Plates and MRS medium. Furthermore, all colonies growing on Petrifilm LAB Count Plates were confirmed to be LAB, while yeast colonies also formed in MRS medium. Petrifilm LAB Count Plates eliminated the plate preparation and plate inoculation steps, and the cultures could be started as soon as a diluted food sample was available. Food companies are required to establish quality controls and perform tests to check the quality of food products; the use of Petrifilm LAB Count Plates can simplify this testing process for food companies.

  19. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Mechanical and water barrier properties of agar/őļ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, őļ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(¬ģ) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and őļ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright ¬© 2013 Elsevier Ltd. All rights reserved.

  1. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  2. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 őľm to 10 mm away from focal point.

  3. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  4. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  5. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  8. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  9. Plate Full of Color

    Centers for Disease Control (CDC) Podcasts

    The Eagle Books are a series of four books that are brought to life by wise animal characters - Mr. Eagle, Miss Rabbit, and Coyote - who engage Rain That Dances and his young friends in the joy of physical activity, eating healthy foods, and learning from their elders about health and diabetes prevention. Plate Full of Color teaches the value of eating a variety of colorful and healthy foods.

  10. Effect of plate shapes in orifice plate type flowmeters

    International Nuclear Information System (INIS)

    Moeller, S.V.

    1984-01-01

    The study of unusual plate shapes in orifice plate type flowmeters is presented, with a view to providing data for the substitution of the plate with one centered circular orifice in those applications where its use is not possible. For this purpose, six pairs of plates with different forms, with and without chamfered edges, were made and tested in a closed water loop. Results show that, generally, the use of chamfers improves the results and, in the case of perforated and slotlike orificed plates, the narrow-ness of the fluid passage tends to make unnecessary its use. (Author) [pt

  11. Plate removal following orthognathic surgery.

    Science.gov (United States)

    Little, Mhairi; Langford, Richard Julian; Bhanji, Adam; Farr, David

    2015-11-01

    The objectives of this study are to determine the removal rates of orthognathic plates used during orthognathic surgery at James Cook University Hospital and describe the reasons for plate removal. 202 consecutive orthognathic cases were identified between July 2004 and July 2012. Demographics and procedure details were collected for these patients. Patients from this group who returned to theatre for plate removal between July 2004 and November 2012 were identified and their notes were analysed for data including reason for plate removal, age, smoking status, sex and time to plate removal. 3.2% of plates were removed with proportionally more plates removed from the mandible than the maxilla. 10.4% of patients required removal of one or more plate. Most plates were removed within the first post-operative year. The commonest reasons for plate removal were plate exposure and infection. The plate removal rates in our study are comparable to those seen in the literature. Copyright © 2015 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  12. Plate Tearing by a Cone

    DEFF Research Database (Denmark)

    Simonsen, Bo Cerup

    1997-01-01

    The present paper is concerned with steady-state plate tearing by a cone. This is a scenario where a cone is forced through a ductile metal plate with a constant lateral tip penetration in a motion in the plane of the plate. The considered process could be an idealisaton of the damage, which...... as for the out-of-plane reaction force....

  13. Normal and abnormal growth plate

    International Nuclear Information System (INIS)

    Kumar, R.; Madewell, J.E.; Swischuk, L.E.

    1987-01-01

    Skeletal growth is a dynamic process. A knowledge of the structure and function of the normal growth plate is essential in order to understand the pathophysiology of abnormal skeletal growth in various diseases. In this well-illustrated article, the authors provide a radiographic classification of abnormal growth plates and discuss mechanisms that lead to growth plate abnormalities

  14. La política de los Montes Protectores y su relación con los riesgos naturales en la provincia de Granada

    Directory of Open Access Journals (Sweden)

    Miguel √Āngel Mesa

    2015-01-01

    Full Text Available Ante el problema secular de deforestaci√≥n que se padec√≠a en la Pen√≠nsula Ib√©rica y el relativofracaso de las pol√≠ticas forestales que intentaron la restauraci√≥n del arbolado, la administraci√≥nmoderna intent√≥ resolverlo sobre todo por sus repercusiones en los desastres naturales, medianteuna nueva f√≥rmula. Esta consisti√≥ en la implantaci√≥n de la figura de Monte Protector, mediantela Ley 24 de Junio de 1908 de Conservaci√≥n de Montes y Repoblaci√≥n Forestal. Esta figura finalmentes√≥lo se implantar√≠a en cuatro provincias, entre las que se encontraba la provincia de Granada.Su importancia radica en que marcar√° un hito en la consideraci√≥n de los espacios p√ļblicosy privados como objeto de la ausencia de arbolado y lo que posteriormente significar√≠a las pol√≠ticasde repoblaci√≥n de montes. En este trabajo se analizan las pol√≠ticas de Montes Protectores enla provincia de Granada y su incidencia territorial, as√≠ como su relaci√≥n con los riesgos naturales.

  15. Fases de programación y evolución morfosedimentaria de la flecha litoral de Calahonda (Granada durante el Holoceno

    Directory of Open Access Journals (Sweden)

    Goy, J. L.

    1999-12-01

    Full Text Available The spit bar of Calahonda (Granada, together with that one from Roquetas (Almer√≠a, constitutes one of the best examples in south-eastern Spain. Its development is associated to the different Holocene sea-level oscillations occurred since the last eustatic maximum. Progradation of these spit bars occurs under certain climatic conditions, which have repeated cyclically during Holocene times, giving place to different morphosedimentary units recognized along the whole southern peninsular littoral. In Calahonda, the main development of the spit bar is associated to the second progradation phase, which takes place since ca. 2,400 years.La flecha litoral de Calahonda (Granada constituye, junto con la de Roquetas (Almer√≠a, uno de los mejores ejemplos del sureste peninsular. Su desarrollo est√° asociado a las distintas oscilaciones del nivel del mar ocurridas durante el Holoceno, una vez alcanzado el m√°ximo eust√°tico. En general, se ha visto que la progradaci√≥n de estas flechas se produce en unas condiciones favorables determinadas, que se han repetido c√≠clicamente durante el Holoceno, y han quedado reflejadas como diferentes unidades morfosedimentarias, cuyo patr√≥n de formaci√≥n es reconocible en todo el sur peninsular. En Calahonda, el principal crecimiento de la flecha litoral est√° asociado a la segunda fase de progradaci√≥n, desarrollada en los √ļltimos 2.400 a√Īos.

  16. Juan Sánchez Cordobés: un desconocido escultor en la Granada de la primera mitad del siglo XVII

    Directory of Open Access Journals (Sweden)

    L√°zaro Gila Medina

    2010-03-01

    Full Text Available Tras la incorporaci√≥n de Granada a Castilla, en 1492, la ciudad se erige pronto en un centro art√≠stico de primera magnitud, pues la necesaria cristianizaci√≥n del territorio exigir√° la masiva importaci√≥n de obras y de artistas. Mas, pasado este estadio inicial, pronto ser√° capaz de abastecer de obras y de maestros a todo su entorno geogr√°fico. Precisamente esto explica las frecuentes y positivas relaciones art√≠sticas entre Granada, Murcia, M√°laga, Ja√©n, etc., desde los mismos albores del Quinientos. La oferta granadina en el campo de la pl√°stica escult√≥rica era tan variada, abundante y diversa que favoreci√≥ a esos territorios vecinos donde la demanda superaba con creces a la oferta y no s√≥lo en obras sino tambi√©n en maestros. De ah√≠ que, algunos artistas, que no lograban abrirse camino plenamente en estas tierras, lo buscaran en esos otros territorios, donde eran bien recibidos, los trabajos necesarios y, en √ļltima instancia, la fama anhelada.

  17. La guerra de Granada en las probanzas de hidalguía: los Amador de Lezcano, hidalgos de Cazorla y Quesada

    Directory of Open Access Journals (Sweden)

    García Guzmán, María del Mar

    2002-06-01

    Full Text Available Throughout the late Middle Ages the dominion of Cazorla and the village of Quesada were fortified towns in the frontier with the nazari kingdom of Granada, a fact that favoured the establishment of knights coming from other areas of Peninsula. They came attracted by the benefits of the war against the Islam which allowed them to consolidate their social and economic positions in the archbishops of Toledo's domain.

    A lo largo de la Baja Edad Media, el Adelantamiento de Cazorla y la villa de Quesada fueron plazas avanzadas en la frontera con el reino nazar√≠ de Granada, lo que favoreci√≥ el asentamiento de hidalgos, procedentes de otras zonas de la geograf√≠a peninsular, atra√≠dos por los beneficios de la guerra contra el Islam, lo que les permiti√≥ consolidar su posici√≥n social y econ√≥mica en el se√Īor√≠o de los arzobispos de Toledo.

  18. Study of uranium plating measurement

    International Nuclear Information System (INIS)

    Lin Jufang; Wen Zhongwei; Wang Mei; Wang Dalun; Liu Rong; Jiang Li; Lu Xinxin

    2007-06-01

    In neutron physics experiments, the measurement for plate-thickness of uranium can directly affect uncertainties of experiment results. To measure the plate-thickness of transform target (enriched uranium plating and depleted uranium plating), the back to back ionization chamber, small solid angle device and Au-Si surface barrier semi-conductor, were used in the experiment study. Also, the uncertainties in the experiment were analyzed. Because the inhomo-geneous of uranium lay of plate can quantitively affect the result, the homogeneity of uranium lay is checked, the experiment result reflects the homogeneity of uranium lay is good. (authors)

  19. The Eastern delta-fan deposits on the Granada Basin as tectonic indicators of the Sierra Nevada uplift (Betic Cordillera, South Spain)

    Science.gov (United States)

    Rold√°n, Francisco Javier; Aza√Īon, Jose Miguel; Mateos, Rosa Maria

    2014-05-01

    A geological mapping in detail of the Eastern sector of the Granada Basin (South Spain) reveals two different groups of Gilbert delta-fans related to the Sierra Nevada uplift. The first group, in the southern part and with a surface of 6 km2, has three major coarsening-upward sequences. They are composed of very coarse deposits, those of conglomerates, sands and silts. Progradational strata units to the basin have been observed. The dominantly fluvial facies association has locally developed shallow marine foreset deposits (partially with reef colonization) as well as topset red soils (Dabrio, et al., 1978; Braga et a., 1990; García-García, et al., 1999) . All the sequences are discordant over marine facies (calcarenites) dated over 8,26 Ma (Late Tortonian). The second group, in the northern part and with an extension of 12 km2, has similar characteristics, but some of the boulders have ostreids and lamellibranchs species which reveal their former position in a previous marine environment. The Sierra Nevada uplift caused the remobilization of these boulders, being transported by debris-flow inside the delta-fan bodies (García-García, et al., 2006). The dating of ostreids shells with Sr techniques reveals ages over 7,13, 6,61 and 5,45 Ma, from the lower to the upper delta-fan deposits, which are related to the three main sequences observed and with three major tectonic pulses during the Late Miocene. These interpretations are in agreement with apatite fision-track studies carried out in some boulders of these coarse delta-fan deposits (Clark and Dempster, 2013). They reveal a detailed record of Neogene denudation from the Sierra Nevada basement and with uplift periods between 5,45Ma- 2 Ma. The latest pulses affected the delta-fan sediments given rise to new fan systems in the Granada Basin (Alhambra Formation). The thoroughly study of the Miocene delta-fan sediments allows us to conclude that they were related to a sin-sedimentary tectonic activity linked to the

  20. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    J√≥zefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, PoznaŇĄ (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, PoznaŇĄ (Poland); Kubovńć√≠kov√°, M. [Institute of Experimental Physics, Slovak Academy of Sciences, KoŇ°ice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, PoznaŇĄ (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: ‚ÄĘ Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. ‚ÄĘ The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. ‚ÄĘ Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  1. Molecular Tools for Monitoring the Ecological Sustainability of a Stone Bio-Consolidation Treatment at the Royal Chapel, Granada.

    Directory of Open Access Journals (Sweden)

    Fadwa Jroundi

    Full Text Available Biomineralization processes have recently been applied in situ to protect and consolidate decayed ornamental stone of the Royal Chapel in Granada (Spain. While this promising method has demonstrated its efficacy regarding strengthening of the stone, little is known about its ecological sustainability.Here, we report molecular monitoring of the stone-autochthonous microbiota before and at 5, 12 and 30 months after the bio-consolidation treatment (medium/long-term monitoring, employing the well-known molecular strategy of DGGE analyses. Before the bio-consolidation treatment, the bacterial diversity showed the exclusive dominance of Actinobacteria (100%, which decreased in the community (44.2% after 5 months, and Gamma-proteobacteria (30.24% and Chloroflexi (25.56% appeared. After 12 months, Gamma-proteobacteria vanished from the community and Cyanobacteria (22.1% appeared and remained dominant after thirty months, when the microbiota consisted of Actinobacteria (42.2% and Cyanobacteria (57.8% only. Fungal diversity showed that the Ascomycota phylum was dominant before treatment (100%, while, after five months, Basidiomycota (6.38% appeared on the stone, and vanished again after twelve months. Thirty months after the treatment, the fungal population started to stabilize and Ascomycota dominated on the stone (83.33% once again. Members of green algae (Chlorophyta, Viridiplantae appeared on the stone at 5, 12 and 30 months after the treatment and accounted for 4.25%, 84.77% and 16.77%, respectively.The results clearly show that, although a temporary shift in the bacterial and fungal diversity was observed during the first five months, most probably promoted by the application of the bio-consolidation treatment, the microbiota tends to regain its initial stability in a few months. Thus, the treatment does not seem to have any negative side effects on the stone-autochthonous microbiota over that time. The molecular strategy employed here is suggested

  2. Fuel cell end plate structure

    Science.gov (United States)

    Guthrie, Robin J.; Katz, Murray; Schroll, Craig R.

    1991-04-23

    The end plates (16) of a fuel cell stack (12) are formed of a thin membrane. Pressure plates (20) exert compressive load through insulation layers (22, 26) to the membrane. Electrical contact between the end plates (16) and electrodes (50, 58) is maintained without deleterious making and breaking of electrical contacts during thermal transients. The thin end plate (16) under compressive load will not distort with a temperature difference across its thickness. Pressure plate (20) experiences a low thermal transient because it is insulated from the cell. The impact on the end plate of any slight deflection created in the pressure plate by temperature difference is minimized by the resilient pressure pad, in the form of insulation, therebetween.

  3. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of őĪ increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  4. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ‚ȧ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. ¬© The American Society of Tropical Medicine and Hygiene.

  5. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  6. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  8. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  9. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  10. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  11. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  12. [Conventional plate osteosynthesis].

    Science.gov (United States)

    Klaue, K

    2010-02-01

    Consolidation of bone is an essential clinical problem when treating fractures, fixing osteotomies and fusing joints. In most cases, the means of fixation are plates and screws. The goal is functional postoperative therapy by moving the adjacent joints and thus avoiding the deleterious disadvantages of long-lasting articular immobilization. Pre-operative planning, surgical approach, a good understanding of the precise mechanics of the structure and the biological answer for the various tissues are prerequisites of successful osteosynthesis. The choice of implants and the application of their versatility, as well as their adaptation to individual cases are the key to good results.

  13. Plate Full of Color

    Centers for Disease Control (CDC) Podcasts

    2008-08-04

    The Eagle Books are a series of four books that are brought to life by wise animal characters - Mr. Eagle, Miss Rabbit, and Coyote - who engage Rain That Dances and his young friends in the joy of physical activity, eating healthy foods, and learning from their elders about health and diabetes prevention. Plate Full of Color teaches the value of eating a variety of colorful and healthy foods.  Created: 8/4/2008 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 8/5/2008.

  14. Hans-Joachim Koenig. En el camino hacia la nación. Nacionalismo en el proceso de la formación del Estado y de la nación de la Nueva Granada, 1750-1856

    Directory of Open Access Journals (Sweden)

    Dagmar Kusche

    1993-01-01

    Full Text Available Hans-Joachim Koenig. En el camino hacia la naci√≥n. Nacionalismo en el proceso de la formaci√≥n del Estado y de la naci√≥n de la Nueva Granada, 1750-1856. Bogot√°: Editorial del Banco de la Rep√ļblica, 1994. 562 p√°ginas.

  15. Geometr√≠a y sistemas de flujo en el acu√≠fero de Tur√≥n-Pe√Īarodada (Almer√≠a-Granada): implicaciones estruccturales

    OpenAIRE

    García López, Santiago; Benavente Herrera, José; Cruz Sanjulián, J. J.; Carrasco Cantos, Francisco

    1994-01-01

    The results of a pumping/recovery test and those of a physico-chemical sampling of groundwater from the Turon-Pe√Īarrodada triassic carbonate aquifer (Almeria and Granada provinces, SE Spain), together with the analysis of the relationship between the TSD evolution in the main discharge point-Fuentes de Marbella springs- and the piezometric trend, are commented

  16. Zinc-air cell with KOH-treated agar layer between electrode and electrolyte containing hydroponics gel

    Energy Technology Data Exchange (ETDEWEB)

    Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)

    2002-07-01

    Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.

  17. Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains.

    Science.gov (United States)

    Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B

    1985-07-01

    Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.

  18. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    Science.gov (United States)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard

    2010-03-01

    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  19. Plating on difficult-to-plate metals: what's new

    International Nuclear Information System (INIS)

    Wiesner, H.J.

    1980-01-01

    Some of the changes since 1970 in procedures for plating on such materials as titanium, molybdenum, silicon, aluminum, and gallium arsenide are summarized. While basic procedures for plating some of these materials were developed as many as 30 to 40 years ago, changes in the end uses of the plated products have necessitated new plating processes. In some cases, vacuum techniques - such as ion bombardment, ion implantation, and vacuum metallization - have been introduced to improve the adhesion of electrodeposits. In other cases, these techniques have been used to deposit materials upon which electrodeposits are required

  20. Seasonal occurrence and distribution of a group of ECs in the water resources of Granada city metropolitan areas (South of Spain): Pollution of raw drinking water

    Science.gov (United States)

    Luque-Espinar, Juan Antonio; Navas, Natalia; Chica-Olmo, Mario; Cantarero-Malagón, Samuel; Chica-Rivas, Lucía

    2015-12-01

    This piece of research deals with the monitoring of a group of emerging contaminants (ECs) in the metropolitan area of Granada, a city representative of the South of Spain, in order to evaluate the environmental management of the wastewater system. With that aim, the spatial and seasonal occurrence and distribution of a group of ECs in groundwater, surface and irrigation water resources from the aquifer "Vega de Granada" (VG) have been investigated for the first time. A set of the most prescribed drugs in Spain (ibuprofen, loratadine, pantoprazole and paracetamol), a pesticide widely used in agriculture (atrazine) and a typical anthropogenic contaminant (caffeine) were included in the study. Water samples were taken from the metropolitan area of the city of Granada inside of the zone of the aquifer, from the downstream of two waste water treatment plants (WWTPs) and from the two main irrigation channels where surface and wastewater are mixed before distribution for irrigation purposes in the crops of the study area. A total of 153 water samples were analyzed through liquid chromatography coupled with mass spectrometry (LC-MS/MS) throughout the study that took place over a period of two years, from July 2011 to July 2013. Results demonstrated the occurrence of four of the six target pollutants. Ibuprofen was detected several times, always in both channels with concentration ranges from 5.3 to 20.8 őľg/L. The occurrence of paracetamol was detected in rivers and channels up to 34.3 őľg/L. Caffeine was detected in all the water resources up to 39.3 őľg/L. Pantoprazole was detected twice in the surface water source near to a WWPT ranging from 0.02 to 0.05 őľg/L. The pesticide atrazine and the drug loratadine were not detected in any of the water samples analyzed. These results show evidence of poor environmental management of the wastewater concerning the water quality of the aquifer studied. The groundwater sources seem to receive a very continuous input of wastewater

  1. Extracción, identificación y prueba microbiológica del agar extraído de Gracilaria fortissima dawson (rhodophyta, gigartinales, gracilariaceae (ING

    Directory of Open Access Journals (Sweden)

    M.V. S√°nchez

    2016-03-01

    Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.

  2. Plate Tearing by a Cone

    DEFF Research Database (Denmark)

    Simonsen, Bo Cerup

    1998-01-01

    The present paper is concerned with steady-state plate tearing by a cone. This is a scenario where a cone is forced through a ductile metal plate with a constant lateral tip penetration in a motion in the plane of the plate. The considered process could be an idealisation of the damage, which...... as for the out-of-plane reaction force. (C) 1998 Elsevier Science Ltd. All rights reserved....

  3. Bipolar Plates for PEM Systems

    OpenAIRE

    Lædre, Sigrid

    2016-01-01

    Summary of thesis: The Bipolar Plate (BPP) is an important component in both Proton Exchange Membrane Fuel Cells (PEMFCs) and Proton Exchange Membrane Water Electrolyzers (PEMWEs). Bipolar plate material and processing constitutes for a large fraction of the cost and weight of a PEM cell stack. The main tasks for the bipolar plates in both systems are to separate single cell in a stack, conduct current between single cells and remove heat from active areas. In addition, the BPPs distribu...

  4. Light scattering sensor for real-time identification of Vibrio parahaemolyticus, V. vulnificus and V. cholera colonies on solid agar plates

    Science.gov (United States)

    The three most common pathogenic species of Vibrio, V. cholerae, V. parahemolyticus and V. vulnificus, are of major concern as water- and food-borne pathogens because of an increasing incidence of water and seafood related outbreaks and illnesses worldwide. Current methods are time-consuming and req...

  5. Scintillator plate calorimetry

    International Nuclear Information System (INIS)

    Price, L.E.

    1990-01-01

    Calorimetry using scintillator plates or tiles alternated with sheets of (usually heavy) passive absorber has been proven over multiple generations of collider detectors. Recent detectors including UA1, CDF, and ZEUS have shown good results from such calorimeters. The advantages offered by scintillator calorimetry for the SSC environment, in particular, are speed (<10 nsec), excellent energy resolution, low noise, and ease of achieving compensation and hence linearity. On the negative side of the ledger can be placed the historical sensitivity of plastic scintillators to radiation damage, the possibility of nonuniform response because of light attenuation, and the presence of cracks for light collection via wavelength shifting plastic (traditionally in sheet form). This approach to calorimetry is being investigated for SSC use by a collaboration of Ames Laboratory/Iowa State University, Argonne National Laboratory, Bicron Corporation, Florida State University, Louisiana State University, University of Mississippi, Oak Ridge National Laboratory, Virginia Polytechnic Institute and State University, Westinghouse Electric Corporation, and University of Wisconsin

  6. Reviewing metallic PEMFC bipolar plates

    Energy Technology Data Exchange (ETDEWEB)

    Wang, H.; Turner, J.A. [National Renewable Energy Laboratory, Golden, CO (United States)

    2010-08-15

    A bipolar plate is one of the most important components in a polymer exchange membrane fuel cell (PEMFC) stack and has multiple functions. Metallic bipolar plate candidates have advantages over composite rivals in excellent electrical and thermal conductivity, good mechanical strength, high chemical stability, very wide alloy choices, low cost and, most importantly, existing pathways for high-volume, high-speed mass production. The challenges with metallic bipolar plates are the higher contact resistance and possible corrosion products, which may contaminate the membrane electrode assembly. This review evaluates the candidate metallic and coating materials for bipolar plates and gives the perspective of the research trends. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  7. Infection control in digital intraoral radiography: evaluation of microbiological contamination of photostimulable phosphor plates in barrier envelopes.

    Science.gov (United States)

    MacDonald, David S; Waterfield, J Douglas

    2011-01-01

    The detectors (both solid-state sensors and photostimulable phosphor [PSP] plates) used for digital intraoral radiography cannot be autoclaved, and barriers are typically used to prevent the spread of infection. The aim of this study was to determine the effectiveness of a barrier envelope system for PSP plates. Disinfected PSP plates were aseptically inserted into barrier envelopes and placed in a periapical location. One PSP plate was placed in each of 28 patients, and 12 plates in each of 2 volunteers (D.S.M., J.D.W.). After retrieval, each PSP plate was removed from its barrier envelope, immersed in trypticase soy broth and aliquots were plated on trypticase soy agar. Bacterial colonies were counted 2 days later. Fifty-two PSP plates in barrier envelopes were evaluated for contamination. Quality assurance of the PSP plates before clinical placement revealed defects in the integrity of 4 barrier envelopes, caused by forceps-related damage or failure to achieve a uniform seal. These defects allowed substantial contamination. Contamination also occurred as a result of failure to extract the PSP plate from the barrier envelope cleanly. Of the 44 barriers with no obvious defects that were placed by either final-year dental students or a radiologist, only 3 allowed bacterial contamination of the PSP plate. Detectors contained in barrier envelopes remain a potential source of contamination. PSP plates must be disinfected between removal from a contaminated barrier envelope and placement in a new barrier envelope. In addition, placement into the barrier envelope should ideally be carried out under aseptic conditions. Finally, the integrity of each sealed barrier envelope must be verified visually before release to the clinic.

  8. El valor bélico de la cabalgada en la frontera de Granada (c. 1350-c. 1481

    Directory of Open Access Journals (Sweden)

    Rojas Gabriel, Manuel

    2001-06-01

    Full Text Available In this article, the author starts from the notion that the frontier between Castile and Granada was, above all, a war front where military actions sometimes acquired the characteristics of an open war with great military operations. Some other times, the conflict was reduced to low intensity predatory actions and surprise attacks against some small strongholds. From this double dimension of war stemmed the cavalry raid and acquired its importance as an essential strategic and tactical instrument. From this point of view, the author analyses how the cavalry raid was the main ingredient of the war routine. For the Castilians, it was a very effective wearing element within a general strategic plan whose ultimate and non hidden purpose was the defeat and occupation of the Emirate. For the weakening Moslems, the plundering raids on the Christian frontier were almost the only means to drive the hostilities against their adversdaries in Andalucía and Murcia.

    Tout au long des pages de cet article, nous partons de l'id√©e m√®re que la fronti√®re entre la Castille et Grenade √©tait, par-dessus toute autre circonstance, un front de guerre o√Ļ l'action militaire prenait parfois l'allure d'un conflit ouvert dans lequel c'√©taient les grandes op√©rations militaires qui jouaient le r√īle principal alors que, dans d'autres cas, la lutte guerri√®re se r√©duisait √† des bellig√©rances d√©pr√©datrices de faible intensit√© et √† des attaques-surprises contre de petits points forts. Et c'√©tait du sein m√™me des deux dimensions d'entreprendre et de faire la guerre que jaillissait, multiforme, la chevauch√©e et, en chemin, elle acqu√©rait son √©norme importance en tant qu'instrument strat√©gique et tactique essentiel. √Ä partir de ces pr√©suppos√©s, nous analysons comment la chevauch√©e √©tait l'instrument principal de la routine guerri√®re. Pour les Castillans, c'√©tait un solide et efficace √©l√©ment d'usure dans le cadre de directives strat√©giques g

  9. Comparison of Neisseria gonorrhoeae MICs Obtained by Etest and Agar Dilution for Ceftriaxone, Cefpodoxime, Cefixime and Azithromycin.

    Science.gov (United States)

    Gose, Severin; Kong, Carol J; Lee, Yer; Samuel, Michael C; Bauer, Heidi M; Dixon, Paula; Soge, Olusegun O; Lei, John; Pandori, Mark

    2013-10-24

    We evaluated Neisseria gonorrhoeae Etest minimum inhibitory concentrations (MICs) relative to agar dilution MICs for 664 urethral isolates for ceftriaxone (CRO) and azithromycin (AZM), 351 isolates for cefpodoxime (CPD) and 315 isolates for cefixime (CFM). Etest accurately determined CPD, CFM and AZM MICs, but resulted in higher CRO MICs. © 2013. Published by Elsevier B.V. All rights reserved.

  10. Choline chloride based ionic liquid analogues as tool for the fabrication of agar films with improved mechanical properties

    Science.gov (United States)

    In the present paper, we test the suitability of Choline-Cl/urea (DES-U) and Choline-Cl/glycerol (DES-G) eutectic mixtures at 1:2 molar ratios for the production of agar biodegradable films. A three-step process is proposed: pre-solubilization of polymer in DES followed by compression-molding and s...

  11. Detection of Fusobacterium nucleatum in two cases of empyema and lung abscess using paromomycin-vancomycin supplemented Brucella HK agar.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Kohno, Shigeru

    2017-02-01

    Fusobacterium nucleatum was found in patients with empyema or pulmonary abscess, using paromomycin-vancomycin Brucella HK agar. In vitro examination revealed that growth of the strains differed significantly in different media. Clinicians should be aware that suboptimal F. nucleatum cultivation methods may result in an underestimation of its frequency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.

    Science.gov (United States)

    Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran

    2017-08-01

    We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. [Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

    Science.gov (United States)

    Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

    2014-01-01

    Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

  14. Evaluatie van de membraanfiltratiemethode op mCP-agar voor bepaling van sporen van Clostridium perfringens in water

    NARCIS (Netherlands)

    Schets FM; Medema GJ; LWL

    1995-01-01

    Current Dutch and European drinking water standards include criteria for spores of sulphite reducing clostridia. This has some inherent disadvantages. The reproducibility of the enumeration method for spores of sulphite reducing clostridia (SSRC) in Sulphite Cycloserine Agar (SCA) is poor. Some

  15. Elementos de transformación cultural y religiosa en un barrio histórico de Granada: las cruces del Albaicín

    Directory of Open Access Journals (Sweden)

    Juan Manuel Martín García

    2007-12-01

    Full Text Available Las cruces populares son, entre las formas y motivos con los que tradicionalmente se expresa la cultura religiosa de una sociedad, uno de sus exponentes más representativos pues con frecuencia, y así ocurre en el caso de Granada y particularmente en uno de sus barrios históricos, el del Albaicín, han contribuido a la definición de la propia imagen de la ciudad y a traducir a través de ellas una concretos componentes de significación no sólo religiosa o espiritual sino también política, social y cultural.

  16. Juan de Rueda Alcántara y la construcción de las cárceles secretas de la Inquisición en Granada

    Directory of Open Access Journals (Sweden)

    Luis Méndez Rodríguez

    2007-12-01

    Full Text Available En 1687, Juan de Rueda Alcántara presentó a petición del inquisidor Fernando de Villamarín, el proyecto para realizar la construcción de unas nuevas cárceles secretas para el Tribunal de la Inquisición en Granada. Este trabajo analiza el plano y los alzados inéditos de este edificio a partir de una copiosa documentación, así como el proceso constructivo que se inició y los problemas derivados de la construcción, que enfrentó en una agria polémica al tribunal granadino con el Consejo de la Inquisición.

  17. CLAVES DE COOPERACI√ďN INTERDISCIPLINAR: UNA VISI√ďN RETROSPECTIVA DE LA EDUCACI√ďN AMBIENTAL DESDE SU TRAYECTORIA EN LA UNIVERSIDAD DE GRANADA

    Directory of Open Access Journals (Sweden)

    Francisco Javier Perales Palacios

    2010-01-01

    Full Text Available Las universidades espa√Īolas, en las dos √ļltimas d√©cadas, han incorporado progresivamente en sus agendas de prioridades las tem√°ticas ambientales. En este art√≠culo se presenta la trayectoria recorrida por la Universidad de Granada en su incorporaci√≥n de la Educaci√≥n Ambiental a los √°mbitos de la docencia, la investigaci√≥n y la gesti√≥n. Se aportan claves de √©xito en el trabajo compartido de dos grupos de investigaci√≥n con tradiciones disciplinares diferentes que nos relatan c√≥mo la cooperaci√≥n resulta un elemento clave para avanzar en la implantaci√≥n de proyectos, programas, iniciativas e investigaciones en el campo de la Educaci√≥n Ambiental.

  18. CLAVES DE COOPERACI√ďN INTERDISCIPLINAR: UNA VISI√ďN RETROSPECTIVA DE LA EDUCACI√ďN AMBIENTAL DESDE SU TRAYECTORIA EN LA UNIVERSIDAD DE GRANADA

    Directory of Open Access Journals (Sweden)

    Francisco Javier Perales Palacios

    2010-02-01

    Full Text Available Las universidades espa√Īolas, en las dos √ļltimas d√©cadas, han incorporado progresivamente en sus agendas de prioridades las tem√°ticas ambientales. En este art√≠culo se presenta la trayectoria recorrida por la Universidad de Granada en su incorporaci√≥n de la Educaci√≥n Ambiental a los √°mbitos de la docencia, la investigaci√≥ny la gesti√≥n. Se aportan claves de √©xito en el trabajo compartido de dos grupos de investigaci√≥n con tradiciones disciplinares diferentes que nos relatan c√≥mo la cooperaci√≥n resulta un elemento clave para avanzar en la implantaci√≥n de proyectos, programas, iniciativas e investigaciones en el campo de la Educaci√≥n Ambiental.

  19. Hydrogeological and Hydrogeochemical Modelling of the Alicun de las Torres Termal System (Province of Granada). Isotope Hydrochemistry and Gases in Groundwaters

    International Nuclear Information System (INIS)

    Prado Perez, A. J.; Delgado, A.; Crespo, M. T.; Martin, A.; Vaselli, O.; Perez del Villar, L.

    2010-01-01

    In the framework of a Singular Strategic Project entitled: A dvanced Technologies of Carbon, Capture and Storage (CCS) , supported by the MICINN (Spain) and the FEDER founds (EU), specifically in the Carbon Storage Task, a comprehensive study on the CO 2 leakage as DIC (Dissolved Inorganic Carbon) in the Alicun de Las Torres (Prov. of Granada) natural analogue thermal system was envisaged. This analogous system is characterised by the presence of a very important travertine formation, which can be considered as a permanent and stable sink for CO 2 . In order to explain the formation of these travertine mass an hydrogeological and hydrogeochemical model of the area has been established by using the hydrochemical data, the stable and radioactive isotope characteristics, the dissolved inorganic carbon, as well as the chemical and isotopic composition of the free and dissolved gases of the above mentioned Thermal System. (Author) 11 refs.

  20. Análisis de los resultados ECAES del Programa de Economía de la Universidad Militar Nueva Granada (2004-2006

    Directory of Open Access Journals (Sweden)

    Luis Eduardo Sandoval

    2007-01-01

    Full Text Available El presente documento realiza un an√°lisis comparativo entre los resultados obtenidos por las Universidades Privadas con Jornada Diurna y Nocturna, as√≠ como en las Universidades P√ļblicas para luego analizar estos resultados en t√©rminos de la poblaci√≥n evaluada en el programa de econom√≠a de la Universidad Militar Nueva Granada en la prueba ECAES realizada en el periodo comprendido entre 2004-2006, con esto se busca conocer el comportamiento de la poblaci√≥n de estudiantes en cada uno de los componentes de manera que se puedan analizar las diferencias seg√ļn el tipo de jornada y de instituci√≥n.

  1. 'El influjo del clima sobre los seresorganizadoz' y la retoríca ilustrada en el Semanario del Nuevo Reino de Granada.

    Directory of Open Access Journals (Sweden)

    Mauricio Nieto.

    2005-07-01

    Full Text Available On the basis of an analysis of the debate about the influence of climate on living beings that took place in the Semanario del Nuevo Reyno de Granada, this article aims to illustrate the social and political character of natural sciences in Spanish America during the first decades of the 19th century. Te text offers a description of the argumentative resources employed in this debate and the ways in which reliable knowledge and credible arguments were built. In this sense, it also demonstrates how subjects with both scientific and political authority, the enlightened creoles, were constructed. Te article poses a discussion about the rules of the game of enlightened knowledge arguing that notions such as ‚Äėnature‚Äô, ‚Äėtechnology and ‚Äėsociety‚Äô are inseparable.

  2. Teoría y práctica de la planificación territorial en las aglomeraciones urbanas de Sevilla y Granada

    Directory of Open Access Journals (Sweden)

    Amparo Ferrer Rodríguez

    2010-01-01

    Full Text Available La actual dinámica urbana en la mayor parte del mundo occidental se caracteriza por un cambio de modelo de crecimiento en el que el protagonismo ha pasado de las grandes urbes, que en su devenir habían propiciado un patrón de ciudad compacta, a sus periferias, lo que ha favorecido el surgimiento de una ciudad difusa, consumidora de una gran cantidad de recursos y generadora de multitud de problemas. Sevilla y Granada, en el caso andaluz, ejemplifican a la perfección este proceso. El planeamiento urbanístico y la planificación territorial intentan, con dudoso éxito, frenar esta tendencia movida por intereses económicos que muchas veces quedan fuera de control.

  3. Memory, Art and Mourning: the Case of the 'Salón del Nunca Más' of Granada (Antioquia, Colombia

    Directory of Open Access Journals (Sweden)

    Elkin Rubiano Pinilla

    2017-07-01

    Full Text Available This document examines the work produced in the 'Sal√≥n del Nunca M√°s', located in Granada (Antioquia on the subject of collective memory. In this rural town, the 'Sal√≥n' has articulated different practices that, along with the construction of memory, have allowed survivors of violence and family members of killed and disappeared individuals to symbolize loss by means of public rituals. On the other hand, the article explores the visual settings that lay down the event, not only the exposure of violent events but the practices of the local community: what happens in the 'Sal√≥n', the journalistic covering (written press, the documental photography (Jes√ļs Abad Colorado and the artistic work (Erika Diettes. For this purpose, archival material, a historical interdisciplinary approach, psychoanalysis and image and communication theories, as well as interviews is referenced through this article.

  4. Schools in the Parochial Turmoil: Local Conflict and Dispute in the Province of Popay√°n in the State of New Granada, 1832-1851

    Directory of Open Access Journals (Sweden)

    Luis Ervin Prado Arellano

    2018-01-01

    Full Text Available One of the main goals of the State of New Granada (1832-1855 was the establishment of primary schools in every corner of the Republic. Part of this policy was regulated on May 19 1834, together with other policies (Law 2 of the 16th of May 1836 and Law 3 of the 13th of June 1844, which provided the framework within which the parish centers could establish these educational institutions. However, the policy, which promoted literacy in citizens, fostered conflict among local neighbors, be it because of the contributions that the inhabitants had to pay to fund these schools or because of the selection of the primary school teachers. This article examines such conflicts and, behind them, reveals the local rivalries and the factions in which the parish had been split into. The above unveils the dissemination of primary education as complex and torturous as the state process faced the web of local power.

  5. UN AN√ĀLISIS DE LOS PROFESIONALES EN ECONOM√ćA DE LA UNIVERSIDAD MILITAR NUEVA GRANADA: MERCADO LABORAL Y COMPETENCIAS

    Directory of Open Access Journals (Sweden)

    JOS√Č ISRAEL BAUTISTA RAM√ćREZ

    2013-01-01

    Full Text Available El presente artículo presenta un diagnóstico de la formación y desarrollo profesional de los econo- mistas egresados de la Universidad Militar Nueva Granada, a partir de 58 encuestas a exalumnos. Se contrasta dicha información con los requerimientos específicos que hace el mercado laboral a través del Consejo de Empresas Americanas (CEA y el Grupo Social y Empresarial de la Defensa (GSED. El estudio arroja coincidencias significativas en torno a las necesidades y requerimientos que se demandan, teniendo en cuenta aspectos fundamentales como la inserción de asignaturas relevantes, la inclusión laboral, el manejo de conocimientos específicos y en términos generales la consolidación de economistas fuertemente instruidos en competencias argumentativas, propositi- vas, interpretativas y analíticas.

  6. Power Alliances in a Historical Region: the Case of the Pamplona Elite in the Viceroyalty of Nueva Granada, 1795-1808

    Directory of Open Access Journals (Sweden)

    Lina Constanza Díaz Boada

    2016-01-01

    Full Text Available The social dynamics in Pamplona de Indias, province of the Viceroyalty of Nueva Granada, in the late eighteenth and early nineteenth century, show the rise and consolidation of the group formed by landowners-traders inserted in the agricultural export circuit having its exit point through the Maracaibo Lake. We discuss the concept historical region explained by social networks, analyzing power alliances established by the Pamplona¬īs elite during the years 1795 to 1808. The interest of this work is to deepening the comprehension of links based on kinship amongst members of this social elite.¬† Those links enabled them to expand its local network reaching both economic and political insertion in various regional circuits.

  7. Modeling particulate removal in plate-plate and wire-plate electrostatic precipitators

    Directory of Open Access Journals (Sweden)

    S Ramechecandane

    2016-09-01

    Full Text Available The present study is concerned with the modeling of electrically charged particles in a model plate-plate and a single wire-plate electrostatic precipitator (ESP. The particle concentration distributions for both a plate-plate and a wire-plate ESP are calculated using a modified drift flux model. Numerical investigations are performed using the modified drift flux model for particle number concentration, in addition to the RNG k - őĶ model for the mean turbulent flow field and the Poisson equation for the electric field. The proposed model and the outlined methodology for coupling the flow field, electric field, charging kinetics and particle concentration is applied to two model precipitators that are truly representative of a wide class of commercialized ESPs. The present investigation is quite different from the earlier studies as it does not make assumptions like a homogeneous electric field or an infinite turbulent diffusivity. The electric field calculated is a strong function of position and controls the migration velocity of particles. Hence, the proposed model can be implemented in a flow solver to obtain a full-fledged solution for any kind of ESP with no limitations on the particle number concentration, as encountered in a Lagrangian approach. The effect of turbulent diffusivity on particle number concentration in a plate-plate ESP is investigated in detail and the results obtained are compared with available experimental data. Similarly, the effect of particle size/diameter and applied electric potential on the accumulative collection performance in the case of a wire-plate ESP is studied and the results obtained are compared with available numerical data. The numerical results obtained using the modified drift flux model for both the plate-plate and wire-plate ESP are in close agreement with available experimental and numerical data.

  8. GRANADA, CANARIAS, AM√ČRICA: EL USO DE PR√ĀCTICAS ATERRORIZANTES EN LA PRAXIS DE TRES CONQUISTAS, 1482-1557

    Directory of Open Access Journals (Sweden)

    ANTONIO ESPINO L√ďPEZ

    2012-12-01

    Full Text Available Nuestro prop√≥sito en este art√≠culo es se√Īalar algunos rasgos afines en los procesos de conquista de Granada, Canarias y Am√©rica, remarcando c√≥mo el comportamiento militar de los hispanos se bas√≥ notablemente en el uso de toda una n√≥mina de pr√°cticas aterrorizantes herederas de los modelos coercitivos propios del imperialismo romano. Por otro lado, esta reflexi√≥n sobre la problem√°tica debe conducirnos a otras nuevas, se√Īalando, m√°s que las limitaciones de las cr√≥nicas a la hora de abordar tales cuestiones, c√≥mo afrontan estas la narraci√≥n de la violencia y remarcando una vez m√°s la necesidad de huir de la cosm√©tica de la conquista hispana de las Indias.The aim of this article is to call attention to the related characteristics in the conquest process of Granada, the Canaries and America, highlighting Spanish military behavior, which was mainly based on a wide range of terrifying practices taken from coercive models of the Roman Empire. This analysis of the problem should lead us to new problems, which show us how to deal with the accounts of violence, instead of focusing on the limitations of the chronicles themselves. This in turn also emphasizes the need to escape from the cosmetic image of the Spanish conquest of the Indies.

  9. La arquitectura escolar de José María García de Paredes en Granada. Un prototipo, tres escuelas

    Directory of Open Access Journals (Sweden)

    Castillo Hisp√°n, S.

    2016-03-01

    Full Text Available Jos√© Mar√≠a Garc√≠a de Paredes built three schools in Granada between 1964 and 1967. It was an architecture socially committed that carries on surprising fifty years later due to the clarity of its principles. These are the only school buildings that Garc√≠a de Paredes built during his career. In these buildings he presented a comprehensive approach about the educational architecture that was demanded in the society at the time. He was able to carry out these projects despite the hard circumstances in terms of construction, economy and time. These buildings were not intended to keep working during a long time and were made with simple materials. Yet, they have been successfully performing during fifty years without having changed its principles and shape.Jos√© Mar√≠a Garc√≠a de Paredes, construy√≥ entre 1964 y 1967 tres escuelas en Granada, una arquitectura comprometida, que sigue sorprendiendo cincuenta a√Īos despu√©s por la vigencia y rotundidad de los principios que las originaron. Estos son los √ļnicos edificios escolares que Garc√≠a de Paredes construy√≥ en su carrera, en ellos sintetizo un discurso completo sobre los nuevos espacios docentes que se demandaban por la sociedad de la √©poca. Y lo hizo en unas circunstancias especialmente complicadas en las que el proyecto surge como soluci√≥n a un problema casi imposible de tiempos, econom√≠a y construcci√≥n. Aunque nunca fueron pensadas para estar en servicio tanto tiempo y construidas con materiales humildes, han cumplido de una manera ejemplar los cincuenta a√Īos, y lo hacen en pleno funcionamiento, sin haber sufrido importantes modificaciones en las formas y principios que las generaron.

  10. Development and Validation of a Microbiological Agar Assay for Determination of Orbifloxacin in Pharmaceutical Preparations

    Directory of Open Access Journals (Sweden)

    Hérida R. N. Salgado

    2011-08-01

    Full Text Available Orbifloxacin is a fluoroquinolone with broad-spectrum antimicrobial activity, and belongs to the third generation of quinolones. Regarding the quality control of medicines, a validated microbiological assay for determination of orbifloxacin in pharmaceutical formulations has not as yet been reported. For this purpose, this paper reports the development and validation of a simple, sensitive, accurate and reproducible agar diffusion method to quantify orbifloxacin in tablet formulations. The assay is based on the inhibitory effect of orbifloxacin upon the strain of Staphylococcus aureus ATCC 25923 used as test microorganism. The results were treated statistically by analysis of variance and were found to be linear (r = 0.9992 in the selected range of 16.0‚Äď64.0 őľg/mL, precise with relative standard deviation (RSD of repeatability intraday = 2.88%, intermediate precision RSD = 3.33%, and accurate (100.31%. The results demonstrated the validity of the proposed bioassay, which allows reliable orbifloxacin quantitation in pharmaceutical samples and therefore can be used as a useful alternative methodology for the routine quality control of this medicine.

  11. Hypertonic sabouraud dextrose agar as a substrate for differentiation of Candida dubliniensis.

    Science.gov (United States)

    Akg√ľl, Onc√ľ; Cerik√ßiońülu, Nilg√ľn

    2009-06-01

    In this study, we aimed to detect the proportion of Candida dubliniensis among yeast strains previously identified as C. albicans by using several phenotypic methods and PCR.For this purpose, we screened 300 strains by using phenotypic tests suggested for the identification of C. dubliniensis in the literature, but we detected high proportion of false-positive reactions. Only two strains (0.6%) were detected as true C. dubliniensis by PCR and API ID 32C methods. Moreover, these two strains gave the expected results with all the phenotypic tests, including modified salt tolerance test for C. dubliniensis.In conclusion, none of the phenotypic methods, except for the modified salt tolerance test, revealed 100% successful results in discrimination of C. albicans and C. dubliniensis species. However, in the tobacco agar test, the rate of false positivity was as low as 0.6%. We suggest that in the case of absence of PCR and other automatized identification systems, these two phenotypic tests can be used in routine laboratories to obtain a presumptive result.

  12. Internal properties assessment in agar wood trees using ultrasonic velocity measurement

    International Nuclear Information System (INIS)

    Mohd Noorul Ikhsan Mohamed; Mohamad Pauzi Ismail; Mat Rasol Awang; Mohd Fajri Osman; Fakhruzi, M.; Hashim, M.M.

    2010-01-01

    This paper presents the application of ultrasonic velocity in agar wood trees (Aquilaria crassna) with the purpose of evaluating the relationship of the ultrasonic velocity to the variations of internal properties of trees. In this study, three circular cross-sectional discs from the freshly cut tree were selected as samples. First sample with a big hole (decay) in the middle, second sample with internal resinous and the last one is the sample with no defects. The through transmission ultrasonic testing method was carried out using Tico ultrasonic pulse velocity tester which is from Switzerland. Two-dimensional image of internal properties evaluation by an ultrasonic investigation was obtained using Matlab. The results showed that the ultrasonic wave cannot pass through the internal decay or resinous so that the wave went round it and thus ultrasonic wave velocity significantly decreased by increasing the hole or resinous. The difference in color of the image generated by Matlab software based on variation of ultrasonic velocity between the internal decay area and its surrounding area was obvious. Therefore, the properties of internal properties of the three could be detected by ultrasonic line imaging technique. (author)

  13. Functional properties of edible agar-based and starch-based films for food quality preservation.

    Science.gov (United States)

    Phan, The D; Debeaufort, F; Luu, D; Voilley, A

    2005-02-23

    Edible films made of agar (AG), cassava starch (CAS), normal rice starch (NRS), and waxy (glutinous) rice starch (WRS) were elaborated and tested for a potential use as edible packaging or coating. Their water vapor permeabilities (WVP) were comparable with those of most of the polysaccharide-based films and with some protein-based films. Depending on the environmental moisture pressure, the WVP of the films varies and remains constant when the relative humidity (RH) is >84%. Equilibrium sorption isotherms of these films have been measured; the Guggenheim-Anderson-de Boer (GAB) model was used to describe the sorption isotherm and contributed to a better knowledge of hydration properties. Surface hydrophobicity and wettability of these films were also investigated using the sessile drop contact angle method. The results obtained suggested the migration of the lipid fraction toward evaporation surface during film drying. Among these polysaccharide-based films, AG-based film and CAS-based film displayed more interesting mechanical properties: they are transparent, clear, homogeneous, flexible, and easily handled. NRS- and WRS-based films were relatively brittle and have a low tension resistance. Microstructure of film cross section was observed by environmental scanning electron microscopy to better understand the effect of the structure on the functional properties. The results suggest that AG-based film and CAS-based films, which show better functional properties, are promising systems to be used as food packaging or coating instead of NRS- and WRS-based films.

  14. Estimating the Diffusion Coefficients of Sugars Using Diffusion Experiments in Agar-Gel and Computer Simulations.

    Science.gov (United States)

    Miyamoto, Shuichi; Atsuyama, Kenji; Ekino, Keisuke; Shin, Takashi

    2018-01-01

    The isolation of useful microbes is one of the traditional approaches for the lead generation in drug discovery. As an effective technique for microbe isolation, we recently developed a multidimensional diffusion-based gradient culture system of microbes. In order to enhance the utility of the system, it is favorable to have diffusion coefficients of nutrients such as sugars in the culture medium beforehand. We have, therefore, built a simple and convenient experimental system that uses agar-gel to observe diffusion. Next, we performed computer simulations-based on random-walk concepts-of the experimental diffusion system and derived correlation formulas that relate observable diffusion data to diffusion coefficients. Finally, we applied these correlation formulas to our experimentally-determined diffusion data to estimate the diffusion coefficients of sugars. Our values for these coefficients agree reasonably well with values published in the literature. The effectiveness of our simple technique, which has elucidated the diffusion coefficients of some molecules which are rarely reported (e.g., galactose, trehalose, and glycerol) is demonstrated by the strong correspondence between the literature values and those obtained in our experiments.

  15. Acidity Tunable Ionic Liquids as Catalysts for Conversion of Agar into Mixed Sugars

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Churl; Kim, Hoon Sik [Kyung Hee Univ., Seoul (Korea, Republic of); Ryu, Hyun Jin; Kim, Sang Hyoun; Yoon, Jeong Jun; Kim, Yong Jin [Korea Institute of Industrial Technology, Cheonan (Korea, Republic of)

    2010-02-15

    To summarize, various factors affecting yields of Gal, AG, and 5-HMF formation during saccharification were investigated using agar as a substrate in the presence of several bisulfate-based acidic ionic liquids as catalysts. The result was compared with employing sulfuric acid from the viewpoint of sugar yields and 5-HMF formation. [Bmim][HSO{sub 4}], [Hmim][HSO{sub 4}], [Morph] [HSO{sub 4}], [Bu{sub 4}N][HSO{sub 4}], [Bu{sub 4}P][HSO{sub 4}], [Chol][HSO{sub 4}] showed moderate to high yields of Gal and AG with a remarkable decrease in 5-HMF formation compared with sulfuric acid. Among them, [Chol][HSO{sub 4}] ionic liquid was found to exhibit the highest yield of sugars with an acceptable concentration of 5-HMF that does not inhibit the fermentation process. Generally, there are five major bottom lines for a bioethanol process to be economically viable: the feedstock must be plentiful, inexpensive, in high energy conversion rate, in low demand for food industry, and finally, has to be cultivated in sustainable systems.

  16. Unraveling the nuclear and chloroplast genomes of an agar producing red macroalga, Gracilaria changii (Rhodophyta, Gracilariales).

    Science.gov (United States)

    Ho, Chai-Ling; Lee, Wei-Kang; Lim, Ee-Leen

    2018-03-01

    Agar and agarose have wide applications in food and pharmaceutical industries. Knowledge on the genome of red seaweeds that produce them is still lacking. To fill the gap in genome analyses of these red algae, we have sequenced the nuclear and organellar genomes of an agarophyte, Gracilaria changii. The partial nuclear genome sequence of G. changii has a total length of 35.8Mb with 10,912 predicted protein coding sequences. Only 39.4% predicted proteins were found to have significant matches to protein sequences in SwissProt. The chloroplast genome of G. changii is 183,855bp with a total of 201 open reading frames (ORFs), 29 tRNAs and 3 rRNAs predicted. Five genes: ssrA, leuC and leuD CP76_p173 (orf139) and pbsA were absent in the chloroplast genome of G. changii. The genome information is valuable in accelerating functional studies of individual genes and resolving evolutionary relationship of red seaweeds. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Comparison of three techniques for production goat lentivirus antigen used in the agar gel immunodifusion test

    Directory of Open Access Journals (Sweden)

    Raymundo Rizaldo Pinheiro

    2005-12-01

    Full Text Available The Caprine Arthritis Encephalitis (CAE is a disease who cause considerable economic losses, including loss in the milk production and reduction of the useful life of the animal. In the diagnosis of this disease the agar gel immunodifusion test (AGID is used worldwide as the selection test. The objective of thid work was to test three different concentrations of bovine fetal serum (BFS in the production of the antigen (Ag for the diagnosis of the CAE virus (CAEV, to verify amongst the three methods the most efficient concentration and which the antigen concentration of the antigen produced is appropriate for the test. The method of the AMICON and the concentration of the Ag for dialysis was indicated, however the system AMICON, despite the implantation costs, promoted minor loss of antigen, little time expense in the processing and greater simplicity. With relation to the amount of BFS placed after the viral inoculation it was verified that 5% of BFS the amount that presented better resulted. The antigen concentration 100 times was more indicated, therefore it allowed the diagnosis of the CAEV for two proteins (gp 135 and p28. The concentration of the Ag for precipitation/ultracentrifugation, used for imunoenzimatic tests, did not present resulted satisfactory used in the AGID.

  18. Antimicrobial susceptibility of Brazilian Clostridium difficile strains determined by agar dilution and disk diffusion

    Directory of Open Access Journals (Sweden)

    Edmir Geraldo Fraga

    2016-09-01

    Full Text Available Clostridium difficile is a leading cause of diarrhea in hospitalized patients worldwide. While metronidazole and vancomycin are the most prescribed antibiotics for the treatment of this infection, teicoplanin, tigecycline and nitazoxanide are alternatives drugs. Knowledge on the antibiotic susceptibility profiles is a basic step to differentiate recurrence from treatment failure due to antimicrobial resistance. Because C. difficile antimicrobial susceptibility is largely unknown in Brazil, we aimed to determine the profile of C. difficile strains cultivated from stool samples of inpatients with diarrhea and a positive toxin A/B test using both agar dilution and disk diffusion methods. All 50 strains tested were sensitive to metronidazole according to CLSI and EUCAST breakpoints with an MIC90 value of 2¬†őľg/mL. Nitazoxanide and tigecycline were highly active in vitro against these strains with an MIC90 value of 0.125¬†őľg/mL for both antimicrobials. The MIC90 were 4¬†őľg/mL and 2¬†őľg/mL for vancomycin and teicoplanin, respectively. A resistance rate of 8% was observed for moxifloxacin. Disk diffusion can be used as an alternative to screen for moxifloxacin resistance, nitazoxanide, tigecycline and metronidazole susceptibility, but it cannot be used for testing glycopeptides. Our results suggest that C. difficile strains from S√£o Paulo city, Brazil, are susceptible to metronidazole and have low MIC90 values for most of the current therapeutic options available in Brazil.

  19. Theoretical and experimental NMR studies on muscimol from fly agaric mushroom (Amanita muscaria)

    Science.gov (United States)

    Kupka, Teobald; Wieczorek, Piotr P.

    2016-01-01

    In this article we report results of combined theoretical and experimental NMR studies on muscimol, the bioactive alkaloid from fly agaric mushroom (Amanita muscaria). The assignment of 1H and 13C NMR spectra of muscimol in DMSO-d6 was supported by additional two-dimensional heteronuclear correlated spectra (2D NMR) and gauge independent atomic orbital (GIAO) NMR calculations using density functional theory (DFT). The effect of solvent in theoretical calculations was included via polarized continuum model (PCM) and the hybrid three-parameter B3LYP density functional in combination with 6-311++G(3df,2pd) basis set enabled calculation of reliable structures of non-ionized (neutral) molecule and its NH and zwitterionic forms in the gas phase, chloroform, DMSO and water. GIAO NMR calculations, using equilibrium and rovibrationally averaged geometry, at B3LYP/6-31G* and B3LYP/aug-cc-pVTZ-J levels of theory provided muscimol nuclear magnetic shieldings. The theoretical proton and carbon chemical shifts were critically compared with experimental NMR spectra measured in DMSO. Our results provide useful information on its structure in solution. We believe that such data could improve the understanding of basic features of muscimol at atomistic level and provide another tool in studies related to GABA analogs.

  20. [Variations in hyperbilirrubinemia in low birth weight newborns under phototherapy and continous or discontinous agar oral administration (author's transl)].

    Science.gov (United States)

    Colomer, J; Moya, M; Marco, V; De Paredes, C; Escriv√°, F; Vila, R

    1975-06-01

    Therapeutic attitude in hyperbilirrubinemia is always worth because other infrequent complications but not for this, less important. Phototherapy innocuousness, largely demonstrated, fosters its profilactic use at beginning and not only for those babies with serum bilirrubin over 10 mg % in the first day of life. Previously we have reported positive results with agar oral administration without collateral effects. On this grounds we have planned the following experience in a homogenous group of L.B.W.: one group was fed with agar previously to each formula administration; other group received the same amount of agar but divided in only three administrations in 24 hours; the last group received continuous phototherapy for 96 hours with a white cold fluorescent light from a source of 8-Vita-lite lamp of 40 watts with a intensity of 500 foot candle and 30 lumens. All of these babies weighed less than 2.500 g. and were between 10 and 90 percentil of Lubschenko diagram. They were fed with the same formula and same time table with no infusions, rejecting all that presented any type of pathology. Obstetric conditions were basically identical. This population was randomly divided in four groups. 1) Control group with no profilaxis, but with identical bilirrubin andhematocrit determinations. 2) Group with continuous agar oral administration, 125 mg. before each of the seven formula feeding. 3) Group with discontinuous agar administration, 250 mg. before three of the seven formula feeding. 4) Group with continuous phototherapy for 96 hours. These is initial identification of the groups with statistic signification, and after that a quantitative and sequential evolution of bilirrubin is analized in each group.

  1. Laterally Loaded Nail-Plates

    DEFF Research Database (Denmark)

    Nielsen, Jacob; Rathkjen, Arne

    Load-displacement curves from about 200 short-term and laterally loaded nail-plate joints are analysed. The nail-plates are from Gang-Nail Systems, type GNA 20 S. The test specimens and the measuring systems are described. The tests are divided into 32 different series. The influence of the number...

  2. MyPlate Food Guide

    Science.gov (United States)

    ... Safe Videos for Educators Search English Espa√Īol MyPlate Food Guide KidsHealth / For Teens / MyPlate Food Guide What's ... and other sugary drinks. Avoid large portions . Five Food Groups Different food groups have different nutrients and ...

  3. Scintillating plate calorimeter optical design

    International Nuclear Information System (INIS)

    McNeil, R.; Fazely, A.; Gunasingha, R.; Imlay, R.; Lim, J.

    1990-01-01

    A major technical challenge facing the builder of a general purpose detector for the SSC is to achieve an optimum design for the calorimeter. Because of its fast response and good energy resolution, scintillating plate sampling calorimeters should be considered as a possible technology option. The work of the Scintillating Plate Calorimeter Collaboration is focused on compensating plate calorimeters. Based on experimental and simulation studies, it is expected that a sampling calorimeter with alternating layers of high-Z absorber (Pb, W, DU, etc.) and plastic scintillator can be made compensating (e/h = 1.00) by suitable choice of the ratio of absorber/scintillator thickness. Two conceptual designs have been pursued by this subsystem collaboration. One is based on lead as the absorber, with read/out of the scintillator plates via wavelength shifter fibers. The other design is based on depleted uranium as the absorber with wavelength shifter (WLS) plate readout. Progress on designs for the optical readout of a compensating scintillator plate calorimeter are presented. These designs include readout of the scintillator plates via wavelength shifter plates or fiber readout. Results from radiation damage studies of the optical components are presented

  4. Comparative evaluation of direct plating and most probable number for enumeration of low levels of Listeria monocytogenes in naturally contaminated ice cream products.

    Science.gov (United States)

    Chen, Yi; Pouillot, Régis; S Burall, Laurel; Strain, Errol A; Van Doren, Jane M; De Jesus, Antonio J; Laasri, Anna; Wang, Hua; Ali, Laila; Tatavarthy, Aparna; Zhang, Guodong; Hu, Lijun; Day, James; Sheth, Ishani; Kang, Jihun; Sahu, Surasri; Srinivasan, Devayani; Brown, Eric W; Parish, Mickey; Zink, Donald L; Datta, Atin R; Hammack, Thomas S; Macarisin, Dumitru

    2017-01-16

    A precise and accurate method for enumeration of low level of Listeria monocytogenes in foods is critical to a variety of studies. In this study, paired comparison of most probable number (MPN) and direct plating enumeration of L. monocytogenes was conducted on a total of 1730 outbreak-associated ice cream samples that were naturally contaminated with low level of L. monocytogenes. MPN was performed on all 1730 samples. Direct plating was performed on all samples using the RAPID'L.mono (RLM) agar (1600 samples) and agar Listeria Ottaviani and Agosti (ALOA; 130 samples). Probabilistic analysis with Bayesian inference model was used to compare paired direct plating and MPN estimates of L. monocytogenes in ice cream samples because assumptions implicit in ordinary least squares (OLS) linear regression analyses were not met for such a comparison. The probabilistic analysis revealed good agreement between the MPN and direct plating estimates, and this agreement showed that the MPN schemes and direct plating schemes using ALOA or RLM evaluated in the present study were suitable for enumerating low levels of L. monocytogenes in these ice cream samples. The statistical analysis further revealed that OLS linear regression analyses of direct plating and MPN data did introduce bias that incorrectly characterized systematic differences between estimates from the two methods. Published by Elsevier B.V.

  5. Fundamental processes in ion plating

    International Nuclear Information System (INIS)

    Mattox, D.M.

    1980-01-01

    Ion plating is a generic term applied to film deposition processes in which the substrate surface and/or the depositing film is subjected to a flux of high energy particles sufficient to cause changes in the interfacial region of film properties compared to a nonbombarded deposition. Ion plating is being accepted as an alternative coating technique to sputter deposition, vacuum evaporation and electroplating. In order to intelligently choose between the various deposition techniques, the fundamental mechanisms, relating to ion plating, must be understood. This paper reviews the effects of low energy ion bombardment on surfaces, interface formation and film development as they apply to ion plating and the implementation and applications of the ion plating process

  6. En los albores del catastro parcelario territorial en Espa√Īa: los mapas topogr√°ficos de Granada y su √°rea metropolitana (1819-1820

    Directory of Open Access Journals (Sweden)

    García-Pulido, Luis José

    2016-06-01

    Full Text Available The Topographic map of the city of Granada and its municipal district was accomplished in 1819 with accuracy and graphical quality as a pioneering work in the area of the land registries maps in Spain. It was conducted by Francisco Dalmau (1766-1824, illustrate mathematic who accomplished numerous titles ending with Headmaster of the Statistics of the Province of Granada. One year later he directed 18 maps more, corresponding to some towns and villages in Granada district. These documents are previous in some decades to other similar works done in Spanish cities. This article gives a general layout of the agrarian land of the surroundings of Granada from the global analysis of these cartographic documents and their geographic data that, in spite of have been promoted out of the military scope, are preserved in the Army‚Äôs Geographic Centre.En 1819 se elabor√≥ con notable precisi√≥n y calidad gr√°fica el Mapa topogr√°fico de la ciudad de Granada y su t√©rmino, obra pionera en el √°mbito de los planos catastrales parcelarios espa√Īoles. Su autor fue Francisco Dalmau (1766-1824, matem√°tico ilustrado que acapar√≥ numerosos t√≠tulos, culminados con el de director de la Estad√≠stica de la Provincia de Granada. Un a√Īo m√°s tarde dirigi√≥ la elaboraci√≥n de 18 mapas m√°s, correspondientes a los t√©rminos municipales de los lugares y villas del partido granadino. Con esta iniciativa se adelantar√≠a en varias d√©cadas a los trabajos de similares caracter√≠sticas realizados en otras poblaciones espa√Īolas. En este art√≠culo se ofrece una completa visi√≥n del uso del suelo agrario en el entorno de la capital granadina a partir del an√°lisis conjunto de los datos geogr√°ficos contenidos en estas cartograf√≠as que, pese a que fueron promovidas fuera del √°mbito militar, se han conservado en el Centro Geogr√°fico del Ej√©rcito.

  7. The Golosyiv plate archive digitisation

    Science.gov (United States)

    Sergeeva, T. P.; Sergeev, A. V.; Pakuliak, L. K.; Yatsenko, A. I.

    2007-08-01

    The plate archive of the Main Astronomical Observatory of the National Academy of Sciences of Ukraine (Golosyiv, Kyiv) includes about 85 000 plates which have been taken in various observational projects during 1950-2005. Among them are about 25 000 of direct northern sky area plates and more than 600 000 plates containing stellar, planetary and active solar formations spectra. Direct plates have a limiting magnitude of 14.0-16.0 mag. Since 2002 we have been organising the storage, safeguarding, cataloguing and digitization of the plate archive. The very initial task was to create the automated system for detection of astronomical objects and phenomena, search of optical counterparts in the directions of gamma-ray bursts, research of long period, flare and other variable stars, search and rediscovery of asteroids, comets and other Solar System bodies to improve the elements of their orbits, informational support of CCD observations and space projects, etc. To provide higher efficiency of this work we have prepared computer readable catalogues and database for 250 000 direct wide field plates. Now the catalogues have been adapted to Wide Field Plate Database (WFPDB) format and integrated into this world database. The next step will be adaptation of our catalogues, database and images to standards of the IVOA. Some magnitude and positional accuracy estimations for Golosyiv archive plates have been done. The photometric characteristics of the images of NGC 6913 cluster stars on two plates of the Golosyiv's double wide angle astrograph have been determined. Very good conformity of the photometric characteristics obtained with external accuracies of 0.13 and 0.15 mag. has been found. The investigation of positional accuracy have been made with A3¬Ī format fixed bed scanner (Microtek ScanMaker 9800XL TMA). It shows that the scanner has non-detectable systematic errors on the X-axis, and errors of ¬Ī 15 őľm on the Y-axis. The final positional errors are about ¬Ī 2 őľm (¬

  8. Indonesian Landforms and Plate Tectonics

    Directory of Open Access Journals (Sweden)

    Herman Th. Verstappen

    2014-06-01

    Full Text Available DOI:¬†10.17014/ijog.v5i3.103The horizontal configuration and vertical dimension of the landforms occurring in the tectonically unstable parts of Indonesia were resulted in the first place from plate tectonics. Most of them date from the Quaternary and endogenous forces are ongoing. Three major plates ‚Äď the northward moving Indo-Australian Plate, the south-eastward moving SE-Asian Plate and the westward moving Pacific Plate - meet at a plate triple-junction situated in the south of New Guinea‚Äôs Bird‚Äôs Head. The narrow North-Moluccan plate is interposed between the Asia and Pacific. It tapers out northward in the Philippine Mobile Belt and is gradually disappearing. The greatest relief amplitudes occur near the plate boundaries: deep ocean trenches are associated with subduction zones and mountain ranges with collision belts. The landforms of the more stable areas of the plates date back to a more remote past and, where emerged, have a more subdued relief that is in the first place related to the resistance of the rocks to humid tropical weathering Rising mountain ranges and emerging island arcs are subjected to rapid humid-tropical river erosions and mass movements. The erosion products accumulate in adjacent sedimentary basins where their increasing weight causes subsidence by gravity and isostatic compensations. Living and raised coral reefs, volcanoes, and fault scarps are important geomorphic indicators of active plate tectonics. Compartmental faults may strongly affect island arcs stretching perpendicular to the plate movement. This is the case on Java. Transcurrent faults and related pull-apart basins are a leading factor where plates meet at an angle, such as on Sumatra. The most complicated situation exists near the triple-junction and in the Moluccas. Modern research methods, such as GPS measurements of plate movements and absolute dating of volcanic outbursts and raised coral reefs are important tools. The mega-landforms resulting

  9. Analysis of High Quality Agar wood Oil Chemical Compounds By Means Of SPME/ GC-MS and Z-Score Technique

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Mohd Ali Nor Azah; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Currently, the grading of the agar wood oil to the high and low quality is done using manually such as human trained grader. It was performed based on the agar wood oil physical properties such as human experience and perception and the oil colour, odor and long lasting aroma. Several researchers found that chemical profiles of the oil should be utilized to overcome the problem facing by manual techniques for example human nose cannot tolerate with the many oils at the same time, so that accurate result can be obtained in grading the agar wood oil. The analysis involved of SPME/ GC-MS and Z-score techniques have been proposed in this study to analyze the chemical compounds especially from the high quality samples of agar wood oil (Aquilariamalaccensis) from Malaysia. Two SPME fibers were used such as divinylbenzene-carbogen-polydimethylsiloxane (DVB-CAR-PDMS) and polydimethylsiloxane (PDMS) in extracting the oils compound under three different sampling temperature conditions such as 40, 60 and 80 degree Celsius. The chemical compounds extracted by SPME/ GC-MS were analyzed. The chemical compounds as identified by Z-score as significant compounds were discussed before the conclusion is made. It was found that 10-epi-ő≥-eudesmol, aromadendrene, ő≤-agar ofuran, őĪ-agar ofuran and ő≥-eudesmol were highlighted as significant for high quality agar wood oil and can be used as a marker compounds in classifying the agar wood oil. (author)

  10. Equivalency testing of TTC Tergitol 7 agar (ISO 9308-1:2000) with five culture media for the detection of E. coli in water samples in Greece.

    Science.gov (United States)

    Mavridou, A; Smeti, E; Mandilara, G; Mandilara, G; Boufa, P; Vagiona-Arvanitidou, M; Vantarakis, A; Vassilandonopoulou, G; Pappa, O; Roussia, V; Tzouanopoulos, A; Livadara, M; Aisopou, I; Maraka, V; Nikolaou, E; Mandilara, G

    2010-01-01

    In this study ten laboratories in Greece compared the performance of reference method TTC Tergitol 7 Agar (with the additional test of beta-glucuronidase production) with five alternative methods, to detect E. coli in water, in line with European Water Directive recommendations. The samples were prepared by spiking drinking water with sewage effluent following a standard protocol. Chlorinated and non-chlorinated samples were used. The statistical analysis was based on the mean relative difference of confirmed counts and was performed in line with ISO 17994. The results showed that in total, three of the alternative methods (Chromocult Coliform agar, Membrane Lauryl Sulfate agar and Trypton Bilex-glucuronidase medium) were not different from TTC Tergitol 7 agar (TTC Tergitol 7 agar vs Chromocult Coliform agar, 294 samples, mean RD% 5.55; vs MLSA, 302 samples, mean RD% 1; vs TBX, 297 samples, mean RD% -2.78). The other two alternative methods (Membrane Faecal coliform medium and Colilert 18/ Quantitray) gave significantly higher counts than TTC Tergitol 7 agar (TTC Tergitol 7 agar vs MFc, 303 samples, mean RD% 8.81; vs Colilert-18/Quantitray, 76 samples, mean RD% 18.91). In other words, the alternative methods generated performance that was as reliable as, or even better than, the reference method. This study will help laboratories in Greece overcome culture and counting problems deriving from the EU reference method for E. coli counts in water samples.

  11. Comparison of Rosco Neo-Sensitabs with Oxoid paper disks in EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar

    DEFF Research Database (Denmark)

    Justesen, U S; Acar, Ziyap; Olsson, K

    2013-01-01

    This study compared Neo-Sensitabs with Oxoid paper disks using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) disk diffusion antimicrobial susceptibility test on Mueller-Hinton agar. The EUCAST-recommended quality control strains (Escherichia coli ATCC 25922, Pseudomonas...... paper disks for EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar....

  12. Chromium and zinc uptake by algae Gelidium and agar extraction algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-11-19

    Biosorption of chromium and zinc ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). Langmuir and Langmuir-Freundlich equilibrium models describe well the equilibrium data. The parameters of Langmuir equilibrium model at pH 5.3 and 20 degrees C were for the algae, q(L)=18 mg Cr(III)g(-1) and 13 mgZn(II)g(-1), K(L) = 0.021l mg(-1)Cr(III) and 0.026l mg(-1) Zn(II); for the algal waste, q(L)=12 mgCr(III)g(-1) and 7mgZn(II)g(-1), K(L)=0.033lmg(-1) Cr(III) and 0.042l mg(-1) Zn(II); for the composite material, q(L) = 9 mgCr(III)g(-1) and 6 mgZn(II)g(-1), K(L)=0.032l mg(-1)Cr(III) and 0.034l mg(-1)Zn(II). The biosorbents exhibited a higher preference for Cr(III) ions and algae Gelidium is the best one. The pseudo-first-order Lagergren and pseudo-second-order models fitted well the kinetic data for the two metal ions. Kinetic constants and equilibrium uptake concentrations given by the pseudo-second-order model for an initial Cr(III) and Zn(II) concentration of approximately 100 mgl(-1), at pH 5.3 and 20 degrees C were k(2,ads)=0.04 g mg(-1)Cr(III)min(-1) and 0.07 g mg(-1)Zn(II)min(-1), q(eq)=11.9 mgCr(III)g(-1) and 9.5 mgZn(II)g(-1) for algae; k(2,ads)=0.17 g mg(-1)Cr(III)min(-1) and 0.19 g mg(-1)Zn(II)min(-1), q(eq)=8.3 mgCr(III)g(-1) and 5.6 mgZn(II)g(-1) for algal waste; k(2,ads)=0.01 g mg(-1)Cr(III)min(-1) and 0.18 g mg(-1)Zn(II)min(-1), q(eq)=8.0 mgCr(III)g(-1) and 4.4 mgZn(II)g(-1) for composite material. Biosorption was modelled using a batch adsorber mass transfer kinetic model, which successfully predicts Cr(III) and Zn(II) concentration profiles. The calculated average homogeneous diffusivities, D(h), were 4.2 x 10(-8), 8.3 x 10(-8) and 1.4 x 10(-8)cm(2)s(-1) for Cr(III) and 4.8 x 10(-8), 9.7 x 10(-8) and 6.2 x 10(-8)cm(2)s(-1

  13. Defective plastic infection-control barriers and faulty technique may cause PSP plate contamination used in digital intraoral radiography.

    Science.gov (United States)

    Kuperstein, Arthur S

    2012-09-01

    Fifty-two disinfected photostimulable phosphor (PSP) plates in plastic barrier envelopes were evaluated for contamination following placement in 30 study participants. Forty-four plates were acceptable for use in the study. The risk factor was the abundant oropharyngeal microbial flora and its ability to breach infection-control barrier sheaths. The presence of bacterial colonies on an agar plate was used to determine bacterial contamination and the presence of any growth indicated failure of the barrier envelope. Before clinical placement of the plates, quality review of the PSP plates revealed defects in the integrity of 4 barrier envelopes most likely caused by forceps-related damage or failure to achieve a uniform seal during manufacturing. These defects allowed substantial contamination. Contamination also occurred as a result of failure to extract the PSP plate from the barrier envelope cleanly. Of the 44 barriers with no obvious signs of a defect, 3 produced bacterial growth following culture. The authors concluded that digital sensor sheathed in barrier envelopes remain a potential source of contamination. PSP plates must be disinfected between removal from a contaminated barrier envelope (used in a patient) and placement in a new barrier envelope. In addition, placement into the barrier envelope should ideally be carried out under aseptic conditions. Finally, the integrity of each sealed barrier envelope must be verified visually. Copyright © 2012. Published by Mosby, Inc. All rights reserved.

  14. Direct impression on agar surface as a diagnostic sampling procedure for candida balanitis.

    Science.gov (United States)

    Lisboa, Carmen; Santos, António; Azevedo, Filomena; Pina-Vaz, Cidália; Rodrigues, Acácio Gonçalves

    2010-02-01

    The diagnosis of candida balanitis should be based upon both clinical and mycological data. The procedure of material collection is a critical issue to confirm or rule out the clinical diagnosis of candida balanitis. To compare direct impression of the glans on the agar surface of solid culture media with the collection of genital exudates with cotton swab for the diagnosis of candida balanitis. A prospective cross-sectional study was carried out during a 36-month period. Sexually transmitted disease clinic attendees with balanitis and asymptomatic men were included. Specimens for yeast culture were collected from the glans penis and inner preputial layer using the direct impression on CHROMagar candida medium and by swabbing with a sterile cotton swab. Among 478 men enrolled, 189 had balanitis. The prevalence of candida balanitis was 17.8% (85/478) confirmed after culture by direct impression; the swab method detected only 54/85 (63.5%) of these men. Of the 289 asymptomatic men, 36 (12.5%) yielded Candida spp; the swab method detected only 38.9% of these men. The risk of having candida balanitis is 8.9 (IC 95% 2.48 to 32.04) whenever the number of candida colonies recovered by direct impression was greater than 10. Direct impression on CHROMagar candida medium resulted in the highest Candida spp recovery rate. More than 10 colonies yielded by impression culture were statistically associated with candida balanitis. This method shows the ideal profile for sampling the male genital area for yeasts and should be included in the management of balanitis.

  15. In vitro antifungal susceptibility testing of Scopulariopsis brevicaulis strains using agar diffusion method.

    Science.gov (United States)

    Skóra, Magdalena; Macura, Anna B

    2011-01-01

    The genus Scopulariopsis is a common soil saprotroph and has been isolated from air, organic waste and also from plant, animal and human tissues. Scopulariopsis has mainly been associated in humans with superficial mycoses, but it has also been described as the cause of subcutaneous and invasive infections. The most common aetiological agent of infections in humans is Scopulariopsis brevicaulis. This species has been reported to be resistant in vitro to broad-spectrum antifungal agents available today. The aim of the study was to establish in vitro antifungal susceptibility of 35 S. brevicaulis strains against amphotericin B (AMB), flucytosine (FC), caspofungin (CAS), terbinafine (TER), ciclopirox (CIC), voriconazole (VOR), clotrimazole (CTR), miconazole (MCZ), econazole (ECO), ketoconazole (KET), itraconazole (ITR), and fluconazole (FLU). Antifungal susceptibility tests were evaluated by an agar diffusion method (Neo-Sensitabs, Rosco, Denmark). AMB, FC, CAS, ITR and FLU showed no antifungal activity against S. brevicaulis. TER, CIC, CTR, KET, VOR, ECO, and MCZ revealed inhibitory activity for S. brevicaulis, but it varied for each of the drugs. The best antifungal effect was observed for TER and CIC. All isolates had large inhibition zones for TER and CIC. CTR was also inhibitory for all tested S. brevicaulis isolates, but the diameters of inhibition zones were smaller than for TER and CIC. Nearly 89% isolates showed inhibition zones for KET and the mean diameter of the inhibition zone was comparable to CTR. The least antifungal activity exhibited VQR, ECO and MCZ. Because of the multiresistance of S. brevicaulis, infections due to this species may not respond to particular antifungal treatment and other therapeutic approaches should be considered, e.g., combined therapy and/or surgery.

  16. Preparation and application of agar/alginate/collagen ternary blend functional food packaging films.

    Science.gov (United States)

    Wang, Long-Feng; Rhim, Jong-Whan

    2015-09-01

    Ternary blend agar/alginate/collagen (A/A/C) hydrogel films with silver nanoparticles (AgNPs) and grapefruit seed extract (GSE) were prepared. Their performance properties, transparency, tensile strength (TS), water vapor permeability (WVP), water contact angle (CA), water swelling ratio (SR), water solubility (WS), and antimicrobial activity were determined. The A/A/C film was highly transparent, and both AgNPs and GSE incorporated blend films (A/A/C(AgNPs) and A/A/C(GSE)) exhibited UV-screening effect, especially, the A/A/C(GSE) film had high UV-screening effect without sacrificing the transmittance. In addition, the A/A/C blend films formed efficient hydrogel film with the water holding capacity of 23.6 times of their weight. Both A/A/C(AgNPs) and A/A/C(GSE) composite films exhibited strong antimicrobial activity against both Gram-positive (Listeria monocytogenes) and Gram-negative (Escherichia coli) food-borne pathogenic bacteria. The test results of fresh potatoes packaging revealed that all the A/A/C ternary blend films prevented forming of condensed water on the packaged film surface, both A/A/C(AgNPs) and A/A/C(GSE) composite films prevented greening of potatoes during storage. The results indicate that the ternary blend hydrogel films incorporated with AgNPs or GSE can be used not only as antifogging packaging films for highly respiring fresh agriculture produce, but also as an active food packaging system utilizing their strong antimicrobial activity. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Evaluation of semisolid agar method for antifungal susceptibility test of T. rubrum

    Directory of Open Access Journals (Sweden)

    Sultana Razia

    2016-08-01

    Full Text Available Background: With increasing fungal disease many newer antifungal drugs are available with different spectrum of activ¬≠ity. Antifungal susceptibility test will help clinicians for selection of effective drug and thereby treatment of patient. Objective: The study was undertaken to perform a simple screening drug susceptibility test of T. rnbrum by Semi Solid Agar Antifungal Susceptibility (SAAS Method: Perfonnance of susceptibility method was assessed by comparing the MICs of three commonly prescribed antifungal agents namely- tluconazole (FCZ, itraconazole (ITZ and terbinafine (TER to the CLSI (Clinical and Laboratory Standard Institute recommended M-38, a broth microdilution method. Results: In SAAS method, among twenty nine T. rubrum, twenty five (86.2% were susceptible (MIC range 0.5-64 ¬Ķg/ml to Fluconazole (FCZ and four (13.7% were resistant (MIC value >64 ¬Ķg/ml. In broth microdilution method, among twenty nine T. rubrum, twenty six (89.6% were susceptible (MIC range 0.3-64 ¬Ķg/ml to FCZ and three (10.3% were resistant (MIC value >64 ¬Ķg/ml. In case of both ITZ and TER, all were susceptible (MIC range 0.3-64 ¬Ķg/ml to both methods. The SAAS method demonstrated the susceptibility pattern of T. rubrum against FCZ, ITZ and TER usually within 72 to 96 hours after organism isolation and results were concordance with the results of CLSI broth microdilution method. Conclusion: Though it is a newer method with proper standardization of the test method, SAAS method is simple and easily applicable screening method for susceptibility testing of antifungal agents against dermatophytes in any microbiology laboratories.

  18. Perbedaan Cara Penyebaran Suspensi terhadap Jumlah Bakteri pada Media Eosin Methylene Blue Agar

    Directory of Open Access Journals (Sweden)

    Ahmad Nuzuludin Kadri

    2015-06-01

    Full Text Available Dalam rangka pengawasan mutu secara biologis dilakukan pengujian laboratorium untuk mengisolasi dan melakukan jumlah penghitungan jumlah bakteri patogen (enumerasi. Tujuan dari penelitian ini adalah untuk mengetahui perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok, mikropipet dan ose terhadap jumlah bakteri yang terhitung pada media Eosin Methylene Blue Agar. Sampel diambil dari air susu kambing yang kemudian dihitung jumlah bakteri-nya dengan tiga kelompok perlakuan yaitu menggunakan batang gelas bengkok, mikropipet dan ose. Data hasil penelitian dianalisis menggunakan sidik ragam, bila hasilnya berbeda nyata maka dilanjutkan dengan uji Duncan. Jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok, mikropipet dan ose per ml berturut-turut mengandung 9.722.222 cfu, 68.944.444 cfu dan 116.444.444 cfu. Dengan sidik ragam, perlakuan cara penyebaran dengan menggunakan mikropipet dan ose berbeda sangat nyata (P<0,01 terhadap jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok. Setelah di uji dengan uji Duncan, rata-rata jumlah bakteri yang terhitung dengan menggunakan mikropipet dan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan batang gelas bengkok, sedangkan rata-rata jumlah bakteri yang terhitung menggunakan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan mikropipet. Kesimpulan dari penelitian ini adalah terdapat perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok,mikropipet dan ose terhadap jumlah bakteri pada media EMBA. Penyebaran bakteri menggunakan ose lebih banyak (P<0,01 dibandingkan mikropipet dan batang gelas bengkok. Sedangkan penyebaran bakteri menggunakan mikropipet lebih banyak (P<0,01 dibandingkan dengan gelas bengkok.

  19. Halococcus agarilyticus sp. nov., an agar-degrading haloarchaeon isolated from commercial salt.

    Science.gov (United States)

    Minegishi, Hiroaki; Echigo, Akinobu; Shimane, Yasuhiro; Kamekura, Masahiro; Itoh, Takashi; Ohkuma, Moriya; Usami, Ron

    2015-05-01

    Two agar-degrading halophilic archaeal strains, 62 E(T) and 197 A, were isolated from commercial salt samples. Cells were non-motile cocci, approximately 1.2-2.0 ¬Ķm in diameter and stained Gram-negative. Colonies were pink-pigmented. Strain 62 E(T) was able to grow with 24-30% (w/v) NaCl (optimum, 27%), at pH 6.5-8.5 (optimum, pH 7.5) and at 22-47 ¬įC (optimum, 42 ¬įC). The 16S rRNA gene sequences of strains 62 E(T) and 197 A were identical, and the level of DNA-DNA relatedness between them was 90 and 90% (reciprocally). The closest relative was Halococcus saccharolyticus JCM 8878(T) with 99.7% similarity in 16S rRNA orthologous gene sequences, followed by Halococcus salifodinae JCM 9578(T) (99.6%), while similarities with other species of the genus Halococcus were equal to or lower than 95.1%. The rpoB' gene tree strongly supported that the two strains were members of the genus Halococcus . Mean DNA-DNA relatedness between strain 62 E(T) and H. saccharolyticus JCM 8878(T) and H. salifodinae JCM 9578(T) was 46 and 44%, respectively. The major polar lipids were archaeol derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, derived from both C20C20 and C20C25 archaeol, and sulfated diglycosyl archaeol-1. Several unidentified glycolipids were present. Based on the phenotypic and phylogenetic analyses, the isolates are considered to represent a novel species of the genus Halococcus , for which the name Halococcus agarilyticus sp. nov. is proposed. The type strain is 62 E(T) (‚Ää=‚ÄäJCM 19592(T)‚Ää=KCTC 4143(T)). ¬© 2015 IUMS.

  20. Agar Technique for the Cultivation In Vitro of Bone-Marrow Colonies

    Energy Technology Data Exchange (ETDEWEB)

    Metcalf, D. [Walter and Eliza Hall Institute, Royal Melbourne Hospital, Melbourne, VIC (Australia)

    1969-07-15

    In solid-state agar cultures certain haemopoietic cells proliferate and form discrete colonies of 200 - 4000 cells. Colony formation is dependent on stimulation by the colony-stimulating factor, and this is achieved by (1) the use of a cell feeder layer, (2) the addition of conditioned medium, or (3) the addition of human or mouse serum or urine containing the factor. All colonies initially contain granulocytic cells which differentiate from myeloblasts to polymorphs as colony growth proceeds. Later colonies develop a second population of phagocytic mononuclear cells (macrophages). The colony-forming-system is simple, readily quantitated and highly reproducible. Linear dose responses occur between the dose of colony-stimulating factor and the number and size of colonies developing from a standard number of bone-marrow cells. In-vitro colony formation has been achieved with haemopoietic cells of the following species: mouse, rat, hamster, guinea pig, rabbit and human. In the adult mouse, colony-forming cells are located in the bone marrow, spleen and blood and in the embryo, in the yolk sac, liver and spleen. The colony-forming cell appears to be an early member of the granulocytic series. The colony-forming system has been used as a quantitative assay system: (1) to assay levels of colony-stimulating factor in serum and urine and in the chemical- characterization and purification of the factor; and (2) to enumerate the number of colony-forming cells in haemopoietic tissues in response to a variety of experimental procedures and disease states. Since the system is applicable to human bone-marrow cells, it should prove of value in the quantitative assay of (1) survival of human bone marrow on storage, and (2) bone-marrow content of granulocytic precursor cells in various disease states and following various types of therapy. The system is not suitable for the mass production in vitro of haemopoietic cells for therapeutic use. (author)

  1. Plate shell structures of glass

    DEFF Research Database (Denmark)

    Bagger, Anne

    to their curved shape. A plate shell structure maintains a high stiffness-to-weight ratio, while facilitating the use of plane structural elements. The study focuses on using laminated glass panes for the load bearing facets. Various methods of generating a plate shell geometry are suggested. Together with Ghent......, such as facet size, imperfections, and connection characteristics. The critical load is compared to that of a similar, but smoothly curved, shell structure. Based on the investigations throughout the study, a set of guidelines for the structural design of plate shells of glass is proposed....

  2. Plating on stainless steel alloys

    International Nuclear Information System (INIS)

    Dini, J.W.; Johnson, H.R.

    1981-01-01

    Quantitative adhesion data are presented for a variety of electroplated stainless steel type alloys. Results show that excellent adhesion can be obtained by using a Wood's nickel strike or a sulfamate nickel strike prior to final plating. Specimens plated after Wood's nickel striking failed in the deposit rather than at the interface between the substrate and the coating. Flyer plate quantitative tests showed that use of anodic treatment in sulfuric acid prior to Wood's nickel striking even further improved adhesion. In contrast activation of stainless steels by immersion or cathodic treatment in hydrochloric acid resulted in very reduced bond strengths with failure always occurring at the interface between the coating and substrate

  3. Effect of EDTA on Pb(II) Uptake and Translocation by Tumbleweed (Salsola Kali): Agar and Hydroponics Studies

    Energy Technology Data Exchange (ETDEWEB)

    de la Rosa, Guadalupe; Gardea-Torresdey, Jorge L.; Peralta-Videa, Jose R.; Aldrich, Mary

    2004-03-31

    Environmental accumulation of Pb represents a worldwide health hazard. While conventional cleanup techniques are generally expensive and soil disturbing, phytoremediation represents an inexpensive friendly option for the removal of contaminants from soil and water. In this research, tumbleweed (Salsola kali) plants exposed for 15 days to Pb(NO3)2 at 80 and 125 ppm in hydroponics and agar media, demonstrated a high capacity to uptake lead. The results showed that the plants cultivated in agar accumulated 25563, 5534 and 2185 mg Pb kg-1 DW in roots, stems and leaves, respectively. Moreover, Pb concentrations found in hydroponically grown tumbleweed plants tissues were 30744, 1511 and 1421 mg kg-1 DW in roots, stems and leaves, respectively. It was observed that EDTA enhanced Pb translocation. No Pb phytotoxic effects were observed during the experimental time period. Cellular structural features were also observed using TEM.

  4. MyPlate Daily Checklist

    Science.gov (United States)

    ... Price Tag Read the Food Label Kitchen Timesavers Cooking for Your Family Tasty & Low-Cost Recipes Sample 2-Week Menus Resources for Professionals MyPlate Tip Sheets Print Materials Infographics 5 Ways ...

  5. License plate recognition (phase B).

    Science.gov (United States)

    2010-06-01

    License Plate Recognition (LPR) technology has been used for off-line automobile enforcement purposes. The technology has seen mixed success with correct reading rate as high as 60 to 80% depending on the specific application and environment. This li...

  6. Armor Plate Surface Roughness Measurements

    National Research Council Canada - National Science Library

    Stanton, Brian; Coburn, William; Pizzillo, Thomas J

    2005-01-01

    ...., surface texture and coatings) that could become important at high frequency. We measure waviness and roughness of various plates to know the parameter range for smooth aluminum and rolled homogenous armor (RHA...

  7. Variation in Microbial Identification System Accuracy for Yeast Identification Depending on Commercial Source of Sabouraud Dextrose Agar

    OpenAIRE

    Kellogg, James A.; Bankert, David A.; Chaturvedi, Vishnu

    1999-01-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc.) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system’s accuracy.

  8. Variation in Microbial Identification System accuracy for yeast identification depending on commercial source of Sabouraud dextrose agar.

    Science.gov (United States)

    Kellogg, J A; Bankert, D A; Chaturvedi, V

    1999-06-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc. ) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system's accuracy.

  9. Performance of Chromogenic Candida agar and CHROMagar Candida in recovery and presumptive identification of monofungal and polyfungal vaginal isolates.

    Science.gov (United States)

    Ozcan, Kadri; Ilkit, Macit; Ates, Aylin; Turac-Bicer, Aygul; Demirhindi, Hakan

    2010-02-01

    Chromogenic Candida agar (OCCA) is a novel medium facilitating isolation and identification of Candida albicans, C. tropicalis, and C. krusei, as well as indicating polyfungal population in clinical samples. We compare the performance of OCCA, to CHROMagar Candida (CAC) and Sabouraud chloramphenicol agar (SCA). Vaginal swab samples from 392 women were simultaneously inoculated onto three study media. A total of 161 (41.1%) were found to be positive for fungi of which 140 (87%) were monofungal, and 21 (13%) polyfungal. One-hundred and fifty-seven samples (97.5%) were positive on CAC, 156 (96.9%) on OCCA, 148 (91.9%) on SCA and 144 (89.4%) samples were positive on all three media. The yeasts were identified by conventional methods including germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX. The 182 isolates were C. albicans (n = 104), C. glabrata (n = 51), C. krusei (n = 7), C. tropicalis (n = 5), C. famata (n = 3), C. kefyr (n = 3), C. zeylanoides (n = 3), C. colliculosa (n = 2), and other species of Candida (n = 4). Among the 21 polyfungal populations, 20 (95.2%) were detected in OCCA, 14 (66.7%) in CAC, and 13 (61.9%) in CAC and OCCA (P or=92.9% at 72 h. OCCA is more efficient and reliable for rapidly identifying C. albicans and polyfungal populations than CAC. However, CAC is more efficient for identifying C. krusei and C. tropicalis. A chromogenic agar with a higher isolation rate of yeasts and better detection of polyfungal populations than SCA, is suggested as a medium of first choice when available.

  10. Comparison of antibacterial activities of root-end filling materials by an agar diffusion assay and Alamar blue assay

    Directory of Open Access Journals (Sweden)

    Tsui-Hsien Huang

    2012-12-01

    Conclusion: We concluded that both the agar diffusion test and Alamar blue assay gave comparable findings of assessing the antimicrobial activity present in root-end filling materials. No antimicrobial activity was detected for mineral trioxide aggregate, calcium silicate cement, or amalgam after coming into contact with S. mutans, S. sanguinis and E. coli. IRM showed high antimicrobial activity against both S. sanguinis and E. coli.

  11. Rhodium platings ‚Äď experimental study

    OpenAIRE

    Rudolf, R.; Budińá, B.; Stamenkovińá, D.; ńĆolińá, M.; Ivanińć, A.; Kosec, B.

    2013-01-01

    Modern rhodium plating solutions are based on either sulphate or phosphate. Although in theory there are four possible combinations, in practice only three different rhodium electrolytes are used. These are based on dilutions of rhodium sulphate or phosphate concentrates with added sulphuric or phosphoric acid. These processes are be discussed in this paper with a demonstration of Rh platings in the Slovenian firm Zlatarna Celje d.d.

  12. Rhodium platings ‚Äď experimental study

    Directory of Open Access Journals (Sweden)

    R. Rudolf

    2013-07-01

    Full Text Available Modern rhodium plating solutions are based on either sulphate or phosphate. Although in theory there are four possible combinations, in practice only three different rhodium electrolytes are used. These are based on dilutions of rhodium sulphate or phosphate concentrates with added sulphuric or phosphoric acid. These processes are be discussed in this paper with a demonstration of Rh platings in the Slovenian firm Zlatarna Celje d.d.

  13. Irradiation of silver and agar/silver nanoparticles with argon, oxygen glow discharge plasma, and mercury lamp.

    Science.gov (United States)

    Ahmad, Mahmoud M; Abdel-Wahab, Essam A; El-Maaref, A A; Rawway, Mohammed; Shaaban, Essam R

    2014-01-01

    The irradiation effect of argon, oxygen glow discharge plasma, and mercury lamp on silver and agar/silver nanoparticle samples is studied. The irradiation time dependence of the synthesized silver and agar/silver nanoparticle absorption spectra and their antibacterial effect are studied and compared. In the agar/silver nanoparticle sample, as the irradiation time of argon glow discharge plasma or mercury lamp increases, the peak intensity and the full width at half maximum, FWHM, of the surface plasmon resonance absorption band is increased, however a decrease of the peak intensity with oxygen glow plasma has been observed. In the silver nanoparticle sample, as the irradiation time of argon, oxygen glow discharge plasma or mercury lamp increases, the peak intensity of the surface plasmon resonance absorption band is increased, however, there is no significant change in the FWHM of the surface plasmon resonance absorption band. The SEM results for both samples showed nanoparticle formation with mean size about 50 nm and 40 nm respectively. Throughout the irradiation time with the argon, oxygen glow discharge plasma or mercury lamp, the antibacterial activity of several kinds of Gram-positive and Gram-negative bacteria has been examined.

  14. Estudio del proyecto pedag√≥gico de la instituci√≥n libre de ense√Īanza. La Residencia de Se√Īoritas Normalistas de Granada

    Directory of Open Access Journals (Sweden)

    Remedios Sánchez García

    2017-07-01

    Full Text Available El objeto de este trabajo es analizar, desde una perspectiva hist√≥rica y socio-educativa, el proyecto pedag√≥gico de la Instituci√≥n Libre de Ense√Īanza y su concreci√≥n en la Residencia de Se√Īoritas Normalistas en Granada. La metodolog√≠a utilizada pretende indagar en el contexto de la √©poca, realizando un estudio socio-hist√≥rico y comparado de documentos para poder reconstruir los hechos, tratando de describirlos y explicarlos. Partiendo de la importancia del ideario de la Residencia de Se√Īoritas de Madrid, fundada por Mar√≠a de Maeztu, del valor educativo su proyecto pedag√≥gico, hemos realizado un estudio comparativo con la Residencia de Se√Īoritas Normalistas de Granada creada por Agust√≠n Escribano para, a la luz de los datos in√©ditos encontrados y del aporte fotogr√°fico acreditativo -y hasta ahora desconocido-, evidenciar las similitudes en infraestructuras, organizaci√≥n interna; que, en el caso de la Residencia de Se√Īoritas Normalistas de Granada, abri√≥ posibilidades de estudio y nuevos horizontes a j√≥venes estudiantes con pocos recursos de Andaluc√≠a.

  15. Impact of global change on ground subsidence related to aquifer exploitation. The case of the Vega de Granada aquifer (SE Spain)

    Science.gov (United States)

    Pulido-Velazquez, David; María Mateos, Rosa; Rueda, Ramon; Pegalajar-Cuellar, Manuel; Ezquerro, Pablo; Béjar, Marta; Herrera, Gerardo; Collados-Lara, Antonio-Juan

    2017-04-01

    better explains the relationship between subsidence, hydraulic changes and the remaining independent variables. This methodology has been applied to the Vega de Granada aquifer system (Granada, SE Spain). The Vega de Granada detrital aquifer (with an extension of 200 km2) is one of the largest groundwater reservoirs in Andalusia and it is considered as strategic for the economy of this semi-arid region. Ground motion was monitored by exploiting SAR images from ENVISAT (2003-2009), Cosmo-SkyMed (2011-2014) and Sentinel-1A (2015-2016). PSInSAR results show an inelastic deformation in the aquifer and land surface displacements values up to -55 mm. The most widespread land subsidence is detected for the ENVISAT period (2003-2009), which coincided with a dry, long period in the region. The highest recorded data accounts up to 10 mm/yr in surface displacement velocity, which were detected in the central part of the aquifer, where many villages are located. For this period, a good correlation between groundwater level depletion and the augmentation of the subsidence average velocity is obtained, and light hydraulic head changes (research will contribute to assess a sustainable management plan of this vital aquifer, taking into account critical levels of groundwater level depletion to avoid land subsidence on the identified vulnerable areas and during drought critical scenarios. This research has been supported by the CGL2013-48424-C2-2-R (MINECO) project.

  16. A simple and convenient microtiter plate assay for the detection of bactericidal antibodies to Vibrio cholerae O1 and Vibrio cholerae O139.

    Science.gov (United States)

    Boutonnier, Alain; Dassy, Bruno; Duménil, Rémy; Guénolé, Alain; Ratsitorahina, Maherisoa; Migliani, René; Fournier, Jean-Michel

    2003-12-01

    It is believed that the correlate of protection for cholera can be determined by the serum vibriocidal assay. The currently available vibriocidal assays, based on the conventional agar plating technique, are labor intensive. We developed a simple and convenient microtiter plate assay for the detection of vibriocidal antibodies that is equally as efficient for Vibrio cholerae O1 and for V. cholerae O139. The addition of succinate and neotetrazolium made it possible to measure the growth of surviving bacterial target cells by monitoring a color change. We evaluated assay parameters (target strains, growth of target cells, complement source and concentration) that may affect the reproducibility of the method for V. cholerae O139. The results obtained with the microtiter plate assay were uniformly similar to those obtained with the conventional agar plating assay, when testing both the Inaba and Ogawa serotypes of V. cholerae O1. The microtiter plate assay was also convenient for measuring the activity of animal sera and mouse monoclonal antibodies.

  17. Matrices coloniales y diásporas africanas: Hacia una investigación de las culturas negra y mulata en la Nueva Granada

    Directory of Open Access Journals (Sweden)

    Rafael Antonio Díaz Díaz

    2003-12-01

    Full Text Available Witches who steal your soul by embracing you, councils of blacks and mulattos, secret dances, dances of blacks during religious festivals and games of all type, prohibited drums, demons of resistance, communities of runaway slaves, parties of mulattos, mulattos dressed up as women, singing instruments-these are some of the most important cultural manifestations of the black and mulatto population in the Kingdom of New Granada. However, they share with other social sectors (Native Americans, Spaniards and mestizos their own processes of constructing a wide array of colonial cultures, shaded by regional spaces and their own historic, social and demographic dynamic. This article, then, takes as its primary axis of investigation an analysis of the make-up of that which, provisionally, I will call black and mulatto culture. To achieve this, the research will be shaped by theory of colonial culture. Later, I will focus on the field of the transatlantic stages as a fluid scene of the African Diaspora, and I will attempt to recuperate the African dimension of this Diaspora.//Brujas que roban el alma al abrazar, concilios de negros y mulatos, danzas secretas, danzas de negros durante festivales religiosos y juegos de todo tipo, tambores prohibidos, demonios, comunidades de esclavos fugitivos, fiestas de mulatos, mulatos vestidos como mujeres, instrumentos de canto. Estas son unas de las manifestaciones culturales de las poblaciones negra y mulata en el Reino de la Nueva Granada. Sin embargo, ellos comparten con otros sectores sociales (nativos americanos, espa√Īoles y mestizos su propio proceso de construcci√≥n de una amplia matriz de cultural coloniales, ensombrecida por los espacios regionales y por sus propias din√°micas hist√≥ricas, demogr√°ficas y sociales. Este art√≠culo toma como eje principal de investigaci√≥n el an√°lisis de la construcci√≥n de algo que en primera instancia llamar√© cultura negra y mulata. Para lograr este objetivo el ensayo

  18. Research on Candida dubliniensis in a Brazilian yeast collection obtained from cardiac transplant, tuberculosis, and HIV-positive patients, and evaluation of phenotypic tests using agar screening methods.

    Science.gov (United States)

    Ribeiro, Patrícia Monteiro; Querido, Silvia Maria Rodrigues; Back-Brito, Graziela Nueremberg; Mota, Adolfo José; Koga-Ito, Cristiane Yumi; Jorge, Antonio Olavo Cardoso

    2011-09-01

    The aim of this study was to research Candida dubliniensis among isolates present in a Brazilian yeast collection and to evaluate the main phenotypic methods for discrimination between C. albicans and C. dubliniensis from oral cavity. A total of 200 isolates, presumptively identified as C. albicans or C. dubliniensis obtained from heart transplant patients under immunosuppressive therapy, tuberculosis patients under antibiotic therapy, HIV-positive patients under antiretroviral therapy, and healthy subjects, were analyzed using the following phenotypic tests: formation and structural arrangement of chlamydospores on corn meal agar, casein agar, tobacco agar, and sunflower seed agar; growth at 45 ¬įC; and germ tube formation. All strains were analyzed by polymerase chain reaction (PCR). In a preliminary screen for C. dubliniensis, 48 of the 200 isolates on corn meal agar, 30 of the 200 on casein agar, 16 of the 200 on tobacco agar, and 15 of the 200 on sunflower seed agar produced chlamydoconidia; 27 of the 200 isolates showed no or poor growth at 45 ¬įC. All isolates were positive for germ tube formation. These isolates were considered suggestive of C. dubliniensis. All of them were subjected to PCR analysis using C. dubliniensis-specific primers. C. dubliniensis isolates were not found. C. dubliniensis isolates were not recovered in this study done with immunocompromised patients. Sunflower seed agar was the medium with the smallest number of isolates of C. albicans suggestive of C. dubliniensis. None of the phenotypic methods was 100% effective for discrimination between C. albicans and C. dubliniensis. Copyright ¬© 2011 Elsevier Inc. All rights reserved.

  19. Production of trichothecenes and other secondary metabolites by Fusarium culmorum and Fusarium equiseti on common laboratory media and a soil organic matter agar: An ecological interpretation

    DEFF Research Database (Denmark)

    Hestbjerg, H.; Nielsen, Kristian Fog; Thrane, Ulf

    2002-01-01

    trichothecene production was detected for 94 of 102 F culmorum isolates, only 8 of 57 F equiseti isolates were positive. Profiles of secondary metabolites were compared by following growth on yeast extract sucrose agar (YES), potato sucrose agar (PSA), and an agar medium, prepared from soil organic matter (SOM......), which was included to simulate growth, conditions in soil. SOM supported the production of chrysogine by F culmorum. The two species utilized the media differently. F culmorum produced zearalenone (ZEA) on YES, whereas some F. equiseti isolates produced ZEA on PSA. Other F. equiseti isolates produced...

  20. Optimization of the agar-gel method for isolation of migrating Ascaris suum larvae from the liver and lungs of pigs

    DEFF Research Database (Denmark)

    Saeed, I.; Roepstorff, A.; Rasmussen, T.

    2001-01-01

    Experiments on use of an agar-gel method for recovery of migrating Ascaris suum larvae from the liver and lungs of pigs were conducted to obtain fast standardized methods. Subsamples of blended tissues of pig liver and lungs were mixed with agar to a final concentration of 1% agar and the larvae...... clean suspension which reduced the sample counting time. Blending the liver for 60 sec in a commercial blender showed significantly higher larvae recovery than blending for 30 sec. Addition of gentamycin to reduce bacterial growth during incubation, glucose to increase larval motility during migration...

  1. La recuperaci√≥n del patio en la arquitectura dom√©stica mud√©jar. Restauraciones en el Albaic√≠n de Granada en los √ļltimos treinta a√Īos

    Directory of Open Access Journals (Sweden)

    Gutiérrez Carrillo, M. L.

    2016-06-01

    Full Text Available Once the focal point of Mudejar houses in Granada, the courtyard is one of the elements that have undergone most transformation in the process of architectural evolution. The renewed use of these domestic structures as a result of refurbishment for new or similar purposes with respect to their original use has inspired a wide range of very different interventions on the unifying element of the courtyard. In a study of a large sample of seventy homes which have been subject to restoration over the last thirty years in Granada, we analysed the intervention methodologies employed, the criteria defined and the construction processes of restoration and conservation. This has yielded a historical perspective of the sample in terms of how the restoration of Mudejar courtyards has evolved in Granada, encompassing stylistic reinterpretations in the earliest stages to the contemporary criteria of authenticity and architectural reinterpretation in recent interventions.El patio, como n√ļcleo central de la casa mud√©jar granadina ha sido uno de los elementos que ha sufrido m√°s transformaciones en los procesos de evoluci√≥n arquitect√≥nica. La revalorizaci√≥n de estas arquitecturas dom√©sticas a trav√©s de su rehabilitaci√≥n para nuevos o an√°logos usos respecto a los originales, ha motivado intervenciones de muy diferente √≠ndole sobre el elemento centralizador del patio. A partir del estudio de una muestra significativa de setenta viviendas intervenidas en los √ļltimos treinta a√Īos en Granada, analizamos las metodolog√≠as de actuaci√≥n, los criterios definidos y los procesos constructivos de restauraci√≥n y conservaci√≥n. De este modo se obtiene una visi√≥n de conjunto diacr√≥nica de la evoluci√≥n del proceso restaurador en Granada sobre esta tipolog√≠a, que abarca desde las reinterpretaciones en estilo en las etapas m√°s tempranas a los criterios de autenticidad y de reinterpretaci√≥n arquitect√≥nica desde la contemporaneidad para las actuaciones m

  2. Mineralogical, Geochemical and Isotopic Characterisation of the Travertine Formation Associated with the Alicun de las Torres Thermal System (Province of Granada): Palaeoclimatic and Palaeoenvironmental Implications.; Caracterizacion Mineralogica, Geoquimica e Isotopica de los Travertinos Asociados al Sistema Termal de Alicun de las Torres (Provincia de Granada): Implicaciones Paleoclimaticas y Paleoambientales

    Energy Technology Data Exchange (ETDEWEB)

    Prado, A. J.; Delgado, A.; Crespo, M. T.; Martin, A.; Perez del Villar, L.

    2010-12-24

    In the framework of a Singular Strategic Project entitled: Advanced Technologies of Carbon, Capture and Storage (CCS), supported by the MICINN (Spain) and the FEDER founds (EU), specifically in the Carbon Storage Task, a comprehensive study on the CO{sub 2} leakage as DIC (Dissolved Inorganic Carbon) in the Alicun de Las Torres (Prov. of Granada) natural analogue Thermal System was envisaged. This analogous system is characterised by the presence of a very important travertine formation. In order to explain the formation of these travertine mass a detailed mineralogical, petrographic, geochemical and isotopic, including stable and radioactive isotopes, characterisation has been carried out. Based on these data, paleoclimatic and palaeoenvironmental conditions under which this travertine formation was formed, during a period of approximately 230Ky, have also been deduced. (Author) 234 refs.

  3. Hydrogeological and Hydrogeochemical Modelling of the Alicun de las Torres Termal System (Province of Granada). Isotope Hydrochemistry and Gases in Groundwaters; Modelizacion Hidrogeologica e Hidrogeoquimica del Sistema Termal de Alicun de Las Torres (Provincia de Granada). Hidroquimica Isotopica y Gases en Aguas

    Energy Technology Data Exchange (ETDEWEB)

    Prado Perez, A. J.; Delgado, A.; Crespo, M. T.; Martin, A.; Vaselli, O.; Perez del Villar, L.

    2010-11-17

    In the framework of a Singular Strategic Project entitled: {sup A}dvanced Technologies of Carbon, Capture and Storage (CCS){sup ,} supported by the MICINN (Spain) and the FEDER founds (EU), specifically in the Carbon Storage Task, a comprehensive study on the CO{sub 2} leakage as DIC (Dissolved Inorganic Carbon) in the Alicun de Las Torres (Prov. of Granada) natural analogue thermal system was envisaged. This analogous system is characterised by the presence of a very important travertine formation, which can be considered as a permanent and stable sink for CO{sub 2}. In order to explain the formation of these travertine mass an hydrogeological and hydrogeochemical model of the area has been established by using the hydrochemical data, the stable and radioactive isotope characteristics, the dissolved inorganic carbon, as well as the chemical and isotopic composition of the free and dissolved gases of the above mentioned Thermal System. (Author) 11 refs.

  4. Modeling RERTR experimental fuel plates using the PLATE code

    International Nuclear Information System (INIS)

    Hayes, S.L.; Meyer, M.K.; Hofman, G.L.; Snelgrove, J.L.; Brazener, R.A.

    2003-01-01

    Modeling results using the PLATE dispersion fuel performance code are presented for the U-Mo/Al experimental fuel plates from the RERTR-1, -2, -3 and -5 irradiation tests. Agreement of the calculations with experimental data obtained in post-irradiation examinations of these fuels, where available, is shown to be good. Use of the code to perform a series of parametric evaluations highlights the sensitivity of U-Mo dispersion fuel performance to fabrication variables, especially fuel particle shape and size distributions. (author)

  5. Plating on some difficult-to-plate metals and alloys

    International Nuclear Information System (INIS)

    Dini, J.W.; Johnson, H.R.

    1980-02-01

    Electrodeposition of coatings on metals such as beryllium, beryllium-copper, Kovar, lead, magnesium, thorium, titanium, tungsten, uranium, zirconium, and their alloys can be problematic. This is due in most cases to a natural oxide surface film that readily reforms after being removed. The procedures we recommend for plating on these metals rely on replacing the oxide film with a displacement coating, or etching to allow mechanical keying between the substrate and plated deposit. The effectiveness of the procedures is demonstrated by interface bond strengths found in ring-shear and conical-head tensile tests

  6. Electroless metal plating of plastics

    International Nuclear Information System (INIS)

    Krause, L.J.

    1986-01-01

    The product of an electroless plating process is described for plating at least one main group metal directly on a surface of a polymeric substrate comprising the steps of forming a nonaqueous solution containing a metallic salt of an alkali metal in a positive valence state and at least one main group metal in a negative valence state, the main group metal being selected from the group consisting of Ge, Sn, Pb, As, Sb, Bi, Si and Te, selecting an aromatic polymeric substrate reducible by the solublized salt and resistant to degration during the reaction, and carrying out a redox reaction between the salt in solution and the substrate by contacting the solution with the substrate for a sufficient time to oxidize and deposit the main group metal in elemental form to produce a plated substrate. The product is characterized by the plated metal being directly on the surface of the polymeric substrate and the alkali metal being retained in the plated substrate with the substrate being negatively charged with electrons transferred from the main group metal during the redox reaction

  7. Las librer√≠as de la Compa√Ī√≠a de Jes√ļs en Nueva Granada: un an√°lisis descriptivo a trav√©s de sus inventarios = Society of Jesus‚Äôs Libraries in Nueva Granada a Descriptive: Analysis Through their Inventories.

    Directory of Open Access Journals (Sweden)

    Alfonso Rubio Hern√°ndez

    2014-12-01

    Full Text Available A trav√©s de los inventarios de dos librer√≠as de la Compa√Ī√≠a de Jes√ļs expropiadas en la Nueva Granada a ra√≠z de su expulsi√≥n en 1767 (el Inventario de la Librer√≠a del Colegio de la Compa√Ī√≠a de Jes√ļs de Santa Fe de Antioquia, y el del Colegio de Santa Fe de Bogot√°, realizamos un ejercicio descriptivo de dichas librer√≠as atendiendo a tres aspectos: a la presencia de algunas significativas obras utilizadas con fines pedag√≥gicos y espirituales que contemplaban una determinada pr√°ctica de lectura; a su decoraci√≥n, concebida por los propios jesuitas dentro de un fuerte pensamiento contrarreformista; y a los sistemas de clasificaci√≥n que adoptaron sus inventarios en consonancia con su desempe√Īo de formaci√≥n human√≠stica y religiosa = By means of inventories of two bibliographical archives of the Society of Jesus which were expropriated in Nueva Granada due to its expulsion in 1767 (the inventories of the Library of Colegio de la Compa√Īia de Jes√ļs de Santa Fe de Antioquia, and Colegio de Santa Fe de Bogot√° a descriptive analysis of those libraries is carried out, paying special attention to: the uses of books with pedagogical and spiritual issues, to their decorations, conceived by the Jesuits themselves within a strong counter-reformist thought; and the classification systems that were adopted in their inventories according to their performance in humanist and religious education.

  8. Soft Plate and Impact Tectonics

    Science.gov (United States)

    Tikoff, Basil

    In the field of tectonics, most of our ideas are published in journals. This is not true of other fields, such as history, in which ideas are primarily published in books. Within my own field of structural geology, I can recall only one book, Strain Fades by E. Hansen (Springer-Verlag, 1971), which presents a new idea in book form. However, even this book is more useful for its philosophical approach and particular methodology of determining directions of folding, than for its overarching idea.Enter Soft Plate and Impact Tectonics, a new book with an interesting hypothesis that has been informally discussed in the geoscience community: A fundamental tenet of plate tectonics is incorrect‚ÄĒnamely, that the plates are rigid. This assertion is evident when looking at any mountain range, and is perhaps most clearly stated in Molnar [1988].

  9. Espejo cultural africano: im√°genes de los reinos del Congo y Angola en la Costa Caribe del reino de Nueva Granada

    Directory of Open Access Journals (Sweden)

    Andrea Guerrero Mosquera

    2014-01-01

    Full Text Available Esta investigaci√≥n pretendi√≥ a nalizar los escritos sobre √Āfrica realizados durante el siglo XVII, con el fin de adentrarse a los imaginarios que se plasmaron acerca de las culturas de los reinos del Congo y Angola . Para el caso particula r de esta investigaci√≥n , se usaron los textos de los capuchinos Giovanni Ant√≥nio Cavazzi y Anto nio de Teruel . Estos textos son discursos escritos desde una perspectiva de lo observado y bajo el amparo de un discurso hist√≥rico - antropol√≥gico del africano, una imagen eurocentrista y cat√≥lica que perme√≥ tanto en Europa como en la s Indias. Con estos textos se intent√≥ un acer camiento a los Black Atlantic Studies con lo que se logr√≥ a partir de las im√°genes que se interpretar on , realizar una confrontaci√≥n con la herencia cultural que se manifestaba en los escritos de la √©poca y establecer los imaginar ios que llegaron desde √Āfrica al reino de Nueva Granada .

  10. Un vistazo a la cartografía virreinal: Descripción geográfica del Virreinato de la Nueva Granada de 1781

    Directory of Open Access Journals (Sweden)

    Santiago Pérez Zapata

    2016-01-01

    Full Text Available La Descripci√≥n geogr√°fica del virreinato de la Nueva Granada ‚ÄĒ1781‚ÄĒ es el resultado de las visitas realizadas por el corregidor de Tunja Jos√© Mar√≠a Campuzano y Sanz, y el fiscal del crimen y protector de indios Francisco Moreno y Escand√≥n a los pueblos de indios y parroquias de vecinos del gobierno de Santaf√© de Bogot√° (en sus partidos septentrionales, del corregimiento de Tunja y de las provincias del Socorro y Pamplona, entre 1777 y 1779. Este estudio se desarrolla con el fin de reconstruir la historia del mapa como una v√≠a de interpretaci√≥n en dos esferas: 1. Comprender el perfil cultural de sus dos autores principales, Francisco Moreno y Escand√≥n y Francisco Javier Caro; y 2. Reconocer las tensiones sociales y pol√≠ticas que forjaron las visitas plasmadas en dicho plano.

  11. Salubridad y vida urbana en el Nuevo Reino de Granada, 1760-1810. Rese√Īa de tesis de maestria

    Directory of Open Access Journals (Sweden)

    Ana Maria Pérez

    2009-01-01

    Full Text Available La tesis se compone de 218 páginas, ocho mapas y cinco gráficos, y es el resultado de una investigación para optar al título de Magíster en Historia de la Universidad Nacional de Colombia, Sede Medellín. El trabajo se divide en introducción, cuatro capítulos y conclusiones. La tesis esboza algunas líneas de interpretación y aporta una serie de materiales con los cuales los historiadores pueden incursionar en uno de los temas sobre los que menor reflexión tiene el campo de la historia social de la ciencia en Colombia: el estudio de las políticas aplicadas por los funcionarios borbónicos y algunos particulares miembros de las élites locales con respecto al surgimiento de la salubridad de los habitantes de los centros urbanos del Nuevo Reino de Granada.

  12. La elisi√≥n de /d/ intervoc√°lica en el espa√Īol culto de Granada: factores ling√ľ√≠sticos.

    Directory of Open Access Journals (Sweden)

    Juan Antonio Moya Corral

    2010-12-01

    Full Text Available Normal 0 21 false false false ES X-NONE X-NONE MicrosoftInternetExplorer4 En este art√≠culo se analiza el estado en que se encuentra el proceso de elisi√≥n de /d/ ¬†intervoc√°lica en un una comunidad de habla andaluza (Granada, Espa√Īa. Se intenta dilucidar si la p√©rdida de la sonora dental sigue unas pautas de funcionamiento similares a las registradas en la antig√ľedad; es decir, si est√° controlada por factores de car√°cter morfol√≥gico y l√©xico. Asimismo, nuestros datos apuntan a dos formas diferentes de propagarse el proceso: de forma regular, en los morfemas de las palabras, y seg√ļn la teor√≠a de la ‚Äúdifusi√≥n l√©xica‚ÄĚ, cuando el debilitamiento tiene lugar en los lexemas. El an√°lisis arroja unos √≠ndices de elisi√≥n moderados (23,1%, similares a los registrados en otras comunidades andaluzas, pero que se sit√ļan muy por encima de lo observado en el resto del mundo hisp√°nico.

  13. GEOGRAF√ćA DEL ENVEJECIMIENTO VULNERABLE Y SU CONTEXTO AMBIENTAL EN LA CIUDAD DE GRANADA: DISCAPACIDAD, DEPENDENCIA Y EXCLUSI√ďN SOCIAL

    Directory of Open Access Journals (Sweden)

    Diego S√°nchez Gonz√°lez

    2009-01-01

    Full Text Available La investigaci√≥n examina la vulnerabilidad socioespacial de las personas mayores en la ciudad de Granada. La metodolog√≠a combina aspectos cuantitativos y cualitativos, como el an√°lisis de bases de datos de poblaci√≥n, de una encuesta a las personas de 65 a√Īos y m√°s, y la elaboraci√≥n de una cartograf√≠a a escala de barrios y secciones. Los resultados indican que los factores dependencia vulnerable, exclusi√≥n social y discapacidad explican la vulnerabilidad socioespacial de las personas ancianas, que se agudiza por el envejecimiento biol√≥gico y demogr√°fico, y los contextos ambientales precarios para envejecer en el lugar (pobreza, problemas en la vivienda y barrio, abandono y falta de ayuda. La distribuci√≥n espacial del √≠ndice de vulnerabilidad del envejecimiento demuestra que los ancianos vulnerables se concentran en los barrios del centro hist√≥rico y barrios marginados de la periferia, donde se registran problemas de accesibilidad a los servicios sociales y de salud. Se prev√© que la poblaci√≥n anciana vulnerable se incremente por el envejecimiento, la carencia de servicios, la falta de prevenci√≥n y la ausencia de planificaci√≥n gerontol√≥gica.

  14. Las familias ind√≠genas de Santaf√©, Nuevo Reino de Granada, seg√ļn los testamentos de los siglos XVI y XVII

    Directory of Open Access Journals (Sweden)

    Sandra Turbay Ceballos

    2012-01-01

    Full Text Available El an√°lisis de 89 testamentos ind√≠genas de Santaf√©, capital del Nuevo Reino de Granada, de los siglos XVI y XVII, da cuenta de las transformaciones de la familia muisca en la ciudad colonial. Desapareci√≥ la poliginia y el precio de la novia, y se legitim√≥ el matrimonio a trav√©s del sacramento cat√≥lico; se instaur√≥ la costumbre de la dote mediterr√°nea y los hijos empezaron a heredar los bienes de su padre. Sin embargo, los testamentos demuestran la persistencia de algunos rasgos matrilineales en los legados que los hombres dejaban a los hijos de sus hermanas y en la sucesi√≥n de los cacicazgos. La migraci√≥n masiva de ind√≠genas a la nueva ciudad promovi√≥ el mestizaje y la reconfiguraci√≥n de las familias ind√≠genas que acogieron en su seno a hu√©rfanos de diferente condici√≥n. Algunas mujeres alcanzaron posiciones in√©ditas y recurrieron a la Real Audiencia para defender los derechos que cre√≠an conculcados por sus maridos ind√≠genas o por los padres espa√Īoles de sus hijos.

  15. Reflexiones identitarias en el territorio contemporáneo. La construcción colectiva de lugar. Caso de estudio de la Vega de Granada

    Directory of Open Access Journals (Sweden)

    María Teresa Zapiain Aizpuru

    2011-01-01

    Full Text Available El objetivo del art√≠culo es participar en el debate actual sobre las nociones que nos conducen al mantenimiento y desarrollo de un territorio con identidad. Para alcanzar dicho objetivo, y considerando la distinci√≥n de significado establecida entre los conceptos de espacio, territorio y paisaje y su relaci√≥n indisociable con la cultura y la identidad, en su primera parte, el art√≠culo expone una propuesta te√≥rica de interpretaci√≥n de los procesos identitarios vinculados con el territorio como construcci√≥n social. En la segunda parte, se presenta algunos de los principales resultados sobre la investigaci√≥n emp√≠rica desarrollada en la ¬ęVega de Granada¬Ľ. En √©sta se explora la influencia de ciertas transformaciones socioecon√≥micas y culturales en los procesos de identificaci√≥n con el lugar. Se concluye enfatizando la importancia de este tipo de abordajes para el √©xito de los planes de ordenaci√≥n y desarrollo territorial, proponiendo el estudio no s√≥lo de las dimensiones f√≠sicas o sectoriales de un territorio, sino su significado como lugar.

  16. Prevalence and genetic diversity of Trichomonas vaginalis in the general population of Granada and co-infections with Gardnerella vaginalis and Candida species.

    Science.gov (United States)

    Carrillo-√Āvila, Jos√© Antonio; Serrano-Garc√≠a, Mar√≠a Luisa; Fern√°ndez-Parra, Jorge; Sorl√≥zano-Puerto, Antonio; Navarro-Mar√≠, Jos√© Mar√≠a; Stensvold, C Rune; Guti√©rrez-Fern√°ndez, Jose

    2017-10-01

    Purulent or exudative genitourinary infections are a frequent cause of consultation in primary and specialized healthcare. The objectives of this study were: to determine the prevalence of Trichomonas vaginalis and co-infections with Candida spp. and Gardnerella vaginalis in vaginal secretion; and to use multilocus sequence typing (MLST) to analyse the genetic diversity of T. vaginalis strains. The samples were submitted for analysis (n=5230) to a third-level hospital in Granada (Southern Spain) between 2011 and 2014; eight T. vaginalis strains isolated during 2015 were randomly selected for MLST analysis. Culture and nucleic acid hybridization techniques were used to detect microorganisms in the samples. The prevalence of T. vaginalis was 2.4‚Ää% between 2011 and 2014, being higher during the first few months of both 2011 and 2012. Among samples positive for T. vaginalis, co-infection with G. vaginalis was detected in 29 samples and co-infection with Candida spp. in 6, while co-infection with all three pathogens was observed in 3 samples. The only statistically significant between-year difference in co-infection rates was observed for T. vaginalis with G. vaginalis due to an elevated rate in 2011. MLST analysis results demonstrated a high genetic variability among strains circulating in our setting. These findings emphasize the need for the routine application of diagnostic procedures to avoid the spread of this sexually transmitted infection.

  17. La libertad de imprenta en la Nueva Granada: los juicios contra El Alacr√°n a mediados del siglo XIX

    Directory of Open Access Journals (Sweden)

    Paola Ruíz

    2016-07-01

    Full Text Available El presente art√≠culo explora los l√≠mites de la libertad de imprenta en la Nueva Granada a la luz de los juicios seguidos contra el peri√≥dico El Alacr√°n en 1849. A la vez que los describe, analiza la regulaci√≥n en torno a la libertad de imprenta, la manera como la prensa de la capital cerr√≥ filas en defensa del oficio de impresor y la colisi√≥n entre las autoridades ejecutivas y judiciales en el marco de los juicios de imprenta. El texto sugiere algunos alcances de este tipo de fuentes: las formas de lectura y circulaci√≥n de los impresos que plantean; la organizaci√≥n y funcionamiento de las imprentas que pone en evidencia; y los m√ļltiples actores que intervienen. Finalmente cuestiona la representatividad de los jurados de imprenta y la importancia de estos en la consolidaci√≥n de la ciudadan√≠a.

  18. Assessment of the Evolution of a Landslide Using Digital Photogrammetry and LiDAR Techniques in the Alpujarras Region (Granada, Southeastern Spain

    Directory of Open Access Journals (Sweden)

    Tom√°s Fern√°ndez

    2017-04-01

    Full Text Available In this work a detailed analysis of the temporal evolution of the Almeg√≠jar landslide is presented. It is a rock slide located in the Alpujarras region (Granada, Spain that has developed over the last 30 years. Six datasets and photogrammetric flights corresponding to the years 1956, 1984, 1992, 2001, 2008, and 2010 were surveyed. The more recent flight of 2010 combined an aerial digital camera and a LiDAR sensor and was oriented by means of in-flight data and tie points. This 2010 flight allowed for the generation of a reliable and high-precision Digital Terrain Model (DTM. The other flights were oriented using second-order ground control points transferred from the 2010 flight, and the corresponding DTMs were prepared by automatic matching and subsequent editing from the stereoscopic models. After comparing the DTMs of different dates, it has been observed that the landslide was triggered after 1984 and since then has evolved in an irregular pattern with periods of variable activity. On average, the ground surface dropped more than 8 m in depleted zones and rose nearly 4 m in the accumulation zones, with a velocity catalogued as very slow (about 15‚Äď30 cm/year over a time span corresponding to a degree VIII of diachroneity. The total volume of the mobilized mass of this large contemporary slide was about 300 √ó 103 m3.

  19. El San Jos√© de Cano y Mena y la abadesa del convento del √Āngel Custodio de Granada

    Directory of Open Access Journals (Sweden)

    García Cueto, David

    2003-03-01

    Full Text Available Los trabajos de Alonso Cano para la Catedral de Granada, iniciados tras conseguir por mediaci√≥n regia el cargo de Racionero de ese templo, fueron compaginados por el artista con la realizaci√≥n de encargos de distintos conventos de la misma ciudad; entre √©stos, fue el del √Āngel Custodio el que m√°s atenciones recibi√≥ por parte del maestro, ya que para √©l dise√Ī√≥ su arquitectura y realiz√≥ buena parte de su decoraci√≥n pict√≥rica y escult√≥rica. Estas obras fueron emprendidas y financiadas por Sor Mar√≠a de Llagas, hija de los marqueses de Camarasa, fundadora y abadesa del √Āngel Custodio, quien as√≠ cumpli√≥ un deseo de su padre, ya que el marqu√©s estimaba que su hija era dama de muy alta posici√≥n como para ser religiosa en una fundaci√≥n ajena‚Ķ

  20. Multiband PSInSAR and long-period monitoring of land subsidence in a strategic detrital aquifer (Vega de Granada, SE Spain): An approach to support management decisions

    Science.gov (United States)

    Mateos, Rosa Mar√≠a; Ezquerro, Pablo; Luque-Espinar, Juan Antonio; B√©jar-Pizarro, Marta; Notti, Davide; Aza√Ī√≥n, Jose Miguel; Montserrat, Oriol; Herrera, Gerardo; Fern√°ndez-Chac√≥n, Francisca; Peinado, Tom√°s; Galve, Jorge Pedro; P√©rez-Pe√Īa, Vicente; Fern√°ndez-Merodo, Jose A.; Jim√©nez, Jorge

    2017-10-01

    This work integrates detailed geological and hydrogeological information with PSI data to obtain a better understanding of subsidence processes detected in the detrital aquifer of the Vega de Granada (SE Spain) during the past 13 years. Ground motion was monitored by exploiting SAR images from the ENVISAT (2003-2009), Cosmo-SkyMed (2011-2014) and Sentinel-1A (2015-2016) satellites. PSInSAR results show an inelastic deformation in the aquifer and small land surface displacements (up to -55 mm). The most widespread land subsidence is detected during the ENVISAT period (2003-2009), which coincided with a long, dry period in the region. The highest displacement rates recorded during this period (up to 10 mm/yr) were detected in the central part of the aquifer, where many villages are located. For this period, there is a good correlation between groundwater level depletion and the augmentation of the average subsidence velocity and slight hydraulic head changes (account critical levels of groundwater depletion to avoid land subsidence in the areas identified as vulnerable. The European Space Agency satellite Sentinel-1A could be an effective decision-making tool in the near future.