WorldWideScience

Sample records for gram phaseolus mungo

  1. Failure of survival strategies in adaption of heavy metal environment in lens culinaris and phaseolus mungo

    International Nuclear Information System (INIS)

    Haider, S.; Azmat, R.

    2012-01-01

    Lead (Pb)-treated Lens culinaris and Phaseolus mungo seedlings leaves showed considerable reduction in the size with enhance proline and phenol contents while peroxidase and lignin activity was Pb/sup 2+/ dose dependent. The reduced leaves sizes of both seedlings were correlated with an increase in Pb/sup 2+/levels, and activities of peroxidase and lignin deposition in it. The intensification of activities of peroxidase and phenol in the Pb/sup 2+/ treated plants were accompanied by an increase in the biosynthesis of the lignin contents as their function is of scavenging ROS radical. A strong correlation (r/sup 2/=0.8570) was observed between Pb/sup 2+/ and lignin deposition in the Lens culinaris whereas it was non-significant in Phaseolus mungo (r/sup 2/=0.466). Increased in the lignin contents in the Lens culinaris as a chemical adaptation of the cell walls of various leaves tissues for endurance while decrease in the lignin contents in Phaseolus mungo at high dose of Pb/sup 2+/ may be attributed with the decline in the peroxidase activity. Investigations revealed that although plants adopt several biochemical strategies for their survival but toxicity of Pb/sup 2+/was significant due to which plant fails to continue in stay alive. (author)

  2. Growth Response of Two Phaseolus mungo L. Cultivars Induced by Arbuscular Mycorrhizal Fungi and Trichoderma viride

    Directory of Open Access Journals (Sweden)

    Navnita Sharma

    2016-01-01

    Full Text Available The present investigation aimed to quantify the difference in response of two Phaseolus mungo L. cultivars (i.e., UH-1 and IPU-94-1 to Glomus mosseae (G, that is, Funneliformis mosseae, Acaulospora laevis (A, and Trichoderma viride (T, in different combinations or alone. All the treatments were inoculated with Bradyrhizobium japonicum to ensure nodulation as soil used in the experiment was sterilized. After 120 days of inoculation, plants were analyzed for chlorophyll content, nodulation, mycorrhization, leaf area, and protein content. Results indicate variation in growth response of two cultivars with different treatments. Triple inoculation of plants with G + A + T proved to be the best treatment for growth followed by G + T in both cultivars. Our work allowed the selection of P. mungo L. cultivar UH-1 as highly mycorrhizal responsive as compared to IPU-94-1 and G. mosseae to be an efficient bioinoculant as compared to A. laevis for growth enhancement of P. mungo. Further characterization of P. mungo genotypes will enhance our knowledge of physiological and genetic mechanism behind increase in plant growth and yield due to AM symbiosis.

  3. Nodulation studies with induced mutants of black gram (Vigna mungo L.)

    International Nuclear Information System (INIS)

    Mahna, S.K.; Garg, Rekha; Parvateesam, M.

    1990-01-01

    Mutation breeding has been widely used to generate genetic variability in plants, but reports of mutations affecting the root system are less common. In the present work, black gram (Vigna mungo L. var T9), has been used for studies on the effect of induced mutations on nodulation patterns

  4. Bruchid egg induced transcript dynamics in developing seeds of black gram (Vigna mungo.

    Directory of Open Access Journals (Sweden)

    Indrani K Baruah

    Full Text Available Black gram (Vigna mungo seeds are a rich source of digestible proteins, however, during storage these seeds are severely damaged by bruchids (Callosobruchus spp., reducing seed quality and yield losses. Most of the cultivated genotypes of black gram are susceptible to bruchids, however, few tolerant genotypes have also been identified but the mechanism of tolerance is poorly understood. We employed Suppression Subtractive Hybridization (SSH to identify specifically, but rarely expressed bruchid egg induced genes in black gram. In this study, Suppression Subtractive Hybridization (SSH library was constructed to study the genes involved in defense response in black gram against bruchid infestation. An EST library of 277 clones was obtained for further analyses. Based on CAP3 assembly, 134 unigenes were computationally annotated using Blast2GOPRO software. In all, 20 defense related genes were subject to quantitative PCR analysis (qPCR out of which 12 genes showed up-regulation in developing seeds of the pods oviposited by bruchids. Few major defense genes like defensin, pathogenesis related protein (PR, lipoxygenase (LOX showed high expression levels in the oviposited population when compared with the non-oviposited plants. This is the first report on defense related gene transcript dynamics during the bruchid-black gram interaction using SSH library. This library would be useful to clone defense related gene(s such as defensin as represented in our library for crop improvement.

  5. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. �UG157� and �DPU915� were good general combiners. Two crosses namely �PDB 88-31�/�DPU 915� and �PLU 277�/�KAU7� had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  6. Genetic Parameters and Combining Ability Effects of Parents for Seed Yield and other Quantitative Traits in Black Gram [Vigna mungo (L. Hepper

    Directory of Open Access Journals (Sweden)

    Supriyo CHAKRABORTY

    2010-06-01

    Full Text Available Line x tester analysis was carried out in black gram [Vigna mungo (L. Hepper], an edible legume, to estimate the gca (general combining ability effects of parents (3 lines and 3 testers and the SCA (specific combining ability effects of 9 crosses for seed yield and other eleven quantitative traits. Though additive and nonadditive gene actions governed the expression of quantitative traits, the magnitude of nonadditive gene action was higher than that of additive gene action for each quantitative trait. Two parents viz. UG157 and DPU915 were good general combiners. Two crosses namely PDB 88-31/DPU 915 and PLU 277/KAU7 had high per se performance along with positive significant SCA effect for seed yield/plant. The degree of dominance revealed overdominance for all the traits except clusters/plant with partial dominance. The predictability ratio also revealed the predominant role of nonadditive gene action in the genetic control of quantitative traits. Narrow sense heritability was also low for each trait. Recurrent selection or biparental mating followed by selection which can exploit both additive and nonadditive gene actions would be of interest for yield improvement in black gram. Due to presence of high magnitude of nonadditive gene action, heterosis breeding could also be attempted to develop low cost hybrid variety using genetic male sterility system in black gram.

  7. De novo Assembly, Characterization of Immature Seed Transcriptome and Development of Genic-SSR Markers in Black Gram [Vigna mungo (L. Hepper].

    Directory of Open Access Journals (Sweden)

    J Souframanien

    Full Text Available Black gram [V. mungo (L. Hepper] is an important legume crop extensively grown in south and south-east Asia, where it is a major source of dietary protein for its predominantly vegetarian population. However, lack of genomic information and markers has become a limitation for genetic improvement of this crop. Here, we report the transcriptome sequencing of the immature seeds of black gram cv. TU94-2, by Illumina paired end sequencing technology to generate transcriptome sequences for gene discovery and genic-SSR marker development. A total of 17.2 million paired-end reads were generated and 48,291 transcript contigs (TCS were assembled with an average length of 443 bp. Based on sequence similarity search, 33,766 TCS showed significant similarity to known proteins. Among these, only 29,564 TCS were annotated with gene ontology (GO functional categories. A total number of 138 unique KEGG (Kyoto Encyclopedia of Genes and Genomes pathways were identified, of which majority of TCS are grouped into purine metabolism (678 followed by pyrimidine metabolism (263. A total of 48,291 TCS were searched for SSRs and 1,840 SSRs were identified in 1,572 TCS with an average frequency of one SSR per 11.9 kb. The tri-nucleotide repeats were most abundant (35% followed by di-nucleotide repeats (32%. PCR primer pairs were successfully designed for 933 SSR loci. Sequences analyses indicate that about 64.4% and 35.6% of the SSR motifs were present in the coding sequences (CDS and untranslated regions (UTRs respectively. Tri-nucleotide repeats (57.3% were preferentially present in the CDS. The rate of successful amplification and polymorphism were investigated using selected primers among 18 black gram accessions. Genic-SSR markers developed from the Illumina paired end sequencing of black gram immature seed transcriptome will provide a valuable resource for genetic diversity, evolution, linkage mapping, comparative genomics and marker-assisted selection in black gram.

  8. De novo Assembly, Characterization of Immature Seed Transcriptome and Development of Genic-SSR Markers in Black Gram [Vigna mungo (L.) Hepper

    Science.gov (United States)

    Souframanien, J.; Reddy, Kandali Sreenivasulu

    2015-01-01

    Black gram [V. mungo (L.) Hepper] is an important legume crop extensively grown in south and south-east Asia, where it is a major source of dietary protein for its predominantly vegetarian population. However, lack of genomic information and markers has become a limitation for genetic improvement of this crop. Here, we report the transcriptome sequencing of the immature seeds of black gram cv. TU94-2, by Illumina paired end sequencing technology to generate transcriptome sequences for gene discovery and genic-SSR marker development. A total of 17.2 million paired-end reads were generated and 48,291 transcript contigs (TCS) were assembled with an average length of 443 bp. Based on sequence similarity search, 33,766 TCS showed significant similarity to known proteins. Among these, only 29,564 TCS were annotated with gene ontology (GO) functional categories. A total number of 138 unique KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways were identified, of which majority of TCS are grouped into purine metabolism (678) followed by pyrimidine metabolism (263). A total of 48,291 TCS were searched for SSRs and 1,840 SSRs were identified in 1,572 TCS with an average frequency of one SSR per 11.9 kb. The tri-nucleotide repeats were most abundant (35%) followed by di-nucleotide repeats (32%). PCR primer pairs were successfully designed for 933 SSR loci. Sequences analyses indicate that about 64.4% and 35.6% of the SSR motifs were present in the coding sequences (CDS) and untranslated regions (UTRs) respectively. Tri-nucleotide repeats (57.3%) were preferentially present in the CDS. The rate of successful amplification and polymorphism were investigated using selected primers among 18 black gram accessions. Genic-SSR markers developed from the Illumina paired end sequencing of black gram immature seed transcriptome will provide a valuable resource for genetic diversity, evolution, linkage mapping, comparative genomics and marker-assisted selection in black gram. PMID

  9. Aluminium-induced excessive ROS causes cellular damage and metabolic shifts in black gram Vigna mungo (L.) Hepper.

    Science.gov (United States)

    Chowra, Umakanta; Yanase, Emiko; Koyama, Hiroyuki; Panda, Sanjib Kumar

    2017-01-01

    Aluminium-induced oxidative damage caused by excessive ROS production was evaluated in black gram pulse crop. Black gram plants were treated with different aluminium (Al 3+ ) concentrations (10, 50 and 100 μM with pH 4.7) and further the effects of Al 3+ were characterised by means of root growth inhibition, histochemical assay, ROS content analysis, protein carbonylation quantification and 1 H-NMR analysis. The results showed that aluminium induces excessive ROS production which leads to cellular damage, root injury, stunt root growth and other metabolic shifts. In black gram, Al 3+ induces cellular damage at the earliest stage of stress which was characterised from histochemical analysis. From this study, it was observed that prolonged stress can activate certain aluminium detoxification defence mechanism. Probably excessive ROS triggers such defence mechanism in black gram. Al 3+ can induce excessive ROS initially in the root region then transported to other parts of the plant. As much as the Al 3+ concentration increases, the rate of cellular injury and ROS production also increases. But after 72 h of stress, plants showed a lowered ROS level and cellular damage which indicates the upregulation of defensive mechanisms. Metabolic shift analysis also showed that the black gram plant under stress has less metabolic content after 24 h of treatment, but gradually, it was increased after 72 h of treatment. It was assumed that ROS played the most important role as a signalling molecule for aluminium stress in black gram.

  10. Low-fat papadams from black gram-tapioca blends.

    Science.gov (United States)

    Annapure, U S; Michael, M; Singhal, R S; Kulkarni, P R

    1997-07-01

    Papadams, made from black gram (Phaseolus mungo) and largely manufactured on cottage scale are popular in the Indian dietary. Escalating prices of black gram coupled with abundant availability of tapioca flour at almost 1/8th the price of black gram prompted the study of papadam characteristics using blends of black gram and tapioca flour. Tapioca flour up to 25% substitution did not alter the sensory attributes. However, the expansibility of the product decreased on addition of tapioca flour; a fact which could be overcome by using carboxymethyl cellulose (CMC) at 3% level of black gram flour. This decreased the oil content to 19.7% and also increased the expansibility to 5.539%.

  11. Available and unavailable carbohydrate content of black gram(Vigna Mungo) and chick-pea (Cicer Arietinum) as affected by soaking and cooking processes

    International Nuclear Information System (INIS)

    Zia-ur-Rehman; Rashid, M.; Salariya, A.M.

    2003-01-01

    The effects of soaking (Tap water, sodium bicarbonate solution) and cooking in tap water were investigated on available and unavailable carbohydrate contents and starch digestibility of black grams and chick-peas. Available carbohydrates including total soluble sugars, reducing sugars, non-reducing sugars and starch contents of these two legumes decreased to various extents as a result of soaking and cooking. From 3.43 - 25.63% total soluble sugars and 4.26 - 22.70% starch contents were lost on soaking black grams and chick-peas in tap water and sodium bicarbonate solution. Maximum amounts of total soluble sugars (28.43 - 59.64%) and starch contents (29.93 - 67.40%) were lost on cooking the water and alkali soaked legumes. However, these losses were comparatively less in case of water soaking process. Soaking and cooking processes also brought about some changes in the profile of unavailable carbohydrates of black grams and chick-peas. Soaking in sodium bicarbonate solution led to an appreciable increase of hemicellulose (42.50 - 54.31%) and NDF (28.69 - 30.68%) but not in legumes soaked in tap water. However, cooking process caused reduction in NDF (19.25 - 41.04%), ADF (5.48 - 25.31%), cellulose (12.88 - 28.42%) and hemicellulose (31.86 - 59.37%). Lignin contents of these legumes increased to some extents on cooking whereas it remained unchanged as a result of soaking. Starch digestibility of black grams and chick peas was markedly improved after cooking. However, no appreciable improvement in starch digestibility was observed after soaking these legumes in tap water or alkaline solution.(author)

  12. Pathology of the emerging Mycobacterium tuberculosis complex pathogen, M. mungi in the banded mongoose (Mungos mungo)

    Science.gov (United States)

    Wild banded mongooses (Mungos mungo) in northeastern Botswana and Northwest Zimbabwe are infected with a novel Mycobacterium tuberculosis complex pathogen (MTC), M. mungi. This pathogen is transmitted environmentally between mongoose hosts through exposure to infected scent marks used in olfactory c...

  13. Emerging tuberculosis pathogen hijacks social communication behavior in the group-living banded mongoose (Mungos mungo)

    Science.gov (United States)

    Mycobacterium mungi, a novel M. tuberculosis complex pathogen (MtbC), has emerged in wild banded mongoose (Mungos mungo) in Northern Botswana, causing significant mortality. Unlike other members of the MtbC, M. mungi is not transmitted through a primary aerosol route. Rather, pathogen invasion occur...

  14. Project Phaseolus

    International Nuclear Information System (INIS)

    Anon.

    Research carried out through the Phaseolus Project of the 'Centro de Energia Nuclear na Agricultura' (CENA) Piracicaba, Sao Paulo State, Brazil, is described. It comprises the following subject s: plant breeding; nitrogen fixation; tissue cultures; proteins; photosynthetic efficiency; soil-plant interactions; electron microscopy of the golden mosaic virus; pest control; production of 15 N-enriched ammonium sulfate, and determination of elements in the beans plant. (M.A.) [pt

  15. Isolation and Characterization of NADP+ -Linked Isocitrate Dehydrogenase in Germinating Urd Bean Seeds (Phaseolus mungo

    Directory of Open Access Journals (Sweden)

    Pramod Kumar Srivastava

    2010-06-01

    Full Text Available Isocitrate dehydrogenase (EC 1.1.1.42 has been purified to homogeneity from germinating urd bean seeds. The enzyme NADP+ -linked isocitrate dehydrogenase is a tetrameric protein (molecular weight 130,000; gel filtration made up of four identical monomers (sub unit molecular weight about 32,000-33,000; PAGE in presence of sodium dodecyl sulphate. Thermal inactivation of purified enzyme at 40 °C, 45 °C and 50 °C shows single exponential loss of enzyme activity suggesting that the inactivation of this enzyme follows simple first order kinetics (rate constants for purified enzyme 0.020, 0.043 and 0.077 min–1 at 40 °C, 45 °C and 50 °C respectively. Thermal inactivation in presence of glutathione and dithiothretol at 45 °C and 50 °C also follows simple first order kinetics, but the presence of these compounds protects the loss of enzyme activity. The enzyme shows optimum activity at pH 7.3-8.0. The variation of Vmax and Km at different pH values (6.5-8.0 suggests that proton behaves as an "Uncompetitive Inhibitor". A basic group is present at the active site of enzyme which is accessible for protonation in this pH range in the presence of substrate only, with a pKa equal to 6.8. Successive dialysis against EDTA and phosphate buffer, pH 7.5 at 0-4 °C gives an enzymatically inactive protein. Thermal inactivation of this protein at 45 °C and 50 °C shows an exponential loss of enzyme activity as in the case of untreated (native enzyme. Full activity is restored on adding Mn2+ (3.75mM to a solution of this protein. Addition of Mg2+, Zn2+, Co2+ and Cu2+ brings about partial recovery. Alkali metal ions bring about 75% inhibition at 4mM concentration. The inhibition is stronger at high concentration of Na+ and K+ . Other metal ions are not effective.

  16. Vivipary in Ophiorrhiza mungos L. - a rare phenomenon in angiosperms.

    Science.gov (United States)

    Dintu, K P; Sibi, C V; Ravichandran, P; Satheeshkumar, K

    2015-01-01

    Vivipary, the precocious germination of seeds within the parent plant, is a specialised feature of evolutionary and biological importance that ensures survival of a plant. Reports on vivipary in angiosperms are rare, accounting for <0.1% of flowering plants. Here, we report a remarkable case of occurrence of vivipary in Ophiorrhiza mungos. A study was conducted to collect information on the morphology of the capsules that support vivipary, environmental factors that induce vivipary, survival mode and the survival of viviparous seedlings. The hydroscopic movement of the cup-shaped capsules of O. mungos was found to help in viviparous germination during the rainy season. Of the total seeds in a capsule, 70% showed viviparous germination. The seedlings remaining inside the capsule attain a height of 0.98 ± 0.4 cm and reach the ground when the capsule falls. On the ground, seedlings obtain easy anchorage to the substratum since they have already germinated. Vivipary appears to be an adaptation of O. mungos to the rainy season for ensuring viable offspring. This suggests that vivipary in this species might be artificially induced by continuous spraying with water to rescue seeds in all seasons for use in large-scale propagation to meet increasing market demand and conservation of this valuable anticancer medicinal herb. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  17. Gram staining.

    Science.gov (United States)

    Coico, Richard

    2005-10-01

    Named after Hans Christian Gram who developed the method in 1884, the Gram stain allows one to distinguish between Gram-positive and Gram-negative bacteria on the basis of differential staining with a crystal violet-iodine complex and a safranin counterstain. The cell walls of Gram-positive organisms retain this complex after treatment with alcohol and appear purple, whereas gram-negative organisms decolorize following such treatment and appear pink. The method described here is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures.

  18. DEVELOPMENTAL CHANGES IN THE GERMINATION, GROWTH AND CHLOROPHYLLASE ACTIVITY OF VIGNA MUNGO L. USING SEAWEED EXTRACT OF ULVA RETICULATA FORSSKAL.

    OpenAIRE

    Ganapathy Selvam G.; Balamurugan M.; Thinakaran T.; Sivakumar K

    2013-01-01

    The effect of seaweed extract prepared from Ulva reticulata on seed germination, seedling growth and chlorophyllase activity of Vigna mungo L. was studied. 100% germination was recorded in the seeds treated with lower concentration of seaweed extract. The V. mungo seeds soaked with lower concentrations of the seaweed extracts showed higher rates of germination, while the higher concentrations of the extracts inhibited the germination.

  19. Evaluation of the Antioxidant and Melanogenesis Inhibitory Properties of Pracparatum Mungo (Lu-Do Huang

    Directory of Open Access Journals (Sweden)

    Yu-Yu Kao

    2013-07-01

    Full Text Available Pracparatum mungo (Lu-Do Huang is a traditional Chinese functional medicine made from the natural fermentation of mung bean (綠豆 Lǜ Dòu mixed with other Chinese medicines. It has been recognized as having liver protecting and detoxifying effects. As mung beans have been verified to possess anti-inflammatory, antioxidant, antipyretic, and whitening actions, the present research utilized the in vitro, ex vivo, and in vivo experimental models to investigate the antioxidant and melanin inhibiting effects of P. mungo on the skin. The in vitro experiment revealed that P. mungo methanol extract (PMME and P. mungo ethanol extract (PMEE possess the capacity to clear α,α-diphenyl-2-picrylhydrazyl (DPPH radicals and inhibit tyrosinase activity. The ex vivo experiment indicated that PMEE can promote the growth of MDCK cells and increase the enzymatic activities of superoxide dismutase (SOD and catalase in MDCK cells. On the other hand, PMME and PMEE can suppress the proliferation of A375 cells, and PMEE can reduce the enzymatic activities of SOD and catalase in A375 cells. The in vivo results showed that P. mungo can enhance the enzymatic performance of SOD, Catalase, and glutathione peroxidase (GPx in the liver. The results also showed that P. mungo has antioxidant characteristics and can inhibit tyrosinase activity, thereby promoting the growth of skin tissues and suppressing the proliferation of A375 cells, and thus enhancing the effects that the antioxidant enzymatic performance has on the liver. These results can be applied in the development of tyrosinase inhibitors or antioxidants used for the inhibition of melanin biosynthesis or for auto-oxidation in further industrial applications, particularly those relating to functional food or cosmetic compositions.

  20. CHARACTERISATION OF Phaseolus coccineus INTERSPECIFIC ...

    African Journals Online (AJOL)

    ACSS

    2018-02-20

    Feb 20, 2018 ... genetic base of this crop, especially for adaptation to extreme environments. The runner bean (Phaseolus coccineus) in particular, has been shown to contribute to disease ...... Emerging disease problems: The case of.

  1. CHARACTERISATION OF Phaseolus coccineus INTERSPECIFIC ...

    African Journals Online (AJOL)

    ACSS

    2018-02-20

    Feb 20, 2018 ... habit) and agronomic attributes (plant vigour, days to physiological maturity; DPM and days to 50% flowering; ... Days to flowering and to DPM ranged from 31-39 and 81-86, ...... evolution, and classification in Phaseolus. pp.

  2. Structural characterization of silver nanoparticles phyto-mediated by a plant waste, seed hull of Vigna mungo and their biological applications

    Science.gov (United States)

    Varadavenkatesan, Thivaharan; Vinayagam, Ramesh; Selvaraj, Raja

    2017-11-01

    Nanobiotechnology has rapidly become a critical facet of nanotechnology. The green synthesis of silver nanoparticles, making use of the hull of black gram (Vigna mungo), paves the way for a simple and eco-friendly utilization of a domestic waste to a product with antioxidant and anticoagulant activities. The emergence of silver nanoparticles was characterized by a variety of methods UV-visible spectrophotometry, scanning electron microscopy added to energy dispersive spectroscopy, X-ray diffractometry, particle size distribution and FT-IR spectroscopy analyses. A discrete band at 421 nm was obtained from UV-visible spectroscopy of the silver nanoparticle suspension. The extract sourced from the hull of black gram showed evidence of the presence of a variety of functional moieties of phytochemicals using FTIR spectroscopy. These were also deemed responsible for maintaining the stability of silver nanoparticles. SEM and EDAX techniques combined, proved that the zero-valent silver nanoparticles were lesser than 100 nm in size. The crystallinity of the nanoparticles was confirmed, as deduced by the (1 1 1) plane, from XRD analysis. The potential of the phytochemicals in maintaining the steadiness of nanoparticles was implied by the zeta potential value that stood at -30.3 mV. In the current study, we have endeavored to comprehend the antioxidant and anticoagulant nature of the green-synthesized benign silver nanoparticles.

  3. Fish otolith geochemistry, environmental conditions and human occupation at Lake Mungo, Australia

    Science.gov (United States)

    Long, Kelsie; Stern, Nicola; Williams, Ian S.; Kinsley, Les; Wood, Rachel; Sporcic, Katarina; Smith, Tegan; Fallon, Stewart; Kokkonen, Harri; Moffat, Ian; Grün, Rainer

    2014-03-01

    Fish otoliths from the Willandra Lakes Region World Heritage Area (south-western New South Wales, Australia) have been analysed for oxygen isotopes and trace elements using in situ techniques, and dated by radiocarbon. The study focused on the lunettes of Lake Mungo, an overflow lake that only filled during flooding events and emptied by evaporation, and Lake Mulurulu, which was part of the running Willandra Creek system. Samples were collected from two different contexts: from hearths directly associated with human activity, and isolated surface finds. AMS radiocarbon dating constrains the human activity documented by five different hearths to a time span of less than 240 years around 19,350 cal. BP. These hearths were constructed in aeolian sediments with alternating clay and sand layers, indicative of fluctuating lake levels and occasional drying out. The geochemistry of the otoliths confirms this scenario, with shifts in Sr/Ca and Ba/Ca marking the entry of the fish into Lake Mungo several years before their death, and a subsequent increase in the δ18O by ˜4‰ indicating increasing evaporation of the lake. During sustained lake-full conditions there are considerably fewer traces of human presence. It seems that the evaporating Lake Mungo attracted people to harvest fish that might have become sluggish through oxygen starvation in an increasingly saline water body (easy prey hypothesis). In contrast, surface finds have a much wider range in radiocarbon age as a result of reworking, and do not necessarily indicate evaporative conditions, as shown by comparison with otoliths from upstream Lake Mulurulu.

  4. Identification of Mungbean yellow mosaic India virus infecting Vigna mungo var. silvestris L.

    Directory of Open Access Journals (Sweden)

    Kamaal NAIMUDDIN

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabella normale"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Yellow mosaic of Vigna mungo var.  silvestris, a wild relative of blackgram (Vigna mungo [L.] Hepper, was noticed at the Indian Institute of Pulses Research, Kanpur, India during 2008–2010, with an incidence of 100 per cent. The observed symptoms, consisting of veinal yellowing and scattered bright yellow spots, were suggestive of infection with a begomovirus. To characterize the virus, several sets of primer pairs were designed to amplify the targeted DNA fragments of the causal virus. The sequence data revealed that the coat protein (AV1 gene of the begomovirus under study contained a single open reading frame with 774 nucleotides, coding for 257 amino acids. Comparative analysis of the coat protein (AV1 gene of the virus under study (FJ821189 showed a 97 and 99% similarity with Mungbean yellow mosaic India virus (MYMIV-Mungbean strain at the nucleotide and the amino acid levels respectively. Sequence homology of different genes (AC1, AC2, AC3 and AC4 of the isolate under study (FJ663015 with MYMIV-Mungbean (EU523045 was 94–97% for the nucleotides and 91–99% for the amino acids sequence. Therefore, the begomovirus infecting V. mungo var. silvestris at Kanpur is to be considered a strain of MYMIV and is

  5. Thermoluminescence dates for the Lake Mungo aboriginal fireplaces and the implications for radiocarbon dating

    International Nuclear Information System (INIS)

    Bell, W.T.

    1991-01-01

    During the Quaternary period in Australia large areas of western New South Wales and northern Victoria were covered by hundreds of lakes, both large and small. Nearly all are dry today but some may still be recognized by the long low dunes that follow the eastern shorelines. Many traces of early human occupation have been found along the shorelines of nearly all the major lakes and some of the best exposures have occurred on the lunette along the eastern shore of Lake Mungo. This lunette, has suffered massive erosion in recent times and this has uncovered the sites of many ancient fireplaces. Charcoal from some of these fireplaces has been dated by Barbetti and Polach (1973) using the radiocarbon method and the ages place the lakeside dwellers at Mungo in an area of Australian prehistory around 30 000 years ago. The baked sediment from below the fireplaces appears to have been heated to a temperature in excess of 400 o C according to archaeomagnetic studies carried out by Barbetti (1973) and this indicated that the fireplaces might lend themselves to the technique of thermoluminescence (TL) dating. The results of the TL dating programme are described elsewhere. (author)

  6. Thermoluminescence dates for the Lake Mungo aboriginal fireplaces and the implications for radiocarbon dating

    Energy Technology Data Exchange (ETDEWEB)

    Bell, W T [Australian National Univ., Canberra (Australia)

    1991-02-01

    During the Quaternary period in Australia large areas of western New South Wales and northern Victoria were covered by hundreds of lakes, both large and small. Nearly all are dry today but some may still be recognized by the long low dunes that follow the eastern shorelines. Many traces of early human occupation have been found along the shorelines of nearly all the major lakes and some of the best exposures have occurred on the lunette along the eastern shore of Lake Mungo. This lunette, has suffered massive erosion in recent times and this has uncovered the sites of many ancient fireplaces. Charcoal from some of these fireplaces has been dated by Barbetti and Polach (1973) using the radiocarbon method and the ages place the lakeside dwellers at Mungo in an area of Australian prehistory around 30 000 years ago. The baked sediment from below the fireplaces appears to have been heated to a temperature in excess of 400{sup o}C according to archaeomagnetic studies carried out by Barbetti (1973) and this indicated that the fireplaces might lend themselves to the technique of thermoluminescence (TL) dating. The results of the TL dating programme are described elsewhere. (author).

  7. First report of natural infection of Vigna mungo var. silvestris L. by Groundnut bud necrosis virus, a tospovirus

    Directory of Open Access Journals (Sweden)

    Mohammad AKRAM

    2010-09-01

    Full Text Available In the autumn of 2008, Vigna mungo var. silvestris growing in the experimental field of the Indian Institute of Pulses Research, Kanpur, India, showed chlorosis around some lateral veins and vein branches (mainly near the leaflet margin, downward curling of the leaf margins, necrosis of the stems and petioles, and twisting of the leaflets. Disease incidence was 20%. Symptoms indicated that the cause was Groundnut bud necrosis virus. The virus was identified on the basis of the symptoms on the diagnostic host, and the reverse transcription polymerase chain reaction (RT-PCR using specific primers of the NSm and NP genes. To our knowledge this is the first report of Groundnut bud necrosis virus on V. mungo var. silvestris.

  8. The tropics and the rise of the British Empire: Mungo Park's perspective on Africa in the late eighteenth century.

    Science.gov (United States)

    Viana, Larissa

    2011-03-01

    The young Scottish physician Mungo Park, aged 23, arrived in Africa in 1795 with a mission as specific as it was complex in those bygone days, namely to travel the entire length of the River Niger. In 1799, the story of this journey was published in a book that sold 1500 copies in the first month alone, with two further editions published that same year, as well as the translation of the work into French and German the following year. In this article, the narrative of Mungo Park is examined by taking due consideration of the relationship between the tropics, science and travel in the early days of British expansionism into the heart of Africa.

  9. The effect of sodium chloride salinity on germination and productivity of mung bean (Vigna Mungo Linn.)

    International Nuclear Information System (INIS)

    Jabeen, M.; Azim, F.; Ibrar, M.; Hussain, F.; Ilahi, I.

    2003-01-01

    The germination was significantly declined at salinity levels of 5.0 dSm/sup -1/ and above in the laboratory experiment while in the pot experiment germination significantly reduced at salinity levels of 7.5 dSm/sup -1/ and above. Radicle and plumule lengths were also significantly reduced at 5.0 dSm/sup -1/ and higher levels of NaCl. Plant height, number of branches and number of leaves significantly decreased at 10.0 dSm/sup -1/ and higher levels of salinity. The number of seeds was significantly dwindled at 7.5 dSm/sup -1/ and above. Similarly, chlorophyll contents were also significantly low at 7.5 dSm/sup -1/ and higher concentrations. It was concluded that Vigna mungo might not show promising growth and productivity in saline habitats. However, under mild saline conditions it might be grown not only to supplement the crop yield, but also as a source of fodder and soil reclamation measure. (author)

  10. Effect of simulated acid rain (sar) on some morphochemical aspects of mash (vigna mungo l.)

    International Nuclear Information System (INIS)

    Imran, H.A.; Hussain, M.; Hussain, S.

    2014-01-01

    The studies were conducted to evaluate the effect of simulated acid rain (SAR) at early plant growth on some morphochemical characters of two varieties of Mash (Vigna mungo L.) namely Mash 97 and Var. 95009. Different pH values were made by using H/sub 2/SO/sub 4/, HNO/sub 3/, and combination of both. The data revealed that low pH (3.5) of either sulphuric acid or the combination of H/sub 2/SO/sub 4/ and HNO/sub 3/ affected more severely at all parameters including number of leaves, shoot: root ratio, water contents of shoot and Potassium ion concentration. Whereas for a few parameters like plant height and number of branches the simulated acid rain of solution of pH 4.5 and 3.5 by using HNO/sub 3/ proved a bit better for plant growth, the root length was increased in case of SAR of solution of pH 3.5 by using H/sub 2/SO/sub 4/+HNO/sub 3/. Foliar application of SAR of solution of pH greater than 4.5 showed some improvement in crop growth due to fertilizer effect of solution's components. (author)

  11. Wild beans (Phaseolus L.) of North America

    Science.gov (United States)

    The wild relatives of the five domesticated species of bean (Phaseolus L.) are widely distributed across the tropics and subtropics of the New World, with taxa extending to the Canadian border, the Caribbean islands and Bermuda, the Galapagos Islands, and south to Argentina. Mesoamerica holds the la...

  12. DETERMINATION OF DEFENSE MECHANISM IN Phaseolus ...

    African Journals Online (AJOL)

    Administrator

    Field studies were conducted to determine the role of defense mechanism in various parameters associated with plant protection subjected to UV-B radiation in Phaseolus trilobus Ait. commonly used as green manure and fodder. Spectrophotometric analysis showed that UV-B radiation decreases the chlorophyll content ...

  13. Genetic improvement of black gram using induced mutations

    International Nuclear Information System (INIS)

    Pawar, S.E.; Manjaya, J.G.; Souframanien, J.; Bhatkar, S.M.

    2000-01-01

    Induced mutagenesis is an important tool for creating genetic variability in crop plants and has played a significant role in the development of many crop varieties. Genetic improvement of black gram (Vigna mungo L. Hepper) through induced mutations has been in progress at BARC for the past three decades. Mutation studies of genotype EC-168200 have resulted in isolating large number of mutants with distinct morphological characters. TAU-5, an early maturing mutant was identified as a resistant donor for yellow mosaic virus (YMV) disease by the All India Pulse Improvement Project, ICAR, Kanpur. TAU-5 was used in cross breeding with elite cultivars like T-9, TPU-4 and LBG-17. Twelve selections with high yield potential suitable for both kharif and rabi cultivation have been developed. One of the selections TU94-2 has been released for commercial cultivation for southern zone during 1999. The work on the development of YMV resistant genotypes is in progress and will be discussed. (author)

  14. Les hybridations interspecifiques dans le genre Phaseolus ...

    African Journals Online (AJOL)

    La réussite de l'introgression de caractères utiles chez le haricot commun P. vulgaris à partir des deux espèces P. coccineus et P. polyanthus dépend en partie des génotypes utilisés. Ce travail vise à identifier des génotypes de Phaseolus compatibles lors des hybridations interspécifiques et à identifier les hybrides issus ...

  15. Onderzoekingen over virusziekten van de boon (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Want, van der J.P.H.

    1954-01-01

    Three viruses were studied which produce diseases in French beans, Phaseolus virus I (PV1), Phaseolus virus 2 (PV2) and a virus isolated from white clover (WKV). Included are symptoms, host plants, properties in vitro, occurrence and spread in the field. Special attention was given to the

  16. Stool Gram stain

    Science.gov (United States)

    ... stool sample. The Gram stain method is sometimes used to quickly diagnose bacterial infections. How the Test is Performed You will need to collect a stool sample. There are many ways to collect the sample. You can catch the stool on plastic wrap that is loosely placed over the toilet bowl ...

  17. Biofertilizing efficiency of Sargassum polycystum extract on growth and biochemical composition of Vigna radiata and Vigna mungo

    Directory of Open Access Journals (Sweden)

    B Bharath

    2018-01-01

    Full Text Available Objective: To evaluate the effect of marine brown alga Sargassum polycystum extract on growth and biochemical parameters of Vigna radiata and Vigna mungo.Methods: Different concentrations of algal extracts (0.5%, 1.0%, 2.0%, 3.0%, 4.0%, and 5.0% were prepared and applied to the crops at every 10-day intervals under natural conditions. After 30 d, the plants were harvested to evaluate the growth and biochemical parameters.Results: Seaweed liquid fertilizers treated seedlings showed maximum growth in 3.0% concentration when compared to the untreated seedlings. Similarly, biochemical parameters such as photosynthetic pigments, protein, reducing sugar, total sugar and amino acids exhibited increases in 3.0% concentration seaweed extract. Decreases in growth and biochemical parameters were noticed in concentrations higher than 3.0%.Conclusions: Presence of micronutrients and growth regulating substances in the liquid extract help healthier and faster productivity of the crop.

  18. [Microstructural changes in hardened beans (Phaseolus vulgaris)].

    Science.gov (United States)

    Mujica, Maria Virginia; Granito, Marisela; Soto, Naudy

    2015-06-01

    (Phaseolus vulgaris). The hardening of Phaseolus vulgaris beans stored at high temperature and high relative humidity is one of the main constraints for consumption. The objective of this research was to evaluate by scanning electron microscopy, structural changes in cotyledons and testa of the hardened beans. The freshly harvested grains were stored for twelve months under two conditions: 5 ° C-34% RH and 37 ° C-75% RH, in order to promote hardening. The stored raw and cooked grains were lyophilized and fractured. The sections of testa and cotyledons were observed in an electron microscope JSM-6390. After twelve months, grains stored at 37 ° C-75% RH increased their hardness by 503%, whereas there were no significant changes in grains stored at 5 ° C-34% RH. At the microstructural level, the cotyledons of the raw grains show clear differences in appearance of the cell wall, into the intercellular space size and texture matrix protein. There were also differences in compaction of palisade and sub-epidermal layer in the testa of raw grains. After cooking, cotyledon cells of the soft grains were well separated while these ofhard grains were seldom separated. In conclusion, the found differences in hard and soft grains showed a significant participation of both structures, cotyledons and testa, in the grains hardening.

  19. Screening and Identification of putative long non coding RNAs from transcriptome data of a high yielding blackgram (Vigna mungo, Cv. T9

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Singh

    2018-04-01

    Full Text Available Blackgram (Vigna mungo is one of primary legumes cultivated throughout India, Cv.T9 being one of its common high yielding cultivar. This article reports RNA sequencing data and a pipeline for prediction of novel long non-coding RNAs from the sequenced data. The raw data generated during sequencing are available at Sequence Read Archive (SRA of NCBI with accession number- SRX1558530 Keywords: Blackgram, Long non-coding RNA, Legumes, RNA sequencing data

  20. Galactooligosaccharides of seeds during growth of Phaseolus coccineus L. and Phaseolus vulgaris L. beans

    Directory of Open Access Journals (Sweden)

    Ryszard Kosson

    2013-12-01

    Full Text Available The quantitative changes of raffinose and stachyose in seeds of Phaseolus coccineus L. and Phaseolus vulgaris L. during their growth and maturation in a two year experiment were investigated. Trace amounts of raffinose were found in Ph. vulgaris seeds during their vegeta tive growth in 1990. Time of raffinose accumulation in seeds in 1991 began not earlier than on 33rd day since inflorescence. Stachyose started to accumulate in seeds between 33rd and 47th day after inflorescence of all tested cultivars. It was noticed that stachyose and raffinose contents in seeds of most tested cultivars after ten years of storage did not differ significantly when compared to not stored ones.

  1. Genetic diversity study of common bean (Phaseolus vulgaris L ...

    African Journals Online (AJOL)

    SAM

    2014-09-03

    Sep 3, 2014 ... Key words: Genetic diversity, ISSR, Phaseolus vulgaris. INTRODUCTION ..... effective germplasm conservation and for setting germ- plasm collection ... conservation and research programs of the species. Furthermore, the ...

  2. Growth Performance of Five Bean (Phaseolus spp) Varieties as ...

    African Journals Online (AJOL)

    PROF HORSFALL

    had significant (P≤ 0.05) effect on bean plant girth, number of leaves, number of branches, mean number of flowers, total fresh ... Beans (Phaseolus spp) belong to one of several genera .... Meng (2016), that found that applying coffee pulp.

  3. Effects of Kidney Bean, Phaseolus vulgaris Meal on the Growth ...

    African Journals Online (AJOL)

    , Oreochromis niloticus (mean weight 1.36 + 0.05 g) fed diets containing varying levels of the kidney bean, Phaseolus vulgaris were investigated under laboratory conditions. The kidney bean was incorporated at separate levels of 60, 40, ...

  4. Spectrum and frequency of chlorophyll mutations in urdbean (Vigna mungo L. Hepper) induced by EMS and gamma rays

    International Nuclear Information System (INIS)

    Sharma, A.K.; Singh, V.P.; Sarma, M.K.

    2006-01-01

    In mutation breeding experiment, plants with altered characteristics such as chlorophyll changes, sterility, plant lethality etc. could be the marker of the mutability of a variety. In fact, spectrum and frequency of chlorophyll mutations have been studied in the great detail. The chlorophyll mutation is the clear-cut indication of non-directional nature of mutation and possibility of induction of useful mutations. The spectrum and frequency of chlorophyll mutation was estimated by using gamma rays (100, 200, 300 and 400 Gy doses), EMS (0.2, 0.4, 0.6 and 0.8%) and combination of gamma rays (100, 200, 300 400 Gy) with 0.2 % concentration EMS on two cultivars, namely, Pant Urd-19 and Pant Urd-30 of urdbean ( Vigna mungo L. Hepper). Five different types of chlorophyll mutations viz., albina, xantha, viridis, chlorina and maculata were identified in both the cultivars. Almost all the combination treatments produced maximum frequency and wider spectrum of chlorophyll mutations followed by single treatment of gamma rays or EMS. The frequency of chlorophyll mutation increased with higher doses of mutagens but decreased at highest dose. Proc. Nat. Acad. Sci. India. 76(8), I, 2006. 64-68. (author)

  5. Flatulence-causing galactooligosaccharides of Phaseolus coccineus L. and Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Ryszard Kosson

    2014-01-01

    Full Text Available Phaseolus coccineus beans were assayed for the presence of raffinose and stachyose in whole seeds and in the morphological parts of the seed: cotyledon, hypocotyl and hull. The quantitative composition of the galactooligosaccharides of Ph. coccineus was compared with Ph. vulgaris seeds. The major galactooligosaccharide of Ph. coccineus seeds is stachyose. Another galactooligosaccharide, verbascose, was present in Ph. coccineus seeds in very low amounts (0.04%. The highest concentrations of raffinose and stachyose were found in the hypocotyl, 1.11% and 7.48%, respectively. The hull contained the lowest quantities of stachyose and only traces of raffinose.

  6. Black gram ( L. foliage supplementation to crossbred cows: effects on feed intake, nutrient digestibility and milk production

    Directory of Open Access Journals (Sweden)

    Avijit Dey

    2017-02-01

    Full Text Available Objective An experiment was conducted to examine the effect of dietary supplementation of dried and ground foliage of black gram (Vigna mungo L. on feed intake and utilization, and production performance of crossbred lactating cows. Methods Eighteen lactating crossbred (Bos taurus×Bos indicus cows (body weight 330.93± 10.82 kg at their second and mid lactation (milk yield 6.77±0.54 kg/d were randomly divided into three groups of six each in a completely randomized block design. Three supplements were formulated by quantitatively replacing 0, 50, and 100 per cent of dietary wheat bran of concentrate mixture with dried and ground foliage of black gram. The designated supplement was fed to each group with basal diet of rice straw (ad libitum to meet the requirements for maintenance and milk production. Daily feed intake and milk yield was recorded. A digestion trial was conducted to determine the total tract digestibility of various nutrients. Results The daily feed intake was increased (p0.05, the fibre digestibility was increased (p0.05 among the groups, milk yield was increased by 10 per cent with total replacement of wheat bran in concentrate mixture with of black gram foliage. The economics of milk production calculated as feed cost per kg milk yield (INR 10.61 vs 7.98 was reduced by complete replacement of wheat bran with black gram foliage. Conclusion Black gram foliage could be used as complete replacement for wheat bran in concentrate mixture of dairy cows in formulating least cost ration for economic milk production in small holders’ animal production.

  7. Numerical Gram-Schmidt orthonormalization

    International Nuclear Information System (INIS)

    Werneth, Charles M; Dhar, Mallika; Maung, Khin Maung; Sirola, Christopher; Norbury, John W

    2010-01-01

    A numerical Gram-Schmidt orthonormalization procedure is presented for constructing an orthonormal basis function set from a non-orthonormal set, when the number of basis functions is large. This method will provide a pedagogical illustration of the Gram-Schmidt procedure and can be presented in classes on numerical methods or computational physics.

  8. Radiation induced mutations in Phaseolus vulgaris L

    International Nuclear Information System (INIS)

    Al-Rubeai, M.A.F.

    1982-01-01

    A selection of various macro- and micro-mutations was undertaken in the M2 generation of Phaseolus vulgaris cultivars after seed exposure to acute gamma radiation doses of 2.5, 5, 7, 10 and 15 Kr. The chlorophyll mutation was positively correlated with dose. Nevertheless, the highest frequency was at 7 Kr. Several interesting morphological mutants were observed. There were dwarf, stiff stem, shiny small leaf, narrow leaf and green giant mutants. Two selected micromutants were superior in seed yield capacity to their parents. The high yields were related to the high number of pods per plant. In 'The Prince' (seed color: red with beige marbling) several mutants with seeds of black color marbled with beige were selected. These seeds gave M3 segregants exhibiting a range of seed colors including white. Many of these M3 plants were short, early flowering and highly sterile. The work demonstrated that the pigmentation character can readily be changed, and confirmed that the variability induced by radiation can be exploited to obtain desirable mutations. (Author) [pt

  9. AKTIVITAS ENZIM FITASE PADA PERKEMBANGAN KACANG HIJAU (Phaseolus radiatus L

    Directory of Open Access Journals (Sweden)

    Woro Riyadina

    2012-09-01

    Full Text Available This is a study on the phytase enzyme activities on germination of Mung Beans (Phaseolus radiatus L. The activities and stability of phytase enzyme were observed under influence of various incubation temperature (27°C, 37°C and 55"C, and incubation time (1 hour, 2 hours and 3 hours of the Mung Beans (Phaseolus radiatus L in germinating for 1 to 5 days. The results showed that activities of phytase enzyme at the same temperature and incubation time are the same in Mung Beans seed germinating for 1 to 5 days. Phytase enzyme is one of the termostabile enzymes with optimal activities at high temperature.

  10. A higher yielding mutant of black gram with improved nodule formation

    International Nuclear Information System (INIS)

    Singh, R.K.; Raghuvanshi, S.S.

    1987-01-01

    Dry seeds of black gram (Vigna mungo (L) Hopper) var. T 9 with 12.2% moisture content were irradiated at 10, 20 and 30 krad of gamma rays. This was followed by combined treatment of one set in each dose with freshly prepared 0. 25% EMS in phosphate buffer at 7.0 pH at 30± deg. C for 6 hours. In M 2 population of 20 krad two mutants with pentafoliate instead of trifoliate leaves were found. This character was true breeding in M 3 M 6 generation. Crosses revealed monogenic recessive inheritance of this character. The proposed gene symbol is p5. This mutant has normal maturity period and the plant height is the same as T 9 (ca. 50 cm). Preliminary yield trials indicate superiority of the mutant line over control. The mutant line also shows a significant improvement in number and weight of root nodules, potentially improving green manuring value. Improvement of root nodulation in mungbean mutants was reported before by others

  11. A higher yielding mutant of black gram with improved nodule formation

    Energy Technology Data Exchange (ETDEWEB)

    Singh, R K; Raghuvanshi, S S [Plant Genetic Unit, Department of Botany, University of Lucknow (India)

    1987-07-01

    Dry seeds of black gram (Vigna mungo (L) Hopper) var. T{sub 9} with 12.2% moisture content were irradiated at 10, 20 and 30 krad of gamma rays. This was followed by combined treatment of one set in each dose with freshly prepared 0. 25% EMS in phosphate buffer at 7.0 pH at 30{+-} deg. C for 6 hours. In M{sub 2} population of 20 krad two mutants with pentafoliate instead of trifoliate leaves were found. This character was true breeding in M{sub 3} M{sub 6} generation. Crosses revealed monogenic recessive inheritance of this character. The proposed gene symbol is p5. This mutant has normal maturity period and the plant height is the same as T{sub 9} (ca. 50 cm). Preliminary yield trials indicate superiority of the mutant line over control. The mutant line also shows a significant improvement in number and weight of root nodules, potentially improving green manuring value. Improvement of root nodulation in mungbean mutants was reported before by others.

  12. MGS Esmeralda: new large seed mungbean cultivar MGS Esmeralda: nova cultivar de mungo-verde de sementes grandes

    Directory of Open Access Journals (Sweden)

    Rogério Faria Vieira

    2008-06-01

    Full Text Available Mungbean cultivar MGS Esmeralda was developed by Asian Vegetable Research and Development Center (Shanhua, Taiwan, as a result of crossing between the lines VC 1973A and VC 2768A. In ten trials conducted in the State of Minas Gerais, Brazil, it produced 13.5% more grains than 'Ouro Verde MG-2' (control cultivar, and its highest yield was 2,550 kg ha-1. The cultivar MGS Esmeralda is more susceptible to lodging, and its pods mature more uniformly than Ouro Verde MG-2 pods. One hundred-seed mass of 'MGS Esmeralda' ranged between 5.5 and 6.8 g. Both cultivars are susceptible to powdery mildew and cercospora leaf spot.A cultivar de mungo-verde MGS Esmeralda foi criada pelo Asian Vegetable Research and Development Center, localizado em Shanhua, Formosa. Ela é resultado do cruzamento entre as linhagens VC 1973A e VC 2768A. Em dez ensaios conduzidos em Minas Gerais, ela produziu 13,5% mais grãos do que a cultivar Ouro Verde MG-2 (testemunha, e sua produtividade mais alta foi 2.550 kg ha-1. A cultivar MGS Esmeralda é mais suscetível ao acamamento do que a Ouro Verde MG-2, mas suas vagens amadurecem mais uniformemente. A massa de 100 grãos da 'MGS Esmeralda' varia de 5,5 a 6,8 g. Ambas as cultivares são suscetíveis ao oídio e à cercosporiose.

  13. Insects diversity in lima bean (Phaseolus lunatus

    Directory of Open Access Journals (Sweden)

    WIWIN SETIAWATI

    2005-10-01

    Full Text Available Lima bean (Phaseolus lunatus is a vegetable which usually made as a home yard plant for Indonesian people to fulfill their daily needs. This plant has not been produced in the large number by the farmer. So it is hard to find in the market. Lima bean is light by many kind of insect. Inventory, identification and the study of insect taxon to this plant is being done to collect some information about the insect who life in the plant. The research was done in Balitsa experiment garden in the district of Lembang in Bandung regency on November 2003-February 2004, the experiment start at 4 weeks age, at the height of 1260 m over the sea level. The observation was made systematically by absolute method (D-vac macine and relative method (sweeping net. The research so that there were 26 species of phytofagous insect, 9 species of predator insect, 6 species of parasitoid insect, 4 species of pollinator and 14 species of scavenger insect. According to the research the highest species number was got in the 8th week (3rd sampling, which had 27 variety of species, so the highest diversity was also got in this with 2,113 point. Aphididae and Cicadellidae was the most insect found in roay plant. The research also had high number of species insect so the diversity of insect and evenness become high. A community will have the high stability if it is a long with the high diversity. High evenness in community that has low species dominance and high species number of insect so the high of species richness.

  14. allelopathic effects of eucalyptus tereticornis on phaseolus vulgaris

    African Journals Online (AJOL)

    user

    1. ALLELOPATHIC EFFECTS OF EUCALYPTUS TERETICORNIS ON PHASEOLUS. VULGARIS SEEDLINGS. Sale, F.A.. Department of Forestry and Wildlife, Faculty of ..... Sale, F.A. (2009). Allelopathic influence of Acacia auriculiformis. Eucalyptus citriodora and Gliricidia sepium on germination, growth and yield of millet.

  15. Some engineering properties of white kidney beans (Phaseolus ...

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... ... (physical and mechanical) properties, white kidney beans, moisture content, thousand grain mass, static coefficient of friction. INTRODUCTION. White kidney beans (Phaseolus vulgaris L.) are a culti- vated plant grown for fresh and dry consumption and a common raw material in the canned food industry.

  16. Nodulation and nitrogen fixation in common bean (Phaseolus vulgaris)

    African Journals Online (AJOL)

    Mamadou Gueye

    Nodulation and nitrogen fixation of field grown common bean (Phaseolus vulgaris) as influenced by fungicide seed treatment. Ndeye Fatou Diaw GUENE, Adama DIOUF and Mamadou GUEYE*. MIRCEN/ Laboratoire commun de microbiologie IRD-ISRA-UCAD, BP 1386, DAKAR, Senegal. Accepted 23 June 2003.

  17. Phosphorus use efficiency in common bean ( Phaseolus vulgaris L ...

    African Journals Online (AJOL)

    The tripartite symbiosis of common bean (Phaseolus vulgaris L.) recombinant inbred line (RIL) 147 with rhizobia and arbuscular mycorrhizal fungi (AMF) was assessed in sand culture by comparing the effects of three AMF species on the mycorrhizal root colonization, rhizobial nodulation, plant growth and phosphorus use ...

  18. Composite Phaseolus vulgaris plants with transgenic roots as ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... ... important processes in the root system will be discussed. Key words: Genetic transformation, Phaseolus vulgaris, Agrobacterium rhizogenes. INTRODUCTION. Grain legumes are important agricultural crops, especially for developing countries, where they provide proteins in vegetarian or meat-poor diets.

  19. Composite Phaseolus vulgaris plants with transgenic roots as ...

    African Journals Online (AJOL)

    Large seeded grain legumes such as the common bean (Phaseolus vulgaris) and cowpea (Vigna unguiculata) are very important crops with seeds that are major protein source for people in developing countries, but their yields and improvement lag behind the economically more important cereals. For research purposes ...

  20. Response of common bean ( Phaseolus vulgaris L.) cultivars to ...

    African Journals Online (AJOL)

    Yield losses in common bean (Phaseolus vulgaris L.) may occur due to boron (B) deficiency when the susceptible cultivars are grown in calcareous boron deficient soils. The study was therefore aimed at investigating the effects of three B doses: control (0.0 kg ha-1), soil application (3.0 kg ha-1) and foliar fertilization (0.3 kg ...

  1. Oriënterend onderzoek over de reuzen- en dwergplanten in F1 en volgende generaties van Phaseolus vulgaris L. x Phaseolus multiflorus Lam.

    NARCIS (Netherlands)

    Geerts, Sipke Johannes

    1949-01-01

    A cross is studied between the selffertilising bush bean (Phaseolus vulgaris L.) "Zeeuwse Bruine Boon" and crossfertilising runner bean (Phaseolus multiflorus Lam.) "stam" (a scarlet flowering stockrunner-bean) or some other (climbing) runners. With the bushbean as mother this cross easily results

  2. Leaf crinkle disease in urdbean (Vigna mungo L. Hepper): An overview on causal agent, vector and host.

    Science.gov (United States)

    Gautam, Narinder Kumar; Kumar, Krishna; Prasad, Manoj

    2016-05-01

    Urdbean leaf crinkle disease (ULCD) is an economically significant widespread and devastating disease resulting in extreme crinkling, puckering and rugosity of leaves inflicting heavy yield losses annually in major urdbean-producing countries of the world. This disease is caused by urdbean leaf crinkle virus (ULCV). Urdbean (Vigna mungo L. Hepper) is relatively more susceptible than other pulses to leaf crinkle disease. Urdbean is an important and useful crop cultivated in various parts of South-East Asia and well adapted for cultivation under semi-arid and subtropical conditions. Aphids, insects and whiteflies have been reported as vectors of the disease. The virus is also transmitted through sap inoculation, grafting and seed. The loss in seed yield in ULCD-affected urdbean crop ranges from 35 to 81%, which is dependent upon type of genotype location and infection time. The diseased material and favourable climatic conditions contribute for the widespread viral disease. Anatomical and biochemical changes take place in the affected diseased plants. Genetic variations have been reported in the germplasm screening which suggest continuous screening of available varieties and new germplasm to search for new traits (new genes) and identify new sources of disease resistance. There are very few reports on breeding programmes for the development and release of varieties tolerant to ULCD. Mostly random amplified polymorphic DNA (RAPD) as well as inter-simple sequence repeat (ISSR) molecular markers have been utilized for fingerprinting of blackgram, and a few reports are there on sequence-tagged micro-satellite site (STMS) markers. There are so many RNA viruses which have also developed strategies to counteract silencing process by encoding suppressor proteins that create hindrances in the process. But, in the case of ULCV, there is no report available indicating which defence pathway is operating for its resistance in the plants and whether same silencing suppression

  3. Evidence for the endophytic colonization of Phaseolus vulgaris (common bean) roots by the diazotroph Herbaspirillum seropedicae.

    Science.gov (United States)

    Schmidt, M A; Souza, E M; Baura, V; Wassem, R; Yates, M G; Pedrosa, F O; Monteiro, R A

    2011-03-01

    Herbaspirillum seropedicae is an endophytic diazotrophic bacterium, which associates with important agricultural plants. In the present study, we have investigated the attachment to and internal colonization of Phaseolus vulgaris roots by the H. seropedicae wild-type strain SMR1 and by a strain of H. seropedicae expressing a red fluorescent protein (DsRed) to track the bacterium in the plant tissues. Two-day-old P. vulgaris roots were incubated at 30°C for 15 min with 6 x 10(8) CFU/mL H. seropedicae SMR1 or RAM4. Three days after inoculation, 4 x 10(4) cells of endophytic H. seropedicae SMR1 were recovered per gram of fresh root, and 9 days after inoculation the number of endophytes increased to 4 x 10(6) CFU/g. The identity of the recovered bacteria was confirmed by amplification and sequencing of the 16SrRNA gene. Furthermore, confocal microscopy of P. vulgaris roots inoculated with H. seropedicae RAM4 showed that the bacterial cells were attached to the root surface 15 min after inoculation; fluorescent bacteria were visible in the internal tissues after 24 h and were found in the central cylinder after 72 h, showing that H. seropedicae RAM4 is capable of colonizing the roots of the dicotyledon P. vulgaris. Determination of dry weight of common bean inoculated with H. seropedicae SMR1 suggested that this bacterium has a negative effect on the growth of P. vulgaris.

  4. Differential staining of bacteria: gram stain.

    Science.gov (United States)

    Moyes, Rita B; Reynolds, Jackie; Breakwell, Donald P

    2009-11-01

    In 1884, Hans Christian Gram, a Danish doctor, developed a differential staining technique that is still the cornerstone of bacterial identification and taxonomic division. This multistep, sequential staining protocol separates bacteria into four groups based on cell morphology and cell wall structure: Gram-positive cocci, Gram-negative cocci, Gram-positive rods, and Gram-negative rods. The Gram stain is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures. (c) 2009 by John Wiley & Sons, Inc.

  5. Beans (Phaseolus ssp.) as a Model for Understanding Crop Evolution

    Science.gov (United States)

    Bitocchi, Elena; Rau, Domenico; Bellucci, Elisa; Rodriguez, Monica; Murgia, Maria L.; Gioia, Tania; Santo, Debora; Nanni, Laura; Attene, Giovanna; Papa, Roberto

    2017-01-01

    Here, we aim to provide a comprehensive and up-to-date overview of the most significant outcomes in the literature regarding the origin of Phaseolus genus, the geographical distribution of the wild species, the domestication process, and the wide spread out of the centers of origin. Phaseolus can be considered as a unique model for the study of crop evolution, and in particular, for an understanding of the convergent phenotypic evolution that occurred under domestication. The almost unique situation that characterizes the Phaseolus genus is that five of its ∼70 species have been domesticated (i.e., Phaseolus vulgaris, P. coccineus, P. dumosus, P. acutifolius, and P. lunatus), and in addition, for P. vulgaris and P. lunatus, the wild forms are distributed in both Mesoamerica and South America, where at least two independent and isolated episodes of domestication occurred. Thus, at least seven independent domestication events occurred, which provides the possibility to unravel the genetic basis of the domestication process not only among species of the same genus, but also between gene pools within the same species. Along with this, other interesting features makes Phaseolus crops very useful in the study of evolution, including: (i) their recent divergence, and the high level of collinearity and synteny among their genomes; (ii) their different breeding systems and life history traits, from annual and autogamous, to perennial and allogamous; and (iii) their adaptation to different environments, not only in their centers of origin, but also out of the Americas, following their introduction and wide spread through different countries. In particular for P. vulgaris this resulted in the breaking of the spatial isolation of the Mesoamerican and Andean gene pools, which allowed spontaneous hybridization, thus increasing of the possibility of novel genotypes and phenotypes. This knowledge that is associated to the genetic resources that have been conserved ex situ and in

  6. Gramática Hipertextual

    Directory of Open Access Journals (Sweden)

    Francilaine Munhoz Moraes

    2011-07-01

    Full Text Available No meio digital, a construção da notícia se dá pelo hipertexto. Uma linguagem própria ao suporte consolida-se nas duas últimas décadas. Este artigo se dedica a discutir regularidades linguísticas do discurso jornalístico na web. Se há uma linguagem peculiar ao meio, existe também uma gramática correspondente: a gramática hipertextual. Nesse viés, levantamos traços linguísticos da estrutura sintático-semântica, com base na organização da informação em páginas noticiosas eletrônicas. 

  7. Beans (Phaseolus spp.) - model food legumes

    International Nuclear Information System (INIS)

    Broughton, W.J.; Hemandez, H.; Blair, M.; Beebe, S.; Gepts, P.; Vanderleyden, J.

    2001-01-01

    Globally, 800 million people are malnourished. Heavily subsidised farmers in rich countries produce sufficient surplus food to feed the hungry, but not at a price the poor can afford. Even donating the rich world's surplus to the poor would not solve the problem. Most poor people earn their living from agriculture, so a deluge of free food would destroy their livelihoods. Thus, the only answer to world hunger is to safeguard and improve the productivity of farmers in poor countries. Diets of subsistence level farmers in Africa and Latin America often contain sufficient carbohydrates (through cassava, corn/maize, rice, wheat, etc.), but are poor in proteins. Dietary proteins can take the form of scarce animal products (eggs, milk, meat, etc.), but are usually derived from legumes (plants of the bean and pea family). Legumes are vital in agriculture as they form associations with bacteria that 'fix-nitrogen' from the air. Effectively this amounts to internal fertilisation and is the main reason that legumes are richer in proteins than all other plants. Thousands of legume species exist but more common beans (Phaseolus vulgaris L.) are eaten than any other. In some countries such as Mexico and Brazil, beans are the primary source of protein in human diets. As half the grain legumes consumed worldwide are common beans, they represent the species of choice for the study of grain legume nutrition. Unfortunately, the yields of common beans are low even by the standards of legumes, and the quality of their seed proteins is sub-optimal. Most probably this results from millennia of selection for stable rather than high yield, and as such, is a problem that can be redressed by modem genetic techniques. We have formed an international consortium called 'Phaseomics' to establish the necessary framework of knowledge and materials that will result in disease-resistant, stress-tolerant, high-quality protein and high-yielding beans. Phaseomics will be instrumental in improving

  8. Vigna mungo L. Hepper

    African Journals Online (AJOL)

    satyam

    2013-03-13

    Mar 13, 2013 ... Genetic engineering allows these genes to be transferred to cultivated varieties in order to enhance the tolerance to various stresses and hence stabilize .... primer: 5'. AATATCACGGGTAGCCAACG 3' and reverse primer 5'.

  9. Vigna mungo (L.) Hepper

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... Available online at http://www.academicjournals.org/AJB .... g/100 g, Trifolium alexandrianum green manure (GM) @ 4 g/100 g. (on dry weight ... MN-S with concentrated sugar solution as an ad- ..... as an alternative fertilizer.

  10. Two endornaviruses show differential infection patterns between gene pools of Phaseolus vulgaris.

    Science.gov (United States)

    Khankhum, Surasak; Valverde, Rodrigo A; Pastor-Corrales, Marcial A; Osorno, Juan M; Sabanadzovic, Sead

    2015-04-01

    We investigated the occurrence of two plant endornaviruses, Phaseolus vulgaris endornavirus 1 and Phaseolus vulgaris endornavirus 2, in breeding lines, cultivars, landraces, and wild genotypes of common bean (Phaseolus vulgaris) collected from the two centers of common bean domestication: Mesoamerica and the Andes. The two endornaviruses were detected in many genotypes of Mesoamerican origin but rarely in genotypes of Andean origin. The results suggest that these two endornaviruses were introduced into the Mesoamerican modern genotypes during common bean domestication and provide more evidence for the existence of two divergent gene pools of common bean.

  11. Growth and Physiological Responses of Phaseolus Species to Salinity Stress

    Directory of Open Access Journals (Sweden)

    J. S. Bayuelo-Jiménez

    2012-01-01

    Full Text Available This paper reports the changes on growth, photosynthesis, water relations, soluble carbohydrate, and ion accumulation, for two salt-tolerant and two salt-sensitive Phaseolus species grown under increasing salinity (0, 60 and 90 mM NaCl. After 20 days exposure to salt, biomass was reduced in all species to a similar extent (about 56%, with the effect of salinity on relative growth rate (RGR confined largely to the first week. RGR of salt-tolerant species was reduced by salinity due to leaf area ratio (LAR reduction rather than a decline in photosynthetic capacity, whereas unit leaf rate and LAR were the key factors in determining RGR on salt-sensitive species. Photosynthetic rate and stomatal conductance decreased gradually with salinity, showing significant reductions only in salt-sensitive species at the highest salt level. There was little difference between species in the effect of salinity on water relations, as indicated by their positive turgor. Osmotic adjustment occurred in all species and depended on higher K+, Na+, and Cl− accumulation. Despite some changes in soluble carbohydrate accumulation induced by salt stress, no consistent contributions in osmotic adjustment could be found in this study. Therefore, we suggest that tolerance to salt stress is largely unrelated to carbohydrate accumulation in Phaseolus species.

  12. Crop physiological analysis of seed quality variation in common bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Muasya, R.M.

    2001-01-01

    Keywords : Physiological maturity, harvest maturity, earliness, common bean, Phaseolus vulgaris L., morphological markers, variation, moisture content, dry weight, viability, vigour, electrical conductivity, tetrazolium, seed lot, seed

  13. Nutritional analyses for proteins and amino acids in beans (Phaseolus sp.

    Directory of Open Access Journals (Sweden)

    Wathelet B.

    1999-01-01

    Full Text Available The chemical index is a good estimator of seed protein quality of Phaseolus beans. In order to estimate this value, a protein hydrolysis and amino acid quantification are realised. The problems inherent to these techniques are presented.

  14. Gram staining apparatus for space station applications

    Science.gov (United States)

    Molina, T. C.; Brown, H. D.; Irbe, R. M.; Pierson, D. L.

    1990-01-01

    A self-contained, portable Gram staining apparatus (GSA) has been developed for use in the microgravity environment on board the Space Station Freedom. Accuracy and reproducibility of this apparatus compared with the conventional Gram staining method were evaluated by using gram-negative and gram-positive controls and different species of bacteria grown in pure cultures. A subsequent study was designed to assess the performance of the GSA with actual specimens. A set of 60 human and environmental specimens was evaluated with the GSA and the conventional Gram staining procedure. Data obtained from these studies indicated that the GSA will provide the Gram staining capability needed for the microgravity environment of space.

  15. Veillonella, Firmicutes: Microbes disguised as Gram negatives

    DEFF Research Database (Denmark)

    Vesth, Tammi Camilla; Ozen, Asli; Andersen, Sandra Christine

    2013-01-01

    Negativicutes, including the genus Veillonella, stain Gram negative. Veillonella are among the most abundant organisms of the oral and intestinal microflora of animals and humans, in spite of being strict anaerobes. In this work, the genomes of 24 Negativicutes, including eight Veillonella spp., are compared......, with the exception of a shared LPS biosynthesis pathway. The clade within the class Negativicutes to which the genus Veillonella belongs exhibits unique properties, most of which are in common with Gram-positives and some with Gram negatives. They are only distantly related to Clostridia, but are even less closely...... related to Gram-negative species. Though the Negativicutes stain Gram-negative and possess two membranes, the genome and proteome analysis presented here confirm their place within the (mainly) Gram positive phylum of the Firmicutes. Further studies are required to unveil the evolutionary history...

  16. Effect of gamma irradiation on germination and Vitamin-C content of green gram and moth beans

    International Nuclear Information System (INIS)

    Mohan, Priya; Marathe, S.A.; Rao, V.S.; Bongirwar, D.R.

    2001-01-01

    Insect disinfestation of prepacked legumes by using low dose gamma irradiation is well known. Changes in sprout length, water uptake and Vitamin C contents of radiation processed legumes were studied. Gamma irradiation (0.25 kGy) of green gram (Phaseolus aureus) and moth bean (Phaseolus aconitifolius) reduced the sprout length on germination by 6-18% at 0.25 kGy and 20-32% at 0.75 kGy, compared to control. Water uptake was not affected in both the legumes by radiation treatment. Vitamin C content increased significantly on germination in both the legumes for 24 and 48 hrs. Further on cooking of the seeds, Vitamin C contents were decreased in both the legumes significantly, more so in pressure cooked and shallow fried samples, compared to boiled (simple cooking). As such radiation treatment did not show any significant change in Vitamin C content of both the legumes either on germination and/or on cooking compared to control. (author)

  17. Transformation of gram positive bacteria by sonoporation

    Science.gov (United States)

    Yang, Yunfeng; Li, Yongchao

    2014-03-11

    The present invention provides a sonoporation-based method that can be universally applied for delivery of compounds into Gram positive bacteria. Gram positive bacteria which can be transformed by sonoporation include, for example, Bacillus, Streptococcus, Acetobacterium, and Clostridium. Compounds which can be delivered into Gram positive bacteria via sonoporation include nucleic acids (DNA or RNA), proteins, lipids, carbohydrates, viruses, small organic and inorganic molecules, and nano-particles.

  18. Plant growth and laboratory atmosphere. [Phaseolus multiflorus Willd

    Energy Technology Data Exchange (ETDEWEB)

    Richter, O

    1903-01-01

    The author observed that Phaseolus seedlings grown under glass bell jars which were closed off by water were two or three times as long as those seedlings which were grown under jars without the water closure. It was suspected that coal gas or other impurities were causing these results. Thus, experiments were performed to determine if indeed coal gas was affecting plant growth. Results indicated that coal gas has an inhibiting effect on the growth and length of the seedlings, but it also promotes the growth in thickness. Shortening and thickening was proportional to the concentration of the coal gas and the time of exposure. Mercury vapors were found to produce similar differences in height and thickness of seedlings as coal gas, but they are at the same time lethal to the plants.

  19. Evidence for the endophytic colonization of Phaseolus vulgaris(common bean roots by the diazotroph Herbaspirillum seropedicae

    Directory of Open Access Journals (Sweden)

    M.A. Schmidt

    2011-03-01

    Full Text Available Herbaspirillum seropedicae is an endophytic diazotrophic bacterium, which associates with important agricultural plants. In the present study, we have investigated the attachment to and internal colonization of Phaseolus vulgaris roots by the H. seropedicae wild-type strain SMR1 and by a strain of H. seropedicae expressing a red fluorescent protein (DsRed to track the bacterium in the plant tissues. Two-day-old P. vulgaris roots were incubated at 30°C for 15 min with 6 x 10(8 CFU/mL H. seropedicae SMR1 or RAM4. Three days after inoculation, 4 x 10(4 cells of endophytic H. seropedicae SMR1 were recovered per gram of fresh root, and 9 days after inoculation the number of endophytes increased to 4 x 10(6 CFU/g. The identity of the recovered bacteria was confirmed by amplification and sequencing of the 16SrRNA gene. Furthermore, confocal microscopy of P. vulgaris roots inoculated with H. seropedicae RAM4 showed that the bacterial cells were attached to the root surface 15 min after inoculation; fluorescent bacteria were visible in the internal tissues after 24 h and were found in the central cylinder after 72 h, showing that H. seropedicae RAM4 is capable of colonizing the roots of the dicotyledon P. vulgaris. Determination of dry weight of common bean inoculated with H. seropedicae SMR1 suggested that this bacterium has a negative effect on the growth of P. vulgaris.

  20. n-Gram-Based Text Compression

    Science.gov (United States)

    Duong, Hieu N.; Snasel, Vaclav

    2016-01-01

    We propose an efficient method for compressing Vietnamese text using n-gram dictionaries. It has a significant compression ratio in comparison with those of state-of-the-art methods on the same dataset. Given a text, first, the proposed method splits it into n-grams and then encodes them based on n-gram dictionaries. In the encoding phase, we use a sliding window with a size that ranges from bigram to five grams to obtain the best encoding stream. Each n-gram is encoded by two to four bytes accordingly based on its corresponding n-gram dictionary. We collected 2.5 GB text corpus from some Vietnamese news agencies to build n-gram dictionaries from unigram to five grams and achieve dictionaries with a size of 12 GB in total. In order to evaluate our method, we collected a testing set of 10 different text files with different sizes. The experimental results indicate that our method achieves compression ratio around 90% and outperforms state-of-the-art methods. PMID:27965708

  1. n-Gram-Based Text Compression

    Directory of Open Access Journals (Sweden)

    Vu H. Nguyen

    2016-01-01

    Full Text Available We propose an efficient method for compressing Vietnamese text using n-gram dictionaries. It has a significant compression ratio in comparison with those of state-of-the-art methods on the same dataset. Given a text, first, the proposed method splits it into n-grams and then encodes them based on n-gram dictionaries. In the encoding phase, we use a sliding window with a size that ranges from bigram to five grams to obtain the best encoding stream. Each n-gram is encoded by two to four bytes accordingly based on its corresponding n-gram dictionary. We collected 2.5 GB text corpus from some Vietnamese news agencies to build n-gram dictionaries from unigram to five grams and achieve dictionaries with a size of 12 GB in total. In order to evaluate our method, we collected a testing set of 10 different text files with different sizes. The experimental results indicate that our method achieves compression ratio around 90% and outperforms state-of-the-art methods.

  2. Estudio de la fitohemaglutinina proveniente del frijol colorado (Phaseolus Vulgaris Study of phytohemagglutinin from red bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Patricia Hernández Díaz

    1999-12-01

    Full Text Available Se obtuvieron preparaciones crudas de fitohemaglutinina (PHA a partir de frijol colorado (Phaseolus vulgaris por 2 métodos: extracción acuosa y extracción ácida. Por el método ácido se obtuvieron mejores resultados en cuanto a concentración de proteínas y pureza de la misma. Se empleó la cromatografía en hidroxiapatita para separar las isoformas que forman la PHA y se obtuvieron 5 fraccciones proteicas que se evaluaron funcionalmente junto con las preparaciones crudas, a través de sus propiedades eritroaglutinantes y leucoaglutinantes. A medida que se aumentó la fuerza iónica del medio se observó que las fracciones obtenidas presentaban una disminución relativa de la actividad leucoaglutinante, así como un incremento relativo de la actividad eritroaglutinante. Las preparaciones crudas y las fracciones se evaluaron electroforéticamente y se obtuvieron bandas muy similares a la de la PHA patrón utilizadaRaw preparations of phytohemagglutinin (PHA were obtained from red bean (Phaseolus vulgaris by 2 methods: aqueous extraction and acid extraction. Better results were obtained with the acid methods as regards the protein concentration and its purity. Hydroxyapatite chromatography was used to separate the isoforms forming the phytohemagglutinin. 5 protein fractions were obtained and functionally evaluated together with the raw preparations through their erythroagglutinating and leukoagglutinating properties. As the ionic force of the medium increased it was observed that the fractions obtained presented a relative decrease of the leukoagglutinating activity as well as a relative rise of the crythroagglutinating activity. The raw preparations and the fractions were electrophoretically evaluated and bands very similar to that of the PHA used as a pattern were obtained

  3. Methods for Confirming the Gram Reaction of Gram-variable Bacillus Species Isolated from Tobacco

    Directory of Open Access Journals (Sweden)

    Morin A

    2014-12-01

    Full Text Available Bacillus is a predominant genus of bacteria isolated from tobacco. The Gram stain is the most commonly used and most important of all diagnostic staining techniques in microbiology. In order to help confirm the Gram positivity of Bacillus isolates from tobacco, three methods using the chemical differences of the cell wall and membrane of Gram-positive and Gram-negative bacteria were investigated: the KOH (potassium hydroxide, the LANA (L-alanine-4-nitroanilide, and the vancomycin susceptibility tests. When colonies of Gram-negative bacteria are treated with 3% KOH solution, a slimy suspension is produced, probably due to destruction of the cell wall and liberation of deoxyribonucleic acid (DNA. Gram-positive cell walls resist KOH treatment. The LANA test reveals the presence of a cell wall aminopeptidase that hydrolyzes the L-alanine-4-nitroanilide in Gram-negative bacteria. This enzyme is absent in Gram-positive bacteria. Vancomycin is a glycopeptide antibiotic inhibiting the cell wall peptido-glycan synthesis of Gram-positive microorganisms. Absence of lysis with KOH, absence of hydrolysis of LANA, and susceptibility to vancomycin were used with the Gram reaction to confirm the Gram positivity of various Bacillus species isolated from tobacco. B. laevolacticus excepted, all Bacillus species tested showed negative reactions to KOH and LANA tests, and all species were susceptible to vancomycin (5 and 30 µg.

  4. Multicenter Assessment of Gram Stain Error Rates.

    Science.gov (United States)

    Samuel, Linoj P; Balada-Llasat, Joan-Miquel; Harrington, Amanda; Cavagnolo, Robert

    2016-06-01

    Gram stains remain the cornerstone of diagnostic testing in the microbiology laboratory for the guidance of empirical treatment prior to availability of culture results. Incorrectly interpreted Gram stains may adversely impact patient care, and yet there are no comprehensive studies that have evaluated the reliability of the technique and there are no established standards for performance. In this study, clinical microbiology laboratories at four major tertiary medical care centers evaluated Gram stain error rates across all nonblood specimen types by using standardized criteria. The study focused on several factors that primarily contribute to errors in the process, including poor specimen quality, smear preparation, and interpretation of the smears. The number of specimens during the evaluation period ranged from 976 to 1,864 specimens per site, and there were a total of 6,115 specimens. Gram stain results were discrepant from culture for 5% of all specimens. Fifty-eight percent of discrepant results were specimens with no organisms reported on Gram stain but significant growth on culture, while 42% of discrepant results had reported organisms on Gram stain that were not recovered in culture. Upon review of available slides, 24% (63/263) of discrepant results were due to reader error, which varied significantly based on site (9% to 45%). The Gram stain error rate also varied between sites, ranging from 0.4% to 2.7%. The data demonstrate a significant variability between laboratories in Gram stain performance and affirm the need for ongoing quality assessment by laboratories. Standardized monitoring of Gram stains is an essential quality control tool for laboratories and is necessary for the establishment of a quality benchmark across laboratories. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Procalcitonin levels in gram-positive, gram-negative, and fungal bloodstream infections.

    Science.gov (United States)

    Leli, Christian; Ferranti, Marta; Moretti, Amedeo; Al Dhahab, Zainab Salim; Cenci, Elio; Mencacci, Antonella

    2015-01-01

    Procalcitonin (PCT) can discriminate bacterial from viral systemic infections and true bacteremia from contaminated blood cultures. The aim of this study was to evaluate PCT diagnostic accuracy in discriminating Gram-positive, Gram-negative, and fungal bloodstream infections. A total of 1,949 samples from patients with suspected bloodstream infections were included in the study. Median PCT value in Gram-negative (13.8 ng/mL, interquartile range (IQR) 3.4-44.1) bacteremias was significantly higher than in Gram-positive (2.1 ng/mL, IQR 0.6-7.6) or fungal (0.5 ng/mL, IQR 0.4-1) infections (P Gram-negatives from Gram-positives at the best cut-off value of 10.8 ng/mL and an AUC of 0.944 (95% CI 0.919-0.969, P Gram-negatives from fungi at the best cut-off of 1.6 ng/mL. Additional results showed a significant difference in median PCT values between Enterobacteriaceae and nonfermentative Gram-negative bacteria (17.1 ng/mL, IQR 5.9-48.5 versus 3.5 ng/mL, IQR 0.8-21.5; P Gram-negative from Gram-positive and fungal bloodstream infections. Nevertheless, its utility to predict different microorganisms needs to be assessed in further studies.

  6. Embedded Lattice and Properties of Gram Matrix

    Directory of Open Access Journals (Sweden)

    Futa Yuichi

    2017-03-01

    Full Text Available In this article, we formalize in Mizar [14] the definition of embedding of lattice and its properties. We formally define an inner product on an embedded module. We also formalize properties of Gram matrix. We formally prove that an inverse of Gram matrix for a rational lattice exists. Lattice of Z-module is necessary for lattice problems, LLL (Lenstra, Lenstra and Lov´asz base reduction algorithm [16] and cryptographic systems with lattice [17].

  7. Veillonella, Firmicutes: Microbes disguised as Gram negatives.

    Science.gov (United States)

    Vesth, Tammi; Ozen, Aslı; Andersen, Sandra C; Kaas, Rolf Sommer; Lukjancenko, Oksana; Bohlin, Jon; Nookaew, Intawat; Wassenaar, Trudy M; Ussery, David W

    2013-12-20

    The Firmicutes represent a major component of the intestinal microflora. The intestinal Firmicutes are a large, diverse group of organisms, many of which are poorly characterized due to their anaerobic growth requirements. Although most Firmicutes are Gram positive, members of the class Negativicutes, including the genus Veillonella, stain Gram negative. Veillonella are among the most abundant organisms of the oral and intestinal microflora of animals and humans, in spite of being strict anaerobes. In this work, the genomes of 24 Negativicutes, including eight Veillonella spp., are compared to 20 other Firmicutes genomes; a further 101 prokaryotic genomes were included, covering 26 phyla. Thus a total of 145 prokaryotic genomes were analyzed by various methods to investigate the apparent conflict of the Veillonella Gram stain and their taxonomic position within the Firmicutes. Comparison of the genome sequences confirms that the Negativicutes are distantly related to Clostridium spp., based on 16S rRNA, complete genomic DNA sequences, and a consensus tree based on conserved proteins. The genus Veillonella is relatively homogeneous: inter-genus pair-wise comparison identifies at least 1,350 shared proteins, although less than half of these are found in any given Clostridium genome. Only 27 proteins are found conserved in all analyzed prokaryote genomes. Veillonella has distinct metabolic properties, and significant similarities to genomes of Proteobacteria are not detected, with the exception of a shared LPS biosynthesis pathway. The clade within the class Negativicutes to which the genus Veillonella belongs exhibits unique properties, most of which are in common with Gram-positives and some with Gram negatives. They are only distantly related to Clostridia, but are even less closely related to Gram-negative species. Though the Negativicutes stain Gram-negative and possess two membranes, the genome and proteome analysis presented here confirm their place within the

  8. An optimized staining technique for the detection of Gram positive and Gram negative bacteria within tissue.

    Science.gov (United States)

    Becerra, Sandra C; Roy, Daniel C; Sanchez, Carlos J; Christy, Robert J; Burmeister, David M

    2016-04-12

    Bacterial infections are a common clinical problem in both acute and chronic wounds. With growing concerns over antibiotic resistance, treatment of bacterial infections should only occur after positive diagnosis. Currently, diagnosis is delayed due to lengthy culturing methods which may also fail to identify the presence of bacteria. While newer costly bacterial identification methods are being explored, a simple and inexpensive diagnostic tool would aid in immediate and accurate treatments for bacterial infections. Histologically, hematoxylin and eosin (H&E) and Gram stains have been employed, but are far from optimal when analyzing tissue samples due to non-specific staining. The goal of the current study was to develop a modification of the Gram stain that enhances the contrast between bacteria and host tissue. A modified Gram stain was developed and tested as an alternative to Gram stain that improves the contrast between Gram positive bacteria, Gram negative bacteria and host tissue. Initially, clinically relevant strains of Pseudomonas aeruginosa and Staphylococcus aureus were visualized in vitro and in biopsies of infected, porcine burns using routine Gram stain, and immunohistochemistry techniques involving bacterial strain-specific fluorescent antibodies as validation tools. H&E and Gram stain of serial biopsy sections were then compared to a modification of the Gram stain incorporating a counterstain that highlights collagen found in tissue. The modified Gram stain clearly identified both Gram positive and Gram negative bacteria, and when compared to H&E or Gram stain alone provided excellent contrast between bacteria and non-viable burn eschar. Moreover, when applied to surgical biopsies from patients that underwent burn debridement this technique was able to clearly detect bacterial morphology within host tissue. We describe a modification of the Gram stain that provides improved contrast of Gram positive and Gram negative microorganisms within host

  9. Diversity of Rhizobium-Phaseolus vulgaris symbiosis: Overview and perspectives

    International Nuclear Information System (INIS)

    Martinez-Romero, Esperanza

    2001-01-01

    Common bean (Phaseolus vulgaris) has become a cosmopolitan crop, but was originally domesticated in the Americas and has been grown in Latin America for several thousand years. Consequently an enormous diversity of bean nodulating bacteria have developed and in the centers of origin the predominant species in bean nodules is R. etli. In some areas of Latin America, inoculation, which normally promotes nodulation and nitrogen fixation is hampered by the prevalence of native strains. Many other species in addition to R. etli have been found in bean nodules in regions where bean has been introduced. Some of these species such as R. leguminosarum bv. phaseoli, R. gallicum bv. phaseoli and R. giardinii bv. phaseoli might have arisen by acquiring the phaseoli plasmid from R. etli. Others, like R. trap id, are well adapted to acid soils and high temperatures and are good inoculants for bean under these conditions. The large number of rhizobia species capable of nodulating bean supports that bean is a promiscuous host and a diversity of bean-rhizobia interactions exists. Large ranges of dinitrogen fixing capabilities have been documented among bean cultivars and commercial beans have the lowest values among legume crops. Knowledge on bean symbiosis is still incipient but could help to improve bean biological nitrogen fixation. (author)

  10. Gram-negative, but not Gram-positive, bacteria elicit strong PGE2 production in human monocytes.

    Science.gov (United States)

    Hessle, Christina C; Andersson, Bengt; Wold, Agnes E

    2003-12-01

    Gram-positive and Gram-negative bacteria induce different cytokine patterns in human mononuclear cells. We have seen that Gram-positives preferentially induce IL-12 and TNF-alpha, whereas Gram-negatives induce more IL-10, IL-6, and IL-8. In this study, we compared the capacity of these two groups of bacteria to induce PGE2. Monocytes stimulated with Gram-negative bacterial species induced much more PGE2 than did Gram-positive bacteria (5600 +/- 330 vs. 1700 +/- 670 pg/mL, p Gram-positive and Gram-negative bacteria. We suggest that Gram-positive and Gram-negative bacteria may stimulate different innate effector functions; Gram-positive bacteria promoting cell-mediated effector functions whereas Gram-negative bacteria inducing mediators inhibiting the same.

  11. Ouro Verde MG 2: nova cultivar de mungo-verde para Minas Gerais Ouro Verde MG 2: new mungbean cultivar for Minas Gerais State, Brazil

    Directory of Open Access Journals (Sweden)

    Rogério F. Vieira

    2002-03-01

    Full Text Available Dentre várias linhagens introduzidas do "Asian Vegetable Research and Development Center" (AVRDC, sobressaiu a linhagem VC 3984-B-2-B-4-1-B, que recebeu o nome de Ouro Verde MG 2. Suas sementes são verde-brilhantes e o peso de 1000 unidades varia de 43 a 51 g. O início da floração ocorre em torno de 33 dias após a emergência e a primeira vagem madura surge entre 23 e 33 dias. Por se tratar de espécie de maturação desuniforme, podem ser necessárias duas a quatro colheitas. As plantas podem atingir 95 cm de altura. As vagens são marrom-escuras e concentram-se na parte superior da planta. É suscetível a duas doenças que geralmente aparecem no final do ciclo de vida do mungo-verde: míldio-pulverulento (Erysiphe polygoni e mancha-foliar-de-cercospora (Cercospora canescens. A 'Ouro Verde MG 2' é resistente ao acamamento, e o seu rendimento, em três ensaios instalados em dezembro, janeiro e fevereiro, variou de 1,5 a 2,0 t/ha. Esses rendimentos foram, em média, 12% superior ao da cultivar Ouro Verde.Among many accessions introduced from Asian Vegetable Research and Development Center (AVRDC, the VC 3984-B-2-B-4-1-B stood out and was named 'Ouro Verde MG 2'. The seeds are bright green and 1000-seed weight ranges from 43 to 51 g. Flowering starts approximately 33 days after emergence and the first pod ripens between 23 and 33 days later. As mungbean is a non-uniform maturation species, two to four harvests could be necessary. The plant can reach 95 cm high. The pods are dark brown and concentrated in the upper canopy. This cv. is susceptible to two diseases which generally appear late in the crop: powdery mildew (Erysiphe polygoni and cercospora leaf spot (Cercospora canescens. 'Ouro Verde MG 2' is resistant to lodging. The yield measured in three experiments carried out in December, January, and February, ranged from 1.5 to 2.0 t/ha. In average, these yields were 12% superior than the achieved by the cultivar 'Ouro Verde'.

  12. The comparison of pyrosequencing molecular Gram stain, culture, and conventional Gram stain for diagnosing orthopaedic infections.

    Science.gov (United States)

    Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Lieberman, Isador H; Krebs, Viktor; Togawa, Daisuke; Fujishiro, Takaaki; Procop, Gary W

    2006-08-01

    We have developed a combined real-time PCR and pyrosequencing assay that successfully differentiated the vast majority of gram-positive and gram-negative bacteria when bacterial isolates were tested. The purpose of this study was to evaluate this assay on clinical specimens obtained from orthopedic surgeries, and to prospectively compare the results of "molecular Gram stain" with culture and conventional direct Gram stain. Forty-five surgical specimens were obtained from patients who underwent orthopedic surgery procedures. The DNA was extracted and a set of broad-range PCR primers that targeted a part of the 16S rDNA gene was used for pan-bacterial PCR. The amplicons were submitted for pyrosequencing and the resulting molecular Gram stain characteristics were recorded. Culture and direct Gram staining were performed using standard methods for all cases. Surgical specimens were reviewed histologically for all cases that had a discrepancy between culture and molecular results. There was an 86.7% (39/45) agreement between the traditional and molecular methods. In 12/14 (85.7%) culture-proven cases of bacterial infection, molecular Gram stain characteristics were in agreement with the culture results, while the conventional Gram stain result was in agreement only for five cases (35.7%). In the 31 culture negative cases, 27 cases were also PCR negative, whereas 4 were PCR positive. Three of these were characterized as gram negative and one as gram positive by this molecular method. Molecular determination of the Gram stain characteristics of bacteria that cause orthopedic infections may be achieved, in most instances, by this method. Further studies are necessary to understand the clinical importance of PCR-positive/culture-negative results.

  13. Gram staining for the treatment of peritonsillar abscess.

    Science.gov (United States)

    Takenaka, Yukinori; Takeda, Kazuya; Yoshii, Tadashi; Hashimoto, Michiko; Inohara, Hidenori

    2012-01-01

    Objective. To examine whether Gram staining can influence the choice of antibiotic for the treatment of peritonsillar abscess. Methods. Between 2005 and 2009, a total of 57 cases of peritonsillar abscess were analyzed with regard to cultured bacteria and Gram staining. Results. Only aerobes were cultured in 16% of cases, and only anaerobes were cultured in 51% of cases. Mixed growth of aerobes and anaerobes was observed in 21% of cases. The cultured bacteria were mainly aerobic Streptococcus, anaerobic Gram-positive cocci, and anaerobic Gram-negative rods. Phagocytosis of bacteria on Gram staining was observed in 9 cases. The bacteria cultured from these cases were aerobic Streptococcus, anaerobic Gram-positive cocci, and anaerobic Gram-negative rods. The sensitivity of Gram staining for the Gram-positive cocci and Gram-negative rods was 90% and 64%, respectively. The specificity of Gram staining for the Gram-positive cocci and Gram-negative rods was 62% and 76%, respectively. Most of the Gram-positive cocci were sensitive to penicillin, but some of anaerobic Gram-negative rods were resistant to penicillin. Conclusion. When Gram staining shows only Gram-positive cocci, penicillin is the treatment of choice. In other cases, antibiotics effective for the penicillin-resistant organisms should be used.

  14. Protamine-induced permeabilization of cell envelopes of gram-positive and gram-negative bacteria

    DEFF Research Database (Denmark)

    Johansen, Charlotte; Verheul, A.; Gram, Lone

    1997-01-01

    carboxyfluorescein and ATP after 2 to 5 min. Maximum antibacterial activity was reached at alkaline pH and in the absence of divalent cations. The efficient permeabilization of cell envelopes of both gram-positive and gram-negative bacteria suggests that protamine causes a general disruption of the cell envelope...

  15. Procalcitonin Levels in Gram-Positive, Gram-Negative, and Fungal Bloodstream Infections

    Directory of Open Access Journals (Sweden)

    Christian Leli

    2015-01-01

    Full Text Available Procalcitonin (PCT can discriminate bacterial from viral systemic infections and true bacteremia from contaminated blood cultures. The aim of this study was to evaluate PCT diagnostic accuracy in discriminating Gram-positive, Gram-negative, and fungal bloodstream infections. A total of 1,949 samples from patients with suspected bloodstream infections were included in the study. Median PCT value in Gram-negative (13.8 ng/mL, interquartile range (IQR 3.4–44.1 bacteremias was significantly higher than in Gram-positive (2.1 ng/mL, IQR 0.6–7.6 or fungal (0.5 ng/mL, IQR 0.4–1 infections (P<0.0001. Receiver operating characteristic analysis showed an area under the curve (AUC for PCT of 0.765 (95% CI 0.725–0.805, P<0.0001 in discriminating Gram-negatives from Gram-positives at the best cut-off value of 10.8 ng/mL and an AUC of 0.944 (95% CI 0.919–0.969, P<0.0001 in discriminating Gram-negatives from fungi at the best cut-off of 1.6 ng/mL. Additional results showed a significant difference in median PCT values between Enterobacteriaceae and nonfermentative Gram-negative bacteria (17.1 ng/mL, IQR 5.9–48.5 versus 3.5 ng/mL, IQR 0.8–21.5; P<0.0001. This study suggests that PCT may be of value to distinguish Gram-negative from Gram-positive and fungal bloodstream infections. Nevertheless, its utility to predict different microorganisms needs to be assessed in further studies.

  16. Diversification and Population Structure in Common Beans (Phaseolus vulgaris L.)

    Science.gov (United States)

    Blair, Matthew W.; Soler, Alvaro; Cortés, Andrés J.

    2012-01-01

    Wild accessions of crops and landraces are valuable genetic resources for plant breeding and for conserving alleles and gene combinations in planta. The primary genepool of cultivated common beans includes wild accessions of Phaseolus vulgaris. These are of the same species as the domesticates and therefore are easily crossable with cultivated accessions. Molecular marker assessment of wild beans and landraces is important for the proper utilization and conservation of these important genetic resources. The goal of this research was to evaluate a collection of wild beans with fluorescent microsatellite or simple sequence repeat markers and to determine the population structure in combination with cultivated beans of all known races. Marker diversity in terms of average number of alleles per marker was high (13) for the combination of 36 markers and 104 wild genotypes that was similar to the average of 14 alleles per marker found for the 606 cultivated genotypes. Diversity in wild beans appears to be somewhat higher than in cultivated beans on a per genotype basis. Five populations or genepools were identified in structure analysis of the wild beans corresponding to segments of the geographical range, including Mesoamerican (Mexican), Guatemalan, Colombian, Ecuadorian-northern Peruvian and Andean (Argentina, Bolivia and Southern Peru). The combined analysis of wild and cultivated accessions showed that the first and last of these genepools were related to the cultivated genepools of the same names and the penultimate was found to be distinct but not ancestral to the others. The Guatemalan genepool was very novel and perhaps related to cultivars of race Guatemala, while the Colombian population was also distinct. Results suggest geographic isolation, founder effects or natural selection could have created the different semi-discrete populations of wild beans and that multiple domestications and introgression were involved in creating the diversity of cultivated beans

  17. Purification and partial characterization of Phaseolus vulgaris seed aminopeptidase

    Directory of Open Access Journals (Sweden)

    Abdala A.P.

    1999-01-01

    Full Text Available The aminopeptidase activity of Phaseolus vulgaris seeds was measured using L-Leu-p-nitroanilide and the L-aminoacyl-ß-naphthylamides of Leu, Ala, Arg and Met. A single peak of aminopeptidase activity on Leu-ß-naphthylamide was eluted at 750 µS after gradient elution chromatography on DEAE-cellulose of the supernatant of a crude seed extract. The effluent containing enzyme activity was applied to a Superdex 200 column and only one peak of aminopeptidase activity was obtained. SDS-polyacrylamide gel electrophoresis (10% presented only one protein band with molecular mass of 31 kDa under reducing and nonreducing conditions. The aminopeptidase has an optimum pH of 7.0 for activity on all substrates tested and the highest Vmax/KM ratio for L-Leu-ß-naphthylamide. The enzyme activity was increased 40% by 0.15 M NaCl, inhibited 94% by 2.0 mM Zn2+, inhibited 91% by sodium p-hydroxymercuribenzoate and inhibited 45% by 0.7 mM o-phenanthroline and 30 µM EDTA. Mercaptoethanol (3.3 mM, dithioerythritol (1.7 mM, Ala, Arg, Leu and Met (70 µM, p-nitroaniline (0.25 mM and ß-naphthylamine (0.53 mM had no effect on enzyme activity when assayed with 0.56 mM of substrate. Bestatin (20 µM inhibited 18% the enzyme activity. The aminopeptidase activity in the seeds decayed 50% after two months when stored at 4oC and room temperature. The enzyme is leucyl aminopeptidase metal- and thiol group-dependent.

  18. Diversification and population structure in common beans (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Matthew W Blair

    Full Text Available Wild accessions of crops and landraces are valuable genetic resources for plant breeding and for conserving alleles and gene combinations in planta. The primary genepool of cultivated common beans includes wild accessions of Phaseolus vulgaris. These are of the same species as the domesticates and therefore are easily crossable with cultivated accessions. Molecular marker assessment of wild beans and landraces is important for the proper utilization and conservation of these important genetic resources. The goal of this research was to evaluate a collection of wild beans with fluorescent microsatellite or simple sequence repeat markers and to determine the population structure in combination with cultivated beans of all known races. Marker diversity in terms of average number of alleles per marker was high (13 for the combination of 36 markers and 104 wild genotypes that was similar to the average of 14 alleles per marker found for the 606 cultivated genotypes. Diversity in wild beans appears to be somewhat higher than in cultivated beans on a per genotype basis. Five populations or genepools were identified in structure analysis of the wild beans corresponding to segments of the geographical range, including Mesoamerican (Mexican, Guatemalan, Colombian, Ecuadorian-northern Peruvian and Andean (Argentina, Bolivia and Southern Peru. The combined analysis of wild and cultivated accessions showed that the first and last of these genepools were related to the cultivated genepools of the same names and the penultimate was found to be distinct but not ancestral to the others. The Guatemalan genepool was very novel and perhaps related to cultivars of race Guatemala, while the Colombian population was also distinct. Results suggest geographic isolation, founder effects or natural selection could have created the different semi-discrete populations of wild beans and that multiple domestications and introgression were involved in creating the diversity of

  19. Dissecting Phaseolus vulgaris innate immune system against Colletotrichum lindemuthianum infection.

    Directory of Open Access Journals (Sweden)

    Paula Rodrigues Oblessuc

    Full Text Available BACKGROUND: The genus Colletotrichum is one of the most economically important plant pathogens, causing anthracnose on a wide range of crops including common beans (Phaseolus vulgaris L.. Crop yield can be dramatically decreased depending on the plant cultivar used and the environmental conditions. This study aimed to identify potential genetic components of the bean immune system to provide environmentally friendly control measures against this fungus. METHODOLOGY AND PRINCIPAL FINDINGS: As the common bean is not amenable to reverse genetics to explore functionality and its genome is not fully curated, we used putative Arabidopsis orthologs of bean expressed sequence tag (EST to perform bioinformatic analysis and experimental validation of gene expression to identify common bean genes regulated during the incompatible interaction with C. lindemuthianum. Similar to model pathosystems, Gene Ontology (GO analysis indicated that hormone biosynthesis and signaling in common beans seem to be modulated by fungus infection. For instance, cytokinin and ethylene responses were up-regulated and jasmonic acid, gibberellin, and abscisic acid responses were down-regulated, indicating that these hormones may play a central role in this pathosystem. Importantly, we have identified putative bean gene orthologs of Arabidopsis genes involved in the plant immune system. Based on experimental validation of gene expression, we propose that hypersensitive reaction as part of effector-triggered immunity may operate, at least in part, by down-regulating genes, such as FLS2-like and MKK5-like, putative orthologs of the Arabidopsis genes involved in pathogen perception and downstream signaling. CONCLUSIONS/SIGNIFICANCE: We have identified specific bean genes and uncovered metabolic processes and pathways that may be involved in the immune response against pathogens. Our transcriptome database is a rich resource for mining novel defense-related genes, which enabled us to

  20. Bioacoustics of Acanthoscelides obtectus (Coleoptera: Chrysomelidae: Bruchinae) on Phaseolus vulgaris (Fabaceae)

    Science.gov (United States)

    Acanthoscelides obtectus (Say) (Coleoptera: Chrysomelidae), is an economically important pest of common bean Phaseolus vulgaris L. (Fabaceae) in the tropics and subtropics. It is difficult to detect the presence of A. obtectus because the larvae are cryptic and spend most of their developmental time...

  1. Effects of bioprocessed antinutritional factors on bean protein quality : with special emphasis on Phaseolus vulgaris L.

    NARCIS (Netherlands)

    Savelkoul, F.

    1994-01-01

    Legumes, e.g. beans and peas, can contain antinutritional factors. Some varieties of faba beans (Vicia faba), soya beans (Glycine max ) and white kidney beans (Phaseolus vulgaris) can contain in their raw state antinutritional

  2. [Glycemic response to consumption of a cereals and legume (Phaseolus vulgaris) bar on healthy individuals].

    Science.gov (United States)

    Zambrano, Rosaura; Granito, Marisela; Valero, Yolmar

    2013-06-01

    The objective of this work was to formulate a cereals and legume (Phaseolus vulgaris) bar and assess its impact on the glycemic response of healthy individuals, in order to contribute to the healthy food supply beneficial to consumers. A mixture of cereals (corn and oats) and different percentages (20 and 30%) of Phaseolus vulgaris was used to formulate the bar. Additionally, a legume cereal bar without legumes (bar control) was prepared. The bar with 30% of Phaseolus vulgaris was selected through sensory evaluation, being scored with better flavor and texture. This combination of cereals and legumes aminoacid improves complementation and reaches the formulation criteria previously established. Chemical characterization indicated a higher protein content in the bar with 30% of Phaseolus vulgaris (13.55%) relative to the bar control (8.5%). The contents of fat, ash and dietary fiber did not differ between the two bars evaluated. However, the soluble fiber and resistant starch of the selected bar was a 32.05% and 18.67%, respectively, than in the control bar; this may contribute to decreasing the rate of glucose uptake. The selected bar presented a low glycemic index (49) and intermediate glycemic load (12.0) in healthy volunteers, which could lead to a possible reduction in the rate of absorption of glucose into the bloodstream, associated with a carbohydrate content of slow absorption. This bar represents a proposal of a healthy snack for the consumer.

  3. Characterization of Sugar Concentration Among Edible Podded Accessions in the USDA Phaseolus vulgaris Germplasm Collection

    Science.gov (United States)

    The objective is to gain knowledge regarding variation in sugar and flavor content among a sample of dry bean and green pod-type accessions from the USDA Phaseolus Germplasm Core Collection, Pullman, WA. The results could be used to market product quality and offer unique opportunities to expand ma...

  4. Yields and quality of Phaseolus bean cultivars under farmers’ conditions in eastern and southern Africa

    DEFF Research Database (Denmark)

    Jensen, Henning Høgh; Kamalongo, Donwell; Ngwira, Amos

    2014-01-01

    Common bean (Phaseolus vulgaris L.) is a dominant grain legume in eastern and southern Africa, where it constitutes a major source of protein and microminerals in peoples’ diet. The current studies aimed at determining how initially promising genotypes of bean responded in terms of yield and grain...

  5. Visualization of resistance responses in Phaseolus vulgaris using reporter tagged clones of Bean common mosaic virus

    DEFF Research Database (Denmark)

    Naderpour, Masoud; Johansen, Ida Elisabeth

    2011-01-01

    Reporter tagged virus clones can provide detailed information on virus–host interactions. In Phaseolus vulgaris (bean), four recessive and one dominant gene are known to control infection by strains of the potyvirus species Bean common mosaic virus (BCMV). To study the interactions between BCMV...

  6. Formation of adventitious roots on green leaf cuttings of Phaseolus vulgaris L.

    NARCIS (Netherlands)

    Oppenoorth, Johanna Margriet

    1980-01-01

    n this thesis the development of adventitious roots on green leaf cuttings of Phaseolus vulgaris L. is studies. The use of green leaf cuttings has the advantage that the leaf blade provides the developing roots inthe petiole with all the nutrients required, a disadvantage is that the composition of

  7. Cortical projection patterns of magnocellular basal nucleus subdivisions as revealed by anterogradely transported Phaseolus vulgaris leucoagglutinin

    NARCIS (Netherlands)

    Luiten, P.G.M.; Gaykema, R.P.A.; Traber, J.; Spencer Jr., D.G.

    1987-01-01

    The present paper deals with a detailed analysis of cortical projections from the magnocellular basal nucleus (MBN) and horizontal limb of the diagonal band of Broca (HDB) in the rat. The MBN and HDB were injected iontophoretically with the anterograde tracer Phaseolus vulgaris leucoagglutinin

  8. Phaseolus vulgaris leuco-agglutinin immunohistochemistry. A comparison between autoradiographic and lectin tracing of neuronal efferents

    NARCIS (Netherlands)

    Horst, G.J. ter; Karst, H.; Luiten, P.G.M.

    1984-01-01

    The autoradiographic pattern of anterograde labeling as a result from injections with tritiated amino acids is compared to the labeling of efferents with Phaseolus vulgaris leuco-agglutinin after lectin injections in the same nucleus visualized by immunohistochemical methods. This comparison is made

  9. Phenotypic variation in a core collection of common bean (Phaseolus vulgaris L.) in the Netherlands

    NARCIS (Netherlands)

    Zeven, A.C.; Waninge, J.; Hintum, van Th.J.L.; Singh, S.P.

    1999-01-01

    Forty accessions, forming a core collection of mainly bush type of the common bean (Phaseolus vulgaris L.) germplasm in the Netherlands, were evaluated for 14 qualitative and quantitative traits at the Agricultural University, Wageningen (WAU), the Netherlands in 1992. These and an additional 117

  10. Effects of radiation quality on the opening of stomata in intact Phaseolus vulgaris leaves

    International Nuclear Information System (INIS)

    Sikorska, K.; Kozłowska, B.; Ciereszko, I.; Maleszewski, S.

    1997-01-01

    In intact French bean (Phaseolus vulgaris L.) leaves blue radiation enhanced opening of stomata both when it was used individually and when it was used as preirradiation before ''white light'' irradiation. Effects of red radiation were just the contrary

  11. THE ACTION OF UV RADIATION ON MITOTIC INDEX AND MITOTIC DIVISION PHASES AT PHASEOLUS VULGARIS L

    Directory of Open Access Journals (Sweden)

    Csilla Iuliana Bara

    2005-08-01

    Full Text Available In this work, damaging effects of UV radiations on bean Phaseolus vulgaris L. plantule root tips were investigated. Our study proves that by bean plants, the decrease of cell division frequency appears to be part of protection mechanism against especially the short waved UV radiation, with variations depending on cultivar.

  12. Differential proteomics reveals the hallmarks of seed development in common bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Parreira, J R; Bouraada, J; Fitzpatrick, M A; Silvestre, S; Bernardes da Silva, A; Marques da Silva, J; Almeida, A M; Fevereiro, P; Altelaar, A F M; Araújo, S S

    2016-01-01

    Common bean (Phaseolus vulgaris L.) is one of the most consumed staple foods worldwide. Little is known about the molecular mechanisms controlling seed development. This study aims to comprehensively describe proteome dynamics during seed development of common bean. A high-throughput gel-free

  13. BIOCHEMICAL EFFECTS INDUCED BY UV TREATMENT ON 5 ROMANIAN PHASEOLUS VULGARIS L. CULTIVARS, GROWN IN FIELD

    Directory of Open Access Journals (Sweden)

    Iulia Bara

    2006-08-01

    Full Text Available Our study is focused on the influence of the UV-B irradiation, at the level of hidric balance, methabolic activity, and in the content of minerals, polyphenols, pigments, nucleic acids, proteins, of five romanian cultivars: Diva, Star, Vera, Ami, Avans of Phaseolus vulgaris, sawn after germination in enreached UV-B environment in natural field condition.

  14. Proteomic analysis of common bean (Phaseolus vulgaris) by two-dimensional gel electrophoresis and mass spectrometry

    Science.gov (United States)

    The modern cultivated common bean (Phaseolus vulgaris) has evolved from wild common beans distributed in Central America, Mexico and the Andean region of South America. It has been reported that wild common bean accessions have higher levels of protein content than the domesticated dry bean cultiva...

  15. Rhizosphere microorganisms affected by soil solarization and cover cropping in Capsicum annuum and Phaseolus lunatus agroecosystems

    Science.gov (United States)

    Field experiments were conducted to evaluate the effects of soil solarization or cover cropping on bell pepper (Capsicum annuum) and lima bean (Phaseolus lunatus, L.) rhizosphere microorganisms. In Experiment I, flat surface solarization (FSS), raised bed solarization (RBS), cowpea (Vigna unguiculat...

  16. Revisiting the gram-negative lipoprotein paradigm

    Science.gov (United States)

    The processing of lipoproteins (lpps) in Gram-negative bacteria is generally considered to be an essential pathway. Mature lipoproteins in these bacteria are triacylated, with the final fatty acid addition performed by Lnt, an apolipoprotein n-acyltransferase. The mature lipoproteins are then sorted...

  17. Gram staining with an automatic machine.

    Science.gov (United States)

    Felek, S; Arslan, A

    1999-01-01

    This study was undertaken to develop a new Gram-staining machine controlled by a micro-controller and to investigate the quality of slides that were stained in the machine. The machine was designed and produced by the authors. It uses standard 220 V AC. Staining, washing, and drying periods are controlled by a timer built in the micro-controller. A software was made that contains a certain algorithm and time intervals for the staining mode. One-hundred and forty smears were prepared from Escherichia coli, Staphylococcus aureus, Neisseria sp., blood culture, trypticase soy broth, direct pus and sputum smears for comparison studies. Half of the slides in each group were stained with the machine, the other half by hand and then examined by four different microbiologists. Machine-stained slides had a higher clarity and less debris than the hand-stained slides (p stained slides, some Gram-positive organisms showed poor Gram-positive staining features (p Gram staining with the automatic machine increases the staining quality and helps to decrease the work load in a busy diagnostic laboratory.

  18. Revisiting the Gram-negative lipoprotein paradigm.

    Science.gov (United States)

    LoVullo, Eric D; Wright, Lori F; Isabella, Vincent; Huntley, Jason F; Pavelka, Martin S

    2015-05-01

    The processing of lipoproteins (Lpps) in Gram-negative bacteria is generally considered an essential pathway. Mature lipoproteins in these bacteria are triacylated, with the final fatty acid addition performed by Lnt, an apolipoprotein N-acyltransferase. The mature lipoproteins are then sorted by the Lol system, with most Lpps inserted into the outer membrane (OM). We demonstrate here that the lnt gene is not essential to the Gram-negative pathogen Francisella tularensis subsp. tularensis strain Schu or to the live vaccine strain LVS. An LVS Δlnt mutant has a small-colony phenotype on sucrose medium and increased susceptibility to globomycin and rifampin. We provide data indicating that the OM lipoprotein Tul4A (LpnA) is diacylated but that it, and its paralog Tul4B (LpnB), still sort to the OM in the Δlnt mutant. We present a model in which the Lol sorting pathway of Francisella has a modified ABC transporter system that is capable of recognizing and sorting both triacylated and diacylated lipoproteins, and we show that this modified system is present in many other Gram-negative bacteria. We examined this model using Neisseria gonorrhoeae, which has the same Lol architecture as that of Francisella, and found that the lnt gene is not essential in this organism. This work suggests that Gram-negative bacteria fall into two groups, one in which full lipoprotein processing is essential and one in which the final acylation step is not essential, potentially due to the ability of the Lol sorting pathway in these bacteria to sort immature apolipoproteins to the OM. This paper describes the novel finding that the final stage in lipoprotein processing (normally considered an essential process) is not required by Francisella tularensis or Neisseria gonorrhoeae. The paper provides a potential reason for this and shows that it may be widespread in other Gram-negative bacteria. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Pencegahan hipertensi dan penebalan dinding aorta dengan pemberian kecambah kacang hijau (Phaseolus radiatus (L pada tikus putih Sprague Dawley

    Directory of Open Access Journals (Sweden)

    Novian Swasono Hadi

    2016-01-01

    Full Text Available Background: Lifestyle changes with high-fat food consumption is one of the factors the risks of cardiovascular diseases like of coronary heart disease and atherosclerosis. A healthy diet and a balanced diet and consume foods that contain lots of antioxidants is one of the effective ways to prevent hyperlipidemia. Mung bean sprouts have properties that neutralize free radicals cause Hyperlipidemia and cardiovascular diseases because it is an antioxidant compound. Objective: The aim of this study was to determinate the effect of mung bean sprouts (Phaseolus radiatus (L to blood pressure and histopathology aorta of Sprague-Dawley male rats. Method: The type of study was experimental research using pre-post test controlled group design for blood pressure variable and post test only controlled group design histopathology aorta. The thirty-five of Sprague-Dawley male rats was eight weeks divided into 5 groups. The first group was given standard diet, group 2 was given a hight fat diet, the third group was given a high-fat diet and mung bean sprout 0,67 gram, group 4 was given a high-fat diet and mung bean 1,34 gram, and group 5 was given a high-fat diet and vitamin E doses of 23 IU. Results: Result of this study showed that after 4 weeks of treatment, increased in blood pressure systole in the given of  high fat diet higher than group who were given a high fat diet and mung bean sprout and also on group who were given high fat diet and vitamin E, but there is no difference effect a decrease in blood pressure between the provision of mung bean sprouts and vitamin E (p>0,05. Statistical analysis to thick the wall the aorta show the similarity meaningful in all the treatment group, it can be said that overall thick the wall the aorta in this research is not different. Conclusion: A dose of mung bean sprout 0,67 g is optimal doses in preventing a rise in blood pressure and prevent alterations histopathology Sprague-Dawley male rats.

  20. Comportamento de linhagens de feijão-mungo(Vigna radiata L. em Santa Catarina Behaviour of mungbean (Vigna radiata L. in Santa Catarina

    Directory of Open Access Journals (Sweden)

    Shong Lin Shiow

    2002-08-01

    Full Text Available Foram conduzidos três experimentos na fazenda experimental do Centro de Ciências Agrárias da Universidade Federal de Santa Catarina, Florianópolis, SC, Brasil. A finalidade do trabalho foi avaliar o comportamento de 29 linhagens de feijão mungo provenientes do "Asian Vegetable Research and Development Center" (AVRDC. Avaliaram-se as características agronômicas (formacão da primeira flor, primeiro legume maduro, estatura da planta, o peso de mil sementes e o rendimento. As linhagens foram testadas em blocos ao acaso, com quatro repetições. Cada parcela foi constituída por 4 linhas de 6m de comprimento, espaçadas de 50cm, com vinte sementes por metro de sulco. A floração inicial das linhagens ocorreu entre os 33 e 49 dias após o plantio, enquanto a maturação do primeiro legume se deu entre os 70 e 78 dias após a semeadura. A estatura das plantas e o peso de mil sementes variaram entre 22,5 e 63,8cm e 33,0 e 76,4g respectivamente. As linhagens mais produtivas foram: VC 3890B, VC 1973C e VC 2764B com rendimento acima de 1140kg.ha-1. Estas linhagens apresentaram peso de mil sementes e estatura de planta boas para cultivo e um ciclo biológico médio. A colheita foi feita em uma única operação, entre 80 e 85 dias após a semeadura no primeiro e segundo experimentos. No terceiro experimento, a colheita foi feita em duas vezes, aos 80 e 85 dias e aos 95 e 100 dias, sendo que na primeira colheita foram colhidos 78% dos legumes; os restantes 22% foram colhidos 15 dias após a primeira.Three experiments were conducted at the experimental farm of the Agricultural Science Center, Federal University of Santa Catarina, Ressacada, Florianópolis, SC. Brazil. Twenty nine lines of mungbean from the Asian Vegetable Research and Development Center (AVRDC, Taiwan, Republic of China were evaluated about their agronomic characters (first flower formation, first legume mature, plant height, thousand seeds weight and yield. The experimental design

  1. Mid-infrared spectroscopic assessment of nanotoxicity in gram-negative vs. gram-positive bacteria.

    Science.gov (United States)

    Heys, Kelly A; Riding, Matthew J; Strong, Rebecca J; Shore, Richard F; Pereira, M Glória; Jones, Kevin C; Semple, Kirk T; Martin, Francis L

    2014-03-07

    Nanoparticles appear to induce toxic effects through a variety of mechanisms including generation of reactive oxygen species (ROS), physical contact with the cell membrane and indirect catalysis due to remnants from manufacture. The development and subsequent increasing usage of nanomaterials has highlighted a growing need to characterize and assess the toxicity of nanoparticles, particularly those that may have detrimental health effects such as carbon-based nanomaterials (CBNs). Due to interactions of nanoparticles with some reagents, many traditional toxicity tests are unsuitable for use with CBNs. Infrared (IR) spectroscopy is a non-destructive, high throughput technique, which is unhindered by such problems. We explored the application of IR spectroscopy to investigate the effects of CBNs on Gram-negative (Pseudomonas fluorescens) and Gram-positive (Mycobacterium vanbaalenii PYR-1) bacteria. Two types of IR spectroscopy were compared: attenuated total reflection Fourier-transform infrared (ATR-FTIR) and synchrotron radiation-based FTIR (SR-FTIR) spectroscopy. This showed that Gram-positive and Gram-negative bacteria exhibit differing alterations when exposed to CBNs. Gram-positive bacteria appear more resistant to these agents and this may be due to the protection afforded by their more sturdy cell wall. Markers of exposure also vary according to Gram status; Amide II was consistently altered in Gram-negative bacteria and carbohydrate altered in Gram-positive bacteria. ATR-FTIR and SR-FTIR spectroscopy could both be applied to extract biochemical alterations induced by each CBN that were consistent across the two bacterial species; these may represent potential biomarkers of nanoparticle-induced alterations. Vibrational spectroscopy approaches may provide a novel means of fingerprinting the effects of CBNs in target cells.

  2. Gram positive and Gram negative bacteria differ in their sensitivity to cold plasma

    Science.gov (United States)

    Mai-Prochnow, Anne; Clauson, Maryse; Hong, Jungmi; Murphy, Anthony B.

    2016-12-01

    Cold atmospheric-pressure plasma (CAP) is a relatively new method being investigated for antimicrobial activity. However, the exact mode of action is still being explored. Here we report that CAP efficacy is directly correlated to bacterial cell wall thickness in several species. Biofilms of Gram positive Bacillus subtilis, possessing a 55.4 nm cell wall, showed the highest resistance to CAP, with less than one log10 reduction after 10 min treatment. In contrast, biofilms of Gram negative Pseudomonas aeruginosa, possessing only a 2.4 nm cell wall, were almost completely eradicated using the same treatment conditions. Planktonic cultures of Gram negative Pseudomonas libanensis also had a higher log10 reduction than Gram positive Staphylococcus epidermidis. Mixed species biofilms of P. aeruginosa and S. epidermidis showed a similar trend of Gram positive bacteria being more resistant to CAP treatment. However, when grown in co-culture, Gram negative P. aeruginosa was more resistant to CAP overall than as a mono-species biofilm. Emission spectra indicated OH and O, capable of structural cell wall bond breakage, were present in the plasma. This study indicates that cell wall thickness correlates with CAP inactivation times of bacteria, but cell membranes and biofilm matrix are also likely to play a role.

  3. Antiadhesion agents against Gram-positive pathogens.

    Science.gov (United States)

    Cascioferro, Stella; Cusimano, Maria Grazia; Schillaci, Domenico

    2014-01-01

    A fundamental step of Gram-positive pathogenesis is the bacterial adhesion to the host tissue involving interaction between bacterial surface molecules and host ligands. This review is focused on antivirulence compounds that target Gram-positive adhesins and on their potential development as therapeutic agents alternative or complementary to conventional antibiotics in the contrast of pathogens. In particular, compounds that target the sortase A, wall theicoic acid inhibitors, carbohydrates able to bind bacterial proteins and proteins capable of influencing the bacterial adhesion, were described. We further discuss the advantages and disadvantages of this strategy in the development of novel antimicrobials and the future perspective of this research field still at its first steps.

  4. Influence of insecticidal plant materials used during storage on sensory attributes and instrumental hardness of dry edible beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Dunkel, F V; Serugendo, A; Breene, W M; Sriharan, S

    1995-07-01

    Three plant products with known insecticidal properties, a dry extract of flowers of Chrysanthemum cinerariaefolium (Trevir.) Vis. produced in Rwanda, an ethanol extract of seeds of neem, Azadirachta indica A. Juss, and crushed leaves of Tetradenia riparia Hochst Codd, a traditional Rwandan medicine, were mixed with beans, Phaseolus vulgaris L., for storage protection. These plant-protected beans were compared with "off the shelf' beans that were being sold to consumers by the Rwandan National Agricultural Products Marketing Organization (OPROVIA). A trained sensory panel determined that beans treated with neem and C. cinerariaefolium were as acceptable after 8 months storage as those being sold throughout Rwanda by the marketing organization. Beans marketed by this organization were all treated with the standard insecticide application in Rwanda, 0.01% weight/weight pirimiphos methyl in a powder formulation. Instrumental hardness (% hard-to-cook/mean gram force) after 20 months of storage was acceptable for beans stored with neem or with C. cinerariaefolium or with the conventional government application of pirimiphos methyl. Use of either neem or C. cinerariaefolium for storage protection should not affect consumer acceptance of dry beans.

  5. Effect of dietary fiber on the activity of intestinal and fecal beta-glucuronidase activity during 1,2-dimethylhydrazine induced colon carcinogenesis.

    Science.gov (United States)

    Manoj, G; Thampi, B S; Leelamma, S; Menon, P V

    2001-01-01

    The effects of fiber isolated from black gram (Phaseolus mungo) and coconut (Cocos nucifera) kernel on the metabolic activity of intestinal and fecal beta glucuronidase activity during 1,2-dimethylhydrazine induced colon carcinogenesis were studied. The results indicated that the inclusion of fiber from black gram and coconut kernel generally supported lower specific activities and less fecal output of beta-glucuronidase than did the fiber free diet. This study suggests that the fibers isolated from coconut or black gram may potentially play a role in preventing the formation of colon tumors induced by the carcinogen 1,2-dimethylhydrazine by reducing the activity of the intestinal as well as fecal beta-glucuronidase.

  6. Prognostic factors and monomicrobial necrotizing fasciitis: gram-positive versus gram-negative pathogens

    Directory of Open Access Journals (Sweden)

    Hsu Wei-Hsiu

    2011-01-01

    Full Text Available Abstract Background Monomicrobial necrotizing fasciitis is rapidly progressive and life-threatening. This study was undertaken to ascertain whether the clinical presentation and outcome for patients with this disease differ for those infected with a gram-positive as compared to gram-negative pathogen. Methods Forty-six patients with monomicrobial necrotizing fasciitis were examined retrospectively from November 2002 to January 2008. All patients received adequate broad-spectrum antibiotic therapy, aggressive resuscitation, prompt radical debridement and adjuvant hyperbaric oxygen therapy. Eleven patients were infected with a gram-positive pathogen (Group 1 and 35 patients with a gram-negative pathogen (Group 2. Results Group 2 was characterized by a higher incidence of hemorrhagic bullae and septic shock, higher APACHE II scores at 24 h post-admission, a higher rate of thrombocytopenia, and a higher prevalence of chronic liver dysfunction. Gouty arthritis was more prevalent in Group 1. For non-survivors, the incidences of chronic liver dysfunction, chronic renal failure and thrombocytopenia were higher in comparison with those for survivors. Lower level of serum albumin was also demonstrated in the non-survivors as compared to those in survivors. Conclusions Pre-existing chronic liver dysfunction, chronic renal failure, thrombocytopenia and hypoalbuminemia, and post-operative dependence on mechanical ventilation represent poor prognostic factors in monomicrobial necrotizing fasciitis. Patients with gram-negative monobacterial necrotizing fasciitis present with more fulminant sepsis.

  7. Culinary and nutritional quality of Phaseolus vulgaris seeds as affected by environmental factors

    Directory of Open Access Journals (Sweden)

    Kigel J.

    1999-01-01

    Full Text Available Efficient selection for specific culinary and nutritional quality traits needs a better understanding of the genetic and environmental control of quality traits at the structural, physiological and biochemical levels. Field experiments indicate great variability in the Phaseolus gene pool regarding the content of antinutritional compounds, as well as in cooking characteristics of the seeds. These seed attributes are strongly affected by geographic location, edaphic and climatic conditions at site of cultivation. However, information on the influence of specific environmental factors (such as temperature, water availability, edaphic conditions, etc. on seed quality traits, as well as on their stability is very scarce. This lack of knowledge impairs a faster progress in the improvement of Phaseolus seed quality.

  8. Description of Phaseolus vulgaris L. aborting embryos from ethyl methanesulfonate (EMS mutagenized plants

    Directory of Open Access Journals (Sweden)

    Silué, S.

    2013-01-01

    Full Text Available The aim of this study was to describe the embryos abortion process and the inheritance of the embryos abortion trait in Phaseolus vulgaris plants deficient in seed development. These plants were isolated within the second generation of an ethyl methanesulfonate (EMS TILLING population of P. vulgaris cv. 'BAT93'. Mutant embryos show abnormalities mainly in suspensors, shoot apical meristem (SAM and cotyledons from the globular to the cotyledon stages and abort before maturity compared to those observed in wild-type samples. Mutant embryos show also hyperhydricity and contain low amount of chlorophyll. Genetic analyses of F1, F2 and F3 populations from the crosses carried out between the mutagenized plants with aborting embryos and the wild-type plants indicated that the embryo abortion phenotype is maternally inherited and controlled by a single recessive gene. These Phaseolus mutant plants with aborting embryos constitute a valuable material for plant embryogenesis studies.

  9. Alternate gram staining technique using a fluorescent lectin.

    Science.gov (United States)

    Sizemore, R K; Caldwell, J J; Kendrick, A S

    1990-01-01

    Fluorescence-labeled wheat germ agglutinin binds specifically to N-acetylglucosamine in the outer peptidoglycan layer of gram-positive bacteria. The peptidoglycan layer of gram-negative bacteria is covered by a membrane and is not labeled by the lectin. By exploiting this phenomenon, an alternative Gram staining technique has been developed. Images PMID:1697149

  10. Collection, Characterization and Use of Genetic Bariation in Chilean Bean Germplasm (Phaseolus vulgaris L.)

    OpenAIRE

    Bascur B., Gabriel; Tay U., Juan

    2005-01-01

    Recently performed studies on the type of seed protein present from several origins and their morphological traits have shown that the common bean (Phaseolus vulgaris L.) is native to America, being a species without a specific center of origin and with two areas of domestication: Central America and South America. In this last center, three strains were determined, one of them is called "the Chilean strain", which as noted is a sub-center of genetic diversity for this species. With the purpo...

  11. Evaluation of gamma radiation (60-Co) induced mutation in two Phaseolus vulgaris varieties

    International Nuclear Information System (INIS)

    Silva, R.M.

    1984-01-01

    Two varieties of Phaseolus vulgaris (Jutiapan and San Martin) were irradiated at 0, 8, 15, 20 and 30 kR doses in a 60-cobalt gamma source, to identify mutants and 20% lethality. M 2 plants showing morphogical mutations were selected. Differences in sensitivity to irradiation of the two varieties were noted, using data and physiological effects of M 1 . Selection and analysis for protein content were in M 3 as well as hereditary changes. (M.A.C.) [pt

  12. Strategies for improving the nutritional quality of Phaseolus beans through gene engineering

    Directory of Open Access Journals (Sweden)

    Kapila J.

    1999-01-01

    Full Text Available Although Phaseolus species are still difficult to transform, progress in this field now opens the way to engineering beans with a higher nutritional value. The opportunities for gene engineering in nutritional quality improvement, the strategies which canbe adopted and the constraints we are still facing are briefly outlined, using the enhancement of the seed methionine content and the reduction in antinutritional factors as examples.

  13. Quorum sensing in gram-negative bacteria

    DEFF Research Database (Denmark)

    Wu, H.; Song, Z.J.; Høiby, N.

    2004-01-01

    Bacteria can communicate with each other by means of signal molecules to coordinate the behavior of the entire community, and the mechanism is referred to as quorum sensing (QS). Signal systems enable bacteria to sense the size of their densities by monitoring the concentration of the signal...... molecules. Among Gram-negative bacteria N-acyl-L-homoserine lactone (acyl-HSL)-dependent quorum sensing systems are particularly widespread. These systems are used to coordinate expression of phenotypes that are fundamental to the interaction of bacteria with each other and with their environment...

  14. Textualidad y gramática argumentativa

    Directory of Open Access Journals (Sweden)

    RAÚL FIRACATIVE-RUIZ

    2014-01-01

    Full Text Available La argumentación es un modo de organizar el discurso, cuya orientación se da para lograr el convencimiento del otro. El presente artículo acoge este precepto para abordar la propuesta argumentativa del autor italiano Vincenzo Lo Cascio desde la noción de textualidad . Gramática argumentativa es el nombre dado a esta apuesta teórica y surge de las ideas de la Nueva Retórica de Perelman. Lo Cascio propone la existencia de categorías sintácticas finitas, denominadas reglas categoriales e indicadores de fuerza , las cuales permiten orientar la información de los enunciados y analizar multiplicidad de discursos; por ello, es una teoría que sigue la línea de la sintaxis generativa de Noam Chomsky. El artículo plantea la necesidad de reconocer, desde la Gramática argumentativa, el potencial enunciativo de la palabra en situaciones comunicativas cotidianas, donde es preciso que los enunciadores sean conscientes del uso que hacen de la palabra.

  15. A new technique for Gram staining paraffin-embedded tissue.

    Science.gov (United States)

    Engbaek, K; Johansen, K S; Jensen, M E

    1979-01-01

    Five techniques for Gram staining bacteria in paraffin sections were compared on serial sections of pulmonary tissues from eight bacteriological necropsies. Brown and Hopp's method was the most satisfactory for distinguishing Gram-positive and Gram-negative bacteria. However, this method cannot be recommended as the preparations were frequently overstained, and the Gram-negative bacteria were stained indistinctly. A modification of Brown and Hopps' method was developed which stains larger numbers of Gram-negative bacteria and differentiates well between different cell types and connective tissue, and there is no risk of overstaining. PMID:86548

  16. Leaf area development, dry weight accumulation and solar energy conversion efficiencies of Phaseolus vulgaris L. under different soil moisture levels near Nairobi, Kenya

    NARCIS (Netherlands)

    Muniafu, M.M.; Macharia, J.N.M.; Stigter, C.J.; Coulson, G.L.

    1999-01-01

    Leaf area development, dry weight accumulation and solar energy conversion efficiencies of Phaseolus vulgaris L. cv GLP-2 under two soil moisture levels in two contrasting seasons near Nairobi, Kenya were investigated. The experiment confirms that dry weights and yields of Phaseolus vulgaris are

  17. Effect of variable protein contents in diets containing Phaseolus vulgaris beans on performance, organ weights and blood variables in piglets, rats and chickens

    NARCIS (Netherlands)

    Huisman, J.; Poel, A.F.B. van der; Mouwen, J.M.V.M.; Weerden, E.J. van

    1990-01-01

    A comparison was made of the effects of antinutritional factors present in Phaseolus vulgaris on piglets, rats and chickens. Also the hypothesis of whether the negative effect on weight gain due to the inclusion of raw Phaseolus vulgaris in the diet can be attributed to an insufficient supply of

  18. Techniques for controlling variability in gram staining of obligate anaerobes.

    Science.gov (United States)

    Johnson, M J; Thatcher, E; Cox, M E

    1995-01-01

    Identification of anaerobes recovered from clinical samples is complicated by the fact that certain gram-positive anaerobes routinely stain gram negative; Peptostreptococcus asaccharolyticus, Eubacterium plautii, Clostridium ramosum, Clostridium symbiosum, and Clostridium clostridiiforme are among the nonconformists with regard to conventional Gram-staining procedures. Accurate Gram staining of American Type Culture Collection strains of these anaerobic bacteria is possible by implementing fixing and staining techniques within a gloveless anaerobic chamber. Under anaerobic conditions, gram-positive staining occurred in all test organisms with "quick" fixing techniques with both absolute methanol and formalin. The results support the hypothesis that, when anaerobic bacteria are exposed to oxygen, a breakdown of the physical integrity of the cell wall occurs, introducing Gram stain variability in gram-positive anaerobes. PMID:7538512

  19. Hepatoprotective and antioxidant activity of Phaseolus trilobus, Ait on bile duct ligation induced liver fibrosis in rats.

    Science.gov (United States)

    Fursule, R A; Patil, S D

    2010-06-16

    Phaseolus trilobus Ait (Fabaceae) is extensively used by tribal people of Nandurbar district (Maharashtra, India) in the treatment of Jaundice and other liver disorders. of the present study was to assess the medicinal claim of Phaseolus trilobus as hepatoprotective and antioxidant. The hepatoprotective activity of methanol and aqueous extract of Phaseolus trilobus was evaluated by bile duct ligation induced liver fibrosis and antioxidant activity was evaluated using in vitro and in vivo antioxidant models viz anti-lipid peroxidation assay, super oxide radical scavenging assay and glutathione estimation in liver. Liver function tests were carried out to detect hepatoprotective activity, which was further supported by histopathological examination. Methanol and aqueous extracts of Phaseolus trilobus reduced elevated level of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), lactate dehydrogenase (LDH), bilirubin and hydroxyproline significantly (pWistar rats, proving hepatoprotective activity comparable with Silymarin. Both the extracts were found to reduce the elevated levels of serum thiobarbituric acid reactive substance (TBARS) and elevate superoxide scavenging radical activity proving antioxidant activity comparable with ascorbic acid. The reduced level of glutathione was found to be elevated in liver proving antioxidant activity comparable with Silymarin. Phaseolus trilobus posses hepatoprotective property and is effective in oxidative stress induced cholestatic hepatic injury. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  20. Bioengineered nisin A derivatives with enhanced activity against both Gram positive and Gram negative pathogens.

    Directory of Open Access Journals (Sweden)

    Des Field

    Full Text Available Nisin is a bacteriocin widely utilized in more than 50 countries as a safe and natural antibacterial food preservative. It is the most extensively studied bacteriocin, having undergone decades of bioengineering with a view to improving function and physicochemical properties. The discovery of novel nisin variants with enhanced activity against clinical and foodborne pathogens has recently been described. We screened a randomized bank of nisin A producers and identified a variant with a serine to glycine change at position 29 (S29G, with enhanced efficacy against S. aureus SA113. Using a site-saturation mutagenesis approach we generated three more derivatives (S29A, S29D and S29E with enhanced activity against a range of Gram positive drug resistant clinical, veterinary and food pathogens. In addition, a number of the nisin S29 derivatives displayed superior antimicrobial activity to nisin A when assessed against a range of Gram negative food-associated pathogens, including E. coli, Salmonella enterica serovar Typhimurium and Cronobacter sakazakii. This is the first report of derivatives of nisin, or indeed any lantibiotic, with enhanced antimicrobial activity against both Gram positive and Gram negative bacteria.

  1. Mechanistic antimicrobial approach of extracellularly synthesized silver nanoparticles against gram positive and gram negative bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Tamboli, Dhawal P.; Lee, Dae Sung, E-mail: daesung@knu.ac.kr

    2013-09-15

    Highlights: • Bacterial extracelluar enzymes stabilized the silver nanoparticles (AgNPs). • AgNPs formation was characterized by analytical techniques such as UV–vis, TEM, and FTIR. • AgNPs showed obvious antimicrobial activity against both gram positive and gram negative microorganisms. • A mechanism of AgNPs’ antimicrobial activity was proposed. -- Abstract: The development of eco-friendly and reliable processes for the synthesis of nanoparticles has attracted considerable interest in nanotechnology. In this study, an extracellular enzyme system of a newly isolated microorganism, Exiguobacterium sp. KNU1, was used for the reduction of AgNO{sub 3} solutions to silver nanoparticles (AgNPs). The extracellularly biosynthesized AgNPs were characterized by UV–vis spectroscopy, Fourier transform infra-red spectroscopy and transmission electron microscopy. The AgNPs were approximately 30 nm (range 5–50 nm) in size, well-dispersed and spherical. The AgNPs were evaluated for their antimicrobial effects on different gram negative and gram positive bacteria using the minimum inhibitory concentration method. Reasonable antimicrobial activity against Salmonella typhimurium, Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus was observed. The morphological changes occurred in all the microorganisms tested. In particular, E. coli exhibited DNA fragmentation after being treated with the AgNPs. Finally, the mechanism for their bactericidal activity was proposed according to the results of scanning electron microscopy and single cell gel electrophoresis.

  2. Mechanistic antimicrobial approach of extracellularly synthesized silver nanoparticles against gram positive and gram negative bacteria

    International Nuclear Information System (INIS)

    Tamboli, Dhawal P.; Lee, Dae Sung

    2013-01-01

    Highlights: • Bacterial extracelluar enzymes stabilized the silver nanoparticles (AgNPs). • AgNPs formation was characterized by analytical techniques such as UV–vis, TEM, and FTIR. • AgNPs showed obvious antimicrobial activity against both gram positive and gram negative microorganisms. • A mechanism of AgNPs’ antimicrobial activity was proposed. -- Abstract: The development of eco-friendly and reliable processes for the synthesis of nanoparticles has attracted considerable interest in nanotechnology. In this study, an extracellular enzyme system of a newly isolated microorganism, Exiguobacterium sp. KNU1, was used for the reduction of AgNO 3 solutions to silver nanoparticles (AgNPs). The extracellularly biosynthesized AgNPs were characterized by UV–vis spectroscopy, Fourier transform infra-red spectroscopy and transmission electron microscopy. The AgNPs were approximately 30 nm (range 5–50 nm) in size, well-dispersed and spherical. The AgNPs were evaluated for their antimicrobial effects on different gram negative and gram positive bacteria using the minimum inhibitory concentration method. Reasonable antimicrobial activity against Salmonella typhimurium, Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus was observed. The morphological changes occurred in all the microorganisms tested. In particular, E. coli exhibited DNA fragmentation after being treated with the AgNPs. Finally, the mechanism for their bactericidal activity was proposed according to the results of scanning electron microscopy and single cell gel electrophoresis

  3. Bioengineered Nisin A Derivatives with Enhanced Activity against Both Gram Positive and Gram Negative Pathogens

    Science.gov (United States)

    Field, Des; Begley, Maire; O’Connor, Paula M.; Daly, Karen M.; Hugenholtz, Floor; Cotter, Paul D.; Hill, Colin; Ross, R. Paul

    2012-01-01

    Nisin is a bacteriocin widely utilized in more than 50 countries as a safe and natural antibacterial food preservative. It is the most extensively studied bacteriocin, having undergone decades of bioengineering with a view to improving function and physicochemical properties. The discovery of novel nisin variants with enhanced activity against clinical and foodborne pathogens has recently been described. We screened a randomized bank of nisin A producers and identified a variant with a serine to glycine change at position 29 (S29G), with enhanced efficacy against S. aureus SA113. Using a site-saturation mutagenesis approach we generated three more derivatives (S29A, S29D and S29E) with enhanced activity against a range of Gram positive drug resistant clinical, veterinary and food pathogens. In addition, a number of the nisin S29 derivatives displayed superior antimicrobial activity to nisin A when assessed against a range of Gram negative food-associated pathogens, including E. coli, Salmonella enterica serovar Typhimurium and Cronobacter sakazakii. This is the first report of derivatives of nisin, or indeed any lantibiotic, with enhanced antimicrobial activity against both Gram positive and Gram negative bacteria. PMID:23056510

  4. The Causes of Post-Operative Meningitis: The Comparison Of Gram-Negative and Gram-Positive Pathogens.

    Science.gov (United States)

    Kurtaran, Behice; Kuscu, Ferit; Ulu, Aslihan; Inal, Ayse Seza; Komur, Suheyla; Kibar, Filiz; Cetinalp, Nuri Eralp; Ozsoy, Kerem Mazhar; Arslan, Yusuf Kemal; Aksu, Hasan Salih; Tasova, Yesim

    2017-06-20

    In this study, we aim to determine the microbiological etiology in critically ill neurosurgical patients with nosocomial meningitis (NM) and show the impact of Gram-negative rods and differences of patient's characteristics, clinical and prognostic measures between Gram-negative and Gram-positive meningitis. In this prospective, one center study we reviewed all adult patients hospitalized during a 12-year period and identified pathogens isolated from post-neurosurgical cases of NM. Demographic, clinical, and treatment characteristics were noted from the medical records. Of the 134 bacterial NM patients, 78 were male and 56 were female, with a mean age of 46±15.9 and median age of 50 (18-80) years. 141 strains isolated; 82 (58.2%) were Gram negative, 59 (41.8%) were Gram positive. Most common isolated microorganism was Acinetobacter baumannii (%34.8). In comparison of mortality data shows that the patients who have meningitis with Gram-negative pathogens have higher mortality than with Gram positives (p=0.034). The duration between surgery and meningitis was shorter in Gram negative meningitis cases compared to others (p=0.045) but the duration between the diagnosis and death was shorter in Gram-positive meningitis cases compared to Gram negatives (p= 0.017). CSF protein and lactate level were higher and glucose level was lower in cases of NM with Gram negatives (p value were respectively, 0.022, 0.039 and 0.049). As conclusions; in NM, Gram-negative pathogens were seen more frequently; A.baumanni was the predominant pathogen; and NM caused by Gram negatives had worse clinical and laboratory characteristic and prognostic outcome than Gram positives.

  5. Utilisation de la PCR-RFLP sur de l'ADN chloro-plastique pour l'étude des relations phylogénétiques au sein du genre Phaseolus

    Directory of Open Access Journals (Sweden)

    Baudoin JP.

    1998-01-01

    Full Text Available Phylogenetic relationships among 74 accessions belonging to six species of Phaseolus are investigated using variation in chloroplast DNA assessed according to a PCR-RFLP protocol. Three fragments of chloroplast DNA are amplified using universal primers, and then digested with 10 restriction enzymes. Thirty-six haplotypes are identified on the basis of the polymorphism in fragment number and size. Three main phylogenetic groups, strongly supported through bootstrap analysis, are identified: (1 accessions from Phaseolus lunatus and Phaseolus xolocotzii; (2 accessions from Phaseolus glabellus; (3 accessions from Phaseolus vulgaris, Phaseolus polyanthus and Phaseolus coccineus. Within the third group, accessions of Phaseolus coccineus are scattered along the phylogenetic tree, which provides some evidence that coccineus accessions are paraphyletic with respect to Phaseolus vulgaris and Phaseolus polyanthus. An analysis of molecular variance applied on four species show that they are significantly differentiated with 79% of molecular variance among species and 21% within species. The results agree with previous investigations on chloroplast DNA variation in the genus Phaseolus, and suggest that PCRRFLP methods, which are technically less labour-intensive than previous methods, are of great value for phylogenetic investigations at the generic level.

  6. Physiological traits of endornavirus-infected and endornavirus-free common bean (Phaseolus vulgaris) cv Black Turtle Soup.

    Science.gov (United States)

    Khankhum, S; Valverde, R A

    2018-04-01

    This study evaluated the physiological traits of eight lines of common bean (Phaseolus vulgaris) cv. Black Turtle Soup, four of which were double-infected with Phaseolus vulgaris endornavirus 1 and Phaseolus vulgaris endornavirus 2, and four of which were endornavirus-free. Plants from all eight lines were morphologically similar and did not show statistically significant differences in plant height, wet weight, number of days to flowering and pod formation, pods per plant, pod thickness, seed size, number of seeds per pod, and anthocyanin content. However, the endornavirus-infected lines had faster seed germination, longer radicle, lower chlorophyll content, higher carotene content, longer pods, and higher weight of 100 seeds, all of which were statistically significant. The endornaviruses were not associated with visible pathogenic effects.

  7. Gram staining in the diagnosis of acute septic arthritis.

    Science.gov (United States)

    Faraj, A A; Omonbude, O D; Godwin, P

    2002-10-01

    This study aimed at determining the sensitivity and specificity of Gram staining of synovial fluid as a diagnostic tool in acute septic arthritis. A retrospective study was made of 22 patients who had arthroscopic lavage following a provisional diagnosis of acute septic arthritis of the knee joint. Gram stains and cultures of the knee aspirates were compared with the clinical and laboratory parameters, to evaluate their usefulness in diagnosing acute arthritis. All patients who had septic arthritis had pain, swelling and limitation of movement. CRP was elevated in 90% of patients. The incidence of elevated white blood cell count was higher in the group of patients with a positive Gram stain study (60%) as compared to patients with a negative Gram stain study (33%). Gram staining sensitivity was 45%. Its specificity was however 100%. Gram staining is an unreliable tool in early decision making in patients requiring urgent surgical drainage and washout.

  8. Subcellular localization for Gram positive and Gram negative bacterial proteins using linear interpolation smoothing model.

    Science.gov (United States)

    Saini, Harsh; Raicar, Gaurav; Dehzangi, Abdollah; Lal, Sunil; Sharma, Alok

    2015-12-07

    Protein subcellular localization is an important topic in proteomics since it is related to a protein׳s overall function, helps in the understanding of metabolic pathways, and in drug design and discovery. In this paper, a basic approximation technique from natural language processing called the linear interpolation smoothing model is applied for predicting protein subcellular localizations. The proposed approach extracts features from syntactical information in protein sequences to build probabilistic profiles using dependency models, which are used in linear interpolation to determine how likely is a sequence to belong to a particular subcellular location. This technique builds a statistical model based on maximum likelihood. It is able to deal effectively with high dimensionality that hinders other traditional classifiers such as Support Vector Machines or k-Nearest Neighbours without sacrificing performance. This approach has been evaluated by predicting subcellular localizations of Gram positive and Gram negative bacterial proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Influence of 60Co gamma radiation on Zabrotes subfasciatus (Bohemann, 1833) (Coleoptera, Curculionidae) and beams Phaseolus vulgaris

    International Nuclear Information System (INIS)

    Moraes Rego, A.F. de; Rodrigues, Z.A.; Oliveira, M.L. de; Santana, M.D.

    1986-01-01

    Influence of gamma radiation on Zabrotes subfasciatus (Boh, 1833) (Coleoptera Bruchidae) and the beans Phaseolus vulgaris (L.). The effects of 60 CO gamma radiation, 50 Gy, on both Phaseolus vulgaris (L.) seedbeans and adults of Zabrotes subfasciatus were studied using the no free choise method. Radiation decreased insect fertility hence insect population and it damage loss of weight and germination of seedbeans. However, radiation resulted in abnamal seedlings, showing various degrees of morphological malformation, although there was no effect on germination rates or seedling vigor. (Author) [pt

  10. Diagnosing periprosthetic infection: false-positive intraoperative Gram stains.

    Science.gov (United States)

    Oethinger, Margret; Warner, Debra K; Schindler, Susan A; Kobayashi, Hideo; Bauer, Thomas W

    2011-04-01

    Intraoperative Gram stains have a reported low sensitivity but high specificity when used to help diagnose periprosthetic infections. In early 2008, we recognized an unexpectedly high frequency of apparent false-positive Gram stains from revision arthroplasties. The purpose of this report is to describe the cause of these false-positive test results. We calculated the sensitivity and specificity of all intraoperative Gram stains submitted from revision arthroplasty cases during a 3-month interval using microbiologic cultures of the same samples as the gold standard. Methods of specimen harvesting, handling, transport, distribution, specimen processing including tissue grinding/macerating, Gram staining, and interpretation were studied. After a test modification, results of specimens were prospectively collected for a second 3-month interval, and the sensitivity and specificity of intraoperative Gram stains were calculated. The retrospective review of 269 Gram stains submitted from revision arthroplasties indicated historic sensitivity and specificity values of 23% and 92%, respectively. Systematic analysis of all steps of the procedure identified Gram-stained but nonviable bacteria in commercial broth reagents used as diluents for maceration of periprosthetic membranes before Gram staining and culture. Polymerase chain reaction and sequencing showed mixed bacterial DNA. Evaluation of 390 specimens after initiating standardized Millipore filtering of diluent fluid revealed a reduced number of positive Gram stains, yielding 9% sensitivity and 99% specificity. Clusters of false-positive Gram stains have been reported in other clinical conditions. They are apparently rare related to diagnosing periprosthetic infections but have severe consequences if used to guide treatment. Even occasional false-positive Gram stains should prompt review of laboratory methods. Our observations implicate dead bacteria in microbiologic reagents as potential sources of false-positive Gram

  11. Defining a role for Hfq in Gram-positive bacteria

    DEFF Research Database (Denmark)

    Nielsen, Jesper Sejrup; Lei, Lisbeth Kristensen; Ebersbach, Tine

    2010-01-01

    Small trans-encoded RNAs (sRNAs) modulate the translation and decay of mRNAs in bacteria. In Gram-negative species, antisense regulation by trans-encoded sRNAs relies on the Sm-like protein Hfq. In contrast to this, Hfq is dispensable for sRNA-mediated riboregulation in the Gram-positive species......-dependent and -independent mechanisms, thus adding another layer of complexity to sRNA-mediated riboregulation in Gram-positive species....

  12. Orbit Classification of Qutrit via the Gram Matrix

    International Nuclear Information System (INIS)

    Tay, B. A.; Zainuddin, Hishamuddin

    2008-01-01

    We classify the orbits generated by unitary transformation on the density matrices of the three-state quantum systems (qutrits) via the Gram matrix. The Gram matrix is a real symmetric matrix formed from the Hilbert–Schmidt scalar products of the vectors lying in the tangent space to the orbits. The rank of the Gram matrix determines the dimensions of the orbits, which fall into three classes for qutrits. (general)

  13. Raman Spectroscopy of Xylitol Uptake and Metabolism in Gram-Positive and Gram-Negative Bacteria▿

    Science.gov (United States)

    Palchaudhuri, Sunil; Rehse, Steven J.; Hamasha, Khozima; Syed, Talha; Kurtovic, Eldar; Kurtovic, Emir; Stenger, James

    2011-01-01

    Visible-wavelength Raman spectroscopy was used to investigate the uptake and metabolism of the five-carbon sugar alcohol xylitol by Gram-positive viridans group streptococcus and the two extensively used strains of Gram-negative Escherichia coli, E. coli C and E. coli K-12. E. coli C, but not E. coli K-12, contains a complete xylitol operon, and the viridans group streptococcus contains an incomplete xylitol operon used to metabolize the xylitol. Raman spectra from xylitol-exposed viridans group streptococcus exhibited significant changes that persisted even in progeny grown from the xylitol-exposed mother cells in a xylitol-free medium for 24 h. This behavior was not observed in the E. coli K-12. In both viridans group streptococcus and the E. coli C derivative HF4714, the metabolic intermediates are stably formed to create an anomaly in bacterial normal survival. The uptake of xylitol by Gram-positive and Gram-negative pathogens occurs even in the presence of other high-calorie sugars, and its stable integration within the bacterial cell wall may discontinue bacterial multiplication. This could be a contributing factor for the known efficacy of xylitol when taken as a prophylactic measure to prevent or reduce occurrences of persistent infection. Specifically, these bacteria are causative agents for several important diseases of children such as pneumonia, otitis media, meningitis, and dental caries. If properly explored, such an inexpensive and harmless sugar-alcohol, alone or used in conjunction with fluoride, would pave the way to an alternative preventive therapy for these childhood diseases when the causative pathogens have become resistant to modern medicines such as antibiotics and vaccine immunotherapy. PMID:21037297

  14. Utility of Gram staining for diagnosis of Malassezia folliculitis.

    Science.gov (United States)

    Tu, Wei-Ting; Chin, Szu-Ying; Chou, Chia-Lun; Hsu, Che-Yuan; Chen, Yu-Tsung; Liu, Donald; Lee, Woan-Ruoh; Shih, Yi-Hsien

    2018-02-01

    Malassezia folliculitis (MalF) mimics acne vulgaris and bacterial folliculitis in clinical presentations. The role of Gram staining in rapid diagnosis of MalF has not been well studied. In our study, 32 patients were included to investigate the utility of Gram staining for MalF diagnosis. The final diagnoses of MalF were determined according to clinical presentation, pathological result and treatment response to antifungal agents. Our results show that the sensitivity and specificity of Gram staining are 84.6% and 100%, respectively. In conclusion, Gram staining is a rapid, non-invasive, sensitive and specific method for MalF diagnosis. © 2017 Japanese Dermatological Association.

  15. Enzymatic changes in intact leaves of Phaseolus vulgaris following ozone fumigation

    Energy Technology Data Exchange (ETDEWEB)

    Dass, H C; Weaver, G M

    1972-01-01

    Enzymatic changes in the intact leaves of Phaseolus vulgaris cv. Seaway 65 were studied following ozone fumigation. It was found that peroxidase enzyme increased significantly with the ozone treatment in the first 48 h. Similarly, cellulase enzyme showed significant increase 48 h. following ozone treatment. Lactic dehydrogenase activity was not markedly affected by ozone treatment. Disc electrophoretic studies of peroxidase isoenzymes showed that ozone treatment induced a new band of peroxidase. The role of peroxidase, cellulase and lactic dehydrogenase enzymes is discussed in relation to ozone damage and the bronzing disorder in white beans. 22 references, 1 figure, 1 table.

  16. Morpho-physiological analysis of adaptive responses of common bean (Phaseolus vulgaris L.) to drought stress /

    OpenAIRE

    Polania Perdomo, José A.,

    2016-01-01

    Bibliografia El frijol común (Phaseolus vulgaris L.) es la leguminosa alimenticia más importante en los trópicos. Es cultivada por pequeños agricultores y por lo general expuesta a condiciones desfavorables con mínimo uso de insumos. La sequía y la baja fertilidad del suelo, especialmente deficiencias de nitrógeno (N) y fósforo (P), son principales limitaciones para el rendimiento del frijol en los sistemas de pequeños productores. El frijol puede derivar parte de su requerimiento de N de ...

  17. Genome sequence of Bradyrhizobium sp. LMTR 3, a diazotrophic symbiont of Lima bean (Phaseolus lunatus

    Directory of Open Access Journals (Sweden)

    Ernesto Ormeño-Orrillo

    2017-09-01

    Full Text Available Bradyrhizobium sp. LMTR 3 is a representative strain of one of the geno(species of diazotrophic symbionts associated with Lima bean (Phaseolus lunatus in Peru. Its 7.83 Mb genome was sequenced using the Illumina technology and found to encode a complete set of genes required for nodulation and nitrogen fixation, and additional genes putatively involved in root colonization. Its draft genome sequence and annotation have been deposited at GenBank under the accession number MAXC00000000.

  18. Antimicrobial Activity of Carbon Nanoparticles Isolated from Natural Sources against Pathogenic Gram-Negative and Gram-Positive Bacteria

    International Nuclear Information System (INIS)

    Varghese, S.; Jose, S.; Varghese, S.; Kuriakose, S.; Jose, S.

    2013-01-01

    This paper describes the isolation of carbon nanoparticles (CNPs) from kitchen soot, characterization of the CNPs by UV/visible spectroscopy, SEM and XRD, and their antimicrobial action. The antibacterial activity of the isolated carbon nanoparticles was tested against various pathogenic bacterial strains such as Gram-negative Proteus refrigere and Pseudomonas aeruginosa and Gram-positive Staphylococcus aureus and Streptococcus haemolyticus. The inhibition zones were measured, and it was found that the carbon nanoparticles isolated from natural sources are active against these Gram-negative and Gram-positive bacterial strains

  19. Restriction enzyme analysis of the chloroplast DNA of Phaseolus vulgaris L. vr. Rio Negro Análise de restrição do DNA cloroplástico de Phaseolus vulgaris vr. Rio Negro

    Directory of Open Access Journals (Sweden)

    Sergio Echeverrigaray

    1996-12-01

    Full Text Available The chloroplast DNA of Phaseolus vulgaris L. vr. Rio Negro was isola ted from chloroplasts obtained by descontiuous sucrose gradient centrifugation. The restriction analysis with the enzymes HindIII, EcoRI and BamHI and their combination, allowed to identified more than 20 fragments of 18 to 0.65kb. The size of Phaseolus vulgaris L. cp DNA was estimated in 140kb with the presence of a repeat sequence of about 22kb.O DNA cloroplástico do cultivar Rio Negro (Phaseolus vulgaris L. foi isolado a partir de cloroplastos obtidos por gradiente descontínuo de sacarose. A análise de restrição com as enzimas HindIII, EcoRI e BamHI e a combinação destas, permitiu a identificação de mais de 20 fragmentos na faixa de 18 a 0.65kb. O tamanho do cp DNA de Phaseolus vulgaris L. foi estimado em 140kb com a existência de sequências repetidas de aproximadamente 22kb.

  20. Glass bead transformation method for gram-positive bacteria

    OpenAIRE

    Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

    2009-01-01

    A simple, inexpensive and reproducible transformation method was developed for Gram-positive bacteria. It was based on agitation of bacterial protoplasts with glass beads in the presence of DNA and polyethylene glycol. By using this method, introduction of pGK12 into protoplasts of several strains of Gram-positive bacteria was achieved.

  1. Methods for targetted mutagenesis in gram-positive bacteria

    Science.gov (United States)

    Yang, Yunfeng

    2014-05-27

    The present invention provides a method of targeted mutagenesis in Gram-positive bacteria. In particular, the present invention provides a method that effectively integrates a suicide integrative vector into a target gene in the chromosome of a Gram-positive bacterium, resulting in inactivation of the target gene.

  2. Genetic diversity in green gram accessions as revealed by STMS ...

    African Journals Online (AJOL)

    Molecular characterization of green gram (Vigna radiata (L.) Wilczek) germplasm is essential for scientific assessment of variability and diversity for its better utilization in breeding programs. In this study, 120 accessions of green gram were analysed for 27 Sequence Tagged Microsatellites (STMS) loci. For data analysis ...

  3. Gram-positive bacteria persisting in the food production environment

    DEFF Research Database (Denmark)

    Knøchel, Susanne; Harmsen, Morten; Knudsen, Bettina

    2008-01-01

    Many gram-positive bacteria are able to form aggregates or biofilms and resist external stress factors and some gram-positive pathogenic bacteria such as Listeria monocytogenes and Bacillus cereus may persist in the food production environment for extended periods. Most research has focussed...

  4. Decreased mortality associated with prompt Gram staining of blood cultures.

    Science.gov (United States)

    Barenfanger, Joan; Graham, Donald R; Kolluri, Lavanya; Sangwan, Gaurav; Lawhorn, Jerry; Drake, Cheryl A; Verhulst, Steven J; Peterson, Ryan; Moja, Lauren B; Ertmoed, Matthew M; Moja, Ashley B; Shevlin, Douglas W; Vautrain, Robert; Callahan, Charles D

    2008-12-01

    Gram stains of positive blood cultures are the most important factor influencing appropriate therapy. The sooner appropriate therapy is initiated, the better. Therefore, it is reasonable to expect that the sooner Gram stains are performed, the better. To determine the value of timely Gram stains and whether improvement in Gram stain turnaround time (TAT) is feasible, we compared data for matched pairs of patients with cultures processed promptly ( or =1 hour TAT) and then monitored TAT by control charting.In 99 matched pairs, average difference in time to detection of positive blood cultures within a pair of patients was less than 0.1 hour. For the less than 1 hour TAT group, the average TAT and crude mortality were 0.1 hour and 10.1%, respectively; for the 1 hour or longer TAT group, they were 3.3 hours and 19.2%, respectively (P Gram stains.

  5. Phenotypic diversity for seed mineral concentration in North American dry bean (Phaseolus vulgaris L.) germplasm of Middle American ancestry

    Science.gov (United States)

    Dry bean (Phaseolus vulgaris L.) seeds are a major protein, carbohydrate, and mineral source for human diets in multiple regions of the world. Seed mineral biofortification is an going objective to improve this important food source. The objective of this research was to assess the seed mineral co...

  6. A non-destructive selection method for faster growth at suboptimal temperature in common bean (Phaseolus vulgaris)

    NARCIS (Netherlands)

    Drijfhout, E.; Oeveren, J.C. van; Jansen, R.C.

    1991-01-01

    A non-destructive method has been developed to select common bean (Phaseolus vulgaris L.) plants whose growth is less effected at a suboptimal temperature. Shoot weight was determined at a suboptimal (14°C) and optimal temperature (20°C), 38 days after sowing and accessions identified with a

  7. Comparison of growth, nitrogen metabolism and organ weights in piglets and rats fed on diets containing Phaseolus vulgaris beans

    NARCIS (Netherlands)

    Huisman, J.; Poel, A.F.B. van der; Leeuwen, P. van; Verstegen, M.W.A.

    1990-01-01

    The effects of lectins in the diet have been mainly studied in rats. An important question is whether results obtained in rats can be extrapolated to larger animals like the pig. Phaseolus vulgaris beans are rich in toxic lectins. Therefore a study was carried out to compare the effects of diets

  8. The interaction between endopolygalacturonase from Fusarium moniliforme and PGIP from Phaseolus Vulgaris studied by surface plasmon resonance and mass spectrometry

    DEFF Research Database (Denmark)

    Mattei, B; Cervone, F; Roepstorff, Peter

    2001-01-01

    Phaseolus vulgaris. PG hydrolyses the homogalacturonan of the plant cell wall and is considered an important pathogenicity factor of many fungi. PGIP is a specific inhibitor of fungal PGs and is thought to be involved in plant defence against phytopathogenic fungi. SPR was used either to study the effect...

  9. Effect of bacterial distribution and activity on conjugal transfer on the phylloplane of the bush bean (Phaseolus vulgaris)

    DEFF Research Database (Denmark)

    Normander, Bo; Christensen, Bjarke Bak; Molin, Søren

    1998-01-01

    Conjugal plasmid transfer was examined on the phylloplane of bean (Phaseolus vulgaris) and related to the spatial distribution pattern and metabolic activity of the bacteria. The donor (Pseudomonas putida KT2442) harbored a derivative of the TOL plasmid, which conferred kanamycin resistance and had...

  10. Sucrose metabolizing enzymes in cell suspension cultures of Bauhinia forficata, Curcuma zedoaria and Phaseolus vulgaris Enzimas do metabolismo da sacarose em cultura celular de Bauhinia forficata, Curcuma zedoaria e Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Marcia Ometto de Mello

    2001-09-01

    Full Text Available The objective of this work was to study the activity of sucrose metabolizing enzymes in extracts of cell suspension cultures of Bauhinia forficata Link, Curcuma zedoaria Roscoe and Phaseolus vulgaris L. Invertase pathway was identified in the three studied species. Sucrose synthase pathway was also responsible for sucrose metabolism in Curcuma zedoaria and Phaseolus vulgaris cells. Activity values higher than 300 nmol min-1 mg-1 of protein were found for acid and neutral invertases, UDPglucose pyrophosphorylase and phosphoglucomutase in the cell extract of the three plant species. Sucrose synthase showed low activity in Bauhinia forficata cells. As sucrose concentration in the culture medium decreased, sucrose synthase activity increased in C. zedoaria and P. vulgaris cells. The glycolytic enzymes activity gradually reduced at the end of the culture period, when carbohydrate was limited.O objetivo deste trabalho foi estudar as enzimas do metabolismo da sacarose em culturas de célula em suspensão de Bauhinia forficata Link, Curcuma zedoaria Roscoe e Phaseolus vulgaris L. A via da invertase foi identificada nas três espécies estudadas. A via da sacarose sintase também foi responsável pelo metabolismo da sacarose em células de Curcuma zedoaria e Phaseolus vulgaris. Foram encontradas atividades maiores que 300 nmol min-1 mg-1 de proteína das enzimas invertase ácida e alcalina, UDPglicose pirofosforilase e fosfoglicomutase no extrato celular das três espécies de plantas. A sacarose sintase mostrou atividade baixa nas células de Bauhinia forficata. À medida que a concentração de sacarose no meio de cultura diminuiu, a atividade da sacarose sintase aumentou em células de Curcuma zedoaria e Phaseolus vulgaris. Ao final do período de cultura, quando os carboidratos se tornaram limitantes, as atividades das enzimas glicolíticas reduziram-se gradualmente.

  11. Dynamics of a Novel Highly Repetitive CACTA Family in Common Bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Dongying Gao

    2016-07-01

    Full Text Available Transposons are ubiquitous genomic components that play pivotal roles in plant gene and genome evolution. We analyzed two genome sequences of common bean (Phaseolus vulgaris and identified a new CACTA transposon family named pvCACTA1. The family is extremely abundant, as more than 12,000 pvCACTA1 elements were found. To our knowledge, this is the most abundant CACTA family reported thus far. The computational and fluorescence in situ hybridization (FISH analyses indicated that the pvCACTA1 elements were concentrated in terminal regions of chromosomes and frequently generated AT-rich 3 bp target site duplications (TSD, WWW, W is A or T. Comparative analysis of the common bean genomes from two domesticated genetic pools revealed that new insertions or excisions of pvCACTA1 elements occurred after the divergence of the two common beans, and some of the polymorphic elements likely resulted in variation in gene sequences. pvCACTA1 elements were detected in related species but not outside the Phaseolus genus. We calculated the molecular evolutionary rate of pvCACTA1 transposons using orthologous elements that indicated that most transposition events likely occurred before the divergence of the two gene pools. These results reveal unique features and evolution of this new transposon family in the common bean genome.

  12. [Use of Phaseolus vulgaris and Vigna sinensis in a fermented dairy drink].

    Science.gov (United States)

    Granito, Marisela; Trujillo, Lesma; Guerra, Marisa

    2004-06-01

    The objective of this work was to develop a new kind fermented dairy drink, partially substituted with clear varieties of Phaseolus vulgaris (caraota) and Vigna sinensis (frijol). The formulation of fermented dairy drinks included sterile extracts of caraota and frijol, as partial substitutes which replaced milk: 10, 20 and 30%. The mixtures were inoculated with 2% of a mixture of Lactobacillus acidophillus, Streptococcus thermophilus and Bifidobacterium sp. and were incubated at 42 degrees C for 7 hours. Mango and guava jams were used as flavorings at 20%. On the basis of the sensorial evaluation the mixtures 10% frijol-mango, 10% frijol-guava, 30% caraota-mango and 20% caraota-guava were selected. In the selected fermented dairy drinks, the levels of protein, soluble and insoluble fiber, available and resistant starches were increased and the protein digestibility was 81%. The technical feasibility of partial substitution of milk with extracts of Phaseolus vulgaris or Vigna sinensis. For the elaboration of a fermented dairy drink similar to the liquid yogurt kind was demonstrated.

  13. Chemical and biological studies on sweet biscuits produced from irradiated phaseolus beans flour

    International Nuclear Information System (INIS)

    Nassef, A.E.

    2005-01-01

    This study was carried out to evaluate the chemical composition of beans such as minerals, amino acids, total carbohydrates and fiber to produce high quality sweet biscuits for treating some special diseases. In this study, the Phaseolus beans flour was used as a new source of very important composition. Beans flour was irradiated at two doses (0.5 and 1.0 KGy) for preservation. Sweet biscuits were made with supplementation of 5, 10, 15% beans flour. All samples of sweet biscuits were examined for chemical composition and organoleptic characteristics. Biological assay was carried out in rats maintained on 15% either irradiated or non-irradiated beans flour sweet biscuits through determining the weight gain, serum cholesterol and triglycerides and investigating the internal organs. The results obtained showed that sweet biscuits containing 15% Phaseolus beans flour had highest content of protein, minerals and fiber and scored a good grade. Weight gain, cholesterol and triglycerides levels were reduced comparable to control and there was no effect of irradiated beans flour on the internal organs

  14. Fenólicos totais e atividade antioxidante do extrato aquoso de broto de feijão-mungo (Vigna radiata L. Total phenolics and antioxidant activity of the aqueous extract of mung bean sprout (Vigna radiata L.

    Directory of Open Access Journals (Sweden)

    Vera Lúcia Arroxelas Galvão de Lima

    2004-03-01

    Full Text Available OBJETIVO: Considerando a importância dos compostos fenólicos em alimentos e que o broto de feijão-mungo vem sendo incluído na culinária brasileira, este estudo teve como objetivo quantificar o teor de fenólicos totais deste vegetal e avaliar a ação antioxidante do seu extrato aquoso. MÉTODOS: Os compostos fenólicos foram extraídos por quatro sistemas de solventes e dois métodos de extração, os quais foram diferenciados no tempo (2 e 1h e número de extrações (2 e 3 extrações. Os fenólicos totais dos extratos foram quantificados por método espectrofotométrico. RESULTADOS: Os extratos obtidos com água à temperatura ambiente (28ºC, nos dois métodos de extração, foram os que apresentaram maior quantidade de fenólicos totais, sem contudo apresentar diferença significativa entre eles. O método II, que consistiu de três extrações em 1h, pode ser considerado o melhor por ter utilizado menor tempo de extração. O extrato aquoso em sistema modelo b-caroteno/ácido linoléico exibiu ação antioxidante (48,07% de inibição da oxidação, entretanto foi inferior ao padrão BHT. CONCLUSÃO: O broto de feijão-mungo possui considerável quantidade de fenólicos totais, compostos responsáveis por sua ação antioxidante, cujo consumo pode proporcionar efeitos benéficos à saúde.OBJECTIVE: Considering the importance of phenolic compounds in foods and the increasing consumption of mung bean sprouts in Brazil, this study had the objective of quantifying the total phenolic content in this vegetable and to assess the antioxidant activity of its aqueous extract. METHODS: The phenolic compounds were extracted by four solvent systems and two extraction methods, which were different in time (2 and 1h and in number of extractions (2 and 3 extractions. The total phenolic content of the extracts were quantified by the spectrophotometric method. RESULTS: The extracts obtained with water at room temperature (28ºC in both extraction

  15. Antioxidant activity of commonly consumed cereals, millets, pulses and legumes in India.

    Science.gov (United States)

    Sreeramulu, D; Reddy, C Vijaya Kumar; Raghunath, M

    2009-02-01

    Plant foods are important due to their antioxidant activity (AOA) attributed to the phenolics which are known to protect organisms against harmful effects of oxygen radicals. However, information on antioxidant activity of Indian plant foods is scanty. Therefore, the present study evaluated the AOA of cereals, millets, pulses and legumes, commonly consumed in India and assessed the relationship with their total phenolic content (TPC). AOA was assessed by DPPH (2,2-Diphenyl-1-picryl hydrazyl) radical scavenging assay, ferric reducing antioxidant power (FRAP) assay and reducing power. DPPH scavenging activity ranged from 0.24 and 1.73 mg/g, whereas FRAP ranged from 16.21 to 471.71 micromoles/g. Finger millet (Eleusine cora cana) and Rajmah (Phaseolus vulgaris) had the highest FRAP 471.71, 372.76 and DPPH scavenging activity 1.73, 1.07. Similar trends were observed with reducing power. Among cereals and legumes, Finger millet (Ragi) and black gram dhal (Phaseolus mungo Roxb) had the highest TPC, the values being 373 and 418 mg/100 g respectively, while rice (Oryza sativa) and green gram dhal (Phaseolus aureus Roxb) showed the least (47.6 and 62.4 mg/100 g). In the present study, FRAP (r = 0.91) and reducing power (r = 0.90) showed significant correlation with TPC in cereals and millets, but not in pulses and legumes. The results suggest that TPC contributes significantly to the AOA of Indian cereals and millets.

  16. Antibacterial Activity of Silver-Graphene Quantum Dots Nanocomposites Against Gram-Positive and Gram-Negative Bacteria

    Science.gov (United States)

    Habiba, Khaled (Inventor); Makarov, Vladimir (Inventor); Weiner, Brad R (Inventor); Morell, Gerardo (Inventor)

    2018-01-01

    The invention provides a composite of silver nanoparticles decorated with graphene quantum dots (Ag-GQDs) using pulsed laser synthesis. The nanocomposites were functionalized with polyethylene glycol (PEG). A concentration of 150 .mu.g/mL of Ag-GQDs, a non-toxic level for human cells, exhibits strong antibacterial activity against both Gram-Positive and Gram-Negative Bacteria.

  17. Distribution of multi-resistant Gram-negative versus Gram-positive bacteria in the hospital inanimate environment.

    Science.gov (United States)

    Lemmen, S W; Häfner, H; Zolldann, D; Stanzel, S; Lütticken, R

    2004-03-01

    We prospectively studied the difference in detection rates of multi-resistant Gram-positive and multi-resistant Gram-negative bacteria in the inanimate environment of patients harbouring these organisms. Up to 20 different locations around 190 patients were surveyed. Fifty-four patients were infected or colonized with methicillin-resistant Staphylococcus aureus (MRSA) or vancomycin-resistant enterococci (VRE) and 136 with multi-resistant Gram-negative bacteria. The environmental detection rate for MRSA or VRE was 24.7% (174/705 samples) compared with 4.9% (89/1827 samples) for multi-resistant Gram-negative bacteria (PGram-positive bacteria were isolated more frequently than Gram-negatives from the hands of patients (PGram-positive and Gram-negative isolates. Our results suggest that the inanimate environment serves as a secondary source for MRSA and VRE, but less so for Gram-negative bacteria. Thus, strict contact isolation in a single room with complete barrier precautions is recommended for MRSA or VRE; however, for multi-resistant Gram-negative bacteria, contact isolation with barrier precautions for close contact but without a single room seems sufficient. This benefits not only the patients, but also the hospital by removing some of the strain placed on already over-stretched resources.

  18. Dustborne and airborne gram-positive and gram-negative bacteria in high versus low ERMI homes

    Science.gov (United States)

    The study aimed at investigating Gram-positive and Gram-negative bacteria in moldy and non-moldy homes, as defined by the home's Environmental Relative Moldiness Index (ERMI) value. The ERMI values were determined from floor dust samples in 2010 and 2011 and homes were classified...

  19. Protein classification using modified n-grams and skip-grams.

    Science.gov (United States)

    Islam, S M Ashiqul; Heil, Benjamin J; Kearney, Christopher Michel; Baker, Erich J

    2018-05-01

    Classification by supervised machine learning greatly facilitates the annotation of protein characteristics from their primary sequence. However, the feature generation step in this process requires detailed knowledge of attributes used to classify the proteins. Lack of this knowledge risks the selection of irrelevant features, resulting in a faulty model. In this study, we introduce a supervised protein classification method with a novel means of automating the work-intensive feature generation step via a Natural Language Processing (NLP)-dependent model, using a modified combination of n-grams and skip-grams (m-NGSG). A meta-comparison of cross-validation accuracy with twelve training datasets from nine different published studies demonstrates a consistent increase in accuracy of m-NGSG when compared to contemporary classification and feature generation models. We expect this model to accelerate the classification of proteins from primary sequence data and increase the accessibility of protein characteristic prediction to a broader range of scientists. m-NGSG is freely available at Bitbucket: https://bitbucket.org/sm_islam/mngsg/src. A web server is available at watson.ecs.baylor.edu/ngsg. erich_baker@baylor.edu. Supplementary data are available at Bioinformatics online.

  20. Bio sorption of some Rare Earth Elements and Yttrium by Gram Positive and Gram Negative Bacteria

    International Nuclear Information System (INIS)

    Ibrahim, H.A.

    2012-01-01

    The separate bio sorption of the REEs La, Sm, Eu and Dy together with yttrium upon the Gram positive bacteria Bacillus subtilis (B.subtilis) and Bacillus Licheniformis (B. Licheniformis),the Gram negative bacterium Escherichia coli (E. coli ) and Saccharomyces cervisiae (Yeast) was studied. The revelant factors of ph 1-6, contact time (30-180 min), the initial rare earth concentration (50-200 mg/l) have been studied. The amount of the accumulated element was strongly affected by its concentration.In addition, bio sorptive fractionation of Y and the studied REEs from a solution containing a mixture of these elements was also studied. From the obtained data, it was found that Langmuir isotherm model for both B.licheniformis and E.coli gives a best fit for the studied elements over the working range of concentration (50-200 mg/I). Transmission electron microscopy exhibited accumulation throughout the bacterial cell with some granular deposits in both the cell periphery and cytoplasm

  1. Cytokine profile in severe gram-positive and gram-negative abdominal sepsis

    Science.gov (United States)

    Surbatovic, Maja; Popovic, Nada; Vojvodic, Danilo; Milosevic, Ivan; Acimovic, Gordana; Stojicic, Milan; Veljovic, Milic; Jevdjic, Jasna; Djordjevic, Dragan; Radakovic, Sonja

    2015-01-01

    Sepsis is a principal cause of death in critical care units worldwide and consumes considerable healthcare resources. The aim of our study was to determine whether the early cytokine profile can discriminate between Gram-positive and Gram-negative bacteraemia (GPB and GNB, respectively) and to assess the prognostic value regarding outcome in critically ill patients with severe abdominal sepsis. The outcome measure was hospital mortality. Blood samples were obtained from 165 adult patients with confirmed severe abdominal sepsis. Levels of the proinflammatory mediators TNF-α, IL-8, IL-12 and IFN-γ and the anti-inflammatory mediators IL-1ra, IL-4, IL-10 and TGF-β1 were determined and correlated with the nature of the bacteria isolated from the blood culture and outcome. The cytokine profile in our study indicated that the TNF-α levels were 2-fold, IL-8 were 3.3-fold, IFN-γ were 13-fold, IL-1ra were 1.05-fold, IL-4 were 1.4-fold and IL-10 were 1.83-fold higher in the GNB group compared with the GPB group. The TNF-α levels were 4.7-fold, IL-8 were 4.6-fold, IL-1ra were 1.5-fold and IL-10 were 3.3-fold higher in the non-survivors compared with the survivors. PMID:26079127

  2. [Usefulness of sputum Gram staining in community-acquired pneumonia].

    Science.gov (United States)

    Sato, Tadashi; Aoshima, Masahiro; Ohmagari, Norio; Tada, Hiroshi; Chohnabayashi, Naohiko

    2002-07-01

    To evaluate the usefulness of sputum gram staining in community-acquired pneumonia (CAP), we reviewed 144 cases requiring hospitalization in the last 4 years. The sensitivity was 75.5%, specificity 68.2%, positive predictive value 74.1%, negative predictive value 69.8%, positive likelihood ratio 2.37, negative likelihood ratio 0.36 and accuracy 72.2% in 97 cases. Both sputum gram staining and culture were performed. Concerning bacterial pneumonia (65 cases), we compared the Gram staining group (n = 33), which received initial antibiotic treatment, based on sputum gram staining with the Empiric group (n = 32) that received antibiotics empirically. The success rates of the initial antibiotic treatment were 87.9% vs. 78.1% (P = 0.473); mean hospitalization periods were 9.67 vs. 11.75 days (P = 0.053); and periods of intravenous therapy were 6.73 vs. 7.91 days (P = 0.044), respectively. As for initial treatment, penicillins were used in the Gram staining group more frequently (P gram staining is useful for the shortening of the treatment period and the appropriate selection of initial antibiotics in bacterial pneumonia. We believe, therefore, that sputum gram staining is indispensable as a diagnostic tool CAP.

  3. Comparing Medline citations using modified N-grams

    Science.gov (United States)

    Nawab, Rao Muhammad Adeel; Stevenson, Mark; Clough, Paul

    2014-01-01

    Objective We aim to identify duplicate pairs of Medline citations, particularly when the documents are not identical but contain similar information. Materials and methods Duplicate pairs of citations are identified by comparing word n-grams in pairs of documents. N-grams are modified using two approaches which take account of the fact that the document may have been altered. These are: (1) deletion, an item in the n-gram is removed; and (2) substitution, an item in the n-gram is substituted with a similar term obtained from the Unified Medical Language System  Metathesaurus. N-grams are also weighted using a score derived from a language model. Evaluation is carried out using a set of 520 Medline citation pairs, including a set of 260 manually verified duplicate pairs obtained from the Deja Vu database. Results The approach accurately detects duplicate Medline document pairs with an F1 measure score of 0.99. Allowing for word deletions and substitution improves performance. The best results are obtained by combining scores for n-grams of length 1–5 words. Discussion Results show that the detection of duplicate Medline citations can be improved by modifying n-grams and that high performance can also be obtained using only unigrams (F1=0.959), particularly when allowing for substitutions of alternative phrases. PMID:23715801

  4. Phaseolus vulgaris Leuco-Agglutinin Tracing of Intrahypothalamic Connections of the Lateral, Ventromedial, Dorsomedial and Paraventricular Hypothalamic Nuclei in the Rat

    NARCIS (Netherlands)

    Horst, G.J. ter; Luiten, P.G.M.

    Intrahypothalamic connections of the lateral (LHA), ventromedial (VMH), dorsomedial (DMH) and paraventricular (PVN) hypothalamic nuclei were studied with anterograde transport of iontophoretically injected Phaseolus vulgaris leuco-agglutinin and the immunocytochemical detection of labeled

  5. Patterns of Direct Projections from the Hippocampus to the Medial Septum-Diagonal Band Complex : Anterograde Tracing with Phaseolus vulgaris Leucoagglutinin Combined with Immunohistochemistry of Choline Acetyltransferase

    NARCIS (Netherlands)

    Gaykema, R.P.A.; Kuil, J. van der; Hersh, L.B.; Luiten, P.G.M.

    1991-01-01

    The projections from the Ammon's horn to the cholinergic cell groups in the medial septal and diagonal band nuclei were investigated with anterograde tracing of Phaseolus vulgaris leucoagglutinin combined with immunocytochemical detection of choline acetyltransferase, in the rat. Tracer injections

  6. Sauvetage d'embryons chez les légumineuses alimentaires en général et dans le genre Phaseolus en particulier (synthèse bibliographique

    Directory of Open Access Journals (Sweden)

    Barikissou, E.

    2012-01-01

    Full Text Available A review of embryos rescue in food legumes in general and in the genus Phaseolus in particular. Genetic improvement of Phaseolus vulgaris L. by interspecific hybridization with Phaseolus coccineus L. and Phaseolus polyanthus Greenm., used as female parents, often gives rise to embryo abortion at globular developmental stage. In vitro culture of embryos at cotyledonary and torpedo shaped stages, leads to hybrid plants, but with very low percentages of success. Several investigations of in vitro culture in selfed genotypes of Phaseolus and from embryos at globular or young heart shaped stages have allowed to regenerate some young plantlets. However, problems of rooting and stopping of growth restrict the number of developing plantlets. Analysis of the results achieved from interspecific embryo rescue in others food legumes of the genus Lupinus, Cajanus, Cicer, Lens and Trifolium, helped to identify some solutions to resolve incompatibility problems in Phaseolus.

  7. Influence of heat processing on the bioaccessibility of zinc and iron from cereals and pulses consumed in India.

    Science.gov (United States)

    Hemalatha, Sreeramaiah; Platel, Kalpana; Srinivasan, Krishnapura

    2007-01-01

    Influence of heat processing on the bioaccessibility of zinc and iron from food grains consumed in India was evaluated. Cereals - rice (Oryza sativa), finger millet (Eleusine coracana), sorghum (Sorghum vulgare), wheat (Triticum aestivum), and maize (Zea mays), and pulses - chickpea (Cicer arietinum) - whole and decorticated, green gram (Phaseolus aureus) - whole and decorticated, decorticated black gram (Phaseolus mungo), decorticated red gram (Cajanus cajan), cowpea (Vigna catjang), and French bean (Phaseolus vulgaris) were examined for zinc and iron bioaccessibility by employing an in vitro dialysability procedure. Both pressure-cooking and microwave heating were tested for their influence on mineral bioaccessibility. Zinc bioaccessibility from food grains was considerably reduced upon pressure-cooking, especially in pulses. Among cereals, pressure-cooking decreased zinc bioaccessibility by 63% and 57% in finger millet and rice, respectively. All the pressure-cooked cereals showed similar percent zinc bioaccessibility with the exception of finger millet. Bioaccessibility of zinc from pulses was generally lower as a result of pressure-cooking or microwave heating. The decrease in bioaccessibility of zinc caused by microwave heating ranged from 11.4% in chickpea (whole) to 63% in cowpea. Decrease in zinc bioaccessibility was 48% in pressure-cooked whole chickpea, 45% and 55% in pressure-cooked or microwave-heated whole green gram, 32% and 22% in pressure-cooked or microwave-heated decorticated green gram, and 45% in microwave-heated black gram. Iron bioaccessibility, on the other hand, was significantly enhanced generally from all the food grains studied upon heat treatment. Thus, heat treatment of grains produced contrasting effect on zinc and iron bioaccessibility.

  8. Genetic diversity in green gram [Vigna radiata (L.)] landraces ...

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... nitrogen fixer for maintaining soil fertility. However ... use of radioactive elements makes it more costly and tedious. ... Figure 1. Geographic distribution of sampling localities of wild green gram in Southern Tamil Nadu, India.

  9. LexGram - a practical categorial grammar formalism -

    OpenAIRE

    Koenig, Esther

    1995-01-01

    We present the LexGram system, an amalgam of (Lambek) categorial grammar and Head Driven Phrase Structure Grammar (HPSG), and show that the grammar formalism it implements is a well-structured and useful tool for actual grammar development.

  10. Volatile metabolites from some gram-negative bacteria

    DEFF Research Database (Denmark)

    Schöller, Charlotte; Molin, Søren; Wilkins, Ken

    1997-01-01

    A survey of volatile organic compounds (VOCs) excreted from various Gram-negative bacteria (Pseudomonas spp., Serratia spp. and Enterobacter spp.) was carried out. Compounds were identified by gas chromatography-mass spectrometry. VOCs identified included dimethyl disulphide, dimethyl trisulphide...

  11. leaves extracts as counter stain in gram staining reaction 56

    African Journals Online (AJOL)

    DR. AMINU

    is a stain with color contrasting to the principal stain, making the stained ... technology today, the Gram's staining method remains ... was aimed at employing the use of Henna leaves extract as ... fragrant, white or rose flowers in clusters. It is.

  12. Pulmonary infiltrates during community acquired Gram-negative bacteremia

    DEFF Research Database (Denmark)

    Fjeldsøe-Nielsen, Hans; Gjeraa, Kirsten; Berthelsen, Birgitte G

    2013-01-01

    The primary aim of this study was to describe the frequency of pulmonary infiltrates on chest X-ray (CXR) during community acquired Gram-negative bacteremia at a single centre in Denmark.......The primary aim of this study was to describe the frequency of pulmonary infiltrates on chest X-ray (CXR) during community acquired Gram-negative bacteremia at a single centre in Denmark....

  13. BOOKLET TO INSTITUTO PEDAGOGICO NACIONAL TEACHERS ABOUT SYMBIOSIS AND PROCESSES ON BIOTECHNOLOGY: THE BIOFERTILIZER Rhizobium sp IN Phaseolus vulgaris WITH ALTERNATIVE TO SYMBIOSIS FOR Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    María Camila Quevedo Rubiano

    2016-09-01

    Full Text Available This article presents the results of the thesis carried out in the research group of Biotechnology Teaching in Colombia, with the aim of providing teachers of Biology of Instituto Pedagogico Nacional a booklet that can strengthen the teaching of biotechnology processes using Rhizobium sp reduction of chemical fertilizers and symbiosis with Phaseolus vulgaris.   The booklet contains a proposal of practical activities that enable teachers of this institution to use spaces like the farm, enabling to teach biotechnology related to agronomy. Therefore, for this project was considered two Biological and Pedagogical approaches, the first is within the analytical empirical paradigm in the process of microbiological characterization of Rhizobium and their Biofertilizing ability in beans; and the teaching approach within the design of a booklet that includes the findings of this study as a contribution to the reduction of chemical fertilizers school farm. In order to have a complete analysis of the work it was subjected to quantitative and qualitative methods.   This biotech practice is included in the booklet showing in bioassays that bacteria has biofertilizer without inhibiting potential symbiosis, and that research and teaching biological concepts from scientific expertise can be promoted in Biology class for students to understand its context in a significant way, to be used in different levels of education; also it is a teaching strategy.

  14. Selective bowel decontamination results in gram-positive translocation.

    Science.gov (United States)

    Jackson, R J; Smith, S D; Rowe, M I

    1990-05-01

    Colonization by enteric gram-negative bacteria with subsequent translocation is believed to be a major mechanism for infection in the critically ill patient. Selective bowel decontamination (SBD) has been used to control gram-negative infections by eliminating these potentially pathogenic bacteria while preserving anaerobic and other less pathogenic organisms. Infection with gram-positive organisms and anaerobes in two multivisceral transplant patients during SBD led us to investigate the effect of SBD on gut colonization and translocation. Twenty-four rats received enteral polymixin E, tobramycin, amphotericin B, and parenteral cefotaxime for 7 days (PTA + CEF); 23 received parenteral cefotaxime alone (CEF), 19 received the enteral antibiotics alone (PTA), 21 controls received no antibiotics. Cecal homogenates, mesenteric lymph node (MLN), liver, and spleen were cultured. Only 8% of the PTA + CEF group had gram-negative bacteria in cecal culture vs 52% CEF, 84% PTA, and 100% in controls. Log Enterococcal colony counts were higher in the PTA + CEF group (8.0 + 0.9) vs controls (5.4 + 0.4) P less than 0.01. Translocation of Enterococcus to the MLN was significantly increased in the PTA + CEF group (67%) vs controls (0%) P less than 0.01. SBD effectively eliminates gram-negative organisms from the gut in the rat model. Overgrowth and translocation of Enterococcus suggests that infection with gram-positive organisms may be a limitation of SBD.

  15. Prediction of lipoprotein signal peptides in Gram-negative bacteria.

    Science.gov (United States)

    Juncker, Agnieszka S; Willenbrock, Hanni; Von Heijne, Gunnar; Brunak, Søren; Nielsen, Henrik; Krogh, Anders

    2003-08-01

    A method to predict lipoprotein signal peptides in Gram-negative Eubacteria, LipoP, has been developed. The hidden Markov model (HMM) was able to distinguish between lipoproteins (SPaseII-cleaved proteins), SPaseI-cleaved proteins, cytoplasmic proteins, and transmembrane proteins. This predictor was able to predict 96.8% of the lipoproteins correctly with only 0.3% false positives in a set of SPaseI-cleaved, cytoplasmic, and transmembrane proteins. The results obtained were significantly better than those of previously developed methods. Even though Gram-positive lipoprotein signal peptides differ from Gram-negatives, the HMM was able to identify 92.9% of the lipoproteins included in a Gram-positive test set. A genome search was carried out for 12 Gram-negative genomes and one Gram-positive genome. The results for Escherichia coli K12 were compared with new experimental data, and the predictions by the HMM agree well with the experimentally verified lipoproteins. A neural network-based predictor was developed for comparison, and it gave very similar results. LipoP is available as a Web server at www.cbs.dtu.dk/services/LipoP/.

  16. Silver enhances antibiotic activity against gram-negative bacteria.

    Science.gov (United States)

    Morones-Ramirez, J Ruben; Winkler, Jonathan A; Spina, Catherine S; Collins, James J

    2013-06-19

    A declining pipeline of clinically useful antibiotics has made it imperative to develop more effective antimicrobial therapies, particularly against difficult-to-treat Gram-negative pathogens. Silver has been used as an antimicrobial since antiquity, yet its mechanism of action remains unclear. We show that silver disrupts multiple bacterial cellular processes, including disulfide bond formation, metabolism, and iron homeostasis. These changes lead to increased production of reactive oxygen species and increased membrane permeability of Gram-negative bacteria that can potentiate the activity of a broad range of antibiotics against Gram-negative bacteria in different metabolic states, as well as restore antibiotic susceptibility to a resistant bacterial strain. We show both in vitro and in a mouse model of urinary tract infection that the ability of silver to induce oxidative stress can be harnessed to potentiate antibiotic activity. Additionally, we demonstrate in vitro and in two different mouse models of peritonitis that silver sensitizes Gram-negative bacteria to the Gram-positive-specific antibiotic vancomycin, thereby expanding the antibacterial spectrum of this drug. Finally, we used silver and antibiotic combinations in vitro to eradicate bacterial persister cells, and show both in vitro and in a mouse biofilm infection model that silver can enhance antibacterial action against bacteria that produce biofilms. This work shows that silver can be used to enhance the action of existing antibiotics against Gram-negative bacteria, thus strengthening the antibiotic arsenal for fighting bacterial infections.

  17. Sensitivity of Phaseolus vulgaris cv. `CIAP 7247F' plants to Glufosinate ammonium herbicide in greenhouse

    Directory of Open Access Journals (Sweden)

    Idalmis Bermúdez-Caraballoso

    2014-01-01

    Full Text Available Genetic breeding in Phaseolus by genetic transformation requires an efficient selection system. The present investigation was aimed to determine the minimum lethal concentration of glufosinate-ammonium (Finale ® in beans plants cv. `CIAP 7247F' grown in greenhouse. Different concentrations of the herbicide were applied to the foliage of plants in acclimatization phase (20, 30 y 40 mg l-1 and the control. Results showed that the minimum lethal concentration in plants in acclimatization phase was 30 mg l-1. Results also demonstrated that is possible the use of the herbicide as a selective agent of beans transformants cv. `CIAP 7247F' carrying the bar gene. Keywords: genetic transformation, herbicide, selective agent, tissue culture

  18. Starch and sucrose synthesis in Phaseolus vulgaris as affected by light, CO2, and abscisic acid

    International Nuclear Information System (INIS)

    Sharkey, T.D.; Berry, J.A.; Raschke, K.

    1985-01-01

    Phaseolus vulgaris L. leaves were subjected to various light, CO 2 , and O 2 levels and abscisic acid, then given a 10 minute pulse of 14 CO 2 followed by a 5 minute chase with unlabeled CO 2 . After the chase period, very little label remained in the ionic fractions except at low CO 2 partial pressure. Most label was found in the neutral, alcohol soluble fraction or in the insoluble fraction digestable by amyloglucosidase. Sucrose formation was linearly related to assimilation rate. Starch formation increased linearly with assimilation rate, but did not occur if the assimilation rate was below 4 micromoles per square meter per second. Neither abscisic acid, nor high CO 2 in combination with low O 2 caused significant perturbations of the sucrose/starch formation ratio. These studies indicate that the pathways for starch and sucrose synthesis both are controlled by the rate of net CO 2 assimilation, with sucrose the preferred product at very low assimilation rates

  19. Iron and ferritin accumulate in separate cellular locations in Phaseolus seeds

    DEFF Research Database (Denmark)

    Cvitanich, Cristina; Przybylowicz, Wojciech J; Urbanski, Dorian Fabian

    2010-01-01

    and will assist in the production of staples with increased bioavailable iron. Results Here we reveal the distribution of iron in seeds of three Phaseolus species including thirteen genotypes of P. vulgaris, P. coccineus, and P. lunatus. We showed that high concentrations of iron accumulate in cells surrounding...... the provascular tissue of P. vulgaris and P. coccineus seeds. Using the Perls' Prussian blue method, we were able to detect iron in the cytoplasm of epidermal cells, cells near the epidermis, and cells surrounding the provascular tissue. In contrast, the protein ferritin that has been suggested as the major iron...... to P. vulgaris and P. coccineus, we did not observe iron accumulation in the cells surrounding the provascular tissues of P. lunatus cotyledons. A novel iron-rich genotype, NUA35, with a high concentration of iron both in the seed coat and cotyledons was bred from a cross between an Andean...

  20. Development of 12 Chloroplast Microsatellite Markers in Vigna unguiculata (Fabaceae and Amplification in Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Lei Pan

    2014-03-01

    Full Text Available Premise of the study: Vigna unguiculata is an economically important legume, and the complexity of its variability and evolution needs to be further understood. Based on publicly available databases, we developed chloroplast microsatellite primers to investigate genetic diversity within V. unguiculata and its related species Phaseolus vulgaris. Methods and Results: Twelve polymorphic chloroplast microsatellite markers were developed and characterized in 62 V. unguiculata individuals. The number of alleles per locus varied between two and four, the unbiased haploid diversity per locus ranged from 0.123 to 0.497, and the polymorphism information content varied from 0.114 to 0.369. In cross-species amplifications, nine of these markers showed polymorphism in 29 P. vulgaris individuals. Conclusions: The newly developed chloroplast microsatellite markers exhibit variation in V. unguiculata as well as their transferability in P. vulgaris. These markers can be used to investigate genetic diversity and evolution in V. unguiculata and P. vulgaris.

  1. Fractionation of gamma-emitting fission products absorbed by red kidney beans (Phaseolus vulgaris L.)

    International Nuclear Information System (INIS)

    D'Souza, T.J.; Mistry, K.B.

    1980-01-01

    The gamma-emitting fission product nuclides 106 Ru, 125 Sb, 137 Cs and 144 Ce that accumulated in the edible pods of bean (Phaseolus vulgaris L.) plants grown in nutrient culture were subjected to chemical fractionation. The results indicated that the largest fraction of 106 Ru, 125 Sb and 144 Ce was associated with ionic forms including salts of organic acids, phosphates, carbonates and some protein-bound forms extracted with dilute mineral acids (acid fraction). The association of these radionuclides with lipids including lipophyllic pigments, free amino acids and amino sugars (ethanol fraction) was next in significance. The association of 137 Cs was, however, greater with the ethanol fraction than with the acid fraction. Considerably reduced amounts of the fission products were present in the pectates, proteins, polysaccharides and nucleic acids. (U.K.)

  2. Yield and drougth tolerance of six varieties of common bean (Phaseolus vulgaris L. under field condition

    Directory of Open Access Journals (Sweden)

    Yanitza Meriño Hernandez

    2015-01-01

    Full Text Available In two moisture conditions (drought and irrigation were evaluated six varieties of common bean (Phaseolus vulgaris L., with a factorial randomized complete blocks. The objectives of the study was to evaluate the effect caused by drought conditions crop varieties, identify high performance and features that enable them to adapt to varying conditions of soil moisture. With the data in yields between the two humidity conditions intensity indices of drought (IIS, susceptibility to drought (ISS, relative efficiency (IER, geometric mean (GM and percent yield losses were calculated . The results were statistically processed using the Statistica software version 8.0 for Windows, if significant differences Tukey test was applied to p<0.05. The selection based on levels ISS, MG, IER and PPR identified high yielding varieties adapted to drought and favorable moisture conditions.

  3. Effect of lead on imbibition, germination, and growth of Phaseolus vulgaris L. and Zea mays L.

    Directory of Open Access Journals (Sweden)

    Gustavo Isaza Guzmán Isaza Guzmán

    2013-07-01

    Full Text Available Lead is highly reactive and it can be consequently toxic to living cells to both plants and humans. This heavy metal is a source of contamination to the environment and it disrupts natural cycles. The present study was aimed to evaluate the effect of lead on the imbibition process, germination and growth in the bean (Phaseolus vulgaris L. and maize (Zea mays L.. It was developed a system consisting of receptacles to expose flooded plants at different concentrations of the metal. Results showed that at concentrations of 5 g l-1 lead imbibition process was affected, but was more evident in bean. Germination percentage was not affected in maize seeds, while viability was affected in bean seeds. We observed statistically that there is an effect on organ growth of root, stem and leaf in both species in the presence of solution whose effect is most noticeable in bean plants. Key words: heavy metals,phytoremediation, stress, toxic substances

  4. Phylogenetic relationships and host range of Rhizobium spp. that nodulate Phaseolus vulgaris L.

    Science.gov (United States)

    Hernandez-Lucas, I; Segovia, L; Martinez-Romero, E; Pueppke, S G

    1995-07-01

    We determined the nucleotide sequences of 16S rRNA gene segments from five Rhizobium strains that have been isolated from tropical legume species. All share the capacity to nodulate Phaseolus vulgaris L., the common bean. Phylogenetic analysis confirmed that these strains are of two different chromosomal lineages. We defined the host ranges of two strains of Rhizobium etli and three strains of R. tropici, comparing them with those of the two most divergently related new strains. Twenty-two of the 43 tested legume species were nodulated by three or more of these strains. All seven strains have broad host ranges that include woody species such as Albizia lebbeck, Gliricidia maculata, and Leucaena leucocephala.

  5. Effect of different nitrogen sources on plant characteristics and yield of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Fernández-Luqueño, F; Reyes-Varela, V; Martínez-Suárez, C; Salomón-Hernández, G; Yáñez-Meneses, J; Ceballos-Ramírez, J M; Dendooven, L

    2010-01-01

    Wastewater sludge can be used to fertilize crops, especially after vermicomposting (composting with earthworms to reduce pathogens). How wastewater sludge or vermicompost affects bean (Phaseolus vulgaris L.) growth is still largely unknown. In this study the effect of different forms of N fertilizer on common bean plant characteristics and yield were investigated in a Typic Fragiudepts (sandy loam) soil under greenhouse conditions. Beans were fertilized with wastewater sludge, or wastewater sludge vermicompost, or urea, or grown in unamended soil, while plant characteristics and yield were monitored (the unamended soil had no fertilization). Yields of common bean plants cultivated in unamended soil or soil amended with urea were lower than those cultivated in wastewater sludge-amended soil. Application of vermicompost further improved plant development and increased yield compared with beans cultivated in wastewater amended soil. It was found that application of organic waste products improved growth and yield of bean plants compared to those amended with inorganic fertilizer.

  6. Pinto Beans (Phaseolus vulgaris L. as a Functional Food: Implications on Human Health

    Directory of Open Access Journals (Sweden)

    Vicki Schlegel

    2013-02-01

    Full Text Available Most foods are considered functional in terms of providing nutrients and energy to sustain daily life, but dietary systems that are capable of preventing or remediating a stressed or diseased state are classified as functional foods. Dry beans (Phaseolus vulgaris L. contain high levels of chemically diverse components (phenols, resistance starch, vitamins, fructooligosaccharides that have shown to protect against such conditions as oxidative stress, cardiovascular disease, diabetes, metabolic syndrome, and many types of cancer, thereby positioning this legume as an excellent functional food. Moreover, the United States has a rich dry bean history and is currently a top producer of dry beans in the world with pinto beans accounting for the vast majority. Despite these attributes, dry bean consumption in the US remains relatively low. Therefore, the objective of this manuscript is to review dry beans as an important US agricultural crop and as functional food for the present age with an emphasis on pinto beans.

  7. Novel vitamin E forms in leaves of Kalanchoe daigremontiana and Phaseolus coccineus.

    Science.gov (United States)

    Kruk, Jerzy; Pisarski, Adam; Szymańska, Renata

    2011-11-15

    In the present study, we isolated novel tocochromanols from green leaves of Kalanchoe daigremontiana and primary leaves of etiolated seedlings of Phaseolus coccineus that were identified as β-, γ-, and δ-tocomonoenols with unsaturation at the terminal isoprene unit of the side chain. The content of γ-tocomonoenol in leaves of etiolated bean increased gradually with the age of seedlings, reaching 50% of the γ-tocopherol level in 40-day-old plants. The content of this compound in leaves was increased by short illumination of etiolated plants and by addition of homogentisic acid, a biosynthetic precursor of tocopherols. These data indicated that γ-tocomonoenol is synthesized de novo from homogentisic acid and tetrahydro-geranylgeraniol diphosphate, a phytol precursor. Based on these results, a biosynthetic pathway of tocomonoenols is proposed. Copyright © 2011 Elsevier GmbH. All rights reserved.

  8. Nutritive value evaluated on rats of new cultivars of common beans (Phaseolus vulgaris) released in Chile.

    Science.gov (United States)

    Yañez, E; Zacarias, I; Aguayo, M; Vasquez, M; Guzman, E

    1995-06-01

    Five new cultivars of common beans (Phaseolus vulgaris) recently released were analyzed for their proximate chemical composition and protein biological quality. The crude protein content in these cultivars ranged from 21.9 percent in cultivar Arroz 3 to 26.9 percent in cultivar Tórtola Diana (dry matter basis). Rats fed cultivar Tórtola INIA gained more weight, had a higher protein intake and registered higher PER and NPR than Tórtola corriente. On the other hand, rats consuming cultivars Arroz 3 and Fleetwood had lower weight gain, lower protein intake and lower PER and NPR than cultivar Coscorrón corriente. However, all these cultivars have a relatively good protein value as compared to other plant protein sources.

  9. Gamma radiation effects on bean plants (Phaseolus vulgaris L.) in flowering

    International Nuclear Information System (INIS)

    Tulmann Neto, A.; Matsumoto, K.; Marchezoni, S.A.; Ando, A.; Menten, J.O.M.

    1980-01-01

    The possibility of utilizing the 60 Co source in the Center of Nuclear Energy for Agriculture (CENA), Sao Paulo University, for gamma-irradiation of plants in flower was shown by an experiment with beans (Phaseolus vulgaris L.). Pots with two bean plants in flower, variety Carioca, line 6E 1 , were put individually in the center of the source. Doses used were 1, 2, 3, 4 and 5 kR. The development of these plants after irradiation till harvest and seedling emergence of their progeny were observed. The effects of gamma-rays and the advantages of irradiation of plants in flower were discussed, and recommendable procedures for research workers who need to use the 60 Co source of the CENA are suggested. (Author) [pt

  10. Seedborne Pathogenic Fungi in Common Bean (Phaseolus vulgaris cv. INTA Rojo) in Nicaragua.

    Science.gov (United States)

    Marcenaro, Delfia; Valkonen, Jari P T

    2016-01-01

    Common bean (Phaseolus vulgaris L.) is an important legume with high nutritional value. In Nicaragua, certified healthy seeds of local bean varieties are not available, and seedborne fungi have gained little attention. Here, were surveyed seedborne pathogenic fungi in an important local bean cultivar, 'INTA Rojo'. Beans grown in the four main production areas in Nicaragua (Boaco, Carazo, Estelí, Matagalpa) for future use as seed stock were sampled from four seed storehouses and six seed lots. A total of 133 fungal strains were isolated from surface-sterilized beans and inoculated to healthy lima beans (Phaseolus lunatus) under controlled conditions. Eighty-seven isolates caused symptoms of varying severity in the seedlings, including discoloration, necrotic lesions, cankers, rot, and lethal necrosis. Pathogenic isolates were divided into eight phenotypically distinguishable groups based on morphology and growth characteristics on artificial growth medium, and further identified by analysis of the internal transcribed spacer sequences (ITS1 and ITS2) of the ribosomal RNA genes. The pathogenic isolates belonged to eight genera. Fusarium spp. (F. chlamydosporum, F. equiseti, F. incarnatum), Lasiodiplodia theobromae, Macrophomina phaseolina, and Penicillium citrinum were the most damaging and common fungi found in the seed lots. Furthermore, Corynespora cassiicola, Colletotrichum capsisi, Colletotrichum gloeosporioides, Aspergillus flavus, and Diaporthe sp. (Phomopsis) were seedborne in cultivar 'INTA Rojo' and found to be pathogenic to bean seedlings. This study reveals, for the first time, many seedborne pathogenic fungi in beans in Nicaragua; furthermore, prior to this study, little information was available concerning F. equiseti, F. incarnatum, L. theobromae, C. cassiicola, and Diaporthe spp. as seedborne pathogens of common bean. Our results lay the basis for developing diagnostic tools for seed health inspection and for further study of the epidemiology

  11. Aplicação de óleo no controle de Zabrotes subfasciatus e na germinação de Phaseolus vulgaris Oil aplication in the control of Zabrotes subfasciatus and in the germination of Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Maiene de F. C. de Queiroga

    2012-07-01

    Full Text Available Propôs-se, com este trabalho, estudar a qualidade de sementes de feijão carioca (Phaseolus vulgaris L. tratadas com óleos vegetais de mamona, soja e oiticica, durante cinco meses de armazenamento. Mediante os resultados obtidos concluiu-se que os óleos vegetais utilizados no tratamento das sementes de feijão Phaseolus foram eficientes na manutenção da viabilidade e no controle da infestação pelo inseto-praga de armazenamento Zabrotes subfasciatus, nos cinco meses de armazenamento, sendo o óleo de oiticica o que apresentou melhor média de germinação, frente às tratadas com óleo de mamona e soja. O óleo de oiticica também foi o mais eficiente no controle de Z. subfasciatus. Verificou-se, ainda, redução da eficiência dos óleos nas suas menores doses, sendo a dose de 4,5 mL para 500 g de sementes, a mais eficaz para todas as variáveis estudadas.The purpose of this work was to study the quality of bean seeds (Phaseolus vulgaris L. treated with vegetable oils of castor, soybean and 'oiticica' during five months of storage. From the obtained results it was concluded that vegetable oils used in the treatment of seeds of Phaseolus beans were effective in maintaining the viability and control of storage insect pest infestation Zabrotes subfasciatus during the five months of storage, and the 'oiticica' oil presented the best mean germination, compared to those treated with castor oil and soybeans. 'Oiticica' oil was also the most efficient in controlling Z. subfasciatus. Reduced efficiency of the oils was observed in the small doses and the dose of 4.5 mL for 500 g of seeds was the most effective for all variables.

  12. Effects of Fertilization on Uptake of 85Sr, 60Co and 54Mn by Tomato and Phaseolus Plants

    International Nuclear Information System (INIS)

    Ramadan, A.B.; Ezz El-Din, M.R.

    2001-01-01

    The effects of N-, P-, and K- fertilizers on availability of 85 Sr, 60 Co and 54 Mn added to the soil were measured in an open field experiment. The uptake of 85 Sr, 60 Co and 54 Mn by tomato and phaseolus was lower in fertilized treatments than in unfertilized ones. The radionuclide availability under fertilized condition depends on soil and element properties. Solubilization of Ca-ions following nitrification of nitrogen in ammonium salts and the presence of stable Strontium, Cobalt and Manganese in the acidifying fertilizers are the main factors giving rise to the reduced radioisotopes uptake by plants. The relative order of uptake of the investigated radionuclides by plants appeared to be as follow 54 Mn> 60 Co> 85 Sr. The distribution pattern of the total absorbed radionuclides in the two plants shows that the shoots contained the highest percent of these radionuclides. Transfer factors for phaseolus plants were higher than those of tomato plants

  13. The seed coat of Phaseolus vulgaris interferes with the development of the cowpea weevil [Callosobruchus maculatus (F. (Coleoptera: Bruchidae

    Directory of Open Access Journals (Sweden)

    Silva Luciana B.

    2004-01-01

    Full Text Available We have confirmed here that the seeds of the common bean (Phaseolus vulgaris, L. do not support development of the bruchid Callosobruchus maculatus (F., a pest of cowpea [Vigna unguiculata (L. Walp] seeds. Analysis of the testa (seed coat of the bean suggested that neither thickness nor the levels of compounds such as tannic acid, tannins, or HCN are important for the resistance. On the other hand, we have found that phaseolin (vicilin-like 7S storage globulin, detected in the testa by Western blotting and N-terminal amino acid sequencing, is detrimental to the development of C. maculatus. As for the case of other previously studied legume seeds (Canavalia ensiformis and Phaseolus lunatus we suggest that the presence of vicilin-like proteins in the testa of P. vulgaris may have had a significant role in the evolutionary adaptation of bruchids to the seeds of leguminous plants.

  14. Drug-resistant gram-negative uropathogens: A review.

    Science.gov (United States)

    Khoshnood, Saeed; Heidary, Mohsen; Mirnejad, Reza; Bahramian, Aghil; Sedighi, Mansour; Mirzaei, Habibollah

    2017-10-01

    Urinary tract infection(UTI) caused by Gram-negative bacteria is the second most common infectious presentation in community medical practice. Approximately 150 million people are diagnosed with UTI each year worldwide. Drug resistance in Gram-negative uropathogens is a major global concern which can lead to poor clinical outcomes including treatment failure, development of bacteremia, requirement for intravenous therapy, hospitalization, and extended length of hospital stay. The mechanisms of drug resistance in these bacteria are important due to they are often not identified by routine susceptibility tests and have an exceptional potential for outbreaks. Treatment of UTIs depends on the access to effective drugs, which is now threatened by antibiotic resistant Gram-negative uropathogens. Although several effective antibiotics with activity against highly resistant Gram-negatives are available, there is not a unique antibiotic with activity against the high variety of resistance. Therefore, antimicrobial susceptibility tests, correlation between clinicians and laboratories, development of more rapid diagnostic methods, and continuous monitoring of drug resistance are urgent priorities. In this review, we will discuss about the current global status of drug-resistant Gram-negative uropathogens and their mechanisms of drug resistance to provide new insights into their treatment options. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  15. Local (gut) and systemic metabolism of rats is altered by consumption of raw bean (Phaseolus vulgaris L var athropurpurea).

    Science.gov (United States)

    Santidrián, Santiago; de Moya, Carmen Cavallé; Grant, George; Frühbeck, Gema; Urdaneta, Elena; García, María; Marzo, Florencio

    2003-03-01

    The composition of the raw legume Phaseolus vulgaris L. var. athropurpurea (PhVa) and its effects on the metabolism of young growing rats have been evaluated. The levels of protein, unsaturated fatty acids, carbohydrate, fibre and bioactive factors present in PhVa were comparable with those in other Phaseolus vulgaris varieties. However, the lectins of PhVa were predominantly of the leucoagglutinating type, and concentrated in the albumin protein fraction. Rats fed a diet (110 g total protein, 16.0 MJ/kg) in which PhVa meal provided about half of the protein excreted high levels of N in faeces and urine, and grew more slowly, than rats fed a high-quality control diet (ad libitum or pair-fed). Small intestine, large intestine and pancreas weights were increased (by almost 100 %, PPhVa, which were concentrated in the albumin protein fraction, whereas in many other Phaseolus vulgaris lines they are distributed across the globulin and albumin fractions.

  16. Space Efficient Data Structures for N-gram Retrieval

    Directory of Open Access Journals (Sweden)

    Fotios Kounelis

    2017-10-01

    Full Text Available A significant problem in computer science is the management of large data strings and a great number of works dealing with the specific problem has been published in the scientific literature. In this article, we use a technique to store efficiently biological sequences, making use of data structures like suffix trees and inverted files and also employing techniques like n-grams, in order to improve previous constructions. In our attempt, we drastically reduce the space needed to store the inverted indexes, by representing the substrings that appear more frequently in a more compact inverted index. Our technique is based on n-gram indexing, providing us the extra advantage of indexing sequences that cannot be separated in words. Moreover, our technique combines classical one level with two-level n-gram inverted file indexing. Our results suggest that the new proposed algorithm can compress the data more efficiently than previous attempts.

  17. Suetônio, dos gramáticos

    Directory of Open Access Journals (Sweden)

    Marcos Martinho

    2014-12-01

    Full Text Available O Dos gramáticos de Suetônio divide-se em duas partes: na primeira, o autor narra a introdução, desenvolvimento, florescimento e declínio da gramática em Roma (1-4; na segunda, expõe a biografia de vinte professores de gramática, que ensinaram na Cidade entre o início do séc.  I a.C. e meados do século seguinte (5-24. Quanto à primeira parte, procuro mostrar que Suetônio adota conceitos fisicistas ou naturalistas para narrar a história da gramática em Roma, de modo que aquela se possa comparar à vida de um ser vivo. Assim, a exposição de Suetônio revela-se, na verdade, antes biográfica que historicista. Quanto à segunda parte, procuro mostrar que o Biógrafo se interessa por gramáticos que não só escreveram sobre sua arte no ócio, mas a ensinaram por ofício, isto é, por professores de gramática. Daí, seleciono e comento os elementos narrativos relacionados à docência, a saber: os métodos de ensino, o lugar de ensino, o número e qualidade dos alunos, os preços e honorários dos professores. Por fim, apresento tradução anotada do texto de Suetônio.

  18. Glycosaminoglycans are involved in pathogen adherence to corneal epithelial cells differently for Gram-positive and Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Beatriz García

    2016-11-01

    Full Text Available The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies.

  19. Different Use of Cell Surface Glycosaminoglycans As Adherence Receptors to Corneal Cells by Gram Positive and Gram Negative Pathogens

    Science.gov (United States)

    García, Beatriz; Merayo-Lloves, Jesús; Rodríguez, David; Alcalde, Ignacio; García-Suárez, Olivia; Alfonso, José F.; Baamonde, Begoña; Fernández-Vega, Andrés; Vazquez, Fernando; Quirós, Luis M.

    2016-01-01

    The epithelium of the cornea is continuously exposed to pathogens, and adhesion to epithelial cells is regarded as an essential first step in bacterial pathogenesis. In this article, the involvement of glycosaminoglycans in the adhesion of various pathogenic bacteria to corneal epithelial cells is analyzed. All microorganisms use glycosaminoglycans as receptors, but arranged in different patterns depending on the Gram-type of the bacterium. The heparan sulfate chains of syndecans are the main receptors, though other molecular species also seem to be involved, particularly in Gram-negative bacteria. Adherence is inhibited differentially by peptides, including heparin binding sequences, indicating the participation of various groups of Gram-positive, and -negative adhesins. The length of the saccharides produces a major effect, and low molecular weight chains inhibit the binding of Gram-negative microorganisms but increase the adherence of Gram-positives. Pathogen adhesion appears to occur preferentially through sulfated domains, and is very dependent on N- and 6-O-sulfation of the glucosamine residue and, to a lesser extent, 2-O sulfation of uronic acid. These data show the differential use of corneal receptors, which could facilitate the development of new anti-infective strategies. PMID:27965938

  20. Neither Single nor a Combination of Routine Laboratory Parameters can Discriminate between Gram-positive and Gram-negative Bacteremia

    Science.gov (United States)

    Ratzinger, Franz; Dedeyan, Michel; Rammerstorfer, Matthias; Perkmann, Thomas; Burgmann, Heinz; Makristathis, Athanasios; Dorffner, Georg; Loetsch, Felix; Blacky, Alexander; Ramharter, Michael

    2015-01-01

    Adequate early empiric antibiotic therapy is pivotal for the outcome of patients with bloodstream infections. In clinical practice the use of surrogate laboratory parameters is frequently proposed to predict underlying bacterial pathogens; however there is no clear evidence for this assumption. In this study, we investigated the discriminatory capacity of predictive models consisting of routinely available laboratory parameters to predict the presence of Gram-positive or Gram-negative bacteremia. Major machine learning algorithms were screened for their capacity to maximize the area under the receiver operating characteristic curve (ROC-AUC) for discriminating between Gram-positive and Gram-negative cases. Data from 23,765 patients with clinically suspected bacteremia were screened and 1,180 bacteremic patients were included in the study. A relative predominance of Gram-negative bacteremia (54.0%), which was more pronounced in females (59.1%), was observed. The final model achieved 0.675 ROC-AUC resulting in 44.57% sensitivity and 79.75% specificity. Various parameters presented a significant difference between both genders. In gender-specific models, the discriminatory potency was slightly improved. The results of this study do not support the use of surrogate laboratory parameters for predicting classes of causative pathogens. In this patient cohort, gender-specific differences in various laboratory parameters were observed, indicating differences in the host response between genders. PMID:26522966

  1. Cellular reprogramming by gram-positive bacterial components: a review.

    LENUS (Irish Health Repository)

    Buckley, Julliette M

    2012-02-03

    LPS tolerance has been the focus of extensive scientific and clinical research over the last several decades in an attempt to elucidate the sequence of changes that occur at a molecular level in tolerized cells. Tolerance to components of gram-positive bacterial cell walls such as bacterial lipoprotein and lipoteichoic acid is a much lesser studied, although equally important, phenomenon. This review will focus on cellular reprogramming by gram-positive bacterial components and examines the alterations in cell surface receptor expression, changes in intracellular signaling, gene expression and cytokine production, and the phenomenon of cross-tolerance.

  2. Fluorescence In Situ Hybridization (FISH-Based Karyotyping Reveals Rapid Evolution of Centromeric and Subtelomeric Repeats in Common Bean (Phaseolus vulgaris and Relatives

    Directory of Open Access Journals (Sweden)

    Aiko Iwata-Otsubo

    2016-04-01

    Full Text Available Fluorescence in situ hybridization (FISH-based karyotyping is a powerful cytogenetics tool to study chromosome organization, behavior, and chromosome evolution. Here, we developed a FISH-based karyotyping system using a probe mixture comprised of centromeric and subtelomeric satellite repeats, 5S rDNA, and chromosome-specific BAC clones in common bean, which enables one to unambiguously distinguish all 11 chromosome pairs. Furthermore, we applied the karyotyping system to several wild relatives and landraces of common bean from two distinct gene pools, as well as other related Phaseolus species, to investigate repeat evolution in the genus Phaseolus. Comparison of karyotype maps within common bean indicates that chromosomal distribution of the centromeric and subtelomeric satellite repeats is stable, whereas the copy number of the repeats was variable, indicating rapid amplification/reduction of the repeats in specific genomic regions. In Phaseolus species that diverged approximately 2–4 million yr ago, copy numbers of centromeric repeats were largely reduced or diverged, and chromosomal distributions have changed, suggesting rapid evolution of centromeric repeats. We also detected variation in the distribution pattern of subtelomeric repeats in Phaseolus species. The FISH-based karyotyping system revealed that satellite repeats are actively and rapidly evolving, forming genomic features unique to individual common bean accessions and Phaseolus species.

  3. Probing interaction of Gram-positive and Gram-negative bacterial cells with ZnO nanorods

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Aanchal; Bhargava, Richa; Poddar, Pankaj, E-mail: p.poddar@ncl.res.in

    2013-04-01

    In the present work, the physiological effects of the ZnO nanorods on the Gram positive (Staphylococcus aureus and Bacillus subtilis) and Gram-negative (Escherichia coli and Aerobacter aerogenes) bacterial cells have been studied. The analysis of bacterial growth curves for various concentrations of ZnO nanorods indicates that Gram positive and Gram negative bacterial cells show inhibition at concentrations of ∼ 64 and ∼ 256 μg/mL respectively. The marked difference in susceptibility towards nanorods was also validated by spread plate and disk diffusion methods. In addition, the scanning electron micrographs show a clear damage to the cells via changed morphology of the cells from rod to coccoid etc. The confocal optical microscopy images of these cells also demonstrate the reduction in live cell count in the presence of ZnO nanorods. These, results clearly indicate that the antibacterial activity of ZnO nanorods is higher towards Gram positive bacterium than Gram negative bacterium which indicates that the structure of the cell wall might play a major role in the interaction with nanostructured materials and shows high sensitivity to the particle concentration. Highlights: ► Effect of ZnO nanorods on the growth cycles of four bacterial strains. ► A relation has been established between growth rate of bacteria and concentration. ► Serious damage in the morphology of bacterial cells in the presence of ZnO nanorods. ► Microscopic studies to see the time dependent effect on bacterial cells.

  4. Comparative activity of ceftobiprole against Gram-positive and Gram-negative isolates from Europe and the Middle East: the CLASS study.

    Science.gov (United States)

    Rossolini, Gian M; Dryden, Matthew S; Kozlov, Roman S; Quintana, Alvaro; Flamm, Robert K; Läuffer, Jörg M; Lee, Emma; Morrissey, Ian; CLASS Study Group

    2011-01-01

    to assess the in vitro activity of ceftobiprole and comparators against a recent collection of Gram-positive and Gram-negative pathogens, in order to detect potential changes in susceptibility patterns, and to evaluate the Etest assay for ceftobiprole susceptibility testing. contemporary Gram-positive and Gram-negative isolates (excluding extended-spectrum β-lactamase-producing isolates) from across Europe and the Middle East were collected, and their susceptibility to ceftobiprole, vancomycin, teicoplanin, linezolid, ceftazidime and cefepime was assessed using the Etest method. Quality testing [using Etest and broth microdilution (BMD)] was conducted at a central reference laboratory. some 5041 Gram-positive and 4026 Gram-negative isolates were included. Against Gram-positive isolates overall, ceftobiprole had the lowest MIC50 (0.5 mg/L), compared with 1 mg/L for its comparators (vancomycin, teicoplanin and linezolid). Against methicillin-resistant Staphylococcus aureus, all four agents had a similar MIC90 (2 mg/L), but ceftobiprole had a 4-fold better MIC90 (0.5 mg/L) against methicillin-susceptible strains. Only 38 Gram-positive isolates were confirmed as ceftobiprole resistant. Among Gram-negative strains, 86.9%, 91.7% and 95.2% were susceptible to ceftobiprole, ceftazidime and cefepime, respectively. Pseudomonas aeruginosa was less susceptible to all three antimicrobials than any other Gram-negative pathogen. There was generally good agreement between local Etest results and those obtained at the reference laboratory (for ceftobiprole: 86.8% with Gram-negatives; and 94.7% with Gram-positives), as well as between results obtained by BMD and Etest methods (for ceftobiprole: 98.2% with Gram-negatives; and 98.4% with Gram-positives). ceftobiprole exhibits in vitro activity against a wide range of Gram-positive and Gram-negative pathogens, including multidrug-resistant strains. No changes in its known susceptibility profile were identified.

  5. Identification and analysis of common bean (Phaseolus vulgaris L. transcriptomes by massively parallel pyrosequencing

    Directory of Open Access Journals (Sweden)

    Thimmapuram Jyothi

    2011-10-01

    Full Text Available Abstract Background Common bean (Phaseolus vulgaris is the most important food legume in the world. Although this crop is very important to both the developed and developing world as a means of dietary protein supply, resources available in common bean are limited. Global transcriptome analysis is important to better understand gene expression, genetic variation, and gene structure annotation in addition to other important features. However, the number and description of common bean sequences are very limited, which greatly inhibits genome and transcriptome research. Here we used 454 pyrosequencing to obtain a substantial transcriptome dataset for common bean. Results We obtained 1,692,972 reads with an average read length of 207 nucleotides (nt. These reads were assembled into 59,295 unigenes including 39,572 contigs and 19,723 singletons, in addition to 35,328 singletons less than 100 bp. Comparing the unigenes to common bean ESTs deposited in GenBank, we found that 53.40% or 31,664 of these unigenes had no matches to this dataset and can be considered as new common bean transcripts. Functional annotation of the unigenes carried out by Gene Ontology assignments from hits to Arabidopsis and soybean indicated coverage of a broad range of GO categories. The common bean unigenes were also compared to the bean bacterial artificial chromosome (BAC end sequences, and a total of 21% of the unigenes (12,724 including 9,199 contigs and 3,256 singletons match to the 8,823 BAC-end sequences. In addition, a large number of simple sequence repeats (SSRs and transcription factors were also identified in this study. Conclusions This work provides the first large scale identification of the common bean transcriptome derived by 454 pyrosequencing. This research has resulted in a 150% increase in the number of Phaseolus vulgaris ESTs. The dataset obtained through this analysis will provide a platform for functional genomics in common bean and related legumes and

  6. Diesel degradation and biosurfactant production by Gram-positive ...

    African Journals Online (AJOL)

    The ability of Gram-positive bacteria to degrade diesel increased in a comparable trend as its biosurfactant production increased. The E24 index was highest at 87.6% for isolate D9. Isolates D2, D9 and D10, were identified as Paenibacillus sp. whilst isolate DJLB was found to belong to Stenotrophomonas sp. This study ...

  7. A sustainable process for gram-scale synthesis of stereoselective ...

    Indian Academy of Sciences (India)

    RAJAN ABRAHAM

    2018-02-07

    Feb 7, 2018 ... for the additional structure modification.17–20. Acrylic acid derivatives ... mild conditions, and application in synthesizing bio- logically ... cal process for the gram-scale synthesis of streoselective ... ate yield of desired product 2 (58%, Table 1, entry. 2). .... Cross-Coupling and Atom-Economic Addition Reac-.

  8. Nicotinoprotein methanol dehydrogenase enzymes in Gram-positive methylotrophic bacteria

    NARCIS (Netherlands)

    Hektor, Harm J.; Kloosterman, Harm; Dijkhuizen, Lubbert

    2000-01-01

    A novel type of alcohol dehydrogenase enzyme has been characterized from Gram-positive methylotrophic (Bacillus methanolicus, the actinomycetes Amycolatopsis methanolica and Mycobacterium gastri) and non-methylotrophic bacteria (Rhodococcus strains). Its in vivo role is in oxidation of methanol and

  9. Prevalence of Gram-negative Pathogens and their antimicrobial ...

    African Journals Online (AJOL)

    The present study was conducted to find out the prevalence and spectrum of Gram negative pathogens causing bacterial meningitis and their antimicrobial susceptibility pattern in a tertiary care hospital. The cerebrospinal fluid (CSF) (3-5 ml) was collected from 638 admitted children clinically suspected of septic meningitis.

  10. Detection of Extended-Spectrum Β-Lactamases among Gram ...

    African Journals Online (AJOL)

    Biochemical tests confirmed the identity of the Gram-negative isolates to be members of the enterobactericeae, which included Klebsiella pneumoniae (60), Escherichia coli (98), Providencia Spp. (32), Morganella moganii (32), Shigella Spp. (14), Citrobacter freundii (14), Serratia marcescens (10), Salmonella paratyphi A ...

  11. Endocarditis : Effects of routine echocardiography during Gram-positive bacteraemia

    NARCIS (Netherlands)

    Vos, F J; Bleeker-Rovers, C P; Sturm, P D; Krabbe, P F M; van Dijk, A P J; Oyen, W J G; Kullberg, B J

    2011-01-01

    BACKGROUND: Despite firm recommendations to perform echocardiography in high-risk patients with Gram-positive bacteraemia, routine echocardiography is not embedded in daily practice in many settings. The aim of this study was to evaluate whether a regime including routine echocardiography results in

  12. NDM 1 Gene Carrying Gram negative Bacteria Isolated from Rats ...

    African Journals Online (AJOL)

    In this study, we screened 56 Gram negative bacteria comprising: 3 isolates of Enterobacter ludwigii, 30 Pseudomonas aeruginosa, 22 Proteus mirabilis, and 1 Aeromonas caviae isolated from oral cavity and rectum of rats captured from commercial poultry houses in Ibadan, Oyo State, Nigeria that were resistant to at least ...

  13. Sinus surgery postpones chronic gram-negative lung infection

    DEFF Research Database (Denmark)

    Alanin, M C; Aanaes, K; Høiby, N

    2016-01-01

    Background: In patients with cystic fibrosis (CF) the sinuses are a bacterial reservoir for Gram-negative bacteria (GNB). From the sinuses the GNB can repeatedly migrate to the lungs. In a one-year follow-up study, endoscopic sinus surgery (ESS) with adjuvant therapy reduced the frequency...

  14. Will new antimicrobials overcome resistance among Gram-negatives?

    Science.gov (United States)

    Bassetti, Matteo; Ginocchio, Francesca; Mikulska, Małgorzata; Taramasso, Lucia; Giacobbe, Daniele Roberto

    2011-10-01

    The spread of resistance among Gram-positive and Gram-negative bacteria represents a growing challenge for the development of new antimicrobials. The pace of antibiotic drug development has slowed during the last decade and, especially for Gram-negatives, clinicians are facing a dramatic shortage in the availability of therapeutic options to face the emergency of the resistance problem throughout the world. In this alarming scenario, although there is a shortage of compounds reaching the market in the near future, antibiotic discovery remains one of the keys to successfully stem and maybe overcome the tide of resistance. Analogs of already known compounds and new agents belonging to completely new classes of antimicrobials are in early stages of development. Novel and promising anti-Gram-negative antimicrobials belong both to old (cephalosporins, carbapenems, β-lactamase inhibitors, monobactams, aminoglycosides, polymyxin analogues and tetracycline) and completely new antibacterial classes (boron-containing antibacterial protein synthesis inhibitors, bis-indoles, outer membrane synthesis inhibitors, antibiotics targeting novel sites of the 50S ribosomal subunit and antimicrobial peptides). However, all of these compounds are still far from being introduced into clinical practice. Therefore, infection control policies and optimization in the use of already existing molecules are still the most effective approaches to reduce the spread of resistance and preserve the activity of antimicrobials.

  15. Horse gram- an underutilized nutraceutical pulse crop: a review.

    Science.gov (United States)

    Prasad, Saroj Kumar; Singh, Manoj Kumar

    2015-05-01

    Horse gram is an underutilized pulse crop grown in wide range of adverse climatic conditions. It occupies an important place in human nutrition and has rich source of protein, minerals, and vitamins. Besides nutritional importance, it has been linked to reduced risk of various diseases due to presence of non-nutritive bioactive substances. These bioactive substances such as phytic acid, phenolic acid, fiber, enzymatic/proteinase inhibitors have significant metabolic and/or physiological effects. The importance of horse gram was well recognized by the folk/alternative/traditional medicine as a potential therapeutic agent to treat kidney stones, urinary diseases, piles, common cold, throat infection, fever etc. The inception of nutraceutical concept and increasing health consciousness the demand of nutraceutical and functional food is increased. In recent years, isolation and utilization of potential antioxidants from legumes including horse gram are increased as it decreases the risk of intestinal diseases, diabetes, coronary heart disease, prevention of dental caries etc. Keeping in view the increasing demand of food having nutraceutical values, the present review ascribed with recent scientific knowledge towards the possibilities of exploring the horse gram, as a source of food and nutraceuticals compounds.

  16. Biosorption of mercury by capsulated and slime layerforming Gram ...

    African Journals Online (AJOL)

    The biosorption of mercury by two locally isolated Gram-ve bacilli: Klebsiella pneumoniae ssp. pneumonia (capsulated) and slime layer forming Pseudomonas aeruginosa, was characterized. Mercury adsorption was found to be influenced by the pH value of the biosorption solution, initial metal concentration, amount of the ...

  17. Prediction of lipoprotein signal peptides in Gram-negative bacteria

    DEFF Research Database (Denmark)

    Juncker, Agnieszka; Willenbrock, Hanni; Von Heijne, G.

    2003-01-01

    A method to predict lipoprotein signal peptides in Gram-negative Eubacteria, LipoP, has been developed. The hidden Markov model (HMM) was able to distinguish between lipoproteins (SPaseII-cleaved proteins), SPaseI-cleaved proteins, cytoplasmic proteins, and transmembrane proteins. This predictor ...

  18. Antimicrobial Photodynamic Therapy to Kill Gram-negative Bacteria

    Science.gov (United States)

    Sperandio, Felipe F; Huang, Ying-Ying; Hamblin, Michael R

    2013-01-01

    Antimicrobial photodynamic therapy (PDT) or photodynamic inactivation (PDI) is a new promising strategy to eradicate pathogenic microorganisms such as Gram-positive and Gram-negative bacteria, yeasts and fungi. The search for new approaches that can kill bacteria but do not induce the appearance of undesired drug-resistant strains suggests that PDT may have advantages over traditional antibiotic therapy. PDT is a non-thermal photochemical reaction that involves the simultaneous presence of visible light, oxygen and a dye or photosensitizer (PS). Several PS have been studied for their ability to bind to bacteria and efficiently generate reactive oxygen species (ROS) upon photostimulation. ROS are formed through type I or II mechanisms and may inactivate several classes of microbial cells including Gram-negative bacteria such as Pseudomonas aeruginosa, which are typically characterized by an impermeable outer cell membrane that contains endotoxins and blocks antibiotics, dyes, and detergents, protecting the sensitive inner membrane and cell wall. This review covers significant peer-reviewed articles together with US and World patents that were filed within the past few years and that relate to the eradication of Gram-negative bacteria via PDI or PDT. It is organized mainly according to the nature of the PS involved and includes natural or synthetic food dyes; cationic dyes such as methylene blue and toluidine blue; tetrapyrrole derivatives such as phthalocyanines, chlorins, porphyrins, chlorophyll and bacteriochlorophyll derivatives; functionalized fullerenes; nanoparticles combined with different PS; other formulations designed to target PS to bacteria; photoactive materials and surfaces; conjugates between PS and polycationic polymers or antibodies; and permeabilizing agents such as EDTA, PMNP and CaCl2. The present review also covers the different laboratory animal models normally used to treat Gram-negative bacterial infections with antimicrobial PDT. PMID

  19. Antimicrobial Activities of Leaf Extracts of Guava (Psidium guajava L.) on Two Gram-Negative and Gram-Positive Bacteria

    Science.gov (United States)

    Biswas, Bipul; Rogers, Kimberly; McLaughlin, Fredrick; Yadav, Anand

    2013-01-01

    Aim. To determine the antimicrobial potential of guava (Psidium guajava) leaf extracts against two gram-negative bacteria (Escherichia coli and Salmonella enteritidis) and two gram-positive bacteria (Staphylococcus aureus and Bacillus cereus) which are some of foodborne and spoilage bacteria. The guava leaves were extracted in four different solvents of increasing polarities (hexane, methanol, ethanol, and water). The efficacy of these extracts was tested against those bacteria through a well-diffusion method employing 50 μL leaf-extract solution per well. According to the findings of the antibacterial assay, the methanol and ethanol extracts of the guava leaves showed inhibitory activity against gram-positive bacteria, whereas the gram-negative bacteria were resistant to all the solvent extracts. The methanol extract had an antibacterial activity with mean zones of inhibition of 8.27 and 12.3 mm, and the ethanol extract had a mean zone of inhibition of 6.11 and 11.0 mm against B. cereus and S. aureus, respectively. On the basis of the present finding, guava leaf-extract might be a good candidate in the search for a natural antimicrobial agent. This study provides scientific understanding to further determine the antimicrobial values and investigate other pharmacological properties. PMID:24223039

  20. Antimicrobial Activities of Leaf Extracts of Guava (Psidium guajava L. on Two Gram-Negative and Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Bipul Biswas

    2013-01-01

    Full Text Available Aim. To determine the antimicrobial potential of guava (Psidium guajava leaf extracts against two gram-negative bacteria (Escherichia coli and Salmonella enteritidis and two gram-positive bacteria (Staphylococcus aureus and Bacillus cereus which are some of foodborne and spoilage bacteria. The guava leaves were extracted in four different solvents of increasing polarities (hexane, methanol, ethanol, and water. The efficacy of these extracts was tested against those bacteria through a well-diffusion method employing 50 μL leaf-extract solution per well. According to the findings of the antibacterial assay, the methanol and ethanol extracts of the guava leaves showed inhibitory activity against gram-positive bacteria, whereas the gram-negative bacteria were resistant to all the solvent extracts. The methanol extract had an antibacterial activity with mean zones of inhibition of 8.27 and 12.3 mm, and the ethanol extract had a mean zone of inhibition of 6.11 and 11.0 mm against B. cereus and S. aureus, respectively. On the basis of the present finding, guava leaf-extract might be a good candidate in the search for a natural antimicrobial agent. This study provides scientific understanding to further determine the antimicrobial values and investigate other pharmacological properties.

  1. Genetic control of common bean (Phaseolus vulgaris resistance to powdery mildew (Erysiphe polygoni

    Directory of Open Access Journals (Sweden)

    Rezende Viviane Ferreira

    1999-01-01

    Full Text Available Genetic control of common bean (Phaseolus vulgaris resistance to powdery mildew (Erysiphe polygoni was studied using segregating populations from the bean variety crosses Jalo x ESAL 686 and ESAL 550 x ESAL 686. F2 plants, together with the parents, were inoculated and evaluated using a scale of values from one (plant without symptoms to nine (completely infected plant. F2 plants were harvested individually, and F2:3 families were obtained. These families were evaluated in an 11 x 11 and 12 x 12 simple lattice statistical design for the Jalo x ESAL 686 and ESAL 550 x ESAL 686 crosses, respectively, using the same value scale as the F2 generation. The segregation observed in F2 plants and F2:3 families indicated that two genes are involved in genetic control, due to a double recessive epistasis. The high linear regression coefficient (b between F2 plants and their F2:3 family, 0.66 for ESAL 550 x ESAL 686 cross, and 0.71 for Jalo x ESAL 686 cross, showed that the trait is highly heritable.

  2. Interaction of cold radiofrequency plasma with seeds of beans (Phaseolus vulgaris)

    Science.gov (United States)

    Bormashenko, Edward; Shapira, Yekaterina; Grynyov, Roman; Whyman, Gene; Bormashenko, Yelena; Drori, Elyashiv

    2015-01-01

    The impact of cold radiofrequency air plasma on the wetting properties and water imbibition of beans (Phaseolus vulgaris) was studied. The influence of plasma on wetting of a cotyledon and seed coat (testa) was elucidated. It was established that cold plasma treatment leads to hydrophilization of the cotyledon and tissues constituting the testa when they are separately exposed to plasma. By contrast, when the entire bean is exposed to plasma treatment, only the external surface of the bean is hydrophilized by the cold plasma. Water imbibition by plasma-treated beans was studied. Plasma treatment markedly accelerates the water absorption. The crucial role of a micropyle in the process of water imbibition was established. It was established that the final percentage of germination was almost the same in the cases of plasma-treated, untreated, and vacuum-pumped samples. However, the speed of germination was markedly higher for the plasma-treated samples. The influence of the vacuum pumping involved in the cold plasma treatment on the germination was also clarified. PMID:25948708

  3. Polyphenol-Rich Dry Common Beans (Phaseolus vulgaris L.) and Their Health Benefits

    Science.gov (United States)

    Ganesan, Kumar

    2017-01-01

    Polyphenols are plant metabolites with potent anti-oxidant properties, which help to reduce the effects of oxidative stress-induced dreaded diseases. The evidence demonstrated that dietary polyphenols are of emerging increasing scientific interest due to their role in the prevention of degenerative diseases in humans. Possible health beneficial effects of polyphenols are based on the human consumption and their bioavailability. Common beans (Phaseolus vulgaris L.) are a greater source of polyphenolic compounds with numerous health promoting properties. Polyphenol-rich dry common beans have potential effects on human health, and possess anti-oxidant, anti-diabetic, anti-obesity, anti-inflammatory and anti-mutagenic and anti-carcinogenic properties. Based on the studies, the current comprehensive review aims to provide up-to-date information on the nutritional compositions and health-promoting effect of polyphenol-rich common beans, which help to explore their therapeutic values for future clinical studies. Investigation of common beans and their impacts on human health were obtained from various library databases and electronic searches (Science Direct PubMed, and Google Scholar). PMID:29113066

  4. Incorporation of 14CO2 by illuminated intact leaves of bean (PHASEOLUS VULGARIS) plants

    International Nuclear Information System (INIS)

    Andrade, A.G. de

    1980-01-01

    Bean plants were grown in hydroponic nutrient solution, maintained in controlled environment. Measurements of the photosynthetic activity using the method of 14 CO 2 incorporation in intact leaves with portable equipment were made on the central leaflet of the first trifoliate leaf except when the effect of leaf age was studied in which case all central leaflets of the same branch were used. The data obtained indicated differences in the photosynthetic efficiency of bean (Phaseolus vulgaris) cultivars. Relative differences in RuDP carboxylase activity in the crude extracts of leaves, leaf area and leaf chlorophyll content were also observed. Rates of 14 CO 2 incorporation at saturating light varied from 14.94 to 22.96 mg CO 2 .dm -2 .h and the 6 studied cultivars could be divided into two classes: Classe 1 (above 20 mg CO 2 .dm -2 .h): Pirata-1, Rosinha G-2, and Pintadinho Precoce; Classe 2 (below 20 mg CO 2 .dm - 2 .h): Carioca, Rosinha Precoce and Pintado. Plants of the same cultivar showed a relatively high variability and a strong dependence in relation to environmental conditions. Differences among cultivars in relation to RuDP carboxylase activity, leaf area and leaf age were correlated to photosynthetic rate. (Author) [pt

  5. CINÉTICA DE FEIJÃO PRETO (PHASEOLUS VULGARIS, L. EM SECADOR DE BANDEJA

    Directory of Open Access Journals (Sweden)

    Deyzi Santos Gouveia

    2011-03-01

    Full Text Available O presente trabalho propôs estudar a cinética de feijão preto (Phaseolus vulgaris, l. em secador de bandeja a diferentes temperaturas do ar e posterior ajuste dos dados experimentais, obtidos com os diferentes modelos matemáticos ( Fick, Page e Cavalcante Mata. O teor de umidade inicial das sementes foi determinado pelo método padrão da estufa, 105 ± 3 °C, durante 72 h, com três repetições, de acordo com as regras do Instituto Adolfo Lutz (1985. Os tratamentos de secagem foram realizados em cinco níveis de temperaturas (40, 50, 60 ,70 e 80 ºC. Para cada tratamento de secagem foram utilizados em torno de 60 g de feijão por repetição. Para este fim utilizou-se um desidratador de frutas, Polidryer PD-25. O ar foi aquecido por meio de gás de cozinha, enquanto a temperatura foi controlada com o auxílio de um termopar, conectado ao secador. Os resultados mostraram que as equações propostas por Cavalcanti Mata e Page foram as que melhor representaram os dados experimentais, quando comparada com a equação de Fick utilizando um termo da série.

  6. Plantas invasoras da cultura do feijoeiro (Phaseolus vulgaris L. no Estado de Minas Gerais

    Directory of Open Access Journals (Sweden)

    Julio Pedro Laca-Buendia

    1989-01-01

    Full Text Available Nas áreas de cultura do feijoeiro (Phaseolus vulgaris L., no Estado de Minas Gerais, foram coletadas e identificadas 222 espécies de plantas invasoras (= plantas daninhas, pertencentes a 35 famílias botânias, representando 118 gêneros, sendo que as famílias Compositae, Leguminosae, Gramineae, Malvaceae, Convolvulaceae, Rubiaceae, Euphorbiaceae, Amaranthaceae, Cyperaceae e Solanaceae, são as mais importantes em relação à cultura. As plantas coletadas, devidamente etiquetadas e identificadas, foram anexadas no PAMG (Herbário da Empresa de Pesquisa Agropecuária de Minas Gerais, Belo Horizonte - (MG..A survey in the cultivation area of bean in the state of Minas Gerais, Brazil, resulted in the determination of 222 weeds species, of 118 genera belonging to 35 families presenting a greater number of species areas: Compositae, Leguminosae, Gramineae, Malvaceae, Convolvulaceae, Rubiaceae, Euphorbiaceae, Amaranthaceae, Cyperaceae and Solanaceae, with 33, 30, 25, 21, 12, 10. 10, 10, 9. 8 species respectively.

  7. Pathogenic variability of Colletotrichum lindemuthianum and Ecuadorian Phaseolus vulgaris L. germplasm resistance

    Directory of Open Access Journals (Sweden)

    Diego Rodríguez-Ortega

    2018-01-01

    Full Text Available Anthracnose caused by Colletotrichum lindemuthianum is one of the most economically important diseases of bean (Phaseolus vulgaris L. cultivation in Ecuador. The best control alternative is the use of resistant varieties. C. lindemuthianum presents great pathogenic variability, which hinders the development of varieties with a lasting resistance, therefore, the knowledge of the presence and distribution of the physiological races of the pathogen and the identification of resistance genes are key to developing varieties with broad and lasting resistance. The objective of this research was to determine the pathogenic variability of C. lindemuthianum and to evaluate the resistance of Ecuadorian bean germplasm. The research was carried out between 2013 and 2014. Seventeen isolates of C. lindemuthianum from northern central Ecuador were characterized by the inoculation of a group of twelve standard differential bean varieties. Among the analyzed samples, thirteen races were identified; five of those races had not been previously reported in the country. The differential G2333 (Co-42, Co-52 and Co-7 presented resistance to every characterized races in Ecuador. In addition, twenty - one improved varieties and elite bean lines were evaluated with sixteen of the seventeen isolates, three genotypes were identified (TB2, TB3 and INIAP 485 Urcuquí with resistance to the mentioned isolates, which can be used as sources of resistance to Anthracnose. The identified sources of resistance in this study will allow to plan the development of bean varieties with broad and durable resistance to C. lindemuthianum.

  8. Study on mutation induced effect of gamma ray and DES on black bean phaseolus vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Le Thi Dinh; Pham Le Ha; Nguyen Van Toan; Le Xuan Tham [Nuclear Research Institute, Radiobiology Department, Dalat (Viet Nam)

    2001-03-01

    The study on mutation induced effect of gamma ray and DES on black bean Phaseolus vulgaris was carried out at Radiobiology Department, Nuclear Research Institute of Dalat. Dry seeds of variety No.1847 - Bonita - Cuba in set of 13 black bean varieties were irradiated with gamma ray from {sup 60}Co source at dose range from 150 Gy to 350 Gy and treated with DES at concentration from 0.1% to 0.3% in 2 hours for experiments in laboratory. The doses of 200, 250, 300 Gy and concentration of 0.2% DES in 2 hours were selected to treat dry seeds for experiments on the field. In populations of M{sub 1} generation, the height, number of branches and fruits per plant, number of seeds per fruit were decreased with increasing of irradiation doses. In populations of M{sub 2} generation, individual variants in leaf shape, chlorophyll, short stem, dwarf, early maturity, flowering in very short time were obtained and selected in all treatment cases. Mutation frequency at dose of 300 Gy was higher than that in other treatment cases, but ratio of sterility is also largest. The mutant lines of early maturity and short stem with flowering in very short time are promised materials for further studies. (author)

  9. Removal of some metal ions by activated carbon prepared from Phaseolus aureus hulls.

    Science.gov (United States)

    Rao, M Madhava; Ramana, D K; Seshaiah, K; Wang, M C; Chien, S W Chang

    2009-07-30

    Removal of lead [Pb(II)], zinc [Zn(II)], copper [Cu(II)], and cadmium [Cd(II)] from aqueous solutions using activated carbon prepared from Phaseolus aureus hulls (ACPAH), an agricultural waste was studied. The influence of various parameters such as effect of pH, contact time, adsorbent dose, and initial concentration of metal ions on the removal was evaluated by batch method. The removal of metal ions by ACPAH was pH dependent and the optimum pH values were 7.0, 8.0, 7.0 and 6.0 for Cu(II), Cd(II), Zn(II), and Pb(II), respectively. The sorption isotherms were studied using Langmuir, Freundlich, Dubinin-Radushkevich (D-R), and Temkin isotherm models. The maximum adsorption capacity values of ACPAH for metal ions were 21.8 mg g(-1) for Pb(II), 21.2 mg g(-1) for Zn(II), 19.5 mg g(-1) for Cu(II), and 15.7 mg g(-1) for Cd(II). The experiments demonstrated that the removal of metal ions followed the pseudo-second-order kinetic model. Desorption experiments were carried out using HCl solution with a view to regenerate the spent adsorbent and to recover the adsorbed metal ions.

  10. Removal of some metal ions by activated carbon prepared from Phaseolus aureus hulls

    International Nuclear Information System (INIS)

    Rao, M. Madhava; Ramana, D.K.; Seshaiah, K.; Wang, M.C.; Chien, S.W. Chang

    2009-01-01

    Removal of lead [Pb(II)], zinc [Zn(II)], copper [Cu(II)], and cadmium [Cd(II)] from aqueous solutions using activated carbon prepared from Phaseolus aureus hulls (ACPAH), an agricultural waste was studied. The influence of various parameters such as effect of pH, contact time, adsorbent dose, and initial concentration of metal ions on the removal was evaluated by batch method. The removal of metal ions by ACPAH was pH dependent and the optimum pH values were 7.0, 8.0, 7.0 and 6.0 for Cu(II), Cd(II), Zn(II), and Pb(II), respectively. The sorption isotherms were studied using Langmuir, Freundlich, Dubinin-Radushkevich (D-R), and Temkin isotherm models. The maximum adsorption capacity values of ACPAH for metal ions were 21.8 mg g -1 for Pb(II), 21.2 mg g -1 for Zn(II), 19.5 mg g -1 for Cu(II), and 15.7 mg g -1 for Cd(II). The experiments demonstrated that the removal of metal ions followed the pseudo-second-order kinetic model. Desorption experiments were carried out using HCl solution with a view to regenerate the spent adsorbent and to recover the adsorbed metal ions.

  11. Nitrogen cycling in a 15N-fertilized bean (Phaseolus vulgaris L.) crop

    International Nuclear Information System (INIS)

    Victoria, R.L.; Libardi, P.L.; Reichardt, K.; Cervellini, A.

    1982-01-01

    To increase our understanding of the fate of applied nitrogen in Phaseolus vulgaris crops grown under tropical conditions, 15 N-labelled urea was applied to bean crops and followed for three consecutive cropping periods. Each crop received 100 kg urea-N ha - 1 and 41 kg KCl-K ha - 1 . At the end of each period we estimated each crop's recovery of the added nitrogen, the residual effects of nitrogen from the previous cropping period, the distribution of nitrogen in the soil profile, and leaching losses of nitrogen. In addition, to evaluate potential effects of added phosphorus on nitrogen cycling in this crop, beans were treated at planting with either 35 kg rock-phosphate-P, 35 kg superphosphate-P, or 0 kg P ha - 1 . Results showed that 31.2% of the nitrogen in the first crop was derived from the applied urea, which represents a nitrogen utilization efficiency of 38.5%, 6.2% of the nitrogen in the second crop was derived from fertilizer applied to the first crop, and 1.4% of the nitrogen in the third crop. (orig./AJ)

  12. Characterisation of a haemagglutinin from Hokkaido red bean (Phaseolus vulgaris cv. Hokkaido red bean).

    Science.gov (United States)

    Wong, Jack H; Wan, Chung T; Ng, Tzi B

    2010-01-15

    A haemagglutinin was purified from Japanese Hokkaido red beans (Phaseolus vulgaris cv. Hokkaido red bean) with a procedure that included three chromatographic media. Haemagglutinating activity was adsorbed on DEAE cellulose, Affi-gel blue gel and Mono S. The pure haemagglutinin was a homodimer and each subunit was around 30 kDa in molecular mass. The haemagglutinating activity of this agglutinin could not be inhibited by a variety of simple sugars at 200 mmol L(-1) concentration including alpha-L-fucose, D(+)-galactose, D(+)-glucose, D(+)-glucosamine, D(-)galactosamine, galacturonic acid, (+)-lactose, D(+)-melibose, L(-)-mannose, D(+)-mannose, D-mannosamine, D(+)-raffinose, L-rhamnose, (+)-xylose and galacturonic acid. The haemagglutinating activity was fully retained at pH 4-11 and at 0-80 degrees C, but was completely lost at extreme pH values (0-2 and 13-14) and at very high temperatures (90 degrees C and 100 degrees C). The haemagglutinin exhibited a weak mitogenic activity toward mouse splenocytes, a stronger anti-proliferative activity than Con A toward HepG2 (human hepatoma) cells and inhibited >80% of HIV-1 reverse transcriptase inhibitory activity at 3.3 micromol L(-1). It was devoid of anti-fungal activity. Hokkaido red bean haemagglutinin possesses a potent anti-proliferative effect on HepG2 cells. Copyright (c) 2009 Society of Chemical Industry.

  13. Carbon partitioning among leaves, fruits, and seeds during development of Phaseolus vulgaris L

    International Nuclear Information System (INIS)

    Geiger, D.R.; Shieh, Wenjang; Saluke, R.M.

    1989-01-01

    Development of vegetative and floral buds was found to be a key factor in establishing the way carbon is distributed among growing leaves and fruits in Phaseolus vulgaris L. plants. Leaves emerged principally during a period 14 to 32 days after planting while flowers were produced during a 10- to 12-day period near the end of leaf emergence. Timing of anthesis established the sigmoidal time course for dry weight accumulated by the composite of all fruits on the plant. During the first 12 days following anthesis, fruit growth mainly consisted of elongation and dry weight accumulation by the pod wall. Thereafter, seed dry weight increased for about 1 week, decreased markedly for several days, and then increased again over the next 2 weeks. Accumulation of imported carbon in individual seeds, measured by steady-state labeling, confirmed the time course for dry weight accumulation observed during seed development. Seed respiration rate initially increased rapidly along with dry weight and then remained nearly steady until seed maturation. A number of developmental events described in the literature coincided with the different phases of diauxic growth. The results demonstrated the feasibility of relating current rates of carbon import in individual seeds measured with tracer 14 C to the rates of conversion of imported sucrose and use of the products for specific developmental processes. The resulting data are useful for evaluating the roles of conversion and utilization of imported sucrose in regulating import by developing seeds

  14. Weed Interference Effects on Leaves, Internode and Harvest Index of Dry Bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Hossein GHAMARI

    2015-03-01

    Full Text Available The development of appropriate weed management strategies and efficient use of herbicides relies upon understanding weed-crop interactions. A field study was carried out to assess the effect of weed interference on leaves, internode and harvest index of dry bean (Phaseolus vulgaris L.. The experiment was established under a randomized complete block design with two types of weed interference treatments: plots with weeds and plots without weeds at different time intervals (0, 10, 20, 30, 40 and 50 days after crop emergence. The sigmoid Boltzmann model was used to quantify the crop traits as influenced by weed interference. Prolonged delays in weed removal reduced gradually the number of leaves of the crop. Weed interference decreased dry weight of leaves as well, so that the lowest value of it (33.49 g plant-1 was observed in full season during weed-infested treatment. Infestation of weeds affected the length of the crop internodes. While the weed interference duration increased, the length of the internodes decreased. Harvest index was also sensitive to weed competition. As the crop was kept weed-infested from the emergence for increasing periods of time, harvest index decreased to a value of 28.01%. A significant negative correlation between total biomass of weeds and dry bean traits (number of leaves, leaves dry weight, internode length and harvest index was observed. Therefore, weeds are able to adversely affect dry bean growth through constraining environmental resources and impairing leaves as the photosynthetic areas.

  15. Attempts to induce mutants resistant or tolerant to golden mosaic virus in dry beans (Phaseolus vulgaris)

    International Nuclear Information System (INIS)

    Tulmann Neto, A.; Ando, A.; Costa, A.S.

    1977-01-01

    The golden mosaic of dry beans (Phaseolus vulgaris L.) that is present in the tropical parts of the American continent has become a major hindrance for the cultivation of this food legume of great importance to many Latin America countries. Good control measures are not known and bean germ plasm resistant or tolerant to this virus disease is not yet available. Attempts to induce bean mutants with this desirable characteristic were made using gamma radiation and chemical mutagen. Some M 2 plants from one progeny of the cultivar Carioca treated with 0.48% ethyl methane sulphonate (EMS), 6 hours of treatment at 20 0 C, showed milder symptoms than the control progenies, and at the same time they showed a tendency to recover. This mutant is being tested under field conditions and used in crosses with other bean types that show a certain degree of tolerance, aiming at adding the favourable characters of both parents. Seeds of the hybrids, as well as those of the parent types, are also being further submitted to mutagenic treatments in order to obtain still better mutants that will be satisfactory for direct or indirect control of bean golden mosaic. (author)

  16. Nutritional and water effect on fluoride uptake and respiration of bean seedlings. [Phaseolus vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Applegate, H G; Adams, D F

    1960-01-01

    Bean plants (Phaseolus vulgaris) were grown in an atmosphere containing 2.0 +/- 0.21 g F /mT (1.6 ppb). The effect of N, P, K, Fe, and Ca deficiencies and the effect of osmotic pressures of 0, 1.5, 3.0, 4.5, 6.0 and 7.5 pounds on fluoride uptake and fluoride-mediated respiration were studied. The data showed that P deficient plants took up more fluoride than plants deficient in any of the other elements studied. Fluoride-mediated respiration was phosphorous dependent, however. Plants low in Fe or K showed increased uptake of fluoride. Nitrogen had no effect on fluoride uptake under the conditions of this experiment. Plants low in Fe showed inhibition of oxygen uptake. This inhibition was accentuated by fluoride. The interactions of N, K and Ca with fluoride on respiration were complex. Neither fluoride uptake nor fluoride-mediated respiration appeared to be linked directly to the water economy of the plants. 14 references, 6 tables.

  17. Manganese toxicity effects on nodulation and nitrogen fixation of beans (Phaseolus vulgaris L. ), in acid soils

    Energy Technology Data Exchange (ETDEWEB)

    Doebereiner, J

    1966-02-01

    Three greenhouse experiments were conducted to study manganese toxicity effects on the nitrogen fixing symbiosis of beans (Phaseolus vulgaris). Addition of 40 ppm of manganese to two acid soils affected nodulation and nitrogen fixation. Dependent on the Rhizobion strain either nodule numbers or efficiency in nitrogen fixation were reduced; the efficiency of one Rhizobium-host combination was more affected than another. Under less severe conditions of manganese toxicity, reduction of nodule numbers or of efficiency in nitrogen fixation could be compensated by an increase of nodule size. In the absence of manganese toxicity nodulation and nitrogen fixation of beans were abundant in a soil with pH 4.4. Naturally occurring manganese toxicity in a gray hydromorphic soil was eliminated by liming. The total nitrogen content of bean plants which were dependent on symbiotic nitrogen fixation decreased linearly with the logarithm of the manganese concentration in the plants. This did not happen when the plants were grown with mineral nitrogen. The role of manganese toxicity in the well known sensitivity to acid soil conditions of certain legumes and the importance of selection of manganese tolerant Rhizobium strains for the inoculation of beans in acid tropical soils, are discussed. 25 references, 1 figure, 6 tables.

  18. The fate of urea applied to tropical bean (Phaseolus vulgaris, L.) crops

    International Nuclear Information System (INIS)

    Cervellini, A.; Libardi, P.L.; Victoria, R.L.; Reichardt, K.

    The fate of nitrogen is studied when it is applied to three bean (Phaseolus vulgaris, L.) crops variety 'carioca' grown on a site of 'Terra Roxa Estruturada' (Paleudalf) soil. Urea labeled with three different 15 N enrichment percentages was used in order to estimate crop recovery of N (and its utilization efficiency), residual effects of N from one crop to another, distribution of N in the soil profile after cropping and leaching losses of N. The superphosphate and the rockphosphate 'Araxa' were also used. Grain yield was not significantly different between the phosphorus treatments, indicating that both P sources behaved similarly. Differences in fertilizer 15 N enrichment did not affect calculated amounts of nitrogen derived from fertilizer and N utilization efficiency (NUE), as expected. The first crop recovered on the average 31,2% of the N from the applied urea. The second crop recovered 6,2% N from the fertilizer applied to the first crop. The third crop recovered only 1,4%. Taking in account the NUE for the three crops, they recovered 44,1% of the N applied to the first crop. The partition of nitrogen applied to the first crop in four components (crop N removal; soil mineral N (NO 3 + NH 4 ); soil organic N and leaching N) is analysed. Due to the low N utilization efficiency of the crop, much of N remains in the soil profile, being potentially available for leaching and so contributing for fertilizer pollution of ground water. (M.A.) [pt

  19. Outcomes of single organism peritonitis in peritoneal dialysis: gram negatives versus gram positives in the Network 9 Peritonitis Study.

    Science.gov (United States)

    Bunke, C M; Brier, M E; Golper, T A

    1997-08-01

    The use of the "peritonitis rate" in the management of patients undergoing peritoneal dialysis is assuming importance in comparing the prowess of facilities, care givers and new innovations. For this to be a meaningful outcome measure, the type of infection (causative pathogen) must have less clinical significance than the number of infections during a time interval. The natural history of Staphylococcus aureus, pseudomonas, and fungal peritonitis would not support that the outcome of an episode of peritonitis is independent of the causative pathogen. Could this concern be extended to other more frequently occurring pathogens? To address this, the Network 9 Peritonitis Study identified 530 episodes of single organism peritonitis caused by a gram positive organism and 136 episodes caused by a single non-pseudomonal gram negative (NPGN) pathogen. Coincidental soft tissue infections (exit site or tunnel) occurred equally in both groups. Outcomes of peritonitis were analyzed by organism classification and by presence or absence of a soft tissue infection. NPGN peritonitis was associated with significantly more frequent catheter loss, hospitalization, and technique failure and was less likely to resolve regardless of the presence or absence of a soft tissue infection. Hospitalization and death tended to occur more frequently with enterococcal peritonitis than with other gram positive peritonitis. The outcomes in the NPGN peritonitis group were significantly worse (resolution, catheter loss, hospitalization, technique failure) compared to coagulase negative staphylococcal or S. aureus peritonitis, regardless of the presence or absence of a coincidental soft tissue infection. Furthermore, for the first time, the poor outcomes of gram negative peritonitis are shown to be independent of pseudomonas or polymicrobial involvement or soft tissue infections. The gram negative organism appears to be the important factor. In addition, the outcome of peritonitis caused by S. aureus

  20. How bacterial cell division might cheat turgor pressure - a unified mechanism of septal division in Gram-positive and Gram-negative bacteria.

    Science.gov (United States)

    Erickson, Harold P

    2017-08-01

    An important question for bacterial cell division is how the invaginating septum can overcome the turgor force generated by the high osmolarity of the cytoplasm. I suggest that it may not need to. Several studies in Gram-negative bacteria have shown that the periplasm is isoosmolar with the cytoplasm. Indirect evidence suggests that this is also true for Gram-positive bacteria. In this case the invagination of the septum takes place within the uniformly high osmotic pressure environment, and does not have to fight turgor pressure. A related question is how the V-shaped constriction of Gram-negative bacteria relates to the plate-like septum of Gram-positive bacteria. I collected evidence that Gram-negative bacteria have a latent capability of forming plate-like septa, and present a model in which septal division is the basic mechanism in both Gram-positive and Gram-negative bacteria. © 2017 WILEY Periodicals, Inc.

  1. Chemical profile of beans cultivars (Phaseolus vulgaris) by 1H NMR - high resolution magic angle spinning (HR-MAS);Perfil quimico de cultivares de feijao (Phaseolus vulgaris) pela tecnica de high resolution magic angle spinning (HR-MAS)

    Energy Technology Data Exchange (ETDEWEB)

    Liao, Luciano Morais; Choze, Rafael; Cavalcante, Pedro Paulo Araujo; Santos, Suzana da Costa; Ferri, Pedro Henrique, E-mail: luciano@quimica.ufg.b [Universidade Federal de Goias (UFG), Goiania, GO (Brazil). Inst. de Quimica; Ferreira, Antonio Gilberto [Universidade Federal de Sao Carlos (UFScar), SP (Brazil). Dept. de Quimica

    2010-07-01

    The application of one-dimensional proton high-resolution magic angle spinning ({sup 1}H HR-MAS) NMR combined with a typical advantages of solid and liquid-state NMR techniques was used as input variables for the multivariate statistical analysis. In this paper, different cultivars of beans (Phaseolus vulgaris) developed and in development by EMBRAPA - Arroz e Feijao were analyzed by {sup 1}H HR-MAS, which have been demonstrated to be a valuable tool in its differentiation according chemical composition and avoid the manipulation of the samples as used in other techniques. (author)

  2. Mise au point d'une technique de culture in vitro d'embryons immatures de Phaseolus

    Directory of Open Access Journals (Sweden)

    Véronique Schmit

    1997-01-01

    Full Text Available Development of an in vitro culture technique for immature Phaseolus embryos. In the interspecific crosses Phaseolus polyanthus (or P. coccineus (i? x P. vulgaris, the hybrid embryos abort very early. Therefore, it is essentiel to develop an in vitro culture technique that allows the rescue of beau embryos at globular or early heart-shaped stages. After several trials conceming the salts composition, the sugar rate and the amino acid concentration of différent in vitro culture media, a technique has been developed for heart-shaped Phaseolus embryos. This technique consists of two stages. In a first step, embryos are cultivated under darkness until their germination on a medium containing the salts of Gamborg et al. (1968, 400 mg . 1` (5mM - 1 -' NHNO,, 1 mg . 1-' thiamine HCI, 5 mg . l` nicotinic acid, 0.5 mg - l` pyridoxine, 1,000 mg . l` -glutamine, 1,000 mg . l` casein hydrolysate, 100 mg . l` myo-inositol, 0.028 mg . P N6-benzyladenine, 30 g . l` sucrase, and 8 g -1-' DIFCO agar. After germination, the embryos are cultivated under light on a second medium that does not contain any NHNO, complément and is poorer in amino acids (100 mg • 1-' L-glutamine. Developed with six deys old heart-shaped embryos of the P. vulgaris Bico de Ouro (NI 637 variety, this technique has proved its efficiency with other P. vulgaris and P. polyanthus génotypes. It allows an average régénération rate of 30% from the total number of cultivated embryos.

  3. Pathogenic seedborne viruses are rare but Phaseolus vulgaris endornaviruses are common in bean varieties grown in Nicaragua and Tanzania.

    Directory of Open Access Journals (Sweden)

    Noora Nordenstedt

    Full Text Available Common bean (Phaseolus vulgaris is an annual grain legume that was domesticated in Mesoamerica (Central America and the Andes. It is currently grown widely also on other continents including Africa. We surveyed seedborne viruses in new common bean varieties introduced to Nicaragua (Central America and in landraces and improved varieties grown in Tanzania (eastern Africa. Bean seeds, harvested from Nicaragua and Tanzania, were grown in insect-controlled greenhouse or screenhouse, respectively, to obtain leaf material for virus testing. Equal amounts of total RNA from different samples were pooled (30-36 samples per pool, and small RNAs were deep-sequenced (Illumina. Assembly of the reads (21-24 nt to contiguous sequences and searches for homologous viral sequences in databases revealed Phaseolus vulgaris endornavirus 1 (PvEV-1 and PvEV-2 in the bean varieties in Nicaragua and Tanzania. These viruses are not known to cause symptoms in common bean and are considered non-pathogenic. The small-RNA reads from each pool of samples were mapped to the previously characterized complete PvEV-1 and PvEV-2 sequences (genome lengths ca. 14 kb and 15 kb, respectively. Coverage of the viral genomes was 87.9-99.9%, depending on the pool. Coverage per nucleotide ranged from 5 to 471, confirming virus identification. PvEV-1 and PvEV-2 are known to occur in Phaseolus spp. in Central America, but there is little previous information about their occurrence in Nicaragua, and no information about occurrence in Africa. Aside from Cowpea mild mosaic virus detected in bean plants grown from been seeds harvested from one region in Tanzania, no other pathogenic seedborne viruses were detected. The low incidence of infections caused by pathogenic viruses transmitted via bean seeds may be attributable to new, virus-resistant CB varieties released by breeding programs in Nicaragua and Tanzania.

  4. Bovine mastitis caused by gram negative bacteria in Mosul

    Directory of Open Access Journals (Sweden)

    S. Y. A. Al-Dabbagh

    2012-01-01

    Full Text Available A total of 90 milk samples were collected from cows with clinical and subclinical mastitis from different areas in Mosul city, in a period from October 2009 to June 2010, for the detection of gram negative bacteriological causative agents. The bacteria were identified using morphological, cultural and biochemical characteristics. thirty tow (35.3% gram negative bacterial isolates were obtained from the total count which included 14 isolates (15.5% for Escherichia coli, 7 isolates (7.7% for Klebsiella spp, 4 isolates (4.4% for Pseudomonas aeruginosa, 3 isolates (3.3% for Enterobacter aerogenes ,2 isolates for Serratia marcescens and one isolates (1.1% for each of Aeromonas hydrophila and Pasteurella multocida. Results of antibiotic sensitivity test indicated that most of these isolates were sensitive to Ciprofloxacin following by Gentamycin and Cotrimoxazole, while most of these organisms were resistant to Ampicillin, the isolates showed different percentages of sensitivity to Doxycycline, Tetracycline, Neomycin and Chloramphenicol.

  5. Multidrug resistance in enteric and other gram-negative bacteria.

    Science.gov (United States)

    George, A M

    1996-05-15

    In Gram-negative bacteria, multidrug resistance is a term that is used to describe mechanisms of resistance by chromosomal genes that are activated by induction or mutation caused by the stress of exposure to antibiotics in natural and clinical environments. Unlike plasmid-borne resistance genes, there is no alteration or degradation of drugs or need for genetic transfer. Exposure to a single drug leads to cross-resistance to many other structurally and functionally unrelated drugs. The only mechanism identified for multidrug resistance in bacteria is drug efflux by membrane transporters, even though many of these transporters remain to be identified. The enteric bacteria exhibit mostly complex multidrug resistance systems which are often regulated by operons or regulons. The purpose of this review is to survey molecular mechanisms of multidrug resistance in enteric and other Gram-negative bacteria, and to speculate on the origins and natural physiological functions of the genes involved.

  6. Horse gram- an underutilized nutraceutical pulse crop: a review

    OpenAIRE

    Prasad, Saroj Kumar; Singh, Manoj Kumar

    2014-01-01

    Horse gram is an underutilized pulse crop grown in wide range of adverse climatic conditions. It occupies an important place in human nutrition and has rich source of protein, minerals, and vitamins. Besides nutritional importance, it has been linked to reduced risk of various diseases due to presence of non-nutritive bioactive substances. These bioactive substances such as phytic acid, phenolic acid, fiber, enzymatic/proteinase inhibitors have significant metabolic and/or physiological effec...

  7. La Gramática Discursivo-Funcional

    NARCIS (Netherlands)

    Hengeveld, K.; Mackenzie, J.L.

    2011-01-01

    La Gramática Discursivo-Funcional (GDF) es una teoría funcional del lenguaje de inspiración tipológica que presenta una organización descendente (top-down) con el objeto de alcanzar la adecuación psicológica y que toma el Acto Discursivo como unidad básica de análisis para lograr la adecuación

  8. Papel del frijol negro Phaseolus vulgaris en el estado nutricional de la población guatemalteca

    OpenAIRE

    Serrano, José; Goñi, Isabel

    2004-01-01

    RESUMEN. En Guatemala existe un fenómeno de superposición epidemiológica, en el que coexisten problemas de salud propios de países desarrollados con otros característicos de poblaciones en vías de desarrollo. Se observan deficiencias marcadas en algunos macronutrientes tales como hierro y vitamina A. en simultaneidad con enfermedades crónicas como diabetes tipo II o enfermedades cardiovasculares. Se conoce muy bien la importancia del frijol negro (Phaseolus vulgaris) en la dieta habitual de G...

  9. Gamma radiation effects on some nutritional and physico-chemical characteristics of stored beans (Phaseolus vulgaris L.)

    International Nuclear Information System (INIS)

    Mancini Filho, J.

    1990-01-01

    The radiation effects on physico-chemical and nutritional characteristics of three Brazilian varieties of beans (Phaseolus vulgaris, L.) - Catu, Rajado and Carioca -were studied. The analytical parameters were obtained by the determination of soaking and cooking times, biological value in rats, protein electrophoretic profile, reductors sugars, oligosaccharides, fiber and fatty acids content. Also, amyloglucosidase, phytohemagglutinins, α-amylase and tryptic inhibitors activities were analysed. It was observed the gamma radiation until determined doses promotes changes on those parameters subsequently reducing substantially the cooking time without modification of the biological value of the proteins. This alteration was particularly noticed in the hard-to-cook beans. (author)

  10. Improvement of protein and amino acid contents in seeds of food legumes. A case study in Phaseolus

    Directory of Open Access Journals (Sweden)

    Baudoin J.P.

    1999-01-01

    Full Text Available Food legumes are considered as the major source of dietary proteins among the plant species. Protein and amino acid contents were evaluated in a wide sample of both wild and cultivated genotypes of Phaseolus species, with a view to investigate possibilities of genetic improvement in seed nutritional quality. Results indicate a variation in relation with taxa, biological status within species (such as in P. lunatus, ecological conditions, seed parts (testa, cotyledons and embryonic axis, and major protein groups. However, the sulphur containing amino acids remain a limiting factor, which could be better overcome by mixing food legumes with other plant species such as cereals.

  11. Correlation of protein content to flatulent galactooligosaccharides and exogenous amino acids in seeds of Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Ryszard Kosson

    2014-01-01

    Full Text Available In order to estimate the possible correlations among constituents of Phaseolus vulgaris seeds, the contents of protein, exogenous amino acids and flatulent galactooligosaccharides (raffinose and stachyose were analyzed in 16 Polish bean cultivars for dry seeds. A negative correlation coefficient (r =-0.9490 was found between protein and methionine contents. High positive correlations among exogenous amino acids, such as lysine and isoleucine, valine and isoleucine, lysine and tyrosine, were observed indicating a chance of selecting far more than one at a time. The small-seeded bean cultivars contained higher contents of protein and galactooligosaccharides than the large-seeded ones.

  12. Antimicrobial activity of metal oxide nanoparticles against Gram-positive and Gram-negative bacteria: a comparative study

    Directory of Open Access Journals (Sweden)

    Azam A

    2012-12-01

    Full Text Available Ameer Azam,1,2 Arham S Ahmed,2 Mohammad Oves,3 Mohammad S Khan,3 Sami S Habib,1 Adnan Memic11Centre of Nanotechnology, King Abdulaziz University, Jeddah, Saudi Arabia; 2Centre of Excellence in Materials Science (Nanomaterials, 3Department of Agricultural Microbiology, Aligarh Muslim University, Aligarh, IndiaBackground: Nanomaterials have unique properties compared to their bulk counterparts. For this reason, nanotechnology has attracted a great deal of attention from the scientific community. Metal oxide nanomaterials like ZnO and CuO have been used industrially for several purposes, including cosmetics, paints, plastics, and textiles. A common feature that these nanoparticles exhibit is their antimicrobial behavior against pathogenic bacteria. In this report, we demonstrate the antimicrobial activity of ZnO, CuO, and Fe2O3 nanoparticles against Gram-positive and Gram-negative bacteria.Methods and results: Nanosized particles of three metal oxides (ZnO, CuO, and Fe2O3 were synthesized by a sol–gel combustion route and characterized by X-ray diffraction, Fourier-transform infrared spectroscopy, and transmission electron microscopy techniques. X-ray diffraction results confirmed the single-phase formation of all three nanomaterials. The particle sizes were observed to be 18, 22, and 28 nm for ZnO, CuO, and Fe2O3, respectively. We used these nanomaterials to evaluate their antibacterial activity against both Gram-negative (Escherichia coli and Pseudomonas aeruginosa and Gram-positive (Staphylococcus aureus and Bacillus subtilis bacteria.Conclusion: Among the three metal oxide nanomaterials, ZnO showed greatest antimicrobial activity against both Gram-positive and Gram-negative bacteria used in this study. It was observed that ZnO nanoparticles have excellent bactericidal potential, while Fe2O3 nanoparticles exhibited the least bactericidal activity. The order of antibacterial activity was demonstrated to be the following: ZnO > CuO > Fe2O3

  13. Selenoproteins in Archaea and Gram-positive bacteria.

    Science.gov (United States)

    Stock, Tilmann; Rother, Michael

    2009-11-01

    Selenium is an essential trace element for many organisms by serving important catalytic roles in the form of the 21st co-translationally inserted amino acid selenocysteine. It is mostly found in redox-active proteins in members of all three domains of life and analysis of the ever-increasing number of genome sequences has facilitated identification of the encoded selenoproteins. Available data from biochemical, sequence, and structure analyses indicate that Gram-positive bacteria synthesize and incorporate selenocysteine via the same pathway as enterobacteria. However, recent in vivo studies indicate that selenocysteine-decoding is much less stringent in Gram-positive bacteria than in Escherichia coli. For years, knowledge about the pathway of selenocysteine synthesis in Archaea and Eukarya was only fragmentary, but genetic and biochemical studies guided by analysis of genome sequences of Sec-encoding archaea has not only led to the characterization of the pathways but has also shown that they are principally identical. This review summarizes current knowledge about the metabolic pathways of Archaea and Gram-positive bacteria where selenium is involved, about the known selenoproteins, and about the respective pathways employed in selenoprotein synthesis.

  14. RNases and Helicases in Gram-Positive Bacteria.

    Science.gov (United States)

    Durand, Sylvain; Condon, Ciaran

    2018-04-01

    RNases are key enzymes involved in RNA maturation and degradation. Although they play a crucial role in all domains of life, bacteria, archaea, and eukaryotes have evolved with their own sets of RNases and proteins modulating their activities. In bacteria, these enzymes allow modulation of gene expression to adapt to rapidly changing environments. Today, >20 RNases have been identified in both Escherichia coli and Bacillus subtilis , the paradigms of the Gram-negative and Gram-positive bacteria, respectively. However, only a handful of these enzymes are common to these two organisms and some of them are essential to only one. Moreover, although sets of RNases can be very similar in closely related bacteria such as the Firmicutes Staphylococcus aureus and B. subtilis , the relative importance of individual enzymes in posttranscriptional regulation in these organisms varies. In this review, we detail the role of the main RNases involved in RNA maturation and degradation in Gram-positive bacteria, with an emphasis on the roles of RNase J1, RNase III, and RNase Y. We also discuss how other proteins such as helicases can modulate the RNA-degradation activities of these enzymes.

  15. Combating multidrug-resistant Gram-negative bacterial infections.

    Science.gov (United States)

    Xu, Ze-Qi; Flavin, Michael T; Flavin, John

    2014-02-01

    Multidrug-resistant (MDR) bacterial infections, especially those caused by Gram-negative pathogens, have emerged as one of the world's greatest health threats. The development of novel antibiotics to treat MDR Gram-negative bacteria has, however, stagnated over the last half century. This review provides an overview of recent R&D activities in the search for novel antibiotics against MDR Gram-negatives. It provides emphasis in three key areas. First, the article looks at new analogs of existing antibiotic molecules such as β-lactams, tetracyclines, and aminoglycoside as well as agents against novel bacterial targets such as aminoacyl-tRNA synthetase and peptide deformylase. Second, it also examines alternative strategies to conventional approaches including cationic antimicrobial peptides, siderophores, efflux pump inhibitors, therapeutic antibodies, and renewed interest in abandoned treatments or those with limited indications. Third, the authors aim to provide an update on the current clinical development status for each drug candidate. The traditional analog approach is insufficient to meet the formidable challenge brought forth by MDR superbugs. With the disappointing results of the genomics approach for delivering novel targets and drug candidates, alternative strategies to permeate the bacterial cell membrane, enhance influx, disrupt efflux, and target specific pathogens via therapeutic antibodies are attractive and promising. Coupled with incentivized business models, governmental policies, and a clarified regulatory pathway, it is hoped that the antibiotic pipeline will be filled with an effective armamentarium to safeguard global health.

  16. Keywords in Context (Using n-grams with Python

    Directory of Open Access Journals (Sweden)

    William J. Turkel

    2012-07-01

    Full Text Available Like in Output Data as HTML File, this lesson takes the frequency pairs collected in Counting Frequencies and outputs them in HTML. This time the focus is on keywords in context (KWIC which creates n-grams from the original document content – in this case a trial transcript from the Old Bailey Online. You can use your program to select a keyword and the computer will output all instances of that keyword, along with the words to the left and right of it, making it easy to see at a glance how the keyword is used. Once the KWICs have been created, they are then wrapped in HTML and sent to the browser where they can be viewed. This reinforces what was learned in Output Data as HTML File, opting for a slightly different output. At the end of this lesson, you will be able to extract all possible n-grams from the text. In the next lesson, you will be learn how to output all of the n-grams of a given keyword in a document downloaded from the Internet, and display them clearly in your browser window.

  17. Microbiology of liver abscesses and the predictive value of abscess gram stain and associated blood cultures.

    Science.gov (United States)

    Chemaly, Roy F; Hall, Gerri S; Keys, Thomas F; Procop, Gary W

    2003-08-01

    Although rare, pyogenic liver abscesses are potentially fatal. We evaluated the predictive value of Gram stain of liver abscess aspirates and temporally associated blood cultures. Gram stains detected bacteria in 79% of the liver abscesses tested. The sensitivity and specificity of Gram stain of the liver abscesses were 90% and 100% for Gram-positive cocci (GPC) and 52% and 94% for Gram-negative bacilli (GNB). The sensitivities of the blood cultures for any GPC and GNB present in the liver abscess were 30% and 39%, respectively. Although, Gram stains and blood cultures offer incomplete detection of the microbial contents of pyogenic liver abscesses, both tests should always accompany liver abscess cultures.

  18. Adaptação do feijoeiro comum (Phaseolus vulgaris L. à seca Common bean (Phaseolus vulgaris L. adaptation to drought

    Directory of Open Access Journals (Sweden)

    Cleber M. Guimarães

    2006-03-01

    Full Text Available Realizou-se este trabalho tendo em vista o propósito de se estudar a adaptação de genótipos de feijoeiro comum (Phaseolus vulgaris L. à seca, como suporte a programas de melhoramento que visem à criação de cultivares para regiões sujeitas a deficiência hídrica, mediante a avaliação do potencial da água nas folhas e da resistência difusiva estomática. Adicionalmente avaliou-se a técnica de medição da temperatura do dossel pela termometria de infravermelho para inferir o estado hídrico da planta. Os genótipos Carioca e RAB 96 foram submetidos, dos 20 dias após a emergência até a colheita, a dois tratamentos hídricos: irrigação adequada e com deficiência hídrica. Em geral, a cultivar Carioca manteve potenciais de água na folha mais altos e também melhor capacidade de recuperação hídrica, além de apresentar resistência difusiva estomática e temperatura do dossel mais baixas que a linhagem RAB 96 sendo, portanto, melhor adaptada à seca. A temperatura do dossel correlacionou-se significativamente com o potencial da água nas folhas e, devido a sua medição ser rápida e não-destrutiva, mostrou tratar-se de uma técnica útil no processo de seleção de genótipos para regiões sujeitas a deficiência hídrica.The objective of this study was to investigate the common bean adaptation to drought, as support to breeding programs directed to regions with water deficiency, through the evaluation of leaf water potential and stomatal diffusive resistance. Furthermore, the canopy temperature was evaluated with the infrared thermometer technique to infer the plant water content. From twenty days after emergence until harvest, the genotypes Carioca and RAB 96 were submitted to two water treatments: adequate irrigation and water deficit. The 'Carioca' showed higher leaf water potentials and better water recovery capacity compared with 'RAB 96'. This cultivar also showed lower stomatal diffusive resistance and canopy

  19. Amplifiable DNA from Gram-negative and Gram-positive bacteria by a low strength pulsed electric field method

    Science.gov (United States)

    Vitzthum, Frank; Geiger, Georg; Bisswanger, Hans; Elkine, Bentsian; Brunner, Herwig; Bernhagen, Jürgen

    2000-01-01

    An efficient electric field-based procedure for cell disruption and DNA isolation is described. Isoosmotic suspensions of Gram-negative and Gram-positive bacteria were treated with pulsed electric fields of Pulses had an exponential decay waveform with a time constant of 3.4 µs. DNA yield was linearly dependent on time or pulse number, with several thousand pulses needed. Electrochemical side-effects and electrophoresis were minimal. The lysates contained non-fragmented DNA which was readily amplifiable by PCR. As the method was not limited to samples of high specific resistance, it should be applicable to physiological fluids and be useful for genomic and DNA diagnostic applications. PMID:10734214

  20. Gram-negative diabetic foot osteomyelitis: risk factors and clinical presentation.

    Science.gov (United States)

    Aragón-Sánchez, Javier; Lipsky, Benjamin A; Lázaro-Martínez, Jose L

    2013-03-01

    Osteomyelitis frequently complicates infections in the feet of patients with diabetes. Gram-positive cocci, especially Staphylococcus aureus, are the most commonly isolated pathogens, but gram-negative bacteria also cause some cases of diabetic foot osteomyelitis (DFO). These gram-negatives require different antibiotic regimens than those commonly directed at gram-positives. There are, however, few data on factors related to their presence and how they influence the clinical picture. We conducted a retrospective study to determine the variables associated with the isolation of gram-negative bacteria from bone samples in cases of DFO and the clinical presentation of these infections. Among 341 cases of DFO, 150 had a gram-negative isolate (alone or combined with a gram-positive isolate) comprising 44.0% of all patients and 50.8% of those with a positive bone culture. Compared with gram-positive infections, wounds with gram-negative organisms more often had a fetid odor, necrotic tissue, signs of soft tissue infection accompanying osteomyelitis, and clinically severe infection. By multivariate analysis, the predictive variables related to an increased likelihood of isolating gram-negatives from bone samples were glycated hemoglobin gram-negatives had a statistically significantly higher prevalence of leukocytosis and higher white blood cell counts than those without gram-negatives. In conclusion, gram-negative organisms were isolated in nearly half of our cases of DFO and were associated with more severe infections, higher white blood cell counts, lower glycated hemoglobin levels, and wounds of traumatic etiology.

  1. Organo-Selenium Coatings Inhibit Gram-Negative and Gram-Positive Bacterial Attachment to Ophthalmic Scleral Buckle Material.

    Science.gov (United States)

    Tran, Phat; Arnett, Avery; Jarvis, Courtney; Mosley, Thomas; Tran, Khien; Hanes, Rob; Webster, Dan; Mitchell, Kelly; Dominguez, Leo; Hamood, Abdul; Reid, Ted W

    2017-09-01

    Biofilm formation is a problem for solid and sponge-type scleral buckles. This can lead to complications that require removal of the buckle, and result in vision loss due to related ocular morbidity, primarily infection, or recurrent retinal detachment. We investigate the ability of a covalent organo-selenium coating to inhibit biofilm formation on a scleral buckle. Sponge and solid Labtican brand scleral buckles were coated with organo-selenium coupled to a silyation reagent. Staphylococcus aureus biofilm formation was monitored by a standard colony-forming unit assay and the confocal laser scanning microscopy, while Pseudomonas aeruginosa biofilm formation was examined by scanning electron microscopy. Stability studies were done, by soaking in phosphate buffer saline (PBS) at room temperature for 2 months. Toxicity against human corneal epithelial cell was examined by growing the cells in the presence of organo-selenium-coated scleral buckles. The organo-selenium coating inhibited biofilm formation by gram-negative and gram-positive bacteria. The buckle coatings also were shown to be fully active after soaking in PBS for 2 months. The organo-selenium coatings had no effect on the viability of human corneal epithelial cells. Organo-selenium can be used to covalently coat a scleral buckle, which is stable and inhibits biofilm formation for gram-negative and gram-positive bacteria. The organo-selenium buckle coating was stable and nontoxic to cell culture. This technology provides a means to inhibit bacterial attachment to devices attached to the eye, without damage to ocular cells.

  2. A Synthetic Dual Drug Sideromycin Induces Gram-Negative Bacteria To Commit Suicide with a Gram-Positive Antibiotic.

    Science.gov (United States)

    Liu, Rui; Miller, Patricia A; Vakulenko, Sergei B; Stewart, Nichole K; Boggess, William C; Miller, Marvin J

    2018-05-10

    Many antibiotics lack activity against Gram-negative bacteria because they cannot permeate the outer membrane or suffer from efflux and, in the case of β-lactams, are degraded by β-lactamases. Herein, we describe the synthesis and studies of a dual drug conjugate (1) of a siderophore linked to a cephalosporin with an attached oxazolidinone. The cephalosporin component of 1 is rapidly hydrolyzed by purified ADC-1 β-lactamase to release the oxazolidinone. Conjugate 1 is active against clinical isolates of Acinetobacter baumannii as well as strains producing large amounts of ADC-1 β-lactamase. Overall, the results are consistent with siderophore-mediated active uptake, inherent activity of the delivered dual drug, and in the presence of β-lactamases, intracellular release of the oxazolidinone upon cleavage of the cephalosporin to allow the freed oxazolidinone to inactivate its target. The ultimate result demonstrates that Gram-positive oxazolidinone antibiotics can be made to be effective against Gram-negative bacteria by β-lactamase triggered release.

  3. KARAKTERISASI ENAM VARIETAS BUNCIS (Phaseolus vulgaris L. BERDASARKAN PANDUAN PENGUJIAN INDIVIDUAL

    Directory of Open Access Journals (Sweden)

    Vina Eka Aristya

    2016-02-01

    Full Text Available Beans (Phaseolus vulgaris L. is a plant that has the potential for mainstream consumers, have a large enough market opportunity and a source of vegetable protein. “Perancis” varieties are local Central Java bean varieties are widely grown in the Bandungan area. “Perancis” varieties not currently provide enough characters clear and complete. Test objectives were (1 to characterize the “Perancis” varieties in order to have a complete character information varieties and (2 to determine distinctness, uniformity and stability of the “Perancis” varieties compared with varieties Gypsie, Spectacular, Balitsa 1, Balitsa 2 and PV 072 using guidelines for the conduct of test for distinctness, uniformity and stability reference beans. Implemented on the Garden Seed Testing Bandungan Horticulture, Central Java with an altitude of 560-800 meters above sea level the place. Materials testing consists of six varieties of beans are “Perancis” varieties and the varieties used for comparison Gypsie, Spectacular, Balitsa 1, Balitsa 2 and PV 072. This research used a randomized block design six varieties of beans are planted side by side on three experimental plots as replications. Parameters observed include 49 characters corresponding guidelines bean plants are divided into the plant character, leaves character, flower character, pods character and seed character. Test results based guidelines, “Perancis” varieties showed eight unique characters compared to varieties of Gypsie, Spectacular, Balitsa 1, Balitsa 2 and PV 072 ie. plant height, leaf color, leaf rugosity, long (including beak pods, the degree of the pods curvature, the shape of distal part (excluding beak pods, length of beak pods and curvature of beak pods and “Perancis” varieties have uniformity and stability.

  4. Genome-Wide Association Study of Anthracnose Resistance in Andean Beans (Phaseolus vulgaris.

    Directory of Open Access Journals (Sweden)

    Grady H Zuiderveen

    Full Text Available Anthracnose is a seed-borne disease of common bean (Phaseolus vulgaris L. caused by the fungus Colletotrichum lindemuthianum, and the pathogen is cosmopolitan in distribution. The objectives of this study were to identify new sources of anthracnose resistance in a diverse panel of 230 Andean beans comprised of multiple seed types and market classes from the Americas, Africa, and Europe, and explore the genetic basis of this resistance using genome-wide association mapping analysis (GWAS. Twenty-eight of the 230 lines tested were resistant to six out of the eight races screened, but only one cultivar Uyole98 was resistant to all eight races (7, 39, 55, 65, 73, 109, 2047, and 3481 included in the study. Outputs from the GWAS indicated major quantitative trait loci (QTL for resistance on chromosomes, Pv01, Pv02, and Pv04 and two minor QTL on Pv10 and Pv11. Candidate genes associated with the significant SNPs were detected on all five chromosomes. An independent QTL study was conducted to confirm the physical location of the Co-1 locus identified on Pv01 in an F4:6 recombinant inbred line (RIL population. Resistance was determined to be conditioned by the single dominant gene Co-1 that mapped between 50.16 and 50.30 Mb on Pv01, and an InDel marker (NDSU_IND_1_50.2219 tightly linked to the gene was developed. The information reported will provide breeders with new and diverse sources of resistance and genomic regions to target in the development of anthracnose resistance in Andean beans.

  5. Effects of putrescine, kinetin and IAA on protein synthesis in 'Phaseolus vulgaris' coleoptiles

    Energy Technology Data Exchange (ETDEWEB)

    Crocomo, O J; Lee, T S.G. [Centro de Energia Nuclear na Agricultura, Piracicaba (Brazil)

    1975-01-01

    Incubation of etiolated 'Phaseolus vulgaris' coleoptiles shows a converse flux between soluble protein and reducing sugar. The rate of incorporation of radioactive arginine into protein was higher than that of radioactive leucine. Radioactive arginine incorporation into protein was linear up to 120 min and then started to decline. The rate of incorporation of radioactive leucine was increased by preincubation of the tissue in the incubation medium. Roots were found to contain more soluble protein and much less reducing sugar than the coleoptile. The optimum pH value for protein synthesis in coleoptile sections was found to be 6 for control tissues and 4 for those treated with 10-/sup 3/M IAA. This high concentration of IAA was also found to inhibit soluble protein synthesis, the incorporation rate of radioactive arginine and leucine into protein fraction, the secretion of hydrogen ion into the incubation medium and elongation of the bean segment. Kinetin at 2x10/sup -4/M and putrescine at 5mM both decreased the rate of /sup 14/C-arginine incorporation into soluble protein, but for /sup 14/C-leucine, this rate of incorporation was found to be increased after 90 min incubation with a preincubation of 30 min. In general, the change pattern of the soluble protein content, the reducing sugar level and the incorporation rate of radioactive arginine and leucine into protein in the kinetin and putrescine treated tissues were about the same although tissues that incubated with kinetin always contain more soluble protein and less reducing sugar than that of incubated with putrescine.

  6. Physical, biochemical and physiological effects of ultraviolet radiation on Brassica napus and Phaseolus vulgaris

    International Nuclear Information System (INIS)

    Cen Yan-Ping.

    1993-01-01

    In order to follow some of the changes induced by ultraviolet-B (UV-B, 280-320 nm) radiation in Phaseolus vulgaris and Brassica napus, experiments were designed to localize sites of changes in leaves and to correlate some of the physiological and biochemical changes with penetration of UV-B radiation. B.napus was exposed to 8.9 kJ m -2 day -1 biologically effective UV-B radiation (UV-B BE ). The penetration of UV-B radiation into the leaf was followed using a quartz fibre optic microprobe. Monochromatic radiation at 310 nm was decreased by ca 50 and 34% in the adaxial and abaxial epidermis, respectively, in plants not exposed to UV-B, whereas the radiation was decreased by ca 70 and 42%, respectively, in the same region in UV-treated plants. Polychromatic radiation showed a wavelength dependent change mainly for the collimated radiation. The results correlated with the distribution of phenolic compounds analysed from 40 μm paradermal leaf sections. The first adaxial section (40μm) contained 35% of the whole leaf sample flavonoid glycosides in control plants, and 66% in UV-treated plants. Hydroxycinnamic acid derivatives increased by 26% in UV-treated plants relative to controls. The ratio of quercetin to kaempferol derivatives increased from 0.11 in controls to 0.91 in leaves of UV-treated plants. The leaf epidermis protected the inner leaf tissue where most of the photosynthetic apparatus is located. P. vulgaris was subjected to 6.17 kJ m -2 day -1 UV-B BE with different levels of visible light. The largest UV-induced changes in photosynthesis, chlorophyll, carotenoids, UV-screening pigments, and surface leaf reflectance occurred under growth conditions of low levels of visible light together with UV radiation

  7. Genotipos de frijol (Phaseolus Vulgaris l. resistentes a Xanthomonas campestris pv. phaseoli de Mexico

    Directory of Open Access Journals (Sweden)

    Rosa Navarrete

    2000-01-01

    Full Text Available Genotipos de frijol (Phaseolus vulgaris L. resistentes a Xanthomonas campestris pv. phaseoli de México. Durante 1995 se evaluó la reacción de genotipos de frijol de diversos origenes a Xcp, bajo condiciones de invernadero en el Campo Experimental del Valle de México, del INIFAP. Se realizaron tres experimentos con a120, b44 y csiete genotipos de frijol. Las plantas se inocularon por corte con navajas en la etapa V3, a y b con una mezcla de nueve cepas de Xcp y el c, con cada una de siete cepas con diferente grado de patogenicidad. La severidad se evaluó 20 días después de la inoculación, por comparación con una escala visual de nueve grados. Los datos se analizaron bajo un diseño completamente al azar. En a, los genotipos que mostraron reacción de resistencia a Xcp fueron: A 36, A 475, G 5686, G 11867, Harowood, SEA 14, XAN 266, MCD 4012 y REN 27. En b los genotipos resistentes fueron: Sequía Durango, Taylor y XAN 30. En los experimentos anteriores la severidad de la enfermedad mostró una distribución normal, con el máximo número de genotipos en el grado de severidad cinco en a y seis en b. Los resultados obtenidos indican que el uso de mezclas de cepas de bacterias con diferente patogenicidad es eficiente para identificar genotipos de frijol resistentes a Xcp. Los genotipos resistentes identificados en el último experimento, mostraron respuesta diferencial e interacciones genotipo por cepa. REN 27 y SEA 14 mostraron resistencia a las cepas utilizadas

  8. Transcriptome analysis of salt tolerant common bean (Phaseolus vulgaris L. under saline conditions.

    Directory of Open Access Journals (Sweden)

    Mahmut Can Hiz

    Full Text Available Salinity is one of the important abiotic stress factors that limit crop production. Common bean, Phaseolus vulgaris L., a major protein source in developing countries, is highly affected by soil salinity and the information on genes that play a role in salt tolerance is scarce. We aimed to identify differentially expressed genes (DEGs and related pathways by comprehensive analysis of transcriptomes of both root and leaf tissues of the tolerant genotype grown under saline and control conditions in hydroponic system. We have generated a total of 158 million high-quality reads which were assembled into 83,774 all-unigenes with a mean length of 813 bp and N50 of 1,449 bp. Among the all-unigenes, 58,171 were assigned with Nr annotations after homology analyses. It was revealed that 6,422 and 4,555 all-unigenes were differentially expressed upon salt stress in leaf and root tissues respectively. Validation of the RNA-seq quantifications (RPKM values was performed by qRT-PCR (Quantitative Reverse Transcription PCR analyses. Enrichment analyses of DEGs based on GO and KEGG databases have shown that both leaf and root tissues regulate energy metabolism, transmembrane transport activity, and secondary metabolites to cope with salinity. A total of 2,678 putative common bean transcription factors were identified and classified under 59 transcription factor families; among them 441 were salt responsive. The data generated in this study will help in understanding the fundamentals of salt tolerance in common bean and will provide resources for functional genomic studies.

  9. Transcriptome Analysis of Paraburkholderia phymatum under Nitrogen Starvation and during Symbiosis with Phaseolus Vulgaris

    Directory of Open Access Journals (Sweden)

    Martina Lardi

    2017-12-01

    Full Text Available Paraburkholderia phymatum belongs to the β-subclass of proteobacteria. It has recently been shown to be able to nodulate and fix nitrogen in symbiosis with several mimosoid and papilionoid legumes. In contrast to the symbiosis of legumes with α-proteobacteria, very little is known about the molecular determinants underlying the successful establishment of this mutualistic relationship with β-proteobacteria. In this study, we performed an RNA-sequencing (RNA-seq analysis of free-living P. phymatum growing under nitrogen-replete and -limited conditions, the latter partially mimicking the situation in nitrogen-deprived soils. Among the genes upregulated under nitrogen limitation, we found genes involved in exopolysaccharides production and in motility, two traits relevant for plant root infection. Next, RNA-seq data of P. phymatum grown under free-living conditions and from symbiotic root nodules of Phaseolus vulgaris (common bean were generated and compared. Among the genes highly upregulated during symbiosis, we identified—besides the nif gene cluster—an operon encoding a potential cytochrome o ubiquinol oxidase (Bphy_3646-49. Bean root nodules induced by a cyoB mutant strain showed reduced nitrogenase and nitrogen fixation abilities, suggesting an important role of the cytochrome for respiration inside the nodule. The analysis of mutant strains for the RNA polymerase transcription factor RpoN (σ54 and its activator NifA indicated that—similar to the situation in α-rhizobia—P. phymatum RpoN and NifA are key regulators during symbiosis with P. vulgaris.

  10. Impact of management strategies in the basal rot, charcoal rots epidemiology and Phaseolus vulgaris L. yield.

    Directory of Open Access Journals (Sweden)

    Ulacio Osorio Dilcia

    2013-02-01

    Full Text Available The effect of chemical, physical, biologycal and cultural strategies individually or combinated were evaluated in the epidemiology of the basal rot (Sclerotium rolfsii, charcoal rot (Macrophomina phaseolina and the Phaseolus vulgaris cv Tacarigua yield at Barinas state from Venezuela. In the experiment, Tebuconazole (Teb was applicated at seed (1 L/Ton and at soil, a los 30 y 60 days after of the sow (1 L/ha; Trichoderma harzianum (Tri was applicated at seed (15 g for each 1.5 k and to 15, 30, 45 y 60 days after of the sow (30 g/10 L of water. On the other hand, soil was solarizated (Sol during 15 days and calcium nitrate (Ca (60 g/10 L of water was applicated each 15 days until 60 days of growth of cultivated plants. Basal rot was registered as far as 42 days after of the sow, showing less of 5.3% in Teb y the combination SolTeb. The hightest incidence of this disease was observed in the treatment Tri with 28.5%, being highter that control (14.5%. Last to 42 days predominated the charcoal rot in the rest of the plants for a total of 100% of incidente in everything the treatments. Nevertheless, Teb showed the hightest yield with 555 k/ha, being different estatistically at treatment TriCa, which showed the lowest yield with 31 k/ha, however, the roots not formed nodules nitrogen uptake in these replications with the fungicide and Ca. It is concluded that S. rolfsii was sensible at action of some of the treatments; but not M. phaseolina; nevertheless, the plants were capables to produce seeds health apparently in treatments in which observed less severity of charcoal rot.

  11. Anatomical alterations of Phaseolus vulgaris L. mature leaves irradiated with X-rays.

    Science.gov (United States)

    De Micco, V; Arena, C; Aronne, G

    2014-01-01

    The cultivation of higher plants in Space involves not only the development of new agro-technologies for the design of ecologically closed Space greenhouses, but also understanding of the effects of Space factors on biological systems. Among Space factors, ionising radiation is one of the main constraints to the growth of organisms. In this paper, we analyse the effect of low-LET radiation on leaf histology and cytology in Phaseolus vulgaris L. plants subjected to increasing doses of X-rays (0.3, 10, 50, 100 Gy). Leaves irradiated at tissue maturity were compared with not-irradiated controls. Semi-thin sections of leaves were analysed through light and epi-fluorescence microscopy. Digital image analysis was applied to quantify anatomical parameters, with a specific focus on the occurrence of signs of structural damage as well as alterations at subcellular level, such as the accumulation of phenolic compounds and chloroplast size. Results showed that even at high levels of radiation, general anatomical structure was not severely perturbed. Slight changes in mesophyll density and cell enlargement were detected at the highest level of radiation. However, at 100 Gy, higher levels of phenolic compounds accumulated along chloroplast membranes: this accompanied an increase in number of chloroplasts. The reduced content of chlorophylls at high levels of radiation was associated with reduced size of the chloroplasts. All data are discussed in terms of the possible role of cellular modifications in the maintenance of high radioresistance and photosynthetic efficiency. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  12. Genome-Wide Association Study of Anthracnose Resistance in Andean Beans (Phaseolus vulgaris).

    Science.gov (United States)

    Zuiderveen, Grady H; Padder, Bilal A; Kamfwa, Kelvin; Song, Qijian; Kelly, James D

    2016-01-01

    Anthracnose is a seed-borne disease of common bean (Phaseolus vulgaris L.) caused by the fungus Colletotrichum lindemuthianum, and the pathogen is cosmopolitan in distribution. The objectives of this study were to identify new sources of anthracnose resistance in a diverse panel of 230 Andean beans comprised of multiple seed types and market classes from the Americas, Africa, and Europe, and explore the genetic basis of this resistance using genome-wide association mapping analysis (GWAS). Twenty-eight of the 230 lines tested were resistant to six out of the eight races screened, but only one cultivar Uyole98 was resistant to all eight races (7, 39, 55, 65, 73, 109, 2047, and 3481) included in the study. Outputs from the GWAS indicated major quantitative trait loci (QTL) for resistance on chromosomes, Pv01, Pv02, and Pv04 and two minor QTL on Pv10 and Pv11. Candidate genes associated with the significant SNPs were detected on all five chromosomes. An independent QTL study was conducted to confirm the physical location of the Co-1 locus identified on Pv01 in an F4:6 recombinant inbred line (RIL) population. Resistance was determined to be conditioned by the single dominant gene Co-1 that mapped between 50.16 and 50.30 Mb on Pv01, and an InDel marker (NDSU_IND_1_50.2219) tightly linked to the gene was developed. The information reported will provide breeders with new and diverse sources of resistance and genomic regions to target in the development of anthracnose resistance in Andean beans.

  13. Physical, biochemical and physiological effects of ultraviolet radiation on Brassica napus and Phaseolus vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Cen Yan-Ping

    1993-12-31

    In order to follow some of the changes induced by ultraviolet-B (UV-B, 280-320 nm) radiation in Phaseolus vulgaris and Brassica napus, experiments were designed to localize sites of changes in leaves and to correlate some of the physiological and biochemical changes with penetration of UV-B radiation. B.napus was exposed to 8.9 kJ m{sup -2} day{sup -1} biologically effective UV-B radiation (UV-B{sub BE}). The penetration of UV-B radiation into the leaf was followed using a quartz fibre optic microprobe. Monochromatic radiation at 310 nm was decreased by ca 50 and 34% in the adaxial and abaxial epidermis, respectively, in plants not exposed to UV-B, whereas the radiation was decreased by ca 70 and 42%, respectively, in the same region in UV-treated plants. Polychromatic radiation showed a wavelength dependent change mainly for the collimated radiation. The results correlated with the distribution of phenolic compounds analysed from 40 {mu}m paradermal leaf sections. The first adaxial section (40{mu}m) contained 35% of the whole leaf sample flavonoid glycosides in control plants, and 66% in UV-treated plants. Hydroxycinnamic acid derivatives increased by 26% in UV-treated plants relative to controls. The ratio of quercetin to kaempferol derivatives increased from 0.11 in controls to 0.91 in leaves of UV-treated plants. The leaf epidermis protected the inner leaf tissue where most of the photosynthetic apparatus is located. P. vulgaris was subjected to 6.17 kJ m{sup -2} day{sup -1} UV-B{sub BE} with different levels of visible light. The largest UV-induced changes in photosynthesis, chlorophyll, carotenoids, UV-screening pigments, and surface leaf reflectance occurred under growth conditions of low levels of visible light together with UV radiation.

  14. Mechanistic insight into softening of Canadian wonder common beans (Phaseolus vulgaris) during cooking.

    Science.gov (United States)

    Chigwedere, Claire Maria; Olaoye, Taye Foyeke; Kyomugasho, Clare; Jamsazzadeh Kermani, Zahra; Pallares Pallares, Andrea; Van Loey, Ann M; Grauwet, Tara; Hendrickx, Marc E

    2018-04-01

    The relative contributions of cotyledons and seed coats towards hardening of common beans (Phaseolus vulgaris) were investigated and the rate-limiting process which controls bean softening during cooking was determined. Fresh or aged whole beans and cotyledons were soaked and cooked in demineralised water or 0.1 M NaHCO 3 solution, and texture evolution, microstructure changes and thermal properties were studied. Fresh and aged whole beans cooked in demineralised water had significantly different softening rate constants and so did fresh and aged cotyledons. The comparable softening rate constants of aged whole beans and cotyledons indicated an insignificant role of the seed coat in hardening during storage. All samples cooked faster in 0.1 M NaHCO 3 solution. Disintegration of cooked tissues followed by microscopic examination revealed a transition from cell breakage through a phase of cell breakage and separation to complete cell separation with increased cooking time wherefore texture decayed. Therefore, progressive solubilization of pectin in the middle lamella greatly promoted texture decay. While residual birefringence even after substantial cooking time suggested some molecular order of the starch, calorimetric analyses revealed complete starch gelatinisation before complete cell separation occurred. This implies an insignificant role of starch in texture decay during cooking but its hindered uncoiling into a viscous gel after gelatinisation due to the restricting cell wall could promote its retrogradation. Therefore, we suggest that the rate-determining process in bean softening relates to cell wall/middle lamella changes influencing pectin solubilization. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Annotation and sequence diversity of transposable elements in common bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Scott eJackson

    2014-07-01

    Full Text Available Common bean (Phaseolus vulgaris is an important legume crop grown and consumed worldwide. With the availability of the common bean genome sequence, the next challenge is to annotate the genome and characterize functional DNA elements. Transposable elements (TEs are the most abundant component of plant genomes and can dramatically affect genome evolution and genetic variation. Thus, it is pivotal to identify TEs in the common bean genome. In this study, we performed a genome-wide transposon annotation in common bean using a combination of homology and sequence structure-based methods. We developed a 2.12-Mb transposon database which includes 791 representative transposon sequences and is available upon request or from www.phytozome.org. Of note, nearly all transposons in the database are previously unrecognized TEs. More than 5,000 transposon-related expressed sequence tags (ESTs were detected which indicates that some transposons may be transcriptionally active. Two Ty1-copia retrotransposon families were found to encode the envelope-like protein which has rarely been identified in plant genomes. Also, we identified an extra open reading frame (ORF termed ORF2 from 15 Ty3-gypsy families that was located between the ORF encoding the retrotransposase and the 3’LTR. The ORF2 was in opposite transcriptional orientation to retrotransposase. Sequence homology searches and phylogenetic analysis suggested that the ORF2 may have an ancient origin, but its function is not clear. This transposon data provides a useful resource for understanding the genome organization and evolution and may be used to identify active TEs for developing transposon-tagging system in common bean and other related genomes.

  16. Response of French Bean (Phaseolus vulgaris L. Cultivars to Foliar Applications of Magnesium

    Directory of Open Access Journals (Sweden)

    Michele Pisante

    2011-02-01

    Full Text Available Magnesium deficiencies have been shown to be particularly dangerous to short cycled crops, both on sandy and clay soils. Such deficiencies may be corrected by foliar fertilisations, but in French bean (Phaseolus vulgaris L. no experimental data may be found to support this hypothesis. Therefore this paper was aimed at studying the effect of foliar Mg-applications (56, 112 and 224 g ha-1 in single application at flowering or splitted half dose at 4-leaf stage and half at flowering alone and with Zn (200 g ha-1 on yield and quality of two French bean genotypes (Bronco, Cadillac. Foliar Mg-applications significantly increased pod yield and, considering the highest rate with respect to the untreated, such an increase was 78% and 32% for Bronco and Cadillac, respectively. Split applications were also more effective, with yield increases of 109% and 50% for the two genotypes. Concerning quality, foliar Mg applications showed a significant effect particularly on sugars, calcium, phosphate, sulphate and Mg contents in pods. On the other hand, a significant effect on the accumulation of nitrates was noted, especially with split applications (144% increase vs. unfertilised and, in some cases, an antagonistic effect on K content (10-20% decrease on average. Foliar Mg fertilisation of French bean seemed to be a promising practice with reference to human health and nutrition, tough some care is needed to avoid the accumulation of nitrates in pods. Split applications seemed to be more effective, while the addition of Zn to the fertiliser mix did not give any relevant effect.

  17. Daya Terima Proporsi Kacang Hijau (Phaseolus Radiata L) Dan Bekatul (Rice Bran) Terhadap Kandungan Serat Pada Snack Bar

    OpenAIRE

    Pricilya, Vyatri; Wirjatmadi, Bambang; Andriani, Merryana

    2015-01-01

    Snack bar is a product made from cereal and nuts that usually consumed between meals. Commercial snack bar contains energy, protein, and fiber. The fiber content in it is usually 1 gram per 25 grams serving. The fiber content is relatively low because food categorized as high fi ber if it has 5 grams per 100 gram products. Therefore, a new innovation to improve its fi ber content is required. Green bean and rice bran are type of food with high fiber content that possible to be added in snack bar. T...

  18. DAYA TERIMA PROPORSI KACANG HIJAU (PHASEOLUS RADIATA L) DAN BEKATUL (RICE BRAN) TERHADAP KANDUNGAN SERAT PADA SNACK BAR

    OpenAIRE

    Pricilya, Vyatri; Wirjatmadi, Bambang; Andriani, Merryana

    2017-01-01

    Snack bar is a product made from cereal and nuts that usually consumed between meals. Commercial snack bar contains energy, protein, and fiber. The fiber content in it is usually 1 gram per 25 grams serving. The fiber content is relatively low because food categorized as high fi ber if it has 5 grams per 100 gram products. Therefore, a new innovation to improve its fi ber content is required. Green bean and rice bran are type of food with high fiber content that possible to be added in snack bar. T...

  19. Improving adaptation to drought stress in white pea bean (Phaseolus vulgaris L): genotypic effects on grain yield, yield components and pod harvest index

    Science.gov (United States)

    Common bean (Phaseolus vulgaris L.) is the most important food legume crop in Africa and Latin America where rainfall pattern is unpredictable. The objectives were to identify better yielding common bean lines with good canning quality under drought, and to identify traits that could be used as sele...

  20. Molecular characterization of the U.S. Phaseolus acutifolius A. Gray collection using Amplified Fragment Length Polymorphism (AFLP) and Targeted Region Amplification Polymorphism (TRAP) markers.

    Science.gov (United States)

    Tepary bean (Phaseolus acutifolius A. Gray), a truly Native American crop, is a short life-cycle annual desert legume indigenous to northwestern Mexico and the southwestern USA and is considered drought and heat tolerant. The Western Regional Plant Introduction Station currently maintains 211 acce...

  1. Effects of water stress on the photosynthetic assimilation and distribution of 14C-photosynthate in maize (Zea mays L.) and bean (Phaseolus vulgaris L.)

    International Nuclear Information System (INIS)

    Martinez y Huaman, C.A.; Cerri, C.C.

    1984-01-01

    The relationship between photosynthesis and distribution of 14 C-photosinthate as affected by water stress was evaluated. Corn (Zea mays L.) during the grain filling period and bean (Phaseolus vulgaris L.) during flowering, representing a C-4 and a C-3 photosynthetic type, respectively, were studied. (M.A.C.) [pt

  2. Assesing potential effects of inulin and probiotic bacteria on Fe bioavailability from common beans (Phaseolus vulgaris L.) to Caco-2 cells

    Science.gov (United States)

    Inulin, a prebiotic, may enhance intestinal Fe absorption. Our objective was to assess the effects of supplemental inulin and two probiotic bacteria (B. infantis and L.acidophillus) on Fe availability to Caco-2 cells from common white and red beans (Phaseolus vulgaris L.). Cooked beans were mixed o...

  3. Improovement of statistical counting conditions for the determination of chloride in Beams leaves (Phaseolus vulgaris L.) by thermal neutron activation analysis

    International Nuclear Information System (INIS)

    Ferraz, E.S.B.; Nascimento Filho, V.F.

    1975-04-01

    The use of two radiation peaks from the same gamma-emitting source in the calculation of the corresponding liquid counting rate in multi-element gamma spectrometry is discussed. It is shown that, in the determination of chlorine in Phaseolus vulgaris L. using neutronic activation analysis will result in an increase in accuracy of measurement of approximately 40%

  4. Fraccionamiento de nitrógeno en frijol ( phaseolus vulgaris l. en el valle de san juan

    Directory of Open Access Journals (Sweden)

    Juan Cedano

    2000-01-01

    Full Text Available Fraccionamiento de nitrógeno en frijol (Phaseolus vulgaris L. en el valle de San Juan. Se realizó un estudio para determinar el efecto del fraccionamiento de la fertilización nitrogenada y el momento adecuado para la aplicación de nitrógeno en el cultivo de frijol (Phaseolus vulgaris L. en cinco localidades del Valle de San Juan, R. D. Los experimentos fueron establecidos del 5 al 14 de noviembre (1997 , se utilizó un diseño de bloques completamente al azar y nueve tratamientos en cada localidad, encontrándose que en los terrenos con altos niveles de nitrógeno no hubo respuesta a la aplicación de nitrógeno ni al fraccionamiento de este nutrimento; mientras que en los suelos con deficiencia en nitrógeno si hubo respuesta a la fertilización nitrogenada encontrándose diferencia estadística significativa a la aplicación y al momento de aplicación del fertilizante. Entre las localidades hubo diferencia estadística significativa (P>0.05, mientras que no se encontró interacción entre los tratamientos y las localidades

  5. La collection de base des espèces sauvages de Phaseolus et Vigna : historique, gestion et conservation

    Directory of Open Access Journals (Sweden)

    Thierry Vanderborght

    1998-01-01

    Full Text Available The base collection of wild species of Phaseolus and Vigna: history, management and conservation.The National Botanic Garden of Belgium ensures the management of a base collection of botanical and wild forms in the tribe Phaseoleae and the sub-tribe Phaseolinae. The main objective is to conserve on a long terni basic the largest possible genetic diversity through seed semples stored at - 20°C. The collection provided the basic material for the investigations conducted at the University Faculty of Agricultural Sciences of Gembloux in fields as diverse as taxonomy, genome analysis, definition of genetic réservoirs, agronomie and chemical evaluations, interspecific hybridization and plant breeding. The results have allowed to becter understand the organization of genetic diversity in the studied plant material and to highlight the wealthy genetic potentiel of the collection. The latter should be preserved and valorized for the genetic improvement of food legumes, in particular within the two genera Phaseolus and Vigna.

  6. DMPD: Cellular reprogramming by gram-positive bacterial components: a review. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16885502 Cellular reprogramming by gram-positive bacterial components: a review. Bu...(.csml) Show Cellular reprogramming by gram-positive bacterial components: a review. PubmedID 16885502 Title... Cellular reprogramming by gram-positive bacterial components: a review. Authors

  7. Use of magnetic beads for Gram staining of bacteria in aqueous suspension.

    Science.gov (United States)

    Yazdankhah, S P; Sørum, H; Larsen, H J; Gogstad, G

    2001-12-01

    A Gram staining technique was developed using monodisperse magnetic beads in concentrating bacteria in suspension for downstream application. The technique does not require heat fixation of organisms, electrical power, or a microscope. Gram-negative and Gram-positive bacteria were identified macroscopically based on the colour of the suspension. The bacteria concentrated on magnetic beads may also be identified microscopically.

  8. Is the gram stain useful in the microbiologic diagnosis of VAP? A meta-analysis.

    Science.gov (United States)

    O'Horo, John C; Thompson, Deb; Safdar, Nasia

    2012-08-01

    In a meta-analysis examining respiratory specimen Gram stain for diagnosis of ventilator-associated pneumonia, absence of bacteria on Gram stain had a high negative predictive value, but a positive Gram stain correlated poorly with organisms recovered in culture. Rapid and accurate diagnosis of ventilator-associated pneumonia (VAP) is a major challenge and no generally accepted gold standard exists for VAP diagnosis. We conducted a meta-analysis to examine the role of respiratory specimen Gram stain to diagnose VAP, and the correlation with final culture results. In 21 studies, pooled sensitivity of Gram stain for VAP was 0.79 (95% confidence interval [CI], .77-0.81; P Gram stain for a VAP prevalence of 20%-30% was 91%, suggesting that VAP is unlikely with a negative Gram stain but the positive predictive value of Gram stain was only 40%. Pooled kappa was 0.42 for gram-positive organisms and 0.34 for gram-negative organisms, suggesting fair concordance between organisms on Gram stain and recovery by culture. Therefore, a positive Gram stain should not be used to narrow anti-infective therapy until culture results become available.

  9. [Characteristic of clinical strains of gram-negative obligate anaerobes].

    Science.gov (United States)

    Kadzielska, Joanna; Kierzkowska, Marta; Sawicka-Grzelak, Anna; Rokosz, Alicja; Łuczak, Mirosław

    2007-01-01

    The aim of the study was to assess prevalence and antibiotic susceptibility profiles ofGram-negative strictly anaerobic bacteria isolated from clinical specimens taken from hospitalized patients in 2005-2006. Biochemical identification and antibiotic susceptibility were done in an automated system ATB Expression (bioMerieux sa). From 12262 specimens examined 867 strains of obligate anaerobes were isolated. Gram-negative strictly anaerobic bacteria were cultured in number of 138 strains (15,9%). All cultures were performed on Columbia agar and Schaedler agar media (bioMerieux sa) supplemented with 5% sheep blood and incubated at 37 degrees C for 48-120 h in 85% N2, 10% H2, 5% CO2. Most frequently isolated was Bacteroides spp. (41,3%). For this group beta-lactamase activity was evaluated by using nitrocefin disc test (Cefinase BBL, Becton Dickinson and Co., Cockeysville, MD, USA). Production of ESBLs was detected with the use of two disc diffusion methods: the double-disc synergy test (DDST) according to Jarlier et al. and the diagnostic disc (DD) test according to Appleton. ESBLs were produced by 5,3% strains of Bacteroides spp. For all Bacteroides spp. strains MIC values were determined by gradient diffusion method Etest (AB BIODISK, Sweden). ESBLs and MIC were performed on Wilkins-Chalgren solid medium supplemented with 5% sheep blood (Difco Lab., USA) and all plates were incubated at 35 degrees C for 48 hours in 85% N2, 10% H2, 5% CO2. Most Gram-negative obligate anaerobes isolated from clinical specimens are still susceptible to imipenem (100%), metronidazole (99,3%) and beta-lactam antibiotics with beta-lactamase inhibitors: piperacillin/tazobactam (99,3%), ticarcillin/clavulanate (99.3%), amoxicillin/clavulanate (97.8%).

  10. [Diagnostic and therapeutic management of Gram-negative infections].

    Science.gov (United States)

    Bassetti, Matteo; Repetto, Ernestina

    2008-04-01

    Among Gram negative bacteria, Pseudomonas aeruginosa, the extended spectrum beta-lactamases (ESBL)-producing strains, Acinetobacter spp, in particular the multiresistant Acinetobacter baumannii, and Stenotrophomonas maltophilia are the most implicated micrororganisms in the ever more increasing problem of bacterial resistance. Possible solutions have to be searched, on one hand, in the use of new drugs but, on the other hand, in the re-evaluation of those already available drugs, possibly considering a new role for old drugs such as colistine and fosfomycin. Concerning ESBL-producing strains, the most recent data provided by EARSS report, in Italy, an incidence rate of 10-25 percent. The insurgence of an infection sustained by an ESBL+ve strain is strictly related to some well known risk factors, like the hospital stay itself, the disease severity, the length of stay in ICU, intubation and mechanical ventilation, catheterization, urinary or artery, and the past exposure to antibiotics. The raise in ESBL producing strains is closely related to the increasing use of cephalosporins. In the setting of a Gram negative infection, the combination therapy guarantees a higher coverage by reducing insurgence of possible resistance mechanisms, possibly resulting synergistic, and allowing a de-escalation therapy, although to this latter other problems, such as tolerability, costs and compliance, can be related. Another basic aspect to take into account of, in order to achieve the maximal efficacy of the antibiotic treatment, is the right dosage. In the idea to look for the best approach for the antibiotic treatment of a severe infection in a hospital setting, when a Gram negative aetiology is implicated, it can be possibly presumed that the right way consists in avoiding inappropriate antibiotic therapies, making therapeutic choices based on guidelines resulted from local epidemiological data, initiating the therapy promptly, avoiding excessive use of antibiotics, possibly

  11. Daptomycin treatment in Gram-positive vascular graft infections

    Directory of Open Access Journals (Sweden)

    Francisco Arnaiz de las Revillas

    2018-03-01

    Full Text Available Background: Daptomycin is a bactericidal antibiotic approved for the treatment of skin and soft tissue infections and right-side endocarditis. However, there is a lack of published data outlining its usefulness in vascular graft infections (VGI. The aim of this study was to describe the clinical experience of daptomycin use in the treatment of VGI caused by Gram-positive bacteria. Methods: This was a retrospective cohort study of patients diagnosed with VGI receiving daptomycin at a tertiary care hospital during the period January 2010 to December 2012. Results: Of a total 1066 consecutive patients who had undergone vascular grafts (VG, 25 were diagnosed with VGI. Fifteen of these patients (11 prosthetic VG, three autologous VG, one both types received daptomycin (median dose 6.7 mg/kg/day, range 4.1–7.1 mg/kg/day; median age 69 years, range 45–83 years; 80% male. The infected bypass was removed in 13 cases. The most common reason for selecting daptomycin was kidney failure (53%. The Gram-positive organisms isolated were coagulase-negative Staphylococcus (n = 10, Staphylococcus aureus (n = 3 (two methicillin-resistant S. aureus, Enterococcus faecium (n = 2, and Enterococcus faecalis (n = 1. The mean follow-up was 69 months (interquartile range 48–72 months. Ten patients (66.7% achieved complete healing of the VGI. A recurrence of the infection was observed in 100% of patients in whom the bypass was not removed. Among patients who did not achieve complete healing, one needed a supracondylar amputation and one died as a consequence of infection. Five patients received treatment with rifampicin in addition to daptomycin and they were all cured. Conclusions: The use of daptomycin and surgery for Gram-positive VGI was effective and well tolerated, and this may be a good alternative for the treatment of VGI in patients with peripheral arterial disease in whom renal insufficiency is common. Keywords: Daptomycin, Gram-positive, Vascular

  12. Inhaled Antibiotics for Gram-Negative Respiratory Infections

    Science.gov (United States)

    Fraidenburg, Dustin R.; Scardina, Tonya

    2016-01-01

    SUMMARY Gram-negative organisms comprise a large portion of the pathogens responsible for lower respiratory tract infections, especially those that are nosocomially acquired, and the rate of antibiotic resistance among these organisms continues to rise. Systemically administered antibiotics used to treat these infections often have poor penetration into the lung parenchyma and narrow therapeutic windows between efficacy and toxicity. The use of inhaled antibiotics allows for maximization of target site concentrations and optimization of pharmacokinetic/pharmacodynamic indices while minimizing systemic exposure and toxicity. This review is a comprehensive discussion of formulation and drug delivery aspects, in vitro and microbiological considerations, pharmacokinetics, and clinical outcomes with inhaled antibiotics as they apply to disease states other than cystic fibrosis. In reviewing the literature surrounding the use of inhaled antibiotics, we also highlight the complexities related to this route of administration and the shortcomings in the available evidence. The lack of novel anti-Gram-negative antibiotics in the developmental pipeline will encourage the innovative use of our existing agents, and the inhaled route is one that deserves to be further studied and adopted in the clinical arena. PMID:27226088

  13. Daptomycin: a novel lipopeptide antibiotic against Gram-positive pathogens

    Directory of Open Access Journals (Sweden)

    Andres Beiras-Fernandez

    2010-08-01

    Full Text Available Andres Beiras-Fernandez1,*, Ferdinand Vogt1,*, Ralf Sodian1, Florian Weis21Department of Cardiac Surgery, University Hospital Großhadern, Ludwig-Maximilian-University, Munich, Germany; 2Department of Anesthesiology, University Hospital Großhadern, Ludwig-Maximilian-University, Munich, Germany *Andres Beiras-Fernandez and Ferdinand Vogt contributed equally to this paperAbstract: The aim of this review is to summarize the historical background of drug resistance of Gram-positive pathogens as well as to describe in detail the novel lipopeptide antibiotic daptomycin. Pharmacological and pharmacokinetic aspects are reviewed and the current clinical use of daptomycin is presented. Daptomycin seems to be a reliable drug in the treatment of complicated skin and skin structure infections, infective right-sided endocarditis, and bacteremia caused by Gram-positive agents. Its unique mechanism of action and its low resistance profile, together with its rapid bactericidal action make it a favorable alternative to vancomycin in multi-drug resistant cocci. The role of daptomycin in the treatment of prosthetic material infections, osteomyelitis, and urogenital infections needs to be evaluated in randomized clinical trials.Keywords: daptomycin, multi-drug resistance, methicillin-resistant Staphylococcus aureus (MRSA, pneumonia, urinary tract infection, left-sided endocarditis

  14. VIP as a potential therapeutic agent in gram negative sepsis.

    Science.gov (United States)

    Ibrahim, Hiba; Barrow, Paul; Foster, Neil

    2012-12-01

    Gram negative sepsis remains a high cause of mortality and places a great burden on public health finance in both the developed and developing world. Treatment of sepsis, using antibiotics, is often ineffective since pathology associated with the disease occurs due to dysregulation of the immune system (failure to return to steady state conditions) which continues after the bacteria, which induced the immune response, have been cleared. Immune modulation is therefore a rational approach to the treatment of sepsis but to date no drug has been developed which is highly effective, cheap and completely safe to use. One potential therapeutic agent is VIP, which is a natural peptide and is highly homologous in all vertebrates. In this review we will discuss the effect of VIP on components of the immune system, relevant to gram negative sepsis, and present data from animal models. Furthermore we will hypothesise on how these studies could be improved in future and speculate on the possible different ways in which VIP could be used in clinical medicine.

  15. Black-pigmented gram-negative anaerobes in endodontic infections.

    Science.gov (United States)

    Haapasalo, M

    1993-03-01

    Necrotic dental root canal infections are polymicrobial infections dominated by anaerobic bacteria. The number of different species in one canal is usually low, approx. 4-7 species. The species isolated most frequently belong to the genera Prevotella, Porphyromonas, Fusobacterium, Peptostreptococcus, Eubacterium and Streptococcus. The frequency of isolation of black-pigmented Gram-negative anaerobes in endodontic infections varies from 25% to > 50%. Pr. intermedia is the most commonly found pigmented species, followed by Pr. denticola and two Porphyromonas species, P. gingivalis and P. endodontalis. Several studies have shown that P. gingivalis and P. endodontalis are closely related to the presence of acute symptoms in endodontic infections, whereas other black-pigmented Gram-negative anaerobes are not. However, several other species may also be involved in acute infections. Moreover, Porphyromonas species have occasionally been isolated from cases with no symptoms. Although Porphyromonas spp. are clearly related to symptoms at the beginning of therapy, they are not important for the prognosis of the treatment.

  16. Simultaneous fluorescent gram staining and activity assessment of activated sludge bacteria.

    Science.gov (United States)

    Forster, Scott; Snape, Jason R; Lappin-Scott, Hilary M; Porter, Jonathan

    2002-10-01

    Wastewater treatment is one of the most important commercial biotechnological processes, and yet the component bacterial populations and their associated metabolic activities are poorly understood. The novel fluorescent dye hexidium iodide allows assessment of Gram status by differential absorption through bacterial cell walls. Differentiation between gram-positive and gram-negative wastewater bacteria was achieved after flow cytometric analysis. This study shows that the relative proportions of gram-positive and gram-negative bacterial cells identified by traditional microscopy and hexidium iodide staining were not significantly different. Dual staining of cells for Gram status and activity proved effective in analyzing mixtures of cultured bacteria and wastewater populations. Levels of highly active organisms at two wastewater treatment plants, both gram positive and gram negative, ranged from 1.5% in activated sludge flocs to 16% in the activated sludge fluid. Gram-positive organisms comprised Gram status and activity within activated sludge samples over a 4-day period showed significant differences over time. This method provides a rapid, quantitative measure of Gram status linked with in situ activity within wastewater systems.

  17. Gram-positive rods prevailing in teeth with apical periodontitis undergoing root canal treatment.

    Science.gov (United States)

    Chávez de Paz, L E; Molander, A; Dahlén, G

    2004-09-01

    To identify Gram-positive rods from root canals of teeth with apical periodontitis and to examine their associations with other species. Consecutive root canal samples (RCSs) from 139 teeth undergoing root canal treatment were analyzed prospectively for cultivable microbes. Gram-positive rods in the first RCS submitted after chemo-mechanical preparation were categorised to genus level by selective media and gas-liquid chromatography (GLC), and identified to species level by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Associations between organisms were measured by odds ratios (OR). In the first samples submitted a total of 158 Gram-positive rods, 115 Gram-positive cocci, 26 Gram-negative rods and 9 Gram-negative cocci, were identified. At genus levels Gram-positive rods were classified into: Lactobacillus spp. (38%), Olsenella spp. (18%), Propionibacterium spp. (13%), Actinomyces spp. (12%), Bifidobacterium spp. (13%) and Eubacterium spp. (6%). The most frequent species were Olsenella uli, Lactobacillus paracasei and Propionibacterium propionicum. In subsequent samples taken during treatment, Gram-positive rods were also identified, although the number of strains was considerably reduced. Positive associations were observed between members of the genus lactobacilli and Gram-positive cocci (OR>2). Olsenella uli and Lactobacillus spp. predominated over other Gram-positive rods. A possible association exists between Lactobacillus spp. and Gram-positive cocci in root canals of teeth with apical periodontitis receiving treatment.

  18. Thesis Abstract Bean (Phaseolus vulgaris L.) lines: chemical composition and protein digestibility.

    Science.gov (United States)

    Mesquita, F R; Silva, M I A; Corrêa, A D

    2016-05-09

    The bean represents the main source of proteins for the low income populations, although the digestibility of those proteins is relatively low. Consequently, the programs of plant genetic breeding have been working on the search for new lines with higher protein levels. Thus, with the purpose of supplying information to the researchers, in this study, 21 bean (Phaseolus vulgaris L.) lines were analyzed for the centesimal and mineral composition, protein digestibility, phenolic compounds, and trypsin inhibitor. The entirely randomized experimental design was used with 21 treatments (lines) and three repetitions. All values were within the following ranges: 22.34 to 36.28 g crude protein/100 g dry matter (DM); 7.56 to 20.91 g neutral detergent fiber/100 g DM; 0.53 to 2.55 g fat/100 g DM and 2.97 to 4.87 g ashes/100 g DM. The levels of phosphorus, potassium, calcium, magnesium, and sulfur, in g/100 g DM, varied from 0.45 to 0.72; 1.51 to 2.48; 0.03 to 0.28; 0.18 to 0.34 and 0.28 to 0.45, respectively. Regarding copper, manganese, zinc and iron, the levels, in mg/kg DM, varied from 11.37 to 17.73; 14.93 to 28.90; 36.67 to 69.90 and 71.37 to 126.90, respectively. The in vitro protein digestibility varied from 18.03 to 48.32%. The levels of phenolic compounds varied from 0.28 to 1.08 mg acid tanic/100 g DM and the one of trypsin inhibitor from 59.93 to 151.07 trypsin inhibited units/mg DM. Among the lines with higher protein contents, "ESAL 569" (beige with brown stripe) presented the largest protein digestibility and considerable levels of minerals. "P-180" (beige with brown stripe) was one of the lines with higher crude protein contents and digestibilities, and also presented high levels for most of the minerals. No relation between protein digestibility and the contents of phenolic compounds or trypsin inhibitor was observed.

  19. Domestication Genomics of the Open-Pollinated Scarlet Runner Bean (Phaseolus coccineus L.)

    Science.gov (United States)

    Guerra-García, Azalea; Suárez-Atilano, Marco; Mastretta-Yanes, Alicia; Delgado-Salinas, Alfonso; Piñero, Daniel

    2017-01-01

    The runner bean is a legume species from Mesoamerica closely related to common bean (Phaseolus vulgaris). It is a perennial species, but it is usually cultivated in small-scale agriculture as an annual crop for its dry seeds and edible immature pods. Unlike the common bean, P. coccineus has received little attention from a genetic standpoint. In this work we aim to (1) provide information about the domestication history and domestication events of P. coccineus; (2) examine the distribution and level of genetic diversity in wild and cultivated Mexican populations of this species; and, (3) identify candidate loci to natural and artificial selection. For this, we generated genotyping by sequencing data (42,548 SNPs) from 242 individuals of P. coccineus and the domesticated forms of the closely related species P. vulgaris (20) and P. dumosus (35). Eight genetic clusters were detected, of which half corresponds to wild populations and the rest to domesticated plants. The cultivated populations conform a monophyletic clade, suggesting that only one domestication event occurred in Mexico, and that it took place around populations of the Trans-Mexican Volcanic Belt. No difference between wild and domesticated levels of genetic diversity was detected and effective population sizes are relatively high, supporting a weak genetic bottleneck during domestication. Most populations presented an excess of heterozygotes, probably due to inbreeding depression. One population of P. coccineus subsp. striatus had the greatest excess and seems to be genetically isolated despite being geographically close to other wild populations. Contrasting with previous studies, we did not find evidence of recent gene flow between wild and cultivated populations. Based on outlier detection methods, we identified 24 domestication-related SNPs, 13 related to cultivar diversification and eight under natural selection. Few of these SNPs fell within annotated loci, but the annotated domestication

  20. Domestication Genomics of the Open-Pollinated Scarlet Runner Bean (Phaseolus coccineus L.

    Directory of Open Access Journals (Sweden)

    Azalea Guerra-García

    2017-11-01

    Full Text Available The runner bean is a legume species from Mesoamerica closely related to common bean (Phaseolus vulgaris. It is a perennial species, but it is usually cultivated in small-scale agriculture as an annual crop for its dry seeds and edible immature pods. Unlike the common bean, P. coccineus has received little attention from a genetic standpoint. In this work we aim to (1 provide information about the domestication history and domestication events of P. coccineus; (2 examine the distribution and level of genetic diversity in wild and cultivated Mexican populations of this species; and, (3 identify candidate loci to natural and artificial selection. For this, we generated genotyping by sequencing data (42,548 SNPs from 242 individuals of P. coccineus and the domesticated forms of the closely related species P. vulgaris (20 and P. dumosus (35. Eight genetic clusters were detected, of which half corresponds to wild populations and the rest to domesticated plants. The cultivated populations conform a monophyletic clade, suggesting that only one domestication event occurred in Mexico, and that it took place around populations of the Trans-Mexican Volcanic Belt. No difference between wild and domesticated levels of genetic diversity was detected and effective population sizes are relatively high, supporting a weak genetic bottleneck during domestication. Most populations presented an excess of heterozygotes, probably due to inbreeding depression. One population of P. coccineus subsp. striatus had the greatest excess and seems to be genetically isolated despite being geographically close to other wild populations. Contrasting with previous studies, we did not find evidence of recent gene flow between wild and cultivated populations. Based on outlier detection methods, we identified 24 domestication-related SNPs, 13 related to cultivar diversification and eight under natural selection. Few of these SNPs fell within annotated loci, but the annotated

  1. Effect of vermicompost on soil fertility and crop productivity--beans (Phaseolus vulgaris).

    Science.gov (United States)

    Manivannan, S; Balamurugan, M; Parthasarathi, K; Gunasekaran, G; Ranganathan, L S

    2009-03-01

    Field experiments were conducted at Sivapuri, Chidambaram, Tamil Nadu to evaluate the efficacy of vermicompost, in comparison to inorganic fertilizers-NPK, on the physio-chemical and biological characteristics of the soils--clay loam soil (CLS) and sandy loam soil (SLS) and on the growth, yield and nutrient content of beans--Phaseolus vulgaris. Results showed that the application of vermicompost @ 5 tonnes ha(-1) had enhanced significantly the pore space (1.09 and 1.02 times), water holding capacity (1.1 and 1.3 times), cation exchange capacity (1.2 and 1.2 times). It reduced particles (1.2 and 1.2 times), and bulk density (1.2 and 1.2 times), pH (1 and 1.02 times) and electrical conductivity (1.4 and 1.2 times) and increased organic carbon (37 and 47 times), micro (Ca 3.07 and 1.9 times, Mg 1.6 and 1.6 times, Na 2.4 and 3.8 times, Fe 7 and 7.6 times, Mn 8.2 and 10.6 times, Zn 50 and 52 times and Cu 14 and 22 times) and macro (N 1.6 and 1.7 times, P 1.5 and 1.7 times, K 1.5 and 1.4 times) nutrients and microbial activity (1.4 and 1.5 times) in both soil types, particularly more in CLS. The growth, yield (1.6 times) and quality (protein (1.05 times) and sugar (1.01 times) content in seed) of bean were enhanced in CLS than SLS. On the other hand, the application of inorganic fertilizers @ 20:80:40 kg ha(-1) has resulted in reduced porosity (1.03 and 1.01 times), organic carbon (1.04 and 9.5 times) and microbial activity (1.02 and 1.03 times) in both soil types.

  2. Does methyl jasmonate modify the oxidative stress response in Phaseolus coccineus treated with Cu?

    Science.gov (United States)

    Hanaka, Agnieszka; Wójcik, Małgorzata; Dresler, Sławomir; Mroczek-Zdyrska, Magdalena; Maksymiec, Waldemar

    2016-02-01

    The contribution of methyl jasmonate (MJ) as a signal molecule able to take part in the defense mechanism against copper (Cu)-imposed oxidative stress was studied in the leaves and roots of runner bean (Phaseolus coccineus) plants. Roots of plants cultivated hydroponically were preincubated in MJ (10µM) for 1h or 24h and subsequently exposed to Cu (50µM) for 5h (short-term experiment) or 5 days (long-term experiment). Enzymatic (activity of superoxide dismutase, SOD; catalase, CAT; ascorbate peroxidase, APX; guaiacol peroxidase, POX) and non-enzymatic (accumulation of malondialdehyde, MDA; homoglutathione, hGSH; proline; anthocyanins; low molecular weight organic acids, LMWOAs) responses were determined in the leaves and roots. The antioxidative defense mechanism was significantly activated after Cu supplementation. In most cases, activities of ROS (reactive oxygen species) scavenging enzymes like SOD, CAT, APX, POX, as well as MDA, hGSH and proline concentrations increased following Cu exposure. MJ showed a time-dependent effect on antioxidative enzymes activity. In the short-term experiment, MJ elevated CAT, APX and POX activities in the roots, and POX activity in the leaves of non-Cu-treated plants. In the long-term experiment, MJ not only decreased POX and partially CAT activity in the roots, but also increased the MDA level and partially CAT activity in the leaves of the control plants. In Cu-treated plants, MJ reduced APX, but elevated POX activity in the leaves after 5-h exposure. After 5-day-Cu treatment, MJ inhibited POX activity in the leaves and mainly reduced SOD and CAT activities in the roots. Moreover, in the long-term experiment, MJ reduced tartrate and pyruvate in the leaves of Cu-stressed plants, but mostly elevated tartrate and malate in the roots comparing with Cu alone treatment. MJ alone and under Cu excess did not alter accumulation of MDA, hGSH and proline comparing with Cu alone, but partially elevated anthocyanin concentration. The

  3. Biosynthesis of compatible solutes in rhizobial strains isolated from Phaseolus vulgaris nodules in Tunisian fields

    Directory of Open Access Journals (Sweden)

    Nieto Joaquín J

    2010-07-01

    Full Text Available Abstract Background Associated with appropriate crop and soil management, inoculation of legumes with microbial biofertilizers can improve food legume yield and soil fertility and reduce pollution by inorganic fertilizers. Rhizospheric bacteria are subjected to osmotic stress imposed by drought and/or NaCl, two abiotic constraints frequently found in semi-arid lands. Osmostress response in bacteria involves the accumulation of small organic compounds called compatible solutes. Whereas most studies on rhizobial osmoadaptation have focussed on the model species Sinorhizobium meliloti, little is known on the osmoadaptive mechanisms used by native rhizobia, which are good sources of inoculants. In this work, we investigated the synthesis and accumulations of compatible solutes by four rhizobial strains isolated from root nodules of Phaseolus vulgaris in Tunisia, as well as by the reference strain Rhizobium tropici CIAT 899T. Results The most NaCl-tolerant strain was A. tumefaciens 10c2, followed (in decreasing order by R. tropici CIAT 899, R. leguminosarum bv. phaseoli 31c3, R. etli 12a3 and R. gallicum bv. phaseoli 8a3. 13C- and 1H-NMR analyses showed that all Rhizobium strains synthesized trehalose whereas A. tumefaciens 10c2 synthesized mannosucrose. Glutamate synthesis was also observed in R. tropici CIAT 899, R. leguminosarum bv. phaseoli 31c3 and A. tumefaciens 10c2. When added as a carbon source, mannitol was also accumulated by all strains. Accumulation of trehalose in R. tropici CIAT 899 and of mannosucrose in A. tumefaciens 10c2 was osmoregulated, suggesting their involvement in osmotolerance. The phylogenetic analysis of the otsA gene, encoding the trehalose-6-phosphate synthase, suggested the existence of lateral transfer events. In vivo 13C labeling experiments together with genomic analysis led us to propose the uptake and conversion pathways of different carbon sources into trehalose. Collaterally, the β-1,2-cyclic glucan from R

  4. Linkage disequilibrium at the APA insecticidal seed protein locus of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Blair, Matthew W; Prieto, Sergio; Díaz, Lucy M; Buendía, Héctor F; Cardona, César

    2010-04-29

    An interesting seed protein family with a role in preventing insect herbivory is the multi-gene, APA family encoding the alpha-amylase inhibitor, phytohemagglutinin and arcelin proteins of common bean (Phaseolus vulgaris). Variability for this gene family exists and has been exploited to breed for insect resistance. For example, the arcelin locus has been successfully transferred from wild to cultivated common bean genotypes to provide resistance against the bruchid species Zabrotes subfasciatus although the process has been hampered by a lack of genetic tools for and understanding about the locus. In this study, we analyzed linkage disequilibrium (LD) between microsatellite markers at the APA locus and bruchid resistance in a germplasm survey of 105 resistant and susceptible genotypes and compared this with LD in other parts of the genome. Microsatellite allele diversity was found to vary with each of the eight APA-linked markers analyzed, and two markers within the APA locus were found to be diagnostic for bruchid resistance or susceptibility and for the different arcelin alleles inherited from the wild accessions. Arc1 was found to provide higher levels of resistance than Arc5 and the markers in the APA locus were highly associated with resistance showing that introgression of this gene-family from wild beans provides resistance in cultivated beans. LD around the APA locus was found to be intermediate compared to other regions of the genome and the highest LD was found within the APA locus itself for example between the markers PV-atct001 and PV-ag004. We found the APA locus to be an important genetic determinant of bruchid resistance and also found that LD existed mostly within the APA locus but not beyond it. Moderate LD was also found for some other regions of the genome perhaps related to domestication genes. The LD pattern may reflect the introgression of arcelin from the wild into the cultivated background through breeding. LD and association studies for

  5. A pathway closely related to the (D)-tagatose pathway of gram-negative enterobacteria identified in the gram-positive bacterium Bacillus licheniformis.

    Science.gov (United States)

    Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M; Galleni, Moreno; Joris, Bernard

    2013-06-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.

  6. A Pathway Closely Related to the d-Tagatose Pathway of Gram-Negative Enterobacteria Identified in the Gram-Positive Bacterium Bacillus licheniformis

    Science.gov (United States)

    Van der Heiden, Edwige; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard

    2013-01-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus. PMID:23524682

  7. A Pathway Closely Related to the d-Tagatose Pathway of Gram-Negative Enterobacteria Identified in the Gram-Positive Bacterium Bacillus licheniformis

    OpenAIRE

    Van der Heiden, Edwige; Delmarcelle, Michaël; Lebrun, Sarah; Freichels, Régine; Brans, Alain; Vastenavond, Christian M.; Galleni, Moreno; Joris, Bernard

    2013-01-01

    We report the first identification of a gene cluster involved in d-tagatose catabolism in Bacillus licheniformis. The pathway is closely related to the d-tagatose pathway of the Gram-negative bacterium Klebsiella oxytoca, in contrast to the d-tagatose 6-phosphate pathway described in the Gram-positive bacterium Staphylococcus aureus.

  8. Gram-positive and gram-negative bacteria induce different patterns of cytokine production in human mononuclear cells irrespective of taxonomic relatedness.

    Science.gov (United States)

    Skovbjerg, Susann; Martner, Anna; Hynsjö, Lars; Hessle, Christina; Olsen, Ingar; Dewhirst, Floyd E; Tham, Wilhelm; Wold, Agnes E

    2010-01-01

    Upon bacterial stimulation, tissue macrophages produce a variety of cytokines that orchestrate the immune response that clears the infection. We have shown that Gram-positives induce higher levels of interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor (TNF) from human peripheral blood mononuclear cells (PBMCs) than do Gram-negatives, which instead induce more of IL-6, IL-8, and IL-10. Here, we study whether these patterns follows or crosses taxonomic borders. PBMCs from blood donors were incubated with UV-inactivated bacteria representing 37 species from five phyla. IL-12, TNF, IL-1beta, IL-6, IL-8, and IL-10 were measured in the supernatants after 24 h and IFN-gamma after 5 days. Irrespective of phylogenetic position, Gram-positive bacteria induced much more IL-12 (nine times more on average) and IFN-gamma (seven times), more TNF (three times), and slightly more IL-1beta (1.5 times) than did Gram-negatives, which instead induced more IL-6 (1.5 times), IL-8 (1.9 times), and IL-10 (3.3 times) than did Gram-positives. A notable exception was the Gram-positive Listeria monocytogenes, which induced very little IL-12, IFN-gamma, and TNF. The results confirm the fundamental difference in innate immune responses to Gram-positive and Gram-negative bacteria, which crosses taxonomic borders and probably reflects differences in cell wall structure.

  9. Comparative activity of tigecycline and tetracycline on Gram-negative and Gram-positive bacteria revealed by a multicentre study in four North European countries

    DEFF Research Database (Denmark)

    Nilsson, Lennart E; Frimodt-Møller, Niels; Vaara, Martti

    2011-01-01

    This study involves a multicentre surveillance of tigecycline and tetracycline activity against Gram-negative and Gram-positive bacteria from primary care centres (PCCs), general hospital wards (GHWs) and intensive care units (ICUs) in Denmark (n = 9), Finland (n = 10), Norway (n = 7) and Sweden (n...

  10. Higher order structure in the 3'-minor domain of small subunit ribosomal RNAs from a gram negative bacterium, a gram positive bacterium and a eukaryote

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1983-01-01

    of additional higher order structure in the renatured free RNA. It can be concluded that a high level of conservation of higher order structure has occurred during the evolution of the gram negative and gram positive eubacteria and the eukaryote in both the double helical regions and the "unstructured" regions...

  11. Dose-Dependent Antimicrobial Activity of Silver Nanoparticles on Polycaprolactone Fibers against Gram-Positive and Gram-Negative Bacteria

    Directory of Open Access Journals (Sweden)

    Erick Pazos-Ortiz

    2017-01-01

    Full Text Available The adhesion ability and adaptability of bacteria, coupled with constant use of the same bactericides, have made the increase in the diversity of treatments against infections necessary. Nanotechnology has played an important role in the search for new ways to prevent and treat infections, including the use of metallic nanoparticles with antibacterial properties. In this study, we worked on the design of a composite of silver nanoparticles (AgNPS embedded in poly-epsilon-caprolactone nanofibers and evaluated its antimicrobial properties against various Gram-positive and Gram-negative microorganisms associated with drug-resistant infections. Polycaprolactone-silver composites (PCL-AgNPs were prepared in two steps. The first step consisted in the reduction in situ of Ag+ ions using N,N-dimethylformamide (DMF in tetrahydrofuran (THF solution, and the second step involved the simple addition of polycaprolactone before electrospinning process. Antibacterial activity of PCL-AgNPs nanofibers against E. coli, S. mutans, K. pneumoniae, S. aureus, P. aeruginosa, and B. subtilis was evaluated. Results showed sensibility of E. coli, K. pneumoniae, S. aureus, and P. aeruginosa, but not for B. subtilis and S. mutans. This antimicrobial activity of PCL-AgNPs showed significant positive correlations associated with the dose-dependent effect. The antibacterial property of the PCL/Ag nanofibers might have high potential medical applications in drug-resistant infections.

  12. Silver-doped manganese dioxide and trioxide nanoparticles inhibit both gram positive and gram negative pathogenic bacteria.

    Science.gov (United States)

    Kunkalekar, R K; Prabhu, M S; Naik, M M; Salker, A V

    2014-01-01

    Palladium, ruthenium and silver-doped MnO2 and silver doped Mn2O3 nanoparticles were synthesized by simple co-precipitation technique. SEM-TEM analysis revealed the nano-size of these synthesized samples. XPS data illustrates that Mn is present in 4+ and 3+ oxidation states in MnO2 and Mn2O3 respectively. Thermal analysis gave significant evidence for the phase changes with increasing temperature. Antibacterial activity of these synthesized nanoparticles on three Gram positive bacterial cultures (Staphylococcus aureus ATCC 6538, Streptococcus epidermis ATCC 12228, Bacillus subtilis ATCC 6633) and three Gram negative cultures (Escherichia coli ATCC 8739, Salmonella abony NCTC 6017 and Klebsiella pneumoniae ATCC 1003) was investigated using a disc diffusion method and live/dead assay. Only Ag-doped MnO2 and Ag-doped Mn2O3 nanoparticles showed antibacterial property against all six-test bacteria but Ag-doped MnO2 was found to be more effective than Ag-doped Mn2O3. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Nanoparticle targeting of Gram-positive and Gram-negative bacteria for magnetic-based separations of bacterial pathogens

    Science.gov (United States)

    Lu, Hoang D.; Yang, Shirley S.; Wilson, Brian K.; McManus, Simon A.; Chen, Christopher V. H.-H.; Prud'homme, Robert K.

    2017-04-01

    Antimicrobial resistance is a healthcare problem of increasing significance, and there is increasing interest in developing new tools to address bacterial infections. Bacteria-targeting nanoparticles hold promise to improve drug efficacy, compliance, and safety. In addition, nanoparticles can also be used for novel applications, such as bacterial imaging or bioseperations. We here present the use of a scalable block-copolymer-directed self-assembly process, Flash NanoPrecipitation, to form zinc(II)-bis(dipicolylamine) modified nanoparticles that bind to both Gram-positive and Gram-negative bacteria with specificity. Particles have tunable surface ligand densities that change particle avidity and binding efficacy. A variety of materials can be encapsulated into the core of the particles, such as optical dyes or iron oxide colloids, to produce imageable and magnetically active bacterial targeting constructs. As a proof-of-concept, these particles are used to bind and separate bacteria from solution in a magnetic column. Magnetic manipulation and separation would translate to a platform for pathogen identification or removal. These magnetic and targeted nanoparticles enable new methods to address bacterial infections.

  14. Inhibition of various gram-positive and gram-negative bacteria growth on selenium nanoparticle coated paper towels.

    Science.gov (United States)

    Wang, Qi; Larese-Casanova, Philip; Webster, Thomas J

    2015-01-01

    There are wide spread bacterial contamination issues on various paper products, such as paper towels hanging in sink splash zones or those used to clean surfaces, filter papers used in water and air purifying systems, and wrappings used in the food industry; such contamination may lead to the potential spread of bacteria and consequent severe health concerns. In this study, selenium nanoparticles were coated on normal paper towel surfaces through a quick precipitation method, introducing antibacterial properties to the paper towels in a healthy way. Their effectiveness at preventing biofilm formation was tested in bacterial assays involving Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Staphylococcus epidermidis. The results showed significant and continuous bacteria inhibition with about a 90% reduction from 24 to 72 hours for gram-positive bacteria including S. aureus and S. epidermidis. The selenium coated paper towels also showed significant inhibition of gram-negative bacteria like P. aeruginosa and E. coli growth at about 57% and 84%, respectively, after 72 hours of treatment. Therefore, this study established a promising selenium-based antibacterial strategy to prevent bacterial growth on paper products, which may lead to the avoidance of bacteria spreading and consequent severe health concerns.

  15. Antibacterial activity of sphingoid bases and fatty acids against Gram-positive and Gram-negative bacteria.

    Science.gov (United States)

    Fischer, Carol L; Drake, David R; Dawson, Deborah V; Blanchette, Derek R; Brogden, Kim A; Wertz, Philip W

    2012-03-01

    There is growing evidence that the role of lipids in innate immunity is more important than previously realized. How lipids interact with bacteria to achieve a level of protection, however, is still poorly understood. To begin to address the mechanisms of antibacterial activity, we determined MICs and minimum bactericidal concentrations (MBCs) of lipids common to the skin and oral cavity--the sphingoid bases D-sphingosine, phytosphingosine, and dihydrosphingosine and the fatty acids sapienic acid and lauric acid--against four Gram-negative bacteria and seven Gram-positive bacteria. Exact Kruskal-Wallis tests of these values showed differences among lipid treatments (P 500 μg/ml). Sapienic acid (MBC range, 31.3 to 375.0 μg/ml) was active against Streptococcus sanguinis, Streptococcus mitis, and Fusobacterium nucleatum but not active against Escherichia coli, Staphylococcus aureus, S. marcescens, P. aeruginosa, Corynebacterium bovis, Corynebacterium striatum, and Corynebacterium jeikeium (MBC > 500 μg/ml). Lauric acid (MBC range, 6.8 to 375.0 μg/ml) was active against all bacteria except E. coli, S. marcescens, and P. aeruginosa (MBC > 500 μg/ml). Complete killing was achieved as early as 0.5 h for some lipids but took as long as 24 h for others. Hence, sphingoid bases and fatty acids have different antibacterial activities and may have potential for prophylactic or therapeutic intervention in infection.

  16. The gram-negative bacterial periplasm: Size matters.

    Directory of Open Access Journals (Sweden)

    Samuel I Miller

    2018-01-01

    Full Text Available Gram-negative bacteria are surrounded by two membrane bilayers separated by a space termed the periplasm. The periplasm is a multipurpose compartment separate from the cytoplasm whose distinct reducing environment allows more efficient and diverse mechanisms of protein oxidation, folding, and quality control. The periplasm also contains structural elements and important environmental sensing modules, and it allows complex nanomachines to span the cell envelope. Recent work indicates that the size or intermembrane distance of the periplasm is controlled by periplasmic lipoproteins that anchor the outer membrane to the periplasmic peptidoglycan polymer. This periplasm intermembrane distance is critical for sensing outer membrane damage and dictates length of the flagellar periplasmic rotor, which controls motility. These exciting results resolve longstanding debates about whether the periplasmic distance has a biological function and raise the possibility that the mechanisms for maintenance of periplasmic size could be exploited for antibiotic development.

  17. Sinus surgery postpones chronic Gram-negative lung infection

    DEFF Research Database (Denmark)

    Alanin, M C; Aanaes, K; Høiby, N

    2016-01-01

    of pulmonary samples positive for GNB. We investigated whether the effect is sustained. METHODOLOGY: We report the effect of ESS and adjuvant therapy three years postoperatively in a CF cohort participating in this prospective clinical follow-up study. The primary endpoint was the lung infection status defined......BACKGROUND: In patients with cystic fibrosis (CF) the sinuses are a bacterial reservoir for Gram-negative bacteria (GNB). From the sinuses the GNB can repeatedly migrate to the lungs. In a one-year follow-up study, endoscopic sinus surgery (ESS) with adjuvant therapy reduced the frequency....... The total cohort had decreasing lung function during follow-up; however, in 27 patients with improved lung infection status lung function was stable. Revision surgery was performed in 31 patients (28%). CONCLUSION: ESS with adjuvant therapy significantly improves the lung infection status for at least three...

  18. TSTA loop operation with 100 grams-level of tritium

    International Nuclear Information System (INIS)

    Yoshida, Hiroshi; Fukui, Hiroshi; Hirata, Shingo

    1988-12-01

    A fully integrated loop operation test of Tritium systems Test Assembly (TSTA) with 107 grams of tritium was completed at Los Alamos National Laboratory (LANL) in June, 1988. In this test, a compound cryopump with a charcoal panel was incorporated into the main process loop for the first time. The objectives were (i) to demonstrate the compound cryopump system with different flow rates and impurities, (ii) to demonstrate the regeneration of the compound cryopump system, (iii) to accumulate operating experience with other process systems such as the fuel cleanup system, the isotope separation system, the tritium supply and recovery system, etc. and (iv) to improve the data-base on TSTA safety systems such as the secondary containment system, tritium waste treatment system and tritium monitoring system. This report briefly describes characteristics of the main subsystems observed during the milestone run. (author)

  19. Marine Compounds with Therapeutic Potential in Gram-Negative Sepsis

    Directory of Open Access Journals (Sweden)

    Irina Yermak

    2013-06-01

    Full Text Available This paper concerns the potential use of compounds, including lipid A, chitosan, and carrageenan, from marine sources as agents for treating endotoxemic complications from Gram-negative infections, such as sepsis and endotoxic shock. Lipid A, which can be isolated from various species of marine bacteria, is a potential antagonist of bacterial endotoxins (lipopolysaccharide (LPSs. Chitosan is a widespread marine polysaccharide that is derived from chitin, the major component of crustacean shells. The potential of chitosan as an LPS-binding and endotoxin-neutralizing agent is also examined in this paper, including a discussion on the generation of hydrophobic chitosan derivatives to increase the binding affinity of chitosan to LPS. In addition, the ability of carrageenan, which is the polysaccharide of red alga, to decrease the toxicity of LPS is discussed. We also review data obtained using animal models that demonstrate the potency of carrageenan and chitosan as antiendotoxin agents.

  20. A study of gram-negative bacterial resistance to Aminoglycosides

    Directory of Open Access Journals (Sweden)

    Maleknejad P

    1993-05-01

    Full Text Available From hygienic and economical point of view, drug therapy and prophylaxy in infectious diseases are of great importance. After the world war II, a reduction in the efficacy of sulfonamide in the treatment of shigellosis was observed and later on it led to a survey on drug resistance and the way of its transmission. The aim of this survey, during which 100 cases of gram-negative bacteria were identified, is to study the drug resistance of this bacteria against five types of aminoglycosides by antibiotic sensitivity test (disc-diffusion. Out of 100 strains, 47% were resistant to gentamycin, 70% to kanamycin, 82% to streptomycin, 53% to tobramycin, and 8% to amikacin

  1. Transient sensitivity to nisin in cold-shocked Gram negatives.

    Science.gov (United States)

    Boziaris, I S; Adams, M R

    2000-09-01

    Rapid chilling in the presence of nisin caused a dose-dependent reduction in the populations of several Gram-negative bacteria, despite the fact that appreciable structural injury to the outer membrane was not detected. Pseudomonas aeruginosa was most affected, followed by Pseudomonas fragi, Salmonella enteritidis PT4, PT7 and Escherichia coli, respectively. Addition of nisin after the chilling treatment had no effect. The results are ascribed to a transient susceptibility caused by phase changes in the lipids associated with the outer membrane, which are rapidly reversed when the cells return to higher temperatures. Combinations of chilling shock, nisin and EDTA gave much lower reductions of Salmonella and Pseudomonas on chicken skin in comparison with broths. This is attributed to a buffering of the temperature shock experienced by adherent bacteria and binding of the nisin by food particles.

  2. Distribution of Gram Negative Bacteria and Evaluation of Resistance Profiles

    Directory of Open Access Journals (Sweden)

    Serap Pamukcuoglu

    2014-03-01

    Full Text Available Aim: In this study, we aimed to examine the distributon of Gram negative bacteria isolated from urine cultures of out-patients in Afyonkarahisar State Hospital and evaluate the antimicrobial resistance rates of these pathogens. Material and Method: Urine samples of out-patients which were sent to microbiology laboratory between 2012-2013 were retrospectively evaluated. The isolates were identified using conventional methods and/or automated Vitec 2.0 system. Antibiogram sensitivities were determined by Kirby-Bauer disc diffusion method or automated system and interpreted on the basis of Clinical and Laboratory Standards Institute (CSI criteria. Double disc sinergy test (DDST or Vitec 2.0 system was used to detect extended spectrum beta-lactamase (ESBL.When conventional methods could%u2019t be clarified according to their colony morphologies, gram staining patterns, biochemical test; automated system has been used. Results: A total of 671 isolates acquired from urine samples were studied. 427 Escherichia coli (63.6 %, 165 Klebsiella spp. (24.6 %, 22 Pseudomonas spp. (3.3 %, nine Acinetobacter spp. (1.3 %, 41 Proteus spp. (6.1 % and seven Serratia (1.0 % strains were identified among isolates. 97 E.coli (22.8 % and 41 Klebsiella (24.8 % isolates were ESBL positive. Most common bacteria were E.coli, 31.1 % of which were resistant to trimethoprim-sulfamethoxazole, 16 % to ciprofloxacin and 3.6 % to nitrofurantoin. Among Enterobacteriaceae, no resistance aganist carbapenems were detected. Moreover, aminoglicoside sensitivity rate was significantly high in this group. Discussion: Microorganisms that have progressively increasing antimicrobial resistance should be considered in the treatment of urinary tract infections. It is also important to use the most appropriate antibiotics to avoid unnecessary usage of these drugs in order to decrease drug resistance rates and ESBL production which may effect the success of the treatment.

  3. Gram-Negative Bacterial Sensors for Eukaryotic Signal Molecules

    Directory of Open Access Journals (Sweden)

    Olivier Lesouhaitier

    2009-09-01

    Full Text Available Ample evidence exists showing that eukaryotic signal molecules synthesized and released by the host can activate the virulence of opportunistic pathogens. The sensitivity of prokaryotes to host signal molecules requires the presence of bacterial sensors. These prokaryotic sensors, or receptors, have a double function: stereospecific recognition in a complex environment and transduction of the message in order to initiate bacterial physiological modifications. As messengers are generally unable to freely cross the bacterial membrane, they require either the presence of sensors anchored in the membrane or transporters allowing direct recognition inside the bacterial cytoplasm. Since the discovery of quorum sensing, it was established that the production of virulence factors by bacteria is tightly growth-phase regulated. It is now obvious that expression of bacterial virulence is also controlled by detection of the eukaryotic messengers released in the micro-environment as endocrine or neuro-endocrine modulators. In the presence of host physiological stress many eukaryotic factors are released and detected by Gram-negative bacteria which in return rapidly adapt their physiology. For instance, Pseudomonas aeruginosa can bind elements of the host immune system such as interferon-γ and dynorphin and then through quorum sensing circuitry enhance its virulence. Escherichia coli sensitivity to the neurohormones of the catecholamines family appears relayed by a recently identified bacterial adrenergic receptor. In the present review, we will describe the mechanisms by which various eukaryotic signal molecules produced by host may activate Gram-negative bacteria virulence. Particular attention will be paid to Pseudomonas, a genus whose representative species, P. aeruginosa, is a common opportunistic pathogen. The discussion will be particularly focused on the pivotal role played by these new types of pathogen sensors from the sensing to the transduction

  4. Comparisons of phaseolin type and α-amylase inhibitor in common bean(Phaseolus vulgaris L.)in China

    Institute of Scientific and Technical Information of China (English)

    Yang Yao; Yibo Hu; Yingying Zhu; Yue Gao; Guixing Ren

    2016-01-01

    The objective of this study was to characterize the phaseolin type and a-amylase(αAI) level in common bean(Phaseolus vidgaris L.) accessions deposited in the Chinese National Genebank.The 40 accessions sampled were common varieties originating in Asia,North America,South America,Europe,and Africa.No Inca(I-) phaseolin was observed in the accessions.Only four accessions contained Tendergreen(T-) phaseolin and the remaining36 contained Sanilac(S-) phaseolin.aAI proteins extracted from nine accessions showed higher a-amylase inhibitory activity than the control(Phase 2,IC50 = 0.65 μg).These common bean accessions have potential use as nutraceutical ingredients.

  5. Purification and characterization of an alkaline phosphatase induced by phosphorus starvation in common bean (Phaseolus vulgaris L.) roots

    Energy Technology Data Exchange (ETDEWEB)

    Morales, L.; Gutierrez, N.; Maya, V.; Parra, C.; Martinez B, E.; Coello, P., E-mail: pcoello@servidor.unam.mx [UNAM, Facultad de Quimica, Departamento de Bioquimica, Ciudad Universitaria, 04510 Mexico D. F. (Mexico)

    2012-07-01

    Two phosphatase isoforms from roots of the common bean (Phaseolus vulgaris L.) showed an increase in activity in response to phosphate deficiency. One of them (APIII) was chosen for further purification through ionic exchange chromatography and preparative electrophoresis. The estimated molecular mass of APIII was 35 kDa by both SDS-Page and gel filtration analyses, suggesting a monomeric form of the active enzyme. The phosphatase was classified as an alkaline phosphatase based on the requirement of ph 8 for optimum catalysis. It not only exhibited broad substrate specificity, with the most activity against pyrophosphate, but also effectively catalyzed the hydrolysis of polyphosphate, glucose-1-phosphate and phospho enol-pyruvate. Activity was completely inhibited by molybdate, vanadate and phosphate but was only partially inhibited by fluoride. Although divalent cations were not essential for the pyro phosphatase activity of this enzyme, the hydrolysis of pyro phosphatase increased substantially in the presence of Mg{sup 2+}.

  6. Effect of Processing on the In Vitro and In Vivo Protein Quality of Beans (Phaseolus vulgaris and Vicia Faba

    Directory of Open Access Journals (Sweden)

    Matthew G. Nosworthy

    2018-05-01

    Full Text Available In this work, the protein quality of different bean types after undergoing the preparatory methods of baking, cooking and extrusion was assayed. Protein quality was assessed using a rodent bioassay to evaluate growth and protein digestibility while amino acid composition was determined via HPLC. In vivo protein digestibility was compared to an in vitro assessment method. The average protein digestibility corrected amino acid score (PDCAAS for processed beans was higher than the digestible indispensable amino acid score (DIAAS (61% vs. 45%. Extrusion/cooking of Phaseolus varieties resulted in higher PDCAAS (66% on average and DIAAS values (61% on average than baked (52% and 48% while baked faba beans had higher PDCAAS (66% and DIAAS (61% values. A significant correlation was found between PDCAAS and in vitro PDCAAS (R2 = 0.7497. This demonstrates which bean processing method will generate the optimal protein quality, which has benefits for both industrial production and individual domestic preparation.

  7. Effect of cooking on aroma profile of red kidney beans (Phaseolus vulgaris) and correlation with sensory quality.

    Science.gov (United States)

    Mishra, Prashant K; Tripathi, Jyoti; Gupta, Sumit; Variyar, Prasad S

    2017-01-15

    Volatile aroma compounds of three varieties of red kidney beans (Phaseolus vulgaris) namely Kashmiri red, Sharmili and Chitra were extracted in raw state using solid-phase microextraction (SPME) and cooked state using simultaneous distillation extraction (SDE). During cooking a significant (palcohols and terpene hydrocarbons while an increase in content of various sulfurous compounds, terpene alcohols, ketones and pyrazines was noted. Descriptive sensory analysis showed that the maximum intensity of 'kidney bean', 'earthy' and 'smoky' odour was observed in Kashmiri red while Sharmili variety was characterised by 'sulfurous' odour. Correlation of volatile profile data with descriptive sensory analysis and odour activity values clearly established the role of compounds, such as methanethiol, diethyl sulfide, dimethyl disulfide, methional and dimethyl trisulfide, in contributing to 'cooked kidney bean' aroma, while dimethyl sulfoxide, dimethyl sulfone and ethyl methyl sulfone were responsible for 'sulfurous' aroma. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Pathovars of Pseudomonas syringae Causing Bacterial Brown Spot and Halo Blight in Phaseolus vulgaris L. Are Distinguishable by Ribotyping

    Science.gov (United States)

    González, Ana J.; Landeras, Elena; Mendoza, M. Carmen

    2000-01-01

    Ribotyping was evaluated as a method to differentiate between Pseudomonas syringae pv. phaseolicola and pv. syringae strains causing bacterial brown spot and halo blight diseases in Phaseolus vulgaris L. Ribotyping, with restriction enzymes BglI and SalI and using the Escherichia coli rrnB operon as the probe, differentiated 11 and 14 ribotypes, respectively, and a combination of data from both procedures yielded 19 combined ribotypes. Cluster analysis of the combined ribotypes differentiated the pathovars phaseolicola and syringae, as well as different clonal lineages within these pathovars. The potential of ribotyping to screen for correlations between lineages and factors such as geographical region and/or bean varieties is also reported. PMID:10653764

  9. Purification and characterization of an alkaline phosphatase induced by phosphorus starvation in common bean (Phaseolus vulgaris L.) roots

    International Nuclear Information System (INIS)

    Morales, L.; Gutierrez, N.; Maya, V.; Parra, C.; Martinez B, E.; Coello, P.

    2012-01-01

    Two phosphatase isoforms from roots of the common bean (Phaseolus vulgaris L.) showed an increase in activity in response to phosphate deficiency. One of them (APIII) was chosen for further purification through ionic exchange chromatography and preparative electrophoresis. The estimated molecular mass of APIII was 35 kDa by both SDS-Page and gel filtration analyses, suggesting a monomeric form of the active enzyme. The phosphatase was classified as an alkaline phosphatase based on the requirement of ph 8 for optimum catalysis. It not only exhibited broad substrate specificity, with the most activity against pyrophosphate, but also effectively catalyzed the hydrolysis of polyphosphate, glucose-1-phosphate and phospho enol-pyruvate. Activity was completely inhibited by molybdate, vanadate and phosphate but was only partially inhibited by fluoride. Although divalent cations were not essential for the pyro phosphatase activity of this enzyme, the hydrolysis of pyro phosphatase increased substantially in the presence of Mg 2+ .

  10. Studies on the distribution of 14C-malformin A in major fractions of Phaseolus vulgaris L

    International Nuclear Information System (INIS)

    Ciarlante, D.; Curtis, R.W.

    1976-01-01

    The distribution pattern of 14 C-malformin in major fractions of Phaseolus vulgaris L, seedlings shifted during water treatment in the absence of malformin. From these shifts, and by comparison of the 14 C distribution patterns at the base and top of the seedlings, it was concluded that some 14 C-malformin enters the cell and proceeds to the cell wall via intermediate compounds. As a working hypothesis it was suggested that in roots 14 C-malformin first appears in a soluble ''small molecules'' fraction, binds to a soluble protein fraction, and proceeds via the wall lipid fraction to the wall itself. Direct binding of some 14 C-malformin to the wall fraction was not precluded. In leaves, the pathway of 14 C-malformin to the cell wall was similar in some respects to that in roots. (auth.)

  11. Effects of acetylsalicylic acid on fresh weight pigment and protein content of bean leaf discs (Phaseolus vulgaris L.).

    Science.gov (United States)

    Canakçi, S

    2003-01-01

    The effects of 100, 250, and 500 ppm acetylsalicylic acid solutions treatments on weight alteration, pigment and protein amounts in discs from the primary leaves of one month old bean (Phaseolus vulgaris L.) seedlings produced tinder greenhouse conditions are presented. The experiments show that: 100 ppm ASA had no significant influence (P > 0.05) but 250 and 500 ppm ASA caused an increase on weight loss (P 0.05), none of the ASA treatments caused a statistically significant influence on carotenoid amount (P > 0.05); 100 and 250 ppm ASA treatments did not cause a significant influence on protein amount (P > 0.05). however 500 ppm ASA treatment caused an increase on protein injury (P < 0.05). Consequently, it is supposed that wet weight loss, pigment and protein injury have somewhat increased on leaf discs. depending on the toxic effect of high acetylsalicylic acid concentrations.

  12. Functional specialization of one copy of glutamine phosphoribosyl pyrophosphate amidotransferase in ureide production from symbiotically fixed nitrogen in Phaseolus vulgaris.

    Science.gov (United States)

    Coleto, Inmaculada; Trenas, Almudena T; Erban, Alexander; Kopka, Joachim; Pineda, Manuel; Alamillo, Josefa M

    2016-08-01

    Purines are essential molecules formed in a highly regulated pathway in all organisms. In tropical legumes, the nitrogen fixed in the nodules is used to generate ureides through the oxidation of de novo synthesized purines. Glutamine phosphoribosyl pyrophosphate amidotransferase (PRAT) catalyses the first committed step of de novo purine synthesis. In Phaseolus vulgaris there are three genes coding for PRAT. The three full-length sequences, which are intron-less genes, were cloned, and their expression levels were determined under conditions that affect the synthesis of purines. One of the three genes, PvPRAT3, is highly expressed in nodules and protein amount and enzymatic activity in these tissues correlate with nitrogen fixation activity. Inhibition of PvPRAT3 gene expression by RNAi-silencing and subsequent metabolomic analysis of the transformed roots shows that PvPRAT3 is essential for the synthesis of ureides in P. vulgaris nodules. © 2016 John Wiley & Sons Ltd.

  13. Purification, cDNA Cloning, and Developmental Expression of the Nodule-Specific Uricase from Phaseolus vulgaris L. 1

    Science.gov (United States)

    Sánchez, Federico; Campos, Francisco; Padilla, Jaime; Bonneville, Jean-Marc; Enríquez, Consuelo; Caput, Daniel

    1987-01-01

    Nodule-specific uricase (uricase II) from Phaseolus vulgaris L. was purified to homogeneity by chromatographic methods. Purification data indicated that uricase II is approximately 2% of the total soluble protein from mature nodules. Specific antiserum was raised and used to determine the developmental expression and for immunoselection of polysomes. Uricase II was antigenically detected early in nodule development, 2 to 3 days before nitrogen fixation. Uricase-encoding cDNA clones were isolated by hybridizing a nodule-specific pUC9 cDNA library with labeled mRNA from immunoselected polysomes and a 35,000 molecular weight uricase II-encoding cDNA from soybean. An homologous clone (pNF-UR07) was used to assess the expression pattern of the specific transcript during development. Northern-blot analysis indicated that uricase II mRNA is exclusively expressed in nodule tissue. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:16665575

  14. Flow cytometric evaluation of physico-chemical impact on Gram-positive and Gram-negative bacteria

    Science.gov (United States)

    Fröhling, Antje; Schlüter, Oliver

    2015-01-01

    Since heat sensitivity of fruits and vegetables limits the application of thermal inactivation processes, new emerging inactivation technologies have to be established to fulfill the requirements of food safety without affecting the produce quality. The efficiency of inactivation treatments has to be ensured and monitored. Monitoring of inactivation effects is commonly performed using traditional cultivation methods which have the disadvantage of the time span needed to obtain results. The aim of this study was to compare the inactivation effects of peracetic acid (PAA), ozonated water (O3), and cold atmospheric pressure plasma (CAPP) on Gram-positive and Gram-negative bacteria using flow cytometric methods. E. coli cells were completely depolarized after treatment (15 s) with 0.25% PAA at 10°C, and after treatment (10 s) with 3.8 mg l−1 O3 at 12°C. The membrane potential of CAPP treated cells remained almost constant at an operating power of 20 W over a time period of 3 min, and subsequently decreased within 30 s of further treatment. Complete membrane permeabilization was observed after 10 s O3 treatment, but treatment with PAA and CAPP did not completely permeabilize the cells within 2 and 4 min, respectively. Similar results were obtained for esterase activity. O3 inactivates cellular esterase but esterase activity was detected after 4 min CAPP treatment and 2 min PAA treatment. L. innocua cells and P. carotovorum cells were also permeabilized instantaneously by O3 treatment at concentrations of 3.8 ± 1 mg l−1. However, higher membrane permeabilization of L. innocua and P. carotovorum than of E. coli was observed at CAPP treatment of 20 W. The degree of bacterial damage due to the inactivation processes is highly dependent on treatment parameters as well as on treated bacteria. Important information regarding the inactivation mechanisms can be obtained by flow cytometric measurements and this enables the definition of critical process parameters. PMID

  15. Flow cytometric evaluation of physico-chemical impact on Gram-positive and Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Antje eFröhling

    2015-09-01

    Full Text Available Since heat sensitivity of fruits and vegetables limits the application of thermal inactivation processes, new emerging inactivation technologies have to be established to fulfil the requirements of food safety without affecting the produce quality. The efficiency of inactivation treatments has to be ensured and monitored. Monitoring of inactivation effects is commonly performed using traditional cultivation methods which have the disadvantage of the time span needed to obtain results.The aim of this study was to compare the inactivation effects of peracetic acid (PAA, ozonated water (O3 and cold atmospheric pressure plasma (CAPP on Gram-positive and Gram-negative bacteria using flow cytometric methods. E. coli cells were completely depolarized after treatment (15 s with 0.25 % PAA at 10 °C, and after treatment (10 s with 3.8 mg l-1 O3 at 12°C. The membrane potential of CAPP treated cells remained almost constant at an operating power of 20 W over a time period of 3 min, and subsequently decreased within 30 s of further treatment. Complete membrane permeabilization was observed after 10 s O3 treatment, but treatment with PAA and CAPP did not completely permeabilize the cells within 2 min and 4 min, respectively. Similar results were obtained for esterase activity. O3 inactivates cellular esterase but esterase activity was detected after 4 min CAPP treatment and 2 min PAA treatment. L. innocua cells and P. carotovorum cells were also permeabilized instantaneously by O3 treatment at concentrations of 3.8 ± 1 mg l-1. However, higher membrane permeabilization of L. innocua and P. carotovorum than of E. coli was observed at CAPP treatment of 20 W. The degree of bacterial damage due to the inactivation processes is highly dependent on treatment parameters as well as on treated bacteria. Important information regarding the inactivation mechanisms can be obtained by flow cytometric measurements and this enables the definition of critical process

  16. Antibacterial activity and interactions of plant essential oil combinations against Gram-positive and Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Cristina Anamaria Semeniuc

    2017-04-01

    Full Text Available The aim of this study was to compare the antibacterial effects of several essential oils (EOs alone and in combination against different Gram-positive and Gram-negative bacteria associated with food products. Parsley, lovage, basil, and thyme EOs, as well as their mixtures (1:1, v/v, were tested against Bacillus cereus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Salmonella typhimurium. The inhibitory effects ranged from strong (thyme EO against E. coli to no inhibition (parsley EO against P. aeruginosa. Thyme EO exhibited strong (against E. coli, moderate (against S. typhimurium and B. cereus, or mild inhibitory effects (against P. aeruginosa and S. aureus, and basil EO showed mild (against E. coli and B. cereus or no inhibitory effects (against S. typhimurium, P. aeruginosa, and S. aureus. Parsley and lovage EOs revealed no inhibitory effects against all tested strains. Combinations of lovage/thyme and basil/thyme EOs displayed antagonistic effects against all bacteria, parsley/thyme EOs against B. cereus, S. aureus, P. aeruginosa, and E. coli, and lovage/basil EOs against B. cereus and E. coli. Combinations of parsley/lovage and parsley/basil EOs exhibited indifferent effects against all bacteria. The combination of lovage/basil EO showed indifferent effect against S. aureus, P. aeruginosa, and S. typhimurium, and the combination parsley/thyme EO against S. typhimurium. Thyme EO has the highest percentage yield and antibacterial potential from all tested formulations; its combination with parsley, lovage, and basil EOs determines a reduction of its antibacterial activity. Hence, it is recommended to be used alone as the antibacterial agent.

  17. An unusual class of anthracyclines potentiate Gram-positive antibiotics in intrinsically resistant Gram-negative bacteria.

    Science.gov (United States)

    Cox, Georgina; Koteva, Kalinka; Wright, Gerard D

    2014-07-01

    An orthogonal approach taken towards novel antibacterial drug discovery involves the identification of small molecules that potentiate or enhance the activity of existing antibacterial agents. This study aimed to identify natural-product rifampicin adjuvants in the intrinsically resistant organism Escherichia coli. E. coli BW25113 was screened against 1120 actinomycete fermentation extracts in the presence of subinhibitory (2 mg/L) concentrations of rifampicin. The active molecule exhibiting the greatest rifampicin potentiation was isolated using activity-guided methods and identified using mass and NMR spectroscopy. Susceptibility testing and biochemical assays were used to determine the mechanism of antibiotic potentiation. The anthracycline Antibiotic 301A(1) was isolated from the fermentation broth of a strain of Streptomyces (WAC450); the molecule was shown to be highly synergistic with rifampicin (fractional inhibitory concentration index = 0.156) and moderately synergistic with linezolid (FIC index = 0.25) in both E. coli and Acinetobacter baumannii. Activity was associated with inhibition of efflux and the synergistic phenotype was lost when tested against E. coli harbouring mutations within the rpoB gene. Structure-activity relationship studies revealed that other anthracyclines do not synergize with rifampicin and removal of the sugar moiety of Antibiotic 301A(1) abolishes activity. Screening only a subsection of our natural product library identified a small-molecule antibiotic adjuvant capable of sensitizing Gram-negative bacteria to antibiotics to which they are ordinarily intrinsically resistant. This result demonstrates the great potential of this approach in expanding antibiotic effectiveness in the face of the growing challenge of resistance in Gram-negatives. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. An unusual class of anthracyclines potentiate Gram-positive antibiotics in intrinsically resistant Gram-negative bacteria

    Science.gov (United States)

    Cox, Georgina; Koteva, Kalinka; Wright, Gerard D.

    2014-01-01

    Objectives An orthogonal approach taken towards novel antibacterial drug discovery involves the identification of small molecules that potentiate or enhance the activity of existing antibacterial agents. This study aimed to identify natural-product rifampicin adjuvants in the intrinsically resistant organism Escherichia coli. Methods E. coli BW25113 was screened against 1120 actinomycete fermentation extracts in the presence of subinhibitory (2 mg/L) concentrations of rifampicin. The active molecule exhibiting the greatest rifampicin potentiation was isolated using activity-guided methods and identified using mass and NMR spectroscopy. Susceptibility testing and biochemical assays were used to determine the mechanism of antibiotic potentiation. Results The anthracycline Antibiotic 301A1 was isolated from the fermentation broth of a strain of Streptomyces (WAC450); the molecule was shown to be highly synergistic with rifampicin (fractional inhibitory concentration index = 0.156) and moderately synergistic with linezolid (FIC index = 0.25) in both E. coli and Acinetobacter baumannii. Activity was associated with inhibition of efflux and the synergistic phenotype was lost when tested against E. coli harbouring mutations within the rpoB gene. Structure–activity relationship studies revealed that other anthracyclines do not synergize with rifampicin and removal of the sugar moiety of Antibiotic 301A1 abolishes activity. Conclusions Screening only a subsection of our natural product library identified a small-molecule antibiotic adjuvant capable of sensitizing Gram-negative bacteria to antibiotics to which they are ordinarily intrinsically resistant. This result demonstrates the great potential of this approach in expanding antibiotic effectiveness in the face of the growing challenge of resistance in Gram-negatives. PMID:24627312

  19. Type I and Type II mechanisms of antimicrobial photodynamic therapy: an in vitro study on gram-negative and gram-positive bacteria.

    Science.gov (United States)

    Huang, Liyi; Xuan, Yi; Koide, Yuichiro; Zhiyentayev, Timur; Tanaka, Masamitsu; Hamblin, Michael R

    2012-08-01

    Antimicrobial photodynamic therapy (APDT) employs a non-toxic photosensitizer (PS) and visible light, which in the presence of oxygen produce reactive oxygen species (ROS), such as singlet oxygen ((1) O(2), produced via Type II mechanism) and hydroxyl radical (HO(.), produced via Type I mechanism). This study examined the relative contributions of (1) O(2) and HO(.) to APDT killing of Gram-positive and Gram-negative bacteria. Fluorescence probes, 3'-(p-hydroxyphenyl)-fluorescein (HPF) and singlet oxygen sensor green reagent (SOSG) were used to determine HO(.) and (1) O(2) produced by illumination of two PS: tris-cationic-buckminsterfullerene (BB6) and a conjugate between polyethylenimine and chlorin(e6) (PEI-ce6). Dimethylthiourea is a HO(.) scavenger, while sodium azide (NaN(3)) is a quencher of (1) O(2). Both APDT and killing by Fenton reaction (chemical generation of HO(.)) were carried out on Gram-positive bacteria (Staphylococcus aureus and Enterococcus faecalis) and Gram-negative bacteria (Escherichia coli, Proteus mirabilis, and Pseudomonas aeruginosa). Conjugate PEI-ce6 mainly produced (1) O(2) (quenched by NaN(3)), while BB6 produced HO(.) in addition to (1) O(2) when NaN(3) potentiated probe activation. NaN(3) also potentiated HPF activation by Fenton reagent. All bacteria were killed by Fenton reagent but Gram-positive bacteria needed a higher concentration than Gram-negatives. NaN(3) potentiated Fenton-mediated killing of all bacteria. The ratio of APDT killing between Gram-positive and Gram-negative bacteria was 2 or 4:1 for BB6 and 25:1 for conjugate PEI-ce6. There was a NaN(3) dose-dependent inhibition of APDT killing using both PEI-ce6 and BB6 against Gram-negative bacteria while NaN(3) almost failed to inhibit killing of Gram-positive bacteria. Azidyl radicals may be formed from NaN(3) and HO(.). It may be that Gram-negative bacteria are more susceptible to HO(.) while Gram-positive bacteria are more susceptible to (1) O(2). The differences in Na

  20. Utility of gram staining for evaluation of the quality of cystic fibrosis sputum samples.

    Science.gov (United States)

    Nair, Bindu; Stapp, Jenny; Stapp, Lynn; Bugni, Linda; Van Dalfsen, Jill; Burns, Jane L

    2002-08-01

    The microscopic examination of Gram-stained sputum specimens is very helpful in the evaluation of patients with community-acquired pneumonia and has also been recommended for use in cystic fibrosis (CF) patients. This study was undertaken to evaluate that recommendation. One hundred one sputum samples from CF patients were cultured for gram-negative bacilli and examined by Gram staining for both sputum adequacy (using the quality [Q] score) and bacterial morphology. Subjective evaluation of adequacy was also performed and categorized. Based on Q score evaluation, 41% of the samples would have been rejected despite a subjective appearance of purulence. Only three of these rejected samples were culture negative for gram-negative CF pathogens. Correlation between culture results and quantitative Gram stain examination was also poor. These data suggest that subjective evaluation combined with comprehensive bacteriology is superior to Gram staining in identifying pathogens in CF sputum.

  1. Potential strategies for the eradication of multidrug-resistant Gram-negative bacterial infections.

    Science.gov (United States)

    Huwaitat, Rawan; McCloskey, Alice P; Gilmore, Brendan F; Laverty, Garry

    2016-07-01

    Antimicrobial resistance is one of the leading threats to society. The increasing burden of multidrug-resistant Gram-negative infection is particularly concerning as such bacteria are demonstrating resistance to nearly all currently licensed therapies. Various strategies have been hypothesized to treat multidrug-resistant Gram-negative infections including: targeting the Gram-negative outer membrane; neutralization of lipopolysaccharide; inhibition of bacterial efflux pumps and prevention of protein folding. Silver and silver nanoparticles, fusogenic liposomes and nanotubes are potential strategies for extending the activity of licensed, Gram-positive selective, antibiotics to Gram-negatives. This may serve as a strategy to fill the current void in pharmaceutical development in the short term. This review outlines the most promising strategies that could be implemented to solve the threat of multidrug-resistant Gram-negative infections.

  2. Effect of a combination of Phaseolus vulgaris L. extract and acarbose on postprandial glucose level after cooked rice intake in healthy volunteers

    Directory of Open Access Journals (Sweden)

    Robby Zulkarnain

    2009-03-01

    Full Text Available Aim This study was aimed to measure the effects of combination Phaseolus vulgaris extract and acarbose compared to acarbose alone on postprandial glucose concentration in healthy volunteers after cooked rice intake.Methods Blood sample were obtained at several time points up to three hours after cooked rice intake. The parameter for postprandial glucose concentration is the area under the curve (AUC of glucose concentration vs.time for three hours after cooked rice intake.Results After taking this combination, postprandial glucose concentration was reduced by 21.6%, while the reduction by acarbose alone was 22.9%.Conclusions The reduction of postprandial glucose concentration after administration of this combination was not significantly different compared to that after administration of acarbose alone. (Med J Indones 2009; 18: 25-30Keywords: Phaseolus vulgaris extract, acarbose, postprandial glucose concentration

  3. The target of daptomycin is absent from Escherichia coli and other gram-negative pathogens.

    Science.gov (United States)

    Randall, Christopher P; Mariner, Katherine R; Chopra, Ian; O'Neill, Alex J

    2013-01-01

    Antistaphylococcal agents commonly lack activity against Gram-negative bacteria like Escherichia coli owing to the permeability barrier presented by the outer membrane and/or the action of efflux transporters. When these intrinsic resistance mechanisms are artificially compromised, such agents almost invariably demonstrate antibacterial activity against Gram negatives. Here we show that this is not the case for the antibiotic daptomycin, whose target appears to be absent from E. coli and other Gram-negative pathogens.

  4. Determination of the minimal inhibitory concentration of Ammonium glufosinate in organogenic calli of Phaseolus vulgaris cv. `CIAP 7247F'

    OpenAIRE

    Idalmis Bermúdez-Caraballoso; Raúl Collado; Lourdes R. García; Novisel Veitía; Amanda Martirena; Damaris Torres; Carlos Romero; Gert Angenon

    2012-01-01

    An efficient selection system is necessary for distinguishing transformed cells of the untransformed tissue. This study aimed to determine the minimum inhibitory concentration of the herbicide Ammonium glufosinate in organogenic calli of Phaseolus vulgaris cv. CIAP 7247F, to use it as a selective agent in the process of genetic transformation. Fragments (4-5 mm) of proliferated calli after second subculture were used as explant. Callus proliferation medium with different concentrations of Amm...

  5. EVALUATING THE ACCUMULATION TREND OF L-DOPA IN DARK-GERMINATED SEEDS AND SUSPENSION CULTURES OF Phaseolus vulgaris L. BY AN EFFICIENT UV-SPECTROPHOTOMETRIC METHOD

    Directory of Open Access Journals (Sweden)

    Samira Rahmani-Nezhad

    Full Text Available Seed germination and plant cell cultures provide an alternative mean for producing secondary metabolites. The present study is an attempt to evaluate the effect of seed dark germination and some elicitors and precursors on the production of L-DOPA in Phaseolus vulgaris L. Callus cultured on Murashige and Skoog medium supplemented with various concentrations of different plant growth regulators. L-DOPA produced was quantified by UV-spectrophotometric method. In this study, a user-friendly, quick, and economical UV-spectrophotometric method was described to determine L-DOPA content in extracts from 33 biotypes of Phaseolus vulgaris L. The method is based on the nitrosation of L-DOPA to form a yellow solution and then formation of a red solution by adding base which is measurable at 470 nm. According to our statistical studies, this method showed high efficiency and selectivity for quantitative determination of L-DOPA in herbal extracts from dried plant seeds, dark-germinated seeds and callus cultures. L-DOPA content in dark-germinated seeds and suspension cultures increased significantly to approximately several-fold compared to the control. The implication from this study is that elicitor treatment and precursor feeding of Phaseolus vulgaris L. can significantly improve the parkinson’s relevant L-DOPA content.

  6. Systematic Review and Meta-Analysis of a Proprietary Alpha-Amylase Inhibitor from White Bean (Phaseolus vulgaris L.) on Weight and Fat Loss in Humans.

    Science.gov (United States)

    Udani, Jay; Tan, Ollie; Molina, Jhanna

    2018-04-20

    The aim of this meta-analysis was to examine the evidence for the effectiveness of a proprietary alpha-amylase inhibitor from white bean ( Phaseolus vulgaris L.) supplementation interventions in humans on modification of body weight and fat mass. A systematic literature search was performed using three databases: PubMed, the Cochrane collaboration, and Google Scholar. In addition, the manufacturer was contacted for internal unpublished data, and finally, the reference section of relevant original research and review papers were mined for additional studies. Eleven studies were selected for the meta-analysis of weight loss (a total of 573 subjects), and three studies for the meta-analysis of body fat reduction (a total of 110 subjects), as they fulfilled the inclusion criteria. Phaseolus vulgaris supplementation showed an average effect on weight loss difference of −1.08 kg (95% CI (confidence interval), −0.42 kg to −1.16 kg, p < 0.00001), and the average effect on body fat reduction was 3.26 kg (95% CI, −2.35 kg to −4.163 kg, p = 0.02). This meta-analysis found statistically significant effects of Phaseolus vulgaris supplementation on body weight and body fat.

  7. Systematic Review and Meta-Analysis of a Proprietary Alpha-Amylase Inhibitor from White Bean (Phaseolus vulgaris L. on Weight and Fat Loss in Humans

    Directory of Open Access Journals (Sweden)

    Jay Udani

    2018-04-01

    Full Text Available The aim of this meta-analysis was to examine the evidence for the effectiveness of a proprietary alpha-amylase inhibitor from white bean (Phaseolus vulgaris L. supplementation interventions in humans on modification of body weight and fat mass. A systematic literature search was performed using three databases: PubMed, the Cochrane collaboration, and Google Scholar. In addition, the manufacturer was contacted for internal unpublished data, and finally, the reference section of relevant original research and review papers were mined for additional studies. Eleven studies were selected for the meta-analysis of weight loss (a total of 573 subjects, and three studies for the meta-analysis of body fat reduction (a total of 110 subjects, as they fulfilled the inclusion criteria. Phaseolus vulgaris supplementation showed an average effect on weight loss difference of −1.08 kg (95% CI (confidence interval, −0.42 kg to −1.16 kg, p < 0.00001, and the average effect on body fat reduction was 3.26 kg (95% CI, −2.35 kg to −4.163 kg, p = 0.02. This meta-analysis found statistically significant effects of Phaseolus vulgaris supplementation on body weight and body fat.

  8. Controle de plantas daninhas com herbicidas na cultura do feijão (Phaseolus vulgaris L. Weed control in beans (Phaseolus vulgaris L. with herbicides

    Directory of Open Access Journals (Sweden)

    L.S.P. Cruz

    1981-12-01

    Full Text Available Foi realizada uma pesquisa em 1970, para se conhecer os efeitos de três herbicidas aplicados em pré-plantio incorporado (EPTC a 3,60 kg/ha, nitralin e trifluralin a 0,76 kg/ha e de um em pré-emergência (fluorodifen a 3,00 kg/ha na cultura de feijão comparados com uma testemunha sem herbicida. As duas gramíneas presentes no ensaio, Eleusine indica (L. Gaertn. e Digitaria sanguinalis (L. Scop. foram eficientemente controladas por todos os herbicidas, com indices de controle superiores a 87,00%, em contagem de plantas daninhas realizada 29 dias após a aplicação dos herbicidas. Dentre as dicotiledóneas presentes, Amaranthus viridis L. também foi eficientemente controlado por todos os herbicidas, com indices de controle superiores a 92,00%. Ageratum conyzoides L. foi eficientemente controlado por fluorodifen (91,60% e regularmente por EPTC (78,99% e por nitralin (79,83%. Trifluralin não foi eficiente contra A. conyzoides L. Nenhum dos herbicidas testados controlou Ipomoea sp e Chenopodium ambrosioides L., também presentes no experimento. EPTC e nitralin apresentaram as menores porcentagens de infestação geral de plantas daninhas, tendo, aos 51 dias da aplicação dos produtos, quando suas parcelas foram capinadas mecanicamente, 8,00 e 17,00% de infestação, respectivamente. Trifluralin e fluorodifen precisaram de limpeza aos 42 dias da aplicação, e a testemunha já aos 29 dias, pois apresentavam parcelas com 25,00%, ou mais, de infestação, naquelas épocas. Os herbicidas experimentados não foram prejudiciais à germinação e ao desenvolvimento vegetativo dos feijoeiros, assim como à sua produção de grãos.The weed control with herbicides in beans crop was studied during 1970 year, in Campinas-SP, on a sandy-loam soil. The treatments employed were EPTC at 3.60 kg/ha, nitralin and trifluralin at 0.76 kg/ha, all applied in preplant i •porated; fluorodifen in preemergence at 3.00 kg/ha and a hoed check. Among the weeds

  9. Querying and Serving N-gram Language Models with Python

    Directory of Open Access Journals (Sweden)

    2009-06-01

    Full Text Available Statistical n-gram language modeling is a very important technique in Natural Language Processing (NLP and Computational Linguistics used to assess the fluency of an utterance in any given language. It is widely employed in several important NLP applications such as Machine Translation and Automatic Speech Recognition. However, the most commonly used toolkit (SRILM to build such language models on a large scale is written entirely in C++ which presents a challenge to an NLP developer or researcher whose primary language of choice is Python. This article first provides a gentle introduction to statistical language modeling. It then describes how to build a native and efficient Python interface (using SWIG to the SRILM toolkit such that language models can be queried and used directly in Python code. Finally, it also demonstrates an effective use case of this interface by showing how to leverage it to build a Python language model server. Such a server can prove to be extremely useful when the language model needs to be queried by multiple clients over a network: the language model must only be loaded into memory once by the server and can then satisfy multiple requests. This article includes only those listings of source code that are most salient. To conserve space, some are only presented in excerpted form. The complete set of full source code listings may be found in Volume 1 of The Python Papers Source Codes Journal.

  10. Streptococcus mutans: a new Gram-positive paradigm?

    Science.gov (United States)

    Quivey, Robert G.; Koo, Hyun; Abranches, Jacqueline

    2013-01-01

    Despite the enormous contributions of the bacterial paradigms Escherichia coli and Bacillus subtilis to basic and applied research, it is well known that no single organism can be a perfect representative of all other species. However, given that some bacteria are difficult, or virtually impossible, to cultivate in the laboratory, that some are recalcitrant to genetic and molecular manipulation, and that others can be extremely dangerous to manipulate, the use of model organisms will continue to play an important role in the development of basic research. In particular, model organisms are very useful for providing a better understanding of the biology of closely related species. Here, we discuss how the lifestyle, the availability of suitable in vitro and in vivo systems, and a thorough understanding of the genetics, biochemistry and physiology of the dental pathogen Streptococcus mutans have greatly advanced our understanding of important areas in the field of bacteriology such as interspecies biofilms, competence development and stress responses. In this article, we provide an argument that places S. mutans, an organism that evolved in close association with the human host, as a novel Gram-positive model organism. PMID:23393147

  11. High-level fluorescence labeling of gram-positive pathogens.

    Directory of Open Access Journals (Sweden)

    Simone Aymanns

    Full Text Available Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10-50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration.

  12. TSTA loop operation with 100 grams-level of tritium

    International Nuclear Information System (INIS)

    Yoshida, Hiroshi; Hirata, Shingo; Naito, Taisei

    1988-10-01

    The first loop operation tests of Tritium Systems Test Assembly (TSTA) with 100 grams-level of tritium were carried out at Los Alamos National Laboratory(LANL) on June and July, 1987. The tests were one of the milestones for TSTA goal scheduled in June, 1987 through June, 1988. The objectives were (i) to operate TSTA process loop composed of tritium supply system, fuel gas purification system, hydrogen isotope separation system, etc, (ii) to demonstrate TSTA safety subsystems such as secondary containment system, tritium waste treatment system and tritium monitoring system, and (iii) to accumulate handling experience of a large amount of tritium. This report describes the plan and procedures of the milestone run done in June and the summary results especially on the safety aspects. Analysis of the emergency shutdown of the process loop, which happened in the June run, is also reported. A brief description of the process and safety subsystems as well as the summary of the TSTA safety analysis report is included. (author)

  13. Detection and Antibiotic Susceptibility Pattern of Biofilm Producing Gram Positive and Gram Negative Bacteria Isolated From a Tertiary Care Hospital of Pakistan

    Directory of Open Access Journals (Sweden)

    Iqbal, M.

    2011-01-01

    Full Text Available Microorganisms adhere to non-living material or living tissue, and form biofilms made up of extracellular polymers/slime. Biofilm-associated microorganisms behave differently from free-floating bacteria with respect to growth rates and ability to resist antimicrobial treatments and therefore pose a public health problem. The objective of this study is to detect the prevalence of biofilm producers among Gram positive and Gram negative bacteria isolated from clinical specimens, and to study their antimicrobial susceptibility pattern. The study was carried out from October 2009 to March 2010, at the Department of Microbiology, Army Medical College/ National University of Sciences and Technology (NUST, Rawalpindi, Pakistan. Clinical specimens were received from various wards of a tertiary care hospital. These were dealt by standard microbiological procedures. Gram positive and Gram negative bacteria isolated were subjected to biofilm detection by congo red agar method (CRA. Antimicrobial susceptibility testing of those isolates, which showed positive results (slime production, was done according to the Kirby-Bauer disc diffusion technique. A total of 150 isolates were tested for the production of biofilm/slime. Among them, 81 isolates showed positive results. From these 81, 51 were Gram positive and 30 were Gram negative. All the 81(54% slime producers showed reduced susceptibility to majority of antibiotics. Bacterial biofilms are an important virulence factor associated with chronic nosocomial infection. Detection of biofilm forming organisms can help in appropriate antibiotic choice.

  14. In vitro activity of XF-73, a novel antibacterial agent, against antibiotic-sensitive and -resistant Gram-positive and Gram-negative bacterial species.

    Science.gov (United States)

    Farrell, David J; Robbins, Marion; Rhys-Williams, William; Love, William G

    2010-06-01

    The antibacterial activity of XF-73, a dicationic porphyrin drug, was investigated against a range of Gram-positive and Gram-negative bacteria with known antibiotic resistance profiles, including resistance to cell wall synthesis, protein synthesis, and DNA and RNA synthesis inhibitors as well as cell membrane-active antibiotics. Antibiotic-sensitive strains for each of the bacterial species tested were also included for comparison purposes. XF-73 was active [minimum inhibitory concentration (MIC) 0.25-4 mg/L] against all of the Gram-positive bacteria tested, irrespective of the antibiotic resistance profile of the isolates, suggesting that the mechanism of action of XF-73 is unique compared with the major antibiotic classes. Gram-negative activity was lower (MIC 1 mg/L to > 64 mg/L). Minimum bactericidal concentration data confirmed that the activity of XF-73 was bactericidal. Time-kill kinetics against healthcare-associated and community-associated meticillin-resistant Staphylococcus aureus isolates demonstrated that XF-73 was rapidly bactericidal, with > 5 log(10) kill obtained after 15 min at 2 x MIC, the earliest time point sampled. The post-antibiotic effect (PAE) for XF-73 under conditions where the PAE for vancomycin was 5.4 h. XF-73 represents a novel broad-spectrum Gram-positive antibacterial drug with potentially beneficial characteristics for the treatment and prevention of Gram-positive bacterial infections. 2010. Published by Elsevier B.V.

  15. Bactérias gram negativas resistentes a antimicrobianos em alimentos Gram-negative bacteria resistant to antibiotics in foods

    Directory of Open Access Journals (Sweden)

    José Cavalcante de Albuquerque Ribeiro Dias

    1985-12-01

    Full Text Available A partir de 154 espécimens de alimentos, representados por hortaliças (alface, leite e merenda escolar, obteve-se o isolamento e identificação de 400 amostras de bacilos Gram negativos. Esta amostragem se distribuiu em 339 enterobactérias (Escherichia, Shigella, Citrobacter, Klebsiella, Enterobacter, Serratia e Proteus e 61 de gêneros afins (Acinetobacter, Flavobacterium, Aeromonas e Pseudomonas. Submetendo-se as culturas aos antimicrobianos: sulfadiazina (Su, estreptomicina (Sm, tetraciclina (Tc, cloranfenicol (Cm, canamicina (Km, ampicilina (Ap, ácido nalidíxico (Nal e gentamicina (Gm, observou-se apenas seis estirpes sensíveis a todas as drogas e sensibilidade absoluta à Gm. A predominância dos modelos Su (27,6% e Su-Ap (39,6% incidiu nas enterobactérias, enquanto que, 18,0% para Ap e 9,8% para Su-Ap foram detectados nos gêneros afins. Para caracterização da resistência foram realizados testes de conjugação e a totalidade das culturas não revelou transferência para o gene que confere resistência ao ácido nalidíxico. Relevantes são as taxas de amostras R+ observadas nos bacilos entéricos, oscilando em torno de 90% (leite e merenda escolar e alface, em torno de 70%From 154 food samples, including vegetables (lettuce, milk and meals served at school it was possible to isolate and identify 400 Gram negative bacilli distributed among 339 enteric bacteria (Escherichia, Shigella, Citrobacter, Klebsiella, Enterobacter, Serratia and Proteus and other 61 non enteric bacilli (Acinetobacter, Flavobacterium, Aeromonas and Pseudomonas. Submitting this cultures to the drugs sulfadiazine (Su, streptomycin (Sm, tetracycline (Tc, chloramphenicol (Cm, kanamycin (Km, ampicillin (Ap, nalidixic acid (Nal and gentamycin (Gm it was observed only six stocks susceptible to all drugs and total sensibility to Gm. Among enteric bacteria the profiles Su (27,6% and Su-Ap (39,6% predominated, while for the non enteric bacilli percentages of 18.0 for

  16. Lack of clinical utility of urine gram stain for suspected urinary tract infection in pediatric patients.

    Science.gov (United States)

    Cantey, Joseph B; Gaviria-Agudelo, Claudia; McElvania TeKippe, Erin; Doern, Christopher D

    2015-04-01

    Urinary tract infection (UTI) is one of the most common infections in children. Urine culture remains the gold standard for diagnosis, but the utility of urine Gram stain relative to urinalysis (UA) is unclear. We reviewed 312 pediatric patients with suspected UTI who had urine culture, UA, and urine Gram stain performed from a single urine specimen. UA was considered positive if ≥10 leukocytes per oil immersion field were seen or if either nitrates or leukocyte esterase testing was positive. Urine Gram stain was considered positive if any organisms were seen. Sensitivity, specificity, and positive and negative predictive values were calculated using urine culture as the gold standard. Thirty-seven (12%) patients had a culture-proven UTI. Compared to urine Gram stain, UA had equal sensitivity (97.3% versus 97.5%) and higher specificity (85% versus 74%). Empirical therapy was prescribed before the Gram stain result was known in 40 (49%) patients and after in 42 (51%) patients. The antibiotics chosen did not differ between the two groups (P=0.81), nor did they differ for patients with Gram-negative rods on urine Gram stain compared to those with Gram-positive cocci (P=0.67). From these data, we conclude that UA has excellent negative predictive value that is not enhanced by urine Gram stain and that antibiotic selection did not vary based on the urine Gram stain result. In conclusion, the clinical utility of urine Gram stain does not warrant the time or cost it requires. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Bioremediation and reclamation of soil contaminated with petroleum oil hydrocarbons by exogenously seeded bacterial consortium: a pilot-scale study.

    Science.gov (United States)

    Mukherjee, Ashis K; Bordoloi, Naba K

    2011-03-01

    Spillage of petroleum hydrocarbons causes significant environmental pollution. Bioremediation is an effective process to remediate petroleum oil contaminant from the ecosystem. The aim of the present study was to reclaim a petroleum oil-contaminated soil which was unsuitable for the cultivation of crop plants by using petroleum oil hydrocarbon-degrading microbial consortium. Bacterial consortium consisting of Bacillus subtilis DM-04 and Pseudomonas aeruginosa M and NM strains were seeded to 20% (v/w) petroleum oil-contaminated soil, and bioremediation experiment was carried out for 180 days under laboratory condition. The kinetics of hydrocarbon degradation was analyzed using biochemical and gas chromatographic (GC) techniques. The ecotoxicity of the elutriates obtained from petroleum oil-contaminated soil before and post-treatment with microbial consortium was tested on germination and growth of Bengal gram (Cicer aretinum) and green gram (Phaseolus mungo) seeds. Bacterial consortium showed a significant reduction in total petroleum hydrocarbon level in contaminated soil (76% degradation) as compared to the control soil (3.6% degradation) 180 days post-inoculation. The GC analysis confirmed that bacterial consortium was more effective in degrading the alkane fraction compared to aromatic fraction of crude petroleum oil hydrocarbons in soil. The nitrogen, sulfur, and oxygen compounds fraction was least degraded. The reclaimed soil supported the germination and growth of crop plants (C. aretinum and P. mungo). In contrast, seeds could not be germinated in petroleum oil-contaminated soil. The present study reinforces the application of bacterial consortium rather than individual bacterium for the effective bioremediation and reclamation of soil contaminated with petroleum oil.

  18. The characterization of a new set of EST-derived simple sequence repeat (SSR markers as a resource for the genetic analysis of Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Borba Tereza CO

    2011-05-01

    Full Text Available Abstract Background Over recent years, a growing effort has been made to develop microsatellite markers for the genomic analysis of the common bean (Phaseolus vulgaris to broaden the knowledge of the molecular genetic basis of this species. The availability of large sets of expressed sequence tags (ESTs in public databases has given rise to an expedient approach for the identification of SSRs (Simple Sequence Repeats, specifically EST-derived SSRs. In the present work, a battery of new microsatellite markers was obtained from a search of the Phaseolus vulgaris EST database. The diversity, degree of transferability and polymorphism of these markers were tested. Results From 9,583 valid ESTs, 4,764 had microsatellite motifs, from which 377 were used to design primers, and 302 (80.11% showed good amplification quality. To analyze transferability, a group of 167 SSRs were tested, and the results showed that they were 82% transferable across at least one species. The highest amplification rates were observed between the species from the Phaseolus (63.7%, Vigna (25.9%, Glycine (19.8%, Medicago (10.2%, Dipterix (6% and Arachis (1.8% genera. The average PIC (Polymorphism Information Content varied from 0.53 for genomic SSRs to 0.47 for EST-SSRs, and the average number of alleles per locus was 4 and 3, respectively. Among the 315 newly tested SSRs in the BJ (BAT93 X Jalo EEP558 population, 24% (76 were polymorphic. The integration of these segregant loci into a framework map composed of 123 previously obtained SSR markers yielded a total of 199 segregant loci, of which 182 (91.5% were mapped to 14 linkage groups, resulting in a map length of 1,157 cM. Conclusions A total of 302 newly developed EST-SSR markers, showing good amplification quality, are available for the genetic analysis of Phaseolus vulgaris. These markers showed satisfactory rates of transferability, especially between species that have great economic and genomic values. Their diversity

  19. Physiological and sanity seed quality of common beans (Phaseolus vulgaris L. from Goias state / Qualidade fisiológica e sanitária de sementes de feijoeiro (Phaseolus vulgaris L. provenientes do estado de Goiás

    Directory of Open Access Journals (Sweden)

    Myrna Hilal Moraes

    2008-08-01

    Full Text Available The common beans (Phaseolus vulgaris L. is a fabacea sufficiently spread out in all domestic territory. However, the quality of its seeds represents one of the main causes of low productivity in the beans farmings in Brazil. The objective of this work was to evaluate physiological and sanitary seed qualities of eleven bean cultivars. The physiological seed quality was evaluated trough standard germination and vigor tests. The sanitary seed quality was evaluated through two tests: blotter test was employed to evaluate fungi incidence and “Koch & Menten” method was employed to observe Sclerotinia sclerotiorum (Lib de Bary occurrence. Xamego, BRS Valente, Bambu and Pérola had the best results of physiological tests. Jalo Precoce, Roxo 90, Corrente and Aporé had no good results of vigor and germination, besides presenting the lowest indices of died seeds. Fusarium sp., Aspergillus spp., Penicillium sp., Phoma sp., Rhizopus sp. and Botrytis sp. were the fungi detected in the sanity tests.O feijoeiro comum (Phaseolus vulgaris L. é uma fabacea bastante difundida em todo território nacional. A baixa qualidade de suas sementes representa uma das principais causas de baixa produtividade nas lavouras de feijão no Brasil. O objetivo deste trabalho foi avaliar a qualidade fisiológica e sanitária de sementes de nove cultivares de feijão provenientes do Estado de Goiás. A qualidade fisiológica das sementes foi avaliada através dos testes de germinação e vigor, e a análise sanitária, através dos métodos de papel de filtro, para verificar a ocorrência de fungos em geral, e do método de Koch e Menten, para a avaliação de Sclerotinia sclerotiorum (Lib de Bary. As cultivares que tiveram os melhores desempenhos nos testes fisiológicos foram Xamego, BRS Radiante, Bambu e Pérola. As cultivares Jalo Precoce, Roxo 90, Corrente e Aporé apresentaram baixos índices de vigor e germinação de plântulas normais, além de apresentarem os maiores

  20. Determinação do coeficiente cultural (Kc do feijoeiro (Phaseolus vulgaris L., em Campos dos Goytacazes, RJ Determination of the crop coefficient (Kc for common bean (Phaseolus vulgaris L. in Campos dos Goytacazes, RJ

    Directory of Open Access Journals (Sweden)

    José C. Mendonça

    2007-10-01

    Full Text Available A evapotranspiração de uma cultura é uma das principais informações exigidas para o manejo de irrigação e para fins de planejamento do uso da água. Dentre as abordagens disponíveis para a estimativa do consumo de água pelas plantas, destaca-se o uso de coeficientes de cultura (Kc associados a estimativas da evapotranspiração de referência (ETo. Buscou-se determinar, aqui, os valores de Kc para as diferentes fases fenológicas do feijoeiro comum (Phaseolus vulgaris L., cultivar em lançamento UENF-47, através da utilização de um lisímetro de pesagem e compará-los com os valores propostos pela FAO 56. Concluiu-se que as equações de ajustamento propostas por Allen et al. (1998 se mostraram eficientes para a correção e ajustamento dos coeficientes culturais obtidos neste experimento e que os coeficientes culturais das fases 3 (Kc méd e 4 (Kc fim sugeridos também por Allen et al. (1998 se ajustaram bem ��s condições de cultivo do feijoeiro cultivado no período de outono/inverno, em Campos dos Goytacazes, RJ.The evapotranspiration of a crop is one of the main information required for proper irrigation management and to develop an efficient water usage plan. Among the methods to estimate the amount of water that is consumed by plants, the use of crop coefficients (Kc, associated with estimates of the reference evapotranspiration (ETo, stands as one of the most promising. This work aimed to deterime the values of Kc for different phenological phases of common bean plants (Phaseolus vulgaris L. of the cultivar UENF-47. Determination of Kc values was performed using a weighing lisimeter and results were compared with values obtained through the FAO 56 standard. Results showed that the adjustment equations proposed by Allen et al. (1998 were adequate for fitting the values of Kc obtained in this experiment. It has been shown that the crop coefficients for phenological phases 3 and 4 proposed by Allen et al. (1998 are adequate

  1. Utilisation des mutations induites pour l'étude de l'embryogenèse chez le haricot Phaseolus vulgaris L. et deux plantes modèles Arabidopsis thaliana (L. Heynh. et Zea mays L.

    Directory of Open Access Journals (Sweden)

    Silué, S.

    2011-01-01

    Full Text Available Use of induced mutations in embryogenesis study in bean Phaseolus vulgaris L. and two model plants, Arabidopsis thaliana (L. Heynh. and Zea mays L.. Breeding of common bean, Phaseolus vulgaris L., through interspecific hybridizations with the species Phaseolus coccineus L. and Phaseolus polyanthus Greenm. as female parents leads to the abortion of immature embryos. Identification of genes required for embryo development could partly explain the abortion of hybrid embryos; induced mutations could thus be an alternative to identify key genes involved in Phaseolus embryogenesis. This paper is a review which shows a few examples of the use of induced mutations in the identification of essential genes for embryogenesis in two model plants, Arabidopsis thaliana (L. Heyhn. for dicots and Zea mays L. for monocots. In these two species, embryo development mutants have been isolated using insertional mutagenesis and chemical mutagenesis with Ethyl Methane Sulfonate (EMS. Arabidopsis embryo mutants are affected in apical-basal axis polarity, radial pattern and in post-embryonic stages. Some Arabidopsis embryo mutants are defected in auxin signalisation. In maize, defective kernel (dek mutants are affected in the embryo and the endosperm, while in embryo specific (emb mutants, only the embryo is affected. In common bean, plants deficient in seed development were isolated using EMS mutagenesis. Embryos inside the seeds fail to growth at different stages of development and show abnormalities mainly in the suspensor and the cotyledons.

  2. A Comparison of Heat versus Methanol Fixation for Gram Staining Bacteria

    Science.gov (United States)

    Minnerath, Jeanne M.; Roland, Jenna M.; Rossi, Lucas C.; Weishalla, Steven R.; Wolf, Melissa M.

    2009-01-01

    Gram staining bacteria is a fundamental technique introduced in general biology and microbiology laboratory courses. Two common problems students encounter when Gram staining bacteria are (1) having a difficult time locating bacterial cells on the microscope slide and (2) over-decolorizing bacterial cells during the staining procedure such that…

  3. Tundmatud kohad ja asjade loomus / Katrine Gram Sloth, Johna Hansen ; intervjueerinud Laura Põld

    Index Scriptorium Estoniae

    Gram Sloth, Katrine, 1983-

    2016-01-01

    Taani kunstnik Katrine Gram Sloth ja Rootsi arhitekt Johna Hansen räägivad oma lapsepõlvest, kunstnikuteest, loomingust. Johna Hanseni jaapanipärasest einelaua installatsioonist "Laud" (2015-2016), Katrine Gram Slothi Islandil loodud teosest "Vista Revisited" (2015)

  4. Gram-scale fractionation of nanodiamonds by density gradient ultracentrifugation

    KAUST Repository

    Peng, Wei

    2013-01-01

    Size is a defining characteristic of nanoparticles; it influences their optical and electronic properties as well as their interactions with molecules and macromolecules. Producing nanoparticles with narrow size distributions remains one of the main challenges to their utilization. At this time, the number of practical approaches to optimize the size distribution of nanoparticles in many interesting materials systems, including diamond nanocrystals, remains limited. Diamond nanocrystals synthesized by detonation protocols-so-called detonation nanodiamonds (DNDs)-are promising systems for drug delivery, photonics, and composites. DNDs are composed of primary particles with diameters mainly <10 nm and their aggregates (ca. 10-500 nm). Here, we introduce a large-scale approach to rate-zonal density gradient ultracentrifugation to obtain monodispersed fractions of nanoparticles in high yields. We use this method to fractionate a highly concentrated and stable aqueous solution of DNDs and to investigate the size distribution of various fractions by dynamic light scattering, analytical ultracentrifugation, transmission electron microscopy and powder X-ray diffraction. This fractionation method enabled us to separate gram-scale amounts of DNDs into several size ranges within a relatively short period of time. In addition, the high product yields obtained for each fraction allowed us to apply the fractionation method iteratively to a particular size range of particles and to collect various fractions of highly monodispersed primary particles. Our method paves the way for in-depth studies of the physical and optical properties, growth, and aggregation mechanism of DNDs. Applications requiring DNDs with specific particle or aggregate sizes are now within reach. © 2013 The Royal Society of Chemistry.

  5. Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis

    Science.gov (United States)

    Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.

    2014-01-01

    Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386

  6. Extended-spectrum ß-lactamases in gram negative bacteria

    Directory of Open Access Journals (Sweden)

    Deepti Rawat

    2010-01-01

    Full Text Available Extended-spectrum ß-lactamases (ESBLs are a group of plasmid-mediated, diverse, complex and rapidly evolving enzymes that are posing a major therapeutic challenge today in the treatment of hospitalized and community-based patients. Infections due to ESBL producers range from uncomplicated urinary tract infections to life-threatening sepsis. Derived from the older TEM is derived from Temoniera, a patient from whom the strain was first isolated in Greece. ß-lactamases, these enzymes share the ability to hydrolyze third-generation cephalosporins and aztreonam and yet are inhibited by clavulanic acid. In addition, ESBL-producing organisms exhibit co-resistance to many other classes of antibiotics, resulting in limitation of therapeutic option. Because of inoculum effect and substrate specificity, their detection is also a major challenge. At present, however, organizations such as the Clinical and Laboratory Standards Institute (formerly the National Committee for Clinical Laboratory Standards provide guidelines for the detection of ESBLs in Klebsiella pneumoniae, K. oxytoca, Escherichia coli and Proteus mirabilis. In common to all ESBL-detection methods is the general principle that the activity of extended-spectrum cephalosporins against ESBL-producing organisms will be enhanced by the presence of clavulanic acid. Carbapenems are the treatment of choice for serious infections due to ESBL-producing organisms, yet carbapenem-resistant isolates have recently been reported. ESBLs represent an impressive example of the ability of gram-negative bacteria to develop new antibiotic-resistance mechanisms in the face of the introduction of new antimicrobial agents. Thus there is need for efficient infection-control practices for containment of outbreaks; and intervention strategies, e.g., antibiotic rotation to reduce further selection and spread of these increasingly resistant pathogens.

  7. Comparison of Gram and Kopeloff stains in the diagnosis of bacterial vaginosis in pregnancy.

    Science.gov (United States)

    Libman, Michael D; Kramer, Michael; Platt, Robert

    2006-03-01

    Bacterial vaginosis (BV) is commonly diagnosed by using the Nugent score, a semiquantitative scoring system to evaluate bacterial morphotypes on Gram stain of vaginal secretions. Some authors have suggested using the Kopeloff modification of the Gram stain. Asymptomatic BV in pregnancy has been associated with adverse outcomes. We performed both stains on simultaneously collected vaginal smears from 2652 women at 24-26 weeks of gestation. Gram staining gave significantly higher (more abnormal) Nugent scores than Kopeloff staining. Compared to the Kopeloff stain, the number of specimens graded as indeterminate or consistent with BV by Gram stain increased by 29% (469 versus 364, Pstaining was significantly better than Gram staining (agreement=74% versus 63%, intraclass correlation coefficient=0.87 versus 0.79, P<.05, 95% confidence intervals 0.85-0.89 and 0.75-0.82, respectively).

  8. Gram-negative folliculitis. A rare problem or is it underdiagnosed? Case report and literature review

    Directory of Open Access Journals (Sweden)

    Sierra-Téllez Daniela, Ponce-Olivera Rosa María, Tirado-Sánchez Andrés

    2011-07-01

    Full Text Available AbstractGram-negative folliculitis may be the result of prolonged antibacterial treatments in patients with acne and rosacea. It is caused by alteration of facial skin flora and the nasal mucous, a decrease of Gram-positive bacteria and a proliferation of Gram-negative bacteria (for example Escherichia coli, Pseudomonas aeruginosa, Serratia marcescens, Klebsiella sp. and Proteus mirabilis. It should be considered in patients with acne who have not had a clinical improvement after 3-6 months of treatment with tetracyclines. The disease is underestimated, probably because bacteriological studies are rarely requested and the increased use of oral isotretinoin for acne management. One of the most effective treatments for Gram-negative folliculitis is oral isotretinoin (0.5-1 mg / kg / day for 4-5 months. We report the case of Gram negative folliculitis successfully treated with oral isotretinoin.

  9. ISOENZYMATIC POLYMORPHISM AND ACTIVITY OF PEROXIDASES OF COMMON BEAN (Phaseolus vulgaris L. UNDER SALINE STRESS

    Directory of Open Access Journals (Sweden)

    F. BROETTO

    1997-09-01

    crude extract of the different bean cultivars analysed showed different reations to salt concentration in the cultivation procedures as well as a high increasing of peroxidase activity in cv. IAC and JALO.Uma das utilizações da técnica de cultura de tecidos para o melhoramento vegetal é a identificação de linhas de células que apresentem tolerância ao estresse salino. Para se estudar os mecanismos bioquímicos envolvidos na expressão genética da tolerância a salinidade, calos oriundos de eixos embrionários de quatro cultivares de feijão (Phaseolus vulgaris L.; cultivares IAC - carioca, IAPAR 14, JALO-EEP 558, BAT - 93, foram cultivados em meio sólido Murashige & Skoog (1962, suplementado com NaCl nas concentrações de 0, 20, 40, 60 e 80 mM. Após 14 dias de incubação, os calos foram coletados e analisados quanto aos padrões isoenzimáticos e de atividade das peroxidases. Os cultivares BAT e IAPAR apresentaram duas zonas de atividade em comum na região anódica e apenas uma zona enzimática específica a cada um deles (migração mais rápida.Possivelmente as duas zonas anódicas intermediárias sejam produtos do mesmo loco enzimático, porém com alelos diferentes, consequentemente diferentes mobilidades eletroforéticas. O cv. JALO apresentou duas zonas anódicas de atividade em comum com os cultivares IAC e IAPAR com uma zona anódica exclusiva de migração mais lenta, a qual apresentou atividade mais intensa de todos os cultivares analisados. Este cultivar revelou ainda uma zona catódica provavelmente dimérica e heterozigota nos indivíduos de todos os tratamentos aplicados. Provavelmente, esta é a mesma zona que ocorre em homozigose com fixação do alelo lento para os indivíduos de todos os tratamentos efetuados nos cultivares BAT e IAPAR. O cv. IAC apresentou duas bandas anódicas em comum com os cv. IAPAR e JALO. Apresentou também a banda anódica mais rápida em comum com o cv. IAPAR e uma banda anódica exclusiva de migração mais

  10. The bio-positive effects of diagnostic doses of X-rays on growth of phaseolus-vulgaris plant

    Energy Technology Data Exchange (ETDEWEB)

    Mortazavi, S.M.J.; Mehdipour, L.A.; Behnejad, B.B. [Rafsanjan Univ. of Medical Sciences (Iran, Islamic Republic of)

    2006-07-01

    Objective: Plants absorb radioactive elements from phosphate fertilizers, and also from naturally occurring radiation in the soil, air and water. It has long been known that low doses of ionizing radiation evoke stimulatory effects in a wide variety of living organisms. However, as far as we know, there is no published report on the bio-positive effects of diagnostic doses of X-rays on plant growth. The aim of this study was to evaluate the bio-effects of low doses of diagnostic X-rays on growth rate of Phaseolus vulgaris (Pinto) plants. Materials and Methods: Before cultivation, Phaseolus vulgaris (Pinto) seeds were soaked in tap water for 2 days followed by another 2 days of covering under a wet cloth. Four hundred newly cultivated seeds were randomly divided into two groups of 200 plants each. In this experiment, two seeds were cultivated in each dish (100 dishes for irradiation group and 100 for sham-irradiation group). Fifteen days after starting cultivation, newly grown plants were irradiated with X-rays. Plants were exposed to a single dose of X-ray (80 kVp, 80 mAs) for 6 days. On day 29, plants were pulled out from the ' soil. Length of plant stem, length of root, number of leaves and plant weight were measured. Results: The stem length in irradiated and sham-irradiated plants was 296.5{+-}13.57 and 223.96{+-}15.02 mm respectively. This difference was statistically significant (P<0.001). Although the number of leaves in irradiated plants was higher than that of sham-irradiated plants (7.05{+-}0.18 and 6.74{+-}0.19 respectively), the difference was not statistically significant. The stem diameter in irradiated and sham-irradiated plants were 3.52{+-}0.12 and 3.35{+-}0.09 mm respectively, but the difference again was not statistically significant (P<0.00 1). Plant weight in irradiated samples was less than that of non-irradiated plants but it was not statistically significant. Conclusions: The overall results indicate that diagnostic doses of X-rays can

  11. A prospective study of the diagnostic utility of sputum Gram stain in pneumonia.

    Science.gov (United States)

    Anevlavis, Stavros; Petroglou, Niki; Tzavaras, Athanasios; Maltezos, Efstratios; Pneumatikos, Ioannis; Froudarakis, Marios; Anevlavis, Eleftherios; Bouros, Demosthenes

    2009-08-01

    Sputum Gram stain and culture have been said to be unreliable indicators of the microbiological diagnosis of bacterial pneumonia. The etiological diagnosis of pneumonia is surrounded by great degree of uncertainty. This uncertainty should be and can be calculated and incorporated in the diagnosis and treatment. To determine the diagnostic accuracy and diagnostic value of sputum Gram stain in etiological diagnosis and initial selection of antimicrobial therapy of bacterial community acquired pneumonia (CAP). DESIGN-METHOD: Prospective study of 1390 patients with CAP admitted January 2002-June 2008, to our institutions. Of the 1390 patients, 178 (12.8%) fulfilled the criteria for inclusion into this study (good-quality sputa and presence of the same microorganism in blood and sputum cultures which was used as gold standard for assessing the diagnostic accuracy and diagnostic value of sputum Gram stain). The sensitivity of sputum Gram stain was 0.82 for Pneumococcal pneumonia, 0.76 for Staphylococcal pneumonia, 0.79 for Haemophilus influenzae pneumonia and 0.78 for Gram-negative bacilli pneumonia. The specificity of sputum Gram stain was 0.93 for Pneumococcal pneumonia, 0.96 for Staphylococcal pneumonia, 0.96 for H. influenzae pneumonia and 0.95 for Gram-negative bacilli pneumonia. The positive likelihood ratio (LR+) was 11.58 for Pneumococcal pneumonia, 19.38 for Staphylococcal pneumonia, 16.84 for H. influenzae pneumonia, 14.26 for Gram-negative bacilli pneumonia. The negative likelihood ratio (LR-) was 0.20 for Pneumococcal pneumonia, 0.25 for Staphylococcal pneumonia, 0.22 for H. influenzae pneumonia, and 0.23 for Gram-negative bacilli pneumonia. Sputum Gram stain is a dependable diagnostic test for the early etiological diagnosis of bacterial CAP that helps in choosing orthological and appropriate initial antimicrobial therapy.

  12. Should gram stains have a role in diagnosing hip arthroplasty infections?

    Science.gov (United States)

    Johnson, Aaron J; Zywiel, Michael G; Stroh, D Alex; Marker, David R; Mont, Michael A

    2010-09-01

    The utility of Gram stains in diagnosing periprosthetic infections following total hip arthroplasty has recently been questioned. Several studies report low sensitivity of the test, and its poor ability to either confirm or rule out infection in patients undergoing revision total hip arthroplasty. Despite this, many institutions including that of the senior author continue to perform Gram stains during revision total hip arthroplasty. We assessed the sensitivity, specificity, accuracy, and positive and negative predictive values of Gram stains from surgical-site samplings taken from procedures on patients with both infected and aseptic revision total hip arthroplasties. A review was performed on patients who underwent revision total hip arthroplasty between 2000 and 2007. Eighty-two Gram stains were performed on patients who had infected total hip arthroplasties and underwent revision procedures. Additionally, of the 410 revision total hip arthroplasties performed on patients who were confirmed infection-free, 120 Gram stains were performed. Patients were diagnosed as infected using multiple criteria at the time of surgery. Sensitivity, specificity, positive and negative predictive values, and accuracy were calculated from these Gram stain results. The Gram stain demonstrated a sensitivity and specificity of 9.8% and 100%, respectively. In this series, the Gram stain had a negative predictive value of 62%, a positive predictive value of 100%, and an accuracy of 63%. Gram stains obtained from surgical-site samples had poor sensitivity and poor negative predictive value. Based on these findings, as well as those of other authors, we believe that Gram stains should no longer be considered for diagnosing infections in revision total hip arthroplasty. Level III, diagnostic study. See Guidelines for Authors for a complete description of levels of evidence.

  13. Automated Interpretation of Blood Culture Gram Stains by Use of a Deep Convolutional Neural Network.

    Science.gov (United States)

    Smith, Kenneth P; Kang, Anthony D; Kirby, James E

    2018-03-01

    Microscopic interpretation of stained smears is one of the most operator-dependent and time-intensive activities in the clinical microbiology laboratory. Here, we investigated application of an automated image acquisition and convolutional neural network (CNN)-based approach for automated Gram stain classification. Using an automated microscopy platform, uncoverslipped slides were scanned with a 40× dry objective, generating images of sufficient resolution for interpretation. We collected 25,488 images from positive blood culture Gram stains prepared during routine clinical workup. These images were used to generate 100,213 crops containing Gram-positive cocci in clusters, Gram-positive cocci in chains/pairs, Gram-negative rods, or background (no cells). These categories were targeted for proof-of-concept development as they are associated with the majority of bloodstream infections. Our CNN model achieved a classification accuracy of 94.9% on a test set of image crops. Receiver operating characteristic (ROC) curve analysis indicated a robust ability to differentiate between categories with an area under the curve of >0.98 for each. After training and validation, we applied the classification algorithm to new images collected from 189 whole slides without human intervention. Sensitivity and specificity were 98.4% and 75.0% for Gram-positive cocci in chains and pairs, 93.2% and 97.2% for Gram-positive cocci in clusters, and 96.3% and 98.1% for Gram-negative rods. Taken together, our data support a proof of concept for a fully automated classification methodology for blood-culture Gram stains. Importantly, the algorithm was highly adept at identifying image crops with organisms and could be used to present prescreened, classified crops to technologists to accelerate smear review. This concept could potentially be extended to all Gram stain interpretive activities in the clinical laboratory. Copyright © 2018 American Society for Microbiology.

  14. Ozone impact on vegetation: phenolic metabolism modification and oxidative alteration of Rubisco in Phaseolus vulgaris L; Impact de l'ozone sur le vegetal: modification du metabolisme phenolique et alteration de la Rubisco chez Phaseolus vulgaris L.

    Energy Technology Data Exchange (ETDEWEB)

    Kanoun, M.

    2002-04-15

    In order to characterize and quantify, in semi-natural situation, the incidence of atmospheric pollution on some physiological and metabolic functions in plants, the aim of our work was to identify sub-cellular impact markers, in bean (Phaseolus vulgaris L.), able to characterize a chronic and realistic ozone pollution climate. Two criteria were chosen: the foliar phenolic metabolism and the Rubisco, the key enzyme of photosynthesis. Using Open Top Chambers system, we demonstrated that, according to concentration, exposure kinetic and leaf type, ozone could induce amount variations of some constitutive soluble phenolic and the synthesis of new phenolic (iso-flavonoids). In some cases, these disturbances were observed jointly with foliar injuries and/or biomass reduction. Concurrently, this chronic and moderate ozone exposure could also induce carbonyl formation in amino acid residues constitutive of Rubisco small subunit (Rubisco-SSU) and a reduction in the amount of the native Rubisco. The amount of a constitutive kaempferol glucuronide and the ozone-induced oxidative alteration of Rubisco-SSU were selected and tested for the construction of dose-response relationships. Whatever the marker, the linear model was able to describe the relation. For the phenolic response, several exposure indexes were tested. According to their mode of calculation, these exposure forms emphasize more or less the contribution of high ozone concentrations. If, for Rubisco oxidation, the use of the exposure index AOT40 seems relevant, in the case of the phenolic marker, the choice of the right index is leaf type dependant. (author)

  15. Standardization of a rearing procedure of Tetranychus urticae Koch (Acari: Tetranychidae) on bean (Phaseolus vulgaris): plant age and harvest time; Padronizacao da criacao de Tetranychus urticae Koch (Acari: Tetranychidae) em feijoeiro (Phaseolus vulgaris): idade da planta e tempo de colheita

    Energy Technology Data Exchange (ETDEWEB)

    Bustos, Alexander; Cantor, Fernando; Cure, Jose R; Rodriguez, Daniel [Universidade Militar Nueva Granada, Bogota (Colombia). Facutad de Ciencias. Programa de Biologia Aplicada], e-mail: fernando.cantor@unimilitar.edu.co

    2009-09-15

    A rearing technique was standardized to produce Tetranychus urticae Koch on Phaseolus vulgaris (ICA Cerinza variety) as a prey of the predatory mite Phytoseiulus persimilis Athias-Henriot. Two assays were conducted to assess the following variables: the most suitable plant age for mite infestation, and the best time to harvest the mites and re infest the plants. In the first experiment, four, five, six, and seven-week-old plants of P. vulgaris were infested with six T. urticae per foliole. The lower plant stratum exhibited the largest number of mites regardless of plant age. However, four-week old plants had the larger average number of individuals. In the second experiment four-week-old plants were infested with 0.5 female mite/cm{sup 2} of leaf. The number of individuals per instar of T. urticae was recorded weekly. The highest mite production occurred between four and five weeks after infestation, indicating this to be the most suitable for mite harvesting and for plant reinfestation. (author)

  16. Biologia e tabela de vida de Tetranychus desertorum (Acari: Tetranychidae sobre folhas de feijão (Phaseolus vulgaris Biology and life table of Tetranychus desertorum (Acari: Tetranychidae on leaves of kidney bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Edgar Rivero

    2009-03-01

    Full Text Available Biological aspects and life table of the red spider mite, Tetranychus desertorum Banks, 1900, were studied on leaf discs of kidney bean (Phaseolus vulgaris Linnaeus cultivar "Tacarigua" under laboratory conditions (28 ± 2ºC, 70 ± 10% R.H. and 12:12h. Our results showed that total developmental time was 6.8 days for females, with partial duration of immature stages corresponding to 3.8, 1.4, 1.0 and 0.7 for egg, larva, protonymph and deutonymph, respectively. Preoviposition, oviposition and postoviposition periods were 1.1, 8.4 and 1.3 days, respectively; and the higher mean fecundity (6.93 eggs/female/day was observed on day 4. Female mean longevity was 10 days. The life table parameters recorded were: net reproduction rate (Ro = 41.10 individuals; generation time (T = 11.15 days; intrinsic natural growth (r m = 0.144 individuals/female/day, and finite natural increase rate (λ = 1.155 individuals/female. Our findings could be a basis for further studies devoted to determine damage and control strategies for T. desertorum on kidney bean crops.

  17. Pleural effusion adenosine deaminase: a candidate biomarker to discriminate between Gram-negative and Gram-positive bacterial infections of the pleural space

    Directory of Open Access Journals (Sweden)

    Ruolin Li

    2016-05-01

    Full Text Available OBJECTIVES: Delay in the treatment of pleural infection may contribute to its high mortality. In this retrospective study, we aimed to evaluate the diagnostic accuracy of pleural adenosine deaminase in discrimination between Gram-negative and Gram-positive bacterial infections of the pleural space prior to selecting antibiotics. METHODS: A total of 76 patients were enrolled and grouped into subgroups according to Gram staining: 1 patients with Gram-negative bacterial infections, aged 53.2±18.6 years old, of whom 44.7% had empyemas and 2 patients with Gram-positive bacterial infections, aged 53.5±21.5 years old, of whom 63.1% had empyemas. The pleural effusion was sampled by thoracocentesis and then sent for adenosine deaminase testing, biochemical testing and microbiological culture. The Mann-Whitney U test was used to examine the differences in adenosine deaminase levels between the groups. Correlations between adenosine deaminase and specified variables were also quantified using Spearman’s correlation coefficient. Moreover, receiver operator characteristic analysis was performed to evaluate the diagnostic accuracy of pleural effusion adenosine deaminase. RESULTS: Mean pleural adenosine deaminase levels differed significantly between Gram-negative and Gram-positive bacterial infections of the pleural space (191.8±32.1 U/L vs 81.0±16.9 U/L, p<0.01. The area under the receiver operator characteristic curve was 0.689 (95% confidence interval: 0.570, 0.792, p<0.01 at the cutoff value of 86 U/L. Additionally, pleural adenosine deaminase had a sensitivity of 63.2% (46.0-78.2%; a specificity of 73.7% (56.9-86.6%; positive and negative likelihood ratios of 2.18 and 0.50, respectively; and positive and negative predictive values of 70.6% and 66.7%, respectively. CONCLUSIONS: Pleural effusion adenosine deaminase is a helpful alternative biomarker for early and quick discrimination of Gram-negative from Gram-positive bacterial infections of the

  18. Rapid and reliable identification of Gram-negative bacteria and Gram-positive cocci by deposition of bacteria harvested from blood cultures onto the MALDI-TOF plate.

    Science.gov (United States)

    Barnini, Simona; Ghelardi, Emilia; Brucculeri, Veronica; Morici, Paola; Lupetti, Antonella

    2015-06-18

    Rapid identification of the causative agent(s) of bloodstream infections using the matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) methodology can lead to increased empirical antimicrobial therapy appropriateness. Herein, we aimed at establishing an easier and simpler method, further referred to as the direct method, using bacteria harvested by serum separator tubes from positive blood cultures and placed onto the polished steel target plate for rapid identification by MALDI-TOF. The results by the direct method were compared with those obtained by MALDI-TOF on bacteria isolated on solid media. Identification of Gram-negative bacilli was 100 % concordant using the direct method or MALDI-TOF on isolated bacteria (96 % with score > 2.0). These two methods were 90 % concordant on Gram-positive cocci (32 % with score > 2.0). Identification by the SepsiTyper method of Gram-positive cocci gave concordant results with MALDI-TOF on isolated bacteria in 87 % of cases (37 % with score > 2.0). The direct method herein developed allows rapid identification (within 30 min) of Gram-negative bacteria and Gram-positive cocci from positive blood cultures and can be used to rapidly report reliable and accurate results, without requiring skilled personnel or the use of expensive kits.

  19. EFFECT OF SILICATE ON GRAM STAINING AND VIABILITY OF PNEUMOCOCCI AND OTHER BACTERIA

    Science.gov (United States)

    MacLeod, Colin M.; Roe, Amy S.

    1956-01-01

    Application of silicate solutions to living or heat-killed pneumococci and to certain "viridans" streptococci causes their conversion from a Gram-positive to a Gram-negative state. The original staining properties can be restored by suspending the silicate-treated bacteria in alkaline solutions of various salts but not by simple washing in water. Living pneumococci and the strains of streptococci whose staining properties are similarly affected are killed when suspended in silicate solutions. In other Gram-positive species silicate causes conversion to Gram negativity but restoration to positivity occurs upon washing in water. In a third group of Gram-positive organisms silicate has no effect on the Gram reaction. The viability of organisms in these two groups is unaffected by silicate under the conditions employed. No effect on staining or viability of Gram-negative bacteria has been observed. The effects of silicate on staining and viability are inhibited by nutrient broth or whole serum but not by purified serum albumin. Lecithin, choline, and other substituted ammonium compounds also inhibit the effects of silicate on pneumococci. PMID:13306854

  20. Improving Gram stain proficiency in hospital and satellite laboratories that do not have microbiology.

    Science.gov (United States)

    Guarner, Jeannette; Street, Cassandra; Matlock, Margaret; Cole, Lisa; Brierre, Francoise

    2017-03-01

    Consolidation of laboratories has left many hospitals and satellite laboratories with minimal microbiologic testing. In many hospitals and satellite laboratories, Gram stains on primary specimens are still performed despite difficultly in maintaining proficiency. To maintain Gram stain proficiency at a community 450-bed hospital with an active emergency room we designed bimonthly challenges that require reporting Gram staining and morphology of different organisms. The challenges consist of five specimens prepared by the reference microbiology laboratory from cultures and primary specimens. Twenty to 23 medical laboratory scientists participate reading the challenges. Results from the challenges are discussed with each medical laboratory scientists. In addition, printed images from the challenges are presented at huddle to add microbiology knowledge. On the first three challenges, Gram staining was read correctly in 71%-77% of the time while morphology 53%-66%. In the last six challenges correct answers for Gram stain were 77%-99% while morphology 73%-96%. We observed statistically significant improvement when reading Gram stains by providing frequent challenges to medical laboratory scientists. The clinical importance of Gram stain results is emphasized during huddle presentations increasing knowledge and motivation to perform the test for patients.

  1. Resistance trends in gram-negative bacteria: surveillance results from two Mexican hospitals, 2005–2010

    Directory of Open Access Journals (Sweden)

    Morfin-Otero Rayo

    2012-06-01

    Full Text Available Abstract Background Hospital-acquired infections caused by multiresistant gram-negative bacteria are difficult to treat and cause high rates of morbidity and mortality. The analysis of antimicrobial resistance trends of gram-negative pathogens isolated from hospital-acquired infections is important for the development of antimicrobial stewardship programs. The information obtained from antimicrobial resistant programs from two hospitals from Mexico will be helpful in the selection of empiric therapy for hospital-acquired gram-negative infections. Findings Two thousand one hundred thirty two gram-negative bacteria collected between January 2005 and December 2010 from hospital-acquired infections occurring in two teaching hospitals in Mexico were evaluated. Escherichia coli was the most frequently isolated gram-negative bacteria, with >50% of strains resistant to ciprofloxacin and levofloxacin. Klebsiella spp. showed resistance rates similar to Escherichia coli for ceftazidime (33.1% vs 33.2%, but exhibited lower rates for levofloxacin (18.2% vs 56%. Of the samples collected for the third most common gram-negative bacteria, Pseudomonas aeruginosa, >12.8% were resistant to the carbapenems, imipenem and meropenem. The highest overall resistance was found in Acinetobacter spp. Enterobacter spp. showed high susceptibility to carbapenems. Conclusions E. coli was the most common nosocomial gram-negative bacilli isolated in this study and was found to have the second-highest resistance to fluoroquinolones (>57.9%, after Acinetobacter spp. 81.2%. This finding represents a disturbing development in a common nosocomial and community pathogen.

  2. Gram negative wound infection in hospitalised adult burn patients--systematic review and metanalysis-.

    Science.gov (United States)

    Azzopardi, Ernest A; Azzopardi, Elayne; Camilleri, Liberato; Villapalos, Jorge; Boyce, Dean E; Dziewulski, Peter; Dickson, William A; Whitaker, Iain S

    2014-01-01

    Gram negative infection is a major determinant of morbidity and survival. Traditional teaching suggests that burn wound infections in different centres are caused by differing sets of causative organisms. This study established whether Gram-negative burn wound isolates associated to clinical wound infection differ between burn centres. Studies investigating adult hospitalised patients (2000-2010) were critically appraised and qualified to a levels of evidence hierarchy. The contribution of bacterial pathogen type, and burn centre to the variance in standardised incidence of Gram-negative burn wound infection was analysed using two-way analysis of variance. Pseudomonas aeruginosa, Klebsiella pneumoniae, Acinetobacter baumanni, Enterobacter spp., Proteus spp. and Escherichia coli emerged as the commonest Gram-negative burn wound pathogens. Individual pathogens' incidence did not differ significantly between burn centres (F (4, 20) = 1.1, p = 0.3797; r2 = 9.84). Gram-negative infections predominate in burn surgery. This study is the first to establish that burn wound infections do not differ significantly between burn centres. It is the first study to report the pathogens responsible for the majority of Gram-negative infections in these patients. Whilst burn wound infection is not exclusive to these bacteria, it is hoped that reporting the presence of this group of common Gram-negative "target organisms" facilitate clinical practice and target research towards a defined clinical demand.

  3. Gram negative wound infection in hospitalised adult burn patients--systematic review and metanalysis-.

    Directory of Open Access Journals (Sweden)

    Ernest A Azzopardi

    Full Text Available BACKGROUND: Gram negative infection is a major determinant of morbidity and survival. Traditional teaching suggests that burn wound infections in different centres are caused by differing sets of causative organisms. This study established whether Gram-negative burn wound isolates associated to clinical wound infection differ between burn centres. METHODS: Studies investigating adult hospitalised patients (2000-2010 were critically appraised and qualified to a levels of evidence hierarchy. The contribution of bacterial pathogen type, and burn centre to the variance in standardised incidence of Gram-negative burn wound infection was analysed using two-way analysis of variance. PRIMARY FINDINGS: Pseudomonas aeruginosa, Klebsiella pneumoniae, Acinetobacter baumanni, Enterobacter spp., Proteus spp. and Escherichia coli emerged as the commonest Gram-negative burn wound pathogens. Individual pathogens' incidence did not differ significantly between burn centres (F (4, 20 = 1.1, p = 0.3797; r2 = 9.84. INTERPRETATION: Gram-negative infections predominate in burn surgery. This study is the first to establish that burn wound infections do not differ significantly between burn centres. It is the first study to report the pathogens responsible for the majority of Gram-negative infections in these patients. Whilst burn wound infection is not exclusive to these bacteria, it is hoped that reporting the presence of this group of common Gram-negative "target organisms" facilitate clinical practice and target research towards a defined clinical demand.

  4. Molecular cloning and characterization of a gene encoding the proline transporter protein in common bean(Phaseolus vulgaris L.)

    Institute of Scientific and Technical Information of China (English)

    Jibao; Chen; Jing; Wu; Yunfeng; Lu; Yuannan; Cao; Hui; Zeng; Zhaoyuan; Zhang; Lanfen; Wang; Shumin; Wang

    2016-01-01

    As a typical compatible solute, proline is accumulated in plants under environmental stresses. Proline transporter(Pro T) plays an important role in proline distribution between plant organs. Using a candidate gene approach, we cloned a c DNA sequence for Pro T from common bean(Phaseolus vulgaris L.) and designated the gene Pv Pro T. The deduced amino acid sequence of Pv Pro T showed high similarity to Bet/Pro T proteins from other leguminous plants, and the highest similarity was observed with mothbean(Vigna aconitifolia L.) Vu Pro T.Relative quantification of the m RNA level of Pv Pro T using real-time PCR analysis showed that the Pv Pro T transcript level was higher in leaves than in stems and roots of common bean plants subjected to drought and salt stress. Under 20%(w/w) PEG-6000 treatment,drought-resistant plants expressed a higher level of Pv Pro T transcripts than droughtsensitive plants. Although heterologous expression of Pv Pro T in the Escherichia coli mutant mkh13 showed that Pv Pro T exhibited uptake activities for proline and betaine, no betaine content was detected in the common bean. These findings suggest that Pv Pro T plays an important role in the transportation of proline in common bean plants exposed to drought and salt stress.

  5. Efficiency of Trichome-Based Plant Defense in Phaseolus vulgaris Depends on Insect Behavior, Plant Ontogeny, and Structure

    Directory of Open Access Journals (Sweden)

    Zhenlong Xing

    2017-11-01

    Full Text Available Plant trichomes often function as physical barriers in preventing arthropod feeding and oviposition. Even though insects are frequently reported being entrapped and killed by trichome traps, the actual trapping behavior has not yet been described in detail. Capture experiments showed that capture efficiency during the plant's vegetative stage was considerably higher than in the fruiting and cotyledon stages. The ventral surface of the leaf was more effective in trapping flies than other parts of the plant. Capture-events monitoring showed that the mouthparts, legs, and ovipositor of Liriomyza trifolii adults are the body parts involved in entrapment by surface trichomes on Phaseolus vulgaris plants, and subsequently, deter their ability to feed, walk, and oviposit. Of the three main body parts normally affected, mouthparts was found to be the body part most susceptible to the trichomes. Entrapments were most often caused by landing, followed by puncturing or feeding, and occasionally by walking or fighting. Using scanning electron microscopy (SEM and optical microscopy, we determined the susceptible positions of each body part and found that the flies were all trapped by hooked trichomes. This study revealed the process by which leafminer flies are entrapped by surface trichomes of the host plant and evaluated the capture efficiency. The results will contribute to our understanding of physical defenses against herbivores.

  6. Mass spectrometry-based phytochemical screening for hypoglycemic activity of Fagioli di Sarconi beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Pascale, Raffaella; Bianco, Giuliana; Cataldi, Tommaso R I; Kopplin, Philippe-Schmitt; Bosco, Federica; Vignola, Lisiana; Uhl, Jenny; Lucio, Marianna; Milella, Luigi

    2018-03-01

    The present study deals with the evaluation of antidiabetic activities of Fagioli di Sarconi beans (Phaseolus vulgaris), including 21 ecotypes protected by the European Union with the mark PGI (i.e., Protected Geographical Indication), and cultivated in Basilicata (southern Italy). For this purpose, α-glucosidase and α-amylase assays were assessed; among all bean ecotypes, the tight green seed colour of Verdolino extracts exhibited the highest α-glucosidase and α-amylase inhibitory activity with IC 50 =1.1±0.1μg/ml and IC 50 =19.3±1.1μg/ml, respectively. Phytochemical compound screening of all Fagioli di Sarconi beans performed by flow injection-electrospray ionization-ultrahigh resolution mass spectrometry (uHRMS) and based on the calculation of elemental formulas from accurate m/z values, was helpful to annotate specific compounds, such as alkaloids, saponins, flavonoids, and terpenoids, which are most likely responsible for their biological activity. Copyright © 2017. Published by Elsevier Ltd.

  7. Consumer acceptance and aroma characterization of navy bean (Phaseolus vulgaris) powders prepared by extrusion and conventional processing methods.

    Science.gov (United States)

    Szczygiel, Edward J; Harte, Janice B; Strasburg, Gale M; Cho, Sungeun

    2017-09-01

    Food products produced with bean ingredients are gaining in popularity among consumers due to the reported health benefits. Navy bean (Phaseolus vulgaris) powder produced through extrusion can be considered as a resource-efficient alternative to conventional methods, which often involve high water inputs. Therefore, navy bean powders produced with extrusion and conventional methods were assessed for the impact of processing on consumer liking in end-use products and odor-active compounds. Consumer acceptance results reveal significant differences in flavor, texture and overall acceptance scores of several products produced with navy bean powder. Crackers produced with extruded navy bean powder received higher hedonic flavor ratings than those produced with commercial navy bean powder (P < 0.001). GC-O data showed that the commercial powder produced through conventional processing had much greater contents of several aliphatic aldehydes commonly formed via lipid oxidation, such as hexanal, octanal and nonanal with descriptors of 'grassy', 'nutty', 'fruity', 'dusty', and 'cleaner', compared to the extruded powder. Extrusion processed navy bean powders were preferred over commercial powders for certain navy bean powder applications. This is best explained by substantial differences in aroma profiles of the two powders that may have been caused by lipid oxidation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. Physical and chemical characterization of composite flour from canna flour (Canna edulis) and lima bean flour (Phaseolus lunatus)

    Science.gov (United States)

    Praseptiangga, Danar; Tryas, Anisha Ayuning; Affandi, Dian Rachmawanti; Atmaka, Windi; Ariyantoro, Achmad Ridwan; Minardi, Slamet

    2018-02-01

    The diversity of Indonesian local food sources has potential to be developed for supporting food security based development of local food diversification. Canna tubers (Canna edulis) and lima beans (Phaseolus lunatus) are two local commodities in Indonesia which under is utilization and has limited assessment to its characteristics. This study aimed at determining the best formula of composite flour based on physical and chemical properties of composite flour produced. There were three formulas, F1 for 85% of canna flour and 15%of lima beans flour, F2 for 70% of canna flour and 30% of lima beans flour and F3 for 55% of canna flour and 45% of lima beans flour. Physical and chemical analyses were conducted and completely randomized design was used. De Garmo analysis was then used to determine the highest effectiveness index from the three formulas developed in this study and F3 demonstrated the highest effectiveness index (0.545) among three formulas evaluated. Thus, formula (F3) was selected as the best composite of the flour developed from canna flour and lima beans flour.

  9. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  10. Physiological and molecular analysis of the interaction between aluminium toxicity and drought stress in common bean (Phaseolus vulgaris)

    Science.gov (United States)

    Yang, Zhong-Bao; Eticha, Dejene; Albacete, Alfonso; Rao, Idupulapati Madhusudana; Roitsch, Thomas; Horst, Walter Johannes

    2012-01-01

    Aluminium (Al) toxicity and drought are two major factors limiting common bean (Phaseolus vulgaris) production in the tropics. Short-term effects of Al toxicity and drought stress on root growth in acid, Al-toxic soil were studied, with special emphasis on Al–drought interaction in the root apex. Root elongation was inhibited by both Al and drought. Combined stresses resulted in a more severe inhibition of root elongation than either stress alone. This result was different from the alleviation of Al toxicity by osmotic stress (–0.60 MPa polyethylene glycol) in hydroponics. However, drought reduced the impact of Al on the root tip, as indicated by the reduction of Al-induced callose formation and MATE expression. Combined Al and drought stress enhanced up-regulation of ACCO expression and synthesis of zeatin riboside, reduced drought-enhanced abscisic acid (ABA) concentration, and expression of NCED involved in ABA biosynthesis and the transcription factors bZIP and MYB, thus affecting the regulation of ABA-dependent genes (SUS, PvLEA18, KS-DHN, and LTP) in root tips. The results provide circumstantial evidence that in soil, drought alleviates Al injury, but Al renders the root apex more drought-sensitive, particularly by impacting the gene regulatory network involved in ABA signal transduction and cross-talk with other phytohormones necessary for maintaining root growth under drought. PMID:22371077

  11. Standardization of a rearing procedure of Tetranychus urticae Koch (Acari: Tetranychidae) on bean (Phaseolus vulgaris): plant age and harvest time

    International Nuclear Information System (INIS)

    Bustos, Alexander; Cantor, Fernando; Cure, Jose R; Rodriguez, Daniel

    2009-01-01

    A rearing technique was standardized to produce Tetranychus urticae Koch on Phaseolus vulgaris (ICA Cerinza variety) as a prey of the predatory mite Phytoseiulus persimilis Athias-Henriot. Two assays were conducted to assess the following variables: the most suitable plant age for mite infestation, and the best time to harvest the mites and re infest the plants. In the first experiment, four, five, six, and seven-week-old plants of P. vulgaris were infested with six T. urticae per foliole. The lower plant stratum exhibited the largest number of mites regardless of plant age. However, four-week old plants had the larger average number of individuals. In the second experiment four-week-old plants were infested with 0.5 female mite/cm 2 of leaf. The number of individuals per instar of T. urticae was recorded weekly. The highest mite production occurred between four and five weeks after infestation, indicating this to be the most suitable for mite harvesting and for plant reinfestation. (author)

  12. Rhizofiltration using sunflower (Helianthus annuus L.) and bean (Phaseolus vulgaris L. var. vulgaris) to remediate uranium contaminated groundwater

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Minhee, E-mail: heelee@pknu.ac.kr [Department of Environmental Geosciences, Pukyong National University, 599-1 Daeyondong, Namgu, Busan 608-737 (Korea, Republic of); Yang, Minjune [Department of Environmental Geosciences, Pukyong National University, 599-1 Daeyondong, Namgu, Busan 608-737 (Korea, Republic of)

    2010-01-15

    The uranium removal efficiencies of rhizofiltration in the remediation of groundwater were investigated in lab-scale experiments. Sunflower (Helianthus annuus L.) and bean (Phaseolus vulgaris L. var. vulgaris) were cultivated and an artificially uranium contaminated solution and three genuine groundwater samples were used in the experiments. More than 80% of the initial uranium in solution and genuine groundwater, respectively, was removed within 24 h by using sunflower and the residual uranium concentration of the treated water was lower than 30 {mu}g/L (USEPA drinking water limit). For bean, the uranium removal efficiency of the rhizofiltration was roughly 60-80%. The maximum uranium removal via rhizofiltration for the two plant cultivars occurred at pH 3-5 of solution and their uranium removal efficiencies exceeded 90%. The lab-scale continuous rhizofiltration clean-up system delivered over 99% uranium removal efficiency, and the results of SEM and EDS analyses indicated that most uranium accumulated in the roots of plants. The present results suggested that the uranium removal capacity of two plants evaluated in the clean-up system was about 25 mg/kg of wet plant mass. Notably, the removal capacity of the root parts only was more than 500 mg/kg.

  13. Biosynthesis, isolation and characterization of {sup 57}Fe-enriched Phaseolus vulgaris ferritin after heterologous expression in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Hoppler, Matthias [ETH Zurich, Laboratory of Human Nutrition, Zurich (Switzerland); Meile, Leo [ETH Zurich, Laboratory of Food Biotechnology, Zurich (Switzerland); Walczyk, Thomas [National University of Singapore, Department of Chemistry and Department of Biochemistry, Singapore (Singapore)

    2008-01-15

    Ferritin is the major iron storage protein in the biosphere. Iron stores of an organism are commonly assessed by measuring the concentration of the protein shell of the molecule in fluids and tissues. The amount of ferritin-bound iron, the more desirable information, still remains inaccessible owing to the lack of suitable techniques. Iron saturation of ferritin is highly variable, with a maximum capacity of 4,500 iron atoms per molecule. This study describes the direct isotopic labeling of a complex metalloprotein in vivo by biosynthesis, in order to measure ferritin-bound iron by isotope dilution mass spectrometry. [{sup 57}Fe]ferritin was produced by cloning and overexpressing the Phaseolus vulgaris ferritin gene pfe in Escherichia coli in the presence of {sup 57}FeCl{sub 2}. Recombinant ferritin was purified in a fully assembled form and contained approximately 1,000 iron atoms per molecule at an isotopic enrichment of more than 95% {sup 57}Fe. We did not find any evidence of species conversion of the isotopic label for at least 5 months of storage at -20 C. Transfer efficiency of enriched iron into [{sup 57}Fe]ferritin of 20% was sufficient to be economically feasible. Negligible amounts of non-ferritin-bound iron in the purified [{sup 57}Fe]ferritin solution allows for use of this spike for quantification of ferritin-bound iron by isotope dilution mass spectrometry. (orig.)

  14. Resistance or tolerance to the golden mosaic virus of bean plant (Phaseolus vulgaris L.), obtained by mutation induction

    International Nuclear Information System (INIS)

    Tulmann Neto, A.

    1979-09-01

    Experiments were carried out with the objective of selecting, evaluation and using induced mutants of Phaseolus vulgaris L. resistant or tolerant to golden mosaic - a virus disease of beans. Seeds from three bean cultivars were treated with gamma-ray or the chemical mutagen ethyl methanesulphonate (EMS). After golden mosaic inoculation of 50,000 M 2 seedlings, in a insectary, screening was made and a tolerant mutant (TMD-1) was selected. Evaluation of TMD-1 was carried out by comparing it with the parent cultivar Carioca, indicating that, although showing lower productivity than the original material, (what prevented it from being used directly on a commercial basis), it maintained the same reaction to rust, bacterial blight, and common mosaic. Studies on the genetic basis of the mutation were also done. The possibility of using this mutant in a plant breeding programme aimed at obtaining resistance to golden mosaic was demonstrated in crosses between TMD-1 and two cultivars, to which transference of tolerance was possible. (Author) [pt

  15. Steady-state room temperature fluorescence and CO/sub 2/ assimilation rates in intact leaves. [Phaseolus vulgaris; Xanthium strumarium

    Energy Technology Data Exchange (ETDEWEB)

    Sharkey, T D

    1985-01-01

    Steady-state room temperature variable fluorescence from leaves was measured as a function of CO/sub 2/ pressure in Xanthium strumarium L. and Phaseolus vulgaris L. Measurements were made in a range of light intensities, at normal and low O/sub 2/ partial pressure and over a range of temperatures. At low CO/sub 2/ pressure fluorescence increased with increasing CO/sub 2/. At higher CO/sub 2/ pressure fluorescence usually decreased with increasing CO/sub 2/ but occasionally increased slightly. The transition CO/sub 2/ pressure between the responses could be changed by changing light, O/sub 2/ pressure, or temperature. This breakpoint in the fluorescence-CO/sub 2/ curve was a reliable indicator of the transition between ribulose 1,5-bisphosphate (RuBP) saturated assimilation and RuBP regeneration limited assimilation. The fluorescence signal was not a reliable indicator of O/sub 2/-insensitive assimilation in these C/sub 3/ species. 21 references, 8 figures.

  16. Canopy reflectance indices and its relationship with yield in common bean plants (Phaseolus vulgaris L.) with phosphorus supply

    International Nuclear Information System (INIS)

    Rodriguez, M.G.; Escalante-Estrada, J.A.; Gonzalez, M.T.R.; Reynolds, M.P.

    2006-01-01

    Common bean plants (Phaseolus vulgaris L.) were grown under three phosphorous levels (0,100 & 200 kg ha-1) and under rain fed conditions with the objective to examine the association between vegetative indices (NDVI, normalized difference vegetation index; and GNDVI, green normalized difference vegetation index) and intercepted radiation, leaf area index, biomass and yield during the growing season. The maximum intercepted radiation, leaf area index (LAI) and biomass were reached during the pod filling stage {80 days after sowing (DAS)}, and the P treatment of 200 kg ha-1 showed the highest values. The high intercepted radiation was derived from an increase in LAI inducing a major biomass accumulation. Near to physiological maturity LAI decreased as a result of leaf abscission. NDVI and GNDVI were higher with P supply than without P at anthesis and pod filling stage (50 - 80 DAS). Near to physiological maturity, NDVI and GNDVI decreased in all the treatments . When the maximum intercepted radiation, LAI, and biomass production were reached during anthesis and pod filling stage, NDVI and GNDVI also had the highest values. The association between the vegetative indices and seed yield during the pod filling stage showed a linear relationship by the P supply. The relationship between GNDVI and seed yield was higher (r2 = 0.77) than the relationship between NDVI and seed yield (r2 = 0.61)

  17. The characteristics of pyrophosphate: D-fructose-6-phosphate 1-phosphotransferases from Sansevieria trifasciata leaves and Phaseolus coccineus stems.

    Science.gov (United States)

    Kowalczyk, S

    1987-01-01

    Three different molecular forms of pyrophosphate-dependent phosphofructokinase have been isolated: one from Sansevieria trifasciata leaves and two from Phaseolus coccineus stems. The form isolated from S. trifasciata has the molecular weight of about 115,000. The apparent molecular weights for the two forms from mung bean were approximately 220,000 and 450,000. All three forms have the same pH optima, an absolute requirement for Mg2+ ions both in the forward and reverse reaction, but differ in their sensitivity toward fructose 2,6-bisphosphate. Kinetic properties of the partially purified enzymes have been investigated in the presence and absence of fructose 2,6-bisphosphate. Pyrophosphate-dependent phosphofructokinase from S. trifasciata exhibited hyperbolic kinetics with all substrates tested. The saturation curves of the enzyme (form A) from mung bean for pyrophosphate, fructose 6-phosphate and fructose 1,6-bisphosphate were sigmoidal in the absence of fructose 2,6-bisphosphate. In the presence of fructose 2,6-bisphosphate these kinetics became hyperbolic.

  18. Desempeño del Phaseolus vulgaris bajo riego parcial cultivado en un sistema de respuesta hidrogravitrópica

    Directory of Open Access Journals (Sweden)

    Emil Cristhian Vega Ponce

    2017-01-01

    Full Text Available In the experimental area of the UNALM (Lima - Perú was evaluated on partial root - zone drying irrigation treatments (RPR300 and RPR500, ml and full irrigation (RC300 a nd RC500, ml control, the impact of xylem potential ( x and stomatal conductance (gs in common bean plants ( Phaseolus vulgaris L. cultivated in systems (pots of hydrogravitropic response. A randomized complete block design with 12 plants/pots per trea tments was used in three replicates. To control the irrigation application and manage to maintain the x nonlethal conditions (< - 15 bars, a water - soil retention curve was generated. The values of gs before irrigation (between 217.18 and 268.67 mm m - 2 s - 1 showed that only RPR500 plants were maintained under optimal water conditions, despite low levels of x (between - 9.92 and - 7.33 bar; situation that could be attributed to the ability of the roots to balance those moments when half of these structures we re inside soil with low humidity, while the opposite half was favorable soil water level.

  19. myo-Inositol synthesis from [1-3H]glucose in Phaseolus vulgaris L. during early stages of germination

    International Nuclear Information System (INIS)

    Sasaki, K.; Taylor, I.E.P.

    1986-01-01

    Radiolabeled D-[1- 3 H]glucose was fed by imbibition under sterile conditions to bean (Phaseolus vulgaris L.) seeds. After 72 and 96 hours of feeding, the 3 H was located in uronic acid and pentose residues as well as hexose residues of cell wall polysaccharides in growing hypocotyl and root. Free myo-inositol present in cotyledons, hypocotyl, and root also contained 3 H, showing that de novo synthesis of myo-inositol from [1- 3 H]glucose did occur during the first 72 hours of germination. More than 90% of the labeled, free myo-inositol was present in the cotyledons. The 3 H percentage in trifluoroacetic acid-soluble arabinaose residues of cell wall polysaccharides from 72-hour-old bean hypocotyls was only half of their mole percentage. On the other hand, 3 H percentages in hexose residues were higher than their mole percentages. The results suggest that myo-inositol is synthesized from reserve sugars during the very early stages of germination, and that the newly synthesized myo-inositol, as well as that stored in cotyledons, can be used for the construction of new hypocotyl and root cell wall polysaccharides after conversion into uronic acids and pentoses via the myo-inositol oxidation pathway

  20. Angiotensin-converting enzyme-inhibitory activity in protein hydrolysates from normal and anthracnose disease-damaged Phaseolus vulgaris seeds.

    Science.gov (United States)

    Hernández-Álvarez, Alan Javier; Carrasco-Castilla, Janet; Dávila-Ortiz, Gloria; Alaiz, Manuel; Girón-Calle, Julio; Vioque-Peña, Javier; Jacinto-Hernández, Carmen; Jiménez-Martínez, Cristian

    2013-03-15

    Bean seeds are an inexpensive source of protein. Anthracnose disease caused by the fungus Colletotrichum lindemuthianum results in serious losses in common bean (Phaseolus vulgaris L.) crops worldwide, affecting any above-ground plant part, and protein dysfunction, inducing the synthesis of proteins that allow plants to improve their stress tolerance. The aim of this study was to evaluate the use of beans damaged by anthracnose disease as a source of peptides with angiotensin-converting enzyme (ACE-I)-inhibitory activity. Protein concentrates from beans spoiled by anthracnose disease and from regular beans as controls were prepared by alkaline extraction and precipitation at isolelectric pH and hydrolysed using Alcalase 2.4 L. The hydrolysates from spoiled beans had ACE-I-inhibitory activity (IC(50) 0.0191 mg protein mL(-1)) and were very similar to those from control beans in terms of ACE-I inhibition, peptide electrophoretic profile and kinetics of hydrolysis. Thus preparation of hydrolysates using beans affected by anthracnose disease would allow for revalorisation of this otherwise wasted product. The present results suggest the use of spoiled bean seeds, e.g. anthracnose-damaged beans, as an alternative for the isolation of ACE-I-inhibitory peptides to be further introduced as active ingredients in functional foods. © 2012 Society of Chemical Industry.

  1. Rhizofiltration using sunflower (Helianthus annuus L.) and bean (Phaseolus vulgaris L. var. vulgaris) to remediate uranium contaminated groundwater

    International Nuclear Information System (INIS)

    Lee, Minhee; Yang, Minjune

    2010-01-01

    The uranium removal efficiencies of rhizofiltration in the remediation of groundwater were investigated in lab-scale experiments. Sunflower (Helianthus annuus L.) and bean (Phaseolus vulgaris L. var. vulgaris) were cultivated and an artificially uranium contaminated solution and three genuine groundwater samples were used in the experiments. More than 80% of the initial uranium in solution and genuine groundwater, respectively, was removed within 24 h by using sunflower and the residual uranium concentration of the treated water was lower than 30 μg/L (USEPA drinking water limit). For bean, the uranium removal efficiency of the rhizofiltration was roughly 60-80%. The maximum uranium removal via rhizofiltration for the two plant cultivars occurred at pH 3-5 of solution and their uranium removal efficiencies exceeded 90%. The lab-scale continuous rhizofiltration clean-up system delivered over 99% uranium removal efficiency, and the results of SEM and EDS analyses indicated that most uranium accumulated in the roots of plants. The present results suggested that the uranium removal capacity of two plants evaluated in the clean-up system was about 25 mg/kg of wet plant mass. Notably, the removal capacity of the root parts only was more than 500 mg/kg.

  2. IMPACT OF LIQUID NITROGEN EXPOSURE ON SELECTED BIOCHEMICAL AND STRUCTURAL PARAMETERS OF HYDRATED Phaseolus vulgaris L. SEEDS.

    Science.gov (United States)

    Cejas, Inaudis; Rivas, Maribel; Nápoles, Lelurlys; Marrero, Pedro; Yabor, Lourdes; Aragón, Carlos; Pérez, Aurora; Engelmann, Florent; Martínez-Montero, Marcos Edel; Lorenzo, José Carlos

    2015-01-01

    It is well known that cryopreserving seeds with high water content is detrimental to survival, but biochemical and structural parameters of cryostored hydrated common bean seeds have not been published. The objective of this work was to study the effect of liquid nitrogen exposure on selected biochemical and structural parameters of hydrated Phaseolus vulgaris seeds. We cryopreserved seeds at various moisture contents and evaluated: germination; electrolyte leakage; fresh seed weight; levels of chlorophyll pigments, malondialdehyde, other aldehydes, phenolics and proteins; thickness of cotyledon epidermis, parenchyma, and starch storage parenchyma; and radicle and plumule lengths. Germination was totally inhibited when seeds were immersed in water for 50 min (moisture content of 38%, FW basis) before cryopreservation. The combined effects of seed water imbibition and cryostorage decreased phenolics (free, cell wall-linked, total), chlorophyll a and protein content. By contrast, electrolyte leakage and levels of chlorophyll b and other aldehydes increased as a result of the combination of these two experimental factors. These were the most significant effects observed during exposure of humid seed to liquid nitrogen. Further studies are still required to clarify the molecular events taking place in plant cells during cryostorage.

  3. Bioremediation model for atrazine contaminated agricultural soils using phytoremediation (using Phaseolus vulgaris L.) and a locally adapted microbial consortium.

    Science.gov (United States)

    Madariaga-Navarrete, Alfredo; Rodríguez-Pastrana, Blanca Rosa; Villagómez-Ibarra, José Roberto; Acevedo-Sandoval, Otilio Arturo; Perry, Gregory; Islas-Pelcastre, Margarita

    2017-06-03

    The objective of the present study was to examine a biological model under greenhouse conditions for the bioremediation of atrazine contaminated soils. The model consisted in a combination of phytoremediation (using Phaseolus vulgaris L.) and rhizopheric bio-augmentation using native Trichoderma sp., and Rhizobium sp. microorganisms that showed no inhibitory growth at 10,000 mg L -1 of herbicide concentration. 33.3 mg of atrazine 50 g -1 of soil of initial concentration was used and an initial inoculation of 1 × 10 9 UFC mL -1 of Rhizobium sp. and 1 × 10 5 conidia mL -1 of Trichoderma sp. were set. Four treatments were arranged: Bean + Trichoderma sp. (B+T); Bean + Rhizobium sp. (BR); Bean + Rhizobium sp. + Trichoderma sp. (B+R+T) and Bean (B). 25.51 mg of atrazine 50 g -1 of soil (76.63%) was removed by the B+T treatment in 40 days (a = 0.050, Tukey). This last indicate that the proposed biological model and methodology developed is useful for atrazine contaminated bioremediation agricultural soils, which can contribute to reduce the effects of agrochemical abuse.

  4. Friend or Foe-Light Availability Determines the Relationship between Mycorrhizal Fungi, Rhizobia and Lima Bean (Phaseolus lunatus L..

    Directory of Open Access Journals (Sweden)

    Daniel J Ballhorn

    Full Text Available Plant associations with root microbes represent some of the most important symbioses on earth. While often critically promoting plant fitness, nitrogen-fixing rhizobia and arbuscular mycorrhizal fungi (AMF also demand significant carbohydrate allocation in exchange for key nutrients. Though plants may often compensate for carbon loss, constraints may arise under light limitation when plants cannot extensively increase photosynthesis. Under such conditions, costs for maintaining symbioses may outweigh benefits, turning mutualist microbes into parasites, resulting in reduced plant growth and reproduction. In natural systems plants commonly grow with different symbionts simultaneously which again may interact with each other. This might add complexity to the responses of such multipartite relationships. We experimented with lima bean (Phaseolus lunatus, which efficiently forms associations with both types of root symbionts. We applied full light and low-light to each of four treatments of microbial inoculation. After an incubation period of 14 weeks, we quantified vegetative aboveground and belowground biomass and number and viability of seeds to determine effects of combined inoculant and light treatment on plant fitness. Under light-limited conditions, vegetative and reproductive traits were inhibited in AMF and rhizobia inoculated lima bean plants relative to controls (un-colonized plants. Strikingly, reductions in seed production were most critical in combined treatments with rhizobia x AMF. Our findings suggest microbial root symbionts create additive costs resulting in decreased plant fitness under light-limited conditions.

  5. Isolation and Characterization of 13 New Polymorphic Microsatellite Markers in the Phaseolus vulgaris L. (Common Bean Genome

    Directory of Open Access Journals (Sweden)

    Aihua Wang

    2012-09-01

    Full Text Available In this study, 13 polymorphic microsatellite markers were isolated from the Phaseolus vulgaris L. (common bean by using the Fast Isolation by AFLP of Sequence COntaining Repeats (FIASCO protocol. These markers revealed two to seven alleles, with an average of 3.64 alleles per locus. The polymorphic information content (PIC values ranged from 0.055 to 0.721 over 13 loci, with a mean value of 0.492, and 7 loci having PIC greater than 0.5. The expected heterozygosity (HE and observed heterozygosity (HO levels ranged from 0.057 to 0.814 and from 0.026 to 0.531, respectively. Cross-species amplification of the 13 prime pairs was performed in its related specie of Vigna unguiculata L. Seven out of all these markers showed cross-species transferability. These markers will be useful for future genetic diversity and population genetics studies for this agricultural specie and its related species.

  6. Sonchus oleraceus Residue Improves Nutritive and Health-Promoting Value of Common Bean ( Phaseolus vulgaris L.): A Metabolic Study.

    Science.gov (United States)

    Hassan, Mahmoud O; Saleh, Ahmed M; AbdElgawad, Hamada

    2018-03-07

    This study was conducted to evaluate the use of the phenolic-rich Sonchus oleraceus residue as an environmentally safe approach to induce the nutritive and health-promoting values of common bean ( Phaseolus vulgaris L. cv. Bronco). S. oleraceus shoot residue, at rates of 150 and 300 g m -2 , has improved soil fertility via accumulation of soil macronutrients, organic matter, organic carbon, and total phenolics. The growth and yield of bean were significantly increased. Moreover, chemical composition of the treated seeds was significantly altered, whereas higher levels of total antioxidant capacity, proteins, carbohydrates, and most of the individual phenolic acids, flavonoids, vitamins, essential amino acids, and unsaturated fatty acids were recorded. Interestingly, a concentration dependent effect was also observed, for instance, a lower saturated-to-unsaturated fatty acid ratio was only observed in the case of the lower residue rate. These findings recommend the use of S. oleraceus in organic farming of bean to enhance the health benefits of the produced seeds.

  7. Interaction between cadmium and iron. Accumulation and distribution of metals and changes in growth parameters of Phaseolus vulgaris L. seedlings

    Directory of Open Access Journals (Sweden)

    Anna Siedlecka

    2014-01-01

    Full Text Available The interaction between cadmium, one of the most toxic heavy metals, and iron, an essential plant nutritional element, was investigated in Phaseolus vulgaris L. (cv. Słowianka seedlings. The interaction was externally induced by changing the content of both metals in the nutrient medium. Under iron deficiency conditions (0 and 0.5 of normal dose of this element, the toxic effects of cadmium on plant growth parameters, like fresh and dry weight accumulation, primary leaves area, etc., were generally much more pronounced than under normal iron supply. At normal and excess iron supply (1, 2 and 4 doses cadmium diminished iron accumulation in roots and primary leaves, but on the other hand excess iron decreased cadmium level, preventing plants from extreme toxicity of very high cadmium concentrations in the growth environment. It is to be noted that iron is classified also as a heavy metal, and its excess may become toxic, e.g. decreasing root dry weight or diminishing leaf area, especially at the highest dose. The detoxication role of iron against cadmium, and possibly other toxic metals is, however, limited to concentrations of this element in the nutrient solution which themselves are not toxic for the organism.

  8. Effect of Dehydration Conditions on the Chemical, Physical, and Rehydration Properties of Instant Whole Bean (Phaseolus vulgaris L. var. Azufrado

    Directory of Open Access Journals (Sweden)

    Juan Alberto Resendiz Vazquez

    2015-01-01

    Full Text Available The purpose of this study was to evaluate the effect of dehydration conditions on the chemical, physical, and rehydration properties of instant whole beans (Phaseolus vulgaris L. var. Azufrado using a 22 factorial design (air temperature: 25°C and 30°C, air velocity: 0.5 m/s and 1.0 m/s. To determine the kinetic parameters, the rehydration data were fitted to three models: Peleg’s, First Order, and Sigmoid. The protein, fat, and ash contents of the beans were not significantly affected (P>0.05 by the dehydration conditions. Of the 11 physical properties of the instant whole beans, only water activity and splitting were significantly affected by dehydration conditions (P0.05 between the observed and predicted equilibrium moisture contents of the instant whole beans. Regarding the rehydration kinetics for the instant whole beans, the activation energy values ranged from 23.56 kJ/mol to 30.48 kJ/mol, depending on the dehydration conditions. The dehydration conditions had no significant effect (P>0.05 on the rehydration properties of instant whole beans.

  9. Breeding for culinary and nutritional quality of common bean (Phaseolus vulgaris L. in intercropping systems with maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Rodino A.P.

    1999-01-01

    Full Text Available Common bean (Phaseolus vulgaris L. is widely intercropped with maize (Zea mays L. in the North of Spain. Breeding beans for multiple cropping systems is important for the development of a productive and sustainable agriculture, and is mainly oriented to minimize intercrop competition and to stabilize complementarity with maize. Most agricultural research on intercropping to date has focused on the agronomic and overall yield effects of the different species, but characters related with socio-economic and food quality aspects are also important. The effect of intercropping beans with maize on food seed quality traits was studied for thirty-five bush bean varieties under different environments in Galicia (Northwestern Spain. Parameters determining Asturian (Northern Spain white bean commercial and culinary quality have also been evaluated in fifteen accessions. There are significant differences between varieties in the selected cropping systems (sole crop, intercrop with field maize and intercrop with sweet maize for dry and soaked seed weight, coat proportion, crude protein, crude fat and moisture. Different white bean accessions have been chosen according to their culinary quality. Under these environmental conditions it appears that intercropping systems with sweet maize give higher returns than sole cropping system. It is also suggested that the culinary and nutritional quality potential of some white bean accessions could be the base material in a breeding programme the objectives of which are to develop varieties giving seeds with high food quality.

  10. Cellulosimicrobium funkei-like enhances the growth of Phaseolus vulgaris by modulating oxidative damage under Chromium(VI toxicity

    Directory of Open Access Journals (Sweden)

    Chinnannan Karthik

    2016-11-01

    Full Text Available Contamination of agriculture land by heavy metals is a worldwide risk that has sped up noticeably since the beginning of the industrial revolution. Hence, there arise the demands of heavy metal tolerant plant growth promoting bacterial strains for specific metal contaminated agricultural sites restoration. In this study, 36 bacterial isolates were screened out from the rhizospheric soil of Phaseolus vulgaris. Among these, two bacterial strains AR6 and AR8 were selected based on their higher Cr(VI tolerance (1200 and 1100 μg/mL, respectively and the maximum production of plant growth promoting substances. In the molecular characterization study, both the bacterial strains showed 99% homology with Cellulosimicrobium funkei KM032184. In greenhouse experiments, the exposure of Cr(VI to P.vulgaris inhibited the growth and photosynthetic pigments and increased the enzymatic and non-enzymatic antioxidant expressions. However, rhizosphere bacterial inoculations alleviated the negative effect of Cr(VI and enhanced the seed germination rate (89.54%, shoot (74.50%,root length (60%, total biomass (52.53%, chlorophyll a (15.91%, chlorophyll b (17.97%, total chlorophyll (16.58% and carotenoid content (3.59%. Moreover, bacterial inoculations stabilized and modulated the antioxidant system of P. vulgaris by reducing the accumulation of Cr in plant tissues. The present finding shows the Cr(VI tolerance and plant growth promoting properties of the rhizosphere bacterial strains which might make them eligible as biofertilizer of metal-contaminated soils.

  11. Evaluation of some residual bioactivities of microencapsulated Phaseolus lunatus protein fraction with carboxymethylated flamboyant (Delonix regia gum/sodium alginate

    Directory of Open Access Journals (Sweden)

    Mukthar Sandovai-Peraza

    2014-12-01

    Full Text Available Recent studies have shown the beneficial effect of peptides, an unexploited source could be Phaseolus lunatus being an important raw material for those functional products in order to improve their utilization. In addition to improve the beneficial effect of bioactive peptides the microencapsulation could be a way to protect the peptides against the environment to which they are exposed. P. lunatus protein fraction (<10 kDa of weight was encapsulated using a blend of carboxymethylated flamboyant gum (CFG and sodium alginate (SA at different concentrations of CaCl2 and hardening times. After in vitro digestion of microcapsules the residual activity, in the intestinal system, both inhibition of agiotensin-converting enzyme (I-ACE and antioxidant activity obtained were in a range of 0.019-0.136 mg/mL and 570.64-813.54 mM of TEAC respectively. The microencapsulation employed CFG/SA blends could be used controlled delivery of peptide fractions with potential use as a nutraceutical or therapeutic agents.

  12. Functional and conformational properties of phaseolin (Phaseolus vulgris L.) and kidney bean protein isolate: a comparative study.

    Science.gov (United States)

    Yin, Shou-Wei; Tang, Chuan-He; Wen, Qi-Biao; Yang, Xiao-Quan

    2010-03-15

    Kidney bean (Phaseolus vulgris L.) seed is an underutilised plant protein source with good potential to be applied in the food industry. Phaseolin (also named G1 globulin) represents about 50 g kg(-1) of total storage protein in the seed. The aim of the present study was to characterise physicochemical, functional and conformational properties of phaseolin, and to compare these properties with those of kidney bean protein isolate (KPI). Compared with kidney bean protein isolate (KPI), the acid-extracted phaseolin-rich protein product (PRP) had much lower protein recovery of 320 g kg(-1) (dry weight basis) but higher phaseolin purity (over 950 g kg(-1)). PRP contained much lower sulfhydryl (SH) and disulfide bond contents than KPI. Differential scanning calorimetry analyses showed that the phaseolin in PRP was less denatured than in KPI. Thermal analyses in the presence or absence of dithiothreitol, in combination with SH and SS content analyses showed the contributions of SS to the thermal stability of KPI. The analyses of near-UV circular dichroism and intrinsic fluorescence spectra indicated more compacted tertiary conformation of the proteins in PRP than in KPI. PRP exhibited much better protein solubility, emulsifying activity index, and gel-forming ability than KPI. The relatively poor functional properties of KPI may be associated with protein denaturation/unfolding, with subsequent protein aggregation. The results presented here suggest the potential for acid-extracted PRP to be applied in food formulations, in view of its functional properties.

  13. Molecular cloning and characterization of a gene encoding the proline transporter protein in common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Jibao Chen

    2016-10-01

    Full Text Available As a typical compatible solute, proline is accumulated in plants under environmental stresses. Proline transporter (ProT plays an important role in proline distribution between plant organs. Using a candidate gene approach, we cloned a cDNA sequence for ProT from common bean (Phaseolus vulgaris L. and designated the gene PvProT. The deduced amino acid sequence of PvProT showed high similarity to Bet/ProT proteins from other leguminous plants, and the highest similarity was observed with mothbean (Vigna aconitifolia L. VuProT. Relative quantification of the mRNA level of PvProT using real-time PCR analysis showed that the PvProT transcript level was higher in leaves than in stems and roots of common bean plants subjected to drought and salt stress. Under 20% (w/w PEG-6000 treatment, drought-resistant plants expressed a higher level of PvProT transcripts than drought-sensitive plants. Although heterologous expression of PvProT in the Escherichia coli mutant mkh13 showed that PvProT exhibited uptake activities for proline and betaine, no betaine content was detected in the common bean. These findings suggest that PvProT plays an important role in the transportation of proline in common bean plants exposed to drought and salt stress.

  14. Utilization of soil and fertilizer zinc by maize (Zea mays) and moong (Phaseolus aureus Roxb.) from some Indian soils

    International Nuclear Information System (INIS)

    Iyengar, B.R.V.; Deb, D.L.

    1977-01-01

    Utilization of soil and fertilizer zinc by maize (Zea mays) and moong (Phaseolus aureus Roxb.) was studied under greenhouse conditions in ten soils belonging to three important soil groups of India viz. alluvial, red and laterite using two levels of labelled zinc sulphate. The efficiency of utilization of fertilizer zinc was found to be higher at 10 ppm level of application in both the crops as compared with 20 ppm level of applied zinc. The total utilization of fertilizer zinc by both the crops in different soils ranged from 0.47 to 1.34 percent and 0.41 to 0.95 percent at 10 and 20 ppm level of applied zinc, respectively. Application of fertilizer zinc resulted in a decrease in the uptake of soil zinc. The utilization of fertilizer zinc was found to be negatively correlated with soil pH but the interaction of different soil characters seemed to have determined the efficiency of fertilizer use by both the crops. The efficiency of fertilizer zinc utilization was found to be low in moong as compared with maize. (author)

  15. Gram staining of protected pulmonary specimens in the early diagnosis of ventilator-associated pneumonia.

    Science.gov (United States)

    Mimoz, O; Karim, A; Mazoit, J X; Edouard, A; Leprince, S; Nordmann, P

    2000-11-01

    We evaluated prospectively the use of Gram staining of protected pulmonary specimens to allow the early diagnosis of ventilator-associated pneumonia (VAP), compared with the use of 60 bronchoscopic protected specimen brushes (PSB) and 126 blinded plugged telescopic catheters (PTC) obtained from 134 patients. Gram stains were from Cytospin slides; they were studied for the presence of microorganisms in 10 and 50 fields by two independent observers and classified according to their Gram stain morphology. Quantitative cultures were performed after serial dilution and plating on appropriate culture medium. A final diagnosis of VAP, based on a culture of > or = 10(3) c.f.u. ml-1, was established after 81 (44%) samplings. When 10 fields were analysed, a strong relationship was found between the presence of bacteria on Gram staining and the final diagnosis of VAP (for PSB and PTC respectively: sensitivity 74 and 81%, specificity 94 and 100%, positive predictive value 91 and 100%, negative predictive value 82 and 88%). The correlation was less when we compared the morphology of microorganisms observed on Gram staining with those of bacteria obtained from quantitative cultures (for PSB and PTC respectively: sensitivity 54 and 69%, specificity 86 and 89%, positive predictive value 72 and 78%, negative predictive value 74 and 84%). Increasing the number of fields read to 50 was associated with a slight decrease in specificity and positive predictive value of Gram staining, but with a small increase in its sensitivity and negative predictive value. The results obtained by the two observers were similar to each other for both numbers of fields analysed. Gram staining of protected pulmonary specimens performed on 10 fields predicted the presence of VAP and partially identified (using Gram stain morphology) the microorganisms growing at significant concentrations, and could help in the early choice of the treatment of VAP. Increasing the number of fields read or having the Gram

  16. Multiplex identification of sepsis-causing Gram-negative pathogens from the plasma of infected blood.

    Science.gov (United States)

    Chung, Boram; Park, Chulmin; Cho, Sung-Yeon; Shin, Juyoun; Shin, Sun; Yim, Seon-Hee; Lee, Dong-Gun; Chung, Yeun-Jung

    2018-02-01

    Early and accurate detection of bacterial pathogens in the blood is the most crucial step for sepsis management. Gram-negative bacteria are the most common organisms causing severe sepsis and responsible for high morbidity and mortality. We aimed to develop a method for rapid multiplex identification of clinically important Gram-negative pathogens and also validated whether our system can identify Gram-negative pathogens with the cell-free plasm DNA from infected blood. We designed five MLPA probe sets targeting the genes specific to major Gram-negative pathogens (uidA and lacY for E. coli, ompA for A. baumannii, phoE for K. pneumoniae, and ecfX for P. aeruginosa) and one set targeting the CTX-M group 1 to identify the ESBL producing Gram-negative pathogens. All six target-specific peaks were clearly separated without any non-specific peaks in a multiplex reaction condition. The minimum detection limit was 100 fg of pathogen DNA. When we tested 28 Gram-negative clinical isolates, all of them were successfully identified without any non-specific peaks. To evaluate the clinical applicability, we tested seven blood samples from febrile patients. Three blood culture positive cases showed E. coli specific peaks, while no peak was detected in the other four culture negative samples. This technology can be useful for detection of major sepsis-causing, drug-resistant Gram-negative pathogens and also the major ESBL producing Gram-negatives from the blood of sepsis patients in a clinical setting. This system can help early initiation of effective antimicrobial treatment against Gram-negative pathogens for sepsis patients, which is very crucial for better treatment outcomes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Extruded black gram flour: Partial substitute for improving quality characteristics of Indian traditional snack

    Directory of Open Access Journals (Sweden)

    Laxmi Ananthanarayan

    2018-03-01

    Full Text Available Background: During extrusion of black gram flour, formation of amylose-lipid complexes lowers down the gelatinization enthalpy of extrudates, and the partially gelatinized black gram starch leads to lowering down the water-holding capacity and alters functional properties resulting in changing quality attributes of the end product on frying/microwaving/roasting. Methods: Attempts have been made to improve the quality of an Indian traditional snack (e.g., papad by incorporating extruded black gram flour as partial substitute for raw (unextruded black gram flour. In present work, overall quality improvement was achieved by analyzing prefrying and postfrying characteristics (diameter, moisture content, expansion ratio, oil uptake, texture, and color of papad and physical properties (color and viscosity of fried oil. Results: Four different papad samples were prepared (control papads without addition of papadkhar, papads with use of 3% papadkhar, papads with incorporation of extruded black gram flour at 25% concentration, papads with incorporation of extruded black gram flour at 50% concentration along with 1% papadkhar and analyzed along standard market sample. Incorporation of extruded black gram flour in papad resulted in greater expansion with less oil uptake in fried papad. Further addition of extruded black gram flour permitted the use of lower concentration of papadkhar. After frying, the quality of oil was characterized after numerous frying cycles. Conclusion: Oil used for frying of papads containing highest concentration of papadkhar was effective only up to two frying cycles, after which color and viscosity increased significantly, adversely affecting the quality of fried oil. Keywords: Black gram flour, Extrusion, Prefrying and postfrying characteristics of papad, Quality of fried oil

  18. Clinical utility of an automated instrument for gram staining single slides.

    Science.gov (United States)

    Baron, Ellen Jo; Mix, Samantha; Moradi, Wais

    2010-06-01

    Gram stains of 87 different clinical samples were prepared by the laboratory's conventional methods (automated or manual) and by a new single-slide-type automated staining instrument, GG&B AGS-1000. Gram stains from either heat- or methanol-fixed slides stained with the new instrument were easy to interpret, and results were essentially the same as those from the methanol-fixed slides prepared as a part of the routine workflow. This instrument is well suited to a rapid-response laboratory where Gram stain requests are commonly received on a stat basis.

  19. Clinical Utility of an Automated Instrument for Gram Staining Single Slides ▿

    Science.gov (United States)

    Baron, Ellen Jo; Mix, Samantha; Moradi, Wais

    2010-01-01

    Gram stains of 87 different clinical samples were prepared by the laboratory's conventional methods (automated or manual) and by a new single-slide-type automated staining instrument, GG&B AGS-1000. Gram stains from either heat- or methanol-fixed slides stained with the new instrument were easy to interpret, and results were essentially the same as those from the methanol-fixed slides prepared as a part of the routine workflow. This instrument is well suited to a rapid-response laboratory where Gram stain requests are commonly received on a stat basis. PMID:20410348

  20. Effect of gamma radiation on physico-chemical characteristics of red gram (Cajanus cajan) starch

    International Nuclear Information System (INIS)

    Nene, S.P.; Vakil, U.K.; Sreenivasan, A.

    1975-01-01

    Total reducing and nonreducing sugars in red gram (Cajanus cajan) are not affected by radiation treatment (1 Mrad). Oligosaccharides, reported as flatulence factors in legumes, namely stachyose and raffinose, are slightly decreased on cooking the irradiated samples. Irradiated and cooked red gram starch is more susceptible to alpha-amylase action than the unirradiated sample. Rheological properties of red gram starch, such as gelatinization viscosity, swelling power and solubility improve on irradiation resulting in a final cooked product with better textural properties. (U.S.)

  1. Mining for constructions in texts using N-gram and network analysis

    DEFF Research Database (Denmark)

    Shibuya, Yoshikata; Jensen, Kim Ebensgaard

    2015-01-01

    N-gram analysis to Lewis Carroll's novel Alice's Adventures in Wonderland and Mark Twain's novelThe Adventures of Huckleberry Finn and extrapolate a number of likely constructional phenomena from recurring N-gram patterns in the two texts. In addition to simple N-gram analysis, the following....... The main premise is that, if constructions are functional units, then configurations of words that tend to recur together in discourse are likely to have some sort of function that speakers utilize in discourse. Writers of fiction, for instance, may use constructions in characterizations, mind-styles, text...

  2. Gramáticas de grafos y su aplicación en inferencia gramatical

    OpenAIRE

    Jeltsch F., Eric

    1997-01-01

    En este trabajo se presentan las gramáticas de grafos en particular un tipo de gramáticas de grafo las cuales tienen un contexto libre en el mecanismo de derivación al igual que las gramáticas de Chomsky proporcionando de esta manera un simple mecanismo para generar lenguajes de grafos. Para hacer transparente el proceso de generación de grafos se introducen los grafos decorados que son grafos equipados con una información adicional llamada hiperlíneal las cuales al ser reemplazadas en forma ...

  3. Physico-Chemical-Managed Killing of Penicillin-Resistant Static and Growing Gram-Positive and Gram-Negative Vegetative Bacteria

    Science.gov (United States)

    Richmond, Robert Chaffee (Inventor); Schramm, Jr., Harry F. (Inventor); Defalco, Francis G. (Inventor); Farris, III, Alex F. (Inventor)

    2012-01-01

    Systems and methods for the use of compounds from the Hofmeister series coupled with specific pH and temperature to provide rapid physico-chemical-managed killing of penicillin-resistant static and growing Gram-positive and Gram-negative vegetative bacteria. The systems and methods represent the more general physico-chemical enhancement of susceptibility for a wide range of pathological macromolecular targets to clinical management by establishing the reactivity of those targets to topically applied drugs or anti-toxins.

  4. Cardiolipin, a major phospholipid of gram-positive bacteria that is not readily extractable

    NARCIS (Netherlands)

    Filgueiras, M.H.; Kamp, J.A.F. op den

    1980-01-01

    Extraction of phospholipids from stationary phase grown cells of the Gram+ bacteria, Bacillus megaterium, Bacillus subtilis, Bacillus cereus and Micrococcus lysodeikticus was found to be incomplete with various commonly used extraction procedures. Phosphatidylglycerol and phosphatidyl-ethanolamine

  5. One Small Step for the Gram Stain, One Giant Leap for Clinical Microbiology.

    Science.gov (United States)

    Thomson, Richard B

    2016-06-01

    The Gram stain is one of the most commonly performed tests in the clinical microbiology laboratory, yet it is poorly controlled and lacks standardization. It was once the best rapid test in microbiology, but it is no longer trusted by many clinicians. The publication by Samuel et al. (J. Clin. Microbiol. 54:1442-1447, 2016, http://dx.doi.org/10.1128/JCM.03066-15) is a start for those who want to evaluate and improve Gram stain performance. In an age of emerging rapid molecular results, is the Gram stain still relevant? How should clinical microbiologists respond to the call to reduce Gram stain error rates? Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. Septicemia caused by the gram-negative bacterium CDC IV c-2 in an immunocompromised human.

    OpenAIRE

    Dan, M; Berger, S A; Aderka, D; Levo, Y

    1986-01-01

    A 37-year-old man with plasma cell leukemia developed nonfatal septicemia caused by the gram-negative bacterium CDC IV c-2. Recovery followed appropriate treatment with antibiotics. The biochemical features of this organism are reviewed.

  7. European surveillance study on antimicrobial susceptibility of Gram-positive anaerobic cocci

    DEFF Research Database (Denmark)

    Brazier, J; Chmelar, D; Dubreuil, L

    2008-01-01

    Gram-positive anaerobic cocci (GPAC) are a heterogeneous group of microorganisms frequently isolated from local and systemic infections. In this study, the antimicrobial susceptibilities of clinical strains isolated in 10 European countries were investigated. After identification of 299 GPAC...

  8. Breeding high yielding varieties of pigeon pea, mungbean and black gram using induced mutations

    International Nuclear Information System (INIS)

    Pawar, S.E.; Wanjari, K.B.

    1994-01-01

    The present communication emphasis the developing of high yielding varieties of pigeon pea, mungbean and black gram using induced mutation with disease resistance in these crops. This would help in stabilisation of the higher yield potential

  9. Cystic neutrophilic granulomatous mastitis: an underappreciated pattern strongly associated with gram-positive bacilli.

    Science.gov (United States)

    Renshaw, Andrew A; Derhagopian, Robert P; Gould, Edwin W

    2011-09-01

    Although granulomatous lobular mastitis is associated with gram-positive bacilli such as Corynebacterium, this association is not well known. We report 3 cases of mastitis caused by gram-positive bacilli. All 3 abscesses were suppurative with distinct enlarged cystic spaces in which rare gram-positive bacilli were identified. Two cases were also granulomatous. Cultures in all 3 cases were negative. All 3 patients recovered after biopsy and tetracycline-based therapy. Infection in the breast by gram-positive bacilli is associated with a distinct histologic pattern, including cystic spaces in the setting of neutrophilic/granulomatous inflammation that can be recognized and should prompt careful search for the organism within enlarged vacuoles.

  10. Rapid, highly sensitive detection of Gram-negative bacteria with lipopolysaccharide based disposable aptasensor.

    Science.gov (United States)

    Zhang, Jian; Oueslati, Rania; Cheng, Cheng; Zhao, Ling; Chen, Jiangang; Almeida, Raul; Wu, Jayne

    2018-07-30

    Gram-negative bacteria are one of the most common microorganisms in the environment. Their differential detection and recognition from Gram-positive bacteria has been attracting much attention over the years. Using Escherichia coli (E. coli) as a model, we demonstrated on-site detection of Gram-negative bacteria by an AC electrokinetics-based capacitive sensing method using commercial microelectrodes functionalized with an aptamer specific to lipopolysaccharides. Dielectrophoresis effect was utilized to enrich viable bacteria to the microelectrodes rapidly, achieving a detection limit of 10 2 cells/mL within a 30 s' response time. The sensor showed a negligible response to Staphylococcus aureus (S. aureus), a Gram-positive species. The developed sensor showed significant advantages in sensitivity, selectivity, cost, operation simplicity, and response time. Therefore, this sensing method has shown great application potential for environmental monitoring, food safety, and real-time diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Burkholderia caballeronis sp. nov., a nitrogen fixing species isolated from tomato (Lycopersicon esculentum) with the ability to effectively nodulate Phaseolus vulgaris.

    Science.gov (United States)

    Martínez-Aguilar, Lourdes; Salazar-Salazar, Corelly; Méndez, Rafael Díaz; Caballero-Mellado, Jesús; Hirsch, Ann M; Vásquez-Murrieta, María Soledad; Estrada-de los Santos, Paulina

    2013-12-01

    During a survey of Burkholderia species with potential use in agrobiotechnology, a group of 12 strains was isolated from the rhizosphere and rhizoplane of tomato plants growing in Mexico (Nepantla, Mexico State). A phylogenetic analysis of 16S rRNA gene sequences showed that the strains are related to Burkholderia kururiensis and Burkholderia mimosarum (97.4 and 97.1 %, respectively). However, they induced effective nitrogen-fixing nodules on roots of Phaseolus vulgaris. Based on polyphasic taxonomy, the group of strains represents a novel species for which the name Burkholderia caballeronis sp. nov. is proposed. The type species is TNe-841(T) (= LMG 26416(T) = CIP 110324(T)).

  12. Expression of a methionine-rich storage albumin from the Brazil nut (Bertholletia excelsa H.B.K., Lecythidaceae in transgenic bean plants (Phaseolus vulgaris L., Fabaceae

    Directory of Open Access Journals (Sweden)

    Aragão F.J.L.

    1999-01-01

    Full Text Available Bean (Phaseolus vulgaris, an important component in the diet of people in developing countries, has low levels of the essential amino acid, methionine. We have attempted to correct this deficiency by introducing a transgene coding for a methionine-rich storage albumin from the Brazil nut via biolistic methods. The transgene's coding sequence was driven by a doubled 35S CaMV promoter and AMV enhancer sequences. The transgene was stable and correctly expressed in homozygous R2 to R5 seeds. In two of the five transgenic lines the methionine content was significantly increased (14 and 23% over the values found in untransformed plants.

  13. Efecto inhibitorio de los taninos del frijol carioca (Phaseolus vulgaris L.) sobre la digestibilidad de la faseolina por dos sistemas multienzimáticos

    OpenAIRE

    Del Pino,Victoria H.; Lajolo,Franco M.

    2003-01-01

    Cantidades variables de dos sistemas multienzimáticos de tripsina-quimotripsina-peptidasa y pepsina-pancreatina, fueron utilizados para evaluar el efecto de los taninos provenientes de frijol Carioca (Phaseolus vulgaris L.) sobre la digestibilidad de la faseolina, en las formas nativa y denaturalizada. Esta evaluación hecha por los métodos de caida de pH, de hidrólisis en medio tamponado con posterior medición del grado de hidrólisis con ninhidrina y por la técnica electroforética, demostró e...

  14. Incidence of carbapenem-resistant gram negatives in Italian transplant recipients: a nationwide surveillance study.

    Science.gov (United States)

    Lanini, Simone; Costa, Alessandro Nanni; Puro, Vincenzo; Procaccio, Francesco; Grossi, Paolo Antonio; Vespasiano, Francesca; Ricci, Andrea; Vesconi, Sergio; Ison, Michael G; Carmeli, Yehuda; Ippolito, Giuseppe

    2015-01-01

    Bacterial infections remain a challenge to solid organ transplantation. Due to the alarming spread of carbapenem-resistant gram negative bacteria, these organisms have been frequently recognized as cause of severe infections in solid organ transplant recipients. Between 15 May and 30 September 2012 we enrolled 887 solid organ transplant recipients in Italy with the aim to describe the epidemiology of gram negative bacteria spreading, to explore potential risk factors and to assess the effect of early isolation of gram negative bacteria on recipients' mortality during the first 90 days after transplantation. During the study period 185 clinical isolates of gram negative bacteria were reported, for an incidence of 2.39 per 1000 recipient-days. Positive cultures for gram negative bacteria occurred early after transplantation (median time 26 days; incidence rate 4.33, 1.67 and 1.14 per 1,000 recipient-days in the first, second and third month after SOT, respectively). Forty-nine of these clinical isolates were due to carbapenem-resistant gram negative bacteria (26.5%; incidence 0.63 per 1000 recipient-days). Carbapenems resistance was particularly frequent among Klebsiella spp. isolates (49.1%). Recipients with longer hospital stay and those who received either heart or lung graft were at the highest risk of testing positive for any gram negative bacteria. Moreover recipients with longer hospital stay, lung recipients and those admitted to hospital for more than 48h before transplantation had the highest probability to have culture(s) positive for carbapenem-resistant gram negative bacteria. Forty-four organ recipients died (0.57 per 1000 recipient-days) during the study period. Recipients with at least one positive culture for carbapenem-resistant gram negative bacteria had a 10.23-fold higher mortality rate than those who did not. The isolation of gram-negative bacteria is most frequent among recipient with hospital stays >48 hours prior to transplant and in those

  15. Incidence of carbapenem-resistant gram negatives in Italian transplant recipients: a nationwide surveillance study.

    Directory of Open Access Journals (Sweden)

    Simone Lanini

    Full Text Available Bacterial infections remain a challenge to solid organ transplantation. Due to the alarming spread of carbapenem-resistant gram negative bacteria, these organisms have been frequently recognized as cause of severe infections in solid organ transplant recipients.Between 15 May and 30 September 2012 we enrolled 887 solid organ transplant recipients in Italy with the aim to describe the epidemiology of gram negative bacteria spreading, to explore potential risk factors and to assess the effect of early isolation of gram negative bacteria on recipients' mortality during the first 90 days after transplantation. During the study period 185 clinical isolates of gram negative bacteria were reported, for an incidence of 2.39 per 1000 recipient-days. Positive cultures for gram negative bacteria occurred early after transplantation (median time 26 days; incidence rate 4.33, 1.67 and 1.14 per 1,000 recipient-days in the first, second and third month after SOT, respectively. Forty-nine of these clinical isolates were due to carbapenem-resistant gram negative bacteria (26.5%; incidence 0.63 per 1000 recipient-days. Carbapenems resistance was particularly frequent among Klebsiella spp. isolates (49.1%. Recipients with longer hospital stay and those who received either heart or lung graft were at the highest risk of testing positive for any gram negative bacteria. Moreover recipients with longer hospital stay, lung recipients and those admitted to hospital for more than 48h before transplantation had the highest probability to have culture(s positive for carbapenem-resistant gram negative bacteria. Forty-four organ recipients died (0.57 per 1000 recipient-days during the study period. Recipients with at least one positive culture for carbapenem-resistant gram negative bacteria had a 10.23-fold higher mortality rate than those who did not.The isolation of gram-negative bacteria is most frequent among recipient with hospital stays >48 hours prior to transplant

  16. Efeito da irrigação com água salina em um solo cultivado com o feijoeiro (Phaseolus vulgaris L. Effect of irrigation water salinity in a soilcultivated with french beans (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Márcio José de Santana

    2003-04-01

    Full Text Available Conduziu-se este trabalho com o objetivo de avaliar os efeitos de diferentes concentrações de sal, da água de irrigação, na salinização de um Latossolo Roxo distrófico, onde cultivou-se o feijoeiro (Phaseolus vulgaris L. CV ESAL 686. O experimento foi conduzido em casa-de-vegetação no Departamento de Engenharia da Universidade Federal de Lavras, em Lavras, MG, com o propósito de evitar a interferência das precipitações pluviométricas. Os tratamentos consistiram de cinco níveis de salinidade da água (condutividade elétrica de 0,1; 1,0; 2,5; 4,0 e 5,5 dS m-1 com seis repetições. A condutividade elétrica do extrato saturado do solo foi medida no início do experimento, no final da fase vegetativa e após a colheita. Constatou-se uma diminuição da salinidade do solo para o tratamento 0,1 dS m-1, nas diferentes datas de análise do extrato. Para os demais tratamentos, houve um aumento significativo na salinidade: 116,98%, 195,10%, 565,84% e 955,17% para os níveis 1,0; 2,5; 4,0 e 5,5 dS m-1, respectivamente. Houve uma queda acentuada de produção com níveis crescentes de salinidade do solo. O aumento da salinidade da água promoveu um acréscimo linear na condutividade elétrica do solo e no potencial osmótico.The objective this study was to evaluate the different irrigation water salt concentrations effects in the salinization of a "Dystrophic Dusky Red Latossol", cultivated with (Phaseolus vulgaris L. CV ESAL 686. The experiment was carried out in a greenhouse in the Engineering Department at Federal University of Lavras, of Lavras - MG to avoid the interference of the precipitations. The treatments consisted of five level of water salt concentration (electric conductivity of 0.10; 1.0; 2.5; 4.0 and 5.5 dS m-1 with six replications. The electric conductivity of the soil saturation extract was measured at the beginning of the experiment, at the end of the vegetative phase and after the crop harvest. A decrease of soil

  17. Qualidade da colheita mecanizada de feijão (Phaseolus vulgaris em dois sistemas de preparo do solo Quality of the mechanical harvesting of beans (Phaseolus vulgaris under two tillage systems

    Directory of Open Access Journals (Sweden)

    Rouverson Pereira da Silva

    2013-03-01

    Full Text Available Dentre as etapas de produção do feijoeiro a colheita é uma das mais importantes, porque pode interferir de maneira decisiva na qualidade e no custo de produção. Assim, objetivou-se avaliar a qualidade da operação da colheita mecanizada de feijão (Phaseolus vulgaris, cultivado sob preparo convencional e plantio direto. As variáveis analisadas foram: o nível de ruído emitido, calculado através de um medidor de pressão sonora; o desempenho operacional, sendo monitorado o consumo de combustível, a patinagem dos rodados e a velocidade de deslocamento do conjunto coletados em uma central digital (datalogger; e a operação de colheita quanto à matéria seca e densidade de palhada, e as perdas na colheita. A velocidade e os consumos horário e operacional apresentaram distribuição normal dos dados, enquanto que o nível de ruído apresentou distribuição assimétrica. As perdas na colheita mecanizada de feijão e a densidade de palhada apresentaram baixa variabilidade e distribuição normal. Assim, apenas o consumo horário e a produção de matéria seca de palhada apresentaram comportamento instável em relação ao controle estatístico de processo, enquanto os demais indicadores mostraram condições de manter a qualidade da operação de colheita tanto no preparo convencional de solo quanto no plantio direto.Among the production stages of the bean plant, harvesting is one of the most important, because it can decisively affect both quality and production costs. Thus, the objective was to assess quality in the mechanized harvesting of beans (Phaseolus vulgaris, grown under conventional tillage and no-tillage systems. The variables analysed were: the noise level emitted, calculated using a sound-pressure meter; the operational performance, by monitoring fuel consumption, wheel-slippage, and displacement velocity of the machine, all collected digitally (datalogger; and the harvesting operation with regard to the dry matter and

  18. A flow-cytometric gram-staining technique for milk-associated bacteria.

    Science.gov (United States)

    Holm, Claus; Jespersen, Lene

    2003-05-01

    A Gram-staining technique combining staining with two fluorescent stains, Oregon Green-conjugated wheat germ agglutinin (WGA) and hexidium iodide (HI) followed by flow-cytometric detection is described. WGA stains gram-positive bacteria while HI binds to the DNA of all bacteria after permeabilization by EDTA and incubation at 50 degrees C for 15 min. For WGA to bind to gram-positive bacteria, a 3 M potassium chloride solution was found to give the highest fluorescence intensity. A total of 12 strains representing some of the predominant bacterial species in bulk tank milk and mixtures of these were stained and analyzed by flow cytometry. Overall, the staining method showed a clear differentiation between gram-positive and gram-negative bacterial populations. For stationary-stage cultures of seven gram-positive bacteria and five gram-negative bacteria, an average of 99% of the cells were correctly interpreted. The method was only slightly influenced by the growth phase of the bacteria or conditions such as freezing at -18 degrees C for 24 h. For any of these conditions, an average of at least 95% of the cells were correctly interpreted. When stationary-stage cultures were stored at 5 degrees C for 14 days, an average of 86% of the cells were correctly interpreted. The Gram-staining technique was applied to the flow cytometry analysis of bulk tank milk inoculated with Staphylococcus aureus and Escherichia coli. These results demonstrate that the technique is suitable for analyzing milk samples without precultivation.

  19. Exact closed-form expression for the inverse moments of one-sided correlated Gram matrices

    KAUST Repository

    Elkhalil, Khalil

    2016-08-15

    In this paper, we derive a closed-form expression for the inverse moments of one sided-correlated random Gram matrices. Such a question is mainly motivated by applications in signal processing and wireless communications for which evaluating this quantity is a question of major interest. This is for instance the case of the best linear unbiased estimator, in which the average estimation error corresponds to the first inverse moment of a random Gram matrix.

  20. Exact closed-form expression for the inverse moments of one-sided correlated Gram matrices

    KAUST Repository

    Elkhalil, Khalil; Kammoun, Abla; Al-Naffouri, Tareq Y.; Alouini, Mohamed-Slim

    2016-01-01

    In this paper, we derive a closed-form expression for the inverse moments of one sided-correlated random Gram matrices. Such a question is mainly motivated by applications in signal processing and wireless communications for which evaluating this quantity is a question of major interest. This is for instance the case of the best linear unbiased estimator, in which the average estimation error corresponds to the first inverse moment of a random Gram matrix.

  1. A classification system for plasmids from Enterococci and other Gram-positive bacteria

    DEFF Research Database (Denmark)

    Jensen, Lars Bogø; Garcia-Migura, Lourdes; Valenzuela, Antonio Jesus Sanchez

    2010-01-01

    A classification system for plasmids isolated from enterococci and other Gram-positive bacteria was developed based on 111 published plasmid sequences from enterococci and other Gram-positive bacteria; mostly staphylococci. Based on PCR amplification of conserved areas of the replication initiating....... Furthermore, conjugation experiments were performed obtaining 30 transconjugants when selecting for antimicrobial resistance. Among them 19 gave no positive amplicons indicating presence of rep-families not tested for in this experimental setup....

  2. Gram-Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract.

    Science.gov (United States)

    Kline, Kimberly A; Lewis, Amanda L

    2016-04-01

    Gram-positive bacteria are a common cause of urinary-tract infection (UTI), particularly among individuals who are elderly, pregnant, or who have other risk factors for UTI. Here we review the epidemiology, virulence mechanisms, and host response to the most frequently isolated Gram-positive uropathogens: Staphylococcus saprophyticus, Enterococcus faecalis, and Streptococcus agalactiae. We also review several emerging, rare, misclassified, and otherwise underreported Gram-positive pathogens of the urinary tract including Aerococcus, Corynebacterium, Actinobaculum, and Gardnerella. The literature strongly suggests that urologic diseases involving Gram-positive bacteria may be easily overlooked due to limited culture-based assays typically utilized for urine in hospital microbiology laboratories. Some UTIs are polymicrobial in nature, often involving one or more Gram-positive bacteria. We herein review the risk factors and recent evidence for mechanisms of bacterial synergy in experimental models of polymicrobial UTI. Recent experimental data has demonstrated that, despite being cleared quickly from the bladder, some Gram-positive bacteria can impact pathogenic outcomes of co-infecting organisms. When taken together, the available evidence argues that Gram-positive bacteria are important uropathogens in their own right, but that some can be easily overlooked because they are missed by routine diagnostic methods. Finally, a growing body of evidence demonstrates that a surprising variety of fastidious Gram-positive bacteria may either reside in or be regularly exposed to the urinary tract and further suggests that their presence is widespread among women, as well as men. Experimental studies in this area are needed; however, there is a growing appreciation that the composition of bacteria found in the bladder could be a potentially important determinant in urologic disease, including susceptibility to UTI.

  3. Gram-negative and -positive bacteria differentiation in blood culture samples by headspace volatile compound analysis.

    Science.gov (United States)

    Dolch, Michael E; Janitza, Silke; Boulesteix, Anne-Laure; Graßmann-Lichtenauer, Carola; Praun, Siegfried; Denzer, Wolfgang; Schelling, Gustav; Schubert, Sören

    2016-12-01

    Identification of microorganisms in positive blood cultures still relies on standard techniques such as Gram staining followed by culturing with definite microorganism identification. Alternatively, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry or the analysis of headspace volatile compound (VC) composition produced by cultures can help to differentiate between microorganisms under experimental conditions. This study assessed the efficacy of volatile compound based microorganism differentiation into Gram-negatives and -positives in unselected positive blood culture samples from patients. Headspace gas samples of positive blood culture samples were transferred to sterilized, sealed, and evacuated 20 ml glass vials and stored at -30 °C until batch analysis. Headspace gas VC content analysis was carried out via an auto sampler connected to an ion-molecule reaction mass spectrometer (IMR-MS). Measurements covered a mass range from 16 to 135 u including CO2, H2, N2, and O2. Prediction rules for microorganism identification based on VC composition were derived using a training data set and evaluated using a validation data set within a random split validation procedure. One-hundred-fifty-two aerobic samples growing 27 Gram-negatives, 106 Gram-positives, and 19 fungi and 130 anaerobic samples growing 37 Gram-negatives, 91 Gram-positives, and two fungi were analysed. In anaerobic samples, ten discriminators were identified by the random forest method allowing for bacteria differentiation into Gram-negative and -positive (error rate: 16.7 % in validation data set). For aerobic samples the error rate was not better than random. In anaerobic blood culture samples of patients IMR-MS based headspace VC composition analysis facilitates bacteria differentiation into Gram-negative and -positive.

  4. Sistema de tareas para la enseñanza combinada de la gramática comunicativa y la gramática tradicional de lengua inglesa

    Directory of Open Access Journals (Sweden)

    Nancy del Carmen Jiménez Figueredo

    2015-03-01

    Full Text Available Se realizó el diseño de un sistema de tareas para la enseñanza combinada de la gramática comunicativa y la gramática tradicional de lengua inglesa, con metodología cuali-cuantitativa, en la Facultad de Ciencias Médicas “Zoilo Marinello Vidaurreta” de la Universidad de Ciencias Médicas de Las Tunas, durante el período comprendido entre septiembre de 2011 y julio de 2014. El objetivo estuvo direccionado a perfeccionar la corrección lingüística en el proceso de enseñanza-aprendizaje del idioma Inglés. La realización del diseño contó con: una revisión bibliográfica de los principales enfoques utilizados en la enseñanza-aprendizaje del Inglés; la revisión documental, que permitió determinar las insuficiencias lingüísticas y la necesidad de combinar la gramática comunicativa con la gramática tradicional, en los estudiantes del cuarto año de la carrera de Estomatología; el intercambio con profesionales con más de quince años de experiencia, para obtener información acerca del proceso de enseñanza-aprendizaje de la gramática; y la aplicación de una valoración equivalente al juicio de expertos, método de agregados individuales, para valorar la propuesta. Los principales resultados fueron: la caracterización de las insuficiencias provocadas por la absolutización del enfoque comunicativo en la enseñanza de la gramática de la lengua inglesa y el diseño de un sistema de tareas para el proceso de enseñanza-aprendizaje de la gramática inglesa en estos estudiantes

  5. Widespread Fosfomycin Resistance in Gram-Negative Bacteria Attributable to the Chromosomal fosA Gene

    Directory of Open Access Journals (Sweden)

    Ryota Ito

    2017-08-01

    Full Text Available Fosfomycin is a decades-old antibiotic which is being revisited because of its perceived activity against many extensively drug-resistant Gram-negative pathogens. FosA proteins are Mn2+ and K+-dependent glutathione S-transferases which confer fosfomycin resistance in Gram-negative bacteria by conjugation of glutathione to the antibiotic. Plasmid-borne fosA variants have been reported in fosfomycin-resistant Escherichia coli strains. However, the prevalence and distribution of fosA in other Gram-negative bacteria are not known. We systematically surveyed the presence of fosA in Gram-negative bacteria in over 18,000 published genomes from 18 Gram-negative species and investigated their contribution to fosfomycin resistance. We show that FosA homologues are present in the majority of genomes in some species (e.g., Klebsiella spp., Enterobacter spp., Serratia marcescens, and Pseudomonas aeruginosa, whereas they are largely absent in others (e.g., E. coli, Acinetobacter baumannii, and Burkholderia cepacia. FosA proteins in different bacterial pathogens are highly divergent, but key amino acid residues in the active site are conserved. Chromosomal fosA genes conferred high-level fosfomycin resistance when expressed in E. coli, and deletion of chromosomal fosA in S. marcescens eliminated fosfomycin resistance. Our results indicate that FosA is encoded by clinically relevant Gram-negative species and contributes to intrinsic fosfomycin resistance.

  6. [Comparison of the quick Gram stain method to the B&M modified and favor methods].

    Science.gov (United States)

    Osawa, Kayo; Kataoka, Nobumasa; Maruo, Toshio

    2011-01-01

    The Gram stain is an established method for bacterial identification, but the time needed to carry out this stain is 2-3 min. We attempted to shorten this time and stained a total of 70 clinical specimens isolated from using the Bartholomew & Mittwer (B&M) modified or Favor methods with a 3 s duration for washing and staining steps. Results were plotted and analyzed using a Hue Saturation Intensity (HSI) model. The range based on a plot of the two methods with the HSI model was presented as a reference interval. Our results indicated that 100% (35/35) of strains were Gram positive and 97.1% (34/35) were Gram negative for the quick B&M modified method. In the quick Favor method, 80.0% (28/35) were Gram positive and 68.6% (24/35) of strains were Gram negative. We propose that the quick B&M modified method is equivalent to the standard Gram staining method and is superior to the quick Favor method.

  7. Breaking barriers: expansion of the use of endolysins as novel antibacterials against Gram-negative bacteria.

    Science.gov (United States)

    Briers, Yves; Lavigne, Rob

    2015-01-01

    The emergence and spread of antibiotic-resistant bacteria drives the search for novel classes of antibiotics to replenish our armamentarium against bacterial infections. This is particularly critical for Gram-negative pathogens, which are intrinsically resistant to many existing classes of antibiotics due to the presence of a protective outer membrane. In addition, the antibiotics development pipeline is mainly oriented to Gram-positive pathogens such as methicillin-resistant Staphylococcus aureus. A promising novel class of antibacterials is endolysins. These enzymes encoded by bacterial viruses hydrolyze the peptidoglycan layer with high efficiency, resulting in abrupt osmotic lysis and cell death. Their potential as novel antibacterials to treat Gram-positive bacteria has been extensively demonstrated; however, the Gram-negative outer membrane has presented a formidable barrier for the use of endolysins against Gram-negatives until recently. This review reports on the most recent advances in the development of endolysins to kill Gram-negative species with a special focus on endolysin-engineered Artilysins(®).

  8. Triple-Layer Plastic Bags Protect Dry Common Beans (Phaseolus vulgaris) Against Damage by Acanthoscelides obtectus (Coleoptera: Chrysomelidae) During Storage.

    Science.gov (United States)

    Mutungi, C; Affognon, H D; Njoroge, A W; Manono, J; Baributsa, D; Murdock, L L

    2015-10-01

    Fumigated dry common beans (Phaseolus vulgaris L.) that were artificially infested with Acanthoscelides obtectus Say, and others that were not artificially infested, were stored in hermetic triple-layer PICS (Lela Agro, Kano, Nigeria) or woven polypropylene (PP) bags for 6 mo at ambient laboratory temperature conditions of 22.6 ± 1.9°C and 60.1 ± 4.3% relative humidity. In an additional trial, beans contained in PP bags were treated with Actellic Super dust before introducing A. obtectus. Moisture content, number of live adult A. obtectus, seed damage, weight loss, and seed germination were determined at monthly intervals. At 6 mo, beans stored in PICS bags retained higher moisture than those stored in PP bags, but in all treatments the moisture level remained below that recommended for safe storage of beans. In the PICS bags, proliferation of A. obtectus did not proceed and at 6 mo, beans stored in these bags did not have insect-inflicted seed damage or weight loss. In contrast, seed damage and weight loss in PP bags exceeded economic threshold after 1 mo in the absence of Actellic Super dust (Syngenta Crop protection AG, Basle, Switzerland), and after 2 mo in the presence of it. Germination of beans stored in PP bags decreased greatly whereas the beans stored in PICS bags did not show reduced germination. Chemical free storage of common beans in PICS bags protects them against damage by A. obtectus. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Low Soil Phosphorus Availability Increases Acid Phosphatases Activities and Affects P Partitioning in Nodules, Seeds and Rhizosphere of Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Jean-Jacques Drevon

    2012-06-01

    Full Text Available The effect of phosphorus (P deficiency on phosphatases activities in N2-fixing legumes has been widely studied in hydroponic culture. However, the response of acid phosphatase (APase and phytase in rhizosphere, nodules and seeds of Phaseolus vulgaris to low soil’s P-availability is not yet fully understood. In this study, six genotypes of N2-fixing P. vulgaris were grown under contrasting soil P-availabilities; i.e., low  (4.3 mg P kg−1 and sufficient (16.7 mg P kg−1 in the Haouz region of Morocco. At flowering and maturity stages, plants were harvested and analyzed for their phosphatases activities, growth and P content. Results show that, low P decreased nodulation, growth, P uptake and N accumulation in all the genotypes, but to a greater extent in the sensitive recombinant inbreed line 147. In addition, while seed P content was slightly reduced under low P soil; a higher P was noticed in the Flamingo and Contender large seeded-beans (6.15 to 7.11 mg g−1. In these latter genotypes, high APase and phytase activities in seeds and nodules were associated with a significant decline in rhizosphere’s available P. APase activity was mainly stimulated in nodules, whereas phytase activity was highly induced in seeds (77%. In conclusion, the variations of APase and phytase activities in nodules and seeds depend on genotype and can greatly influence the internal utilization of P, which might result in low P soil tolerance in N2-fixing legumes.

  10. Effect of the dietary level of cull pinto beans (Phaseolus vulgaris on ruminal fermentation, kinetics, and digestibility of hair lambs

    Directory of Open Access Journals (Sweden)

    Francisco Castillo Rangel

    Full Text Available ABSTRACT The objective was to evaluate the effect of three levels of cull pinto beans (CPB; Phaseolus vulgaris on ruminal fermentation, kinetics, and nutrient digestibility in hair lambs. Six cannulated lambs averaging 56.6±3.8 kg were used and were randomly assigned to one of three treatments. Treatments were: 0.0 kg kg−1 of CPB in the supplement (control; 0.25 kg kg−1 of CPB in the supplement (CB25; and 0.40 kg kg−1 of CPB in the supplement (CB40. Dry matter intake, ruminal pH, NH3, and volatile fatty acid (VFA concentration, methane production, Kp (passage rate, MRT (mean retention time, and digestibility of dry matter, crude protein, and neutral detergent fiber were evaluated. Data were analyzed in a Latin square design, repeated in line, by MIXED procedure of SAS. Estimates used for Kp and MRT were obtained by a non-linear regression model (PROC NLIN. Dry matter intake was reduced by supplementation of CPB. No differences were found in ruminal pH or ruminal NH3. During the trial, differences were found for ruminal VFA concentration (mM, which were greater for the CB25 group. The propionate:acetate ratio was greater for the CB40 treatment. Methane production (mM/m differed among treatments, but it was the greatest for the CB40 group. Passage rate (kg kg−1/h and MRT (h were similar among treatments and the digestibility (kg kg−1 of dry matter, crude protein, and neutral detergent fiber was not different among treatments. The inclusion of 0.25 kg kg−1 of CPB in the diet of hair lambs allows for appropriate nutrient digestion without affecting Kp and MRT and increases the molar proportion of the ability of VFA to maintain acetate:propionate ratio without increasing methane production.

  11. Metabolic origin of the {delta}{sup 13}C of respired CO{sub 2} in roots of Phaseolus vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Bathellier, C.; Tcherkez, G.; Cornic, G.; Ghashghaie, J. [Laboratoire d' Ecologie, Systematique et Evolution - ESE, CNRS-UMR 8079 - IFR 87, Batiment 362, Universite Paris-Sud, 91405-Orsay Cedex (France); Tcherkez, G. [Plateforme Metabolisme-Metabolome, IFR87 La Plante et son Environnement, Institut de Biotechnologie des Plantes, Batiment 630, Universite Paris-Sud, 91405-Orsay Cedex (France); Bligny, R.; Gout, E. [Laboratoire de Physiologie Cellulaire Vegetale CEA-Grenoble 17, rue des Martyrs, 38054 Grenoble Cedex 9 (France)

    2009-07-01

    - Root respiration is a major contributor to soil CO{sub 2} efflux, and thus an important component of ecosystem respiration. But its metabolic origin, in relation to the carbon isotope composition ({delta}{sup 13}C), remains poorly understood. - Here, {sup 13}C analysis was conducted on CO{sub 2} and metabolites under typical conditions or under continuous darkness in French bean (Phaseolus vulgaris) roots. {sup 13}C contents were measured either under natural abundance or following pulse-chase labeling with {sup 13}C-enriched glucose or pyruvate, using isotope ratio mass spectrometer (IRMS) and nuclear magnetic resonance (NMR) techniques. - In contrast to leaves, no relationship was found between the respiratory quotient and the {delta}{sup 13}C of respired CO{sub 2}, which stayed constant at a low value (c. -27.5 per thousand) under continuous darkness. With labeling experiments, it is shown that such a pattern is explained by the {sup 13}C-depleting effect of the pentose phosphate pathway; and the involvement of the Krebs cycle fueled by either the glycolytic input or the lipid/protein recycling. The anaplerotic phosphoenolpyruvate carboxylase (PEPc) activity sustained glutamic acid (Glu) synthesis, with no net effect on respired CO{sub 2}. - These results indicate that the root {delta}{sup 13}C signal does not depend on the availability of root respiratory substrates and it is thus plausible that, unless the {sup 13}C photosynthetic fractionation varies at the leaf level, the root {delta}{sup 13}C signal hardly changes under a range of natural environmental conditions. (authors)

  12. Ferti-irrigational impact of sugar mill effluent on agronomical characteristics of Phaseolus vulgaris (L.) in two seasons.

    Science.gov (United States)

    Kumar, Vinod; Chopra, A K

    2014-11-01

    Ferti-irrigation response of 5, 10, 25, 50, 75, and 100 % concentrations of the sugar mill effluent (SME) on French bean (Phaseolus vulgaris L., cv. Annapurna) in the rainy and summer seasons was investigated. The fertigant concentrations produced significant (P potassium (K(+)), calcium (Ca(2+)), magnesium (Mg(2+)), total Kjeldahl nitrogen (TKN), phosphate (PO4 (3-)), sulfate (SO4 (2-)), ferrous (Fe(2+)), cadmium (Cd), chromium (Cr), copper (Cu), manganese (Mn), and zinc (Zn), in both seasons. The contents of Cr, Cu, Mn, and Zn except Cd were found to be below the maximum levels permitted for soils in India. The agronomic performance of P. vulgaris was gradually increased at lower concentrations, i.e., from 5 to 25 %, and decreased at higher concentrations, i.e., from 50 to 100 %, of the SME in both seasons when compared to controls. The accumulations of heavy metals were increased in the soil and P. vulgaris from 5 to 100 % concentrations of the SME in both seasons. The contents of Cu, Mn, and Zn except Cd and Cr were noted under the permissible limit of Food and Agriculture Organization (FAO)/World Health Organization (WHO) standards. Most contents of biochemical components like crude proteins, crude fiber, and total carbohydrates were found with 25 % concentration of the SME in both seasons. The contamination factor (Cf) of various metals was in the order of Cd > Cr > Zn > Mn > Cu for soil and Mn > Zn > Cu > Cr > Cd for P. vulgaris in both seasons after fertigation with SME. Therefore, the SME can be used to improve the soil fertility and yield of P. vulgaris after appropriate dilution.

  13. Specificity of induced defenses, growth, and reproduction in lima bean (Phaseolus lunatus) in response to multispecies herbivory.

    Science.gov (United States)

    Moreira, Xoaquín; Abdala-Roberts, Luis; Hernández-Cumplido, Johnattan; Cuny, Maximilien A C; Glauser, Gaetan; Benrey, Betty

    2015-08-01

    • Following herbivore attack, plants can either reduce damage by inducing defenses or mitigate herbivory effects through compensatory growth and reproduction. It is increasingly recognized that such induced defenses in plants are herbivore-specific, but less is known about the specificity of compensatory responses. Damage by multiple herbivores may also lead to synergistic effects on induction and plant fitness that differ from those caused by a single herbivore species. Although largely unstudied, the order of arrival and damage by different herbivore species might also play an important role in the impacts of herbivory on plants.• We investigated the specificity of defense induction (phenolics) and effects on growth (number of stems and leaves) and reproduction (number of seeds, seed mass, and germination rate) from feeding by two generalist leaf-chewing herbivores (Spodoptera eridania and Diabrotica balteata) on Phaseolus lunatus plants and evaluated whether simultaneous attack by both herbivores and their order of arrival influenced such dynamics.• Herbivory increased levels of leaf phenolics, but such effects were not herbivore-specific. In contrast, herbivory enhanced seed germination in an herbivore-specific manner. For all variables measured, the combined effects of both herbivore species did not differ from their individual effects. Finally, the order of herbivore arrival did not influence defense induction, plant growth, or seed number but did influence seed mass and germination.• Overall, this study highlights novel aspects of the specificity of plant responses induced by damage from multiple species of herbivores and uniquely associates such effects with plant lifetime fitness. © 2015 Botanical Society of America, Inc.

  14. Annotation, Phylogeny and Expression Analysis of the Nuclear Factor Y Gene Families in Common Bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Carolina eRípodas

    2015-01-01

    Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.

  15. Localization of the Bacillus subtilis beta-propeller phytase transcripts in nodulated roots of Phaseolus vulgaris supplied with phytate.

    Science.gov (United States)

    Maougal, Rim Tinhinen; Bargaz, Adnane; Sahel, Charaf; Amenc, Laurie; Djekoun, Abdelhamid; Plassard, Claude; Drevon, Jean-Jacques

    2014-04-01

    Soil organic phosphorus (Po) such as phytate, which comprises up to 80 % of total Po, must be hydrolyzed by specific enzymes called phytases to be used by plants. In contrast to plants, bacteria, such as Bacillus subtilis, have the ability to use phytate as the sole source of P due to the excretion of a beta-propeller phytase (BPP). In order to assess whether the B. subtilis BPP could make P available from phytate for the benefit of a nodulated legume, the P-sensitive recombinant inbred line RIL147 of Phaseolus vulgaris was grown under hydroaeroponic conditions with either 12.5 μM phytate (C₆H₁₈O₂₄P₆) or 75 μmol Pi (K₂HPO₄), and inoculated with Rhizobium tropici CIAT899 alone, or co-inoculated with both B. subtilis DSM 10 and CIAT899. The in situ RT-PCR of BPP genes displayed the most intense fluorescent BPP signal on root tips. Some BPP signal was found inside the root cortex and the endorhizosphere of the root tip, suggesting endophytic bacteria expressing BPP. However, the co-inoculation with B. subtilis was associated with a decrease in plant P content, nodulation and the subsequent plant growth. Such a competitive effect of B. subtilis on P acquisition from phytate in symbiotic nitrogen fixation might be circumvented if the rate of inoculation were reasoned in order to avoid the inhibition of nodulation by excess B. subtilis proliferation. It is concluded that B. subtilis BPP gene is expressed in P. vulgaris rhizosphere.

  16. beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Satoh, S; Matsuda, K; Tamari, K

    1976-12-01

    A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

  17. Genome-Wide Association Studies of Anthracnose and Angular Leaf Spot Resistance in Common Bean (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini

    Full Text Available The common bean (Phaseolus vulgaris L. is the world's most important legume for human consumption. Anthracnose (ANT; Colletotrichum lindemuthianum and angular leaf spot (ALS; Pseudocercospora griseola are complex diseases that cause major yield losses in common bean. Depending on the cultivar and environmental conditions, anthracnose and angular leaf spot infections can reduce crop yield drastically. This study aimed to estimate linkage disequilibrium levels and identify quantitative resistance loci (QRL controlling resistance to both ANT and ALS diseases of 180 accessions of common bean using genome-wide association analysis. A randomized complete block design with four replicates was performed for the ANT and ALS experiments, with four plants per genotype in each replicate. Association mapping analyses were performed for ANT and ALS using a mixed linear model approach implemented in TASSEL. A total of 17 and 11 significant statistically associations involving SSRs were detected for ANT and ALS resistance loci, respectively. Using SNPs, 21 and 17 significant statistically associations were obtained for ANT and angular ALS, respectively, providing more associations with this marker. The SSR-IAC167 and PvM95 markers, both located on chromosome Pv03, and the SNP scaffold00021_89379, were associated with both diseases. The other markers were distributed across the entire common bean genome, with chromosomes Pv03 and Pv08 showing the greatest number of loci associated with ANT resistance. The chromosome Pv04 was the most saturated one, with six markers associated with ALS resistance. The telomeric region of this chromosome showed four markers located between approximately 2.5 Mb and 4.4 Mb. Our results demonstrate the great potential of genome-wide association studies to identify QRLs related to ANT and ALS in common bean. The results indicate a quantitative and complex inheritance pattern for both diseases in common bean. Our findings will

  18. Mapping and Genetic Structure Analysis of the Anthracnose Resistance Locus Co-1HY in the Common Bean (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Mingli Chen

    Full Text Available Anthracnose is a destructive disease of the common bean (Phaseolus vulgaris L.. The Andean cultivar Hongyundou has been demonstrated to possess strong resistance to anthracnose race 81. To study the genetics of this resistance, the Hongyundou cultivar was crossed with a susceptible genotype Jingdou. Segregation of resistance for race 81 was assessed in the F2 population and F2:3 lines under controlled conditions. Results indicate that Hongyundou carries a single dominant gene for anthracnose resistance. An allele test by crossing Hongyundou with another resistant cultivar revealed that the resistance gene is in the Co-1 locus (therefore named Co-1HY. The physical distance between this locus and the two flanking markers was 46 kb, and this region included four candidate genes, namely, Phvul.001G243500, Phvul.001G243600, Phvul.001G243700 and Phvul.001G243800. These candidate genes encoded serine/threonine-protein kinases. Expression analysis of the four candidate genes in the resistant and susceptible cultivars under control condition and inoculated treatment revealed that all the four candidate genes are expressed at significantly higher levels in the resistant genotype than in susceptible genotype. Phvul.001G243600 and Phvul.001G243700 are expressed nearly 15-fold and 90-fold higher in the resistant genotype than in the susceptible parent before inoculation, respectively. Four candidate genes will provide useful information for further research into the resistance mechanism of anthracnose in common bean. The closely linked flanking markers identified here may be useful for transferring the resistance allele Co-1HY from Hongyundou to elite anthracnose susceptible common bean lines.

  19. Mapping and Genetic Structure Analysis of the Anthracnose Resistance Locus Co-1HY in the Common Bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Chen, Mingli; Wu, Jing; Wang, Lanfen; Mantri, Nitin; Zhang, Xiaoyan; Zhu, Zhendong; Wang, Shumin

    2017-01-01

    Anthracnose is a destructive disease of the common bean (Phaseolus vulgaris L.). The Andean cultivar Hongyundou has been demonstrated to possess strong resistance to anthracnose race 81. To study the genetics of this resistance, the Hongyundou cultivar was crossed with a susceptible genotype Jingdou. Segregation of resistance for race 81 was assessed in the F2 population and F2:3 lines under controlled conditions. Results indicate that Hongyundou carries a single dominant gene for anthracnose resistance. An allele test by crossing Hongyundou with another resistant cultivar revealed that the resistance gene is in the Co-1 locus (therefore named Co-1HY). The physical distance between this locus and the two flanking markers was 46 kb, and this region included four candidate genes, namely, Phvul.001G243500, Phvul.001G243600, Phvul.001G243700 and Phvul.001G243800. These candidate genes encoded serine/threonine-protein kinases. Expression analysis of the four candidate genes in the resistant and susceptible cultivars under control condition and inoculated treatment revealed that all the four candidate genes are expressed at significantly higher levels in the resistant genotype than in susceptible genotype. Phvul.001G243600 and Phvul.001G243700 are expressed nearly 15-fold and 90-fold higher in the resistant genotype than in the susceptible parent before inoculation, respectively. Four candidate genes will provide useful information for further research into the resistance mechanism of anthracnose in common bean. The closely linked flanking markers identified here may be useful for transferring the resistance allele Co-1HY from Hongyundou to elite anthracnose susceptible common bean lines.

  20. Gene/QTL discovery for Anthracnose in common bean (Phaseolus vulgaris L.) from North-western Himalayas.

    Science.gov (United States)

    Choudhary, Neeraj; Bawa, Vanya; Paliwal, Rajneesh; Singh, Bikram; Bhat, Mohd Ashraf; Mir, Javid Iqbal; Gupta, Moni; Sofi, Parvaze A; Thudi, Mahendar; Varshney, Rajeev K; Mir, Reyazul Rouf

    2018-01-01

    Common bean (Phaseolus vulgaris L.) is one of the most important grain legume crops in the world. The beans grown in north-western Himalayas possess huge diversity for seed color, shape and size but are mostly susceptible to Anthracnose disease caused by seed born fungus Colletotrichum lindemuthianum. Dozens of QTLs/genes have been already identified for this disease in common bean world-wide. However, this is the first report of gene/QTL discovery for Anthracnose using bean germplasm from north-western Himalayas of state Jammu & Kashmir, India. A core set of 96 bean lines comprising 54 indigenous local landraces from 11 hot-spots and 42 exotic lines from 10 different countries were phenotyped at two locations (SKUAST-Jammu and Bhaderwah, Jammu) for Anthracnose resistance. The core set was also genotyped with genome-wide (91) random and trait linked SSR markers. The study of marker-trait associations (MTAs) led to the identification of 10 QTLs/genes for Anthracnose resistance. Among the 10 QTLs/genes identified, two MTAs are stable (BM45 & BM211), two MTAs (PVctt1 & BM211) are major explaining more than 20% phenotypic variation for Anthracnose and one MTA (BM211) is both stable and major. Six (06) genomic regions are reported for the first time, while as four (04) genomic regions validated the already known QTL/gene regions/clusters for Anthracnose. The major, stable and validated markers reported during the present study associated with Anthracnose resistance will prove useful in common bean molecular breeding programs aimed at enhancing Anthracnose resistance of local bean landraces grown in north-western Himalayas of state Jammu and Kashmir.

  1. Genome-Wide Association Studies of Anthracnose and Angular Leaf Spot Resistance in Common Bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Perseguini, Juliana Morini Küpper Cardoso; Oblessuc, Paula Rodrigues; Rosa, João Ricardo Bachega Feijó; Gomes, Kleber Alves; Chiorato, Alisson Fernando; Carbonell, Sérgio Augusto Morais; Garcia, Antonio Augusto Franco; Vianello, Rosana Pereira; Benchimol-Reis, Luciana Lasry

    2016-01-01

    The common bean (Phaseolus vulgaris L.) is the world's most important legume for human consumption. Anthracnose (ANT; Colletotrichum lindemuthianum) and angular leaf spot (ALS; Pseudocercospora griseola) are complex diseases that cause major yield losses in common bean. Depending on the cultivar and environmental conditions, anthracnose and angular leaf spot infections can reduce crop yield drastically. This study aimed to estimate linkage disequilibrium levels and identify quantitative resistance loci (QRL) controlling resistance to both ANT and ALS diseases of 180 accessions of common bean using genome-wide association analysis. A randomized complete block design with four replicates was performed for the ANT and ALS experiments, with four plants per genotype in each replicate. Association mapping analyses were performed for ANT and ALS using a mixed linear model approach implemented in TASSEL. A total of 17 and 11 significant statistically associations involving SSRs were detected for ANT and ALS resistance loci, respectively. Using SNPs, 21 and 17 significant statistically associations were obtained for ANT and angular ALS, respectively, providing more associations with this marker. The SSR-IAC167 and PvM95 markers, both located on chromosome Pv03, and the SNP scaffold00021_89379, were associated with both diseases. The other markers were distributed across the entire common bean genome, with chromosomes Pv03 and Pv08 showing the greatest number of loci associated with ANT resistance. The chromosome Pv04 was the most saturated one, with six markers associated with ALS resistance. The telomeric region of this chromosome showed four markers located between approximately 2.5 Mb and 4.4 Mb. Our results demonstrate the great potential of genome-wide association studies to identify QRLs related to ANT and ALS in common bean. The results indicate a quantitative and complex inheritance pattern for both diseases in common bean. Our findings will contribute to more

  2. REACTION OF INTRODUCED BEAN (PHASEOLUS ACCESSIONS TO THE INFESTATION BY THIELAVIOPSIS BASICOLA (BERKELEY & BROOME UNDER NATURAL EPIPHYTOTIC CONDITIONS

    Directory of Open Access Journals (Sweden)

    O. Georgieva

    2015-01-01

    Full Text Available A periodic phytopathology field monitoring was conducted on 35 introduced common bean (Phaseolus accessions at Maritsa Vegetable Crops Research Institute in 2014. The epiphytotic disease black root rot on the bean crops (over 75 % reduction of the stand was recorded for the first time for the area of Bulgaria. The causal agent isolated from the plant tissue was identified as the fungus Thielaviopsis basicola (Berkeley Ferraris. A strong relationship between disease severity variation and environmental and soil conditions was established. Black root rot was most severe when cool and wet weather occurred from seedling time to about three weeks after planting, combined with increased soil compaction. Field resistance was recorded in Bulgarian var. “Plovdivski zult”, var. “Starozagorski tzer” and line № 564 (3,66%, 5.33% and 6,50 % dumping-off of bean seedlings, respectively. Bean accession introduced from dry climate areas were highly susceptible to black root rot pathogen (over 76.0 % dumping-off of bean seedlings. Indirect relationship was found between bean tolerance to Th. basicola and presence of the anthocyanin in the hypocotyl and seed coat color. Install the average negative correlation between seed color signs (and hypocotyl and the resistance of plants to Th. basicola. Samples with resistance to black root rot belong to the group with beige, red, brown or black color of seeds. The presence of phenolic compounds (anthocyanins in the seed coat and hypocotyls beans can serve as an indirect indication of the selection of resistant to black rot breeding materials.

  3. Antioxidant and Hypolipidaemic Effect of Raw Green Snap (Phaseolus vulgaris) on Aged Male Rats Exposed to gamma Irradiation

    International Nuclear Information System (INIS)

    Abed EI-Gawad, E.I.; Aiad, S.K.

    2008-01-01

    This Study was established to assess the effect of supplemental dietary raw green snap (Phaseolus vulgaris) for three months to overcome gamma-irradiation induced alterations on some oxidant/ antioxidant parameters (Fe 3+ , Cu 2+ , total iron, ferritin, transferrin and ceruloplasmin) and the hyper lipidemic state (triglycerides, cholesterol, high- and low density lipoprotein (HDL-c and LDL-c) in aged male rats. Raw green snap is an indigenous plant used in Unani and Ayurvedic medicine in India. The study also aimed to estimate the effect of dietary raw green snap on general health through the follow up of body weight and mortality during the course of supplementation. Thirty-two aged male rats (24 months, 370-375 g) were divided equally into four groups. 1- Control group, the animals fed on a balanced diet for 3 months. 2- Supplemented group, the animals balanced diet was supplemented with raw green snap (70 g / kg body wt/ day) for 3 months. 3- Irradiated group, the animals fed on a balanced diet for 3 months were then exposed to whole body y-radiation at a dose level of 4 Gy. 4-Supplemented-irradiated group, the animals' balanced diet was supplemented with raw green snap (70 g/ kg/ day) for three months and then exposed to whole body gamma irradiation at a dose level of 4 Gy. The blood samples were taken from orbital venous plexuses after 48 h of stopping green snap supplementation (supplemented group) or after irradiation (irradiated and supplemented gamma-irradiated groups). The results obtained showed reduction in the body wt in green snap supplemented group which increased gradually concomitant with occurrence of animal mortality on week 7 reaching II) maximal values (-32.79 and 33.33 %) respectively, on week 12 of supplementation. Also, the supplemented group showed non significant changes in tested parameters although the level of total iron and triglycerides recorded noticeable changes as compared with controls

  4. Rapid evolutionary change of common bean (Phaseolus vulgaris L plastome, and the genomic diversification of legume chloroplasts

    Directory of Open Access Journals (Sweden)

    Dávila Guillermo

    2007-07-01

    Full Text Available Abstract Background Fabaceae (legumes is one of the largest families of flowering plants, and some members are important crops. In contrast to what we know about their great diversity or economic importance, our knowledge at the genomic level of chloroplast genomes (cpDNAs or plastomes for these crops is limited. Results We sequenced the complete genome of the common bean (Phaseolus vulgaris cv. Negro Jamapa chloroplast. The plastome of P. vulgaris is a 150,285 bp circular molecule. It has gene content similar to that of other legume plastomes, but contains two pseudogenes, rpl33 and rps16. A distinct inversion occurred at the junction points of trnH-GUG/rpl14 and rps19/rps8, as in adzuki bean 1. These two pseudogenes and the inversion were confirmed in 10 varieties representing the two domestication centers of the bean. Genomic comparative analysis indicated that inversions generally occur in legume plastomes and the magnitude and localization of insertions/deletions (indels also vary. The analysis of repeat sequences demonstrated that patterns and sequences of tandem repeats had an important impact on sequence diversification between legume plastomes and tandem repeats did not belong to dispersed repeats. Interestingly, P. vulgaris plastome had higher evolutionary rates of change on both genomic and gene levels than G. max, which could be the consequence of pressure from both mutation and natural selection. Conclusion Legume chloroplast genomes are widely diversified in gene content, gene order, indel structure, abundance and localization of repetitive sequences, intracellular sequence exchange and evolutionary rates. The P. vulgaris plastome is a rapidly evolving genome.

  5. Damaged-self recognition in common bean (Phaseolus vulgaris shows taxonomic specificity and triggers signalling via reactive oxygen species (ROS

    Directory of Open Access Journals (Sweden)

    Dalia eDuran

    2014-10-01

    Full Text Available Plants require reliable mechanisms to detect injury. Danger signals or 'damage-associated molecular patterns' (DAMPs are released from stressed host cells and allow injury detection independently of enemy-derived molecules. We studied the response of common bean (Phaseolus vulgaris to the application of leaf homogenate as a source of DAMPs and measured the production of reactive oxygen species (ROS as an early response and the secretion of extrafloral nectar (EFN as a jasmonic acid (JA–dependent late response. We observed a strong taxonomic signal in the response to different leaf homogenates. ROS formation and EFN secretion were highly correlated and responded most strongly to leaf homogenates produced using the same cultivar or closely related accessions, less to a distantly related cultivar of common bean or each of the two congeneric species, P. lunatus and P. coccineus, and not at all to homogenates prepared from species in different genera, not even when using other Fabaceae. Interestingly, leaf homogenates also reduced the infection by the bacterial pathogen, Pseudomonas syringae, when they were applied directly before challenging, although the same homogenates exhibited no direct in vitro inhibitory effect in the bacterium. We conclude that ROS signaling is associated to the induction of EFN secretion and that the specific blend of DAMPs that are released from damaged cells allows the plant to distinguish the 'damaged self' from the damaged 'non-self'. The very early responses of plants to DAMPs can trigger resistance to both, herbivores and pathogens, which should be adaptive because injury facilitates infection, independently of its causal reason.

  6. Response- Surface Analysis for Evaluation of Competition in Different Densities of Sesame (Sesamum indicum and Bean (Phaseolus vulgaris Intercropping

    Directory of Open Access Journals (Sweden)

    A. Koocheki

    2014-12-01

    Full Text Available Response surface models predict crop yield based on crop density and this is an important tool for evaluation competition at different density and hence selection of optimum density based on yield. In order to study intra and inter specific competition in intercropping bean (Phaseolus vulgaris and sesame (Sesamum indicum, an experiment was conducted at the Agricultural Research Station, Ferdowsi University of Mashhad during the growing season of 2010. For this purpose a complete randomized block design with 3 replications and 16 treatments based on different densities of sesame and bean intercropping was used. The model predicted the maximum yield of an isolated plant of bean and sesame approximately 33 and 17g per plant respectively. The area associated with the maximum yield per plant in bean and sesame were 0.6 and 0.1 m2, respectively. Bean was the dominant competitor with respect to both grain and biomass, and competition coefficient was 0.35 and 0.3 for bean grain yield and bean biomass respectively. Intra-specific competition was more important than inter-specific competition for bean. Competition coefficient was 2.6 and 2.9 for sesame grain yield and biomass respectively. Intra-specific competition was much less important than Interspecific competition in sesame. The highest grain yield in bean (300 g m-2 was obtained of sole crop with density of 20 plants, and the highest sesame grain yield (195 g m-2 was obtained of sole crop with density of 40 plants, the highest land equivalent ratio (1.14 was obtained in intercropping of 20 plants of bean and 10 plants of sesame.

  7. Conformational study of red kidney bean (Phaseolus vulgaris L.) protein isolate (KPI) by tryptophan fluorescence and differential scanning calorimetry.

    Science.gov (United States)

    Yin, Shou-Wei; Tang, Chuan-He; Yang, Xiao-Quan; Wen, Qi-Biao

    2011-01-12

    Fluorescence and differential scanning calorimetry (DSC) were used to study changes in the conformation of red kidney bean (Phaseolus vulgaris L.) protein isolate (KPI) under various environmental conditions. The possible relationship between fluorescence data and DSC characteristics was also discussed. Tryptophan fluorescence and fluorescence quenching analyses indicated that the tryptophan residues in KPI, exhibiting multiple fluorophores with different accessibilities to acrylamide, are largely buried in the hydrophobic core of the protein matrix, with positively charged side chains close to at least some of the tryptophan residues. GdnHCl was more effective than urea and SDS in denaturing KPI. SDS and urea caused variable red shifts, 2-5 nm, in the emission λ(max), suggesting the conformational compactness of KPI. The result was further supported by DSC characteristics that a discernible endothermic peak was still detected up to 8 M urea or 30 mM SDS, also evidenced by the absence of any shift in emission maximum (λ(max)) at different pH conditions. Marked decreases in T(d) and enthalpy (ΔH) were observed at extreme alkaline and/or acidic pH, whereas the presence of NaCl resulted in higher T(d) and ΔH, along with greater cooperativity of the transition. Decreases in T(d) and ΔH were observed in the presence of protein perturbants, for example, SDS and urea, indicating partial denaturation and decrease in thermal stability. Dithiothreitol and N-ethylmaleimide have a slight effect on the thermal properties of KPI. Interestingly, a close linear relationship between the T(d) (or ΔH) and the λ(max) was observed for KPI in the presence of 0-6 M urea.

  8. Estrategia para el manejo de suelos ácidos en frijol (phaseolus vulgaris l. en el estado de Chiapas, Mexico

    Directory of Open Access Journals (Sweden)

    Bernardo Villar S\\u00E1nchez

    2000-01-01

    Full Text Available Estrategia para el manejo de suelos ácidos en frijol (Phaseolus vulgaris L. en el estado de Chiapas, México. Por su contribución en la dieta alimenticia y la generación de empleos, y por existir una ancestral cultura productiva y una superficie de siembra de más de 100 mil hectáreas, el cultivo de frijol es de fundamental importancia en el estado de Chiapas. Sin embargo, se ha determinado una brecha tecnológica de más de 700 kg/ha entre el potencial del cultivo y los rendimientos actuales. Esta es ocasionada por numerosos factores limitantes entre los que destaca la presencia de suelos de baja fertilidad y ácidos. La estrategia adoptada para el manejo de este problema incluye: 1.Aplicación de cal y fósforo; 2. Mejoramiento genético para resistencia; 3.Manejo de los ciclos de materia orgánica y nutrientes del suelo; y 4.Combinación de las tres alternativas. En este reporte se dan los avances obtenidos con relación a la primera alternativa considerada como el paso inicial para el logro de un manejo integral de suelos en Chiapas. Durante 1997 se estudiaron cinco dosis de cal y tres de fósforo en condiciones de invernadero y campo para suelos de diferentes localidades. Se utilizó un experimento factorial completo con cuatro repeticiones, los experimentos fueron evaluados en términos de la producción de grano y al efecto de la cal sobre las propiedades químicas del suelo. Hubo respuesta del frijol en rendimiento a la aplicación de cal y fósforo

  9. Daya Simpan Susu Kacang Hijau (Phaseolus radiatus L. dengan Persentase Penambahan Sari Jahe Merah (Zingiber officinale var. Rubrum

    Directory of Open Access Journals (Sweden)

    Meilla Dwi Andrestian

    2015-06-01

    Mung bean milk is one of the diversification of processed mung beans. The process of making mung bean milk using Ultra High Temperature (UHT is abundantly sold in the market. As another alternative to have a high shelf life, it needs the addition of natural preservatives such as red ginger. In general, this research aim was to determine the effect of addition of the percentage of red ginger extract (Zingiber officinale var. Rubrum on storability of green beans milk (Phaseolus radiatus L.. This research consisted of two phases, preliminary research and main research. The former stage was conducted to determine the best acceptability of nine treatment variations of red ginger extract addition. After preliminary research was made and it obtained the best results preferred by panelist, it was then followed by main research to determine the storability of green beans milk. From preliminary research, theres were three treatment preferred by panelists, namely P3 (0.75%, P5 (1.25% and P6 (1.5%. After that, those  treatments were tested for their storability in main research. From main research it showed that Q0 (control treatment can last for 0 day, Q1 treatment with the addition of red ginger extract 0,75% and Q2 (1.25% having storability for 1 day and Q3 (1.5% having the best treatment that had the longest storability (for 2 days. The more addition of red ginger extract, the longer storability of green beans milk. The best favored and longest storability of green beans milk was one added with red ginger extract of 1.5%. Keywords: Green Bean Milk, Storability, Red ginger

  10. Relationship between seed coat colors and patterns with phenolic content and antioxidant activity in a collection of 120 heirloom accessions of beans (Phaseolus vulgaris) from the National Plant Germplasm System.

    Science.gov (United States)

    Beans (Phaseolus vulgaris L.) are one of the most economically and nutritionally important crops world-wide. They are the most important legume for direct human consumption with more than 23 million metric tons produced in 2013; more than twice that of the next most important legume, chickpea (Cicer...

  11. Projection from the prefrontal cortex to histaminergic cell groups in the posterior hypothalamic region of the rat. Anterograde tracing with Phaseolus vulgaris leucoagglutinin combined with immunocytochemistry of histidine decarboxylase

    NARCIS (Netherlands)

    Wouterlood, F.G.; Steinbusch, H.W.M.; Luiten, P.G.M.; Bol, J.G.J.M.

    1987-01-01

    We investigated the projection from the infralimbic division of the prefrontal cortex (area 25) to histaminergic neurons in the posterior hypothalamic area. Phaseolus vulgaris-leucoagglutinin (PHA-L) was injected in the prefrontal cortex of rats. Frozen brain sections were subjected to combined

  12. Fabenol® Max, a standardised aqueous extract from Phaseolus vulgaris L., and ‘reduces the absorption of carbohydrates’: evaluation of a health claim pursuant toArticle 13(5) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Sjödin, Anders Mikael

    2016-01-01

    on the scientific substantiation of a health claim related to Fabenol® Max and ‘reduces the absorption of carbohydrates’. The Panel considers that Fabenol® Max, which is an aqueous extract from Phaseolus vulgaris L. standardised by its content of α-amylase inhibitor, is sufficiently characterised. According...

  13. Rhizobia from Lanzarote, the Canary Islands, that nodulate Phaseolus vulgaris have characteristics in common with LMW RNA group II Sinorhizobium meliloti of Medicago, Melilotus and Trigonella from soils of mainland Spain

    Science.gov (United States)

    Several isolates from nodules of Phaseolus vulgaris grown in soil of Lanzarote, an island of the Canaries, had electrophoretic LMW RNA patterns identical with a less common pattern within S. meliloti (assigned as group II) obtained from nodules of alfalfa and alfalfa-related legumes grown in northe...

  14. Abamectin, pymetrozine and azadirachtin sequence as a unique solution to control the leafminer Liriomyza trifolii (Burgess) (Diptera: Agromyzidae) infesting garden beans (Phaseolus vulgaris L.) in Egypt.

    Science.gov (United States)

    Saad, A S A; Massoud, M A; Abdel-Megeed, A A M; Hamid, N A; Mourad, A K K; Barakat, A S T

    2007-01-01

    Field trails were conducted to determine the performance of three different sequences as a unique solution for the control of the leaf miner Liriomyza trifolii (Burgess) (Diptera: Agromyzidae) infesting garden beans (Phaseolus vulgaris L.) during the two successive seasons of 2004 and 2005. Furthermore, during the evaluation period, the side effect against the ectoparasite Diglyphus isaea (Walker) (Hymenoptera: Eulophidae) was put into consideration. Meanwhile, the comparative evaluation of the pesticides alone showed that abamectin and azadirachtin were highly effective against Liriomyza trifolii, while carbosulfan, pymetrozine and thiamethoxam provided to be of a moderate effect. Moreover, carbosulfan showed harmful effect to the larvae of the ectoparasite Diglyphus isaea (Walker), while abamectin and azadirachtin gave a moderate effect. Thiamethoxam and the the detergent (Masrol 410) had slight effect in this respect. The highly effective sequence among the sequences was abamectin, pymetrozine and azadirachtin, against Liriomyza trifolii (Burgess), with slight harmful effect on Diglyphus isaea (Walker). However the sequence of azadirachtin, pymetrozine and abamectin had a moderate effect on Liriomyza trifolii (Burgess) and exhibited a slight toxic effect on Diglyphus isaea (Walker). In contrast, the sequence of carbosulfan, thiamethoxam and pymetrozine was the least effective and represented a slight effect on Diglyphus isaea (Walker). From this study, it was concluded that abamectin, pymetrozine and azadirachtin sequence has proved to be a unique solution for the control of the leaf miner Liriomyza trifolii (Burgess) infesting garden beans (Phaseolus vulgaris L.) in Egypt.

  15. Genetic diversity and population structure of an Italian landrace of runner bean (Phaseolus coccineus L.): inferences for its safeguard and on-farm conservation.

    Science.gov (United States)

    Mercati, F; Catarcione, G; Paolacci, A R; Abenavoli, M R; Sunseri, F; Ciaffi, M

    2015-08-01

    The landraces are considered important sources of valuable germplasm for breeding activities to face climatic changes as well as to satisfy the requirement of new varieties for marginal areas. Runner bean (Phaseolus coccineus L.) is one of the most cultivated Phaseolus species worldwide, but few studies have been addressed to assess the genetic diversity and structure within and among landrace populations. In the present study, 20 different populations of a runner bean landrace from Central Italy named "Fagiolone," together with 41 accessions from Italy and Mesoamerica, were evaluated by using 14 nuclear SSRs to establish its genetic structure and distinctiveness. Results indicated that "Fagiolone" landrace can be considered as a dynamic evolving open-pollinated population that shows a significant level of genetic variation, mostly detected within populations, and the presence of two main genetic groups, of which one distinguished from other Italian runner bean landraces. Results highlighted also a relevant importance of farmers' management practices able to influence the genetic structure of this landrace, in particular the seed exchanges and selection, and the past introduction in cultivation of landraces/cultivars similar to seed morphology, but genetically rather far from "Fagiolone." The most suitable on-farm strategies for seed collection, conservation and multiplication will be defined based on our results, as a model for threatened populations of other allogamous crop species. STRUCTURE and phylogenetic analyses indicated that Mesoamerican accessions and Italian landraces belong to two distinct gene pools confirming the hypothesis that Europe could be considered a secondary diversification center for P. coccineus.

  16. Gram stains: a resource for retrospective analysis of bacterial pathogens in clinical studies.

    Science.gov (United States)

    Srinivasan, Usha; Ponnaluri, Sreelatha; Villareal, Lisa; Gillespie, Brenda; Wen, Ai; Miles, Arianna; Bucholz, Brigette; Marrs, Carl F; Iyer, Ram K; Misra, Dawn; Foxman, Betsy

    2012-01-01

    We demonstrate the feasibility of using qPCR on DNA extracted from vaginal Gram stain slides to estimate the presence and relative abundance of specific bacterial pathogens. We first tested Gram stained slides spiked with a mix of 10(8) cfu/ml of Escherichia coli and 10(5) cfu/ml of Lactobacillus acidophilus. Primers were designed for amplification of total and species-specific bacterial DNA based on 16S ribosomal gene regions. Sample DNA was pre-amplified with nearly full length 16S rDNA ribosomal gene fragment, followed by quantitative PCR with genera and species-specific 16S rDNA primers. Pre-amplification PCR increased the bacterial amounts; relative proportions of Escherichia coli and Lactobacillus recovered from spiked slides remained unchanged. We applied this method to forty two archived Gram stained slides available from a clinical trial of cerclage in pregnant women at high risk of preterm birth. We found a high correlation between Nugent scores based on bacterial morphology of Lactobacillus, Gardenerella and Mobiluncus and amounts of quantitative PCR estimated genus specific DNA (rrn copies) from Gram stained slides. Testing of a convenience sample of eight paired vaginal swabs and Gram stains freshly collected from healthy women found similar qPCR generated estimates of Lactobacillus proportions from Gram stained slides and vaginal swabs. Archived Gram stained slides collected from large scale epidemiologic and clinical studies represent a valuable, untapped resource for research on the composition of bacterial communities that colonize human mucosal surfaces.

  17. Gram and acridine orange staining for diagnosis of septic arthritis in different patient populations.

    Science.gov (United States)

    Cunningham, Gregory; Seghrouchni, Khalid; Ruffieux, Etienne; Vaudaux, Pierre; Gayet-Ageron, Angèle; Cherkaoui, Abdessalam; Godinho, Eduardo; Lew, Daniel; Hoffmeyer, Pierre; Uçkay, Ilker

    2014-06-01

    The sensitivity of Gram staining is known to be suboptimal for the diagnosis of native joint septic arthritis. We lack information about the accuracy of Gram compared to other microscopic staining techniques for predicting infection in different patient populations. This was a cohort study with cost evaluations at the Orthopaedic Service of Geneva University Hospitals (January 1996-October 2012). Among 500 episodes of arthritis (196 with immunosuppression, 227 with underlying arthroplasties and 69 with gout or other crystals in synovial fluid), Gram staining revealed pathogens in 146 episodes (146/500, 29 %) or in 146 of the 400 culture-positive episodes (37 %). Correlation between the Gram and acridine staining of the same sample was good (Spearman 0.85). Overall, the sensitivity, specificity, positive predictive value and negative predictive value of Gram stain for rapid diagnosis of septic arthritis was 0.37, 0.99, 0.99 and 0.28, respectively, compared to microbiological cultures. Quite similar values were recorded across the different patient subpopulations, in particular for sensitivity values that were 0.33 for patients with prosthetic joint infections, 0.40 for immunosuppressed patients, 0.36 for patients under antibiotic administration and 0.52 for patients with concomitant crystalline disease. The sensitivity of Gram or acridine orange staining for a rapid diagnosis of episodes of septic arthritis is suboptimal compared to microbiological culture, regardless of underlying conditions, immunosuppression or antibiotic therapy. The sensitivity in the presence of synovial fluid crystals is moderate. Acridine orange and Gram stains are equivalent.

  18. Phosphorus Response and Amino Acid Composition of Different Green Gram (Vigna radiata L. Genotypes from Myanmar

    Directory of Open Access Journals (Sweden)

    M. Kywe

    2007-10-01

    Full Text Available Mungbean or green gram (Vigna radiata L. is an important component of rice-based cropping systems in Myanmar, where grain yields of around 800 kg ha^(-1 are much below its yield potential of 3000 kg ha^(-1. The reasons for this shortfall are as under-investigated as is the genotype-specific response of this crop to phosphorus (P application, which is critically low in many Myanmar soils, and the genetic variation in grain quality. For green gram quality, the concentration of lysine, an essential amino acid is particularly important given its scarcity in many cereal-based diets of Southeast Asia. The purpose of this study therefore was to investigate the effects of P application on the root and shoot growth, yield and its components for a range of green gram varieties, and to analyse the protein concentration and amino acid composition in green gram seed of different origins. To this end from 2001 to 2003, field experiments were conducted under rain-fed conditions in Yezin and Nyaung Oo. Fifteen landraces and five introduced green gram cultivars were grown at two levels of P (0 and 15 kg ha^(-1. There were large genotypic differences in P effects and a significant interaction between green gram genotypes and P for shoot and root growth. An unexpected benefit of P application was a reduction of pest and plant virus infestation in the field. Significant genotypic differences in the amino acid profile of seeds were also observed. The results indicate the potential for breeding efforts to increase seed yield and protein quality in green gram.

  19. Multi-location gram-positive and gram-negative bacterial protein subcellular localization using gene ontology and multi-label classifier ensemble.

    Science.gov (United States)

    Wang, Xiao; Zhang, Jun; Li, Guo-Zheng

    2015-01-01

    It has become a very important and full of challenge task to predict bacterial protein subcellular locations using computational methods. Although there exist a lot of prediction methods for bacterial proteins, the majority of these methods can only deal with single-location proteins. But unfortunately many multi-location proteins are located in the bacterial cells. Moreover, multi-location proteins have special biological functions capable of helping the development of new drugs. So it is necessary to develop new computational methods for accurately predicting subcellular locations of multi-location bacterial proteins. In this article, two efficient multi-label predictors, Gpos-ECC-mPLoc and Gneg-ECC-mPLoc, are developed to predict the subcellular locations of multi-label gram-positive and gram-negative bacterial proteins respectively. The two multi-label predictors construct the GO vectors by using the GO terms of homologous proteins of query proteins and then adopt a powerful multi-label ensemble classifier to make the final multi-label prediction. The two multi-label predictors have the following advantages: (1) they improve the prediction performance of multi-label proteins by taking the correlations among different labels into account; (2) they ensemble multiple CC classifiers and further generate better prediction results by ensemble learning; and (3) they construct the GO vectors by using the frequency of occurrences of GO terms in the typical homologous set instead of using 0/1 values. Experimental results show that Gpos-ECC-mPLoc and Gneg-ECC-mPLoc can efficiently predict the subcellular locations of multi-label gram-positive and gram-negative bacterial proteins respectively. Gpos-ECC-mPLoc and Gneg-ECC-mPLoc can efficiently improve prediction accuracy of subcellular localization of multi-location gram-positive and gram-negative bacterial proteins respectively. The online web servers for Gpos-ECC-mPLoc and Gneg-ECC-mPLoc predictors are freely accessible

  20. Determination of the irradiation dose for the inhibition (D-10 radiation doses) of some gram negative and gram positive bacteria in peptone saline water

    International Nuclear Information System (INIS)

    Ayhan, H.; Tutluer, H.

    1994-01-01

    Determination of the irradiation dose for the inhibition of some pathogenic bacteria which cause food poisoning and spoilage were aimed. For this purpose, Salmonella typhi, Salmonella typhimurium,Salmonella enteridits,Klebsiella pneumonia, Pseudomonas fluorescence,Proteus vulgaris, Aeromonas hydrophila ,(gram-negative bacteria) and Bacillus cereus, Staphylococcus aureus strain 24,Staphylococcus aureus ATCC 6538 P,Staphylococcus epidermidis strain 115 and Clostridium perfringens A4TTK,(gram-positive bacteria) were used.Sensitivity of above mentioned bacteria to gamma rays (source Cs-137) was examined in saline with 0.1% peptone at different temperatures.Survivor plots (log.10 number of survivors versus dose) were determined by regression analysis of the data.Decimal reduction doses (D values in kGy) were calculated as the slope obtained from the regression analysis